Metabolite for treating neurological diseases

Abstract

The supplementation of an endogenously produced metabolite fructose-2,6-bisphosphate (F2,6BP), or a derivative thereof, was unexpectedly discovered to have a profound effect on neurological disorders associated with double strand break, including but not limited to neurodegenerative diseases such as polyglutamine diseases. F2,6BP metabolite compositions and methods of use surprisingly restored polynucleotide kinase 3'-phosphatase (PNKP) activity to provide enhanced genome integrity, reduction of pathological aggregate species, reduction of neurotoxicity, and rescue of complex physiological behavior.

Description

[0001] METABOLITE FOR TREATING NEUROLOGICAL DISEASES

[0002] CROSS REFERENCE TO REEATED APPLICATIONS

[0003] This application claims the benefit of U. S. Provisional Patent Application 63 / 711,365, filed October 24, 2024, the disclosure of which is hereby incorporated by reference in its entirety.

[0004] STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH

[0005] This invention was made with Government support under Grant Nos. NS073976, All 63327, and AG078635 awarded by the National Institutes of Health. The Government has certain rights in the invention.

[0006] FIELD OF THE INVENTION

[0007] This disclosure relates to a fructose-2,6-bisphosphate (F2,6BP) metabolite, or a derivative thereof, for the treatment of neurological disease, including but not limited to polyglutamine diseases.

[0008] REFERENCE TO SEQUENCE LISTING

[0009] The contents of the xml file named “11893-003W01-ST26-SEP-10-2025” which was created on September 10, 2025, and is 82.0 KB in size, are hereby incorporated by reference in their entirety.

[0010] BACKGROUND OF THE INVENTION

[0011] Neurodegenerative disorders, including dominant, heritable polyglutamine (polyQ) diseases, are manifested by progressive deterioration of cognitive function and, in some cases, motor functions. Huntington’s disease (HD) and Spinocerebellar ataxia type 3 (SCA3) are most common polyQ diseases worldwide. HD is caused by a polyQ expansion (>36) in the N-terminal region of HTT protein. Likewise, SCA3 is attributed to similar unstable glutamine repeat expansion from 12-41 in healthy individuals to 62-84 in patients in the C -terminal region of ATXN3 protein. Despite a well -characterized genetic basis, exact pathophysiologic mechanisms of neurodegenerative disorders including but not limited to HD and SCA3 have remained elusive. Recent genome-wide association studies and genetic data from various sources suggest that deficient DNA repair is central to the pathogenesis of HD and other polyQ diseases. Currently, there is no effective medicine capable of halting or reversing the progression of polyQ disorders or other neurological disorders associated with DNA damage.

[0012] Novel therapies for treating neurological diseases are urgently needed.

[0013] SUMMARY OF THE INVENTION

[0014] Surprisingly, the inventors determined that supplementation of Fructose-2,6-bisphosphate (F2,6BP) restores 3 '-phosphatase activity of the DNA repair protein polynucleotide kinase 3’-phosphatase (PNKP), and is effective in the treatment of neurological disorders, for example polyglutamine (polyQ) diseases such as Huntington’s disease (HD) and Spinocerebellar ataxia type 3 (SCA3) (see, e.g., Example 1). It was also determined herein that PFKFB3, a nuclear member of the 6-Phosphofructo-2-Kinase / Fructose-2,6-Biphosphatase (PFKFB) family, maintains the homeostatic level of F2,6BP, essential for PNKP activity. For example, it was discovered herein that PNKP binds and utilizes F2,6BP (Kj = 525 ± 25 nM) as a cofactor (see, e.g., FIG. 13C of Example 2). Unexpectedly, it was discovered herein that PFKFB3 protein level is significantly reduced in the brains of subjects with HD, SCA3, and amyotrophic lateral sclerosis (ALS)Z frontotemporal dementia (FTD) (see Examples 1-3 herein). As disclosed herein, administering F2,6BP to HD model mouse-derived striatal neurons restored PNKP activity and maintained genome integrity. Unexpectedly, supplementing F2,6BP in a Drosophila Huntington’s disease (HD) model rescued a complex, impaired motor function phenotype, which exemplifies the therapeutic use of metabolite F2,6BP, or an analog thereof, against neurological disorders including but not limited to polyQ diseases. This improvement provides a significant advance in the state of the art of treating neurological disease.

[0015] The result is remarkable in that the use of F2,6BP compositions and methods of use thereof as described herein provides one or more of: (i) potentiation and restoration of PNKP activity; (ii) increased cell viability and / or prevention of neurotoxicity; (iii) restoration and / or improvement of genome integrity (e.g., nuclear' and / or mitochondrial genomes); (rv) prevention of aggregate formation (e.g., mHTT in polyQ disease HD); (v) reduction of toxic aggregation and mislocalization of post-translationally modified and aggregate prone-proteins (e.g., TDP-43); and / or (vi) reversal and / or rescue of complex physiological phenotypes (e.g., motor impairment in neurodegenerative disease).

[0016] In contrast, it has been discovered that the profound benefits of the F2,6BP compositions and methods of use thereof as described herein are not achieved when similar compounds are used, for example F6P or F1,6BP, wherein supplementation of each compound did not restore PNKP activity.

[0017] Surprisingly, it was also discovered herein that F2,6BP, as well as PFKFB3, localize to mitochondria and levels of each are significantly decreased in subjects with Huntingtoil’s disease (HD) mitochondrial extract, leading to abrogated mitochondrial PNKP activity (see, e.g., FIG. 10A of Example 2 herein). Unexpectedly, mitochondrial PNKP activity was specifically restored by supplementation of exogenous F2,6BP (see, e.g., FIGs. 13D-13E of Example E). Moreover, supplementation of F2,6BP in striatal neuronal ceils derived from an HD mouse model and a Drosophila HD model system restored mitochondrial genome integrity in each (see, e.g., FIGs. 14B and 16 of Example 2, respectively). Altogether, the methods disclosed herein exemplify the therapeutic potential of F2,6BP, analogs thereof, in treating HD and related pathologies.

[0018] Furthermore, it was surprisingly discovered herein that exogenous supplementation of F2,6BP in extracts isolated from brain tissue of subjects with ALS / FTD restored PNKP activity (see, e.g., FIG. 21D-21E of Example 3) and reversed PNKP-mediated genome instability (see, e.g., FIG. 24B of Example 3). Unexpectedly, F2,6BP supplementation reduced pathogenic phosphorylation and ubiquitination post-translational modification of TDP-43 (see, e.g., FIG.

[0019] 22D of Example 3). Remarkably, supplementation of F2,6BP even resulted in a significant reduction of TDP-43 aggregates in ALS patient-derived NPSCs (see, e.g., FIG. 22D of Example 3). Moreover, F2,6BP supplementation further rescued complex motor phenotypes, for example in a Drosophila ALS model harboring TDP-43Q331K (see, e.g., FIG. 24A of Example 3), a well-established model that recapitulates key features of the human disease. These findings confirmed the potential of F2,6BP to specifically reverse a neurodegenerative phenotype in a living organism, for example including but not limited to ALS.

[0020] It was also unexpectedly discovered herein that F2,6BP levels are significantly reduced in Alzheimer’s disease (AD) brain, as well as in similar primary tauopathy diseases Corticobasal degeneration (CBD) and Progressive supranuclear palsy (PSP) (see, e.g., FIG.

[0021] 26A of Example 4), wherein subcellular F2.6BP levels were decreased in nuclei and mitochondrial fractions (see, e.g., FIG. 27A of Example 4). In accordance with this finding, it was also discovered that AD brain extract harbored decreased 3’-DNA phosphatase activity despite similar PNKP enzyme levels (see, e.g., FIGs. 26E-26F & 27C of Example 4), leading to high reactive oxygen species (ROS) and resultant DNA damage in these extracts (see, e.g., FIGs. 26H-26K of Example 4). Surprisingly, exogenous supplementation of F2,6P completely and specifically restored PNKP activity in AD patient samples in a dose-dependent manner (see, e.g., FIGs. 28A-28B, 29A-29B of Example 4), whereas structurally related metabolites did not. Further, F2,6BP supplementation was found to promote repair of nuclear DNA damage (see, e.g., FIGs. 34A, 34D of Example 4). It was also unexpectedly discovered that F2,6BP treatment was capable of reducing and preventing tau aggregate formation (see, e.g., FIGs.

[0022] 34C, 34F, and 36D-F of Example 4). For example, treated AD hippocampal slices demonstrated a -90% reduction in MC 1 -positive tau aggregates (see, e.g., FIG. 38B of Example 4).

[0023] Specific benefits of the F2,6BP compositions and methods of use thereof as described herein include one or more of:

[0024] (i) potentiation and restoration of ’-phosphatase activity of PNKP (e.g., FIG. 2B of Example 1) in a dose-dependent manner (e.g., FIG. 3C of Example I; FIG. 21C-21E, 22M, 220, 23D of Example 3; FIGs. 28A-28B, 29A-29B of Example 4);

[0025] (ii) increased cell viability in cells having reduced levels of PFKFB3 and decreased ’-phosphatase activity of PNKP (see, e.g., FIGs. 4E-4G of Example 1);

[0026] (iii) reversal and / or rescue of complex physiological phenotypes, including but not limited to rescued impaired motor function in a Htt mutant Drosophila model of Huntington’s disease (see, e.g., FIG. 5A of Example 1) and model of ALS / TDP43 pathology-associated motor neuron diseases (see, e.g., FIG. 24A of Example 3 ) in vivo,'

[0027] (iv) prevention of aggregate formation in models of HD and AD (see, e.g., FIGs.

[0028] 15B-15C of Example 2; FIGs. 36D of Example 4);

[0029] (v) restoration of nuclear and mitochondrial DNA genome integrity (see, e.g., FIG.

[0030] 16 of Example 2; FIG. 24B of Example 3; FIGs. 34A, 34D of Example 4); and / or

[0031] (vi) reduction of toxic aggregation and mislocalization of post-translationally modified TAR DNA-binding protein 43 (TDP-43) and of tau protein (see, e.g., FIG. 22D of Example 3; FIGs. 34C, 34F, 38B, and 38C-38E of Example 4).

[0032] A summary of embodiments of the invention is described in further detail below. BRIEF DESCRIPTION OF THE FIGURES

[0033] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate certain examples of the present disclosure and together with the description, serve to explain, without limitation, the principles of the disclosure. Like numbers represent the same elements throughout the figures.

[0034] FIGs. 1A-1E show partial characterization of TC-NHEJ complexes involving PNKP, PFKFB3, and UTT.

[0035] FIG. 1A shows benzonase-treated nuclear extracts (NEs) from wild-type (WT) mouse (6 mo old) brain were immunoprecipitated with anti-PFKFB3 (lane 4) and anti-Lig IV (lane 5) antibodies (Abs); or control IgG (Rabbit; lane 2 and mouse; lane 3) and tested for the presence of associated proteins (shown in the Right) using specific Abs (n - 3).

[0036] FIG. IB shows similar extract was immunoprecipitated with anti-HTT (lane 3) Ab or control mouse IgG (lane 2) and tested for the presence of associated proteins (shown in the Right) using specific Abs (n = 3).

[0037] FIG. 1C shows full-length WT PNKP and individual PNKP domains (FHA, phosphatase, and kinase) were expressed as GST-tagged proteins and allowed to bind to glutathione sepharose beads.

[0038] FIG. ID shows similar interaction with full-length WT PNKP and fused (phosphatase + kinase) catalytic domain. Equimolar (20 pmol) amount of His-tagged PFKFB3 was subsequently bound to the full-length PNKP / domains and after stringent wash, interaction was assessed by Western blot analysis with anti-PFKFB3 Ab (Upper panel). Lower panel Immunoblot shows bead-bound GST / GST-PNKP or domains probed with anti-GST Ab. Lane 6 or lane 4: Purified PFKFB3 as control. For C, Upper and Lower panels were generated from two separate gels run in parallel.

[0039] FIG. IE shows full-length WT PNKP and individual PNKP domains (FHA, phosphatase, kinase, and phosphatase-kinase) were expressed as GST-tagged proteins and allowed to bind to His-tagged PFKFB3 (20 pmol) bound to cobalt-resins. After stringent wash, interaction was assessed by Western blot analysis with anti-GST Ab (Upper panel). Lower panel: Immunoblot shows bead-bound PFKFB3 with anti-PFKFB3 Ab. Lane 7: Purified PFKFB3 as control.

[0040] FIGs. 2A-2C show effect of fructose-2,6-bisphosphate on 3 '-phosphatase activity of PNKP.

[0041] FIG. 2A shows PFKFB3 levels. Upper panel Western blot showing PFKFB3 level in the nuclear extracts of control vs. PFKFB3 siRNA transfected HEK293 cells. Lower panel: Quantitation of the relative PFKFB3 levels after normalization with nuclear loading control HDAC2.

[0042] FIG. 2B shows Upper panel: A 32P-labeIed 3'-phosphate-containing oligo substrate (5 pmol) was incubated with the nuclear extract (250 ng) of control (lane 2) and PFKFB3-depleted HEK293 cells (lanes 3 to 10). Lane 4: purified PFKFB3 (200 finol); lanes 5 and 6: increasing amounts of F6P (5 and 10 mM) were added along with purified PFKFB3 (200 finol) and ATP (1 mM); lanes 7 and 8: increasing amounts of F2.6BP (25 and 50 pM) were added; Lane 9: F6P (50 pM) and lane 10: F1,6BP (50 pM). Lane 1: No protein. Lower panel: Quantitation of the % released phosphate in the indicated lanes. S: Substrate and P: Released phosphate.

[0043] FIG. 2C shows Upper panel: 3 '-phosphatase activity of purified PNKP alone (25 fniol, lane 3), PNKP plus increasing amounts of F2.6BP (5, 10, 15, and 20 pM, lanes 4 to 7), PNKP plus PFKFB3 (200 finol, lane 8), PNKP plus F6P (25 pM, lane 9). Lane 1: substrate only; lane 2: PFKFB3 (200 fniol) plus F6P (25 pM). Lower panel: Quantitation of the fold change of the % released phosphate with the activity of purified PNKP considered arbitrarily as unity. S: Substrate and P: Released phosphate. In all the above cases, error bars show ±SD of the mean; n = 3, *P < 0.05; **P < 0.01; ***P < 0.005 (compared to lane 3 in B and C).

[0044] FIGs. 3A-3F show F2,6BP mediated restoration of the 3 '-phosphatase activity of PNKP in the nuclear extracts of postmortem HD and SC A3 patients’ brains.

[0045] FIG. 3 A shows Bar diagram showing the relative levels of F2,6BPin the nuclear extract of control vs. HD patients’ frontal cortex (n = 4).

[0046] FIG. 3B shows PNKP and PFKFB3 levels. Upper panel Western blot showing the relative levels of PNKP and PFKFB3 in the nuclear extract of HD patients vs. age-matched control subjects’ frontal cortex. HDAC2: nuclear loading control. Lower panel'. Quantitation of the relative PFKFB 3 levels after normalization with loading control HDAC2.

[0047] FIG. 3C shows 3 '-phosphatase activity and percent (%) released phosphate of PNKP Upper panel: Representative gel images (four different age-groups representing both genders) showing the 3 '-phosphatase activity of PNKP in the postmortem brain (frontal cortex) nuclear extract of healthy normal control (lane 2) or supplemented with F2,6BP (lane 3, 50 pM), and age / gender-matched HD patient (lane 4) or supplemented with F2,6BP (lanes 5 to 7, 10, 25, and 50 pM) or F6P (lane 8, 50 pM) or F1,6BP (lane 9, 50 pM). Lane 1: substrate only. Lane 10: purified PNKP (1 to 2 ng). S: Substrate and P: Released phosphate. Lower panel: Quantitation of the % released phosphate in the indicated lanes. The difference between activity between lane 4 (HD patients without F2,6BP supplementation) and lanes 6 and 7 (with F2,6BP supplementation) is significant (n = 3, ***P < 0.005). FIG. 3D shows Bar diagram showing the relative levels of F2,6BPin the nuclear extract of control vs. SCA3 patients’ cerebellum (n = 4).

[0048] FIG. 3E shows levels of PFKFB3. Upper panel: Western blot showing the relative levels of PFKFB3 in the nuclear extract of SCA3 patients vs. age-matched control subjects’ cerebellum (n = 3). HDAC2: nuclear loading control. Lower panel: Quantitation of the relative PFKFB3 levels after normalization with loading control IIDAC2.

[0049] FIG. 3F shows '-phosphatase activity and percent (%) released phosphate of PNKP. Upper panel: Representative gel image (different age-groups, n = 4) showing the 3'-phosphatase activity of PNKP in the postmortem brain (cerebellum) nuclear extract of healthy normal control (lane 2) or supplemented with F2.6BP (lanes 3 to 4, 25 and 50 pM), and age-matched SCA3 patients (lane 5) or supplemented with F2,6BP (lanes 6 and 7, 25 and 50 pM) or F6P (lane 8, 50 pM) or F1,6BP (lane 9, 50 pM). Lane 1: substrate only. Lane 10: purified PNKP (2 ng). Lower panel: Quantitation of the % released phosphate in the indicated lanes. The difference between activity between lane 5 (SCA3 patients without F2,6BP supplementation) and lane 7 (with F2.6BP supplementation) is significant (n = 3, ***P < 0.005). In all the above cases, error bars show ±SD of the mean; n = 3 or 4, **P < 0.01; ***P < 0.005, as applicable.

[0050] FIGs. 4A-4H show F2,6BP mediated in cell rescue of the PNKP activity and TC-NHEJ repair in HD mice striatum-derived neuronal cells (Q-lll).

[0051] FIG. 4A shows '-phosphatase activity and percent (%) released phosphate of PNKP. Upper panel: Representative gel image of 3 '-phosphatase activity of PNKP in the nuclear extract of Q-7 (lanes 2 and 3) and Q-lll (lanes 4 to 9) mice striatum-derived neuronal cells with mock treatment (Mock 1; lanes 2 and 4), treatment with K16ApoE carrier peptide alone (25 pM; Mock 2; lanes 3 and 5) or supplemented with F2.6BP (200 pM; 48 and 72 h) (lanes 6 and 7), or F1,6BP (lanes 8 and 9, 200 pM) in presence of carrier peptide. Lane 1: substrate only. Lane 10: purified PNKP (2 ng). Lower panel: Quantitation of the % released phosphate in the indicated lanes. Error bars show ±SD of the mean; n::::3, **P < 0.01; ***P < 0.005 between groups as indicated or compared to lanes 2 and 3.

[0052] FIG. 4B shows levels of PFKFB3. Upper panel: The western blot shows the levels of PFKFB3 in the cytosolic (CE) and nuclear extracts (NE) of Q-7 and Q-lll cells. GAPDH: cytosolic loading control; HDAC2: used as nuclear loading control. Lower panel: Quantitation ofthe relative PFKFB3 levels after normalization with respective loading controls; n = 3, ***P < 0.005. FIG. 4C shows determination of DNA strand break accumulation. Upper panel Amplification of each long amplicon (6 to 8 kb) and a small amplicon (-200 to 300 bp) of the transcribed (Tubb, Enolase, Neurod) genes to assess DNA strand break accumulation. Lower panel: The bar diagram represents the normalized (with short amplicon) relative band intensity with the mock-treated Q-7 sample arbitrarily set as 100.

[0053] FIG. 4D shows determination of DNA strand break accumulation. Upper panel: Amplification of each long amplicon (6 to 8 kb) and a small amplicon (-200 to 300 bp) of the nontranscribed (Myh4, Myh6, and Myod) genes to assess DNA strand break accumulation. Lower panel: The bar diagram represents the normalized (with short amplicon) relative band intensity with the mock-treated Q-7 sample arbitrarily set as 100. For both C and D, Error bars show ±SD of the mean; n = 3, ***P < 0.005; ns P > 0.05 compared to lanes 1 and 2.

[0054] FIG. 4E shows crystal violet (CV)-stained Q-7 (Upper panel) and Q-l 11 (Lower panel) cells following mock treatment with carrier peptide (Left panels) and supplemented with F2,6BP (200 pM) in the presence of carrier peptide (Right panels) at 48 h post F2,6BP delivery.

[0055] FIG.4F shows similar Crystal violet staining of Q-7 and Q- 111 cells at 72 h post F2,6BP delivery.

[0056] FIG. 4G shows a bar diagram illustrating the quantification of cell viability represented as CV-stained cell number / sq. mm area selected from five representative microscopic images of different fields captured independently. Error bars show ±SD of the mean; n = 3, ***P < 0.005 between indicated groups.

[0057] FIG. 4H shows levels of various proteins and markers. Left panel: The western blots show the levels of various proteins (indicated on the Right) in the nuclear extracts of Q-7 and Q-111 cells under indicated treatment conditions. HDAC2: used as nuclear loading control. Right panel: Quantitation of the relative p53BPl and yII2AX levels after normalization with nuclear loading control HDAC2; n = 3, ***P < 0.005 between indicated groups.

[0058] FIGs. 5A-5B show F2,6BP-mediated rescue of neurodegenerative phenotype in a transgenic HD model of Drosophila.

[0059] FIG. 5A shows climbing score measurements. Upper panel: Schematic for climbing score measurement in Drosophila (10 flies) expressing human HIT' gene with expanded polyQ repeat (Httl28Q) in glial and neuronal cells treated with either mock buffer (20 mM Tris-Cl, pH = 8.0) or F2,6BP (200 pM) for 21 d and measured at 8 s. Lower panel: The bar graphs show the effect on climbing score between the mock and F2,6BP treatment or with wl 118 (gray bars) either in male flies or female flies in pan-neuronal (orange bars) or pan-glial (blue bars) expression of Httl28Q. Significance (**P < 0.01, ***P < 0.005) was assessed using one-way ANOVA uncorrecied Fisher’s LSD with a single pooled variance.

[0060] FIG. 5B shows CrebB and Neurexin gene amplicons. Upper panel: Representative agarose gel images of long ( -8 kb; LA) and short ( - 200 bp; SA) amplicon of the CrebB and Neurexin genes from genomic DNA of male (lanes 2 and 3) and female (lanes 4 and 5) flies with pan-neuronal expression of Httl28Q either mock-treated (lanes 2 and 4) or treated with F2,6BP (lanes 3 and 5). Lane 1: will 8 (males and females). Lower panel: The normalized relative band intensities were represented in the bar diagram with wl!18 arbitrarily set as 100 (n = 3, error bars represent ±SD of the mean). The damage for each gene in Drosophila with pan-neuronal expression of Httl28Q was significant (***P < 0.005) compared to the will 8 samples. Also, the strand breaks were significantly repaired in F2,6BP-treated samples (*P < 0.05; ns = nonsignificant P > 0.05, compared to wl 118).

[0061] FIGs. 6A-6C show effect of PFKFB3 depletion onTC-NHEJ repair.

[0062] FIG. 6A shows levels of various proteins and markers. Upper panel Western blot showing the levels of indicated proteins (on the left) in the nuclear extract of control siRNA (lanes 1-6) and PFKFB3 siRNA (lanes 7-12) transfected HEK293 cells either mock, Bleo-treated or 3 (R3), 6 (R6), 9 (R9) and 12 (R12) h recovery following Bleo treatment. HDAC2: used as nuclear loading control. Lower panel: Quantitation of the relative PFKFB3 and yH2AX levels after normalization with nuclear loading control HDAC2; n=3, 10 ***P<0.005 between lanes 3-6 (recovery in control cells) and lanes 9-12 (recovery in PFKFB3 depleted cells).

[0063] FIG. 6B shows HEK293 cells were transfected with either control siRNA (lanes 1-5) or PFKFB3 siRNA (lanes 6-10) and further mock- or Bleo- treated or kept for recovery for 3 (R3), 6 (R6) and 9 (R9) h after Bleo treatment. Upper panel: Amplification of each long amplicon (LA) (10-12 kb) and a small amplicon (SA) (-200-300 bp) of the transcribed (IIPRT, POLB and POLR2A) genes. Lower panel: The bar diagram represents the normalized (with short amplicon) relative band intensity with the mock-treated sample arbitrarily set as 100. Error bars show ±SD of the mean; n==3, ***P<0.005 or ns:::P>0.05, compared to respective mock-treated sample.

[0064] FIG. 6C shows similar experiment showing amplification of each long amplicon (I, A) (10-12 kb) and a small amplicon (SA) (-200-300 bp) of the non- transcribed (NanoG, Oct4, MyH2) genes (Upper panel). Lower panel: The bar diagram represents the normalized relative band intensity with the mock- treated sample arbitrarily set as 100. Error bars show +SD of the mean; n=3, ***P<0.005 orns=P>0.05, compared to respective mock -treated sample.

[0065] FIGs. 7A-7C show effect of fructose 2,6-bisphosphate on PNKP activity. FIG. 7 A shows a schematic representation of 3 ’-phosphatase activity assay of PNKP. FIG. 7B shows Lane 2: 3 ’-phosphatase activity of purified PNKP (2 ng). Lane 1: substrate only. Lane 3-5: similar 3 ’-phosphatase assay with increasing doses of F2,6BP (50 uM-500 pM- 5 mM). S: Substrate and P: Released phosphate.

[0066] FIG. 7C shows ’-kinase activity of PNKP with and without F2,6BP and quantitation of the percent (%) kinase product. Upper panel: 5 ’ -kinase activity of purified PNKP alone (200 fmole, lane 2) PNKP plus increasing amounts of F2,6BP (10, 15 and 20 uM, lanes 3-5). Lane 1: substrate only. Lower panel: Quantitation of the % kinase product. Error bars show ±SD of the mean; n=3, ***P<0.005.

[0067] FIG. 8 shows 3 ’-phosphatase activity and percent (%) released phosphate of PNKP. Upper panel: 3 ’-phosphatase activity of PNKP in the nuclear extract (250 ng) of frontal cortex from healthy normal control (male) (lanes 2-5) vs. age-matched HD patients (lanes 6-9). Lane 1: substrate only. Lane 10: Purified PNKP (2 ng). S: Substrate and P: Released phosphate. Lower panel: Quantitation of the % released phosphate in the indicated lanes; n 3. ***P<0.005 between Control vs. HD patient.

[0068] FIGs. 9A-9C show mediated rescue of the PNKP-mediated TC-NHEJ repair in HEK293 cells.

[0069] FIG. 9A shows levels of various proteins and markers. Upper panel: The Western blot shows the levels of various proteins (indicated on the left) in the nuclear extracts of control (lanes 1-6) or PFKFB3 siRNA (lanes 7-12) transfected HEK293 cells. Mock 1: Mock treatment; Mock 2: treatment with K16ApoE carrier peptide (25 μM); Bleo: Bleo treatment; R6, R: Recovery for 6 h after Bleo treatment; F2,6BP: Prior treatment with 200 uM F2.6BP + carrier peptide; F1,6BP: Prior treatment with 200 pMFl,6BP + Carrier peptide. HDAC2: used as nuclear loading control. Lower panel: Quantitation of the relative PFKFB3, p53BPl and yH2AX levels after normalization with nuclear loading control HDAC2; n=3, ***P<0.005 for p53BPl and yH2AX levels between lane 11 and lanes 9, 10, 12.

[0070] FIG. 9B shows ’-phosphatase activity and percent (%) released phosphate of PNKP. Upper panel: Representative gel image of 3 ’-phosphatase activity of PNKP in the nuclear extract of PFKFB3 siRNA transfected cells under similar conditions. Lane 1: substrate only. Lane 8: purified PNKP (2 ng). Lower panel: Quantitation of the % released phosphate in the indicated lanes. Error bars show iSD of the mean; n:::3, ***P<0.005 compared to mock treatment (Mock 1).

[0071] FIG. 9C shows determination of DNA strand break accumulation. Upper panel: Amplification of each long amplicon (10-12 kb) and a small amplicon (-200-300 bp) of the transcribed (HPRT, POLB and POLR2A) genes to assess DNA strand break accumulation. Lower panel: The bar diagram represents the normalized relative band intensity with the mock-treated sample arbitrarily set as 100. Error bars show ±SD of the mean; n=3, ***P<0.005 compared to samples in lanes 8, 9, 10 and 12.

[0072] FIGs. 10A-10C show PNKP activity, ROS levels, and DNA damage accumulation in the mitochondria of HD patients.

[0073] FIG. 10A shows 3 ’-phosphatase activity and quantitation of percent (%) released phosphate of PNKP. Upper panel: 3’ -phosphatase activity of PNKP in the mitochondrial extract (250 ng) of frontal cortex from healthy normal control (lanes 2-5) vs. age-matched HD patients (lanes 6-9) measured by the release of free phosphate from a radiolabeled 3’-phosphorylated substrate. Lane 1: substrate only. Lane 10: Purified PNKP (2 ng). S: Substrate and P: Released phosphate. Lower panel: Quantitation of the % released phosphate in the indicated lanes (n=3); error bars represent mean + SD. ***P<0.005 between Control vs. HD patient.

[0074] FIG. 10B shows a bar diagram representing mtROS level as relative fluorescence intensity with healthy control arbitrarily chosen as unity (n=14; ***P<0.005).

[0075] FIG. 10C shows amplicons of mitochondrial fragments from genomic DNA. Upper panel: Representative agarose gel image of long (LA) and short (SA) amplicon of the mitochondrial fragment from genomic DNA of postmortem frontal cortex of age-matched healthy normal (control) (lanes 1-4) and HD patients (lanes 5-8). Lower panel: The normalized relative band intensities are represented in the bar diagram with one control sample arbitrarily set as 100. The damage accumulation in HD patients significantly increased (***P < 0.005; **P< 0.01).

[0076] FIGs. 11A-11I show PFKFB3 and PNKP levels in mitochondria in vitro and ex vivo. FIG. HA shows a Western blot demonstrating the relative levels of PFKFB3 in the cytosolic (CE), nuclear (NE) and mitochondrial (ME) extract of HEK293 cells. GAPDH: cytosolic loading control; HDAC2: nuclear loading control. COX4: mitochondrial loading control.

[0077] FIG. 11 B shows a Western blot demonstrating the relative levels of PNKP and PFKFB in the mitochondrial extract of Q-7 and Q-lll cells. COX4: mitochondrial loading control. Lower panel: Quantitation of the relative PFKFB3 levels after normalization with loading control COX4 (n=3, ***P<0.005).

[0078] FIG. 11C shows a Western blot demonstrating the relative levels of PNKP and PFKFB3 in the mitochondrial extract of HD patients vs. age-matched control subjects’ frontal cortex. C0X4: mitochondrial loading control. Lower panel: Quantitation of the relative PFKFB3 levels after normalization with loading control C0X4 (n=3, ***P<0.005).

[0079] FIG. 11D shows benzonase-treated mitochondrial extracts from Q-7 cells were immunoprecipitated with anti-PFKFB3 antibody (PFKFB3 IP); or control IgG and tested for the presence of associated proteins (shown in the right) using specific Abs.

[0080] FIG. 11E-11G shows Q-7 (FIG. 1 IE) and Q-l 11 (FIG. HF) cells were first stained with MitoTracker dye, which marks mitochondria left panels), followed by fixation and staining for PFKFB3 using a secondary antibody conjugated to Alexa Fluor 568 (middle panels). The overlap of these signals is shown in merged images (right panels), confirming PFKFB3’s mitochondrial localization.

[0081] FIG. 11G represents Q-lll ceils after treatment with F2,6BP (50 pM), showing improved co-localization in the merged image suggesting that F2,6BP may help restore mitochondrial integrity and PFKFB3 levels in Q-lll cells. Nuclei are counterstained with DAPI.

[0082] FIG. 11H shows quantitation of the PFKFB3 level (***P<0.005; *P<0.05).

[0083] FIG. HI shows a bar diagram illustrating the relative levels of F2,6BP in the mitochondrial extract of control vs. HD patients’ frontal cortex (n=14, ***P<0.005).

[0084] FIGs. 12A-12D show flow cytometry scatter plot analysis which illustrates changes in mitochondrial membrane potential in Q-7 cells without TMRM (FIG. I2A), Q-7 cells with TMRM (FIG. 12B), Q-lll cells with TMRM (FIG. 12C), and F2,6BP-treated (100 pM) Q-lll cells with TMRM (FIG. 12D). Fluorescence intensity of TMRM was measured using the PE channel.

[0085] FIGs. 12E-12G show isolated mitochondria from both healthy and HD tissues were analyzed by FACS using the MitoView™650 dye on the PE channel, revealing distinct populations with different mitochondrial percentages. Mitochondria from diseased tissues (FIG. 12F) demonstrated a separate population compared to mitochondria from healthy control tissues (FIG. 12E). Quantitative results from duplicate analyses are summarized in the bar graph (FIG. 12G) and are expressed as mean ± SE.

[0086] FIG. 12H show's mtROS level in Q-7 and Q-lll cells + F2,6BP (100 pM) in terms of relative fluorescence intensity.

[0087] FIGs. 12I-12M show mitochondrial respiration comparison between Q-7, Q-lll and Q-lll cells supplemented with 200 pM F2,6BP by seahorse assay. Oxygen consumption rate (OCR) (FIG. 121) was determined throughout the mitochondrial respiration test. Non-mitochondrial oxygen consumption (FIG. 121) was determined by measuring the difference between total oxygen consumption and antiniycin A and rotenone treatment-induced reduction in oxygen consumption, maximal respiration (FIG. 12L) was expressed as difference between oxygen consumption following mitochondria uncoupling by FCCP and rotenone, antimycin A treatment and spare respiratory capacity (FIG. 12M) was determined by subtracting basal respiration (FIG. 12K) from maximal respiration. The data represent mean + s.e.m. from three independent experiments.

[0088] FIGs. 13A-13E show' mass spectrometry (MS) analysis and of F2,6BPand fluorescence analysis of PNKP and F2,6BP.

[0089] FIG. 13A show's ESI-MS analysis of the purified F2,6BP in negative ion mode showing a prominent peak at ni / z 338.99, which corresponds to the deprotonated molecular ion (M-H]-ofF2,6BP.

[0090] FIG. 13B show's fluorescence emission spectra of PNKP excited at 295 nm in the absence and the presence of F2,6BP.

[0091] FIG. 13C shows fluorescence titration of PNKP versus F2,6BP. The protein (50 nM) was excited at 295 nm, and the fluorescence intensity w'as monitored at 340 nm (see inset) at room temperature. The fraction bound (i.e. relative fluorescence quenching) versus F2,6BP concentration is plotted.

[0092] FIG. 13D show's 3 ’-phosphatase activity and quantitation of percent (%) released phosphate of PNKP. Upper panel Representative gel images (four different patients vs healthy control) showing the 3 ’-phosphatase activity of PNKP in the post-mortem brain (frontal cortex) mitochondrial extract of healthy normal control (lane 2) or supplemented with F2,6BP (lane 3, 50 pM), and age / gender-matched HD patient (lane 4) or supplemented with F2,6BP (lanes 5-6, 25 and 50 pM) or F6P (lane 7, 50 pM) or F1,6BP (lane 8, 50 pM). Lane 1: substrate only. Lane 9: purified PNKP (1-2 ng). S: Substrate and P: Released phosphate. Lower panel: Quantitation ofthe % released phosphate in the indicated lanes (n=3, ***P<0.005; **P<0.01).

[0093] FIG. 13E shows ’-phosphatase activity and quantitation of percent (%) released phosphate of PNKP. Upper panel: Representative gel image showing the 3 ’-phosphatase activity of PNKP in the mitochondrial extract of Q-7 ceils (lanes 2, 6) and Q-lll cells (lanes 3, 7) or Q-lll cells supplemented with F2,6BP (lanes 4-5 and 8-9, 25-50 pM). Lane 1: substrate only. Lane 10: purified PNKP (1-2 ng). S: Substrate and P: Released phosphate. Cells from two different passages are used (P6 and P12). Lower panel: Quantitation of the % released phosphate in the indicated lanes (n=3, ***P<0.005, between Q-7 and Q-lll cells).

[0094] FIGs. 14A-14B show' PNKP phosphatase activity and determination of DNA strand break accumulation. FIG. 14A shows 3 ’-phosphatase activity and quantitation of percent (%) released phosphate of PNKP. Upper panel: Representative gel image of 3 ’-phosphatase activity of PNKP in the mitochondrial extract of Q-7 (lanes 2-3) and Q-l 11 (lanes 4-9) cells with mock treatment (Mock 1; lanes 2 and 4), treatment with K16ApoE carrier peptide alone (25 pM; Mock 2; lanes 3 and 5) or supplemented with F2,6BP (100 pM; 72 and 96 h) (lanes 6-7), or Fl,6BP (lanes 8-9, 100 pM) in the presence of carrier peptide. Lane 1: substrate only. Lane 10: purified PNKP (2 ng). Lower panel: Quantitation of the % released phosphate in the indicated lanes. Error bars show ±SD of the mean; ***P<0.005 compared to lanes 2, 3.

[0095] FIG. 14B shows determination of DNA strand break accumulation. Upper panel: Amplification of long amplicon (LA) and a short amplicon (SA) of the mitochondrial fragments to assess DNA strand break accumulation. Lower panel: The bar diagram represents the normalized (with short amplicon) relative band intensity with the mock-treated Q-7 sample arbitrarily set as 100. Error bars show ±SD of the mean; ***P<0.005 compared to lanes 1, 2.

[0096] FIGs. 15A-15C show protein and aggregate analyses.

[0097] FIG. 15A shows benzonase-treated mitochondrial extracts from Q-7, mock and F2,6BP-treated (100 pM, 72 h) Q- l 11 cells were immunoprecipitated with anti-PNKP antibody (PNKP IP); or control IgG and tested for the presence of associated proteins (shown in the right) using specific Abs.

[0098] FIG. 15B shows HIT aggregation levels in Q-7 (top), Q-l 11 (middle) and Q-lll cells treated with F2,6BP (100 pM; bottom) were assessed with ThT dye, which fluoresces green, and nuclear localization was indicated by NucRed dye, providing a cyan signal in the merged images. Imaging was performed on the EVOS™ M5000 system at 200X magnification. (Bottom) Relative quantification of the mean fluorescence intensity (in arbitrary units) (***p<0.005, between Q-7 and Q-lll cells and Q-lll cells + F2,6BP.

[0099] FIG. 15C shows immunofluorescence micrographs show HIT expression and aggregation in Q-7 (top), Q-lll (middle) and Q-lll cells treated with F2,6BP (bottom). Cells were stained with Anti-HTT antibody MW8, visualized using a mouse secondary antibody conjugated to Alexa Fiuor™568, resulting in red fluorescence. The nuclei were counter stained with DAPI. Images were captured at 600X magnification using a SoRa super-resolution spinning disk confocal system with motorized FRAP / photobleaching.

[0100] FIG. 16 shows mitochondrial fragments from genomic DNA. Left panel: Representative agarose gel images of long (LA) and short (SA) amplicon of the two mitochondrial fragments from genomic DNA of male (lanes 2-3) and female (lanes 4-5) flies with pan-neuronal expression of Httl28Q either mock-treated (lanes 2 and 4) or treated with F2,6BP (lanes 3 and 5). Lane 1: will 8 (males and females). Right panel The normalized relative band intensities were represented in the bar diagram with will 8 arbitrarily set as 100 (error bars represent ±SD of the mean). The damage for each gene in Drosophila pan-neuronal expression of Httl28Q was significant (***P<0.005) compared to the w!118 samples. Also, the strand breaks were significantly repaired in F2,6BP-treated samples.

[0101] FIGs. 17A-17E show PNKP activity significantly diminishes in sporadic ALS and FTD patient tissues with TDP-43-positive inclusions.

[0102] FIG. 17 A shows a schematic representation of radio-labeled 32P release by 3’-phosphatase activity of PNKP on a duplex oligonucleotide substrate simulating a DNA singlestrand break (SSB).

[0103] FIG. 17B shows a representative image demonstrating reduced PNKP activity in the nuclear extracts (NE) of ALS-TDP-43 (Lns 5-7) and FTD-TDP-43 (Lns 8-9) cortical tissues compared to age-matched non -neurological controls (Lns 2-4). Ln 1: substrate only (negative control); Ln 10: purified PNKP (25 fmol) as positive control. The histogram displays quantification of PNKP activities for all samples (N = 6) for the Control, ALS and FTDa C groups as fold changes. S: substrate, P: released phosphate.

[0104] FIG. 17C shows a PNKP activity assay from Guamanian ALS patient brain samples (Lns 6-9) compared to age-matched Guam controls (Lns 2-5). The groups were compared using two-way ANOVA or two-tailed t-tests as appropriate. Error bars represent mean ± SD; significance at p < 0.05; ns = non-significant.

[0105] FIG. 17D shows representative immunofluorescence (IF) images showing cytosolic mislocalization of total TDP-43 and corresponding phosphorylated TDP-43 (pTDP-43, S409 / 410) expression levels in autopsied cortical sections from ALS, FTD, and age-matched non-neurological control samples (N = 6 cases per group). Scale bar, 10 pm. Quantification of fluorescence intensity (arbitrary units; a.u.) of pTDP-43 levels is included.

[0106] FIG. 17E shows a representative IB image exhibiting PNKP and PFKFB3 levels in the nuclear extracts (NE) of cortical tissues from controls, ALS, and FTD patients, with HDAC2 serving as a loading control. Quantification of protein levels of PNKP and PFKFB3 across the study groups. The groups were compared using the two-way ANOVA. Error bars represent mean ± SD; significance at p < 0.05; ns = non-significant.

[0107] FIGs. 18A-I8B show loss of TDP-43 abolishes PNKP activity in cultured cells.

[0108] FIG. 18A shows IB analysis showing levels of TDP-43, PNKP, and PFKFB3 in the NE from HEK293 cells treated with siTDP-43 or siControl. HDAC2 served as the nuclear' loading control. The histogram shows quantification of protein levels as fold change, analyzed using two-way ANOVA.

[0109] FIG. 18B shows a representative image of 3 ’-phosphatase activity of PNKP in the NE from HEK293 cells transfected with siControl (Ln 3) or siTDP-43 (Ln 4). Ln 1: substrate alone; Ln 2: purified PNKP (25 fmol) as controls. Quantification of PNKP activity is presented as fold change. Data were analyzed using a Student’s t-test. Error bars represent mean ± SD. The groups were compared using the two-way ANOVA or two-tailed t-tests as appropriate; significance at p < 0.05; ns = non-significant.

[0110] FIGs. 19A-19D show PNKP supplementation rescues DNA damage in TDP-43 KD cells.

[0111] FIG. 19A shows IB showing yH2AX levels in TDP-43 KD (siTDP-43) HEK293 cells with or without PNKP overexpression (OE). The histogram shows quantitation of yH2AX levels (band intensity, normalized to GAPDH).

[0112] FIG. 19B shows a neutral comet assay and quantitation of tail moment. N = 50 cells. Scale bar, 10 pm.

[0113] FIG. 19C shows DNA integrity analysis using LA-qPCR of POLB (12.4 kb) and RNAPII (11.3 kb) genomic regions. Quantitation of PCR products was performed using the Pico-Green method in a plate reader. The long amplicons were normalized to their respective short amplicons of the POLB (196 bp) and RNAPII (295 bp) genes and represented in the bar diagram as fold change of DNA integrity.

[0114] FIG. 19D shows PLA of Lig4 vs vH2AX shows reduced signal in TDP-43 KD HEK293 cells, which was rescued after PNKP-OE. Scale bar, 10 pm. The histogram show's the quantitation of the number of PLA foci per nucleus counted from 25 cells. The groups were compared using one-way or two-way ANOVA. Error bars represent mean ± SD; significance at p < 0.05.

[0115] FIGs. 20A-20B show partial characterization of theTC-NHEJ complex in post-mortem patient tissues and preferential accumulation of genome damage at transcribed genes in TDP-43 pathology.

[0116] FIG. 20 shows NE from autopsi ed frontal cortex tissues of human ALS patients (Ims 4-7) and non-neurological controls (Lns 1-3) (frontal cortex) were immunoprecipitated with anti-PNKP antibody and tested for associated proteins (as indicated). Quantitation of immunoprecipitated protein levels in terms of relative band intensity.

[0117] FIG. 20B shows representative agarose gel images showing accumulation of genome damage in transcribed (Enolase & NeuroD) and non-transcribed (MyII2 & MyII4) genes in autopsied brain samples of non-neurological control and ALS-TDP-43 patients (N = 3) by LA-qPCR. The PCR products were independently quantified using the Pico-Green in a plate reader. Relative long amplicon values were normalized to their respective short amplicon ones: all LA amplicons were 6 kb in size and SA of all indicated genes were 300 bp, except for NeuroD, which was 200 bp. The histogram shows the fold change of DNA integrity. The groups were compared using two-tailed multiple t-tests. Error bars represent mean ± SD; significance at p < 0.05.

[0118] FIGs. 21A-21E show reduced PFKFB3 and F2,6BP levels in ALS / FI'D brains and restoration of PNKP activity by F2,6BP supplementation.

[0119] FIG. 21 A shows a bar graph illustrating relative levels of PFKFB3 in ALS and FTD patients vs. non-neurological controls normalized with HDAC2. Data were analyzed using oneway AN OVA.

[0120] FIG. 21B shows quantitation of F2,6BP levels in control (N=3), ALS (N=3) and FTD (N=4) patient frontal cortices.

[0121] FIG. 21C shows a representative image showing 3 ’-phosphatase activity of PNKP in NE from ALS-TDP-43 samples (Lns 3-6) compared to age-matched non-neurological controls (Ln 2), with activity restored upon adding the F2,6BP metabolite (Lns 7-10). Lane I shows the substrate-only negative control. The histogram quantifies PNKP activity as fold change, analyzed by one-way ANOVA. S: substrate, P: released phosphate.

[0122] FIG. 2 ID shows a representative image showing the concentration-dependent rescue of PNKP activity (Lns 5-6) by F2,6BP in a sporadic ALS-TDP-43 sample (Ln 4), compared with an age-matched control (Ln 2). F1,6BP and F6P were used as negative controls (Lns 7, 8). Lane 1 shows the substrate-only, lane 9: purified PNKP (25 fmol). The histogram presents relative PNKP activity as fold change, with analysis by two-way ANOVA.

[0123] FIG. 2 IE shows a representative image demonstrating concentration-dependent restoration of PNKP activity by F2,6BPin a Guam-ALS-TDP-43 sample compared to an age-matched control, with F1,6BP and F6P serving as negative controls. The histogram represents relative PNKP activities as fold change, analyzed via two-way ANOVA. Error bars represent mean ± SD; significance at p < 0,05; ns = non-significant.

[0124] FIGs. 22A-22O show F2,6BP rescues DNA damage caused by mutant TDP-43-mediated PNKP inhibition in ALS-TDP-43287Sand AI. S-l’DP-43c'"J’''spatient-derived NPSC lines.

[0125] FIG. 22A shows a schematic representation of TDP-43 protein domains, indicating the G287S mutation site. FIG. 2.2B shows an illustration of the CRISPR / Cas9 -mediated correction of the TDP-43G28 / Smutation to generate an isogenic TDP-43G287GiPSC line.

[0126] FIG. 22C shows IF analysis showing cytosolic mislocalization of TDP-43 in the mutant cells. Quantitation of nuclear-to-cytosol ratio of TDP-43 fluorescence (in arbitrary units, a.u.). The groups were compared by t-test. Scale bar, 10pm.

[0127] FIG. 221 ) shows IB analysis of insoluble fractionates from the isogenic and TDP-

[0128]

[0129] treatment for total TDP-43, pTDP-43 (S409 / S410) and polyubiquitinated proteins. The GAPDH served as the loading control indicating the uniformity in preparing insoluble fractionates. Bar graphs show changes in protein levels of the indicated target proteins as fold changes.

[0130] FIG. 22E shows IB analysis of PNKP and PFKFB3 levels in the NE from G287S mutant and isogenic G287G NPSCs. HDAC2 served as the loading control. Quantification of levels of PFKFB3 and PNKP between the groups is shown on the right.

[0131] FIG. 22F shows a representative gel image displaying PNKP activities in NE from the mutant (Ln 3) and isogenic NPSCs (Ln 2) and its rescue by F2,6BP (100 pM, Ln 4) but not F1,6BP (Ln 5). Bar diagram shows quantification of the PNKP activity between the groups (N=3). S: substrate, P: released phosphate. Lane 1, no protein. The groups were compared using t-test, one-way or two-way ANOVA as appropriate. Error bars represent mean ± SD; significance at p < 0,05; ns = non-significant.

[0132] FIGs. 22G-22I show F2,6BP rescues DNA damage caused by mutant TDP-43-mediated PNKP inhibition in an ALS-TDP-43G298Spatient-derived NPSC lines.

[0133] FIG. 22G shows IF analysis of TDP-43’s subcellular distributions in TDP-43 mutant versus wild-type (WT) control cells. Scale bar, 10 pm. Quantitation of nuclear-to-cytosol ratio of TDP-43 fluorescence signal intensities (a.u.).

[0134] FIG. 22H shows IB analysis of yH2AX levels in TDP-43WT versus TDP-43G298Smutant cell extracts, where H2AII served as the loading control for yH2AX and GAPDH for whole cell extracts. Lower panel shows quantification of protein levels in fold change from three independent experiments is shown in the histogram.

[0135] FIG. 221 shows quantitation of PNKP activity in NE from TDP-43 WT and TDP-43G298Smutant cell lines, with or without F2,6BP treatments (50-100 pM). Error bars represent mean ± SD; the groups were compared for statistical significance using two-tailed t- tests or two-way ANOVA as appropriate; significance at p < 0.05; ns = non-significant.

[0136] FIGs. 22.1-220 show DNA damage induced by mutant TDP-43 via PNKP inhibition is rescued by F2,6BP in ALS patient cell lines. FIG. 22. J shows a schematic representation of TDP-43 protein domains indicating the Q331K mutation site.

[0137] FIG. 22K shows IF analysis of TDP-43 ’s subcellular distributions in TDP-43 mutant versus wild-type (WT) control cells. Scale bar, 10 pm. Quantitation of nuclear-to-cytosol ratio of TDP- 43 fluorescence signal intensities (a.u.).

[0138] FIG. 22L shows IB analysis of PNKP and PFKFB3 levels in the NE from TDP-43Isogenic and TDP-43Q331KNPSCs. HDAC2 served as the loading control. The bar diagram shows the quantification of levels of PFKFB3 and PNKP between the groups.

[0139] FIG. 22M shows quantitation of PNKP activity in NE from TDP-43 Isogenic and TDP-43Q331Kmutant cep ijneS) with or without F2,6BP treatments (100 pM).

[0140] FIG. 22N shows a schematic representation of an FID patient-derived cell line harboring bothTDP-4A382iand aC9ORF72 repeat mutation.

[0141] FIG. 220 shows quantitation of PNKP activity in NE from the FTD patient cell line, with or without F2,6BP (100 pM). FL6BP (100 pM) treatment group served as the negative control. Error bars represent mean ± SD; the groups were compared for statistical significance using two-tailed t- tests or two-way ANOVA as appropriate; significance at p < 0.05; ns = nonsignificant.

[0142] FIGs. 23A-23D show reduced PNKP activity in TDP-43 mouse brain tissues correlates with PFKFB3 levels and its restoration by F2,6BP.

[0143] FIG. 23A shows a schematic of the construct used to generate Tdp43-ANLS expression under the UBC promoter in C57BL6 mice.

[0144] FIG. 23B shows representative IB images showing PNKP and PFKFB3 levels in sham and ALS cortical samples. Bar graph displaying changes in PNKP and PFKFB3 levels across the groups as fold changes. Data are analyzed by one-way ANOVA.

[0145] FIG. 23C shows a representative image demonstrating reduced PNKP activity in the nuclear extracts of AES (Lns 6-9) compared to age-matched sham controls (Lns 2-5). Ln 1: substrate only (negative control); Ln 10: substrate plus pure PNKP protein as positive control. The histogram displays the quantification of PNKP activity as fold change, analyzed by Student’s t-test. S: substrate, P: released phosphate.

[0146] FIG. 23D shows a representative image showing the rescue of PNKP activity by F2,6BP in a dose-dependent manner in ALS mice sample compared to WT, where F1,6BP and F6P served as negative controls. Histogram indicating relative PNKP activities as fold change across the groups. Data were analyzed by two-way ANOVA. Error bars represent mean + SD; significance at p < 0.05; ns::::non-significant. FIGs. 24A-24C show F2,6BP rescued motor deficiency and restored genome repair in a whole organism.

[0147] FIG. 24A shows climbing score for ALS flies expressing TDP-43 gene with disease-linked mutation Q331K in motor neurons (10 flies in each cohort, male and female mixed) treated with either mock buffer or F2,6BP (50 M). One-way ANOVA was used to assess the statistical significance.

[0148] FIG. 24B shows representative agarose gel images of long (~8 kb; LA) and short (~200 bp; SA) amplicons of the CrebB and Neurexin genes from flies either mock-treated (lane 2) or treated withF2,6BP (Ln 3). Lane 1: wll!8.

[0149] FIG. 24C shows normalized relative band intensities with wl 118 were arbitrarily set as 100 (N = 3). Error bars represent mean i SD; significance at p < 0.05.

[0150] FIG. 25 shows a schematic overview of PNKP inhibition in neurodegenerative diseases with TDP-43 pathology. The glycolytic enzyme PFKFB3 and its product, the small molecule metabolite F2,6BP, plays a pivotal role in regulating PNKP acti vity and in the repair of genome damage via transcription-coupled NHEJ. TDP-43 pathology (hyper-ubiquitination and phosphorylation) results in reduced levels of PFKFB3 / F2,6BP and significant loss of PNKP activity, which results in neuronal loss. Supplementation of F2,6BP restores PNKP activity demonstrating its therapeutic efficacy in a subject in need thereof.

[0151] FIGs. 26A-26H show levels of F2,6BP, the 3 ’-phosphatase activity of PNKP and ROS in AD and tauopathy patients.

[0152] FIG. 26A is a bar plot showing relative F2,6BP levels in cortices of control and AD (N=10 both patient control), CBD (N=10 in both), and PSP (N=15 patients & N=12 control).

[0153] FIG. 26B shows the 3 ’-phosphate release activity of PNKP in the nuclear extracts of hippocampi of representative control and AD patient samples. Quantification and relative amounts of F2,6BP in nuclei and mitochondria of hippocampi of control and AD patients. N=8 (AD); N=8 (Control).

[0154] FIG. 26C shows the 3 ’-phosphate release activity of PNKP in the nuclear extracts of frontal cortices of representative control and AD patient samples.

[0155] FIG. 26D is a bar graph representation of quantified PNKP activity of 20 patient and 8 control samples.

[0156] FIG. 26E shows Relative ROS levels in the frontal cortices of control and AD patients. NP = no protein control. rPNKP was used as a positive control.

[0157] FIG. 26F shows Relative ROS levels in the frontal cortices of control and PSP patients. NP --- no protein control. rPNKP was used as a positive control. FIG. 26G Long-(LA)-PCR showing DNA break repair defect in two transcribing genes (Tubb and Enolase) but not in a non-transcribing gene (MyH4) of AD and control samples as examples.

[0158] FIG. 2.6H shows quantitation of PCR products for AD and control samples. Quantitation of PCR products derived from CBD and PSP patient and control samples are also shown.

[0159] FIGs. 27A-27D show Levels of F2,6BP, the 3’ -phosphatase activity of PNKP and ROS in AD and tauopathy patients.

[0160] FIG. 27 A shows relative amounts of F2,6BP in mitochondria and nuclei of the cortex of AD and CBD.

[0161] FIG. 27B shows relative amounts of F2,6BP in mitochondria and nuclei of the hippocampus of AD and CBD.

[0162] FIG. 27C is a Long-(LA)-PCR assay showing DNA break repair defect in mitochondrial genome.

[0163] FIG. 27D shows quantitation of the Long-(LA)-PCR assay showing DNA break repair defect in mitochondrial genome in FIG. 27D. Statistical significance was determined using Student’s t-test, ** p < 0.01, and *** p < 0.001 indicate significant, very significant, respectively.

[0164] FIGs. 28A-28H show restoration of PNKP activity in nuclear and mitochondrial extracts of AD patient brains.

[0165] FIG. 28A shows representative radioactive gel images illustrating 3’- phosphatase activity in nuclear extracts of frontal cortices of control and AD patients (female) with and without the presence of 50 / zM F2,6BP.

[0166] FIG. 28B shows representative radioactive gel images illustrating 3’- phosphatase activity in nuclear extracts of frontal cortices of control and AD patients (male) with and without the presence of 50 / zM F2,6BP.

[0167] FIG. 28C shows same as FIG. 28B except for extracts from Hippocampi of control and patient male samples. NP (no protein) and rPNKP (recombinant PNKP) served as negative and positive control, respectively. F6P and F1,6BP showed no effect on the PNKP phosphatase activity.

[0168] FIG. 28D shows same as FIG. 28A except for extracts from Hippocampi of control and patient female samples. NP (no protein) and rPNKP (recombinant PNKP) served as negative and positive control, respectively. F6P and Fl, 6BP showed no effect on the PNKP phosphatase activity. FIG. 28E shows quantitation of PNKP activity rescue expressed as relative fold change (P / S). Quantitation was done on all samples shown in FIGs. 28A-28D and FIGs. 29A-29D.

[0169] FIG. 28F shows 3 ’-phosphatase activity in mitochondrial extracts of control and AD without and with increasing concentrations of F2,6BP. Quantitation of product formation (phosphate release) shown in the bottom.

[0170] FIG. 28G shows confocal images of AD and control cortices stained with a-H2Ax antibody.

[0171] FIG. 28H shows quantification of a-H2Ax antibody staining of confocal images of AD and control cortices.

[0172] FIGs. 29A-29D show F2,6BP restores PNKP activity nuclear extracts of AD patients (Frontal Cortex and Hippocampus).

[0173] FIG. 29A shows dose dependency of the effect of F2,6BP of male patients 3’-phosphatase activity in cortical nuclear extracts of control and AD male patients.

[0174] FIG. 29B shows dose dependency of the effect of F2,6BP of female patients 3’-phosphatase activity in cortical nuclear extracts of control and AD female patients.

[0175] FIG. 29C shows dose dependency of the effect of F2,6BP of male patients in hippocampus. NP (no protein) and rNPKP (recombinant PNKP) are negative and positive control, respectively. F6P and F1,6BP showed no effect on the phosphatase activity in the nuclear extract.

[0176] FIG. 29D shows dose dependency of the effect of F2.6BP of female patients in hippocampus. NP (no protein) and rNPKP (recombinant PNKP) are negative and positive control, respectively. F6P and F1,6BP showed no effect on the phosphatase activity in the nuclear extract.

[0177] FIGs. 30A-30E show PFKFB3 expression in cortical samples of AD patients and healthy controls.

[0178] FIG. 30A shows transcript analysis of several key DNA repair genes in two different Braak stages from a publicly available RNA-seq database.

[0179] FIG. 30B shows RNA levels of PFKFB3 at increasingly severe disease stages analyzed from the same database as in FIG. 30A.

[0180] FIG. 30C shows confocal images of a-PFKFB3 antibody-stained slides of AD and control cortical samples. White arrows denote aggregates in AD samples.

[0181] FIG. 30D shows quantitation of relative fluorescence intensity between AD and control samples.

[0182] FIG. 30E shows comparative PFKFB3 enzyme activity in AD and control samples. FIGs. 31A-31B show Western blot of showing PFKFB3 levels.

[0183] FIG. 31 A shows a western blot of total PFKFB3, phospho PFKFB3 and Vinculin levels using highly specific antibodies.

[0184] FIG. 3 IB shows quantitation of normalized levels of total and phospho-PFKFB3 between AD and control samples.

[0185] FIGs. 32A-32L show Decreased protein phosphatase 2A (PP2A) levels AD and tauopathy patients, and AD patient-derived induced neurons (iNs) correlate with increased tau aggregation.

[0186] FIG. 32 A shows confocal images of immunostained (tau-aggregation detecting MCI antibody) cortical tissue slices from AD patients and matched healthy controls.

[0187] FIG. 32B shows confocal images of immunostained (tau-aggregation detecting MCI antibody) cortical tissue slices from CBD patients and matched healthy controls.

[0188] FIG. 32C shows quantitation showing the difference of tau aggregation in these samples.

[0189] FIG. 32D shows mRN A levels of the catalytic and regulatory subunits at different Braak stages of AD.

[0190] FIG. 32E shows confocal images of cortical tissues of AD and CBD stained with anti-PP2CA antibody.

[0191] FIG. 32F shows quantitation of multiple tissue images.

[0192] FIG. 32G shows Western blot of tissue extracts of AD cortices and matched controls. FIG. 32H shows quantitation of the western blot of tissue extracts of AD cortices and matched controls.

[0193] FIG. 321 shows confocal images of AD- and WT-iN cells with four different antibodies. FIG. 32J shows quantitation of PP2CA levels in control and AD-iNs.

[0194] FIG. 32K shows confocal images showing tau aggregation in AD- and WT-iN cells. FIG. 32L shows quantitation of tau aggregates in AD- and WT-iNs.

[0195] FIGs. 33A-33F show Relative levels of phospho- and total tau in AD and control samples.

[0196] FIG. 33A shows representative West blot showing levels of phospho-tau in AD and control samples.

[0197] FIG. 33B shows quantification of Western blot using Vinculin as a loading control. FIG. 33C shows Representative Western blot showing total tau proteins in these samples and D. quantification of Western blot.

[0198] FIG. 33D shows quantification of the Western blot in FIG. 33C. FIG. 33E shows confocal images of control versus PSP brain sections stained for PP2. A. FIG. 33F shows relative mean fluorescence intensity of PP2A in normal versus PSP brain.

[0199] FIGs. 34A-34G show F2,6BP treatment diminished tau pathology in AD-iNs by reducing DNA damage and activating PFKFB3.

[0200] FIG. 34A shows confocal images of WT-iNs, AD-iNs and AD-iNs-treated with F2.6BP stained with gH2Ax, MCI, DAPI and Tub3. DAPI, MCI and Tau3 stains nuclear DNA, Tau aggregate and neuron-specific tubulin.

[0201] FIG. 34B shows similar experiments as in FIG. 34A except cells stained with a-PFKFB3 antibody. Arrows mark aggregates.

[0202] FIG. 34C shows confocal Images of three cell types stained with MCI only.

[0203] FIG. 34D shows quantitation of relative fluorescence intensity of gH2Ax stained puncta.

[0204] FIG. 34E shows quantitation of relative fluorescence intensity of gH2Ax stained PFKFB3.

[0205] FIG. 34F shows quantitation of relative fluorescence intensity of gU2Ax stained tau aggregate.

[0206] FIG. 34G shows AD-iN cells treated with control or with F2,6BP and stained for Tub3, MCI, PP2a, and DAPI.

[0207] FIG. 35 shows RT-qPCR analysis of pp2ca mRNA levels in AD-iNs untreated and treated with indicated molecules.

[0208] FIGs. 36A-36K show Regulation of tau aggregate formation by F2,6BP via direct interaction between tau and F2,6BP.

[0209] FIG. 36A show's the reaction scheme to monitor the effect of F2,6BP on tau under different condition for experiments in FIG. 36B and FIG. 36C.

[0210] FIG. 36B shows PAGE showing levels of tau remaining in solution.

[0211] FIG. 36C shows quantitation of band intensities shown in FIG. 36B.

[0212] FIG. 36D show's F2,6BP prevents aggregation of full-length tau.

[0213] FIG. 36E shows tracking of fluorescently labeled aggregates shows that F2,6BP disassembles the aggregate indicated by the white arrow'.

[0214] FIG. 36F-36I show' the effect of F2,6BP on the KI 8 aggregation formation measured by dynamic light scattering (DES). Hydrodynamic radius (Rh) of Tau KI 8 aggregates at 0 and 120 min in the presence of F1,6BP (FIGs. 36F & 36G) and F2,6BP (FIGs. 36H and 361) measured for 20 samples. FIG. 36J shows a distribution plot showing time dependent changes of KI 8 aggregation as a function Rh under different conditions.

[0215] FIG. 36K shows a decay plot of diffusion coefficient vs delay time diffusion rates of KI 8 aggregates under different conditions.

[0216] FIGs. 37A-37M show Tau insoluble aggregates and the effect of F2,6BP.

[0217] FIG. 37A shows Tau as insoluble aggregates as measured by increase of TnT fluorescence upon binding to aggregates from the pellet (Fig 36A).

[0218] FIG. 37B shows quantitation of aggregates from fluorescence intensity.

[0219] FIG. 37C shows BLI (Biolayer Interferometry) experiments showing different association and dissociation curves of F1,6BP and F2,6BP for Histidine tagged full length tau on an anti-His Chip. Effect of F2,6BP on the KI 8 aggregation formation measured by dynamic light scattering (DLS).

[0220] FIGs. 37D-37M show Hydrodynamic radius (Rh) of Tau K18 aggregates at different times under different experimental conditions.

[0221] FIGs. 38A-38I show Exogenous F2,6BP reduces tau aggregates in tauopathy slice culture and reverses pathology in Drosophila AD models.

[0222] FIG. 38A shows Top, a schematic showing generation, treatment and imaging of organotypic hippocampal slice culture, and Botom, representative IF images of hippocampal slices untreated (PBS) (left) and treated with 50 uM F2,6BP stained with MCI and DAPI.

[0223] FIG. 38B shows quantification of MCI -stained area in PBS and F2,6BP-treated samples.

[0224] FIG. 38C shows WB analysis of total extracts using indicated antibodies. These are representatives of three independent experiments done over several months.

[0225] FIG. 38D shows quantification of pTau (pSer396 / p404-Tau) in PBS and F2,6BP-treated samples.

[0226] FIG. 38E shows quantification of pTau (pSer202-Tau) in PBS and F2,6BP-treated samples.

[0227] FIG. 38F shows schematics of fly generation and climbing assay.

[0228] FIG. 38G shows quantitation of the climbing assay score.

[0229] FIG. 38H shows PCR analysis of the genomic DNA encompassing two transcribing genes and the mitochondrial genome. LA PCR amplifies 10 kb and SA PCR amplifies 100 bp.

[0230] FIG. 381 shows quantification of LA PCR products of templates isolated from control fly (W1118), AD fly-untreated (mock), and AD fly -treated with F2,6BP. FIG. 39 shows the effect of F2,6BP on AD-Primary neurons. A schematic illustrates the experimental design to observe the effect of F2.6BP on primary neurons (Top) and staining with MCI and MAP2 antibodies and imaging after F2.6BP or PBS (control) treatment (Bottom).

[0231] DETAILED DESCRIPTION

[0232] The following description of the disclosure is provided as an enabling teaching of the disclosure in its best, currently known embodiment(s). To this end, those skilled in the relevant art will recognize and appreciate that many changes can be made to the various embodiments of the invention described herein, while still obtaining the beneficial results of the present disclosure. It will also be apparent that some of the desired benefits of the present disclosure can be obtained by selecting some of the features of the present disclosure without utilizing other features. Accordingly, those who work in the art will recognize that many modifications and adaptations to the present disclosure are possible and can even be desirable in certain circumstances and are a part of the present disclosure. Thus, the following description is provided as illustrative of the principles of the present disclosure and not in limitation thereof.

[0233] Reference will now be made in detail to the embodiments of the invention, examples of which are illustrated in the drawings and the examples. This invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein.

[0234] Definitions

[0235] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this disclosure belongs. The term “comprising” and variations thereof as used herein is used synonymously with the term “including” and variations thereof and are open, non-limiting terms. Although the terms “comprising” and “including” have been used herein to describe various embodiments, the terms “consisting essentially of’ and “consisting of” can be used in place of “comprising” and “including” to provide for more specific embodiments and are also disclosed.

[0236] As used in the specification and claims, the singular form “a”, “an”, and “the” include plural references unless the context clearly dictates otherwise. For example, the term “an agent” includes a plurality of agents, including mixtures thereof.

[0237] The terms "about" and "approximately" are defined as being “close to” as understood by one of ordinary skill in the art. In a non-limiting embodiment the terms are defined to be within 10%. In a non-limiting embodiment, the terms are defined to be within 5%. In a nonlimiting embodiment, the terms are defined to be within 1%.

[0238] Notwithstanding that the numerical ranges and parameters setting forth the broad scope of the disclosure are approximations, the numerical values set forth in the specific examples are reported as precisely as possible. Any numerical value, however, inherently contains certain errors necessarily resulting from the standard deviation found in their respective testing measurements. Furthermore, when numerical ranges of varying scope are set forth herein, it is contemplated that any combination of these values inclusive of the recited values may be used. Further, ranges can be expressed herein as from “about” one particular value, and / or to “about” another particular value. When such a range is expressed, another aspect includes from the one particular value and / or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent “about,” it will be understood that the particular value forms another aspect. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint. Unless stated otherwise, the term “about” means within 10% (e.g., within 2% or 1%) of the particular value modified by the term “about.”

[0239] “Administration" to a subject includes any route of introducing or delivering to a subject an agent. Administration can be carried out by any suitable route, including oral, topical, intravenous, subcutaneous, transcutaneous, transdermal, intramuscular, intra-joint, parenteral, intra-arteriole, intradermal, intraventricular, intracranial, intraperitoneal, intralesional, intranasal, rectal, vaginal, by inhalation, via an implanted reservoir, parenteral (e.g., subcutaneous, intravenous, intramuscular, intra- articular, intra-synovial, intrasternal, intrathecal, intraperitoneal, intrahepatic, intralesional, and intracranial injections or infusion techniques), and the like. "Concurrent administration", "administration in combination", "simultaneous administration" or "administered simultaneously" as used herein, means that the compounds are administered at the same point in time or essentially immediately following one another. In the latter case, the two compounds are administered at times sufficiently close that the results observed are indistinguishable from those achieved when the compounds are administered at the same point in time. "Systemic administration" refers to the introducing or delivering to a subject an agent via a route which introduces or delivers the agent to extensive areas of the subject's body (e.g. greater than 50% of the body), for example through entrance into the circulatory or lymph systems. By contrast, "local administration" refers to the introducing or delivery to a subject an agent via a route which introduces or delivers the agent to the area or area immediately adjacent to the point of administration and does not introduce the agent systemically in a therapeutically significant amount. For example, locally administered agents are easily detectable in the local vicinity of the point of administration but are undetectable or detectable at negligible amounts in distal parts of the subject's body. Administration includes self-administration and the administration by another.

[0240] As used herein, the terms "optionally," "may," and "may optionally" are used interchangeably and are meant to include cases in which the condition occurs as well as cases in which the condition does not occur. Thus, for example, the statement that a formulation "may include an excipient" is meant to include cases in which the formulation includes an excipient as well as cases in which the formulation does not include an excipient.

[0241] The terms “neurodegenerative disorder” or “neurodegenerative disease” or “neurodegeneration” refer to disease caused by the loss or pathological change of numerous central nervous system (CNS) cell populations, including but not limited to neurons and / or their myelin sheaths, microglia, astrocytes, etc., and are associated progressive memory loss and / or motor dysfunction. Examples of neurodegenerative diseases include but are not limited to Alzheimer’s disease (AD), Parkinson’s disease (PD), and amyotrophic lateral sclerosis (ALS). Many neurodegenerative diseases share proteinaceous structures as pathological hallmarks, such as insoluble aggregates of protein, which can be observed within or around neurons in the brains of patients having or at risk of having neurodegenerative disorders. Insoluble aggregates may produce profound cytotoxicity, further leading to neuron loss and disease.

[0242] The terms “polyQ” or “polyglutamine” as used herein refer to a tract of polyglutamine contained within a protein. Glutamine is encoded by cytosine-adenine-guanine (CAG) or cytosine-adenine-adenine (CAA) codons in a gene. CAG repeats are known to be more prone to expansion through a replication slippage mechanism. The length of the polyglutamine tract is proportional to the number of CAG repeats in gene exons. Proteins with abnormally expanded polyQ are known to be associated with neurodegenerative disorders. As used herein, a gene or a protein can be paired with recitation of “Q#” to indicate the number of CAG repeats in exons. For example, “HIT Q24” or “HTT Q58” indicate 2.4 consecutive repeats of CAG codon in exon(s) of the HIT gene or 58 consecutive repeats of glutamine residues in HIT protein, respecti vely.

[0243] The term “polyQ disease” as used herein refers to a neurodegenerative disorder associated with abnormal repeat expansion of glutamine (i.e., polyQ).

[0244] Normal tracts of polyQ in a protein in a normal physiological state that has a length less than a specific number. Inversely, for diseases or pathological conditions, tlie length of polyQ is longer than a specific number. For example, polyQ-related neurological disorders as disclosed herein include but are not limited to SC Al (polyQ > 41), SCA2 (polyQ > 34), SCA3 (polyQ > 62), SCA7 (polyQ > 38), SCA12 (polyQ > 46), SCA17 (polyQ > 45); and dentatorubral-pallidoluysian atrophy (DRPLA) (polyQ > 49), Huntington’s disease (HD) (polyQ > 36), and spinal-bulbar muscular atrophy (SBMA) (polyQ > 38), caused by the expansion of CAG repeat regions in ATXN1, ATXN2, ATXN3, ATXN7, ATXN12, TBP, ATNI, HIT, and AR genes, respectively. Examples of normal polyQ proteins described herein include, but are not limited to, ATXN1 with polyQ < 40, AI'XN2 with polyQ < 33, ATXN3 with polyQ < 41, ATXN7 with polyQ < 19, ATXN12 with polyQ < 46, TBP with polyQ < 44, AI’Nl with polyQ < 39, HTT with polyQ < 36, and AR with polyQ < 37. Inversely, examples of the proteins with abnormally expanded polyQ described herein include, but are not limited to, ATXN 1 with polyQ > 40, ATXN2 with polyQ > 33, ATXN3 with polyQ > 41, ATXN7 with polyQ > 19, and ATXN12 with polyQ > 46, TBP with polyQ > 44, ATNI with polyQ > 39, HTT with polyQ > 36, and AR with polyQ > 37.

[0245] As used here, the terms “therapeutic agent,” “beneficial agent,” and “active agent” are used interchangeably herein to refer to a chemical compound or composition that has a beneficial biological effect. Beneficial biological effects include both therapeutic effects, i.e., treatment of a disorder or other undesirable physiological condition, and prophylactic effects, i.e., prevention of a disorder or other undesirable physiological condition. The terms also encompass pharmaceutically acceptable, pharmacologically active derivatives of beneficial agents specifically mentioned herein, including, but not limited to, salts, esters, amides, prodrugs, active metabolites, isomers, fragments, analogs, and the like. When the terms “beneficial agent” or “active agent” are used, then, or when a particular agent is specifically identified, it is to be understood that the term includes the agent per se as well as pharmaceutically acceptable, pharmacologically active salts, esters, amides, prodrugs, conjugates, active metabolites, isomers, fragments, analogs, etc.

[0246] As used herein, the term “preventing” a disorder or unwanted physiological event in a subject refers specifically to the prevention of the occurrence of symptoms and / or their underlying cause, wherein the subject may or may not exhibit heightened susceptibility to the disorder or event.

[0247] As used herein, the terms “treating” or “treatment” of a subject includes the administration of a drug to a subject with the purpose of curing, healing, alleviating, relieving, altering, remedying, ameliorating, improving, stabilizing or affecting a disease or disorder, or a symptom of a disease or disorder. The terms “treating” and “treatment” can also refer to reduction in severity and / or frequency of symptoms, elimination of symptoms and / or underlying cause, prevention of the occurrence of symptoms, and improvement or remediation of damage.

[0248] By the term “effective amount’’ of a therapeutic agent is meant a nontoxic but sufficient amount of a beneficial agent to provide the desired effect. The amount of beneficial agent that is “effective” will vary from subject to subject, depending on the age and general condition of the subject, the particular beneficial agent or agents, and the like. Thus, it is not always possible to specify an exact “effective amount”. However, an appropriate “effective’ amount in any subject case may be determined by one of ordinary skill in the art using routine experimentation. Also, as used herein, and unless specifically stated otherwise, an “effective amount” of a beneficial can also refer to an amount covering both therapeutically effective amounts and prophylactically effective amounts.

[0249] An “effective amount” of a drug necessary to achieve a therapeutic effect may vary according to factors such as the age, sex, and weight of the subject. Dosage regimens can be adjusted to provide the optimum therapeutic response. For example, several divided doses may be administered daily or the dose may be proportionally reduced as indicated by the exigencies of the therapeutic situation.

[0250] As used herein, a “therapeutically effective amount” of a therapeutic agent refers to an amount that is effective to achieve a desired therapeutic result, and a “prophylactically effective amount” of a therapeutic agent refers to an amount that is effective to prevent an unwanted physiological condition. Therapeutically effective and prophylactically effective amounts of a given therapeutic agent will typically vary with respect to factors such as the type and severity of the disorder or disease being treated and the age, gender, and weight of the subject. The term “therapeutically effective amount" can also refer to an amount of a therapeutic agent, or a rate of delivery of a therapeutic agent (e.g., amount over time), effective to facilitate a desired therapeutic effect. The precise desired therapeutic effect will vary according to the condition to be treated, the tolerance of the subject, the drug and / or drug formulation to be administered (e.g., the potency of the therapeutic agent (drug), the concentration of drug in the formulation, and the like), and a variety of other factors that are appreciated by those of ordinary skill in the art.

[0251] As used herein, the term “pharmaceutically acceptable” component can refer to a component that is not biologically or otherwise undesirable, i.e., the component may be incorporated into a pharmaceutical formulation of the invention and administered to a subject as described herein without causing any significant undesirable biological effects or interacting ill a deleterious manner with any of the other components of the formulation in which it is contained. When the term “pharmaceutically acceptable" is used to refer to an excipient, it is generally implied that the component has met the required standards of toxicological and manufacturing testing or that it is included on the Inactive Ingredient Guide prepared by the U. S. Food and Drug Administration.

[0252] "Pharmaceutically acceptable carrier" (sometimes referred to as a "carrier") means a carrier or excipient that is useful in preparing a pharmaceutical or therapeutic composition that is generally safe and non-toxic and includes a carrier that is acceptable for veterinary and / or human pharmaceutical or therapeutic use. 'The terms "carrier" or "pharmaceutically acceptable carrier" can include, but are not limited to, phosphate buffered saline solution, water, emulsions (such as an oil / water or water / oil emulsion) and / or various types of wetting agents. As used herein, the term "carrier" encompasses, but is not limited to, any excipient, diluent, filler, salt, buffer, stabilizer, solubilizer, lipid, stabilizer, or other material well known in the ait for use in pharmaceutical formulations and as described further herein.

[0253] As used herein, “pharmaceutically acceptable salt” is a derivative of the disclosed compound in which the parent compound is modified by making inorganic and organic, nontoxic, acid or base addition salts thereof. The salts of the present compounds can be synthesized from a parent compound that contains a basic or acidic moiety by conventional chemical methods. Generally, such salts can be prepared by reacting free acid forms of these compounds with a stoichiometric amount of the appropriate base (such as Na, Ca, Mg, or K hydroxide, carbonate, bicarbonate, or the like), or by reacting free base forms of these compounds with a stoichiometric amount of the appropriate acid. Such reactions are typically carried out in water or in an organic solvent, or in a mixture of the two. Generally, non-aqueous media like ether, ethyl acetate, ethanol, isopropanol, or acetonitrile are typical, where practicable. Salts of the present compounds further include solvates of the compounds and of the compound salts.

[0254] Examples of pharmaceutically acceptable salts include, but are not limited to, mineral or organic acid salts of basic residues such as amines; alkali or organic salts of acidic residues such as carboxylic acids; and the like. The pharmaceutically acceptable salts include the conventional non-toxic salts and the quaternary ammonium salts of the parent compound formed, for example, from non-toxic inorganic or organic acids. For example, conventional non-toxic acid salts include those derived from inorganic acids such as hydrochloric, hydrobromic, sulfuric, sulfamic, phosphoric, nitric and the like; and the salts prepared from organic acids such as acetic, propionic, succinic, glycolic, stearic, lactic, malic, tartaric, citric, ascorbic, palmoic, maleic, hydroxymaleic, phenylacetic, glutamic, benzoic, salicylic, mesylic, esylic, besylic, sulfanilic, 2-acetoxybenzoic, fumaric, toluenesulfonic, methanesulfonic, ethane disulfonic, oxalic, isethionic, HOOC-(CH2)n- COOH where n is 0-4, and the like, or using a different acid that produces the same counterion. Lists of additional suitable salts may be found, e.g., in Remington's Pharmaceutical Sciences, 17th ed„ Mack Publishing Company, Easton, Pa., p. 1418 (1985).

[0255] Also, as used herein, the term “pharmacologically active” (or simply “active”), as in a “pharmacologically active” derivative or analog, can refer to a derivative or analog (e.g., a salt, ester, amide, conjugate, metabolite, isomer, fragment, etc.) having the same type of pharmacological activity as the parent compound and approximately equivalent in degree.

[0256] As used herein, the term “subject” or “host” can refer to living organisms such as mammals, including, but not limited to humans, livestock, dogs, cats, and other mammals. Administration of the therapeutic agents can be carried out at dosages and for periods of time effective for treatment of a subject. In some embodiments, the subject is a human.

[0257] A weight percent (wt.%) of a component, unless specifically stated to the contrary, is based on the total weight of the formulation or composition in which the component is included.

[0258] A “nucleic acid” is a chemical compound that serves as the primary informationcarrying molecules in cells and make up the cellular genetic material. Nucleic acids comprise nucleotides, which are the monomers made of a 5-carbon sugar (usually ribose or deoxyribose), a phosphate group, and a nitrogenous base. A nucleic acid can also be a deoxyribonucleic acid (DNA) or a ribonucleic acid (RNA).

[0259] The terms “percent identity” and “% identity,” as applied to polynucleotide sequences, refer to the percentage of residue matches between at least two polynucleotide sequences aligned using a standardized algorithm. Such an algorithm may insert, in a standardized and reproducible way, gaps in the sequences being compared in order to optimize alignment between two sequences and therefore achieve a more meaningful comparison of the two sequences. Percent identity for a nucleic acid sequence may be determined as understood in the art. (see, e.g., U. S. Pat. No. 7,396,664, which is incorporated herein by reference in its entirety). A suite of commonly used and freely available sequence comparison algorithms is provided by the National Center for Biotechnology Information (NCBI) Basic Local Alignment Search Tool (BLAST) (Altschul, S. F. el al. (1990). J. Mol. Biol. 215:403-410)', which is available from several sources, including the NCBI, Bethesda, Md., at its website. The BLAST software suite includes various sequence analysis programs including “blastn,” that is used to align a known polynucleotide sequence with other polynucleotide sequences from a variety of databases. Also available is a tool called “BLAST 2 Sequences” that is used for direct pairwise comparison of two nucleotide sequences. “BLAST 2 Sequences” can be accessed and used interactively at the NCBI website. The “BIAST 2 Sequences” tool can be used for both blastn and blastp (discussed above).

[0260] Percent identity may be measured over the length of an entire defined polynucleotide sequence or may be measured over a shorter length, for example, over the length of a fragment taken from a larger, defined sequence, for instance, a fragment of at least 20, at least 30, at least 40, at least 50, at least 70, at least 100, or at least 200 contiguous nucleotides. Such lengths are exemplary only, and it is understood that any fragment length may be used to describe a length over which percentage identity may be measured.

[0261] A “full length” polynucleotide sequence is one containing at least a translation initiation codon (e.g., methionine) followed by an open reading frame and a translation termination codon. A “full length” polynucleotide sequence encodes a “full length” polypeptide sequence.

[0262] The terms "deoxyribonucleic acid" and "DNA" as used herein mean a polymer composed of deoxyribonucleotides.

[0263] The term "oligonucleotide" denotes single- or double-stranded nucleotide multimers of from about 2 to up to about 100 nucleotides in length. Suitable oligonucleotides may be prepared by the phosphoramidite method described by Beaucage and Carruthers, Tetrahedron Lett., 22: 1859-1862 ( 1981), or by the triester method according to Matteucci, et al., J. Am. ( hem. Soc., 103:3185 (1981), both incorporated herein by reference, or by other chemical methods using either a commercial automated oligonucleotide synthesizer or VLSIPSTM technology. When oligonucleotides are referred to as "double-stranded," it is understood by those of skill in the art that a pair of oligonucleotides exist in a hydrogen-bonded, helical array typically associated with, for example, DNA. In addition to the 100% complementary form of double-stranded oligonucleotides, the term "double-stranded," as used herein is also meant to refer to those forms which include such structural features as bulges and loops, described more fully in such biochemistry texts as Stryer, Biochemistry, Third Ed., (1988).

[0264] The term "polynucleotide" refers to a single or double stranded polymer composed of nucleotide monomers.

[0265] Reference also is made herein to peptides, polypeptides, proteins, and compositions comprising peptides, polypeptides, and proteins. As used herein, a polypeptide and / or protein is defined as a polymer of amino acids, typically of length>100 amino acids (Garrett & Grisham, Biochemistry, 2nd edition, 1999, Brooks / Cole, 110). A peptide is defined as a short polymer of amino acids, of a length typically of 20 or less amino acids, and more typically of a length of 12 or less amino acids (Garrett & Grisham, Biochemistry, 2nd edition, 1999, Brooks / Cole, 110).

[0266] The peptides, polypeptides, and proteins disclosed herein may be modified to include non-amino acid moieties. Modifications may include but are not limited to carboxylation (e.g., N-terminal carboxylation via addition of a di-carboxylic acid having 4-7 straight-chain or branched carbon atoms, such as glutaric acid, succinic acid, adipic acid, and 4,4-dimethylglutaric acid), amidation (e.g., C -terminal amidation via addition of an amide or substituted amide such as alkylamide or dialkylamide), PEGylation (e.g., N-terminal or C-terminal PEGylation via additional of polyethylene glycol), acylation (e.g., O-acylation (esters), N-acylation (amides), S-acylation (thioesters)), acetylation (e.g., the addition of an acetyl group, either at the N -terminus of the protein or at lysine residues), formylation lipoylation (e.g., attachment of a lipoate, a C8 functional group), myristoylation (e.g., attachment of myristate, a C14 saturated acid), palmitoylation (e.g., attachment of palmitate, a C16 saturated acid), alkylation (e.g., the addition of an alkyl group, such as an methyl at a lysine or arginine residue), isoprenylation or prenylation (e.g., the addition of an isoprenoid group such as farnesol or geranylgeraniol), amidation at C -terminus, glycosylation (e.g., the addition of a glycosyl group to either asparagine, hydroxylysine, serine, or threonine, resulting in a glycoprotein). Distinct from glycation, which is regarded as a nonenzymatic attachment of sugars, polysialylation (e.g., the addition of polysialic acid), glypiation (e.g., glycosylphosphatidylinositol (GPI) anchor formation, hydroxylation, iodination (e.g., of thyroid hormones), and phosphorylation (e.g., the addition of a phosphate group, usually to serine, tyrosine, threonine, or histidine).

[0267] The term “variant” means a polypeptide derived from a parent polypeptide by one or more (several) alteration(s), i.e., a substitution, insertion, and / or deletion, at one or more (several) positions. A substitution means a replacement of an amino acid occupying a position with a different amino acid; a deletion means removal of an amino acid occupying a position; and an insertion means adding 1 or more, such as 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10, preferably 1-3 amino acids immediately adjacent an amino acid occupying a position. In relation to substitutions, ‘immediately adjacent’ may be to the N-side (‘upstream’) or C-side (‘downstream’) of the amino acid occupying a position (‘the named amino acid’). Therefore, for an amino acid named / numbered ‘X,’ the insertion may be at position ‘X+l’ (‘downstream’) or at position ‘X-l’ (‘upstream’).

[0268] A “variant” of a particular polypeptide sequence may be defined as a polypeptide sequence having at least 50% sequence identity to the particular polypeptide sequence over a certain length of one of the polypeptide sequences using blastp with the “BLAST 2 Sequences’’ tool available at the National Center for Biotechnology Information's website, (see Tatiana A. Tatusova, Thomas L. Madden (1999), “Blast 2 sequences — a new tool for comparing protein and nucleotide sequences”, FEMS Microbiol Lett. 174:247-250}. In some embodiments a variant polypeptide may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to a reference polypeptide.

[0269] Variants comprising a fragment of a reference amino acid sequence or nucleotide sequence are contemplated herein. A “fragment” is a portion of an amino acid sequence or a nucleotide sequence which is identical in sequence to but shorter in length than the reference sequence. A fragment may comprise up to the entire length of the reference sequence, minus at least one nucleotide / amino acid residue. For example, a fragment may comprise from 5 to 1000 contiguous nucleotides or contiguous amino acid residues of a reference polynucleotide or reference polypeptide, respectively. In some embodiments, a fragment may comprise at least 5, 10, 15, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 50, 60, 70, 80, 90, 100, 150, 250, or 500 contiguous nucleotides or contiguous amino acid residues of a reference polynucleotide or reference polypeptide, respectively. Fragments may be preferentially selected from certain regions of a molecule, for example the N-terminal region and / or the C -terminal region of a polypeptide or the 5'-terminal region and / or the 3' terminal region of a polynucleotide. The term “at least a fragment” encompasses the full length polynucleotide or full length polypeptide.

[0270] The term “increased” or “increase” as used herein generally means an increase by a statically significant amount; for the avoidance of any doubt, “increased” means an increase of at least 10% as compared to a reference level, for example an increase of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% or up to and including a 100%’ increase or any increase between 10-100% as compared to a reference level, or at least about a 2-fold, or at least about a 3-fold, or at least about a 4-fold, or at least about a 5-fold or at least about a 10-fold increase, or any increase between 2-fold and 10-fold or greater as compared to a reference level.

[0271] The term “reduced”, “reduce”, “reduction”, or “decrease” as used herein generally means a decrease by a statistically significant amount. However, for avoidance of doubt, “reduced” means a decrease by at least 10%’ as compared to a reference level, for example a decrease by at least about 20%. or at least about 30% or at least about 40%, or at least about 50%, or at least about 60? >, or at least about 70%, or at least about 80%, or at least about 90% or up to and including a 100% decrease (i.e. absent level as compared to a reference sample), or any decrease between 10-100% as compared to a reference level.

[0272] The terms “restore” or “restoring” as used herein refer to re-adjusting the levels of one or more markers, for example including but not limited to PNKP activity, to baseline levels prior to a disease or a disorder associated with dysregulation of the one or more markers.

[0273] Compositions for Use

[0274] In one aspect, provided herein is a pharmaceutical composition for use in the treatment of a neurological disorder in a subject in need thereof, wherein the pharmaceutical composition comprises: (a) a therapeutically effective amount of fructose-2, 6-bisphosphate (F2.6BP), or a derivative thereof; and (b) a pharmaceutically acceptable excipient or carrier.

[0275] In some embodiments, the neurological disorder is selected from progressive polyneuropathy, cerebellar atrophy, microcephaly, mild epilepsy, seizures, developmental delay, or intellectual disability. In some embodiments, the neurological disorder comprises decreased PFKFB3 levels, decreased F2,6BP levels, decreased PNKP activity, or a combination thereof. In some embodiments, the neurological disorder is associated with double-strand break (DSB) genome damage. In some embodiments, the neurological disorder comprises a neurodegenerative disease.

[0276] Fructose-2, 6-bisphosphate (F2, 6BP)

[0277] F2,6BP is an endogenous metabolite and well-known, potent activator of glycolysis. When levels of F2,6BP are high, glycolysis is enhanced and gluconeogenesis is inhibited. Alternatively, when F2,6BP levels are low, gluconeogenesis predominates. In some embodiments, F2,6BP is represented by the chemical structure of:

[0278]

[0279] derivative thereof.

[0280] As disclosed herein, F2,6BP potentiates the 3 "-phosphatase activity of polynucleotide kinase 3'-phosphatase (PNKP) (see, e.g., FIG. 2B of Example 1) in a dose-dependent manner (see, e.g., FIG. 3C of Example 1). Polynucleotide Kinase S’-Phosphatase (PNKP)

[0281] PNKP (HGNC: 9154; NCBI Gene: 11284; Ensembl: ENSG00000039650; OMIM®: 605610; UniProtKB / Swiss-Prot: Q96T60) is an essential bifunctional DNA repair endprocessing enzyme with 3'-phosphatase and '-kinase activities. DNA strand breaks generated in a physiological environment, or during DNA base excision repair (BER), result in blocked DNA termini at the break sites that can impede DNA repair and stall elongating RNA polymerases. PNKP is a major 3 '-phosphatase for such blocked DNA termini in mammalian cells and participates in multiple DNA repair pathways, including BER / single-strand break (SSBR) and classical nonhomologous end-joining (C-NHEJ)-mediated DSB repair. PNKP is the major and essential 3 ’-phosphatase end-processing enzyme in mammalian cells, as demonstrated by the neonatal death of mice with an ablated pnkp gene due to a defect in neurogenesis and oligodendrogenesis. Multiple mutations have been mapped to the pnkp gene that are responsible for neurological disorders including severe progressive polyneuropathy, cerebellar atrophy, microcephaly, mild epilepsy, seizures, developmental delay, and intellectual disability.

[0282] 6-Phosphofructo-2-Kinase / Fructose-2, 6-Biphosphatase 3 ( PFKFB3)

[0283] PFKFB (HGNC: 8874; NCBI Gene: 5209; Ensembl: ENSG00000170525; OMIM®: 605319; UniProtKB / Swiss-Prot: Q16875) is a component of the transcription-coupled nonhomologous end-joining (TC-NHEJ) repair complex. PFKFB3 is one of four homodimeric bifunctional enzymes (PFKFB1-4) that can reversibly phosphorylate fructose-6-phosphate (F6P) to fructose-2,6-bisphosphate (F2,6BP). PFKFB3 is the only isoform that translocates to the nucleus.

[0284] In one aspect, provided herein is a pharmaceutical composition for use in the treatment of a neurodegenerative disease in a subject in need thereof, wherein the pharmaceutical composition comprises: (a) a therapeutically effective amount of F2,6BP, or a derivative thereof; and (b) a pharmaceutically acceptable excipient or earner.

[0285] In some embodiments, the neurodegenerative disease is selected from a polyglutamine (polyQ) disease, amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FED), Alzheimer’s disease (AD), Down’s syndrome, Parkinsons disease (PD), a prion disease such as Creutzfeldt-Jakob disease, Lewy body disease, diffuse Lewy body disease (DLBD), Progressive supranuclear palsy (PSP), Fields disease, primary progressive aphasia, multiple system atrophy, pantothenate kinase-associated neurodegeneration (PANK), a spinal degenerative disease and / or motor neuron degenerative disease, hippocampal sclerosis, corticobasal degeneration (CBD), chronic traumatic encephalopathy (CTE), primary lateral sclerosis (PLS), or a combination thereof.

[0286] Amyotrophic lateral sclerosis (ALS)

[0287] In some embodiments, the neurodegenerative disease is amyotrophic lateral sclerosis (ALS). ALS is a progressive motor and cognitive disorder. Although over 100 genes have been associated with ALS, variants of the RNA-binding protein (RBP genes TDP-43 and FUS are associated with familial ALS. Additionally, ALS is associated with the repeat expansion of the hexanucleotide GGGGCC in C9ORF72, which is also linked with frontotemporal dementia (FED). Hallmarks of ALS include TDP-43 aggregation and C9ORF72 RNA deposits. ALS therapy targets symptom management.

[0288] Alzheimer's disease (AD)

[0289] In some embodiments, the neurodegenerative disease is Alzheimer's disease (AD). AD is a dementia that includes progressive memory loss and other worsening behavioral deficits. AD is diagnosed by a combination of clinical assessment and neuropathology examination of beta-amyloid and tau. AD symptoms are treated using cholinesterase inhibitors (donepezil (ARICEPT®; ADLARITY®), galantamine and rivastigmine transdermal patch (EXELON®), as well as memantine (NAMENDA®), or a combination thereof. Anti-beta amyloid antibody therapies for the treatment of AD have recently been approved and include lecanemab-irmb (LEQEMBI®) and donanemab-azbt (KISUNLA™). In some embodiments, the compositions and methods disclosed herein are administered in combination with one or more approved therapies for the treatment of AD.

[0290] In one aspect, provided herein is a pharmaceutical composition for use in the treatment of a proteinopathy in a subject in need thereof, wherein the pharmaceutical composition comprises: (a) a therapeutically effective amount of F2,6BP, or a derivative thereof; and (b) a pharmaceutically acceptable excipient or carrier.

[0291] In one aspect, provided herein is a pharmaceutical composition for use in the treatment of a polyglutamine (polyQ) disease, wherein the pharmaceutical composition comprises: (a) a therapeutically effective amount of F2,6BP, or a derivative thereof; and (b) a pharmaceutically acceptable excipient or carrier. In some embodiments, the polyQ disease is selected from dentatorubral pallidoluysian atrophy (DRPLA or Haw-River syndrome), Huntington’s disease (HD), spinal and bulbar muscular atrophy (SBMA or Kennedy disease), Spinocerebellar ataxia (SCA) type 1, SCA type 2 (SCA2), SCA type 3 (SCA3 or Machado-Joseph disease), SCA type 6 (SCA6), SCA type 7 (SCA7), or SCA type 17 (SCA17).

[0292] Huntington’s disease (HD)

[0293] In some embodiments, the polyQ disease is Huntington’s disease (HD). HD is a progressive motor and cognitive disorder having an early age onset (between 35 to 44 years of age). HD is diagnosed by identifying expansion of 36 or more CAG repeats in HTT by molecular testing. By comparison, the normal length of CAG repeats in HD is between 27 to 35 CAG repeats. HD therapy includes neuroleptics (e.g., haloperidol), atypical neuroleptics (e.g., olanzapine), benzodiazepines, a monoamine-depleting agent for choreic movementste.g., tetrabenazine), anti-parkinsonian agents for hypokinesia and rigidity; psychotropic drugs, antiseizure medication for psychiatric disturbances, or valproic acid for myoclonic hyperkinesia. In some embodiments, the compositions and methods disclosed herein are administered in combination with one or more approved therapies for the treatment of HD.

[0294] Spinocerebellar ataxia type 3 (SCA3; Machado- Joseph disease (MJD))

[0295] In some embodiments, the polyQ disease is Spinocerebellar ataxia type 3 (SCA3). SCA3 is characterized by progressive cerebellar ataxia and a variety of neurological findings including but not limited to pyramidal signs, a dystonic-rigid extrapy rami dal syndrome, significant peripheral amyotrophy and generalized areflexia, progressive external ophthalmoplegia, action-induced facial and lingual fasciculations; bulging eyes. SCA3 is inherited in an autosomal dominant manner, and is diagnosed by identifying CAG repeat expansion in ATXN3 identified by molecular genetic testing. The normal length of CAG repeats is between 12-44 CAG repeats.

[0296] In some embodiments, the F2,6BP is exogenous F2,6BP.

[0297] In some embodiments, the pharmaceutically acceptable carrier comprises a carrier peptide. In some embodiments, the carrier peptide comprises a brain-specific carrier peptide. In some embodiments, the brain-specific carrier peptide comprises a K16ApoE carrier peptide.

[0298] The F2,6BP compounds or derivatives thereof disclosed herein and as used in the methods described herein can be administered by any suitable method and technique presently or prospectively known to those skilled in the art. For example, the active components described herein can be formulated in a physiologically- or pharmaceutically-acceptable form and administered by any suitable route known in the ait including, for example, oral and parenteral routes of administering. As used herein, the term “parenteral” includes subcutaneous, intradermal, intravenous, intramuscular, intraperitoneal, and intrasternal administration, such as by injection. Administration of the active components of their compositions can be a single administration, or at continuous and distinct intervals as can be readily determined by a person skilled in the art.

[0299] Compositions, as described herein, comprising an active ingredient F2,6BP, or a derivative thereof, as disclosed herein and a pharmaceutically acceptable carrier or excipient of some sort may be useful in a variety of medical and non-medical applications. For example, pharmaceutical compositions comprising an active F2,6BP compound, or a derivative thereof, and an excipient may be useful for the treatment or prevention of a neurological disorder in a subject in need thereof.

[0300] "Pharmaceutically acceptable carrier" (sometimes referred to as a "carrier") means a carrier or excipient that is useful in preparing a pharmaceutical or therapeutic composition that is generally safe and non-toxic and includes a carrier that is acceptable for veterinary and / or human pharmaceutical or therapeutic use. The terms "carrier" or "pharmaceutically acceptable carrier" can include, but are not limited to, phosphate buffered saline solution, water, emulsions (such as an oil / water or water / oil emulsion) and / or various types of wetting agents. As used herein, the term "carrier" encompasses, but is not limited to, any excipient, diluent, filler, salt, buffer, stabilizer, solubilizer, lipid, stabilizer, or other material well known in the art for use in pharmaceutical formulations and as described further herein.

[0301] “Excipients” include any and all solvents, diluents or other liquid vehicles, dispersion or suspension aids, surface active agents, isotonic agents, thickening or emulsifying agents, preservatives, solid binders, lubricants and the like, as suited to the particular dosage form desired. General considerations in formulation and / or manufacture can be found, for example, in Remington's Pharmaceutical Sciences, Sixteenth Edition, E. W. Martin (Mack Publishing Co., Easton, Pa., 1980), and Remington: The Science and Practice of Pharmacy, 21st Edition (Lippincott Williams & Wilkins, 2005).

[0302] Exemplary excipients include, but are not limited to, any non-toxic, inert solid, semisolid or liquid filler, diluent, encapsulating material or formulation auxiliary of any type. Some examples of materials which can serve as excipients include, but are not limited to, sugars such as lactose, glucose, and sucrose; starches such as com starch and potato starch; cellulose and its derivatives such as sodium carboxymethyl cellulose, ethyl cellulose, and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients such as cocoa butter and suppository waxes; oils such as peanut oil, cottonseed oil; safflower oil; sesame oil; olive oil; com oil and soybean oil; glycols such as propylene glycol; esters such as ethyl oleate and ethyl laurate; agar; detergents such as Tween 80; buffering agents such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ringer's solution; ethyl alcohol; and phosphate buffer solutions, as well as other non-toxic compatible lubricants such as sodium lauryl sulfate and magnesium stearate, as well as coloring agents, releasing agents, coaling agents, sweetening, flavoring and perfuming agents, preservatives and antioxidants can also be present in the composition, according to the judgment of the fomiulator. As would be appreciated by one of skill in this art, the excipients may be chosen based on what the composition is useful for. For example, with a pharmaceutical composition or cosmetic composition, the choice of the excipient will depend on the route of administration, the agent being delivered, time course of delivery of the agent, etc., and can be administered to humans and / or to animals, orally, rectally, parenterally, intracisternally, intravaginally, intranasally, intraperitoneally, topically (as by powders, creams, ointments, or drops), buccally, or as an oral or nasal spray. In some embodiments, the active compounds disclosed herein are administered topically.

[0303] Exemplary diluents include calcium carbonate, sodium carbonate, calcium phosphate, dicalcium phosphate, calcium sulfate, calcium hydrogen phosphate, sodium phosphate lactose, sucrose, cellulose, microcrystalline cellulose, kaolin, mannitol, sorbitol, inositol, sodium chloride, dry starch, cornstarch, powdered sugar, etc., and combinations thereof.

[0304] Exemplary granulating and / or dispersing agents include potato starch, corn starch, tapioca starch, sodium starch glycolate, clays, alginic acid, guar gum, citrus pulp, agar, bentonite, cellulose and wood products, natural sponge, cation-exchange resins, calcium carbonate, silicates, sodium carbonate, cross-linked poly(vinyl-pyrrolidone) (crospovidone), sodium carboxymethyl starch (sodium starch glycolate), carboxymethyl cellulose, crosslinked sodium carboxymethyl cellulose (croscarmeliose), methylcellulose, pregelatinized starch (starch 1500), microcrystalline starch, water insoluble starch, calcium carboxymethyl cellulose, magnesium aluminum silicate (Veegum), sodium lauryl sulfate, quaternary ammonium compounds, etc., and combinations thereof.

[0305] Exemplary surface active agents and / or emulsifiers include natural emulsifiers (e.g. acacia, agar, alginic acid, sodium alginate, tragacanth, chondrux, cholesterol, xanthan, pectin, gelatin, egg yolk, casein, wool fat, cholesterol, wax, and lecithin), colloidal clays (e.g. bentonite [aluminum silicate] and Veegum [magnesium aluminum silicate]), long chain amino acid derivatives, high molecular weight alcohols (e.g. stearyl alcohol, cetyl alcohol, oleyl alcohol, triacetin monostearate, ethylene glycol distearate, glyceryl monostearate, and propylene glycol monostearate, polyvinyl alcohol), carbomers (e.g. carboxy polymethylene, polyacrylic acid, acrylic acid polymer, and carboxy vinyl polymer), carrageenan, cellulosic derivatives (e.g. carboxymethylcellulose sodium, powdered cellulose, hydroxymethyl cellulose, hydroxypropyl cellulose, hydroxypropyl methylcellulose, methylcellulose), sorbitan fatty acid esters (e.g. polyoxyethylene sorbitan monolaurate [Tween 20], polyoxyethylene sorbitan [Tween 60], polyoxyethylene sorbitan monooleate [Tween 80], sorbitan monopalmitate [Span 40], sorbitan monostearate [Span 60], sorbitan tristearate [Span 65], glyceryl monooleate, sorbitan monooleate [Span 80]), polyoxyethylene esters (e.g. polyoxyethylene monostearate [Myrj 45], polyoxyethylene hydrogenated castor oil, polyethoxylated castor oil, polyoxymethylene stearate, and Solutol), sucrose fatty acid esters, polyethylene glycol fatty acid esters (e.g. Cremophor), polyoxyethylene ethers, (e.g. polyoxyethylene lauryl ether [Brij 30]), poly( vinylpyrrolidone), diethylene glycol monolaurate, triethanolamine oleate, sodium oleate, potassium oleate, ethyl oleate, oleic acid, ethyl laurate, sodium lauryl sulfate, Pluronic F 68, Poloxamer 188, cetrimonium bromide, cetylpyridinium chloride, benzalkonium chloride, docusate sodium, etc. and / or combinations thereof. Exemplary binding agents include starch (e.g. cornstarch and starch paste), gelatin, sugars (e.g. sucrose, glucose, dextrose, dextrin, molasses, lactose, lactitol, mannitol, etc.), natural and synthetic gums (e.g. acacia, sodium alginate, extract of Irish moss, panwar gum, ghatti gum, mucilage of isapol husks, carboxymethylcellulose, methylcellulose, ethylcellulose, hydroxyethylcellulose, hydroxypropyl cellulose, hydroxypropyl methylcellulose, microcrystalline cellulose, cellulose acetate, poly(vinyl-pyrrolidone), magnesium aluminum silicate (Veegum), and larch arabogalactan), alginates, polyethylene oxide, polyethylene glycol, inorganic calcium salts, silicic acid, polymethacrylates, waxes, water, alcohol, etc., and / or combinations thereof.

[0306] Exemplary preservatives include antioxidants, chelating agents, antimicrobial preservatives, antifungal preservatives, alcohol preservatives, acidic preservatives, and other preservatives.

[0307] Exemplary antioxidants include alpha tocopherol, ascorbic acid, ascorbyl palmitate, butylated hydroxyanisole, butylated hydroxytoluene, monothioglycerol, potassium metabisulfite, propionic acid, propyl gallate, sodium ascorbate, sodium bisulfite, sodium metabisulfite, and sodium sulfite. Exemplary chelating agents include ethylenediaminetetraacetic acid (EDTA) and salts and hydrates thereof (e.g., sodium edetate, disodium edetate, trisodium edetate, calcium disodium edetate, dipotassium edetate, and the like), citric acid and salts and hydrates thereof (e.g., citric acid monohydrate), fumaric acid and salts and hydrates thereof, malic acid and salts and hydrates thereof, phosphoric acid and salts and hydrates thereof, and tartaric acid and salts and hydrates thereof. Exemplary antimicrobial preservatives include benzalkonium chloride, benzethonium chloride, benzyl alcohol, bronopol, cetrimide, cetylpyridinium chloride, chlorhexidine, chlorobutanol, chlorocresol, chloroxylenol, cresol, ethyl alcohol, glycerin, hexetidine, imidurea, phenol, phenoxyethanol, phenylethyl alcohol, phenylmercuric nitrate, propylene glycol, and thimerosal.

[0308] Exemplary antifungal preservatives include butyl paraben, methyl paraben, ethyl paraben, propyl paraben, benzoic acid, hydroxybenzoic acid, potassium benzoate, potassium sorbate, sodium benzoate, sodium propionate, and sorbic acid.

[0309] Exemplary alcohol preservatives include ethanol, polyethylene glycol, phenol, phenolic compounds, bisphenol, chloro butanol, hydroxybenzoate, and phenylethyl alcohol.

[0310] Exemplary acidic preservatives include vitamin A, vitamin C, vitamin E, beta- carotene, citric acid, acetic acid, dehydroacetic acid, ascorbic acid, sorbic acid, and phytic acid. Other preservatives include tocopherol, tocopherol acetate, deteroxime mesylate, cetrimide, butylated hydroxyanisol (BHA), butylated hydroxy toluene (BHT), ethylenediamine, sodium lauryl sulfate (SLS), sodium lauryl ether sulfate (SEES), sodium bisulfite, sodium metabisulfite, potassium sulfite, potassium metabisulfite, Glydant Plus, Phenonip, methylparaben, Germall 115, Germaben II, NeoIone, Kathon, and Euxyl. In certain embodiments, the preservative is an anti-oxidant. In other embodiments, the preservative is a chelating agent.

[0311] Exemplary buffering agents include citrate buffer solutions, acetate buffer solutions, phosphate buffer solutions, ammonium chloride, calcium carbonate, calcium chloride, calcium citrate, calcium glubionate, calcium gluceptate, calcium gluconate, D-gluconic acid, calcium glycerophosphate, calcium lactate, propanoic acid, calcium levulinate, pentanoic acid, dibasic calcium phosphate, phosphoric acid, tribasic calcium phosphate, calcium hydroxide phosphate, potassium acetate, potassium chloride, potassium gluconate, potassium mixtures, dibasic potassium phosphate, monobasic potassium phosphate, potassium phosphate mixtures, sodium acetate, sodium bicarbonate, sodium chloride, sodium citrate, sodium lactate, dibasic sodium phosphate, monobasic sodium phosphate, sodium phosphate mixtures, tromethamine, magnesium hydroxide, aluminum hydroxide, alginic acid, pyrogen- free water, isotonic saline, Ringer's solution, ethyl alcohol, etc., and combinations thereof. Exemplary lubricating agents include magnesium stearate, calcium stearate, stearic acid, silica, talc, mall, glyceryl behanate, hydrogenated vegetable oils, polyethylene glycol, sodium benzoate, sodium acetate, sodium chloride, leucine, magnesium lauryl sulfate, sodium lauryl sulfate, etc., and combinations thereof.

[0312] Exemplary natural oils include almond, apricot kernel, avocado, babassu, bergamot, black current seed, borage, cade, chamomile, canola, caraway, carnauba, castor, cinnamon, cocoa butter, coconut, cod liver, coffee, corn, cotton seed, emu, eucalyptus, evening primrose, fish, flaxseed, geraniol, gourd, grape seed, hazel nut, hyssop, isopropyl myristate, jojoba, kukui nut, lavandin, lavender, lemon, litsea cubeba, macademia nut, mallow, mango seed, meadowfoam seed, mink, nutmeg, olive, orange, orange roughy, palm, palm kernel, peach kernel, peanut, poppy seed, pumpkin seed, rapeseed, rice bran, rosemary, safflower, sandalwood, sasquana, savoury, sea buckthorn, sesame, shea butler, silicone, soybean, sunflower, tea tree, thistle, tsubaki, vetiver, walnut, and wheat germ oils. Exemplary synthetic oils include, but are not limited to, butyl stearate, caprylic triglyceride, capric triglyceride, cyclomethicone, diethyl sebacate, dimetliicone 360, isopropyl myristate, mineral oil, octyldodecanol, oleyl alcohol, silicone oil, and combinations thereof.

[0313] Additionally, the composition may further comprise a polymer. Exemplary polymers contemplated herein include, but are not limited to, cellulosic polymers and copolymers, for example, cellulose ethers such as methylcellulose (MC), hydroxyethylcellulose (HEC), hydroxypropyl cellulose (HPC), hydroxypropyl methyl cellulose (HPMC), methylhydroxyethylcellulose (MHEC), methylhydroxypropylcellulose (MHPC), carboxymethyl cellulose (CMC) and its various salts, including, e.g., the sodium sail, hydroxyethylcarboxymethylcellulose (HECMC) and its various salts, carboxymethylhydroxyethylcellulose (CMHEC) and its various salts, other polysaccharides and polysaccharide derivatives such as starch, dextran, dextran derivatives, chitosan, and alginic acid and its various sails, carageenan, varoius gums, including xanthan gum, guar gum, gum arabic, gum karaya, gum ghatti, konjac and gum tragacanth, glycosaminoglycans and proteoglycans such as hyaluronic acid and its salts, proteins such as gelatin, collagen, albumin, and fibrin, other polymers, for example, polyhydroxyacids such as polylactide, polyglycolide, polyl(lactide-co-glycolide) and poly(.epsilon.-caprolactone-co-glycolide)-, carboxyvinyl polymers and their salts (e.g., carbomer), polyvinylpyrrolidone (PVP), polyacrylic acid and its salts, polyacrylamide, polyacrylic acid / acrylamide copolymer, polyalkylene oxides such as polyethylene oxide, polypropylene oxide, polyethylene oxide- propylene oxide), and a Pluronic polymer, polyoxy ethylene (polyethylene glycol), polyanhydrides, polyvinylalchol, polyethyleneamine and polypyrridine, polyethylene glycol (PEG) polymers, such as PEGylated lipids (e.g., PEG-stearate, l,2-Disiearoyl-sn-glycero-3-Phosphoethanolamine-N-[Methoxy(Polyethylene glycol)- 1000], l,2-Distearoyl-sn-glycero-3-Phosphoethanolamine-N-[Methoxy(Polyethylene glycol)-2000], and l,2-Distearoyl-sn-glycero-3-Phosphoethanolamine-N-[Methoxy(Polyethylene glycol)-5000J), copolymers and salts thereof.

[0314] Additionally, the composition may further comprise an emulsifying agent. Exemplary emulsifying agents include, but are not limited to, a polyethylene glycol (PEG), a polypropylene glycol, a polyvinyl alcohol, apoly-N-vinyl pyrrolidone and copolymers thereof, poloxamer nonionic surfactants, neutral water-soluble polysaccharides (e.g., dextran, Ficoll, celluloses), non-cationic poly(meth)acrylates, non-cationic polyacrylates, such as poly (meth) acrylic acid, and esters amide and hydroxy alkyl amides thereof, natural emulsifiers (e.g. acacia, agar, alginic acid, sodium alginate, tragacanth, chondrux, cholesterol, xanthan, pectin, gelatin, egg yolk, casein, wool fat, cholesterol, wax, and lecithin), colloidal clays (e.g. bentonite [aluminum silicate] and Veegum [magnesium aluminum silicate]), long chain amino acid derivatives, high molecular weight alcohols (e.g. stearyl alcohol, cetyl alcohol, oleyl alcohol, triacetin monostearate, ethylene glycol distearate, glyceryl monostearate, and propylene glycol monostearate, polyvinyl alcohol), carbomers (e.g. carboxy polymethylene, polyacrylic acid, acrylic acid polymer, and carboxy vinyl polymer), carrageenan, cellulosic derivatives (e.g. carboxymethylcellulose sodium, powdered cellulose, hydroxymethyl cellulose, hydroxypropyl cellulose, hydroxypropyl methylcellulose, methylcellulose), sorbitan fatty acid esters (e.g. polyoxyethylene sorbitan monolaurate [Tween 20], polyoxyethylene sorbitan [Tween 60], polyoxyethylene sorbitan monooleate [Tween 80], sorbitan monopalmitate [Span 40], sorbitan monostearate [Span 60], sorbitan tristearate [Span 65], glyceryl monooleate, sorbitan monooleate [Span 80]), polyoxyethylene esters (e.g. polyoxyethylene monostearate [Myrj 45], polyoxyethylene hydrogenated castor oil, polyethoxylated castor oil, polyoxymethylene stearate, and Solutol), sucrose fatty acid esters, polyethylene glycol fatty acid esters (e.g. Cremophor), polyoxyethylene ethers, (e.g. polyoxyethylene lauryl ether [Brij 30]), poly( vinylpyrrolidone), diethylene glycol monolaurate, triethanolamine oleate, sodium oleate, potassium oleate, ethyl oleate, oleic acid, ethyl laurate, sodium lauryl sulfate, Pluronic F 68, Poloxamer 188, cetrimonium bromide, cetylpyridinium chloride, benzalkonium chloride, docusate sodium, etc. and / or combinations thereof. In certain embodiments, the emulsifying agent is cholesterol. Liquid compositions include emulsions, microemulsions, solutions, suspensions, syrups, and elixirs. In addition to the active compound, the liquid composition may contain inert diluents commonly used in the ait such as, for example, water or other solvents, solubilizing agents and emulsifiers such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, dimethylformamide, oils (in particular, cottonseed, groundnut, corn, germ, olive, castor, and sesame oils), glycerol, tetrahydrofurfuryl alcohol, polyethylene glycols and fatty acid esters of sorbitan, and mixtures thereof. Besides inert diluents, the oral compositions can also include adjuvants such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, and perfuming agents.

[0315] Injectable compositions, for example, injectable aqueous or oleaginous suspensions may be formulated according to the known art using suitable dispersing or wetting agents and suspending agents. The sterile injectable preparation may also be a injectable solution, suspension, or emulsion in a nontoxic parenterally acceptable diluent or solvent, for example, as a solution in 1,3 -butanediol. Among the acceptable vehicles and solvents for pharmaceutical or cosmetic compositions that may be employed are water, Ringer's solution, U. S. P. and isotonic sodium chloride solution. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium. Any bland fixed oil can be employed including synthetic mono- or diglycerides. In addition, fatty acids such as oleic acid are used in the preparation of injectables. In certain embodiments, the particles are suspended in a carrier fluid comprising 1% (w / v) sodium carboxymethyl cellulose and 0.1% (v / v) Tween 80. The injectable composition can be sterilized, for example, by filtration through a bacteria-retaining filter, or by incorporating sterilizing agents in the form of sterile solid compositions which can be dissolved or dispersed in sterile water or other sterile injectable medium prior to use.

[0316] Compositions for rectal or vaginal administration may be in the form of suppositories which can be prepared by mixing the particles with suitable non-irritating excipients or carriers such as cocoa butter, polyethylene glycol, or a suppository wax which are solid at ambient temperature but liquid at body temperature and therefore melt in the rectum or vaginal cavity and release the particles.

[0317] Solid compositions include capsules, tablets, pills, powders, and granules. In such solid compositions, the particles are mixed with at least one excipient and / or a) fillers or extenders such as starches, lactose, sucrose, glucose, mannitol, and silicic acid, b) binders such as, for example, carboxymethylcellulose, alginates, gelatin, polyvinylpyrrolidinone, sucrose, and acacia, c) humectants such as glycerol, d) disintegrating agents such as agar- agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate, e) solution retarding agents such as paraffin, f) absorption accelerators such as quaternary ammonium compounds, g) wetting agents such as, for example, cetyl alcohol and glycerol monostearate, h) absorbents such as kaolin and bentonite clay, and i) lubricants such as talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, and mixtures thereof. In the case of capsules, tablets, and pills, the dosage form may also comprise buffering agents. Solid compositions of a similar' type may also be employed as fillers in soft and hard- filled gelatin capsules using such excipients as lactose or milk sugar as well as high molecular weight polyethylene glycols and the like.

[0318] Tablets, capsules, pills, and granules can be prepared with coatings and shells such as enteric coatings and other coatings well known in the pharmaceutical formulating art. They may optionally contain opacifying agents and can also be of a composition that they release the active ingredient(s) only, or preferentially, in a certain part of the intestinal tract, optionally, in a delayed manner. Examples of embedding compositions which can be used include polymeric substances and waxes. Solid compositions of a similar type may also be employed as fillers in soft and hard- filled gelatin capsules using such excipients as lactose or milk sugar as well as high molecular' weight polyethylene glycols and the like.

[0319] Compositions for topical or transdemial administration include ointments, pastes, creams, lotions, gels, powders, solutions, sprays, inhalants, or patches. The active compound is admixed with an excipient and any needed preservatives or buffers as may be required.

[0320] The ointments, pastes, creams, and gels may contain, in addition to the active compound, excipients such as animal and vegetable fats, oils, waxes, paraffins, starch, tragacanth, cellulose derivatives, polyethylene glycols, silicones, bentonites, silicic acid, talc, and zinc oxide, or mixtures thereof.

[0321] Powders and sprays can contain, in addition to the active compound, excipients such as lactose, talc, silicic acid, aluminum hydroxide, calcium silicates, and polyamide powder, or mixtures of these substances. Sprays can additionally contain customary propellants such as chlorofluorohydrocarbons.

[0322] Transdermal patches have the added advantage of providing controlled delivery of a compound to the body. Such dosage forms can be made by dissolving or dispensing the nanoparticles in a proper medium. Absorption enhancers can also be used to increase the flux of the compound across the skin. The rate can be controlled by either providing a rate controlling membrane or by dispersing the particles in a polymer matrix or gel. The active ingredient F2,6BP, or a derivative thereof, as disclosed herein may be administered in such amounts, lime, and route deemed necessary in order to achieve the desired result. The exact amount of the active ingredient will vary from subject to subject, depending on the species, age, and general condition of the subject, the severity of the medical disorder, the particular active ingredient, its mode of administration, its mode of activity, and the like. The active ingredient, whether the active compound itself, or the active compound in combination with an agent, is preferably formulated in dosage unit form for ease of administration and uniformity of dosage. It will be understood, however, that the total daily usage of the active ingredient will be decided by the attending physician within the scope of sound medical judgment. The specific therapeutically effective dose level for any particular subject will depend upon a variety of factors including the disorder being treated and the severity of the disorder; the activity' of the active ingredient employed; the specific composition employed; tire age, body weight, general health, sex and diet of the patient; the time of administration, route of administration, and rate of excretion of the specific active ingredient employed; tire duration of the treatment; drugs used in combination or coincidental with the specific active ingredient employed; and like factors well known in the medical arts.

[0323] The active ingredient F2,6BP, or a derivative thereof, as disclosed herein may be administered by any route. In some embodiments, the active ingredient is administered via a variety of routes, including oral, intravenous, intramuscular, intra-arterial, intramedullary, intrathecal, subcutaneous, intraventricular, transdermal, interdermal, rectal, intravaginal, intraperitoneal, topical (as by powders, ointments, creams, and / or drops), mucosal, nasal, bucal, enteral, sublingual; by intratracheal instillation, bronchial instillation, and / or inhalation; and / or as an oral spray, nasal spray, and / or aerosol. In general, the most appropriate route of administration will depend upon a variety of factors including the nature of the active ingredient (e.g., its stability in the environment of the gastrointestinal tract), the condition of the subject (e.g., whether the subject is able to tolerate oral administration), etc. In some embodiments, the active ingredient is administered via a nasal route, including but not limited to by a nasal spray.

[0324] The exact amount of the active ingredient F2, 6BP, or a derivative thereof, as disclosed herein required to achieve a therapeutically or prophylactically effective amount will vary from subject to subject, depending on species, age, and general condition of a subject, severity of the side effects or disorder, identity of the particular compound(s), mode of administration, and the like. The amount to be administered to, for example, a child or an adolescent can be determined by a medical practitioner or person skilled in the art and can be lower or the same as that administered to an adult.

[0325] Useful dosages of the active agents and pharmaceutical compositions disclosed herein can be determined by comparing their in vitro activity, and in vivo activity in animal models. Methods for the extrapolation of effective dosages in mice, and other animals, to humans are known to the art.

[0326] The dosage ranges for the administration of the compositions are those large enough to produce the desired effect in which the symptoms or disorder are affected. The dosage should not be so large as to cause adverse side effects, such as unwanted cross-reactions, anaphylactic reactions, and the like. Generally, the dosage will vary with the age, condition, sex and extent of the disease in the patient and can be determined by one of skill in the art. The dosage can be adjusted by the individual physician in the event of any counterindications. Dosage can vary, and can be administered in one or more dose administrations daily, for one or several days.

[0327] Methods

[0328] In one aspect, provided herein is a method of treating a neurological disorder in a subject in need thereof, comprising administering to the subject a pharmaceutical composition comprising: (a) a therapeutically effective amount of fructose-2,6-bisphosphate (F2,6BP), or a derivative thereof; and (b) a pharmaceutically acceptable excipient or carrier. In some embodiments, the neurological disorder comprises decreased PFKFB3 levels, decreased F2,6BP levels, decreased PNKP activity, or a combination thereof, relative to an appropriate control. In some embodiments, the neurological disorder is associated with double-strand break (DSB) genome damage.

[0329] In some embodiments, the neurological disorder is selected from progressive polyneuropathy, cerebellar atrophy, microcephaly, mild epilepsy, seizures, developmental delay, or intellectual disability.

[0330] In some embodiments, the neurological disorder comprises a neurodegenerative disease.

[0331] In one aspect, provided herein is a method of treating a neurodegenerative disease in a subject in need thereof, comprising administering to the subject a pharmaceutical composition comprising: (a) a therapeutically effective amount of F2,6BP, or a derivative thereof; and (b) a pharmaceutically acceptable excipient or carrier.

[0332] In some embodiments, the neurodegenerative disease is selected from a polyglutamine (polyQ) disease, amyotrophic lateral sclerosis (ATS), frontotemporal dementia (FTD), Alzheimer’s disease (AD), Down’s syndrome, Parkinsons disease (PD), a prion disease such as Creutzfeldt- Jakob disease, Lewy body disease, diffuse Lewy body disease (DLBD), Progressive supranuclear palsy (PSP), Fields disease, primary progressive aphasia, multiple system atrophy, pantothenate kinase-associated neurodegeneration (PANK), a spinal degenerative disease and / or motor neuron degenerative disease, hippocampal sclerosis, corticobasal degeneration (CBD), chronic traumatic encephalopathy (CTE), primary lateral sclerosis (PLS), or a combination thereof. In some embodiments, the ALS comprises rapidonset ALS or Guamanian- ALS. In some embodiments, the neurodegenerative disease comprises apolyglutamine (polyQ) disease.

[0333] In one aspect, provided herein is a method of treating a polyglutamine (polyQ) disease in a subject in need thereof, comprising administering to the subject a pharmaceutical composition comprising: (a) a therapeutically effective amount of F2,6BP, or a derivative thereof; and (b) a pharmaceutically acceptable excipient or carrier.

[0334] In some embodiments, the polyQ disease is selected from dentatorubral pallidoluysian atrophy (DRPLA or Haw-River syndrome), Huntington’s disease (HD), spinal and bulbar muscular atrophy (SBMA or Kennedy disease), Spinocerebellar ataxia (SCA) type 1, SCA type 2 (SCA2), SCA type 3 (SCA3 or Machado-Joseph disease), SCA type 6 (SCA6), SCA type 7 (SCA7), or SCA type 17 (SCA17). In some embodiments, the polyQ disease is Huntington’s disease (HD) or Spinocerebellar ataxia type 3 (SCA3).

[0335] In one aspect, provided herein is a method of treating Huntington’s disease (HD) in a subject in need thereof, comprising administering to the subject a pharmaceutical composition comprising: (a) a therapeutically effective amount of F2,6BP, or a derivative thereof; and (b) a pharmaceutically acceptable excipient or carrier.

[0336] In one aspect, provided herein is a method of treating Spinocerebellar ataxia type 3 (SCA3) in a subject in need thereof, comprising administering to the subject a pharmaceutical composition comprising: (a) a therapeutically effective amount of F2,6BP, or a derivative thereof; and (b) a pharmaceutically acceptable excipient or carrier.

[0337] In one aspect, provided herein is a method of treating a proteinopathy in a subject in need thereof, comprising administering to the subject a pharmaceutical composition comprising: (a) a therapeutically effective amount of F2,6BP, or a derivative thereof; and (b) a pharmaceutically acceptable excipient or carrier.

[0338] In some embodiments, the proteinopathy is selected from chronic wasting disease (CWD), Cruzefeldt- Jakob Disease (CJD), transmissible mink encephalopathy, feline spongiform encephalopathy, ungulate spongiform encephalopathy, bovine-spongiform encephalapothy, camilid spongiform encephalopathy, pituitary pars intermedia dysfunction (PPID), Alzheimer's Disease (AD), Parkinson's Disease (PD), Pick’s disease, Lewy body dementia (LBD), amyotrophic lateral sclerosis (ALS), multiple systems atrophies, progressive supranuclear palsy (PSP), corticobasai degenerations (CBD), and chronic traumatic encephalopathy (CTE).

[0339] In some embodiments, the proteinopathy comprises a tauopathy. In some embodiments, the tauopathy is selected from Alzheimer’s disease (AD), corticobasai degeneration (CBD), chronic traumatic encephalopathy (CTE), Amyotrophic lateral sclerosis (ALS), Frontotemporal dementia (FTD), Frontotemporal dementia with Parkinsonism linked to chromosome 17 (FTDP-17), Niemann-Pick disease, Pick’s disease, or progressive supranuclear palsy (PSP).

[0340] In some embodiments, the proteinopathy comprises mislocalization, aggregation, or aberrant post-translational modification (PTM) of TAR DNA-binding protein 43 (TDP-43).

[0341] In some embodiments, the proteinopathy comprises mislocalization, aggregation, or aberrant post-translational modification (PTM) of amyloid-P and / or tau.

[0342] In some embodiments, the proteinopathy comprises mislocalization, aggregation, or aberrant post-translational modification (PTM) of a-synuclein.

[0343] In some embodiments, the proteinopathy comprises decreased polynucleotide kinase 3 ’-phosphatase (PNKP) activity relative to a control.

[0344] In one aspect, provided herein is a method of increasing or restoring PNKP activity in a cell, or a population thereof, comprising contacting the cell with an effective amount of F2,6BP, or a derivative thereof. In some embodiments, the PNKP activity is 3 ’-phosphatase activity.

[0345] In some embodiments, the method increases nuclear DNA genome integrity. In some embodiments, the PNKP activity comprises mitochondrial PNKP activity. In some embodiments, the method increases mitochondrial DNA genome integrity.

[0346] In one aspect, provided herein is a method of improving or increasing DNA repair in a cell, or a population thereof, comprising contacting the cell with an effective amount of F2,6BP, or a derivative thereof.

[0347] In one aspect, provided herein is a method of reducing accumulation of double strand break (DSB) of DNA in a cell, or a population thereof, comprising contacting the cell with an effective amount of F2,6BP, or a derivative thereof. In some embodiments, the DSB accumulation comprises increased levels of yII2Ax and / or p53BPl. In some embodiments, the method reduces yH2Ax and / or p53BPl levels. In one aspect, provided herein is a method of reducing accumulation of transcription-coupled-nonhomologous end-joining (TC-NHEJ) defects in a cell, or a population thereof, comprising contacting the cell with an effective amount of F2,6BP, or a derivative thereof. In some embodiments, the DSB accumulation comprises increased levels of yH2Ax and / or p53BPl. In some embodiments, the method reduces yH2Ax and / or p53BPl levels.

[0348] In one aspect, provided herein is a method of increasing viability of cell, or a population thereof, having decreased levels of PFKFB3 and / or decreased PNKP activity and / or decreased levels of F2,6BP, comprising contacting the cell with an effective amount of F2,6BP, or a derivative thereof.

[0349] In one aspect, provided herein is a method of reducing or reversing genome damage in a cell, or a population thereof, in a subject in need thereof, comprising contacting the cell with an effective amount of F2,6BP, or a derivative thereof. In some embodiments, the genome damage comprises nuclear genome damage. In some embodiments, the genome damage comprises mitochondrial genome damage. In some embodiments, the DNA damage is oxidative stress-induced.

[0350] In one aspect, provided herein is a method of restoring or increasing mitochondrial membrane potential and / or respiration and / or retrograde signaling in a cell, or a population thereof, in a subject in need thereof, comprising contacting the cell with an effective amount of F2,6BP, or a derivative thereof.

[0351] In one aspect, provided herein is a method of preventing, limiting, reducing, or disassembling pathogenic aggregate formation in a cell, or a population thereof, in a subject in need thereof, comprising contacting the cell with an effective amount of F2,6BP, or a derivative thereof. In some embodiments, the pathogenic aggregate formation comprises aggregated TDP-43. In some embodiments, the TDP-43 has one or more aberrant post-translational modifications (PTMs). In some embodiments, pathogenic aggregate formation comprises aggregated tau protein. In some embodiments, the aggregated Tau protein comprises one or more aberrant PTMs. In some embodiments, the one or more Tau aberrant PTMs comprises pT181, pS199, pS202, pS2O8, pS210, pT217, pT231,pS235, pS262, pT263, UbK311, AcK311, UbK317, AcK317, AcK353, AcK369, pS396, pS400, pT403, pS404, or a combination thereof.

[0352] In some embodiments, the cell population comprises neurons. In some embodiments, the neurons comprise striatal neuronal cells.

[0353] In some embodiments, the method restores PFKFB3 level, restores mitochondrial genome integrity, restores mitochondrial membrane potential, restores mitochondrial respiration, prevents pathogenic aggregate formation, or a combination thereof. In one aspect, provided herein is a method of restoring mitochondrial genome integrity in a subject in need thereof, comprising administering to the subject a pharmaceutical composition comprising: (a) a therapeutically effective amount of F2,6BP, or a derivative thereof; and (b) a pharmaceutically acceptable excipient or carrier.

[0354] In one aspect, provided herein is a method of decreasing, reducing, or preventing neurotoxicity in a subject having a neurological disorder, comprising contacting the cell with an effective amount of F2,6BP, or a derivative thereof.

[0355] In one aspect, provided herein is a method of restoring motor phenotypes in a subject in need thereof, comprising administering to the subject a pharmaceutical composition comprising: (a) a therapeutically effective amount of F2,6BP, or a derivative thereof; and (b) a pharmaceutically acceptable excipient or carrier. In some embodiments, the subject has a motor neuron disease (MND). In some embodiments, the MND is ALS and / or FID.

[0356] In some embodiments, the F2,6BP is exogenous F2,6BP. In some embodiments, the derivative of F2,6BP is selected from fructose 2-phosphorothioate 6-phosphate, fructose 2-methylphosphonoyl 6-phosphate, or fructose 2-phosphonoyl 6-phosphate.

[0357] In some embodiments, the pharmaceutically acceptable carrier comprises a carrier peptide. In some embodiments, the carrier peptide comprises a brain-specific carrier peptide. In some embodiments, the brain-specific carrier peptide comprises a K16ApoE carrier peptide.

[0358] In one aspect, provided herein is a method of treating a neurological disorder in a subject in need thereof, comprising: (i) isolating a sample from the subject; (ii) testing the sample for PFKFB3 levels, F2,6BP levels, PNKP activity, or a combination thereof; (iii) if PFKFB3 levels, F2,6BP levels, PNKP activity, or a combination thereof, are significantly decreased relative to a control sample, then administering to the subject a pharmaceutical composition comprising: (a) a therapeutically effective amount of fructose-2,6-bisphosphate (F2,6BP), or a derivative thereof; and (b) a pharmaceutically acceptable excipient or carrier. In some embodiments, the PNKP activity is 3 ’-phosphatase activity.

[0359] In some embodiments, the sample is a tissue, biopsy, or a biofluid. In some embodiments, the biofluid is selected from blood, plasma, serum, urine, sputum, spinal fluid, cerebrospinal fluid, pleural fluid, nipple aspirate, lymph fluid, respiratory tract fluid, intestinal tract fluid, genitourinary tract fluid, tear fluid, saliva, breast milk, lymphatic system fluid, semen, ascitic fluid, tumor cyst fluid, amniotic fluid, tissue, biopsy, or a combination thereof. In some embodiments, the sample is processed to harvest or enrich for nuclei and / or mitochondria. In some embodiments, the sample, following isolation from the subject, comprises a fixed tissue, a frozen tissue, a resection tissue, or a niicrodissected tissue. In some embodiments, the sample is processed by a method selected from tissue sectioning, fractionation, purification, nucleic acid isolation, or cellular organelle separation.

[0360] Methods of obtaining test samples are known to those of skill in the art and include, but are not limited to, aspirations, tissue sections, swabs, drawing of blood or other fluids, surgical or needle biopsies.

[0361] In some embodiments, the testing the sample for PFKFB3 levels, F2.6BP levels, PNKP activity, or a combination thereof, comprises DNA or RNA sequencing, enzyme linked immunosorbent assay (ELISA), immunohistochemistry (IHC), in situ hybridization (ISH), fluorescence in situ hybridization (FISH), Mass spectrometry (MS), next generation sequencing (NGS), Western blot, or whole exome sequencing (WES).

[0362] Diagnostic assays are well-known to those of skill in the art. In some embodiments, the diagnostic methods as disclosed herein comprise assaying gene expression of PFKFB3 and / or PNKP. In some embodiments, gene expression is determined by hybridization or other methods known in the art, e.g., PCR, sequencing, or similar methods, in some embodiments, after isolation of a suitable nucleic acid sample. In some embodiments, the PFKFB3 and / or PNKP gene sequences can be amplified directly from a genomic DNA preparation from the sample using PCR, and the sequence composition is determined by sequencing the amplified product (i.e., amplicon).

[0363] In some embodiments, one or more nucleic acid probes capable of hybridizing specifically to the nucleic acid containing the PFKFB3 and / or PNKP genes are attached to a solid phase support, e.g., a “chip” or “microarray.” These exemplary solid phase support devices can be used to detect genes or gene expression by a number of techniques known to persons of skill in the art. The probes can be used for fluorescent detection of a PFKFB3 and / or PNKP genetic sequence. A probe also can be affixed to an electrode surface for the electrochemical detection of PFKFB3 and / or PNKP nucleic acid sequences. In some embodiments, microarrays containing probes or primers for the PFKFB3 and / or PNKP genes of interest are provided alone or in combination with other probes and / or primers. In some embodiments, a sample can be obtained by isolating from the subject genomic DNA, RNA, or any combination thereof and amplified if necessary. A DNA or RNA sample is contacted to the gene chip or microarray panel under conditions suitable for hybridization of the gene(s) of interest to the probe(s) or primer(s) contained on the gene chip or microarray.

[0364] In some embodiments, whole genome sequencing, in particular with the “next generation sequencing” techniques, which employ massively parallel sequencing of DNA templates, can be used to obtain expression levels, relevant polymorphisms, etc. Exemplary- NGS sequencing platforms for the generation of nucleic acid sequence data include, but are not limited to, Illumina's sequencing by synthesis technology (e.g., Illumina MiSeq or HiSeq System), Life Technologies' Ion Torrent semiconductor sequencing technology (e.g., Ion Torrent PGM or Proton system), the Roche (454 Life Sciences) GS series and Qiagen (Intelligent BioSystems) Gene Reader sequencing platforms.

[0365] Detectable labels can be used to identify a primer or probe hybridized to a genomic nucleic acid or amplicon. Detectable labels include but are not limited to fluorophores, isotopes (e.g., 32P, 33P, 35S, 3H, 14C, 1251, 1311), electron-dense reagents (e.g., gold, silver), nanoparticles, enzymes commonly used in an ELISA (e.g., horseradish peroxidase, betagalactosidase, luciferase, alkaline phosphatase), chemiluminiscent compounds, colorimetric labels (e.g., colloidal gold), magnetic labels (e.g., Dynabeads®), biotin, digoxigenin, haptens, proteins for which antisera or monoclonal antibodies are available, ligands, hormones, oligonucleotides capable of forming a complex with the corresponding oligonucleotide complement.

[0366] In some embodiments, a primer or probe is labeled with a fluorophore that emits a detectable signal. The term “fluorophore” as used herein refers to a molecule that absorbs light at a particular wavelength (excitation frequency) and subsequently emits light of a longer wavelength (emission frequency). While a suitable reporter dye is a fluorescent dye, any reporter dye that can be attached to a detection reagent such as an oligonucleotide probe or primer is suitable for use in the methods described. Suitable fluorescent moieties are well-known in the art.

[0367] In some embodiments, the pharmaceutical composition is administered to the subject by intranasal spray delivery.

[0368] In some embodiments, the subject is a human.

[0369] EMBODIMENTS

[0370] A non-limiting summary of embodiments of the invention is described below'.

[0371] 1. A method of treating a polyglutamine (polyQ) disease in a subject, the method comprising:

[0372] administering to the subject a pharmaceutical composition comprising (i) a therapeutically effective amount of fructose-2,6-bisphosphate (F2,6BP) or a derivative thereof; and (ii) a pharmaceutically acceptable excipient or carrier, thereby treating the polyQ disease in the subject. 2. The method of embodiment 1, wherein the polyQ disease is Huntington’s disease (HD) or Spinocerebellar ataxia type 3 (SCA3).

[0373] 3. The method of embodiment 1 or 2, wherein the fructose-2,6-bisphosphate (F2,6BP) is exogenous fructose-2,6-bisphosphate (F2,6BP).

[0374] 4. The method of any one of embodiments 1-3, wherein the pharmaceutically acceptable carrier comprises a carrier peptide.

[0375] 5. The method of embodiment 4, wherein the carrier peptide comprises a brain- specific carrier peptide.

[0376] 6. The method of embodiment 5, wherein the brain-specific carrier peptide comprises a K16ApoE carrier peptide.

[0377] 7. A method of increasing polynucleotide kinase 3 ’-phosphatase (PNKP) activity in a cell, the method comprising:

[0378] delivering a pharmaceutical composition to the cell, wherein the pharmaceutical composition comprises: (i) a fructose-2,6-bisphosphate (F2.6BP) or a derivative thereof; and (ii) a pharmaceutically acceptable excipient or carrier,

[0379] thereby increasing PNKP activity in the cell.

[0380] 8. The method of embodiment 7, wherein the fructose-2,6-bisphosphate (F2,6BP) is exogenous fructose-2,6-bisphosphate (F2,6BP).

[0381] 9. The method of embodiment 7 or 8, wherein the pharmaceutically acceptable carrier comprises a carrier peptide.

[0382] 10. The method of any one of embodiments 7-9, wherein the carrier peptide comprises a brain-specific earner peptide.

[0383] 11. The method of embodiment 10, wherein the brain-specific carrier peptide comprises a K16ApoE carrier peptide.

[0384] 12. A pharmaceutical composition for the treatment of a polyglutamine (polyQ) disease, wherein the pharmaceutical composition comprises: (i) a therapeutically effective amount of fructose-2,6-bisphosphate (F2,6BP) or a derivative thereof; and (ii) a pharmaceutically acceptable excipient or carrier.

[0385] 13. The pharmaceutical composition of embodiment 12, wherein the polyQ disease is Huntington’s disease (HD) or Spinocerebellar ataxia type 3 (SCA3).

[0386] 14. The method of embodiment 12 or 13, wherein the fructose-2,6-bisphosphate (F2,6BP) is exogenous fructose-2,6-bisphosphate (F2.6BP).

[0387] 15. The method of any one of embodiments 12-14, wherein the pharmaceutically acceptable carrier comprises a carrier peptide. 16. The method of embodiment 15, wherein the carrier peptide comprises a brain-specific carrier peptide.

[0388] 17. The method of embodiment 16, wherein the brain-specific carrier peptide comprises a K16ApoE carrier peptide.

[0389] EXAMPLES

[0390] The following examples are set forth below to illustrate the compositions, devices, methods, and results according to the disclosed subject matter. These examples are not intended to be inclusive of all aspects of the subject matter disclosed herein, but rather to illustrate representative methods and results. These examples are not intended to exclude equivalents and variations of the present invention which are apparent to one skilled in the art.

[0391] Example 1. Fructose-2,6-bisphosphate restores DNA repair activity of PNKP and ameliorates neurodegenerative symptoms in Huntington’s disease

[0392] To unravel the biological basis for the loss of polynucleotide kinase 3 '-phosphatase (PNKP) activity in Huntington’s disease (HD) and Spinocerebellar ataxia type 3 (SCA3), the two most prevalent polyglutamine (polyQ) neurodegenerative disorders, we analyzed PNKP interactome and found that the nuclear isoform of a glycolytic enzyme 6-phosphofructo-2-kinase fructose-2,6-bisphosphatase 3 (PFKFB3) associated with PNKP and other DNA repair proteins forming a multiprotein complex. Surprisingly, we found that PFKFB3 and its biosynthetic product, F2,6BP are significantly low in the affected region of patients’ brain. Exogenous addition of F2,6BP restored PNKP activity in patients’ brain nuclear extract. Moreover, supplementing F2,6BP in HD cells and fruit flies restored genome integrity and rescued the disease symptoms, suggesting supplementation of F2,6BP would be a promising therapeutic option.

[0393] Huntington’s disease (HD) and spinocerebellar ataxia type 3 (SCA3) are the two most prevalent polyglutamine (polyQ) neurodegenerative diseases, caused by CAG (encoding glutamine) repeat expansion in the coding region of the huntingtin (HIT) and ataxin-3 (ATXN3) proteins, respectively. We have earlier reported that the activity, but not the protein level, of an essential DNA repair enzyme, polynucleotide kinase 3 '-phosphatase (PNKP), is severely abrogated in both HD and SCA3 resulting in accumulation of double-strand breaks in patients’ brain genome. While investigating the mechanistic basis for the loss of PNKP activity and accumulation of DNA double-strand breaks leading to neuronal death, we observed that PNKP interacts with the nuclear isoform of 6-phosphofructo-2-kinase fructose-2,6-bisphosphatase 3 (PFKFB3). Depletion of PFKFB3 markedly abrogates PNKP activity without changing its protein level. Notably, the levels of both PFKFB3 and its product fructose-2,6 bisphosphate (F2,6BP), an allosteric modulator of glycolysis, are significantly lower in the nuclear extracts of postmortem brain tissues of HD and SCA3 patients. Supplementation of F2,6BP restored PNKP activity in the nuclear extracts of patients’ brain. Moreover, intracellular delivery of F2,6BP restored both the activity of PNKP and the integrity of transcribed genome in neuronal cells derived from the striatum of the HD mouse. Importantly, supplementing F2,6BP rescued the HD phenotype in Drosophila, suggesting F2,6BP to serve in vivo as a cofactor for the proper functionality of PNKP and thereby, of brain health. Our results thus provide a compelling rationale for exploring the therapeutic use of F2,6BP and structurally related compounds for treating polyQ diseases.

[0394] Polyglutamine (polyQ) diseases are dominant, heritable neurodegenerative disorders that are manifested by progressive deterioration of cognitive and motor functions. Huntington’s disease (HD) and Spinocerebellar ataxia type 3 (SCA3) are the most common polyglutamine (polyQ) diseases worldwide. HD is caused by a polyQ expansion (>36) in the N-terminal region of huntingtin (HTT) protein. Likewise, SCA3 is attributed to unstable glutamine repeat expansion from 12 to 41 in healthy individuals to 62 to 84 in patients in the C -terminal region of ataxin-3 (ATXN3) protein. Despite a well-defined genetic basis, the precise pathophysiological mechanisms underlying HD and SCA3 remain elusive. Recent genomewide association studies and genetic data indicate deficient DNA repair as a contributing factor in the pathogenesis of polyQ diseases.

[0395] DNA strand breaks, a common occurrence under various physiological processes, or during DNA base excision repair (BER), lead to blocked DNA termini at the break sites that can impede DNA repair and stall elongating RNA polymerases. 3'-phosphate (3'-P) is one of such major blocked DNA termini in mammalian cells. Polynucleotide kinase '-phosphatase (PNKP), a bifunctional DNA end-processing enzyme with 3 '-phosphatase and 5'-kinase activities, is a major 3 '-phosphatase in mammalian cells and thus, it participates in multiple DNA repair pathways, including BER / single-strand break (SSBR) and classical nonhomologous end-joining (C-NHEJ)-mediated DSB repair. The knockout (KO) of the gene encoding PNKP leads to postnatal death in mice due to a defect in neurogenesis and oligodendrogenesis. Multiple mutations have been mapped to the Pnkp gene that are responsible for neurological disorders, including severe progressive polyneuropathy, cerebellar atrophy, microcephaly, mild epilepsy, seizures, developmental delay, and intellectual disability. Our previous research demonstrated the association of HTT and ATXN3 with PNKP, RNA polymerase II (RNAPII), and several other DNA repair proteins, forming a transcription-coupled DNA repair complex. We further found that the 3 '-phosphatase activity of PNKP, but not the protein level, was severely compromised in the affected brain regions of HD and SCA3 mice and, in the postmortem brain tissues (cerebellum) of SCA3 patients. The inactivation of PNKP in oxidation-sensitive neurons results in a progressive accumulation of DNA strand breaks that ultimately activate proapoptotic pathways causing neuronal death. Intriguingly, our studies showed amelioration of neurotoxicity by overexpression of PNKP in cells expressing polyQ expanded mutant HTT (mHTT) and ATXN3 (mATXN3) and most importantly, in a functional assay using a Drosophila model of SCA3.

[0396] In this study, we delved into understanding the mechanism behind the loss of PNKP activity in HD and SCA3. We identified 6-phosphofructo-2-kinase / fructose-2,6-bisphosphatase 3 (PFKFB3) as a component of the transcription-coupled nonhomologous end-joining (TC-NHEJ) repair complex. PFKFB3, one of the four homodimeric bifunctional enzymes (PFKFB1-4), can reversibly phosphorylate fructose-6-phosphate (F6P) to fructose-2,6-bisphosphate (F2,6BP). PFKFB3 is the only isoform that translocates to the nucleus and targeted disruption of the mouse PFKFB3 is embryonic lethal, indicating its important role in the nucleus.

[0397] Notably, we found that F2,6BP can restore 3 '-phosphatase activity of PNKP in HD and SCA3 patients’ brain nuclear extracts in vitro. Delivering F2,6BP into HD-mouse-derived striatal neurons protected them by reinstating PNKP activity and maintaining transcribed genome integrity. Finally, supplementing F2,6BP in a Drosophila model system expressing human Httl28Q rescued the impaired motor function phenotype, providing a compelling rationale for exploring the therapeutic potential of the metabolite or its analog against such polyQ diseases.

[0398] Results and Discussion

[0399] PFKFB3 Is a Component of the TC-NHEJ Complex in Mammalian Cells.

[0400] We previously described that the DNA repair process in mammalian brains involves dynamic multiprotein complexes. A key finding in our current study, identified through 2D gel and mass spectrometric (MS) analysis, is the presence of the glycolysis modulator PFKFB3 within the TC-NHEJ complex (Table 1). Immunoprecipitation (IP) using anti-PFKFB3 or anti-DNA ligase IV (Lig IV; exclusively known for its role in C-NHEJ) antibodies (Abs) from the nuclear extracts of mice brains confirmed the presence of PFKFB3, ATXN3, and PNKP along with RNA polymerase II (RNAPII) and other known repair proteins in the TC-NHEJ complex (FIG. 1 A). We have earlier reported that HIT forms a complex with BER / SSBR proteins along with RNAPII, thereby implicating its role in transcription-coupled DNA repair. Therefore, to further assess HTT’s role in TC-NHEJ, we performed coimmunoprecipitation using anti-PFKFB3 and anti-Lig IV Abs and indeed found HIT in both PFKFB3 and Lig IV immunocomplexes (ICs). A reverse immuno-pulldown using anti-HTT antibody further confirmed the association of HTT with PFKFB3, ATXN3, PNKP, and RNAPII, implicating the role of HTT in TC-NHEJ (FIG. IB). The absence of homologous recombination (HR) protein, RAD51 in Lig IV (a C-NHEJ protein) IC provided specificity of the complex formation (FIG.

[0401] 1A, lane 5). However, RAD51 was found to be associated with PFKFB3 (FIG. 1A, lane 4), which is consistent with a recent study reporting the role of PFKFB3 in DSB repair via the HR pathway.

[0402] Next, we performed GST-pulldown experiments using purified recombinant full-length as well as different domains of PNKP to investigate whether PNKP and PFKFB3 directly interact. The results revealed that the full-length and fork-head associated (FHA) domain of PNKP interacted directly with PFKFB3. Neither individual phosphatase nor kinase domain associated with PFKFB3; however, fused catalytic domain (phosphatase + kinase) showed modest but detectable association with PFKFB3 (FIGs. IC, ID). Similar results were observed when we performed a reverse pulldown with His-tagged PFKFB3 (FIG. IE). Notably, it has been established previously that the FHA domain of PNKP directly interacts with other DNA repair proteins, namely XRCC1 (involved in SSBR) and XRCC4 (involved in C-NHEJ). Our study underscores the likelihood of the FHA domain acting as a pivotal protein-protein interaction hub in orchestrating the formation of the pathway-specific repair complexes. Additionally, these results corroborate with a recent report that shows while phosphorylated XRCC1 stimulates PNKP by binding to its FHA domain, nonphosphorylated XRCC1 stimulates PNKP by interacting with the PNKP catalytic domain.

[0403] PFKFB3 Is Involved in DSB Repair of Transcribed Genes in Mammalian Cells.

[0404] To assess the role of PFKFB3 in TC-NHEJ, we depleted PFKFB3 in HEK293 cells by specific siRNA (FIG. 6A), followed by treatment with bleomycin (Bleo), a DSB-inducing radio-mimetic drug, and monitored the repair at various time points (3, 6, 9, 12 h post Bleo treatment). Control cells demonstrated efficient repair of DNA strand-breaks within 6 to 9 h post Bleo treatment, as indicated by the resolution of yH2AX (a DSB marker). In contrast, PFKFB3-depleted cells exhibited impaired repair, as shown by unresolved yH2AX even at 12 h post Bleo treatment (FIG. 6A). We used a complementary, long amplicon (LA)-qPCR-based assay to quantitatively determine whether the DNA strand breaks persisted in PFKFB3-depleted cells. In this assay, a relative decrease in the PCR product of the long amplicon (~8 to 10 kb) vs. the short amplicon (-250 bp) in transcribed or nontranscribed genes reflects accumulation of DNA damage. Persistent DSB was monitored in representative transcribed (HPRT, POLB, and POLR2A) vs. nontranscribed genes (NanoG, Oct4, and MyII2). Control siRNA-treated cells demonstrated repair in all genes within 9 h following Bleo treatment, as indicated by efficient LA -PCR product formation. However, in PFKFB3-depleted cells, DSBs persisted specifically in transcribed genes (FIG. 6B). Interestingly, the nontranscribed genes showed significant repair within 6 to 9 h, similar to the control cells (FIG. 6C). These data highlight a critical role of PFKFB3 in DSB repair of transcribed genes via the TC-NHEJ pathway. Intriguingly, another recent report also revealed the role of a glycolytic enzyme, aldolase A in DSB repair, suggesting metabolic and DNA repair pathways are closely linked.

[0405] F2,6BP Potentiates the 3'-Phosphatase Activity of PNKP In Vitro.

[0406] We have previously demonstrated the critical role of PNKP in the preferential repair of transcribed genes in mammalian cells. Given the direct interaction between PNKP and PFKFB3 forming a TC-NHEJ complex and PFKFB3’s role in transcribed genome-specific repair, we assessed the functional relationship of these proteins in DNA repair activities and their relevance to neurodegenerative pathology. We found that PNKP activity (schematically shown in FIG. 7A) was compromised in PFKFB3-depleted (FIG. 2A) nuclear extracts from HEK293 cells (FIG. 2B, lane 3 vs. lane 2). Complementation with recombinant PFKFB3 failed to restore PNKP activity (FIG. 2B, lane 4 vs. lane 3). PFKFB3, known to shuttle to the nucleus unlike other isoforms, is primarily responsible for F2,6BP synthesis since its kinase activity is -700- fold higher than the phosphatase activity. We hypothesized that PNKP utilizes F2.6BP as a cofactor for its catalytic activity. Consistent with this hypothesis, PNKP activity was restored in PFKFB 3 -depleted nuclear extracts in a dose-dependent manner when supplemented with F6P and ATP along with recombinant PFKFB3 (FIG. 2B, lanes 5, 6 vs. lane 3). Neither the F6P alone, nor a related metabolite, fructose- 1,6-bisphosphate (F1.6BP) restored PNKP activity (FIG. 2B, lanes 9 and 10, respectively). Since PFKFB3, in the presence of F6P and ATP, is expected to produce F2,6BP, we surmised that F2,6BP itself can induce PNKP activity. To confirm this, we supplemented PFKFB 3 -depleted nuclear extracts with purified F2,6BP and indeed observed restoration of the activity of PNKP in a dose-dependent manner (FIG. 2B, lanes 7, 8 vs. lane 3). We also observed that incubation of F2,6BP alone did not release any radiolabeled phosphate indicating that 3 '-phosphate release activity observed in our assays is PNKP-specific (FIG. 7B). We further validated the dose-dependent activation of purified PNKP by F2.6BP (FIG. 2C, lane 3 vs. lanes 4 to 7). In contrast, purified PFKFB3 (FIG. 2C. lane 8) or F6P (FIG. 2C, lane 9) had no discernable effect in activating PNKP. We next tested whether F2,6BP affected the 5 '-kinase activity of PNKP. Surprisingly, F2.6BP abrogated the kinase activity of PNKP in a dose-dependent manner (FIG. 7C, lane 2 vs. lanes 3 to 5).

[0407] Next, we tested the effect of F2,6BP supplementation in the restoration of PNKP activity in the nuclear extracts of the patient samples exhibiting decreased F2,6BP levels. Exogenous F2,6BP indeed restored the 3 '-phosphatase activity of PNKP in a dose-dependent manner in the nuclear extracts of representative postmortem HD brains (frontal cortex) across different age and gender groups (FIG. 3C, lanes 5 to 7 vs. lane 4). As controls, we utilized the other two related natural metabolites, F6P and F1,6BP; however, they failed to restore PNKP activity (FIG. 3C, lanes 8 and 9). This observation indicates that the specific reduction in F2,6BP levels due to the depletion of PFKFB3 led to the abrogation of PNKP activity and subsequent accumulation of double-strand breaks (DSBs), as observed in our earlier study.

[0408] We extended our study to measure F2,6BP levels in the nuclear extracts of postmortem SCA3 patients (cerebellum) vs. age-matched control subjects. F2,6BP levels were found to be significantly lower (~2-fold) in patient samples than that of control (FIG. 3D). PFKFB3 levels were also found to be decreased in the SC A3 patient brain samples compared to age-matched controls (FIG. 3E). Notably, exogenous F2,6BP, but neither F6P (FIG. 3F, lane 8) nor F1,6BP (FIG. 3F, lane 9), restored the 3 '-phosphatase activity of PNKP in a dose-dependent manner (FIG. 3F, lanes 6 and 7 vs. lane 5). These observations suggest a potential mechanism of vulnerability for a subset of neurons in specific brain regions through the reduction of PFKFB3 and F2,6BP levels. While not wishing to be bound by any one theory, PFKFB3 increases the local concentration of the metabolite in the nucleus under normal physiological conditions, thus enhancing its availability to PNKP and, alternatively, PFKFB3 hands off F2,6BP to PNKP via their proximity to potentiate DNA repair. Because PFKFB3 is degraded under pathogenic condition and is thus no longer available to hand off or enhance the availability of F2,6BP to PNKP, it may explain a significant decrease in PNKP activity in HD and SCA3.

[0409] Intracellular Delivery of F2,6BP Can Restore PNKP Activity and DNA Repair Deficiency in HD Mouse Striatum- Derived Neuronal Cells.

[0410] We next investigated the potential of exogenous F2,6BP in restoring DNA repair deficiency in living cells deficient in PFKFB3. To perform the in-cell rescue experiment, we first used HEK293 cells as a model system where PFKFB3 was depleted by siRNA (FIG. 9 A). We observed impaired DSB repair, evident from widespread accumulation of yH2AX and p53BPl (markers of DSB accumulation, with p53BPl, specifically indicating impaired C-NHEJ) (FIG. 9A, lane 7 vs. lane 1). We induced DSBs by bleomycin and allowed cells to repair for 6 h (a time point when efficient repair takes place following DSB induction as tested earlier). Twenty-four hours prior to DSB induction, cells were incubated with F2,6BP in the presence of a cell-permeable carrier peptide (K16ApoE; 25 pM) to facilitate its entry into the cells. Notably, the activation of 3 '-phosphatase activity of PNKP was observed exclusively in the nuclear extracts of F2,6BP transfected cells (FIG. 9B, lane 6 vs. lane 2), but not in cells transfected with the carrier peptide alone or with F1,6BP (FIG. 9B, lanes 5 and 7 vs. lane 2). We also observed a significant reduction in yH2AX and p53BPl levels only in F2,6BP transfected cells (FIG. 9A, lane 11 vs. lane 9) whereas the elevated levels persisted in F1.6BP or carrier peptide-treated PFKFB 3 -depleted cells (FIG. 9A, lane 12 and 10 vs. lane 9). These findings strongly indicate that exogenous F2,6BP activates PNKP to potentiate DSB repair in PFKFB 3-deficient cells.

[0411] Following initial optimization in HEK293 cells, we assessed in-cell rescue in striatal neuronal cells derived from HD mice with expanded polyQ repeats (Q- 111) in comparison to WT cells (Q-7). Biochemical analyses revealed a substantial reduction in the 3 '-phosphatase activity of PNKP, but not its protein level, in Q-lll cells (FIG. 4A, lane 4 vs. lane 2) correlating with a reduction in PFKFB3 level (FIG. 4B) and the subsequent accumulation of DNA strand breaks specifically in the transcribed genome (FIG. 4C, 4D, lane 3 vs. lane 1) compared to Q-7 cells, typical characteristics of the disease pathology. As described above, F2,6BP was delivered with the noncovalent carrier peptide and allowed to alleviate cellular toxicity for 48 and 72 h. Control experiments involved transfecting Q-lll cells with the carrier peptide alone or with F1,6BP. Importantly, transfection of the peptide alone had no significant toxic effect on PNKP activity in either Q-7 or Q-lll cells (FIG. 4A, lane 3 vs. lane 2 and lane 5 vs. lane 4). The restoration of 3 '-phosphatase activity of PNKP was observed in a time-dependent manner exclusively in the nuclear extracts of F2,6BP-transfected cells (FIG. 4A, lanes 6-7 vs. lane 4), but not in cells transfected with either F1,6BP or the carrier peptide (FIG. 4A, lanes 8-9 or lane 5 vs. lane 4). Given that intracellular delivery of F2,6BP restored the '-phosphatase activity of PNKP in Q-lll cells, a cell viability assay was performed by crystal-violet staining of live Q-7 and Q-lll cells treated with F2,6BP. Microscopic imaging showed a significant increase in the Q-ll l cell count following F2,6BP treatment, comparable to control Q-7 cells, contrary to the decreased count under mock treatment (carrier peptide alone) conditions (FIG. 4E-4G). These results collectively suggest that F2.6BP can effectively restore PNKP activity in HD ceils, protecting them from neurotoxicity and apoptosis.

[0412] We then assessed the level of DNA strand breaks in control and F2,6BP-transfected Q-111 or Q-7 cells by LA-qPCR targeting neuron-specific transcribed genes (1’ubb, Enolase, and Neurod) vs. nontranscribed genes (muscle-specific Myh4, Myh6, and Myod). Significant repair of DNA strand breaks was observed only in F2,6BP transfected Q-ll 1 cells (FIG. 4C, lanes 5 and 6 vs. lane 3). Conversely, F2,6BP showed no notable impact on the repair of nontranscribing genes, as they did not accumulate DNA strand-breaks in Q-lll cells (FIG. 4D, lanes 5 and 6 vs. lane 3). These results underscore the ability of exogenous F2,6BP to effectively restore PNKP-mediated TC-NHEJ repair in HD cells. We also assessed the repair of DNA strand breaks in PFKF’B 3 -depleted HEK293 cells described earlier by LA-qPCR. Consistent with the results in the neuronal cells, only in F2,6BP transfected cells, but not in the cells treated with either peptide or F1,6BP, significant LA-PCR product was visible indicating efficient DNA strand break repair (FIG. 9C, lane 11 vs. lanes 10 and 12).

[0413] To further assess the persistence of DNA DSBs or their repair in Q-lll cells under conditions described above, we examined the levels of p53BPl and yII2AX proteins. In F2,6BP-transfected Q-ll l cells, yH2AX and p53BPl levels were markedly reduced (FIG. 4H, lanes 5 and 6 vs. lanes 3), whereas the elevated levels of yH2AX / p53BPl (in comparison to Q- 7 cells) persisted in either mock or Fl,6BP-treated Q-lll cells (FIG. 4H, lane 4 or lanes 7 and 8 vs. lane 3). These results were consistent with the observations in PFKFB 3 -depleted HEK293 cells (FIG. 9A) and demonstrate that F2,6BP deficiency impaired DNA strand break repair, irrespective of cell type specificity.

[0414] F2,6BP Can Reverse the Impaired Motor Phenotype Reported in Httl28Q Model of HD in Drosophila.

[0415] To investigate the effect of F2,6BP in vivo, we used a well-studied transgenic HD model of the fruit fly (Drosophila melanogaster). In this model, the fruit flies were genetically modified to express the human HIT gene with an expanded 128 polyQ repeat (Httl28Q) under upstream activating sequence (UAS) (BDSC# 33808). This model exhibited the common characteristics of HD pathogenesis, viz., increase in neurotransmitter release, neurodegeneration, reduced lifespan, and impaired motor function. These flies were crossed with specific driver lines (repo-GAL4, BDSC# 7415, and elav-GAL4, BDSC# 458) for either pan-glial or pan-neuronal expression of Httl28Q, respectively (FIG. 5A, Upper panel). The pan-neuronal expression of Httl28Q (33,808 x 458) showed significant impairment of motor neuron function compared to its pan-glial expression (FIG. 5A, Lower panel). The flies were then supplemented with 1 to 2 pL of either 200 pM F2.6BP or mock buffer (as control) for 21 d and the rescue of motor deficiency was tested by climbing assays. While there was no detectable effect of this metabolite supplementation in flies expressing Httl28Q in glial cells, the impaired motor phenotype was rescued in neuronal cells and a significant increase in climbing score (in both male and female flies) was observed after supplementation with F2,6BP compared to treatment with mock buffer (FIG. 5 A, Lower panel). To further confirm whether F2,6BP supplementation can ameliorate repair deficiency, we examined the DNA strand break accumulation in Drosophila CrebB and Neurexin genes by LA-qPCR in the affected panneuronal model. We indeed observed elevated level of DNA damage following Httl28Q expression compared to the flies used to generate the strains (wlll8) (FIG. 5B, lanes 2 and 4 vs. lane 1). This further indicates that the mock treatment with control buffer failed to rescue genome integrity. However, significant repair was observed following F2,6BP supplementation (FIG. 5B, lanes 3 and 5 vs. lanes 2 and 4) and the genome integrity was comparable to tire W1118 flies (FIG. 5B, Upper panel). These findings confirm the ability of F2,6BP to specifically reverse the HD neurodegen erative phenotype in vivo in neuronal cells. While not wishing to be bound by any one theory, these results demonstrate that supplementing F2,6BP is therapeutically effective at preventing key aspects of HD progression via maintenance of genomic integrity.

[0416] The present study uncovers a crucial role of PFKFB3, a nuclear member of the PFKFB family, in transcription-coupled DSB repair under normal physiological conditions by maintaining the homeostatic level of F2,6BP, essential for PNKP activity. F2,6BP is traditionally recognized for its role in controlling glycolysis by binding to 6-phosphofructo-l-kinase (PFK1) in the cytoplasm. Our results imply that F2,6BP synthesis by nuclear PFKFB3 is probably a compartmentalized event and locally produced F2,6BP is transferred directly to PNKP within the TC-NHEJ complex. Under the pathogenic HD and SCA3 conditions, PNKP-mediated DNA strand break repair is significantly abrogated due to low levels of nuclear F2,6BP, suggesting a crucial role of F2,6BP in vivo for full catalytic activity of PNKP.

[0417] The expression of PFKFB 3 is stringently controlled by two E3 ligases, anaphasepromoting complex (APC)-Cdhl (APCCdhl) and beta-transducin repeat-containing protein (P-TRCP). It was reported that under homeostatic conditions, PFKFB3 undergoes constitutive degradation facilitated by APCCdhl marking a low glycolytic rate and reduced oxidative damage in neurons. However, it has now been shown that PFKFB3 is stabilized during brain excitation to activate glycolysis. This is consistent with our study showing PFKFB3’s level is low only under pathogenic condition but not in post mitotic healthy neurons.

[0418] Currently, there is no effective medicine capable of halting or reversing the progression of polyQ disorders. McMurray’s group has earlier developed a synthetic small molecule, XJB-5-131, a radical scavenger and uncoupler of oxidative phosphorylation, that showed promise as a therapeutic compound by suppressing disease phenotypes in HD mouse models. Hence, preventing or reversing accumulation of oxidative stress-induced DNA damage under pathogenic condition would be a potential therapeutic option. Here, we have demonstrated that exogenous F2,6BP can rescue TC-NHEJ defects and subsequent cellular toxicity in HD cells. Moreover, F2,6BP supplementation rescued neurodegenerative phenotype in a Drosophila model of HD, emphasizing the potential therapeutic efficacy of the endogenous metabolite by protecting brain cells from progressive accumulation of genome damage. Thus, this study demonstrates an endogenous metabolite modulating the activity of an essential DNA repair protein.

[0419] Methods

[0420] Cell Culture and Various Treatments.

[0421] Human Embryonic Kidney 293 (HEK293; ATCC CRL-1573) cells were grown at 37 °C and 5% CO2 in DMEM: F-12 (1:1, Cellgro) medium containing 10% fetal bovine serum (Sigma), 100 units / mL penicillin, and 100 units / mL streptomycin (Cellgro). Mouse striatum-derived cell line from a knock in transgenic mouse containing homozygous Huntingtin (HIT) loci with a humanized Exon 1 containing 7 or 111 polyglutamine repeats (Q-7 and Q-111; Cornell Institute; Cat# CH00097 and CH00095, respectively) were cultured and maintained in Dulbecco Modified Eagles Medium (high glucose) with 2 mM L-glutamine containing 10% fetal bovine serum, 100 units / mL penicillin and streptomycin, and 0.4 mg / mL G418. As Q-l 11 cells lose the ability to proliferate and survive, high-passage cultures were avoided. We routinely tested for mycoplasma contamination in cultured cells using the Mycoalert Mycoplasma Detection Kit (Lonza) according to the manufacturer’s protocol, and the cells were found to be free from mycoplasma contamination.

[0422] For DNA repair studies, cells were either mock-treated, or treated with bleomycin (Bleo, 30 pg / mL for 1 h; Cat # NDC 0703-3155-01) in reduced serum media (Gibco) and allowed for recovery for 3, 6, 9, and 12 h.

[0423] Analysis of PNKP-Associated Proteins by 2D Gel and MALDI-TOF-TOF MS Analysis. A large-scale immunoprecipitation from AGS (human gastric adenocarcinoma) cell nuclear extracts (100 mg, benzonase treated to remove DNA and RNA to avoid DNA -media ted coimmunoprecipitation) was performed using mouse IgG (control) and anti-PNKP antibody (mouse monoclonal Ab, Cytostore)- conjugated agarose beads as described. The immunoprecipitates (IPs) were washed extensively with cold 'IBS (50 mM Tris-HCl, pH 7.5; 200 mM NaCl) containing 1 mM EDTA, 1% Triton X-100, and 10% glycerol. The complexes were then eluted from the beads stepwise with 25 mM Tris-HCl, pH 7.5 containing 300, 400, and 500 mM NaCl. The eluates were subjected to two-dimensional gel electrophoresis separation and the protein spots (Sypro Ruby, Molecular Probes) that were specifically present in the PNKP IP and not in the IgG IP were subjected to mass spectroscopic identification in the University of Texas Medical Branch Biomolecular Resource Facility.

[0424] Gene Knock-Down by siRNA Transfection.

[0425] PFKFB3 depletion was carried out in HEK293 cells using siRNAs (80 nM; transfected twice on consecutive days) from SIGMA (SASI_Hs01_00065120). The cells were treated with control or specific siRNA and lipofectamine 2000 (Invitrogen) mixture for 6 hin reduced serum medium (Gibco; reduced serum media) followed by addition of 10% FBS containing DMEM / F12 media for each round of transfection. Nuclear extracts were prepared from the harvested cells (72 to 96 h posttransfection) to examine the depletion of individual proteins by immunoblot analysis using specific Abs. HDAC2 (Histone deacetylase 2; GTX 109642, GeneTex) was used as nuclear loading control.

[0426] Coimmunoprecipitation ( Co-JP).

[0427] Approximately 100 mg of brain tissue from freshly killed WT mice (6 mo old; tissue from three mice were pooled together for a single experiment; n = 3) was sliced into small pieces, collected in a prechilled, sterile homogenizer (Thomas, PHILA USA C55506) and hand-homogenized with 4 volumes of ice-cold homogenization buffer [0.25 M sucrose, 15 mM Tris-HCl, pH 7.9, 60 mM KC1, 15 mM NaCl, 5 mM EDTA, 1 mM EGTA, 0.15 mM spermine, 0.5 mM spermidine, 1 mM dithiothreitol (DTT), 0.1 mM phenylmethyl sulfonyl fluoride (PMSF), and protease inhibitors (EDTA-free; Roche)] with 20 strokes to disrupt tissues. Homogenization was continued until a single-cell slurry was obtained, incubated on ice for 15 min, and centrifuged at l,000xg to obtain the cell pellet. Nuclear extracts (NEs) were prepared as described. Briefly, cells were lysed in Buffer A [10 mM Tris-HCl (pH 7.9), 0.34 M sucrose, 3 mM CaC12, 2 mM magnesium acetate, 0.1 mM EDTA, 1 mM DTT, 0.5%’ Nonidet P-40 (NP- 40), and IX protease inhibitor cocktail (Roche)] and centrifuged at 3,500xg for 15 min. Nuclear pellets were washed with Buffer A without NP-40 and then lysed in Buffer B [20 mM HEPES (pH 7.9), 3 mM EDTA, 10% glycerol, 150 mM potassium acetate, 1.5 mM MgC12, 1 mM DTT, 0.1% NP-40, 1 mM sodium ortho vanadate (vanadate) and IX protease inhibitors] by homogenization. Supernatants were collected after centrifugation at 15,000xg for 30 min and DNA / RNA in the suspension was digested with 0.1 U / ul benzonase (Novagen) at 37 °C for 1 h. The samples were centrifuged at 20,000xg for 30 min, and the supernatants collected as NEs. Co-IPs were performed using anti-PFKFB3 (GTX108335, GeneTex), Lig IV (Sc-271299, Santa Cruz Biotechnology), and HIT (Sc-477570, Santa Cruz Biotechnology) Abs with Protein A / G PLUS agarose beads (Sc 2003, Santa Cruz Biotechnology) overnight, followed by four washes with Wash buffer [20 mM HEPES (pH 7.9), 150 mM KC1, 0.5 mM EDTA, 10% glycerol, 0.25% Triton-X-100 and IX protease inhibitors] and eluted with Laemmli Sample Buffer (Bio Rad; final concentration IX). Tire immunoprecipitates were tested for the interacting proteins using appropriate Abs [PFKFB3, HTT, ATXN3 (Proteintech 13505-1-AP), PNKP (BB-AB0105, BioBharati Life Science), 53BP1 (Sc-22760, Santa Cruz Biotechnology), DNA-PKcs (GTX6D1 CH F10, GeneTex), Ku70 (GTX101820, GeneTex), Lig IV (GTX108820, GeneTex), XRCC4 (GTX109632, GeneTex), Polymerase Mu (GTX116332, GeneTex), RNAP II (920202, pSer2, H5 Ab, Biolegend), APE1 (in-house Ab) (19) and RAD51 (GTX 100469, GeneTex)].

[0428] Immunoblotting.

[0429] The proteins in the nuclear extracts were separated onto a Bio-Rad 4 to 20% gradient Bis-Tris Gel, then electrotransferred on a nitrocellulose (0.45 pm pore size; GE Healthcare) membrane using IX Bio-Rad transfer buffer. The membranes were blocked with 5% w / v skimmed milk in TBS buffer (IX Tris-Buffered Saline, 0.1% Tween 20), then immunoblotted with appropriate antibodies [PNKP, PFKFB3, y-H2AX (S139 residue; #9718S, Cell Signaling Technology), p53BPl (S1778, #2675S Ceil Signaling Technology), 53BP1, HDAC2, H2AX (total) (#2595S; Cell Signaling technology)], lire membranes were extensively washed with 1% TBST followed by incubation with anti-isotype secondary antibody (GE Healthcare) conjugated with horseradish peroxidase in 5% skimmed milk at room temperature. Subsequently, the membranes were further washed three times (10 min each) in 1% TBST, developed using ECLTM Western Blotting Detection Reagents (RPN2209, GE Healthcare) and imaged using Kwikquant image analyzer and image analysis software (ver 5.2) (Kindle Biosciences). Human Tissue Samples.

[0430] Deidentified human postmortem frontal cortex tissue of HD patients (Table 2) and cerebellum tissue from SCA3 patients and age-matched controls (IRB exempt) were obtained from the biorepository of the Michigan Brain Bank, USA through Materials Transfer Agreement (UTMB 22-UFA00474).

[0431] Assay of 3'-Phosphatase and 5 '-Kinase Activities of PNKP.

[0432] The 3 '-phosphatase activity of PNKP in the nuclear extract of postmortem patients’ frontal cortex / cerebellum and age-matched control subjects (2.5 pg) or with purified recombinant PNKP (2 ng) was conducted as we described previously. Five pmol of the radiolabeled substrate was incubated at 37 °C for 15 min in buffer A (25 mM Tris-HCl, pH 8.0, 100 mM NaCl, 5 mM MgC12, 1 mM DTT, 10% glycerol, and 0.1 pg / pL acetylated BSA). 5 pmol of nonradiolabeled substrate was used as cold substrate. Nuclear extracts were prepared following the protocol used for Co-IP studies. For kinase activity assay, γ-[³²P] labeled ATP was incubated in kinase assay buffer (80 mM succinic acid pH 5.5, 10 mM MgC12, 1 mM DTT, 2.5% glycerol) along with 1.0 ug / pL acetylated BSA, and 0.6 pmol labeled substrate for 30 min at 30 °C. 100 fmol of PNKP and 2.5 pmole of cold substrate were used in this assay. For in vitro PNKP restoration / abrogation, similar assays were done after incubation of F2,6BP / F6P / F1,6BP (in amounts as indicated in the figure legends) with the nuclear extracts for 1 min. The radioactive bands were visualized in Phosphorlmager (GE Healthcare) and quantitated using Image Quant software. The data were represented as % product (released phosphate or kinase product) released from the radiolabeled substrate with a value arbitrarily set at 100%.

[0433] Enzymatic Preparation of F2,6BP

[0434] Enzymatic preparations of F2,6BP were conducted following the published protocol. Briefly, a reaction cocktail was prepared consisting of 60 mM Tris-HCl (pH 7.5), 1.5 mM DTT, 5 mM Potassium Phosphate (pH 7.5), 20 mM KC1, 40 pM EDTA, 6 mM MgC12, 5 mM ATP, 1 mM F6P, 10% glycerol, and 1 mg / mL BSA in 200 pL. The reaction was initiated by adding 100 pg PFKFB3 and incubated at 37 °C for 90 mins followed by quenching the reaction with 50 μL 1 M NaOH and heating at 80 °C for 5 mins. The mixture was centrifuged to remove any precipitate followed by dilution to 2 mL with 10 mM Triethylammonium bicarbonate (TEABC) buffer (pH 8.5). The diluted reaction mixture was applied to MonoQ column pre-equilibrated with 10 mM TEABC (pH 8.5). F2,6BP was eluted using 20 to 35% gradient with 800 mM TEABC as buffer B. Peak fractions were pooled based on the phosphate release assay by PNKP, dried and dissolved in 20 mM Tris-Cl (pH=8.0). The presence of F2.6BP was verified by ESIMS.

[0435] Estimation ofF2,6BP in Patients’ Extracts.

[0436] To quantify F2,6BP, the F6P assay kit (Sigma- Aldrich) was used to measure the amount of F6P before and after treating the crude cell extracts with 0.1 M HC1 and incubated at 37 °C for 30 min. Acid treatment converts F2,6BP into F6P. The assay was performed using the manufacturer’s protocol which uses NADH-linked luciferase bioluminescence.

[0437] Long amplicon qPCR (LA-qPCR).

[0438] The cells were mock- or Bleo-treated 72 h post PFKFB3 depletion and either harvested immediately after Bleo treatment or kept for recovery (3 to 12 h) after the Bleo treatment and then harvested. Genomic DNA was extracted using the Genomic tip 20 / G kit (Qiagen) per the manufacturer’s protocol, to ensure minimal DNA oxidation during the isolation steps. The DNA was quantitated by Pico Green (Molecular Probes) in a black-bottomed 96-well plate and gene-specific LA qPCR assays were performed as described using Long Amp Taq DNA Polymerase (New England BioLabs). Three transcribed (HPRT, POLB, and RNAPII, 10.9, 12.1, and 11.3 kb, respectively) and three nontranscribed (NANOG, 8.6 kb, OCT3 / 4, 10.1 kb, MyH2, 6.0 kb) genes were amplified from HEK293 cells using appropriate oligos.

[0439] Similar LA-qPCR was performed from genomic DNA isolated from Q-7 and Q-lll cells. Since these are neuronal cells, a different set of transcribed (neuronal differentiation factor 1 (Neurod), tubulin 3 class III (Tubb) and gamma-enolase (Enolase) vs. nontranscribed (myogenic differentiation factor [MyodJ, muscle-specific myosin heavy chain 4 and 6 [Myh4, Myh6]) genes were used for the LA-qPCR assay.

[0440] Finally, genomic DNA isolated from adult Drosophila (10 from each genotype and different treatment groups) was used for DNA damage analysis. Two genes (CrebB and Neurexin, ~8 kb) were amplified using appropriate oligos.

[0441] The LA-qPCR was set for all genes from the same stock of diluted genomic DNA sample, to avoid variations in PCR amplification during sample preparation. Preliminary optimization of the assays was performed to ensure the linearity of PCR amplification with respect to the number of cy cles and DNA concentration (10 to 15 ng). The final PCR conditions were optimized at 94 °C for 30 s; (94 °C for 30 s, 55 to 60 °C for 30 s depending on the oligo annealing temperature, 65 °C for 10 min) for 25 cycles; 65 °C for 10 min. Since amplification of a small region is independent of DNA damage, a small DNA fragment (-200 to 400 bp) from the corresponding gene(s) was also amplified for normalization of amplification of the large fragment. The amplified products were then visualized on gels and quantitated with Imaged software (NIH). The extent of damage was calculated in terms of relative band intensity with a control siRNA / mock-treated sample or w1118 sample (for Drosophila studies) considered as 100. All oligos used in this study are listed in Table 3.

[0442] In Cell Deliver)’ of the Exogenous F2,6BP / F 1,6BP in Q-7 and Q-ill Cells.

[0443] For delivery of the glycolytic metabolites in the mouse striatum-derived neuronal cells (Q-7 and Q-l 11), we followed the protocol optimized in our lab. Briefly, 200 uM of F2,6BPor F1,6BP was mixed with 25 pM cell -permeable carrier peptide K16ApoE (Mayo Proteomic Core Facility) and incubated for 45 min at RT; then, metabolite -peptide mix was added to the cells and incubated for 6 h in reduced serum media. After 6 h, FBS containing complete media was added, and cells were harvested at 48 and 72 h for DNA repair assays / LA-qPCR. In another case, 15,000 cells were plated in 24-well flat-bottomed plates in 2 mF medium per well. Following mock or F2,6BP delivery in the dose mentioned above, the cells were allowed to grow for additional 48 to 72 h, culture medium was aspirated, and cells were stained with 10 uL crystal violet dye solution (to image the live cells). Microscopic imaging was done under bright field using WHN10x / 22 eyepiece and a 20x objective (field of view is 1.1 mm, and camera correction is 1.0) on an Echo Revolution Microscope system. More than five randomly selected fields of view per sample were photographed and ceils were counted manually / sq.mm of the chosen optical field.

[0444] Delivery of the glycolytic metabolites, F2,6BP / F1,6BP were performed using a similar protocol in HEK293 cells 48 h following depletion of PFKFB3 and 2.4 h prior to treatment with bleomycin.

[0445] Protein Expression and Purification.

[0446] WT recombinant His-tagged PFKFB3 and PNKP were purified from Escherichia coli using protocol as described. Briefly, pET28a (Novagen) vector containing N-terminal Ilis-tagged-WT PFKFB3 or PNKP coding DNA sequence was transformed into E. coli BL21(DE3) RIPL Codon-plus cells. Log-phase culture (A600 - 0.4 to 0.6) of E. coli was induced with 0.5 mM isopropyl- 1-thio-P-D-galactopyranoside at 16 °C for 16 h. After centrifugation, the cell pellets were suspended in a lysis buffer (buffer A) containing 25 mM Tris-HCl, pH 7.5, 500 niM NaCl, 10% glycerol, 1 mM P-mercaptoethanol (P-ME), 0.2.5% Tween 20, 5 mM imidazole, 2 mM PMSF. After sonication, the lysates were spun down at 13,000 rpm, and the supernatant was loaded onto HisPur Cobalt Superflow Agarose (Thermo Scientific, catalog no. 25228) previously equilibrated with buffer A and incubated for 2. h at 4 °C. After washing with buffer A with gradient increasing concentration of imidazole (10, 20, 30, 40 mM), the His-tagged proteins were eluted with an imidazole gradient (80 to 500 mM imidazole in buffer containing 25 mM Tris-HCl, pH = 7.5, 300 mM NaCl, 10% glycerol, 1 mM B-ME, 0.25% Tween 20). After elution, the peak protein fractions were dialyzed against buffer C (1XPBS, pH 7.5, 1 mM DTP, and 25% glycerol).

[0447] GST-tagged WT PNKP and its domains were purified as described, following protocols described as above. Glutathion-Sepharose is used as bead instead of HisPur Cobalt Supertlow Agarose.

[0448] GST or His Pull-Down Assays for In Vitro Interaction Study.

[0449] GST pulldown assays were performed as described. Briefly, GST-tagged full-length PNKP or its three individual domains (20 pmol) were bound to glutathione-Sepharose beads (20 pF), washed thoroughly with buffer A (25 mMTris-Cl pH 7.5, 0.1%’ Triton X-100, 0.1 mM EDTA, and 10% glycerol) containing 150 mM NaCl, and then incubated with WT PFKFB3 (20 pmol) with constant rocking for 4 h at 4 °C in 0.5 ml of 1 0 mM salt containing buffer A. After extensive washing with 200 mM NaCl containing buffer A, 20% of the bound proteins were separated by SDS-PAGE for immunoblotting analysis using an anti-PFKFB3 or anti-GST Ab.

[0450] For His pulldown assay, His-tagged PFKFB3 was bound to HisPur cobalt agarose beads (20 pF), washed in buffer A with 150 mM NaCl and then incubated with GST-tagged PNKP / domains (20 pmol) as described above.

[0451] Drosophila Maintenance and Treatment.

[0452] All Drosophila stocks were maintained at 25 °C on standard fly food under a 12:12-h light-dark cycle. Drosophila strains were purchased from Bloomington Drosophila Stock Center (BDSC, Bloomington, Indiana, USA: UAS-htt (#33808, RRID: BDSC_33808), expresses human Huntingtin (HIT) with long polyQ (glutamine) repeat of 128 amino acids. The repo-GAL4 (#7415, RRID: BDSC_7415) is a pan-glial promoter and elav-GAL4 (#458, RRID: BDSC_458) is a pan-neuronal promoter. BDSC 33808 were crossed to BDSC_7415 or BDSC.458 for pan-glial or pan- neuronal expression (shown schematically in FIG. 5 A). Flies eclosed from the crosses were collected in fresh food vials and kept under standard conditions for 1 to 2 d for acclimatization. Flies were separated into two vials for Mock buffer and F2,6BP treatment. One BD syringe (1 mL) was filled with Mock buffer, and the other was filled with F2,6BP and drop is administered per day to respective cohorts at the same time of the day for 21 consecutive days.

[0453] Climbing or Negative Geotaxis Assay.

[0454] The climbing assay was performed as described with minor modifications. Briefly, experimental flies were anesthetized on ice. A group of 10 male flies per vial were transferred to a 25 mL sterile glass measuring cylinder. The measuring cylinder was divided into six compartments equally, the lowest compartment was labeled with 1 and the highest compartment was labeled with 6. The measuring cylinder with flies was placed against a white background for better video recording. The cylinder was tapped gently three times to send the flies to the bottom of the cylinder. The climbing time was recorded for 20 s. Five trials were performed for each cohort. The climbing score was calculated at 8 s.

[0455] Example 2. F2,6BP restores mitochondrial genome integrity in Huntington’s Disease Several reports have indicated that impaired mitochondrial function contributes to the development and progression of Huntington’s disease (HD). Mitochondrial genome damage, particularly DNA strand breaks, is a potential cause for its compromised functionality. Here we show that the activity of polynucleotide kinase 3 ’-phosphatase (PNKP), a critical DNA endprocessing enzyme, is significantly decreased in the mitochondrial extract of HD patients’ brains due to a lower level of fructose-2,6 bisphosphate (F2,6BP), a biosynthetic product of 6-phosphofructo-2-kinase fructose-2,6-bisphosphatase 3 (PFKFB3). Such decrease in PNKP activity leads to persistent DNA strand breaks that are refractory to subsequent steps for repair completion. Both PFKFB3 and F2,6BP, an allosteric modulator of glycolysis, are also present in the mitochondria and PFKFB3 is part of a mitochondrial DNA repair complex containing HTT, PNKP, DNA Pol y (POLG) and Lig Illa. Notably, PNKP binds F2,6BP (Kd= 525+25 nM) and utilizes it as a cofactor. The levels of both F2,6BP and PFKFB3 are significantly decreased in the mitochondrial extract of HD mouse striatal neuronal cells and patients’ brain. Activity of PNKP is thus severely decreased in the mitochondrial extract; however, addition of F2,6BP restored its activity. Moreover, supplementation of F2,6BPin HD cells restored PFKFB3 level, mitochondrial genome integrity and partially restored mitochondrial membrane potential, mitochondrial respiration and prevented pathogenic aggregate formation. We also observed that supplementation with F2.6BP restored mitochondrial genome integrity in an HD Drosophila model. Our findings, therefore, suggest that F2,6BP-mediated restoration of PNKP activity could have a profound impact in ameliorating neurodegenerative symptoms in HD.

[0456] We reported earlier the loss of PNKP activity in the nuclear extracts from HD patients’ brain. However, a glycolytic metabolite, F2,6BP, can restore PNKP activity and rescue organismal phenotypes in HD fly models. As PNKP is present in mitochondria and several reports indicate that mitochondrial dysfunction contributes to HD, we therefore analyzed PNKP activity in the mitochondrial extract. Surprisingly, we found that PFKFB3 and its product, F2,6BP are present in mitochondria, but significantly low in patients’ brains. Exogenous addition of F2,6BP restored PNKP activity in patients’ brain mitochondrial extract. Moreover, supplementing F2,6BP in HD cells and fruit flies restored mitochondrial genome integrity suggesting maintaining adequate intracellular F2,6BP levels is critical for proper functionality of PNKP and thereby of brain health.

[0457] Huntington’s disease (HD), a devastating hereditary neurological disorder, is caused by toxic expansion of the polyglutamine (polyQ) stretch in the N-temiinus of huntingtin protein (HIT). Although, HD is an autosomal, monogenic disease, the underlying mechanisms that contribute to the death of brain cells in HD are still elusive. Genome-wide association studies showed a strong correlation between DNA repair deficiency and the age- dependent onset of HD. In addition to nuclear genome damage biology, recent advances in mitochondrial research have implicated previously unanticipated roles of this organelle in human diseases, particularly aging and neurological disorders, including HD. Mitochondrial DNA (mtDNA) damage is a potential cause of mitochondrial dysfunction and can have a significant impact on cellular health in HD. The mitochondrial genome is subjected to continuous insult by endogenous reactive oxygen species (ROS) because of its proximity to the site of ROS generation via mitochondrial electron transport system complexes. Furthermore, mtDNA lacks protective histones, unlike nuclear DNA (nDNA), and so it is more susceptible to such oxidative damage. Moreover, mitochondria have a high rate of transcription and importantly, most of the mitochondrial genome is transcribed. Thus, mitochondrial DNA encoded core functions would be compromised due to deficient mitochondrial genome repair in HD.

[0458] To protect mtDNA from ROS induced oxidative damage, a range of DNA repair mechanisms have evolved including base excision repair (BER) and single strand break repair (SSBR). Polynucleotide kinase 3’-phosphatese (PNKP) is a major enzyme for processing both “non-ligatable” 3 ’-phosphate (3’-P) and 5 ’-OH termini at strand breaks in mammalian genomes and thus, it is involved in multiple repair pathways including BER and SSBR. Several recent reports, including ours, have documented an association of PNKP deficiency with neurological / developmental disorders. However, the underlying biochemical bases of such phenotypes, which are exclusive to the nervous system, are not well understood. We have recently reported that wild-type HTT plays an important role in DNA repair most likely by providing a platform for the assembly of a novel transcription-coupled DNA repair (TCR) complex in nuclei that includes, RNA polymerase II (RNAPII), PNKP and other DNA repair proteins. This specialized protein complex repairs DNA lesions during transcription to maintain genome integrity of the neurons, preserve their function and by doing so, extend their survival. We have further demonstrated cellular toxicity due to the loss of DNA repair (3 ’-phosphatase) activity of PNKP, but not its protein level, in HD brain extracts, leading to accumulation of DNA SBs, including double strand breaks. Most importantly, we have observed that PNKP interacts with the nuclear isoform of a glycolytic enzyme, 6-phosphofructo-2-kinase fructose-2,6-bisphosphatase 3 (PFKFB3). Depletion of PFKFB3 markedly reduced PNKP activity without changing its protein level. Notably, the levels of bothPFKFB3 and its product fructose-2,6 bisphosphate (F2,6BP), an allosteric modulator of glycolysis, are significantly lower in the nuclear extracts of post-mortem HD patients’ brains. Supplementation of F2,6BPin HD mouse striatal neuronal cells and in HD fruit flies fully restored nuclear genome integrity and functionality, suggesting F2,6BP to be a positive regulator of PNKP activity in vivo.

[0459] The repair of ROS-induced DNA damage in the mitochondrial genome is well characterized. We and others have shown the presence of DNA glycosylases, NEIL1 / NE1L2 and PNKP in the mitochondria. NEIL1 and NEIL2 initiate BER by their combined DNA glycosylase and AP lyase activities and generate SBs with 3’-P termini, a substrate for PNKP. In addition to impeding DNA repair, 3’-P termini can stall elongating RNA polymerases, leading to DNA damage response viap53 activation. Thus, processing of such “non-ligatable” 3’-P-containing DNA termini is essential for repair progression and efficient transcription even within mitochondria. Since PNKP, the major 3 ’-phosphatase in mammalian cells, is also present in mitochondria, we, therefore, asked whether the activity of PNKP is compromised in mitochondria of HD patients and whether PFKFB3 or F2,6BP has any role in mtDNA repair, similar- to what we reported earlier for nuclear DNA repair.

[0460] Surprisingly, we observed that both PFKFB3 and F2,6BP localize to mitochondria and their levels are significantly low in HD patients’ mitochondrial extract, leading to abrogated mtPNKP activity. Supplementing F2,6BPin HD-mouse striatal neuronal cells and a Drosophila HD model system restored mitochondrial genome integrity. Altogether, our data provides support for the use of F2.6BP or its analog in HD and related pathologies.

[0461] Results and discussion

[0462] Mitochondrial PNKP activity’ is decreased in HD

[0463] Our previous studies have demonstrated that nuclear PNKP activity is diminished in HD mouse models and post-mortem brain tissues from HD patients. Given that PNKP is known to translocate to mitochondria, we investigated whether its activity is also compromised in mitochondria by assessing the 3 ’-phosphatase activity of PNKP in the mitochondrial extracts prepared from the frontal cortex of post-mortem HD brains vs healthy controls. We indeed observed a marked reduction of PNKP activity in HD samples (FIG. 10A, lanes 6-9 vs lanes 2-5). Mitochondria are important sources of cellular reactive oxygen species (ROS), essential byproducts generated from leaked electrons and molecular oxygen. While ROS are natural signaling molecules regulating various biological processes, excessive mitochondrial ROS (mtROS) induce oxidative stress, damaging essential biomolecules, including mitochondrial DNA (mtDNA). Therefore, we also assessed the mtROS level in diseased and healthy control tissue. We indeed observed a significantly higher level of ROS in HD patients (FIG. 10B).

[0464] Since PNKP is an essential DNA end-processing enzyme, we next examined accumulation of DNA SBs in the mitochondrial genome by along amplicon (LA)-qPCR-based assay using mitochondrial genome specific primers. In this assay, a relative decrease in the PCR product of the long amplicon (~8-10 kb) vs the short amplicon (~250 bp) suggests increased DNA damage, as a higher number of lesions in the longer templates impedes PCR amplification. We observed significant accumulation of DNA SBs in the mitochondrial genome of HD brains (FIG. 10C, lanes 5-8 vs lanes 1-4) concurrent with higher level of mtROS and compromised mtPNKP activity. In summary, our results indicate that mtDNA also accumulates damage due to a significant reduction in mtPNKP activity in HD pathology, consistent with our earlier report showing significant increase in nuclear genome damage in HD patients.

[0465] Diminished PFKFB3 and F2,6BP levels in HD patients disrupt mitochondrial PNKP activity

[0466] Given that PNKP levels are similar between HD patients and healthy control samples, and that F2,6BP acts as a cofactor of PNKP to maintain its activity in Hie nucleus, we postulated that a similar regulatory mechanism is present in mitochondria. To assess the role of PFKFB3 and its product F2,6BP in mitochondrial DNA repair, we first tested whether PFKFB3 is localized in mitochondria in HEK2.93 cells. Indeed, we detected significant amounts of PFKFB3 in the purified mitochondrial extract of HEK293 cells (FIG. 11 A). We further confirmed the presence PFKFB3 in the mitochondrial extract from WT mouse striatal neuronal (Q-7) cells and post-mortem frontal cortex from healthy controls (FIG. 11B, lane 1; FIG. 11C, lanes 1-4). Since PFKFB3 is present within mitochondria, we tested for its association with mtPNKP and other repair proteins by immunopulldown of PFKFB3 from mitochondrial extract of Q-7 cells using an anti-PFKFB3 antibody. We observed PNKP, mitochondrial DNA polymerase y (POLG) and HIT in the PFKFB3 immunocomplex (FIG. 11D), confirming PFKFB3 as a part of a mitochondrial DNA repair complex. Absence of RNAPII in the mitochondrial extract and immunocomplex provided evidence in favor of mitochondria specific complex formation. To further validate these findings, we performed indirect immunofl uorescence and co-staining of mitochondria and nuclei (by Mito tracker green and DAPI, respectively) which confirmed localization of PFKFB3 in both the mitochondria and nucleus of Q-7 cells (FIG. 11E). We further observed that mitochondrial integrity was severely compromised in striatal neuronal cells from HD mouse with expanded polyQ repeats (Q-l 11), with a significant reduction in PFKFB3 levels (FIGs. 11F, 11H). Western blot analyses also revealed a significant decrease in PFKFB3 levels in the mitochondrial extracts of Q-lll cells (FIG. 11B, lane 2 vs lane 1) and HD post-mortem patients’ brains (FIG. 11C, lanes 5-8 vs lanes 1-4). However, the level of PNKP was similar in both Q-lll cells and HD patient extracts compared to respective controls (FIGs. 11B and 11C). consistent with our previous findings. These observations suggest that the DNA strand break repair components are active in mitochondria of healthy cells / tissues but are compromised under pathogenic conditions. The presence of PFKFB3 in the nucleus and mitochondria further emphasizes its additional function in the DNA repair pathway beyond its known role in glycolysis.

[0467] We next examined if F2,6BP is present in the mitochondria of healthy individuals and if its level is reduced in the post-mortem HD patients in line with low PFKFB3 levels and PNKP activity. Not only did we detect F2,6BP in the mitochondrial extract of healthy subjects, but we also found that the level of F2,6BP was nearly 2.5-fold lower in the mitochondrial extracts of patient samples (FIG. Ill; Left Panel), Since the level of mtPNKP protein remained comparable in HD patients and their age-matched controls, consistent with our previous observations in nuclei, the reduction in mtPNKP activity is therefore due to lower levels of F2,6BP and not due to decrease in the level of PNKP. These results convincingly suggest that an endogenous metabolite F2,6BP, a well-known potent activator of glycolysis, also plays an important additional role in maintaining activity of an essential DNA repair enzyme and thereby contributes to cellular health.

[0468] Dysregulalion of mitochondrial junction in HD

[0469] To gain further insight into mitochondrial quality and functionality, we measured the mitochondrial membrane potential, a key indicator of mitochondrial health. For this purpose, we utilized tetramethyl rhodamine methyl ester (TMRM) that is readily sequestered in healthy cells with functional mitochondria, emitting a red-orange, fluorescent signal. Flow cytometry (FACS) analysis revealed a significant decrease in membrane potential in the Q-lll cells relative to Q-7 cells (FIGs. 12A-12C).

[0470] Additionally, we used MitoViewTM650, a mitochondria specific dye which enables realtime visualization of mitochondrial morphology, distribution, and dynamics in live cells without relying on membrane potential. This dye has an excitation / emission spectrum of 644 / 670 nm, compatible with the Cy®5 channel. Pure mitochondria were isolated from postmortem HD brain frontal cortex vs healthy controls, stained with MitoView™650, and analyzed using the 670 nm channel. A single uniform population of mitochondria was found in healthy controls; however, heterogeneous mitochondrial populations were observed in HD samples (FIG. 12E-12G), which may be attributed to some irregularities in mitochondrial function and health associated with HIT aggregation or reduced level of F2.6BP. Hence, our data clearly indicates that decreased levels of mitochondrial PFKFB3 / F2,6BP in HD are associated with compromised mitochondrial health and function. Consistent with our results in the HD patients, we observed significantly higher level of mtROS in Q-lll cells (FIG. 12H), indicating pathological consequences.

[0471] To assess mitochondrial function further, we measured cellular respiration in Q-7 vs Q-111 cells (FIGs. 12I-12M). These measurements were carried out using the Seahorse XF Cell Mito Stress Test protocol, both under baseline conditions and after the application of mitochondrial inhibitors. Our observations indicated a significant reduction in oxygen consumption rate (OCR) in Q-lll cells (FIG. 121). We also observed significantly less non-mitochondrial oxygen consumption (FIG. 12J), and in their basal, maximal, and spare respiration capacities (FIG. 12K-12M). Taken together, these results suggest that a pool of endogenous PFKFB3 is localized in mitochondria and that the level of PFKFB3 and its metabolic product, F2,6BP is less in Q-lll HD cells that correlates with compromised mitochondrial function, such as mitochondrial membrane potential and respiration. Exogenous F2,6BP restores mitochondrial PNKP activity by direct binding Given that F2,6BP enhanced PNKP activity in the HD patient brain-derived nuclear extracts, we investigated whether F2,6BP could similarly restore PNKP activity in mitochondrial extracts. We synthesized F2,6BP in vitro biochemically using recombinant PFKFB3 followed by purification using ion exchange chromatography. Electrospray ionization (ESI) mass-spectrometry showed the purity of F2,6BP (FIG. 13A). We then determined the binding affinity of PNKP for F2.6BP by monitoring changes in intrinsic tryptophan fluorescence of PNKP upon binding to F2,6BP. Addition of F2,6BP (400 nM) to PNKP resulted in partial quenching of the tryptophan fluorescence of PNKP at 340 nm, when excited at 295 nm with no change in the emission maximum (FIG. 13B). Binding affinity (Kd= 525 ± 25 nM) was determined by following fluorescence quenching (a measure of ligand binding) as a function of F2,6BP concentration (FIG. 13C). A representative plot of relative fluorescence intensities versus concentration of F2,6BP is shown in FIG. 13C (inset).

[0472] We next investigated the effect of F2,6BP in restoring activity of PNKP in the mitochondrial extracts. Exogenous F2,6BP restored the 3’ -phosphatase activity of PNKP in a dose-dependent manner in mitochondrial extracts isolated from post-mortem HD brains (frontal cortex) across different age and gender groups (FIG. 13D, lanes 5-6 vs lane 4). However, related natural metabolites, neither fructose-6-phosphate (F6P) nor fructose 1,6-bisphosphate (Fl,6BP) could restore PNKP activity (FIG. 13D, lanes 7 and 8), highlighting the specificity of F2,6BP in reactivating PNKP. In our previous study, we found compromised PNKP activity in the nuclear extract of Q-lll cells compared to WT cells (Q-7). Therefore, we assessed PNKP activity in the mitochondrial extracts of Q-7 vs Q-lll cells and observed a significant reduction in 3 ’-phosphatase activity in Q-lll cells (FIG. 13E, lane 3 vs lane 2; lane 7 vs lane 6). A similar dose-dependent restoration by F2,6BP was observed in mitochondrial extracts from Q-lll cells (FIG. 13E, lanes 4-5 vs lane 3; lanes 8-9 vs lane 7), underscoring the essential role of F2,6BP as a co-factor, in enhancing PNKP-mediated DNA repair in mitochondria.

[0473] To further evaluate the potential of exogenous F2,6BP in restoring DNA repair deficiency at the cellular level, we assessed in-cell rescue of genome integrity and functionality in Q-111 cells compared to WT Q-7 cells. F2,6BP was delivered following an optimized protocol and allowed 72 or 96 hours to alleviate mtDNA damage-induced cellular toxicity. As a control, Q-lll cells were either mock transfected or transfected with F 1,6BP. The restoration of 3 ’-phosphatase activity of PNKP was observed in a time-dependent manner exclusively in the mitochondrial extracts of F2,6BP-transfected cells (FIG. 14A, lanes 6-7 vs lane 4), but not in cells transfected with either F1,6BP or the mock-transfected cells (FIG. 14A, lanes 8-9 or lane 5). We also observed significant restoration of mitochondrial genome integrity following treatment with F2.6BP, concurrent with rescue of mtPNKP activity (FIG. 14B, lanes 5-6 vs lane 3). In our earlier study, we observed a significant increase in the Q- 111 cell count following F2,6BP treatment, comparable to control Q-7 cells, contrary to the decreased count under mock treatment condition. Therefore, our study further indicates that apart from nuclear DNA repair, repair of mtDNA substantially contributes to the rescue of the diseased cells from neurotoxicity and apoptosis.

[0474] Exogeneous F2,6BP suppresses pathogenic HTT aggregate formation

[0475] Live cell imaging further demonstrated that the treatment with F2.6BP could partially restore the mitochondrial integrity and PFKFB3 level in Q-lll cells (FIGs. 11G, 11H) consistent with its effect on restoration of PNKP activity and repair of mtDNA damage. Consequently, we observed a decreased association of PFKFB3 in the PNKP immunocomplex from mitochondrial extract of Q-lll cells (FIG. 15A, lane 8 vs lane 7); however, such association was restored in F2,6BP-treated Q-lll cells (FIG. 15A, lane 9 vs lane 8). This restoration in PFKFB3 level was accompanied by a significant increase of mitochondrial membrane potential (FIG. 12D) and decrease in mtROS level (FIG. I2H) in Q-lll cells. Notably, mitochondrial respiration, as reflected in OCR, non -mitochondrial oxygen consumption, basal and maximal respiration and spare respiratory capacity showed significant enhancement upon supplementation of F2,6BPin Q-lll cells (FIG. 12I-12M).

[0476] The polyQ expanded HIT proteins are known to be cleaved at the N-terminus, forming pathogenic aggregates, a hallmark of HD pathology. To monitor these pathogenic protein aggregates, we used Thioflavin-T (ThT), a benzothiazole dye considered a 'gold standard’ for detecting neurodegenerative aggregates due to its affinity for p-sheet structures. Microscopic analyses following co-staining with ThT and NucRed (a nuclear specific dye) showed significant increase in aggregate formation in Q-lll cells (FIG. L5B, Middle Panel) compared to Q-7 cells (FIG. 15B, Upper Panel). Remarkably, F2,6BP treatment substantially reduced aggregate formation in Q-lll cells (FIG. 15B, Lower Panel). We also used a monoclonal antibody (MW8) that efficiently recognizes mlTTT aggregates. Staining revealed aggregate formation throughout Q-lll cells including the nuclei. The treatment of Q-lll cells with F2,6BP markedly reduced MW8 staining suggesting reduced aggregation (FIG. 15C). Taken together, these results indicate a correlation between HTT aggregate formation, PFKFB degradation and impairment of PNKP-mediated DNA strand break repair under pathological conditions, which can be significantly rescued by F2.6BP supplementation.

[0477] F2,6BP supplementation restores mitochondrial DNA integrity in Drosophila HD models

[0478] In our previous study, we demonstrated that the pan-neuronal expression of Ht128Q (BDSC# 33808 x 458) resulted in significant impairment of motor neuron function compared to the control used to generate the strains (will 8). When flies were supplemented with F2,6BP for 21 days, vs mock buffer control, motor function was restored, as shown by the climbing assay results. To further investigate whether F2,6BP supplementation would alleviate mitochondrial repair deficiencies, we examined the DNA strand break accumulation in Drosophila mitochondrial genome by LA-qPCR. Flies expressing Httl28Q and treated with mock buffer showed elevated level of mtDNA damage (FIG. 16, lane 2 and 4 vs lane 1), indicating that the mock buffer could not restore mitochondrial genome integrity. However, significant repair was observed following F2.6BP supplementation and the genome integrity was comparable to the W1118 flies (FIG. 16, lane 3 and 5 vs lane 1). These findings confirm the ability of F2,6BP to specifically reverse the HD neurodegenerative phenotype in vivo in neuronal cells by restoring nuclear and mitochondrial DNA repair.

[0479] Our previous study demonstrated that PFKFB, an enzyme traditionally known for its glycolytic function, translocates to the nucleus and participates in nuclear DNA repair via transcription-coupled non-homologous end-joining (TC-NHEJ) pathways. We hypothesized that locally produced F2,6BP is transferred directly to PNKP within the TC-NHEJ complex to potentiate 3 ’-phosphatase activity of PNKP. This process is severely impaired under HD pathogenic conditions. Our present study provides compelling evidence that PFKFB3 and its product F2,6BP are essential also for maintaining mitochondrial PNKP activity, thereby supporting efficient mitochondrial genome repair. Our findings further suggest that this repair function of PFKFB3 and F2,6BP is crucial for mitochondrial health and function. Notably, we observed that F2,6BP treatment in cells partially restores mitochondrial integrity, membrane potential and reduces the pathogenic aggregate formation in neuronal cells expressing polyQ-expanded HTT. It was generally believed that PFKFB3 levels are generally low in neurons compared to other brain cells, such as astrocytes, but now has been established that PFKFB3 is stabilized during brain excitation. Our results are consistent with this report as it shows that PFKFB3’s level is low both in the nucleus and in mitochondria under pathogenic condition but not in post-mitotic healthy neurons. Mitochondria are the sites of cellular energy production. However, recent studies provide evidence of a far wider range of mitochondrial functions. Among these, the roles of mitochondria in intracellular signaling and in communication with other cellular organelles have been elucidated in various organisms. In particular, stressed mitochondria appear to induce beneficial response through effective mitochondrial-nuclear communication. This process is called “Mitochondrial retrograde signaling”- a mechanism by which mitochondria communicate to the nucleus about their functional status. Our results suggest that a small molecule metabolite, F2,6BP can coordinate such communication by potentiating DNA repair in both these organelles. Currently, no curative therapy is available to halt or reverse HD pathology. Previously, a synthetic small molecule, XJB-5-131 (developed by McMurray’s group), a radical scavenger and uncoupler of oxidative phosphorylation, showed promise as a therapeutic compound by suppressing disease phenotypes in HD mouse models. 'Therefore, rescuing diseased cells from oxidative DNA damage could provide a therapeutic approach. Our results in Q- 111 cells and in Drosophila provide an avenue of rescue of oxidative stress-induced nuclear and mitochondrial DNA damage through F2,6BP supplementation, concurrent with improved mitochondrial functionality. Importantly, an endogenous, naturally occurring molecule produced in the body can essentially harness the body’s own mechanisms to promote healing. This “therapeutics from within” approach can involve manipulating the levels of F2,6BP to achieve therapeutic benefit. 'Thus, our results provide support for the use of F2,6BP supplementation or a non-toxic analog to prevent key aspects of HD progression by maintaining nuclear and mitochondrial genomic integrity.

[0480] Recent reports have demonstrated that medium spiny neurons (MSNs) are the most vulnerable cell types in HD striatum. Cholinergic neurons, despite somatic expansion of CAG repeats, are not significantly lost in HD striatum. The authors concluded that somatic repeat expansion is required but not sufficient for neuronal loss. We consider that differential sensitivity of various cell types is attributed to the residual F2,6BP level and consequent PNKP activity in both mitochondria and nucleus, and that degradation of PFKFB3 and the resultant decrease in intracellular F2,6BP level in MSNs is severe, affecting PNKP activity leading to persistent DSBs and cell death.

[0481] Methods

[0482] Cell culture

[0483] Human Embryonic Kidney 293 (HEK293; ATCC CRL-1573) cells were grown at 37°C and 5% CO2 in DMEM: F-12 (1:1, Cellgro) medium containing 10% fetal bovine serum (Sigma), 100 units / ml penicillin, and 100 units / ml streptomycin (Cellgro). Mouse striatum derived cell line from a knock-in transgenic mouse containing homozygous Huntingtin (HTT) loci with a humanized Exon 1 containing 7 or 111 polyglutamine repeats (Q-7 and Q-l 11; Cornell Institute; Cat# CH00097 and CH00095, respectively) were cultured and maintained in Dulbecco Modified Eagles Medium (high glucose) with 2 mM L-glutamine containing 10% fetal bovine serum, 100 units / ml penicillin and streptomycin, and 0.4 mg / ml G418. Q-lll cells lose the ability to proliferate and survive. Therefore, high-passage numbers were avoided. We routinely tested for mycoplasma contamination in cultured cells using the Mycoalert Mycoplasma Detection Kit (Lonza) according to the manufacturer’s protocol, and the cells were found to be free from mycoplasma contamination.

[0484] Isolation of mitochondria and mitochondrial extracts from cultured cells and postmortem human tissues

[0485] Mitochondria were extracted from cultured cells and post-mortem tissues using mitochondria isolation kits from Thermo Fischer (Cat# 89874 and 89801). Isolated mitochondria were washed with PBS, treated with trypsin (1 mg / ml in PBS) for 15 min at room temperature to remove contaminating proteins adhering to the outer surface of mitochondria, and then extensively washed with PBS. The washed mitochondria were lysed in 50 mM Tris, pH 7.5, 150 mM NaCl, 1 mM EDTA, 1 mM DTT, and 1% Triton X-100 to prepare purified mitochondrial extract.

[0486] Immunoblotting

[0487] The proteins in the mitochondrial extracts were separated onto a Bio-Rad 4-20% gradient Bis-Tris gel, then electro -transferred on a nitrocellulose (0.45 gm pore size; GE Healthcare) membrane using IX Bio-Rad transfer buffer. The membranes were blocked with 5% w / v skimmed milk in TBST buffer (IX Tris-Buffered Saline, 0.1% Tween 20), then immunoblotted with appropriate antibodies [PNKP (BB-AB0105, BioBharati Life Science), PFKFB3 (GTX108335, GeneTex), COX4 (GTX114330, GeneTex)]. The membranes were extensively washed with 1% TBST followed by incubation with anti -iso type secondary antibody (GE Healthcare) conjugated with horseradish peroxidase in 5% skimmed milk at room temperature. Subsequently, the membranes were further washed three times (10 min each) in 1% TBST, developed using ECLTM Western Blotting Detection Reagents (RPN2209, GE Healthcare) and imaged using Kwikquant image analyzer and image analysis software (ver 5.2) (Kindle Biosciences). Cytosolic and nuclear extracts were prepared as described earlier22 and their purity was checked by immunoblotting with GAPDH (BB-AB0060 BioBharati Life Science) and HDAC2 (GTX109642, GeneTex) antibodies, respectively.

[0488] Immunopulldown (IP)

[0489] Mitochondrial extracts from Q-7 and Q-lll cells were immunoprecipitated using PFKFB3 and PNKP Abs and with Protein A / G PLUS agarose beads (Sc-2003, Santa Cruz Biotechnology) overnight, followed by four washes with Wash buffer [20 mM HEPES (pH 7.9), 150 mM KCl, 0.5 mM EDTA, 10% glycerol, 0.25% Triton-X-100 and IX protease inhibitors] and eluted with Laemmli Sample Buffer (Bio Rad; final concentration IX). The immunoprecipitates were tested for the interacting proteins using appropriate Abs [PFKFB3, HIT, PNKP, POLG (MA5-57385), Lig Illa (in-house) and RNAPII (920202, pSer2, H5 Ab).

[0490] Human tissue samples

[0491] Deidentified human post-mortem frontal cortex tissue of HD patients (detailed in our earlier publication) and age-matched controls (IRB exempt) were obtained from the biorepository of the Michigan Brain Bank, USA through a Materials Transfer Agreement.

[0492] Assay of 3 ’ -phosphatase of mtPNKP

[0493] The 3 ’-phosphatase activity of PNKP in the mitochondrial extract of post-mortem patients’ frontal cortex and age-matched control subjects or Q-7 or Q-l 11 cells (250 ng) or with purified recombinant PNKP (2 ng) was conducted as we described previously. Five pmol of the radiolabeled substrate was incubated at 37°C for 15 min in buffer A (25 mM Tris-HCl, pH 8.0, 100 mM NaCl, 5 mM MgC12, 1 mM DTT, 10% glycerol and 0.1 pg / pl acetylated BSA). 5 pmol of non-radiolabeled substrate was used as cold substrate. For in vitro PNKP restoration, similar assays were done after incubation of F2,6BP / F6P / F1,6BP (in amounts as indicated in the figure legends) with the mitochondrial extracts for 15 min. The radioactive bands were visualized using a Phosphorlmager (GE Healthcare) and quantitated using ImageQuant software. The data are represented as % product (released phosphate or kinase product) released from the radiolabeled substrate with a value arbitrarily set at 100%.

[0494] Enzymatic preparation ofF2,6BP

[0495] Enzymatic preparations of F2,6BP were conducted following the protocol as described.

[0496] Estimation oj'F2,6BP in patients’ extracts The quantitation of F2,6BP from the purified mitochondrial extract of post-mortem patients was performed as described before.

[0497] Long amplicon quantitative PCR (LA-qPCR )

[0498] Genomic DNA was extracted from post-mortem tissues, striatal neuronal cells and Drosophila (10 each) using the Genomic tip 20 / G kit (Qiagen) per the manufacturer’s protocol, to ensure minimal DNA oxidation during the isolation steps. The DNA was quantitated by Pico Green (Molecular Probes) in a black-bottomed 96-well plate and gene-specific LA qPCR assays were performed as described earlier using Long Amp Taq DNA Polymerase (New England BioLabs). The amplified products were then visualized on gels and quantitated with ImageJ software (NIH). The extent of damage was calculated in terms of relative band intensity with a control / mock-treated sample or w!118 sample (for Drosophila studies) considered as 100. All oligos (LA: long amplicon and SA: short amplicon) used in this study are listed below:

[0499] Oligo sets for amplification of mitochondrial fragment from mouse genome (Q-7 and Q-lll cells):

[0500] For LA PCR: LA 1: (5 '-3') GCCAGCCTGACCCATAGCCATATTAT (SEQ ID NO: 1 ); LA 2: (5'-3') GAGAGATTTTATGGGTGTATTGCGG (SEQ ID NO: 2);

[0501] For SA PCR: SA 1: (5'-3') CCCAGCTACTACCATCATTCAAGT (SEQ ID NO: 3); SA 2: (5 '-3') GATGGTTTGGGAGATTGGTTGATG (SEQ ID NO: 4).

[0502] Oligo sets for amplification of mitochondrial fragment from human genome (postmortem patients):

[0503] For LA PCR: LA 1: (5 '-3 ') TCTAAGCCTCCTTATTCGAGCCGA (SEQ ID NO: 5); LA 2: (5'-3') TTTCATCATGCGGAGATGTTGGATGG (SEQ ID NO: 6).

[0504] For SA PCR: SA 1: (5'-3') CCCCACAAACCCCATTACTAAACCCA (SEQ ID NO: 7);

[0505] SA 2: (5 '-3') TTTCATCATGCGGAGATGTTGGATGG (SEQ ID NO: 6).

[0506] Oligo sets for amplification of mitochondrial fragment from Drosophila genome: For Fragment 1: LA 1: (5'-3') TGTGAATAATAGCCCCAGCACA (SEQ ID NO: 8); LA 2: (5'-3') GCTGGAATGAATGGTTGGACG (SEQ ID NO: 9);

[0507] SA 1: (5'-3') ACACCTGCCCATATTCAACCA (SEQ ID NO: 10);

[0508] SA 2: (5'-3') ACTGGTCGAGCTCCAATTCA (SEQ ID NO: 11);

[0509] For Fragment 2: LA 3: (5'-3') GTGAATAATAGCCCCAGCACA (SEQ ID NO: 12); LA 4: (5'-3') AGGCTGGAATGAATGGTTGGA (SEQ ID NO: 13);

[0510] SA 3: (5'-3') ACCTGCCC ATATTCAACCAGA (SEQ ID NO: 14);

[0511] SA 4: (5'-3') TCAACTGGTCGAGCTCCAAT (SEQ ID NO: 15).

[0512] Binding of F2,6BP to PNKP

[0513] Addition of F2,6BP (400 nM) to PNKP resulted in partial quenching of the tryptophan fluorescence of PNKP at 340 nm, when excited at 295 nm with no change in the emission maximum. Binding affinity (Kd) was determined by following fluorescence quenching (a measure of ligand binding) as a function of F2,6BP concentration. The maximum quenching of fluorescence intensity observed at saturating concentration of F2.6BP was taken as 1, and the observed quenching at different concentrations of F2,6BP was plotted as the fraction bound versus free F2,6BP concentration. Binding of F2,6BP to PNKP was analysed using GraphPad Prism Software, San Diego, CA using the equation:

[0514]

[0515] where X is the total ligand concentration and Rtot is the total receptor concentration (Same units as X). LR refers to ligand bound to the receptor and L is the free ligand concentration.

[0516] In cell delivery of the exogenous F2,6BP / F1,6BP in Q-7 and Q-lll cells

[0517] For delivery of the glycolytic metabolites into the mouse striatum-derived neuronal cells (Q-7 and Q-lll), we followed the protocol optimized in our lab20. Briefly, 200 pM of F2,6BP or F1,6BP was mixed with 25 pM cell-permeable carrier peptide K16ApoE (Mayo Proteomic Core Facility) and incubated for 45 min at RT; then metabolite -peptide mix was added to the cells and incubated for 6 h in reduced serum (oPTIMEM) media. After 6 h, FBS containing complete media was added and cells were harvested at 72 and 96 h for DN A repair assays / LA-qPCR.

[0518] Antibodies and chemicals for immunostaining and flow cytometry

[0519] The antibodies and chemicals used for immunostaining were as follows: Mouse Anti-HTT antibody-MW8 (Creative Biolab, San Diego, USA), Tetramethylrhodamine Methyl Ester Perchlorate (TMRM) from ThermoFischer scientific, USA, Thioflavin-T (Sigma-Aldrich, USA), DAPI (Novus, USA), NucRed dye (647) and MitoTracker from Invitrogen, USA). FACS analysis

[0520] TMRM is widely used for assessing mitochondrial membrane potential due to its ability to accumulate within mitochondria in proportion to membrane potential, as predicted by the Nernst equation. The cells were grown on 10 cm cell culture dishes in DMEM at 37°C with 5% CO₂. The staining protocol was as follows: Briefly, TMRM (1 pM) stock solution and Verapamil (2 nM) were mixed in a ratio of 2:1 and the cells were incubated in the staining solution for 1 hour at 37°C. Fluorescence intensity was measured by flow cytometry (FACSCalibur, BD Biosciences, CA, USA) using Cell Quest Pro software (version 5.2, BD Biosciences, Franklin Lakes, NJ, USA). Each experiment was performed in duplicate.

[0521] Estimation of Mitochondrial ROS level

[0522] Reactive oxygen species (ROS) levels in tissue / cell extracts were estimated using the fluorescent dye H2DCFDA. Tissue samples were homogenized in ice-cold phosphate-buffered saline (PBS), centrifuged at 10,000 x g for 10 minutes at 4°C, and the supernatant was collected. The extracts were incubated with 10 μM H2DCFDA at 37°C for 30 minutes in the dark. Fluorescence intensity was measured using a microplate reader at 485 nm excitation and 530 nm emission wavelengths. ROS levels were expressed as relative fluorescence units (RFU) normalized to total protein content. Data represents the mean of 14 diseased and 14 control samples, each analyzed in triplicate, and are presented with standard error.

[0523] Mitochondrial respiration by sea-horse analyses

[0524] Mitochondrial respiratory function was evaluated in Q-7 (wild-type) and Q-lll (HD) cell lines using the Seahorse XF96 Cell Mito Stress Test. Q-111 cells were treated with F2,6BP (200 μM) and allowed to recover for 72 hours prior to analysis. Both untreated Q-7 and Q-lll cells, as well as F2,6BP-treated Q-lll cells, were plated at a density of 25,000 cells per well in Seahorse XF96 plates. Oxygen consumption rate (OCR) was measured under basal conditions and in response to sequential injections of mitochondrial modulators. First, oligomycin was added to inhibit ATP synthase, allowing for assessment of ATP-linked respiration through the corresponding drop in OCR. This was followed by the injection of FCCP, a mitochondrial uncoupler that induces maximal respiration by collapsing the proton gradient, revealing the spare respiratory capacity. Finally, antimycin A, a complex III inhibitor, was introduced to inhibit the electron transport chain, enabling the determination of non-mitochondrial respiration by analyzing the differences in OCR between oligomycin and antimycin A treatments. This approach allowed for comparative evaluation of basal respiration, maximal respiratory capacity, and mitochondrial efficiency between the two cell lines and treatment conditions.

[0525] Example 3. Fructose-2,6-bisphosphate restores TDP-43 pathology-driven genome repair deficiency in motor neuron diseases

[0526] TAR DNA-binding protein 43 (TDP-43) proteinopatliy plays a critical role in neurodegenerative diseases, including amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD). We recently reported that TDP-43 plays an essential role in DNA doublestrand break (DSB) repair via the non-homologous end-joining (NHEJ) pathway. Here, we provide evidence that the brain of patients with ALS exhibit persistent DNA damage in the transcribed regions of the genome. While investigating the mechanistic basis, we found that the activity of polynucleotide kinase ’-phosphatase (PNKP) was severely impaired in the nuclear extracts of patient brains and TDP-43-depleted cells. PNKP is a key player in DSB repair within the transcribed genome, where its 3 ’-phosphate termini processing activity is crucial for preventing persistent DNA strand breaks and neuronal death. The inactivation of PNKP was due to the reduced level of its interacting partner, phosphofructo-2-kinase fructose 2,6 bisphosphatase (PFKFB3), and its biosynthetic product, fructose-2,6-bisphosphate (F2,6BP), an allosteric modulator of glycolysis. Recently, we have demonstrated that F2,6BP acts as a positive modulator of PNKP activity in vivo. Furthermore, F2,6BP supplementation in cultured ALS patient-derived neural progenitor stem cells (NPSCs) reduced the toxic aggregation of polyubiquitinated TDP-43 and cytosolic pTDP-43 (S409 / 410). Notably, F2,6BP supplementation restored the PNKP activity in the nuclear extracts from autopsied ALS / FTD brain tissues and patient iPSC-derived NPSCs harboring TDP-43 mutations. Importantly, F2,6BP administration significantly restored the genome integrity and motor phenotypes in a Drosophila model of ALS-TDP-43. Collectively, these findings underscore the therapeutic potential of F2,6BP in TDP-43 pathology-associated motor neuron diseases.

[0527] Amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD) are neurodegenerative diseases predominantly marked by dysfunction and toxicity of TAR DNA-binding protein of 43 kDa (TDP-43), which drives the progressive degeneration of motor neurons. TDP-43 pathology in these diseases is characterized by the loss of nuclear TDP-43 and its accumulation in the cytoplasm, disrupting cellular pathways in motor neurons. Our recent studies demonstrated that TDP-43 plays a key role in the classical non-homologous end- joining (C-NHEJ) pathway, which is primarily responsible for repairing DNA double-strand breaks (DSBs) in post-mitotic neurons. Upon DNA damage, TDP-43 is rapidly recruited to DSB sites, where it stably interacts with DNA damage response (DDR) and NHEJ factors, facilitating the recruitment of classical NHEJ factors, including the break-sealing XRCC4-DNA Ligase 4 (Lig4) complex in induced pluripotent stem cell (iPSC)-derived motor neurons. We also showed that mislocalization of ALS-linked mutant TDP-43 significantly impaired NHEJ-mediated DSB repair, leading to the accumulation of DNA damage, cellular senescence, and increased neuroinflammation. Notably, the compromised NHEJ repair in the TDP-43 proteinopathy is associated with reduced recruitment of the XRCC4-Lig4 complex at DSB sites. However, the precise mechanism by which TDP-43 regulates C-NHEJ remains unclear.

[0528] In ALS and LTD, enhanced production of reactive oxygen species (ROS) and persistent neuroinflammation can lead to oxidative genome damage and DNA single-strand breaks (SSBs) and double-strand breaks (DSBs). Polynucleotide kinase 3 ’-phosphatase (PNKP) is a bifunctional DNA end-processing enzyme with ’-phosphatase and 5 ’-kinase activities, and a major 3 ’-phosphatase in mammalian cells that converts repair-incompetent broken DNA ends to ligatable ends, a crucial step in DSB repair. It is involved in several DNA repair pathways, including base excision repair (BER), SSB, and C-NHEJ-mediated DSB repair in mammalian cells. Importantly, functional loss of PNKP in neuronal cells has been linked to several neuropathological conditions. Additionally, we have demonstrated that PNKP plays an essential role in the preferential repair of actively transcribed genomes via transcription-coupled SSB (TC-SSBR) and NHEJ (TC-NHEJ) repair pathways. Notably, our studies reveal that the 3 '-phosphatase activity of PNKP is severely compromised in the two most prevalent polyQ neurodegenerative diseases - Huntington’s disease (HD) and spinocerebellar ataxia type 3 (SCA3).

[0529] Several studies provided strong mechanistic evidence linking metabolic reprogramming and DNA repair activity through the direct involvement of metabolic enzymes and metabolites. We recently showed that 6-phosphofructo-2-kinase fructose-2,6-bisphosphatase 3 (PFKFB3), the only member in the PFKFB family (PFKFB1-4) present in the nucleus, associates with and regulates PNKP functionality in mammalian cells. PFKFB3 converts fructose-6-phosphate (F6P) to fructose-2,6-bisphosphate (F2,6BP), a key inducer of glycolysis. Notably, the levels of both PFKFB3 and its product, F2,6BP, are significantly lower in the nuclear extract (NE) of autopsied HD and SCA3 patients’ brain tissues. Interestingly, supplementation of F2,6BPin HD mouse-derived striatal neurons and HD flies restores nuclear and mitochondrial genome integrity and functionality, suggesting F2,6BP to be a positive regulator of PNKP activity in vivo. Reduced levels of PFKFB3 are therefore linked to the decreased PNKP activity in HD and SCA3, connecting metabolic processes to DNA repair.

[0530] TDP-43 plays a crucial role in C-NHEJ, interacting with other NHEJ factors, such as XRCC4-Lig4, which also associate with PNKP and PFKFB3. Therefore, we reasoned that these proteins might be part of the same molecular complex involved in DSB repair. PNKP interactome studies showed that TDP-43 is associated with PNKP, PFKFB3, Lig4 and other repair proteins, forming a complex involved in TC-NHEJ. These observations led us to investigate the role of PNKP and PFKFB3 in ALS and FTD models showing TDP-43 pathology.

[0531] We observed a near-complete loss of 3 ’-phosphatase activity of PNKP, but no change in the protein level, under TDP-43-associated neurodegenerative conditions, correlating with TDP-43 mislocalization and persistent DNA damage. Furthermore, we observed reduced levels of PFKFB3 and F2,6BP in ALS / FTD patient tissues, indicating potential disruptions in the glycolytic pathway that may exacerbate genomic instability associated with TDP-43 pathology.

[0532] Importantly, such PNKP-mediated repair deficiency could be restored by exogenous supplementation of F2,6BP in extracts isolated from ALS / FTD patients’ brain tissues and patient-derived NPSCs. Supplementation of F2,6BP reduced pathogenic phosphorylation and ubiquitination of TDP-43, resulting in a significant reduction of aggregates of TDP-43 in ALS patient-derived NPSCs. The fruit fly, Drosophila melanogaster, has emerged as a powerful in vivo system to dissect the complex cellular and molecular mechanisms underlying neurodegenerative diseases, owing to its sophisticated genetic toolkit and the high conservation of fundamental biological pathways with humans. Notably, F2,6BP supplementation also significantly rescued motor deficiency in a Drosophila model of ALS harboring TDP-43Q33 IK mutation, a well-established model that recapitulates key features of the human disease, including progressive, age-dependent motor decline and neurodegeneration. Overall, our findings support the use of F2,6BP in ALS, FTD and other neurodegenerative diseases linked to TDP-43 pathology via restoring DNA repair.

[0533] Methods

[0534] Cell culture and stable cell line generation

[0535] Human embryonic kidney HEK293 (ATCC) cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) with high glucose, supplemented with 10% fetal bovine serum (FBS) and 100 U / ml penicillin-streptomycin in a humidified chamber at 37°C and 5% CO2. To generate the PNKP-FLAG-expressing stable HEK293 cell line, the coding DNA sequence of human PNKP (GenBank BC033822.1) was re-cloned to pFLAG-cDNA (Invitrogen / Life Technologies) between the CMV promoter and FLAG-tag encoding sequences at HindTII and Bamlll sites. The gene in the newly constructed plasmid carried the natural Kozak sequence and nucleotides 97 -1,669 of PNKP cDNA. The region containing Kozak-PNKP-FLAG was then transferred to pcDNA3.1-Hygro (Invitrogen / Life Technologies) within the Hindlll-Xbal unique vector sites to generate the final plasmid, which was then used for generating a stable cell line resistant to hygromycin (Hygro), following standard procedures (17). Ectopic expression of PNKP was confirmed by western blotting of whole-cell extract using anti-FLAG Ab (Sigma, FT 804).

[0536] siRNA transfection

[0537] TDP-43 depletion was carried out in HEK293 cells using siRNAs (80 nM; transfected twice on consecutive days) against the TARDBP gene. The cells were transfected with control siRNA (siControl) or TDP-43-specific siRNA (siTDP-43; Thermo Fisher; Silencer Select; 4392420) using Lipofectamine 3000 (Invitrogen) for 6 h in optiMEM (Gibco; reduced serum media, 11058021), followed by replacing the medium with DMEM-High Glucose complete medium. Nuclear extracts (NE) were prepared from the harvested cells (72-96 h posttransfection) to examine the depletion of individual proteins by immunoblot (IB) analysis using specific antibodies.

[0538] Neural Progenitor Stem Cell (NPSC) induction and motor neuron differentiation Control and TDP-43 mutant induced pluripotent stem cells (iPSCs) were cultured on basement membrane matrix Geltrex LDEV-Free-coated Petri dishes using IX Essential 8 media (Gibco, A1 17001) and maintained in a humidified incubator at 37°C in 5% CO2. To derive NPSCs, PSC neural induction medium (Gibco A1647801) was used, as per the manufacturer’s protocol. The process involved replacing the Essential 8 media with PSC neural induction media approximately 24 h after sub-plating those iPSCs. This media was maintained for 7 days. The first passage (P0) NPSCs were then transferred onto Geltrex (Gibco, A1413201) coated 6-weli plates and cultured in StemPRO neural stem cell SFM media (Gibco, Al 050901 ). Neural induction efficiency was assessed at the third passage by immunofluorescence (IF) staining.

[0539] ALS-linked TDP-43G287Smutant and its CRISPR / Cas9-corrected isogenic TDP-43G287G iPSCs, as well a FTD-related TDP-43A382TiPSCs also containing the C9ORF72 repeats were kind gifts from our collaborators Drs. Van Damme and Van Den Bosch (University of Leuven, Belgium). Details about these iPSC lines and the protocols used to culture these cells were published before. Control and ALS patient-derived TDP-43G298S mutant iPSC (NINDS, NH50216) lines were purchased from NIH-NINDS (47). Engineered homozygous TDP-43Q331Kmutant (Jax, JIPSC1064) and its isogenic control (Jax, JIPSC1104) lines were purchased from Jax iPSC.

[0540] Motor neurons were generated from engineered iPSCs with TDP-43Q331K mutation and its isogenic control line. The differentiation process followed established protocols with some modifications. In brief, iPSC clones were transferred from a 60-cm dish to aT-25 flask filled with neuronal basic medium. The medium consisted of a mixture of 50% Neurobasal medium (Gibco, 21103049) and 50% DMEM / F12 medium (Gibco, 21331020), supplemented with N2 and B27 supplements without vitamin A. Collagenase type IV digestion was performed to facilitate suspension of the iPSC clones. Afterward, the suspended cell spheres were subjected to a series of incubations. Initially, they were treated with various inhibitors, including 5 pM ROCK inhibitor (Y-27632), 40 pM TGF-p inhibitor (SB 431524), 0.2 pM bone morphogenetic protein inhibitor (LDN-193189), and 3 pM GSK-3 inhibitor (CHIR99021). This was followed by incubation in a neuronal basic medium containing 0.1 pM retinoic acid (RA) and 500 nM Smoothened Agonist (SAG) for 4 days. Subsequently, the cell spheres were incubated for 2 days in a neuronal basic medium containing RA, SAG, 10 ng / ml brain-derived neurotrophic factor (BDNF), and 10 ng / ml glial cell-derived neurotrophic factor (GDNF). To dissociate the cell spheres into single cells, they were exposed to a neuronal basic medium containing trypsin (0.025 %) / DNase in a water bath at 37°C for 20 min. Afterward, the cells were pipetted into a medium containing trypsin inhibitor (1.2 mg / ml) to maintain the viability. Following cell counting, a specific number of cells were seeded onto dishes or chamber slides coated with 20 pg / ml Laminin. These cells were incubated for 5 days in a basic neuronal medium containing RA, SAG, BDNF, GDNF, and 10 pM Inhibitor of y-secretase (DAPT). Subsequently, the medium was switched to one containing BDNF, GDNF, and 20 pM DAPT for an additional 2 days. For motor neuron maturation, the cells were cultured in a medium containing BDNF, GDNF, and 10 ng / ml ciliary neurotrophic factor (CNTF) for a period exceeding 7 days.

[0541] ALS, FTD and Guamanian ALS patient brain samples

[0542] The cortical brain samples of sporadic ALS, FTD, Guamanian ALS and their non-neurological controls were obtained respectively from the Veterans Affairs Brain Biorepository (VABB ) and Binghamton University Brain Biorepository (see the cohort lists in Table 3). For preparing the nuclear and cytosolic fractions of protein samples, ~30 mg of brain tissue powder was used for each sample, followed by stepwise fractionations of protein extracts using methods described in later sections. For PNKP activity assays, nuclear extracts were freshly prepared and subjected to the assay immediately for reliable and reproducible outcomes. For the extraction of genomic DNA from these tissue samples, about 20 nig of tissue powder was used for each sample, and the genomic DNA was extracted using commercial kits, as described later.

[0543] ALS mouse brain tissue

[0544] In this study, we have utilized an established mouse model of ALS carrying an endogenous murine Tdp-43 NLS mutation. The Tdp-43ANLS variant was expressed under a motor neuron-specific gene promoter, Mnxl (Hb9), allowing the Tdp-43 pathology to initiate as neurons differentiate with aging and exhibited ALS-like pathological phenotypes at one year of age. At this time point, mice were humanely sacrificed, and their brain cortices were harvested for biochemical assays.

[0545] Immunoblotting (IB)

[0546] For IB analysis, cell lysates were prepared with lx RIPA buffer (Millipore, 20-188) containing the protease inhibitor cocktail (Roche, 11836170001). Protein concentration was measured using lx Bradford reagent (Biorad) in NanoDrop instrument.

[0547] For IB with insoluble fractionates, the pellet from the soluble fractionation of each sample was dissolved in an equal volume of SDS buffer containing 2% SDS, 50 mM Tris-HCl pH 8.0, and 10% glycerol, followed by sonication. Probing with GAPDH in soluble fractions was used to confirm the uniformity in the amounts of starting cell pellets.

[0548] Then, 20 pg protein or an equal volume of sample was loaded into NuPAGE 4-12% Bis-Tris precast gels (Invitrogen) for electrophoretic resolution. After transferring to nitrocellulose membranes, the separated proteins were incubated with target primary and respective secondary antibodies, and the protein signals were detected by adding chemiluminescence reagents (LI-COR) and visualized by LI-COR Odyssey imaging system.

[0549] Co-immunoprecipitation ( Co-IP)

[0550] Approximately 30 mg of brain tissues from ALS / FTD post-mortem patients or healthy controls (Table 3) were homogenized with 4 volumes of ice-cold homogenization buffer [0.25 M sucrose, 15 mM Tris-HCl pH 7.9, 60 mM KC1, 15 mM NaCl, 5 mM EDTA, 1 mM EGTA, 0.15 mM spermine, 0.5 mM spermidine, 1 mM dithiothreitol (DTI), 0.1 mM phenylmethylsulfonyl fluoride (PMSF), and protease inhibitors (ED'I'A-free; Roche)]. Following homogenization, the homogenate was incubated on ice for 15 min and centrifuged at l,000xg to obtain the cell pellet. Cells were lysed in buffer A [10 mM Tris-HCl pH 7.9, 0.34 M sucrose, 3 mM CaC12, 2 mM magnesium acetate, 0.1 mM EDTA, 1 mM DTT, 0.5% Nonidet P-40 (NP-40) and lx protease inhibitor cocktail (Roche)] and centrifuged at 3,500xg for 15 min. Nuclear pellets were washed with buffer A without NP-40 and then lysed in buffer B [20 mM HEPES pH 7.9, 3 mM EDTA, 10% glycerol, 150 mM potassium acetate, 1.5 mM MgC12, 1 mM DTT, 0.1% NP-40, 1 mM sodium orthovanadate (vanadate) and lx protease inhibitors] by homogenization. Supernatants were collected after centrifugation at 15,00()xg for 30 min and DNA / RNA in the suspension was digested with 0.15 U / pl benzonase (Novagen, 70-746-3) at 37°C for 1 h. The samples were centrifuged at 20,000xg for 30 min, and the supernatants collected as NEs. Co-IP was performed using anti-PNKP (BioBharati Life Science, BB-AB0105) antibody with Protein A / G PLUS agarose beads (Santa Cruz Biotechnology, sc2003) overnight, followed by four washes with Wash buffer (20 mM HEPES pH 7.9, 150 mM KC1, 0.5 mM EDTA, 10% glycerol, 0.25% Triton-X-100 and lx protease inhibitors) and eluted with Laemmli Sample Buffer (Bio-Rad; final concentration lx). Tlie immunoprecipitates were tested for the interacting proteins using appropriate Abs [PFKFB3 (GeneTex, GTX 108335), Lig 4 (GeneTex, GTX108820), and TDP-43 (Protein tech, 10782-2- AP)].

[0551] Assay of 3D-phosphata.se activity of PNKP

[0552] The 3 ’-phosphatase activity of PNKP in 1 pg of NE of post-mortem ALS / FTD and age-matched patients’ cortical tissues or with purified recombinant PNKP (2 ng) was assessed, as described previously. Five pmol of the radiolabeled substrate was incubated at 37°C for 15 min in buffer A (25 mM Tris-HCl pH 8.0, 100 mM NaCl, 5 mM MgC12, 1 mM DTT, 10% glycerol and 0.1 pg / pl acetylated BSA). Five pmol of non-radiolabeled substrate was used as a cold substrate. For in vitro PNKP restoration, similar assays were done after incubation of F2,6BP or F6P / FL6BP (as controls) with the NE for 15 min. The radioactive bands were visualized in Phosphorlmager (GE Healthcare) and quantified using ImageQuant software.

[0553] Enzymatic preparation ofF2,6BP

[0554] Enzymatic preparations of F2,6BP were conducted, as described.

[0555] Estimation ofF2,6BP in the patient brain NE To quantify F2,6BP, the F6P assay kit (Sigma- Aldrich) was used to measure the amount of F6P before and after treating the crude NF with 0.1M HC1 and incubating at 37°C for 30 min. Acid treatment converts F2,6BP into F6P. The assay was performed using the manufacturer’s protocol, which uses NADH-linked luciferase bioluminescence.

[0556] Long Amplicon Quantitative PCR (LA-qPCR)

[0557] Genomic DNA was extracted from cultured cells, autopsied brain tissues or adult Drosophila using the Genomic tip 20 / G kit (Qiagen) per manufacturer’s protocol, to ensure minimal DNA oxidation during the isolation steps. The DNA was quantified by Pico Green (Molecular Probes) in a black-bottomed 96-well plate and gene-specific LA-qPCR assays were performed as described earlier using Long Amp Taq DNA Polymerase (New England Biolabs). POLE and RNAPII (12.1 and 11.3 kb) were amplified from experimental and control samples using appropriate oligos. Enolase / NeuroD (transcribed genes; 6 kb) and MyH2 / MyH4 (nontranscribed genes; 6 kb) were amplified from human post-mortem samples. Genomic DNA isolated from adult Drosophila (10 flies from each group, male and female mixed) was used for DNA damage analysis. Two genes (CrebB and Neurexin, ~8 kb) were amplified using appropriate oligos (PMID: 32205441; 39298485). The primers used in this study are detailed in Table 5.

[0558] The LA-qPCR reaction was set for all genes from the same stock of diluted genomic DNA (10-15 ng) sample to avoid variations in PCR amplification during sample preparation. The final PCR reaction conditions were optimized at 94°C for 30 s; (94°C for 30 s, 55-60°C for 30 s depending on the oligo annealing temperature, 65°C for 10 min) for 25 cycles; 65°C for 10 min. Since amplification of a small region is independent of DNA damage, a small DNA fragment (~200-400 bp) from the corresponding gene(s) was also amplified for normalization of amplification of the large fragment. The amplified products were then visualized on gels and quantified using Image! software (NIH).

[0559] Immunoflu rescence ( IF)

[0560] For NPSCs and motor neurons, the chamber slides were pre-coated with Geltrex and Matrigel, respectively, to facilitate cell adherence, Fixation of the cells for IF analysis was performed by replacing the media with a mixture of fresh media and 8% paraformaldehyde (PFA) in PBS at a 1:1 ratio, resulting in a final concentration of 4% PFA. Post-fixation, the slides were permeabilized using 0.2% Triton X-100 in lx PBS, followed by blocking with 5% goat serum-TBS-T (lx TBS with 0.1% Tween-20) to prevent non-specific antibody binding. The cells were then incubated overnight at 4°C with target primary antibodies. Following this step, Alexa Fluor-488 (green) and 647 -conjugated secondary antibodies (Thermo Fisher) were incubated for 1 h, and slides were then mounted with coverslips after applying DAPI-containing mounting media (Sigma-Aldrich, USA) to visualize the nuclei. Imaging was performed using a Zeiss Axio Observer 7 microscope or an Olympus Flouview3000 confocal microscope.

[0561] The primary antibodies used for various experiments were as follows: rabbit anti-TDP-43 (Proteintech, #10, 782-2-Al3), mouse anti-TDP-43 (R& D Systems, #MAB77781), rabbit anti-phospho-TDP-43 (S409 / 410) (Proteinlech, #80,007-1 -RR), and rabbit anti-ubiquitin (Abeam, #19247).

[0562] Proximity Ligation Assay (PLA)

[0563] PLA was conducted to investigate direct protein-protein interactions within cells. Approximately 20,000 cells were seeded per well in 8-well chamber slides for this experiment. After staining, cells underwent a washing step and were then fixed with 4% PFA for 15 min at room temperature. Subsequent steps included permeabilization in 0.2% Triton X-100 in lx PBS for 10 min at RT, followed by washes in PBS to remove any residual permeabilization agent. The in-situ PLA experiment was performed per the manufacturer’s guidelines, using the DuoLink kit (Sigma- Aldrich, USA). After the PL, A procedure, coverslips were mounted using DAPI-containing media (Sigma-Aldrich, USA), and imaging was performed using either a Zeiss Axio Observer 7 microscope or an Olympus Flouview3000 confocal microscope.

[0564] Immunohistochemistry ( IHC)

[0565] Tissue samples were paraffin-embedded and sliced into 5 pm horizontal sections and mounted on charged glass slides. Slides were dewaxed and autoclaved for 10 min at 121°C in 0.01 M citrate buffer pH 6.0 for antigen retrieval. Immunostaining was performed using overnight incubation at 4°C with mouse anti-TDP-43 (R& D Systems, MAB77781, 1:200), and rabbit anti-phospho-TDP-43 (S409 / 410) (Proteintech, 8OOO7-1-RR, 1:300). Nuclei were counterstained with DAPI. Slides were imaged in a confocal laser microscope.

[0566] Comet assay

[0567] The neutral comet assay was performed using the Comet Assay Kit (Trevigen, 4250-50-K), according to the manufacturer’s protocol, to assess the extent of DNA DSBs in each sample. Briefly, a single-cell suspension was prepared by trypsinization of respective cell types ill DPBS buffer, and about 200 cells were smeared in LM Agarose at 37°C in duplicate on each slide. The cornet tails were visualized by staining the DNA with SYBR Gold stain under a fluorescence microscope.

[0568] Drosophila maintenance and treatment

[0569] All Drosophila stocks were maintained at 25°C on standard fly food under a 12:12-h light-dark cycle. Drosophila strains were purchased from Bloomington Drosophila Stock Center (BDSC, Bloomington, Indiana, USA: UAS-TDP43 Q331K (RRID: BDSCJ7959O), which expresses human ALS-linkedTDP43Q331K mutant. The driver-P{GawB}OK6 (RRID: BDSC..64199) expresses GAL4 primarily in motor neurons. BDSC..79590 flies were crossed to BDSC__64199, and flies eclosed from the crosses were collected in fresh food vials and kept under standard conditions for 1 to 2 d for acclimatization. Flies were separated into two vials for mock buffer and F2,6BP treatment. One BD syringe (1 ml) was filled with mock buffer, and the other was filled with F2,6BP (50 pM), and one drop was administered per day to respective cohorts at the same time of the day for 21 consecutive days.

[0570] Climbing or negative geotaxis assay

[0571] The climbing assay was performed as described with minor modifications. Briefly, experimental flies were anesthetized on ice. A group of 10 flies (male and female mixed) per vial was transferred to a 25 ml sterile glass measuring cylinder. The measuring cylinder was divided into six compartments equally; the lowest compartment was labeled with 1 and tire highest compartment was labeled with 6. The measuring cylinder with flies was placed against a white background for better video recording. The cylinder was tapped gently three times to send the flies to the bottom of the cylinder. The climbing time was recorded for 20 s. Five trials were performed for each cohort. The climbing score was calculated at 8 s.

[0572] Statistical Analysis

[0573] All data are expressed as mean ± standard deviation (SD). Comparisons among experimental groups were carried out using Student’s t-test, one-way or two-way ANOVA, as appropriate, for significance. Statistical analyses were performed using GraphPad Prism version 10 software. A p- value of less than 0.05 was set as statistically significant.

[0574] Results

[0575] PNKP activity is significantly reduced in ALS and FTD While our recent studies demonstrated the accumulation of DNA DSB s and a deficiency in NHEJ-mediated DSB repair in ALS brains with TDP-43 proteinopaihies, the potential link between PNKP and TDP-43 has not yet been investigated in the context of DSB repair. Therefore, we assessed the impact of TDP-43 proteinopaihies on the 3 ’-phosphatase activity of PNKP in ALS and FTD brains [validated by cytosolic mislocalization of total TDP-43 and corresponding levels of pathogenic phosphorylated TDP-43 (pTDP-43, S409 / 410)] (FIG. 17D) using a duplex oligo-based in vitro assay (schematically shown in FIG. 17A). We observed a significant inhibition of PNKP activity in the NE isolated from ALS-TDP-43 (Lns 5-7) and FTD- TDP-43 (Lns 8-9) cortical tissues, compared to age-matched healthy controls (Lns 2-4) (FIG. 17B). We further validated this observation in a second cohort of Guamanian-ALS patients (Lns 6-9) and age-matched healthy control (Lns 2-5) brain cortical tissues and found a significant and comparable reduction (~4 fold) of PNKP activity, reinforcing the association between TDP-43 pathology and impaired PNKP function (FIG. 17C). Demographic descriptions of ALS, FTD patients and age-matched non-neurological controls are detailed in Table 3. Furthermore, we quantified relative PNKP levels in the patient brain extracts by immunoblotting (IB) and found them to be comparable to healthy controls (FIG. 17E), indicating the loss of PNKP activity to be independent of its protein levels in ALS and FTD brains. These results collectively showed that dysfunction of PNKPis common in ALS, Guam-ALS and FTD cases with TDP-43 proteinopaihies.

[0576] Downregulation of TDP-43 impairs PNKP activity in cultured cells

[0577] To further elucidate the mechanism of how PNKP activity might be regulated by functional loss of TDP-43, we performed siRNA (siTDP-43)-mediated knockdown (KD) of TDP-43 in HEK293 cells, which showed a significant KD of TDP-43 without affecting the PNKP protein level, compared to control siRNA (siControl)-treated cells (FIG. 18 A). Consistently, TDP-43 KD revealed a marked decrease in 3 ’-phosphatase activity of PNKP in siTDP-43-(Ln 4) compared to siControl -treated (Im 3) cells (FIG. 18B). These findings indicate that the loss of TDP-43 directly affects DNA end-processing activity of PNKP, independent of its expression levels, and thereby contributes to the persistent DNA strand breaks in ALS and FTD.

[0578] PNKP overexpression rescues TDP-43 KD-associated DNA damage in cells

[0579] To determine whether PNKP complementation can mitigate TDP-43 depletion-induced DNA damage, we transfected HEK293 cells, ectopically expressing FLAG-PNKP, with siControi or siTDP-43 and assessed the levels of DSB marker yH2AX across the groups. The results revealed that PNKP overexpression (OE) significantly reduced yH2AX levels in siTDP-43 cells compared to respective control cells (FIG. 19A). In addition, the neutral comet assay demonstrated a marked reduction in DSB in terms of decreased comet tail moments in PNKP-OE + siTDP-43 -treated cells compared to only siTDP-43 -transfected cells, indicating improved DNA integrity (FIG. 19B).

[0580] To further confirm the effects of PNKP complementation on DNA integrity, LA-qPCR was performed by amplifying 10-12 kb fragments encompassing two actively transcribed genes - DNA polymerase beta (POLB) and RN A polymerase II (RNAPII). The DNA damage analysis demonstrated a significant recovery of genome integrity as shown by increased PCR band intensity in PNKP-OE cells treated with siTDP-43 compared to cells treated with siTDP-43 alone. The long amplicon product levels were normalized with short amplicons from the same genes for DNA damage analysis (FIG. 19C).

[0581] Our recent studies suggest that the efficient recruitment of XRCC4 / DNA Lig4, the complex capable of covalently sealing the ends of a DSB, is compromised in the absence of functional nuclear TDP-43. However, the mechanism underlying this disruption remained elusive. Given PNKP’s critical role in processing damaged DNA termini at DSB sites to generate ligatable 3 ’-OH and 5’-P ends, we investigated whether the loss of PNKP activity contributes to the impaired recruitment of Lig4 complexes to the DSB sites. PEA revealed a significant reduction in IJg4 interactions with yH2AX-marked DSB sites in the nuclei of TDP-43 KD cells (FIG. 19D). Tills deficiency was effectively rescued by PNKP-OE, suggesting that the restoration of PNKP activity may enhance the recruitment of DNA Lig4 to genomic DSBs.

[0582] Disrupted TDP-43-PNKP association in the TC-NHE. J complex increased damage in transcribed genome in TDP-43 proteinopathy

[0583] Our previous studies uncovered the presence of a pre-formed TC-NHEJ complex involving PNKP and other DSB repair proteins in mammalian brain samples. Notably, PNKP plays a crucial role in RNA-templated error-free TC-NHEJ repair, thereby protecting the transcribed genome. Since our results indicate that either depletion or mislocalization of TDP-43 is sufficient to disrupt the PNKP activity, we assessed PNKP’s association with the TC-NHEJ components in nuclear fractionates from autopsied cortical brain samples of AES and age-matched control subjects using PNKP co-IP assay. Importantly, the interaction of PNKP with TDP-43 was significantly compromised in ALS, indicating potential involvement of TDP-43 in the TC-NHEJ pathway to facilitate PNKP-mediated DSB repair in the transcribed genomic regions (FIG. 20A). We also observed a concomitant decrease in the association of other TC-NHEJ proteins, such as Lig4 and PFKFB3, in ALS (FIG. 20A). This result was consistent with our previous finding showing disruption of the C-NHEJ repair pathway in TDP-43 pathology.

[0584] Since PNKP is involved in the preferential repair of the transcribed genome, we assessed genome damage in actively transcribed versus non-transcribed regions in genomic DNA from cortical tissues of ALS patients versus age-matched control tissues. LA-qPCR analysis revealed a significant increase in DSB accumulation in transcribed genes (left panel; Enolase and NeuroD) compared to non-transcribed genes (right panel; MyH2 and MyH4) in ALS-TDP-43 tissues (FIG. 20B). This preferential accumulation of DNA damage in transcriptionally active regions was consistent with a decrease in PNKP activity and impaired TC-NHEJ repair in ALS,

[0585] Reduced PFKFB3 levels correlate with compromised PNKP activity and supplementation with F2,6BP restores PNKP activity

[0586] We have demonstrated that F2,6BP, the product of PFKFB3, is a positive co-regulator of PNKP activity in vivo. We further showed reduced levels of PFKFB3 and F2,6BP in the affected regions of HD and SCA3 patient brain samples, a plausible cause of PNKP inactivation in these pathologies. Therefore, to elucidate the mechanism of near-complete loss of PNKP activity in ALS / FTD, we assessed levels of PFKFB3 and F2,6BP in patients versus age-matched non-neurological controls. IB analysis revealed significant decreases in PFKFB3 levels in cortical samples from ALS and FTD patients compared to age-matched controls (FIG.

[0587] 21A; FIG. 17E). Our results corroborated earlier reports indicating a more than two-fold decrease in the PFKFB 3 expression in the cortex of post-mortem ALS patients. This result was also consistent with the observation of reduced PFKFB3 levels associated with the depletion of TDP-43 in HEK293 cells (FIG. 18 A). We further observed that the levels of F2,6BP were significantly lower in ALS / FTD patient brain samples compared to age-matched controls (FIG.

[0588] 2 IB), correlating with the reduced levels of PFKFB3 in those samples. These data further suggest a potential link between disrupted glycolytic regulation and impaired DNA repair mechanisms under neurodegenerative conditions. Next, we tested the effect of exogenous F2,6BP supplementation in restoring nuclear PNKP activity in patient samples. Notably, supplementation with F2,6BP significantly restored PNKP activity in the NE of ALS brain samples (FIG. 21C; Lns 7-10 vs. Lns 3-6). Furthermore, we observed F2,6BP-mediated restoration of PNKP activity in a dose-dependent manner both in sporadic ALS (FIG. 21D, Lns 5-6) and Guam-ALS samples (FIG. 21E, Lns 5-7). Notably, we found that F2,6BP but not FT,6BP or F6P could restore PNKP activity in ALSZFTD, which was consistent with our previous finding in polyQ diseases. These results also highlight the importance of restoring the F2,6BP level to stabilize PNKP activity, even under stress conditions, thus indicating a metabolic reprogramming-mediated novel regulatory pathway for restoring DSB repair machinery and genome integrity in neurodegenerative diseases.

[0589] F2,6BP supplementation restores PNKP activity in ALS patient-derived NPSC lines To elucidate the impact of ALS and FTD-associated TDP-43 mutations on DNA repair mechanisms, we utilized three different ALS and one FTD patient iPSC-derived NPSC lines. Initially, we focused on two ALS-linked TDP-43G287Sand TDP-43G298Smutations. FIG. 22C illustrates the domain location of the G287S mutation in TDP-43 protein and a CRISPR / Cas9-mediated mutation-corrected isogenic TDP-43G287GNPSC line (illustration in FIG. 22B). To elucidate the mechanistic effect of these TDP-43 mutants on the PNKP activity and associated DSB repair proficiency, we first assessed the extent of cytosolic mislocalization of TDP-43G287Sin this patient-derived NPSC line. Compared to the isogenic control line, TDP-43G287Scells exhibited a significantly higher nuclear-to-cytosolic ratio (N / C; P < 0.000001) of subcellular distribution of TDP-43 (FIG. 22C). Furthermore, we also examined this phenomenon by IB analyses of insoluble fractionates from ALS patient-derived TDP-43G287SNPSCs in comparison to its isogenic control TDP-43G287Gline, which showed significantly increased accumulations of pathological phenotypes of TDP-43 as well as increased levels of polyubiquitinated proteins in TDP-43 mutant line vs. the isogenic control (FIG. 22D). Notably, treatment with F2,6BP (100 pM, 72 h) significantly reduced such pathogenic protein aggregates and polyubiquitination level. Based on these characterizations, we next examined PFKFB 3 levels and 3 ’ -phosphatase activity of PNKP in the TDP-43G287Smutant vs. its isogenic control to correlate with our earlier results in ALS / FTD patient samples. IB analysis revealed a significant reduction (~60%) in the PFKFB3 protein level in TDP-43G287SNPSCs relative to their isogenic control cells, while PNKP protein levels remained unaffected (FIG. 22E). A marked decrease in PNKP activity correlated with reduced PFKFB3 levels in these samples, and this loss of activity was restored in a dose-dependent manner by F2,6BP supplementation in vitro (FIG. 22F).

[0590] We next extended our analysis to the ALS patient-derived TDP-43G298Smutant NPSCs. Similar to the TDP-43G287Smutant, IF analyses showed a significantly enhanced cytosolic mislocalization of TDP-43 with ~ four-fold less N / C ratio (P < 0.0001) (FIG. 22G). IB analysis revealed a substantial elevation in yH2AX level in the G298S mutant, indicating elevated DNA damage, while total H2AII levels remained comparable between mutant and WT cells (FIG.

[0591] 221). Finally, we assessed PNKF activity in the G298S mutant cells. Similar to our findings with the G287S mutation, we observed an ~8()% reduction in PNKP activity in TDP-43G287SNPSCs compared to WT control cells, while PNKP activity could be restored by F2,6BP in a dose-dependent manner (FIG. 221).

[0592] Further investigations extended to an engineered ALS-linked TDP-43Q331Kmutant, and its isogenic control (FIG. 22J) revealed similar patterns of TDP-43 mislocalization (FIG. 22K), reduced PFKFB3 levels (FIG. 22L), and decreased PNKP activity (FIG. 22M), compared to respective controls. However, PNKP activity was restored by F2,6BP supplementation (FIG.

[0593] 22M). In addition, we examined an FTD patient-derived cell line harboring both TDP-43A382T and a C9ORF72 repeat expansion (FIG. 22N). The results demonstrated a decrease in PNKP activity in mutant iPSCs and restoration of PNKP activity upon F2.6BP supplementation, which was consistent with other TDP-43 mutant cell lines (FIG. 220), underscoring the potential of F2,6BP in restoring DNA repair capacity in TDP-43 pathology. Collectively, our data demonstrates that reduced PNKP activity is linked to decreased levels of PFKFB3 and its product F2,6BP, a crucial cofactor for PNKP activity, under pathological conditions.

[0594] Altered PNKP activity and its restoration by F2,6BP in ALS-TDP-43 mouse brain extracts

[0595] Next, we investigated the impact of TDP-43 pathology on PNKP level and its activity in an ALS-TDP-43 mouse model. FIG. 23A shows the schematic of the genetic construct employed to drive murine Tdp-43ANLS mutant expression. We have shown that murine Tdp-43ANLS expression can enhance the pathological phosphorylation and simultaneous cytosolic aggregation of endogenous Tdp-43, leading to genome instability and inflammation.

[0596] We next assessed the levels of PFKFB3 and PNKP in cortical samples from ALS and sham (wild type) mice. IB analysis revealed a significant reduction in PFKFB3 protein levels in the NE of ALS mice compared to controls, while PNKP levels remained unaltered (FIG.

[0597] 23B). We further evaluated 3 ’-phosphatase activity of PNKP in the NE from cortical tissues of ALS and age-matched sham mice (FIG. 23C), which displayed markedly decreased PNKP activity in ALS mouse brains (Lns 6-9) relative to sham controls (Lns 2-5). Importantly, we observed a dose-dependent increase in PNKP activity following F2,6BP supplementation, whereas the glycolytic metabolites Fl,6BP and F6P did not produce similar effects (FIG. 23D). Overall, these results indicate that TDP-43 pathology in ALS mice leads to significant reductions in PNKP activity. This effect correlated with reduced PFKFB3 levels, which was supported by our results that treatment with F2,6BP could effectively rescue PNKP function, suggesting a promising metabolic approach to restoring DNA repair in ALS animal models.

[0598] Supplementation of F2,6BP restored genome integrity and partially rescued motor phenotype in a Drosophila model of ALS

[0599] To test the effect of F2.6BP in reversing neurodegenerative phenotype in ALS, we used a fruit fly (Drosophila melanogaster) model of ALS where humanized TDP-43Q331Kmutant was expressed under UAS (BDSC# 79590) and crossed with the driver line (BDSC# 64199) to drive motor neuron-specific expression of the mutant TDP-43, a pathogenic variant known to cause early synaptic dysfunction and subsequent motor deficits. The flies were then treated with 1-2 pl of either 50 pM F2,6BP or mock buffer (as control) for 21 days and the motor phenotype was tested by climbing assays, which is a robust and sensitive measure of locomotor function that reliably declines with age and neurodegeneration in fly models of disease.

[0600] We observed a significant increase in climbing score after supplementation with F2,6BP compared to mock buffer control (FIG. 24A). We further examined the DNA strand break accumulation in Drosophila CrebB and Neurexin genes by LA-qPCR. These genes were selected not only for their critical roles in synaptic function, learning, and memory but also because their large size makes them particularly susceptible to transcription-associated DNA damage, a known vulnerability in neurodegenerative conditions. We observed an elevated level of DNA damage following Q331 K expression compared to the flies used to generate the strains (wll 18) (FIG. 24B, Ln 2 vs. Ln 1). These data further indicates that the mock treatment failed to restore genome integrity. However, significant repair was observed following F2,6BP supplementation (FIG. 24B, Ln 3 vs. Ln 2), and the genome integrity was comparable to that of wll 18, which correlated with the rescue of motor phenotype. These findings confirmed the potential of F2,6BP to specifically reverse the ALS neurodegenerative phenotype in a living organism.

[0601] Discussion

[0602] The discovery of TDP-43 pathology, initially identified due to its cytosolic mislocalization in motor neurons of ALS and FTD patients, has profoundly shaped our understanding of neurodegenerative diseases. Beyond ALS and FTD, TDP-43 pathology is now recognized in multiple forms of dementia, including Alzheimer’s disease (AD) and related dementias (ADRD), where over 50% of patients exhibit TDP-43 pathologies. This broader involvement highlights the importance of dissecting the mechanistic underpinnings of TDP-43-driven cellular' dysfunction.

[0603] We and others have shown that PNKP plays a critical role in DNA DSB repair through a C-NHEJ pathway. Our current findings reveal that TDP-43 mislocalization in ALS and FTD results in a severe loss of ’-phosphatase activity of PNKP, essential for generating ligatable DNA ends, without affecting its protein levels. This defect is tightly associated with reduced levels of glycolytic enzyme, PFKFB3, and its metabolic product, F2,6BP, underscoring a novel metabolic regulation of genome repair. We have recently shown that PNKP can bind F2,6BP with high affinity (Kd=0.5 pM) and thus can utilize F2,6BP as a cofactor for its activity, which further supports our observations. Importantly, supplementation with F2,6BP rescued PNKP activity in ALS / FTD brain extracts, patient iPSC-derived NPSCs, and an ALS mouse model, restoring genome integrity in transcribed regions.

[0604] This study expands the mechanistic link between metabolic dysregulation and DNA repair deficiency in neurodegeneration. Our prior reports on polyglutamine disorders such as HD and SCA3 had already implicated PNKP inactivation as an early event in neuronal dysfunction. Our findings extend this paradigm to ALS and FTD, unravelling a common mechanism of pathogenicity in various neurodegenerative diseases, wherein impaired PNKP activity, due to reduced F2,6BP, leads to accumulation of persistent DNA breaks and neurotoxicity, as shown schematically in FIG. 25.

[0605] Importantly, in addition to restoring DNA repair, F2,6BP significantly reduced pathogenic TDP-43 aggregates, including polyubiquitinated and phosphorylated forms, in patient-derived cell lines. This dual effect highlights the multifunctional therapeutic potential of F2,6BP, not only as a metabolic cofactor rescuing DNA repair but also as a suppressor of TDP-43 aggregation and cytoplasmic mislocalization.

[0606] Our study also demonstrates that the TC-NHEJ complex is disrupted in ALS-TDP-43 conditions. Preferential accumulation of DSBs in actively transcribed genes observed in autopsied human brain tissues underscores the vulnerability of transcriptionally active chromatin to repair failure. Restoration of PNKP activity reinstated the recruitment of Lig4 to DSBs and reduced yH2AX signals, validating functional rescue of repair machinery.

[0607] A significant strength of this study lies in its cross-validation across multiple models, including sporadic ALS. Guam- ALS, and FTD patient autopsy tissue from two biorepositories, patient iPSC-derived neurons harboring mis-localizing mutations in TDP-43, a conditional ALS-Tdp-43 mouse model, and a Drosophila ALS model. The findings in the Drosophila ALS model are particularly compelling, as they demonstrate a clear therapeutic effect in a whole, living organism. Importantly, F2,6BP supplementation not only corrected molecular defects but also improved motor phenotypes in flies, demonstrating translational potential. This tight correlation between the restoration of genome integrity and the improvement of the motor phenotype provides powerful in vivo evidence for the PNKP-PFKFB3-F2,6BP axis as a key therapeutic target. Furthermore, these results align with a growing body of literature implicating metabolic dysregulation as a central node in the pathophysiology of various neurodegenerative diseases.

[0608] In summary, our work identifies a previously unrecognized PNKP-PFKFB3-F2,6BP axis disrupted in TDP-43 proteinopathies. We demonstrate that metabolic repletion with F2,6BP restores genome integrity via rescuing PNKP activity and reduces TDP-43 pathology.

[0609] Example 4. The Alzheimer’s Disease Risk Factor PFKFB3 Controls F2,6BP Levels and Neuronal Health

[0610] Summary

[0611] Tauopathies, including Alzheimer’s disease (AD), are progressive neurodegenerative disorders that affect millions worldwide. Here, we identify a critical metabolic defect driven by dysfunction of the AD risk factor gene PFKFB3, which results in markedly reduced levels of its biosynthetic product fructose-2,6-bisphosphate (F2,6BP). We show that F2,6BP exerts pleiotropic neuroprotective functions: it directly sustains the catalytic activity of the DNA strand break repair enzyme PNKP, binds and disassembles tau aggregates while preventing their re-formation, and enhances the expression of the catalytic subunit of protein phosphatase 2A (PP2A). Supplementation of F2,6BP restored these deficits and rejuvenated AD-induced neurons (iNs), as well as neurons in hippocampal slice cultures and Drosophila models of tauopathy, leading to a striking reduction in tau pathology. Together, these findings uncover a metabolic axis linking PFKFB3 dysfunction to neuronal degeneration via F2,6BP depletion, and establish F2,6BP restoration as a promising therapeutic strategy for Alzheimer’s disease and related tauopathies.

[0612] Introduction

[0613] Alzheimer’s disease (AD), AD-related dementias (ADRD) and tauopathies are both heritable and sporadic neurodegenerative disorders that are manifested by progressive deterioration of cognitive and motor functions where the symptoms are overlapping (2020 Alzheimer's disease facts and figures, 2020). Two hallmarks of these diseases are extracellular amyloid beta (AP) plaques and intracellular tau tangles. All cases of AD exhibit both these markers whereas some cases of ADRD and all cases of tauopathy exhibit only tau tangles. A plaque formation requires aberrant processing of the amyloid precursor protein (APP) generating excessive amounts of a 42-mer peptide generating the A 4 plaques. Tau tangles formation is prompted by tau phosphorylation at several residues by multiple kinases including glycogen phosphorylase kinase b (GSK0), protein kinase A (PKA) and cyclin dependent kinase 5 (CDK5). Reduced levels of protein phosphatases have also been implicated for excessive tau phosphorylation. In addition to these well-established disease markers, AD and tauopathies display other abnormalities, including chronic inflammation, metabolic dysregulation, and mitochondrial dysfunction.

[0614] Hereditary disposition of AD / ADRD / tauopathy accounts for only small fraction of total cases and most cases are sporadic with aging being an important risk factor of AD / ADRD / tauopathy. Many tens of other risk factors have been identified in sporadic cases. Recent bioinformatics analyses have identified six additional risk factors including PFKFB3 (6-phosphofructo-2-kinase / fructose-2,6-bisphosphatase 3) that have not received much attention. Among the four members of the PFKF family, PFKFB3 is the only member that mostly localizes to the nucleus and its association with PNKP (polynucleotide kinase 3’-phosphatase), a DNA break repair protein is intriguing. Polynucleotide kinase 3 ’-phosphatase (PNKP), a bifunctional DNA end-processing enzyme, removes ’-phosphate (3’-P) in mammalian cells, participating in multiple repair pathways. Genetic deletion of PNKP is embryonically lethal in mice due to a defect in neurogenesis and oligodendrogenesis.

[0615] DNA breaks with blocked DNA termini can impede DNA repair and stall elongating RN A polymerases. 3’-phosphate (3’-P) is one of the major blocked DNA termini in mammalian cells. We previously reported that the 3 ’-phosphatase catalytic activity of PNKP is severely compromised in postmortem brain tissues from spinocerebellar ataxia type 3 (SCA3) and Huntington’s disease (HD) patients. Inactivation of PNKP in oxidation sensitive neurons results in a continuous accumulation of DNA strand breaks that ultimately activate pro-apoptotic pathways causing neuronal death. Intriguingly, amelioration of neurotoxicity by overexpression of PNKP in cells expressing polyQ expanded mutant HTT (mHTT) and ATXN3 (mATXN3) in Drosophila models of SCA3 and HD. Mounting evidence links DNA strand breaks (DSBs) to AD, ADRD, and tauopathies.

[0616] Strikingly, we found that F2,6BP also activates PNKP in nuclear extracts from HD and ALS brain tissues. This effect was specific: neither fructose-1,6-bisphosphate (F1,6BP) nor fructose-6-phosphate (F6P) - -the product and substrate of PFK1 ---stimulated PNKP activity. F2,6BP is primarily synthesized by PFKFB3, which is associated with high kinase-to-phosphatase activity ratio. F2,6BP is a well-known metabolite due to its established cofactor functions for phosphofructokinase 1 (PFK1) and fructose 1,6-bisphosphatase (FBPase). It enhances glycolysis by augmenting the catalytic activity of PFK1 but inhibits FBPase and gluconeogenesis.

[0617] Excess unrepaired DNA is a recurring feature of neurodegenerative disease. Interestingly, sustained damage is most pronounced at transcribed genes, perhaps because transcriptional activity renders DNA more vulnerable by displacing protective proteins. Similar findings emerged from our studies of ALS patient samples and ALS-derived iPSCs, where PNKP 3 '-phosphatase activity was compromised owing to reduced F2,6BP. The convergence of F2,6BP deficiency across four distinct neurodegenerative diseases prompted us to investigate whether AD, ADRD, and tauopathies — by far the most prevalent neurological disorders — also share this defect.

[0618] Here, we examined whether DNA strand break repair (DSBR) is impaired in AD and tauopathies, and whether this impairment stems from PNKP inactivation. We found that DSBR is indeed compromised in AD, Corticobasal degeneration (CBD), and progressive supranuclear palsy (PSP) patient samples, coinciding with reduced F2,6BP levels. Moreover, we uncovered additional functions of F2,6BP including transcriptional and post transcriptional activation of protein phosphatase 2A and PFKFB3, respectively, and prevention of tau aggregation through direct interactions. Most significantly, supplementation with F2,6BP in cultured cells, tissue models, and Drosophila rescued multiple pathogenic phenotypes, highlighting its therapeutic potential in AD and related tauopathies.

[0619] Materials and Methods

[0620] Chemical reagents were from Merck / Sigma / Aldrich, Roche, Invitrogen, Bio-Rad. Commercial antibodies were from Invitrogen (Whitham, MA; phopho-PFKFB3, ref: PAS-114619; PFKFB3, ref: MA5-32766), Cell Signaling (Danvers, MA; vinculin ref: 13901), ThermoFisher (phospho-Tau, ref: MN1020) and Sigma (Tau, ref: T9450). MCI, AT7, Tubulin3, PNKP, gH2Ax, PP2CA,

[0621] Preparation o f human tissue extracts

[0622] These samples were processed following standard operating procedures, with the appropriate approval of the Ethics and Scientific Committees. Frozen samples of brain cortex (20-40 mg) were homogenized at 4°C in 0.5 ml of 10 mM Tris-HCl (pH 7.5), 1 mM MgCl₂, 1 mM EGTA, 1 mM DTT, 50 mM NaF, 0.5 mM phenylmethanesulphonyl fluoride, 10 pM leupeptin and a protease and phosphatase inhibitor cocktail (Merck). The extracts were centrifuged for 15 min at 13,000g and the supernatants were aliquoted (50 pl) and stored at -20°C. Protein concentration was determined using the detergent-compatible Bio-Rad reagent.

[0623] Preparation of F2,6BP

[0624] A reaction cocktail was prepared consisting of 60 mM Tris-HCl (pH 7.5), 1.5 mM DTT, 5 mM Potassium Phosphate (pH 7.5), 20 mM KC1, 40 pM EDTA, 6 mM MgCl₂, 5 mM ATP, 1 mM F6P, 10% Glycerol and 1 mg / mL BSA in 200pL. The reaction was initiated by adding 100 pg PFKFB3 and incubated at 37°C for 90 mins followed by quenching the reaction with 50 pL IM NaOH and heating at 80°C for 5 mins. The mixture was centrifuged to remove any precipitate followed by dilution to 2 mL with 10 mM TEABC (pH 8.5). The diluted reaction mixture was applied to MonoQ column pre-equilibrated with 10 mM TEABC (pH 8.5). F26BP was eluted using 20 to 35% gradient with 800 mM TEABC as buffer B. Peak fractions were pooled based on the phosphate release assay by PNKP, dried and dissolved in 20 mM Tris-Cl (pH=8.0).

[0625] Assay of6-phosphofructo-2-kinase / fructose-2,6-bisphosphatase (PFK2 / BPase-2) activity Poly(ethylene)glycol 6000 was added to aliquots of tissue extracts to reach 5% concentration (weight / volume). After centrifugation at 7000g for 15 min more poly(ethylene)glycol was added to the supernatant to reach 15% to fully precipitate the PFK2 / FBPase-2 protein. After resuspension of the pellet in the extraction medium, PFK2 / FBPase-2 activity was determined at 30°C and pH 8.5 with 5 mM Mg ATP, 5 mM Fru-6-P and 15 mM Glc-6-P. Samples were collected at different times (10 pl) and one volume of 50 mM NaOH at 80°C was added to stop the reaction. One unit of PFK2 / FBPase-2 activity is the amount of enzyme that catalyzes the formation of one pmol of Fru-2, 6-P2 per min.

[0626] Assay of Fru-2, 6-P2

[0627] The synthesis of Fru-2, 6-P2 from the PFK2 / FBPase-2 assays and the tissue Fru-2, 6-P2 concentration were determined in the extracts previously described in 25 mM NaOH at 80°C for 10 min. The metabolite was measured by the activation of the pyrophosphate-dependent phosphofructokinase as previously described. 3 ’-Phosphate release Assay

[0628] The 3 ’-phosphatase activity of PNKP in the nuclear extract of post-mortem patient frontal cortex / cerebellum and age-matched control subjects (2.5 pg) or with purified recombinant PNKP (2 ng) was conducted as we described previously. Five pmol of the radiolabeled substrate was incubated at 37°C for 15 min in buffer A (25 mM Tris-HCl, pH 8.0, 100 mM NaCl, 5 mM MgCl₂, 1 mM DTT, 10% glycerol and 0.1 pg / pl acetylated BSA). Nuclear extracts were prepared following the protocol used for Co-IP studies. For kinase activity assay, yP32 labeled ATP was incubated in kinase assay buffer (80 mM succinic acid pH 5.5, 10 mM MgCl₂, 1 mM DTT 2.5% glycerol) along with 1.0 pg / ul acetylated BSA, and 0.6 pmole labeled substrate for 30 min at 30°C. 100 fmol of PNKP and 2.5 pmole of cold substrate were used in this assay. For in vitro PNKP restoration / abrogation, similar assays were done after incubation of F2,6BP / F6P / F1,6BP with the nuclear extracts for 15 min. The radioactive bands were visualized in Phosphorlmager (GE Healthcare) and quantitated using ImageQuant software. The data were represented as % product (phosphate) released from the radiolabeled substrate with a value arbitrarily set at 100%.

[0629] Long amplicon quantitative PCR (LA-qPCR)

[0630] Genomic or mitochondrial DNA was extracted using the Genomic tip 20 / G kit (Qiagen) per the manufacturer’s protocol, to ensure minimal DNA oxidation during the isolation steps. The DNA was quantitated by Pico Green (Molecular Probes) in a black-bottomed 96-well plate and gene-specific LA qPCR assays were performed as described earlier using Long Amp Taq DNA Polymerase (New England BioLabs). A different set of transcribed (neuronal differentiation factor 1 (NeuroD), tubulin P3 class III (TUBB) and gamma-enolase (Enolase) vs. non-transcribed (muscle-specific myosin heavy chain 2 [MyII2]) genes were used for the LA-qPCR assay. The LA-qPCR reaction was set for all genes from the same stock of diluted genomic DNA sample, to avoid variations in PCR amplification during sample preparation. Preliminary optimization of the assays was performed to ensure the linearity of PCR amplification with respect to the number of cycles and DNA concentration (10-15 ng). The final PCR reaction conditions were optimized at 94°C for 30 s; (94°C for 30 s, 55-60°C for 30 s depending on the oligo annealing temperature, 65°C for 10 min) for 25 cycles; 65°C for 10 min. Since amplification of a small region is independent of DNA damage, a small DNA fragment (-200-400 bp) from the corresponding gene(s) was also amplified for normalization of amplification of the large fragment. The amplified products were then visualized on gels and quantitated with ImageJ software (NIH). The extent of damage was calculated in terms of relative band intensity with a control siRNA / mock-treated sample considered as 100.

[0631] His-Tau (full length) and Myc-K18 purification and in vitro aggregate formation

[0632] Full length wild type tau as a poly-histidine tagged protein and the repeat domains (KI 8) of tau bearing the P301L as a Myc fusion protein was expressed in E. coli BL21 (DE3) strain. Celis at OD A600 ~0.6 were induced with IPTG (100 pM) at 30 °C for 3.5 h, pelleted and the pellet was resuspended in the lysis buffer (500 mM NaCl, 20 mM MES, pH 6.8, 1 mM EDTA, 0.2 mM MgCl₂, 1 mM PMSF, 1 mM DTT), and sonicated for lysis. The supernatant was heated at 90 °C for 20 min. was clarified by centrifugation and was dialyzed overnight (Buffer A: 50 mM NaCl, 1 mM MgCl₂, 0.1 mM PMSF, 2 mM DTT, 1 mM EGTA, 20 mM MES pH 6,8). Subsequently, cation exchange (HiTrap SP HP, 5 ml column from Cytiva) was performed to purify KI 8. Protein was eluted by a salt gradient. Pure proteins were concentrated and further dialyzed against assay buffer (PBS pH 7.4, 1 mM DTT and 2 mM MgC12). Proteins were concentrated to 2 mg / mL and stored at -80°C. Aggregates were formed by incubating the proteins at 37 °C with gentle shaking (2 hr for KI 8) and 24 hr for His-tauFLin the presence of 44fig / ml Heparin.

[0633] Western blot analysis

[0634] Protein extracts from brain tissues were completed with 1% (w / v) Triton X-100. Proteins were resolved on SDS-PAGE gels and then transferred to nitrocellulose membranes. Protein bands were visualized using a Luminata chemiluminescence detection system (Merck Millipore) and an Image-Quant LAS 500 imager (GE Healthcare Life Sciences, Freiburg, Germany) and were quantified using ImageJ [National Institutes of Health (NIH), Bethesda, MD, USA], The ratio between the intensities of each protein band and vinculin (used as reference) was calculated and plotted.

[0635] Treatment of the exogenous metabolites in IN cells

[0636] We treated iNs with 25 to 50 pM of F2,6BP or F1,6BP was mixed and incubated for few min to 48 hours for different experiments.

[0637] Slice Culture

[0638] Organotypic hippocampal slice cultures were prepared from postnatal day 7-9 from WT pups as described previously (Croft & Noble, 2018). Briefly, pups were culled by decapitation and the hippocampus quickly dissected in oxygenated artificial cerebrospinal fluid (ACSF).

[0639] 400 pm slices were cut using a tissue slicer. Approximately 18-24 slices were collected and cultured in Millicell culture inserts (Millipore) in 6 well plates (6-8 slices per insert). Hippocampal slices were transduced with AAV viral vector expressing P301S human tau (2×109 / mL) for 24 hours. AAV was removed and KI 8 preformed tau fibrils were added to the culture media (1.5 ug / mL) and incubated for one media change. Subsequent media changes were either media + PBS or media containing F2,6BP. Culture media was changed every 3 days supplemented with PBS or F2,6BP and the slices were harvested after 21 days in culture for Western blot or immunostaining.

[0640] Primary neuron cultures

[0641] Primary cortical neuronal cultures were propagated using postnatal day 0 or 1 mice. The cerebral cortices of 3-4 pups were dissected on ice, meninges removed and placed in the cold dissection medium (DM) consisting of 6 mM MgC12, 0.25 mM CaC12,10 mM HEPEs (100X), 0.9% Glucose, 20 mM D-AP5 (Cayman, NC1368401), and 5 mM NBQX (Tocris Bioscience, 10-441-0). The tissues were digested with papain (Worthington, LK00 176) in 37 C water bath for 20 min, followed by 5 min incubation with low OVO and DNase I incubation to stop the digestion. The digested samples were triturated and filtered through 70 mm cell strainer. The cell suspension was centrifuged at 1000rpm for 10 min, and the cell pellet was gently resuspended in 20 mL B27 / NBMZ High glucose media and centrifuged again at 850 rpm for 5 min. The resulting cell pellet was resuspended in B27 / NBM (1 mL / mouse brain). The cells were counted and plated onto the coverslips at 250,000 in 24-well plates for immunofluorescent imaging. Antibodies used: MAP2 (1:400, Millipore-Sigma Cat# AB-5622), MC I (1:500, generated by Dr. Peter Davies and a received as a Gift from Albert Einstein College of Medicine).

[0642] WT- andAD-iNs culture

[0643] ‘iN-ready’ frozen fibroblasts regrown in in DMEM containing 15% tetracycline-free fetal bovine serum and 0.1% NEAA (Thermo Fisher) in the presence of puromycin (1 pg / mL, Sigma Aldrich). Cells were trypsinized and pooled into high densities (30.000 - 50.000 cells per cm2) and, after 24 h, the medium was changed to neuron conversion (NC) medium based on DMEM: F12 / Neurobasal (1:1) for 3 weeks. NC medium contains the following supplements: N2 supplement, B27 supplement (both lx; Thermo Fisher), doxycycline (2 pg / ml, Sigma Aldrich), Laminin (1 pg / ml, Thermo Fisher Scientific), dibutyryl-cyclic- AMP (500 pg / ml, Sigma Aldrich), human recombinant Noggin (150 ng / ml; Preprotech), LDN-193189 (5 pM; Fisher Scientific Co) and A83-1 (5 pM; Santa Cruz Biotechnology Inc.), CHIR99021 (3 pM, LC Laboratories), Forskolin (5 pM, LC Laboratories) and SB-431542 (10 pM; Cayman Chemicals). For further maturation beyond 3 weeks, flow cytometry-isolated or -non-isolated IN cultures were switched to BrainPhys (STEMCELL Technologies)-based neural maturation media containing N2, B27, GDNF, BDNF (both 20 ng / ml, R& D), dibutyryl cyclicAMP (500 pg / ml, Sigma Aldrich), doxycycline (2 pg / ml, Sigma- Aldrich) and laminin (1 pg / ml, Thermo Fisher).

[0644] Immunofluorescence

[0645] Paraffin-embedded brain slices pre-mounted on slides were de-paraffinized in xylene for 10 mins, followed by rehydration with sequential incubation in 100%, 90%, 70% EtOH, 5 mins each. Sections were placed in Citrate buffer (pH 6) solution in a pressure cooker at low pressure for 10 minutes for antigen retrieval. The slides were blocked (2.5% Normal Goat Serum for 1 hr at room temperature) and incubated with primary antibody for overnight at 4 °C, followed by 3X PBS wash for 15 min each. Next, a secondary antibody and DAPI (1:2000, Thermo Fisher Cat #D3571) were added and incubated for an hour at room temperature.

[0646] DLS analysis

[0647] Dynamic Light Scattering (DLS) analysis was performed using a DynaPro NanoStar (Wyatt Technology, USA) to monitor the time-dependent aggregation of KI 8 peptide fragments of the Tau protein. Samples were incubated with different supplements, including F1,6BP, F2,6BP, and the standard aggregation-promoting agent, heparin. The final concentration of KI 8 in the solution was 1 pM, while the concentrations of supplements ranged from 1 to 50 pM. Aliquots were collected at regular time intervals and analyzed. The hydrodynamic diameter and polydispersity index (PDI) were recorded using the instrument’s Dynamics software to assess changes in particle size distribution. A gradual increase in average particle size and scattering intensity indicated the progressive formation of KI 8 aggregates. Buffer (TBS, pH 7.5) and monomeric KI 8 samples were used as controls to ensure measurement accuracy. These results provided quantitative insight into the kinetics and stability of KI 8 aggregation over time.

[0648] Continuous live imaging analysis of In-Vitro Tau aggregate Fluorescence labeling of tau protein was carried out using a maleimide-ester -based fluorescent compound designed to react with the amine groups of lysine residues. Purified tau was incubated with the dye in TBS buffer (pH 7.5) at 37 °C to enable efficient conjugation. Unreacted dye molecules were removed by dialysis using a 3 kDa cut-off membrane against fresh buffer to obtain the purified labeled protein. The degree of labeling and purity were verified by UV-Vis spectroscopy and SDS-PAGE. The resulting fluorescent tau conjugates were subsequently used for continuous fluorescence imaging. Fluorescence-tagged KI 8 was aggregated for 2. h in TBS buffer (pH 7.5) at 37 °C, and aggregation was confirmed using a thioflavin T (ThT) assay. The resulting aggregates were then used as a substrate (1 μM) with or without F2,6BP to study the assembly and disassembly processes in vitro under controlled conditions. The reaction mixture was incubated in TBS buffer (pH 7.5) at 37 °C and monitored continuously for 10 hours using a fluorescence microscope equipped for time-lapse imaging. Changes in fluorescence intensity and distribution were recorded to observe the progressive association and dissociation of Tau aggregates.

[0649] Biolayer Interferometry (BLI) analysis

[0650] Biolayer Interferometry (BLI) experiments were performed using an Octet system (ForteBio, USA) to investigate the interaction of full-length His-tagged Tau protein (0.2 μM). The Tau protein was immobilized onto Ni-NTA biosensors via its His-tag, ensuring stable attachment and proper orientation for binding analysis. Association and dissociation kinetics were measured upon exposure to fructose- 1,6-bisphosphate (F1,6BP), fructose-2,6-bisphosphate (F2,6BP), and heparin at concentrations of 1 μM and 5 μM. Each analyte was allowed to interact with the Tau-coated sensor, followed by dissociation in buffer to record realtime binding profiles. The response curves revealed concentration-dependent differences in binding behavior, indicating distinct or opposing affinities of Tau toward t...

Claims

CLAIMSWhat is claimed is:

1. A method of treating a neurological disorder in a subject in need thereof, comprising administering to the subject a pharmaceutical composition comprising:(a) a therapeutically effective amount of fructose-2,6-bisphosphate (F2,6BP), or a derivative thereof; and(b) a pharmaceutically acceptable excipient or carrier.

2. The method of claim 1, wherein the neurological disorder is selected from progressive polyneuropathy, cerebellar atrophy, microcephaly, mild epilepsy, seizures, developmental delay, or intellectual disability.

3. The method of claim 1, wherein the neurological disorder comprises a neurodegenerative disease.

4. A method of treating a neurodegenerative disease in a subject in need thereof, comprising administering to the subject a pharmaceutical composition comprising:(a) a therapeutically effective amount of F2,6BP, or a derivative thereof; and(b) a pharmaceutically acceptable excipient or carrier.

5. The method of claim 3 or 4, wherein the neurodegenerative disease is selected from a polyglutamine (polyQ) disease, amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer’s disease (AD), Down’s syndrome, Parkinsons disease (PD), a prion disease such as Creutzfeldt-Jakob disease, Lewy body disease, diffuse Lewy body disease (DLBD), Progressive supranuclear palsy (PSP), Fields disease, primary progressive aphasia, multiple system atrophy, pantothenate kinase-associated neurodegeneration (PANK), a spinal degenerative disease and / or motor neuron degenerative disease, hippocampal sclerosis, corticobasal degeneration (CBD), chronic traumatic encephalopathy (CTE), primary lateral sclerosis (PLS), or a combination thereof.

6. The method of claim 5, wherein the ALS comprises rapid-onset ALS or Guamanian-ALS.

7. The method of claim 3 or 4, wherein the neurodegenerative disease comprises a polyQ disease.

8. A method of treating a polyQ disease in a subject in need thereof, comprising administering to the subject a pharmaceutical composition comprising:(a) a therapeutically effective amount of F2,6BP, or a derivative thereof; and(b) a pharmaceutically acceptable excipient or carrier.

9. The method of claim 7 or 8, wherein the polyQ disease is selected from dentatorubral pallidoluysian atrophy (DRPLA or Haw-River syndrome), Huntington’s disease (HD), spinal and bulbar muscular atrophy (SBMA or Kennedy disease), Spinocerebellar ataxia (SCA) type 1, SC A type 2 (SCA2), SC A type 3 (SC A3 or Machado-Joseph disease), SCA type 6 (SCA6), SCA type 7 (SCA7), or SCA type 17 (SCA17).

10. The method of claim 7 or 8, wherein the polyQ disease is HD or SC A3.

11. A method of treating a proteinopathy in a subject in need thereof, comprising administering to the subject a pharmaceutical composition comprising:(a) a therapeutically effective amount of F2,6BP, or a derivative thereof; and(b) a pharmaceutically acceptable excipient or carrier.

12. The method of claim 11, wherein the proteinopathy comprises a tauopathy.

13. The method of claim 12, wherein the tauopathy is selected from Alzheimer’s disease (AD), corticobasal degeneration (CBD), chronic traumatic encephalopathy (CTE), Amyotrophic lateral sclerosis (ALS), Frontotemporal dementia (FED), Frontotemporal dementia with Parkinsonism linked to chromosome 17 (FTDP-17), Niemann-Pick disease, Pick’s disease, or progressive supranuclear palsy (PSP).

14. The method of claim 11, wherein the proteinopathy comprises mislocalization, aggregation, or aberrant post-translational modification (PTM) of TAR DNA-binding protein 43 (TDP-43).

15. The method of any one of claims 11 - 14, wherein the proteinopathy comprises decreased polynucleotide kinase 3 ’-phosphatase (PNKP) activity relative to a control.

16. The method of any one of claims 1-15, wherein the F2,6BP is exogenous F2,6BP.

17. The method of any one of claims 1-16, wherein the derivative of F2,6BP is selected from fructose 2-phosphorothioate 6-phosphate, fructose 2-methylphosphonoyl 6-phosphate, or fructose 2-phosphonoyl 6-phosphate.

18. The method of any one of claims 1-17, wherein the pharmaceutically acceptable carrier comprises a carrier peptide.

19. The method of claim 18, wherein the carrier peptide comprises a brain-specific carrier peptide.

20. The method of claim 19, wherein the brain-specific carrier peptide comprises a K16ApoE carrier peptide.

21. A method of increasing or restoring PNKP activity in a cell, or a population thereof, comprising contacting the cell with an effective amount of F2,6BP, or a derivative thereof.

22. The method of claim 21, wherein the method increases nuclear DNA genome integrity.

23. The method of claim 21, wherein the PNKP activity comprises mitochondrial PNKP activity.

24. The method of any one of claims 21-23, wherein the method increases mitochondrial DNA genome integrity.

25. A method of reducing or reversing mitochondrial genome damage in a cell, or a population thereof, in a subject having Huntington’s disease (HD), comprising contacting the cell with an effective amount of F2,6BP, or a derivative thereof.

26. The method of claim 25, wherein the cell population comprises neurons.

27. The method of claim 26, wherein the neurons comprise striatal neuronal cells.

28. The method of any one of claims 25-27, wherein the method restores PFKFB3 level, restores mitochondrial genome integrity, restores mitochondrial membrane potential, restores mitochondrial respiration, prevents pathogenic aggregate formation, or a combination thereof.

29. The method of any one of claims 21-28, wherein the F2,6BP is exogenous F2,6BP.

30. The method of any one of claims 21-29, wherein the pharmaceutically acceptable carrier comprises a carrier peptide.

31. The method of claim 30, wherein the carrier peptide comprises a brain-specific carrier peptide.

32. The method of claim 31, wherein the brain-specific carrier peptide comprises a K16ApoE carrier peptide.

33. A method of treating a neurological disorder in a subject in need thereof, comprising: (i) isolating a sample from the subject;(ii) testing the sample for PFKFB3 levels, F2,6BP levels, PNKP activity, or a combination thereof;(iii) if PFKFB3 levels, F2,6BP levels, PNKP activity, or a combination thereof, are significantly decreased relative to a control sample, then administering to the subject a pharmaceutical composition comprising: (a) a therapeutically effective amount of fructose-2,6-bisphosphate (F2,6BP), or a derivative thereof; and (b) a pharmaceutically acceptable excipient or carrier.

34. The method of claim 33, wherein the sample is selected from blood, plasma, serum, urine, sputum, spinal fluid, cerebrospinal fluid, pleural fluid, nipple aspirate, lymph fluid, respiratory tract fluid, intestinal tract fluid, genitourinary tract fluid, tear fluid, saliva, breast milk, lymphatic system fluid, semen, ascitic fluid, tumor cyst fluid, amniotic fluid, tissue, biopsy, or a combination thereof.

35. The method of claim 33, wherein the sample is a tissue, biopsy, or a biofluid.

36. The method of any one of claims 33-35, wherein the sample is processed to harvest or enrich for nuclei and / or mitochondria.

37. The method of any one of claims 1-36, wherein the pharmaceutical composition is administered to the subject by intranasal spray delivery.

38. The method of any one of claims 1 -37, wherein the subject is a human.

Images