Small molecule therapy for ocular conditions

A combination of sodium 4-phenylbutytate and tauroursodeoxy cholic acid targets the trabecular meshwork to lower intraocular pressure and protect neurons, addressing the limitations of current glaucoma treatments by providing significant IOP reduction and neuroprotection.

WO2026096543A1PCT designated stage Publication Date: 2026-05-07RGT UNIV OF CALIFORNIA
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/052971
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-10-28
Filing Date
2025-10-28
Publication Date
2026-05-07

AI Technical Summary

Technical Problem

Current glaucoma treatments primarily target aqueous humor production and fail to effectively address the trabecular meshwork (TM) pathology, leading to elevated intraocular pressure (IOP) and progressive vision loss.

Method used

A combination therapy of sodium 4-phenylbutytate (PBA) and tauroursodeoxy cholic acid (TUDCA) is administered to directly target the TM, reducing mitochondrial dysfunction, preventing protein aggregation, and upregulating anti-apoptotic genes, thereby lowering IOP and providing neuroprotection.

Benefits of technology

The combination therapy effectively reduces IOP by up to 40% and protects neurons, offering superior results compared to existing treatments, while also preventing fibrosis in the TM, thus potentially enhancing the success of iStent® or MIGS procedures.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025052971_07052026_PF_FP_ABST
    Figure US2025052971_07052026_PF_FP_ABST
Patent Text Reader

Abstract

Provided are pharmaceutical compositions comprising a combination therapy having therapeutically effective amounts of sodium 4-phenyIbutylate and tauroursodeoxycholic acid for the treatment of an ocular condition in a subject. Also provided herein are methods using the combination therapy, and a pharmaceutical composition thereof, for preventing or treating an ocular condition in a subject.
Need to check novelty before this filing date? Find Prior Art

Description

Atorney docket No. 00058-090W01SMALL MOLECULE THERAPY FOR OCULAR CONDITIONSCROSS REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority under 35 U.S.C. §119 from Provisional Application Serial No. 63 / 713.008, filed October 28, 2024 the disclosure of which is incorporated herein by reference.STATEMENT OF GOVERNMENT SUPPORT

[0002] This invention was made with Government support under Grant Nos: EY260177 and EY028616, awarded by the National Institutes of Health. The Government has certain rights in the invention.INCORPORATION BY REFERENCE OF SEQUENCE LISTING

[0003] Accompanying this filing is a Sequence Listing entitled, “00058-090W01.xml” created on October 28, 2025, and having 3,736 bytes of data, machine formatted on IBM-PC, MS-Windows operating system. The sequence listing is hereby incorporated by reference in its entirety for all purposes.TECHNICAL FIELD

[0004] Provided are pharmaceutical compositions comprising a combination therapy having therapeutically effective amounts of sodium 4-phenylbutytate and tauroursodeoxy cholic acid for the treatment of an ocular condition in a subject. Also provided herein are methods using the combination therapy, and a pharmaceutical composition thereof, for preventing or treating an ocular condition in a subject.BACKGROUND

[0005] Glaucoma is the leading cause of irreversible blindness, and it is often associated with elevated intraocular pressure (IOP) due to damage to trabecular meshwork (TM) cells. Elevated IOP leads to axonal loss and blindness. The trabecular meshwork (TM) maintains normal IOP by regulating aqueous humor (AH) outflow resistance. In glaucoma, there is increased resistance to aqueous humor outflow through TM, thus elevating IOP. About 70% outflow is regulated by TM; however, most of the current drug treatments approved for glaucoma target AH production via the ciliary body. Despite TM being major site of glaucomatous pathology, drugs acting directly on TM pathology has not yet been developed and vision loss continues to progress in some glaucoma patients, thus highlighting a criticalAtorney docket No. 00058-090W01 need to develop an effective treatment that targets TM outflow to prevent vision loss in glaucoma patients.SUMMARY

[0006] Provided herein is a therapy comprising a combination therapy of small molecule therapeutics that is highly effective in lowering intraocular pressure (IOP) and can therefore be used for the treatment of eye diseases or disorder associated with elevated IOP. The combination therapy disclosed herein can be used alone or in combination with other IOP lowering medications, such as latanoprost, to treat said eye disorders or diseases.Latanoprost, and other prostaglandin inhibitors lower IOP by increasing the flow of natural eye fluids out of the eye. As such, latanoprost and similar drugs work mechanistically in a manner different from the small molecule therapy disclosed herein. Accordingly, use of the small molecule therapy of the disclosure with latanoprost, and like drugs, would be expected to be highly effective in reducing IOP. Additionally, the combination therapy disclosed herein can be used in combination with a gene-editing therapy or an antisense oligo that lowers the expression of gene product(s) that cause elevated IOP to treat said eye disorders or diseases. The combination therapy disclosed herein can also be used as a preventative to prevent or counteract adverse effects of medications, like corticosteroids, in elevating IOP in subjects.

[0007] In the studies presented herein, recombinant TM cells that stably expressed a glaucoma gene were used to determine whether the use of sodium 4-phenylbutytate (PBA) and tauroursodeoxy cholic acid (TUDCA) in combination would restore normal TM function. It was found that the use of PBA with TUDCA effectively reversed glaucomatous phenotypes in the recombinant TM cells in a synergistic manner. A combination therapy of PBA and TUDCA. therefore, provides an effective therapy for glaucoma pathology by reducing mitochondrial dysfunction, preventing protein aggregation, and upregulating anti-apoptotic genes. It is expected that a combination therapy of PBA and TUDCA would be effective for treating all forms of glaucoma.

[0008] In addition, the combination of PBA and TUDCA provides direct neuroprotectant effects, thereby preventing neuronal damage due to elevated IOP. iStent® or MIGS procedures have been developed to lower IOP in glaucoma patients. However, the procedures often fail after 1 -2 years due to fibrosis in TM. Accordingly, a combinationAtorney docket No. 00058-090W01 therapy comprising PBA and TUDCA is likely to aid iStent® or MIGS to increase overall success by preventing fibrosis in TM.In a particular embodiment, the disclosure provides a pharmaceutical composition for the treatment of an ocular condition associated with elevated intraocular pressure (IOP), comprising: a combination therapy comprising therapeutically effective amounts of sodium 4-phenylbutytate (PBA) and tauroursodeoxy cholic acid (TUDCA), in a pharmaceutically acceptable carrier, diluent, and / or excipient. In another embodiment, the ocular condition associated with elevated intraocular pressure is selected from glaucoma, ocular hypertension, uveitis, retinal detachment, pigment dispersion syndrome, pseudoexfoliation syndrome, large cataracts, tumors within the eye, steroid-induced ocular hypertension, steroid-induced glaucoma and eye damage from injury or surgery. In a certain embodiment, the ocular condition is glaucoma. In another embodiment, the pharmaceutical composition is formulated for intravitreal injection, intracameral injection, subretinal injection, or for topical administration to the eye(s). In yet another embodiment, the composition is formulated for topical administration to the eye(s) and is in the form of eye drops, eye ointment, or eye gel. In another embodiment, the pharmaceutical composition comprises PBA at a concentration (% w / v) from 0. 1 to 3. In a further embodiment, the pharmaceutical composition comprises PBA at a concentration (% w / v) from 0.5 to 1.5. In a certain embodiment, the pharmaceutical composition comprises TUDCA at a concentration (% w / v) from 0.05 to 1.5. In another embodiment, the pharmaceutical composition comprises TUDCA at a concentration (% w / v) from 0. 1 to 0.8. In a particular embodiment, the pharmaceutical composition comprises PBA and TUDCA in a pharmaceutically acceptable carrier, diluent, and / or excipient and a preservative at the following concentrations (% w / v):PBA 1TUDCA 0.5Dibasic Sodium Phosphate 0.2Hydroxypropyl Methylcellulose 0.5Polysorbate 80 0.05Benzalkonium Chloride 0.01Sodium Chloride 0.75Edetate Disodium (EDTA) 0.01NaOH I HC1 as needed to provide a pH 7.4Purified Water as needed up to 100%.Atorney docket No. 00058-090W01In a further embodiment, the pharmaceutically acceptable diluent comprises buffered saline or purified water. In yet a further embodiment, the pharmaceutically acceptable carrier, diluent, and / or excipient includes sodium citrate, hydroxyethyl cellulose, sodium hydroxide (to adjust pH), hydrochloric acid (to adjust pH), mannitol, sodium phosphate, carbomer 974P, tyloxapol, edetate disodium, sodium chloride, and / or purified water. In a certain embodiment, the pharmaceutical composition further comprises a preservative. In yet a further embodiment, the preservative is benzalkonium chloride. In another embodiment, the combination therapy comprises PBA at a concentration of 0.5 mM to 4.0 mM. In yet another embodiment, the combination therapy comprises PBA at a concentration of 1.0 mM to 2.0 mM. In a further embodiment, the combination therapy comprises TUDCA at a concentration of 0.3 mM to 3.0 mM. In yet a further embodiment, the combination therapy comprises TUDCA at a concentration of 0.5 mM to 1 .0 mM. In a certain embodiment, the pharmaceutical composition further comprises additional medication(s) selected from a prostaglandin analogue, a beta-blocker, a carbonic anhydrase inhibitor, a corticosteroid, a Rho kinase inhibitor, an alpha-adrenergic agonist, and / or a miotic. In another embodiment, the pharmaceutical composition further comprises additional medication(s) selected from bimatoprost, tafluprost, latanoprost, travoprost, betaxolol, timolol, brinzolamide, dorzolamide, brimonidine, and netarsudil. In yet another embodiment, the pharmaceutical composition further comprises 5-Amino-3-(l -Hydroxy-2, 2,6, 6-Tetramethylpiperidin-4-yl)- l,2,3-Oxadiazol-3-Ium Chloride (SA-2). In a certain embodiment, the pharmaceutical composition further comprises additional medication(s) selected from prednisolone acetate, dexamethasone, loteprednol etabonate, fluoromethoIone, rimexolone, and difluprednate. In a further embodiment, the pharmaceutical composition further comprises a gene editing therapy or an antisense oligo that lowers the expression of gene product(s) that causes elevated IOP. In yet a further embodiment, the antisense oligo is selected from siRNA, miRNA, RNAi, shRNA, and aptamers. In a certain embodiment, the antisense oligo is an siRNA selected from SYL040012, SYL1801 and QPI-1007. In another embodiment, the gene editing therapy or the antisense oligo lowers the expression of a protein selected from MYOC, OPTN, CYP1B1 AV1 / CAV2, CDKN2B. TMCOI, SIX1 / SIX6, LRP12 / ZFP, TBK1, GALC, PITX2, PITX3, FOXCI, FOXE3, PAX6, LMX1B, MAF PLEKHA7, PCMTD1 / ST18, COL11A1, LOXL1, ANGPTL7 and CNTNAP2. In yet another embodiment, the gene editing therapy is a CRISPR-Cas9-based system that suppresses orAtorney docket No. 00058-090W01 reduces myocilin gene expression. In a further embodiment, the myocilin gene encodes a mutant form of myocilin. In yet a further embodiment, the CRISPR-Cas9-based system comprises a guide sequence having the sequence of GGCCTGCCTGGTGTGGGATG (SEQ ID NO: I).

[0009] In a particular embodiment, the disclosure also provides a method of treating or preventing an ocular condition associated with elevated intraocular pressure (IOP) in a subject in need thereof, the method comprising: administering a combination therapy comprising therapeutically effective amounts of 4-pheny 1 butylate (PBA) and a tauroursodeoxy cholic acid (TUDCA) to the subject in need thereof. In another embodiment, the combination therapy has a synergistic effect in reducing elevated IOP. In yet another embodiment, the ocular condition is selected from glaucoma, ocular hypertension, uveitis, retinal detachment, pigment dispersion syndrome, pseudoexfoliation syndrome, large cataracts, tumors within the eye, steroid-induced ocular hypertension, steroid-induced glaucoma and eye damage from injury or surgery. In a further embodiment, the ocular condition is glaucoma. In yet a further embodiment, PBA is administered separately from TUDCA. In a certain embodiment, PBA is administered concurrently or sequentially with TUDCA. In a further embodiment, a pharmaceutical composition comprises a combination therapy disclosed herein that is administered to the subj ect in need thereof. In yet a further embodiment, a pharmaceutical composition comprises the combination therapy that is administered to the subject in need thereof. In another embodiment, the pharmaceutical composition comprises PBA at a concentration (% w / v) from 0.1 to 3. In yet another embodiment, the pharmaceutical composition comprises PBA at a concentration (% w / v) from 0.5 to 1.5. In a further embodiment, the pharmaceutical composition comprises TUDCA at a concentration (% w / v) from 0.05 to 1.5. In yet a further embodiment, the pharmaceutical composition comprises TUDCA at a concentration (% w / v) from 0.1 to 0.8. In a further embodiment, the combination therapy is administered directly to the eyes of the subject. In yet a further embodiment, the combination therapy is administered by intravitreal injection, by intracameral injection, by subretinal injection, or by topical administration to the eye(s). In a certain embodiment, the combination therapy is formulated for topical administration to the eye(s) and is in the form of eye drops, eye ointment, or eye gel. In another embodiment, the combination therapy comprises PBA at a concentration of 0.5 mM to 4.0 mM. In yet another embodiment, the combination therapy comprises PBA at aAtorney docket No. 00058-090W01 concentration of 1.0 mM to 2.0 mM. In a further embodiment, the combination therapy comprises TUDCA at a concentration of 0.3 mM to 3.0 mM. In yet a further embodiment, the combination therapy comprises TUDCA at a concentration of 0.5 mM to 1.0 mM. In another embodiment, the combination therapy is administered in combination with additional medication(s) selected from a prostaglandin analogue, a beta-blocker, a carbonic anhydrase inhibitor, a corticosteroid, a Rho kinase inhibitor, an alpha- adrenergic agonist, and / or a miotic. In yet another embodiment, the combination therapy is administered to the subject in need thereof in combination w ith additional medication(s) selected from bimatoprost, tafluprost, latanoprost, travoprost, betaxolol, timolol, brinzolamide, dorzolamide, brimonidine, and netarsudil. In a certain embodiment, the combination therapy is administered to the subject in need thereof in combination with 5-amino-3-(l -hydroxy - 2,2,6,6-tetramethylpiperidin-4-yl)-l,2,3-oxadiazol-3-ium chloride (SA-2). In another embodiment, the combination therapy is administered to the subject in need thereof in combination with gene editing therapy or an antisense oligo that lowers the expression of gene product(s) that causes elevated IOP. In yet another embodiment, the antisense oligo is selected from siRNA, miRNA, RNAi, shRNA, and aptamers. In a further embodiment, the antisense oligo is an siRNA selected from SYL040012, SYL1801 and QPI-1007. In a further embodiment, the gene editing therapy or the antisense oligo or siRNA lowers the expression of a protein selected from MYOC, OPTN, CYP1B1 AV1 / CAV2, CDKN2B, TMCO1, SIX1 / SIX6, LRP12 / ZFP, TBK1. GALC, PITX2, PITX3, FOXCI, FOXE3. PAX6. LMX1B. MAF PLEKHA7, PCMTD1 / ST18, COL1 1 Al , LOXL1 , ANGPTL7, and CNTNAP2. In yet a further embodiment, the gene editing therapy is CRISPR-Cas9-based system that suppresses or lowers the expression of a myocilin gene. In a certain embodiment, the myocilin gene encodes a mutant form of myocilin. In another embodiment, the CRISPR-Cas9-based system comprises a guide sequence having the sequence of GGCCTGCCTGGTGTGGGATG (SEQ ID NO: 1). In yet another embodiment, the gene editing therapy or the antisense oligo is delivered to a cell by use of a viral vector, non-viral vector, or by a physical delivery method. In a further embodiment, the viral vector is selected from Adenoviral vector, lentiviral vector and an AAV vector. In yet a further embodiment, the non-viral vector is selected from nanoparticles, polymers, micelles, and liposomes. In a certain embodiment, the nanoparticles are lipid nanoparticles. In a further embodiment, the polymers are selected from elastin-like polypeptide (ELP). boronic dendrimer, nano-clew, polyethyleneimine (PEI), and carbonAtorney docket No. 00058-090W01 nanotubes, PEG (polyethylene glycol), PLL (poly -L-ly sine), chitosan, PLGA (polylactic- cogly colic acid) and polymeric nanocapsules. In yet a further embodiment, the combination therapy is administered to prevent an ocular condition associated with elevated intraocular pressure (IOP) that is induced by, or possibly aggravated by, the administration of a medication or treatment that is used to treat a condition, a disorder or a disease. In a certain embodiment, the ocular condition is steroid-induced ocular hypertension or steroid-induce glaucoma, and wherein the medication is a steroid. In a further embodiment, the steroid is a corticosteroid. In yet a further embodiment, the corticosteroid is selected from betamethasone, budesonide, dexamethasone, hydrocortisone, clobetasol propionate, methylprednisolone, mometasone, amcinonide, cloprednol, cortisol, prednisolone, alclometasone. ciclesonide, clocortolone, deflazacort. fluticasone furoate, triamcinolone acetonide, aldosterone, beclomethasone dipropionate, cortobenzolone, halcinonide, prednisolone acetate, loteprednol etabonate, fluorometholone, rimexolone, and difluprednate. In another embodiment, the ocular condition is glaucoma, and wherein the medication or treatment is contraindicated or has a warning label for use in subjects who have glaucoma or at risk of developing glaucoma. In yet another embodiment, the medication or treatment is selected from ipratropium bromide, tiotropium bromide, botulinum toxin (botox) injections used around the eyes, cold / flu medications containing antihistamines or decongestants, tolterodine, oxybutynin, dilating eye drops, diphenhydramine, loratadine, fexofenadine, cetirizine, sumatriptan, orphenadrine, trihexyphenidyl, scopolamine patches, fluoxetine, paroxetine, amitriptyline, tofranil, dul ox etine, topiramate, acetazolamide, trimethoprimsulfamethoxazole, cimetidine and ranitidine. In a further embodiment, the combination therapy is administered prior to and / or concurrently with the administration of the medication or treatment that is used to treat a condition, a disorder or a disease.

[0010] In a particular embodiment, the disclosure further provides a method of treating or preventing fibrosis in the trabecular meshwork (TM) in the eyes of a subject in need thereof, the method comprising: administering a combination therapy comprising therapeutically effective amounts of sodium 4-phenylbutytate (PBA) and tauroursodeoxy cholic acid (TUDCA) to the subject in need thereof. In another embodiment, the subject has undergone a surgical procedure to implant a device to treat an ocular condition. In yet another embodiment, the ocular condition is associated with elevated intraocular pressure (IOP) or is cataracts. In a further embodiment, the ocular condition isAtorney docket No. 00058-090W01 associated with elevated IOP is glaucoma. In yet a further embodiment, PBA is administered separately from TUDCA. In a certain embodiment, PBA is administered concurrently or sequentially with TUDCA. In another embodiment, a pharmaceutical composition comprises a combination therapy of the disclosure that is administered to the subject in need thereof. In another embodiment, the pharmaceutical composition comprises PBA at a concentration (% w / v) from 0. 1 to 3. In yet another embodiment, the pharmaceutical composition comprises PBA at a concentration (% w / v) from 0.5 to 1.5. In a further embodiment, the pharmaceutical composition comprises TUDCA at a concentration (% w / v) from 0.05 to 1.5. In yet a further embodiment, the pharmaceutical composition comprises TUDCA at a concentration (% w / v) from 0.1 to 0.8. In yet another embodiment, the combination therapy is administered directly to the eyes of the subject. In a further embodiment, the combination therapy is administered by intravitreal injection, by intracameral injection, by subretinal injection, or by topical administration to the eye(s). In yet a further embodiment, the combination therapy is formulated for topical administration to the eye(s) and is in the form of eye drops, eye ointment, or eye gel. In a certain embodiment, the combination therapy comprises PBA at a concentration of 0.5 mM to 4.0 mM. In another embodiment, the combination therapy comprises PBA at a concentration of 1.0 mM to 2.0 mM. In yet another embodiment, the combination therapy comprises TUDCA at a concentration of 0.3 mM to 3.0 mM. In a further embodiment, the combination therapy comprises TUDCA at a concentration of 0.5 mM to 1.0 mM. In yet a further embodiment, the combination therapy is administered in combination with additional medication(s) selected from a prostaglandin analogue, a betablocker, a carbonic anhydrase inhibitor, a corticosteroid, a Rho kinase inhibitor, an alpha- adrenergic agonist, and / or a miotic. In a certain embodiment, the combination therapy is administered to the subject in need thereof in combination with additional medication(s) selected from bimatoprost, tafluprost, latanoprost, travoprost, betaxolol, timolol, brinzolamide, dorzolamide, brimonidine, and netarsudil. In another embodiment, the combination therapy is administered to the subject in need thereof in combination with 5- amino-3-(l-hydroxy-2,2,6.6-tetramethylpiperidin-4-yl)-1.2.3-oxadiazol-3-ium chloride (SA- 2). In yet another embodiment, the combination therapy is administered to the subject in need thereof in combination w ith gene editing therapy or an antisense oligo that lowers the expression of gene product(s) that causes elevated IOP. In a further embodiment, the antisense oligo is selected from siRNA, miRNA, RNAi, shRNA, and aptamers. In yet aAtorney docket No. 00058-090W01 further embodiment, the antisense oligo is an siRNA selected from SYL040012, SYL1801 and QPI-1007. In a certain embodiment, the gene editing therapy or the antisense oligo lowers the expression of a protein selected from MYOC, OPTN, CYP1B1 AV1 / CAV2, CDKN2B, TMC01, SIX1 / SIX6, LRP12 / ZFP, TBK1, GALC, PITX2, PITX3, FOXCI, ANGPTL7, FOXE3, PAX6, LMX1B, MAF PLEKHA7, PCMTD1 / ST18, COL11A1, LOXL1, ANGPTL7 and CNTNAP2. In another embodiment, the gene editing therapy is CRISPR-Cas9-based system that suppresses or lowers the expression of a myocilin gene. In yet another embodiment, the myocilin gene encodes a mutant form of myocilin. In a further embodiment, the CRISPR-Cas9-based system comprises a guide sequence having the sequence of GGCCTGCCTGGTGTGGGATG (SEQ ID NO: 1). In yet a further embodiment, the gene editing therapy or the antisense oligo is delivered to a cell by use of a viral vector, non-viral vector, or by a physical delivery method. In a certain embodiment, the viral vector is selected from Adenoviral vector, lentiviral vector, and an AAV vector. In another embodiment, the non-viral vector is selected from nanoparticles, polymers, micelles, and liposomes. In yet another embodiment, the nanoparticles are lipid nanoparticles. In a certain embodiment, the polymers are selected from elastin-like polypeptide (ELP), boronic dendrimer, nano-clew, polyethyleneimine (PEI), and carbon nanotubes, PEG (polyethylene glycol), PLL (poly-L-lysine), chitosan, PLGA (polylactic-coglycolic acid), polymeric nanocapsules, l,2-distearoyl-sn-glycero-3-phosphocholine 280 (DSPC), cholesterol, and 1,2- dimyristoyl-rac-glycero-3-methoxypoly ethylene gly col-2000 (DMG-281 PEG 2000).

[0011] In a particular embodiment, the disclosure further provides a method of reducing corticosteroid-induced ER stress or myocilin accumulation in the trabecular meshwork (TM) in the eyes of a subject in need thereof, the method comprising: administering a combination therapy comprising therapeutically effective amounts of sodium 4-phenylbutytate (PBA) and tauroursodeoxy cholic acid (TUDCA), and a topical ophthalmic corticosteroid to the subject in need thereof. In another embodiment, PBA is administered separately from TUDCA. In yet another embodiment, PBA is administered concurrently or sequentially with TUDCA. In yet another embodiment, the combination therapy is administered separately from the topical ophthalmic corticosteroid. In a further embodiment, the combination therapy is administered concurrently or sequentially with the topical ophthalmic corticosteroid. In yet a further embodiment, a pharmaceutical composition comprises the combination therapy that is administered to the subject in need thereof. In another embodiment, the pharmaceuticalAtorney docket No. 00058-090W01 composition comprises PBA at a concentration (% w / v) from 0.1 to 3. In yet another embodiment, the pharmaceutical composition comprises PBA at a concentration (% w / v) from 0.5 to 1.5. In a further embodiment, the pharmaceutical composition comprises TUDCA at a concentration (% w / v) from 0.05 to 1.5. In yet a further embodiment, the pharmaceutical composition comprises TUDCA at a concentration (% w / v) from 0.1 to 0.8. In another embodiment, the combination therapy is administered directly to the eyes of the subject. In yet another embodiment, the combination therapy is administered by intravitreal injection, by intracameral injection, by subretinal injection, or by topical administration to the eye(s). In a further embodiment, the combination therapy is formulated for topical administration to the eye(s) and is in the form of eye drops, eye ointment, or eye gel. In yet a further embodiment, the combination therapy comprises PBA at a concentration of 0.5 mM to 4.0 mM. In a certain embodiment, the combination therapy comprises PBA at a concentration of 1.0 mM to 2.0 mM. In another embodiment, the combination therapy comprises TUDCA at a concentration of 0.3 mM to 3.0 mM. In yet another embodiment, the combination therapy comprises TUDCA at a concentration of 0.5 mM to 1.0 mM. In a certain embodiment, the the topical ophthalmic corticosteroid is selected from prednisolone acetate, dexamethasone, loteprednol etabonate, fluoromethoIone, rimexolone, and difluprednate.

[0012] In a certain embodiment, the disclosure provides for a composition, or a method as substantially described in the disclosure and figures presented herein.DESCRIPTION OF DRAWINGS

[0013] The accompanying drawings, which are incorporated into and constitute a part of this specification, illustrate one or more embodiments of the disclosure and, together with the detailed description, serve to explain the principles and implementations of the invention.

[0014] FIG. 1 demonstrates that the combined use of sodium 4-phenylbutytate (PBA) and tauroursodeoxy cholic acid (TUDCA) reduced intracellular mutant myocilin accumulation in TM cells. TM3 cells stably expressing G364V mutant myocilin were treated with various concentrations of PBA alone (top panel), TUDCA alone (middle panel), and a combination of PBA and TUDCA (bottom panel). It was found that PBA lowered intracellular mutant myocilin only when used at 5 mM, but PBA+TUDCA reduced mutant myocilin more effectively starting from 1 mM PBA and 0.5 mM TUDCA, suggesting a synergistic effect of this regimen.Atorney docket No. 00058-090W01

[0015] FIG. 2A-B demonstrates that PBA+TUDC A reduces intracellular mutant myocilin accumulation in TM cells. TM3 cells stably expressing G364V mutant myocilin were treated with various concentrations of PBA alone, TUDCA alone, and a combination of PBA and TUDCA. (A) Western blot analysis demonstrated that PBA lowered intracellular mutant myocilin only at 5 mM, but PBA+TUDCA reduced mutant myocilin more effectively, validating the synergistic effect of this regimen. (B) Quantitation of the results of the Western blot in panel A by using ImageJ. The signal intensity of the target protein bands have been corrected based upon loading differences, as determined by the intensity of the GAPDH bands.

[0016] FIG. 3A-B provides IOP measurements in perfusion cultured anterior segment model treated with (A) 5 mM PBA or (B) PBA+TUDCA at two different concentrations.

[0017] FIG. 4 demonstrates that PBA+TUDCA eye drops reduced elevated IOP in mouse model of glaucoma: Cre-inj ection induced ocular hypertension in Tg-CreMYOCY437Hmice and PBA+TUDCA eye drops were applied at 13 weeks of Cre-injections. One week after eye drops, PBA+TUDCA significantly reduced ocular hypertension.

[0018] FIG. 5 shows that PBA+TUDCA improves RGC function in mouse model of glaucoma: PERG amplitudes in 15-weeks Cre-inj ected Tg-CreMYOCY437Hmice demonstrated that Cre-inj ected Tg-CreMYOCY437Hmice exhibit significantly reduced amplitude and delayed latencies indicating functional loss of RGCs, which was completely reversed by PBA+TUDCA.DETAILED DESCRIPTION

[0019] As used herein and in the appended claims, the singular forms "a", "an", and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "an ocular condition" includes a plurality of such ocular conditions and reference to "the therapeutic" includes reference to one or more therapeutics and equivalents thereof known to those skilled in the art, and so forth.

[0020] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this disclosure belongs. Although many methods and reagents are similar or equivalent to those described herein, the exemplary methods and materials are disclosed herein.

[0021] All publications mentioned herein are incorporated by reference in full for the purpose of describing and disclosing methodologies that might be used in connection with theAtorney docket No. 00058-090W01 description herein. The publications are provided solely for their disclosure prior to the fding date of the present application. Nothing herein is to be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior disclosure. Moreover, with respect to any term that is presented in one or more publications that is similar to, or identical with, a term that has been expressly defined in this disclosure, the definition of the term as expressly provided in this disclosure will control in all respects.

[0022] As used herein, the terms ‘"guide polynucleotide,’7“guide sequence,” or “guide RNA” as can refer to any polynucleotide sequence having sufficient complementarity with a target polynucleotide sequence to hybridize with the target sequence and direct sequencespecific binding of a CRISPR complex to the target sequence. The degree of complementarity between a guide polynucleotide and its corresponding target sequence, when optimally aligned using a suitable alignment algorithm, is about or more than about 50%, 60%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99%, or more. Optimal alignment may be determined with the use of any suitable algorithm for aligning sequences known in the art. A guide CRIPSR RNA (crRNA) can be a guide polynucleotide or guide RNA and is used interchangeably herein.

[0023] The human eye is a very sensitive and complex organ. The human eye is composed of anterior and posterior chambers. The anterior segment is composed of tear film, cornea, pupil, lens, and ciliary body. The posterior segment is composed of conjunctiva, sclera, choroid, retina, vitreous humor, and optic nerve. The structure and quantity of tears are controlled by orbital glands and epithelial secretions. Cornea is the front portion of the eye that conveys and focuses light into the eye. It is divided into epithelium, stroma, and endothelium. The epithelium is made of five to seven layers of firmly connected cells. Stroma is a water-based compact layer. The endothelium preserves the transparency of the cornea. Iris is the colored portion of the eye which controls the quantity of light penetrating the eye. The dark center opening in the middle of the iris is called pupil. The pupil changes its size according to the available light. Lens is transparent portion that focuses the light into retina. The ciliary body is made of pigmented and non-pigmented ciliary epithelia, a stroma, and ciliary muscles. Capillaries of ciliary body allow communication between anterior and posterior segments. Vitreous humor is a gel-like, clear, avascular connective tissue that exists between the eye lens and the retina. It is made of 99.9% water, hyaluronic acid, ions, and collagen. The conjunctiva is a delicate transparent membrane lining inside the eyelids andAtorney docket No. 00058-090W01 shelter the frontal surface of the sclera. It is a mucous membrane that is composed of three layers, an outer epithelium, a substantia propria enclosing nerves, lymphatic and blood vessels, and a submucosa layer linked to the sclera. The sclera is a continuous of cornea. It is made of collagen and mucopolysaccharides. Choroid is vascular layer that is located between retina and sclera. The retina is thin fdm of tissue composed of neural and glial cells covering the back of the eye. It produces electrical impulses that are delivered through the optic nerve to the brain.

[0024] Glaucoma is a quite common optic neuropathy disease. Symptoms start with blurred vision that progresses into irreversible blindness in the late stage. It leads to blindness as a result of slow deterioration of optic nerve axon and fatality of retinal ganglion cells. It is commonly connected with elevation in intraocular pressure (IOP) because of irregular formation or obstruction of the aqueous humor. Risk factors include age, race, diabetes, genetics, nearsightedness, migraine, and retinal vascular caliber. Glaucoma is more common in women population as they represent 55% of open angle glaucoma, 70% of angle closure glaucoma, and 59% of all forms of glaucoma in 2010. Worldwide incidence is estimated at 76 million at 2020 and is expected to elevate to 112 million by 2040. There are two types of glaucoma: open angle and closed angle. Open angle glaucoma has no symptoms and is characterized by enlarging optic disc cupping and visual field that results in elevated prevention of drainage of aqueous humor through trabecular meshwork. However, closed angle is characterized by the elevated pressure resulted from the blockage of outflow pathways. About 76 million people suffered from glaucoma and the number is expected to reach 112 million by 2040. Generally, anti-glaucoma drugs help to adjust either aqueous humor formation or drainage.

[0025] Glaucoma is often associated with elevated IOP due to damage to trabecular meshwork (TM) cells. Elevated IOP leads to axonal loss and blindness. The trabecular meshwork (TM) maintains normal IOP by regulating aqueous humor (AH) outflow resistance. In glaucoma, there is increased resistance to aqueous humor outflow through TM, thus elevating IOP. About 70% outflow is regulated by TM, however most of the current drug treatments approved for the glaucoma target AH production via ciliary body. Despite TM being major site of glaucomatous pathology, drugs acting directly on TM pathology have not yet been developed and vision loss continues to progress in some glaucoma patients, thusAtorney docket No. 00058-090W01 highlighting a critical need to develop an effective treatment that target TM outflow to prevent vision loss in glaucoma patients.

[0026] It was shown herein that endoplasmic reticulum (ER) stress plays an important role in pathological damage to TM and IOP elevation. Previous studies have demonstrated targeting ER stress via the small molecule sodium 4-phenylbutytate (PBA) reduced elevated IOP and rescued vision loss in mice. PBA, however, had to be used at very’ high non- clinically significant concentrations (5 mM) to reduce IOP. Accordingly, based upon the drawbacks w ith PBA, it was examined herein whether alternative small molecules that reduce ER stress can also reduce glaucoma pathology7.

[0027] In was found herein that additional ER stress reducing small molecules, like tauroursodeoxy cholic acid (TUDCA), was superior to PBA in lowering elevated IOP levels. TUDCA is the taurine conjugate of ursodeoxycholic acid (UDCA). Both PBA and TUDCA are approved by FDA for the treatment of human diseases (ALS and Urea cycle disorder). TUDCA is a potent inhibitor of apoptosis, reduces ER stress and prevents mitochondrial dysfunction. It was further unexpectedly found herein that use of a combination of PBA and TUDCA worked in a synergistic manner to lower IOP and also protect neurons. In the studies presented herein wdth ex vivo human perfusion eyes, it was observed that compositions comprising PBA and TUDCA lowered IOP much more effectively than PBA alone (e.g, IOP was reduced by more than 20%) at a significantly lower dose. The data further indicates that PBA and TUDCA acted synergistically to generate said effect. Further, use of PBA with TUDCA lowered TOP by' almost 40%, which is much higher compared to currently approved glaucoma drugs.

[0028] The combination therapy of the disclosure that comprises PBA and TUDCA has many advantages, including, but not limited to:(1) Excellent safety profile, in that PBA and TUDCA have been used in humans and has been found to be very safe.(2) Very effective in lowering IOP: the combination therapy of the disclosure low ered IOP up to 40% in glaucoma donor eyes, which is notably, far superior to current medication approved for glaucoma.(3) In glaucoma, there is increased resistance to aqueous humor outflow at trabecular meshw ork, leading to elevated IOP. The combination therapy of the disclosure targets theAtorney docket No. 00058-090W01 trabecular meshwork outflow pathway to increase aqueous humor outflow and reduce IOP. The trabecular meshwork outflow pathway is not targeted by approved glaucoma treatments.(4) The combination therapy of the disclosure targets Juvenile-onset glaucoma by reducing mutant myocilin accumulation in trabecular meshwork cells.(5) The combination therapy of the disclosure targets both IOP lowering, which further protects neurons, and it also exerts strong neuroprotection (independently of its action on IOP).

[0029] Any of a variety of art-known methods can be used to administer a combination therapy comprising PBA and TUDCA disclosed herein, either alone or in combination with one or more additional agents that lower IOP or are treatments for ocular conditions. For example, the combination therapy can be administered by topical application to the eye(s). by intravitreal injection, by intracameral injection, by subretinal injection, etc.

[0030] Preparations for parenteral administration of a composition comprising a combination therapy disclosed herein, comprising PBA and TUDCA, include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils (e.g, olive oil), and injectable organic esters such as ethyl oleate. Examples of aqueous carriers include purified water, saline, and buffered media, alcoholic / aqueous solutions, and emulsions or suspensions.Examples of parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's, and fixed oils. Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer's dextrose), and the like. Preservatives and other additives, such as other antimicrobials, antioxidants, chelating agents, inert gases, and the like, can also be included. Examples of aqueous carriers for topical administration to eyes include purified water and saline. Other pharmaceutically acceptable carriers include aqueous solutions, non-toxic excipients, including salts, preservatives, buffers and the like, as described, for instance, in Remington's Pharmaceutical Sciences, 15th ed., Easton: Mack Publishing Co., 1405-1412, 1461-1487 (1975), and The National Formulary’ XIV., 14th ed., Washington: American Pharmaceutical Association (1975), the contents of which are hereby incorporated by reference. The pH and exact concentration of the various components of the pharmaceutical composition are adjusted according to routine skills in the art. See Goodman and Gilman's, The Pharmacological Basis for Therapeutics (7th ed.). In a particular embodiment, a pharmaceutical compositionAtorney docket No. 00058-090W01 disclosed herein comprises a pharmaceutically acceptable diluent that is buffered saline or purified water. In yet a further embodiment, disclosed herein a pharmaceutical composition disclosed herein comprises a pharmaceutically acceptable carrier, diluent, and / or excipient. Examples of pharmaceutically acceptable carriers, diluents, and excipients include, but are not limited to, sodium citrate, hy droxy ethyl cellulose, sodium hydroxide (to adjust pH), hydrochloric acid (to adjust pH), mannitol, sodium phosphate, dibasic sodium phosphate, carbomer 974P, tyloxapol, edetate disodium, hydroxypropyl methylcellulose, polysorbate 80, sodium chloride, edetate disodium and / or purified water.

[0031] Generally, the optimal dosage of PBA and TUDCA, making up a combination therapy of the disclosure, will depend upon the type and stage of the eye condition and factors such as the weight, sex, and condition of the subject. Nonetheless, suitable dosages can readily be determined by one skilled in the art. Typically, dosages used in vitro may provide useful guidance in the amounts useful for in situ administration of the combination therapy, and animal models may be used to determine effective dosages for treatment of specific ocular conditions. Various considerations are described, e.g., in Langer, Science, 249: 1527, (1990); Gilman et al. (eds.) (1990), each of which is herein incorporated by reference. Typically, a suitable dosage for PBA in the combination therapy disclosed herein is 0.5 mM, 0.6 mM, 0.7 mM, 0.8 mM, 0.9 mM, 1.0 mM, 1.1 mM, 1.2 rnM, 1.3 mM, 1.4 rnM,1.5 mM, 1.6 mM, 1.7 mM. 1.8 mM, 1.9 mM, 2.0 mM, 2.1 mM, 2.2 mM, 2.3 mM, 2.4 mM,2.5 mM, 2.6 mM, 2.7 mM. 2.8 mM, 2.9 mM, 3.0 mM, 3. 1 mM. 3.2 mM, 3.3 mM, 3.4 mM,3.5 mM, 3.6 mM, 3.7 mM, 3.8 mM, 3.9 mM, 4.0 mM, or a range that includes or is between any two of the foregoing dosages, including fractional dosages thereof (e.g., 1 mM to 2 mM).Generally, a suitable dosage for TUDCA in the combination therapy disclosed herein is 0.3 mM 0.4 mM 0.5 mM, 0.6 mM, 0.7 mM. 0.8 mM, 0.9 mM, 1.0 mM, 1.1 mM, 1.2 mM, 1.3 mM, 1.4 mM, 1.5 mM, 1.6 mM, 1.7 mM, 1.8 mM, 1.9 mM, 2.0 mM, 2.1 mM, 2.2 mM, 2.3 mM, 2.4 mM, 2.5 mM, 2.6 mM, 2.7 mM, 2.8 mM, 2.9 mM, 3.0 mM, 3.1 mM, 3.2 mM, 3.3 mM, 3.4 rnM, 3.5 mM, 3.6 rnM, 3.7 mM, 3.8 mM, 3.9 mM, 4.0 mM, or a range that includes or is between any two of the foregoing dosages, including fractional dosages thereof (e.g., 0.5 mM to 1 mM). In a particular embodiment, the disclosure provides for a combination therapy that comprises 1.0 to 2.0 mM of PBA and 0.5 to 1.0 mM of TUDCA.

[0032] Additionally, the disclosure provides for pharmaceutical compositions that comprise a combination therapy disclosed herein which comprises PBA and TUDCA, andAtorney docket No. 00058-090W01 optionally, additional therapeutic agents and / or medications. The optimal dosage of PBA and TUDCA in the pharmaceutical composition will depend upon the t pe and stage of the eye condition, the mode of administration, and factors such as the weight, sex, and condition of the subject. Nonetheless, suitable dosages can readily be determined by one skilled in the art. Typically , dosages used in vitro may provide useful guidance in the amounts useful for in situ administration of the pharmaceutical composition, and animal models may be used to determine effective dosages for treatment of specific ocular conditions. Various considerations are described, e.g., in Langer, Science, 249: 1527, (1990); Gilman et al. (eds.) (1990), each of which is herein incorporated by reference. Typically, a suitable concentration, by %w / v, for PBA in a pharmaceutical composition disclosed herein is 0.1, 0.11, 0.12, 0.13, 0.14. 0.15, 0.16, 0.17, 0.18, 0.19, 0.2, 0.21, 0.22, 0.23, 0.24. 0.25. 0.26. 0.27. 0.28, 0.29, 0.3.0.31, 0.32, 0.33, 0.34. 0.35, 0.36, 0.37, 0.38, 0.39, 0.4, 0.41, 0.42, 0.43, 0.44. 0.45, 0.46, 0.47,0.48, 0.49, 0.5, 0.51, 0.52, 0.53, 0.54. 0.55, 0.56, 0.57, 0.58, 0.59, 0.6, 0.61, 0.62, 0.63, 0.64. 0.65, 0.66, 0.67, 0.68, 0.69, 0.7, 0.71, 0.72, 0.73, 0.74. 0.75, 0.76, 0.77, 0.78, 0.79, 0.8, 0.81,0.82, 0.83, 0.84. 0.85, 0.86, 0.87, 0.88, 0.89, 0.9, 0.91, 0.92, 0.93. 0.94. 0.95, 0.96, 0.97, 0.98,0.99. 1.0. 1.1, 1.2, 1.3. 1.4. 1.5, 1.6, 1.7. 1.8, 1.9, 2.0, 2.1. 2.2, 2.3, 2.4, 2.5. 2.6, 2.7, 2.8. 2.9. 3.0, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0,5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, 10.0, 10.5, 11.0, 11.5, 12.0, 12.5, 13.0, 13.5, 14.0,14.5, 15.0, or a range that includes or is between any two of the foregoing dosages, including fractional dosages thereof (e.g., 0.1 to 3. 0.5 to 1.5, etc.). Generally, a suitable concentration, by %w / v, for TUDCA in a pharmaceutical composition disclosed herein is 0.01, 0.02, 0.03, 0.04. 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.11, 0.12, 0.13, 0.14. 0.15, 0.16, 0.17, 0.18, 0.19, 0.2,0.21, 0.22, 0.23, 0.24. 0.25, 0.26, 0.27, 0.28, 0.29, 0.3, 0.31, 0.32, 0.33, 0.34. 0.35, 0.36, 0.37,0.38, 0.39, 0.4. 0.41, 0.42, 0.43, 0.44. 0.45, 0.46, 0.47, 0.48, 0.49. 0.5, 0.51, 0.52, 0.53. 0.54. 0.55, 0.56, 0.57, 0.58, 0.59, 0.6, 0.61, 0.62, 0.63, 0.64. 0.65, 0.66, 0.67, 0.68, 0.69, 0.7, 0.71,0.72, 0.73, 0.74. 0.75, 0.76, 0.77, 0.78, 0.79, 0.8, 0.81, 0.82, 0.83, 0.84. 0.85, 0.86, 0.87, 0.88,0.89, 0.9, 0.91, 0.92, 0.93, 0.94. 0.95, 0.96, 0.97, 0.98, 0.99, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6,1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2. 3.3, 3.4, 3.5, 3.6. 3.7,3.8, 3.9, 4.0, 4.1. 4.2, 4.3, 4.4. 4.5. 4.6, 4.7, 4.8. 4.9. 5.0, 5.5, 6.0, 6.5. 7.0, 7.5, 8.0. 8.5. 9.0,9.5, 10.0, or a range that includes or is between any two of the foregoing dosages, including fractional dosages thereof (e.g., 0.05 to 1.5, 0.1 to 0.8, etc.). In a particular embodiment, theAtorney docket No. 00058-090W01 disclosure provides for a pharmaceutical composition that comprises 0.5 to 1.5 by %w / v of PBA and 0. 1 to 0.8 by %w / v of TUDCA.

[0033] A pharmaceutical composition comprising PBA and TUDCA can be in a form suitable for administration to a subject using carriers, excipients, and additives or auxiliaries. Frequently used carriers or auxiliaries include magnesium carbonate, titanium dioxide, lactose, mannitol and other sugars, talc, milk protein, gelatin, starch, vitamins, cellulose and its derivatives, animal and vegetable oils, polyethylene glycols and solvents, such as sterile water, buffered saline, alcohols, glycerol, and polyhydric alcohols. Intravenous vehicles include fluid and nutrient replenishers. Preservatives include antimicrobial, chelating agents, and inert gases. In a particular embodiment, the pharmaceutical composition disclosed herein comprises a preservative. In a further embodiment, the preservative is benzalkonium chloride.

[0034] The disclosure further provides a pharmaceutical composition comprising a combination therapy of PBA and TUDCA, administered by topical application to the eye(s), intravitreal injection, intracameral injection, or subretinal injection. In particular embodiment, the pharmaceutical composition is formulated for topical administration to the eye(s) and is in the form of eye drops, eye ointment, or eye gel. In yet a further embodiment, the disclosure provides for a pharmaceutical composition that comprises PBA and TUDCA in a pharmaceutically acceptable carrier, diluent, and / or excipient and a preservative at the following concentrations (% w / v):Ingredients Concentration (% w / v)PBA 1TUDCA 0.5Dibasic Sodium Phosphate 0.2Hydroxypropyl Methylcellulose 0.5Polysorbate 80 0.05Benzalkonium Chloride 0.01Sodium Chloride 0.75Edetate Disodium (EDTA) 0.01NaOH / HC1 q.s., pH 7.4Purified Water q.s. to!00%.Topical administration to the eyes typically takes the form of drops, suspensions, emulsions, gels, or ointments. Eye drops represent more than 95% of the marketed ocular products.They are used for delivering the medication into the anterior part of the eye, but with a shortAtorney docket No. 00058-090W01 residence time. Their advantages include easy administration and accepted stability. Ocular suspensions and emulsions have the ability to deliver hydrophobic drugs but may lead to blurred vision. Ocular gels and ointments (semi-solid) could significantly enhance residence time. Solid dosage forms could be used to deliver water-sensitive drugs (powder), provide zero order release model (insert), or sustain residence time (therapeutic contact lens).

[0035] Intravitreal (IVT) injection is a widely used technique to deliver therapeutic agents, like vascular endothelial growth factor inhibitors, antibiotics and glucocorticoids. IVT injections are one of the most commonly performed ocular surgery procedure in the developed world, second only to cataract surgery. The procedure is generally performed under local anesthesia with e.g., lidocaine 2%. During the procedure, the eyelids and eyelashes are treated with disinfectant such as a povidone-iodine solution. Subsequently, a 30 Gauge needle is inserted through the sclera at the pars plana region, 3.5-4 mm posterior to the limbus between vertical and horizontal muscles. The therapeutic agent is directly injected into the vitreous cavity with limited reflux. IVT injections bypass the blood retinal barrier so as to provide clinically effective doses of therapeutic agents to the target tissue. Therapeutic intraocular concentrations of the combination therapy disclosed herein can be achieved immediately and effectively without the danger of systemic absorption and toxicity.

[0036] Unlike IVT, subretinal (SR) injections constitute “proper” ophthalmic surgery performed by vitreoretinal surgeons. SR injections are routinely used in severe cases of submacular hemorrhage or other complex vitreoretinal disease involving the subretinal space. In clinical research, subretinal surgery has been performed in macular translocation surgeries, electronic, or stem-cell implants and gene therapy trials, with the aim to prevent or reverse blindness. The SR injection can be performed under retro- / parabular anesthesia or under general anesthesia in an operating theater. After disinfection, a three-port pars plana vitrectomy is performed, mostly using standard 23 or 25G trocar systems. After successful detachment of the posterior hyaloid membrane and removal of the vitreous, e.g., a doublebarreled 23G needle with 41 G tip is inserted through the trocar. The tip is guided to the subretinal area, and a small infusion of balanced salt solution (BSS) is performed into the potential subretinal space to form a bleb. Once the subretinal space has formed and location of the bleb is within the targeted region, the same retinotomy (injection channel through neuroretina) is used to guide a second instrument with the same tip built into the subretinal space for the injection of the therapeutic agent using a controlled flow rate.Atorney docket No. 00058-090W01

[0037] The disclosure further provides for a pharmaceutical composition comprising PBA and TUDCA that is administered by injection (subcutaneous, intravenous, etc.), oral administration, inhalation, or transdermal application. Depending on the route of administration, the pharmaceutical composition can be coated with a material to protect the pharmaceutical composition from the action of enzy mes, acids, and other natural conditions that may inactivate the pharmaceutical composition. The pharmaceutical composition can also be administered parenterally or intraperitoneally. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof, and in oils. Under ordinary conditions of storage and use, these preparations may contain a preservative to prevent the growth of microorganisms.

[0038] Pharmaceutical compositions suitable for inj ectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases, the composition should be sterile and should be fluid to the extent that easy syringability7exists. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. The proper fluidity can be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size, in the case of dispersion, and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens. chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it will be typical to include isotonic agents, for example, sugars, polyalcohols, such as mannitol, sorbitol, or sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent that delays absorption, for example, aluminum monostearate and gelatin.

[0039] Sterile inj ectable solutions can be prepared by incorporating the pharmaceutical composition in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by fdtered sterilization. Generally, dispersions are prepared by incorporating the pharmaceutical composition into a sterile vehicle that contains a basic dispersion medium and the required other ingredients from those enumerated above.Atorney docket No. 00058-090W01

[0040] The pharmaceutical composition can be orally administered, for example, with an inert diluent or an assimilable edible carrier. The pharmaceutical composition and other ingredients can also be enclosed in a hard or soft-shell gelatin capsule, compressed into tablets, or incorporated directly into the individual's diet. For oral therapeutic administration, the pharmaceutical composition can be incorporated with excipients and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, and the like. Such compositions and preparations should contain at least 1% by weight of active compound. The percentage of the compositions and preparations can, of course, be varied and can conveniently be between about 5% to about 80% of the weight of the unit.

[0041] The tablets, troches, pills, capsules, and the like can also contain the following: a binder, such as gum tragacanth, acacia, com starch, or gelatin; excipients such as dicalcium phosphate; a disintegrating agent, such as com starch, potato starch, alginic acid, and the like; a lubricant, such as magnesium stearate; and a sweetening agent, such as sucrose, lactose or saccharin, or a flavoring agent such as peppermint, oil of wintergreen, or cherry flavoring. When the dosage unit form is a capsule, it can contain, in addition to materials of the above type, a liquid carrier. Various other materials can be present as coatings or to otherw ise modify the physical form of the dosage unit. For instance, tablets, pills, or capsules can be coated with shellac, sugar, or both. A syrup or elixir can contain the agent, sucrose as a sweetening agent, methyl and propylparabens as preservatives, a dye. and flavoring, such as cherry or orange flavor. Of course, any material used in preparing any dosage unit form should be pharmaceutically pure and substantially non-toxic / biocompatible in the amounts employed. In addition, the pharmaceutical composition can be incorporated into sustained- release preparations and formulations.

[0042] Thus, a '■pharmaceutically acceptable earner” is intended to include solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the pharmaceutical composition, use thereof in the therapeutic compositions and methods of treatment is contemplated. Supplementary active compounds can also be incorporated into the compositions.

[0043] It is especially advantageous to formulate parenteral compositions in dosage unit form for ease of administration and uniformity of dosage. ‘‘Dosage unit form” as used herein,Atorney docket No. 00058-090W01 refers to physically discrete units suited as unitary dosages for the individual to be treated; each unit containing a predetermined quantity of pharmaceutical composition is calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. The specifics for the dosage unit forms of the disclosure are related to the characteristics of the pharmaceutical composition and the particular therapeutic effect to be achieve.

[0044] The principal pharmaceutical composition is compounded for convenient and effective administration in effective amounts with a suitable pharmaceutically acceptable carrier in an acceptable dosage unit. In the case of compositions containing supplementary active ingredients, the dosages are determined by reference to the usual dose and manner of administration of the said ingredients.

[0045] The disclosure provides methods for treating an ocular condition in a subject in need thereof, comprising: administering therapeutically effective amounts of sodium 4- phenylbutytate (PBA) and tauroursodeoxycholic acid (TUDCA) to the subject, wherein PBA and TUDCA are administered concurrently or sequentially, either alone or in combination with other therapeutic agents to a subject who has, or is at risk of having, an ocular condition associated with elevated intraocular pressure (IOP). Examples of ocular conditions associated with elevated IOP include, but are not limited to, glaucoma, ocular hypertension, uveitis, retinal detachment, pigment dispersion syndrome, pseudoexfoliation syndrome, large cataracts, tumors within the eye, and eye damage from injury or surgery.

[0046] The disclosure further provides that PBA and TUDCA can administered to the subject in combination with compounds that lower IOP. Examples of compounds that lower IOP include prostaglandin analogues (e.g., latanoprost, travoprost, and bimatoprost), betablockers (e.g., timolol and betaxolol), carbonic anhydrase inhibitors (e.g., dorzolamide, and brinzolamide), alpha-adrenergic agonists (e.g, brimonidine), and miotics (cholinergic agonists) (e.g., pilocarpine)

[0047] The disclosure further provides that PBA and TUDCA can be administered to the subject in combination with a therapeutic agent that lowers IOP, where the therapeutic agent comprises a gene editing therapy, a siRNA or an antisense oligo that lowers the expression of gene products that cause elevated IOP. With regards to antisense oligo, the antisense oligo can include siRNA, miRNA, RNAi, shRNA, and aptamers. Examples of gene editing therapy include, but are not limited to, base editors, AAV-based homologous recombination. CRISPR-Cas systems, TALEN, and zinc finger nucleases. The eye is a relatively isolatedAtorney docket No. 00058-090W01 tissue compartment; this particularity provides several advantages to the use of gene editing therapy, siRNA or antisense oligo-based therapies. Local delivery’ of compounds to the eye limits systemic exposure and reduces the amount of compound needed. It allows for local silencing of a gene while reducing the likelihood of widespread silencing outside the eye. In addition, the immune system has limited access to the eye; therefore, immune responses to the compound are less likely to occur. Finally, the eye has lower content in RNases than other tissues, allowing for an increased stability of RNA-based compounds.

[0048] The siRNA or antisense oligo can be delivered to cells using any method known in the art, including those exemplified below for base editors. In certain embodiments, the siRNA or antisense oligo is topically applied to an eye. In further embodiment, a pharmaceutical composition comprising a combination therapy disclosed herein further comprises an siRNA or antisense oligo. In yet a further embodiment, a pharmaceutical composition comprising a combination therapy disclosed herein, and an siRNA or antisense oligo, is formulated for topical administration to an eye. In a particular embodiment, the siRNA or antisense oligo is designed to suppress or disrupt expression from a myocilin gene. In further embodiments, the antisense oligo that lowers the expression of gene products that cause elevated IOP is selected from SYL1801, SYL040012 and QPI-1007. Examples of gene products that cause elevated IOP, include, but are not limited to, naturally occurring proteins that comprise one or more mutations that affect the structure and / or function of the naturally occurring protein so that expression of the mutated naturally occurring protein leads to elevated IOP, and overexpression of naturally occurring proteins leading to aberrant accumulation of the naturally occurring protein leading to elevated IOP. Examples of genes that can express proteins, or mutant proteins thereof, that can lead to elevated IOP include, but are not limited to, MYOC, OPEN, CYP1B1 AV1 / CAV2, CDKN2B, TMCO1, SIX1 / SIX6, LRP12 / ZFP, TBK1, GALC, PITX2, PITX3, FOXCI, FOXE3, PAX6, LMX1B, ANGPT7, MAF PLEKHA7, PCMTD1 / ST18, COL11A1, LOXL1 and CNTNAP2. In a particular embodiment, the gene that is affected by the gene editing therapy, siRNA or antisense oligos is selected from MYOC, OPEN, CYP1B1 AV1 / CAV2, CDKN2B antisense RNA, TMCO1, SIX1 / SIX6, LRP12 / ZFP, TBK1, and GALC. In a particular embodiment, the gene that is affected by the gene editing therapy or antisense oligos is MYOC.MYOC encodes the myocilin protein, which is expressed throughout the body, but primarily in trabecular meshwork (TM) tissue in the eyes. EM is principally involved in regulatingAtorney docket No. 00058-090W01 intraocular pressure (IOP), and elevated IOP is the main risk factor associated with glaucoma. Several mRNAs extending in size from 1.8-2.3 kb are transcribed from this gene. The variation in transcript length arises due to the discrepancy in the use of three polyadenylation sites present at the 3' end of the gene. The MYOC gene yields a secreted glycoprotein build of 504 amino acids. More than 100 disease-causing alterations in MYOC have been identified (myocilin). These alterations in MYOC can cause it to exhibit distinct phenotypes, such as having a varying age of disease onset, being prevalent among individuals of a particular race, or being influenced by environmental or epigenetic factors. Disease-causing myocilin variants are prone to aggregate and accumulate inside the ER. When both WT and mutant myocilin are present in a heterozygous state inside TM cells, proteolytic processing and the secretion of WT myocilin molecules are also impeded. This occurs due to interactions resulting in the formation of hetero oligomers between the WT and mutant protein molecules. The ER stress response and associated cell toxicity as a consequence of misfolded myocilin constitute the broadly accepted mechanism for the pathogenesis of myocilin-associated glaucoma.

[0049] The disclosure further provides that PBA and TUDCA can administered to the subject in combination with a therapeutic agent that lower IOP, where the therapeutic agent comprises a base editor or CRISPR-Cas system that lowers the expression of gene products that cause elevated IOP. Examples of gene products that cause elevated IOP, include, but are not limited to, naturally occurring proteins that comprise one or more mutations that affect the structure and / or function of the naturally occurring protein so that expression of the mutated naturally occurring protein leads to elevated IOP, and overexpression of naturally occurring proteins leading to aberrant accumulation of the naturally occurring protein leading to elevated IOP. Examples of genes that can express proteins, or mutant proteins thereof, that can lead to elevated IOP include, but are not limited to, MYOC, OPTN, CYP1B1 AV1 / CAV2, CDKN2B, TMCO1, SIX1 / SIX6, ANGPT7, LRP12 / ZFP, TBK1, GALC, PITX2, PITX3, FOXCI, FOXE3, PAX6, LMX1B, MAF PLEKHA7, PCMTD1 / ST18, COL11A1, LOXL1 and CNTNAP2. In a further embodiment, the gene that is affected by the base editor or CRISPR-Cas system is selected from MYOC, OPTN, CYP1B1 AV1 / CAV2, CDKN2B antisense RNA, TMCO1, SIX1 / SIX6, LRP12 / ZFP, TBK1, and GALC. In a particular embodiment, the gene that is affected by the base editor or CRISPR-Cas system is MYOC.Atorney docket No. 00058-090W01

[0050] Base editors combine the powerful DNA-scanning and sequence-identification capabilities of the CRISPR-Cas9 system with a deaminase enzyme, which introduces single nucleotide polymorphisms (SNPs) by chemically altering the target DNA sequence without the intentional generation of a DNA double-strand break (DSB). This chemical modification, known as deamination, consists of the removal of an amino group from a nucleotide, which after DNA repair or replication results in the installation of a new base. Use of base editors is an attractive way to edit DNA, because it greatly reduces some of the major risks associated with conventional, double stranded break-mediated gene editing. Typically, base editors comprise a Cas9 nickase (nCas9) and a nucleotide deaminase. nCas9 is still able to pair with a gRNA and target a DNA sequence complementary' to the gRNA spacer but is only able to nick one strand of the DNA. Base editors can be delivered to cells using any known methods, including, but not limited to viral vectors, non-viral vectors, and physical delivery methods. Viral vectors (e.g., Adenovirus, lentiviral and AAV vectors) are the most common method to deliver base editors. Viral vectors integrate base editors-encoding sequences into a virus's genome and release the base editors into infected cells. Generally, non-viral vector delivery systems entail use of nanoparticles, polymers, micelles, or liposomes for delivering the base editors to cells. Lipid nanoparticles (LNPs) have become an attractive nonviral delivery' platform for base editors due to their low immunogenicity and application flexibility. LNPs typically include four primary lipid components: ionizable cationic lipids, polyethylene glycol (PEG) lipids, zwitterionic phospholipids, and cholesterol. LNPs primarily enter cells via the endocytosis pathway. Inorganic vectors, such as black phosphorus, graphene oxide, mesoporous silica nanoparticles, and gold nanoparticles, have been also used to deliver base editors to cells. The advantages of inorganic vectors include stability, biocompatibility and large loading capacity. Polymeric drug delivery systems are defined as a polymeric formulation that transports the therapeutic substance into the cell or body. Polymeric delivery systems are safe, efficient, and could stably control the rate, time, and place of drug release. Examples of polymeric drug delivery' systems include, but are not limited to, elastin-like polypeptide (ELP), boronic dendrimer, nano-clew, polyethyleneimine (PEI), and carbon nanotubes, PEG (polyethylene glycol), PLL (poly-L-lysine), chitosan, PLGA (polylactic-cogly colic acid) and polymeric nanocapsules. ELPs are a stimulus- responsive biopolymer derived from the hydrophobic domain of human tropoelastin therefore ideal for gene delivery as they are less likely to be toxic. It consists of pentapeptide repeatsAtorney docket No. 00058-090W01 comprising a guest residue that can be any amino acid except proline (Pro). The genetic- engineering methods for synthesis of ELP allow absolute control over the architecture, including physical or chemical properties, especially surface charge, polydispersity, aggregation, and biocompatibility at the gene level. They exhibit reversible phase transitions from soluble to insoluble aggregates at a certain temperature, known as transition temperature (Tt). ELPs are soluble in aqueous solutions below their transition temperatures (Tt) but insoluble above. Physical delivery methods, use external forces to create pores in the cell membrane, allowing base editors to enter the cell. Electroporation is the most common physical delivery' method, where an electrical current is passed through the cells to create holes in the membrane. Other physical delivery methods include microinjection and squeezing cells. In a particular embodiment, the base editor is delivered to cells using a viral vector. In another embodiment, the base editor is delivered to cells using a non-viral vector. In yet another embodiment, the base editor is delivered to cells using a non-viral vector selected from LNPs or a polymeric drug delivery' system.

[0051] The CRISPR complex provides an effective means for modifying a target polynucleotide. The CRISPR complex has a wide variety of utilities including modifying (e.g., deleting, inserting, translocating, inactivating, activating) a target polynucleotide in a multiplicity' of cell ty pes in various tissues and organs. As such the CRISPR complex has a broad spectrum of applications in, e.g., gene or gene editing, gene therapy, drug discovery, drug screening, disease diagnosis, and prognosis. In vivo, in vitro and ex vivo uses are envisaged. In some embodiments, the CRISPR enzy me is a ty pe I or III CRISPR enzyme, preferably a type II CRISPR enzyme. This type II CRISPR enzyme may be any Cas enzy me. The Cas enzy me can be any known Cas enzy me. Examples of Cas enzy mes, include, but are not limited to, Cas9, Casl2, Casl3, Casl4, and Cpfl. In a particular embodiment, the Cas enzyme is Cas9. The CRISPR-Cas system can be delivered to cells using any known methods in the art, including those exemplified above for base editors. Where therapeutic applications are envisaged, or for other gene engineering in the target cells, then where a correction is required, it will be appreciated that following nicking or cleavage of the genomic DNA target, then correction via the HDR pathway is suitable. For gene knockdown, NHEJ is advantageous, however, correction via the HDR pathway is more suitable for therapy. In such circumstances, it is preferable to deliver a repair template. This is most preferably ssDNA although RNA via a retroviral vector to provide a corresponding DNAAtorney docket No. 00058-090W01 template is also possible. The guide sequences of the CRISPR-Cas system are generally designed to target the genes that are causing, or suspected of causing, elevated IOP, including the genes provided above. In a particular embodiment, the guide sequence of the CRISPR- Cas system targets the MYOC gene. In yet a further embodiment, the guide sequence comprises the sequence of GGCCTGCCTGGTGTGGGATG (SEQ ID NO: 1). In a certain embodiment, treatment of glaucoma in a subject in need thereof comprises using the small molecules therapy as described herein with the CRISPR-Cas system described in Jain et al. ("CRISPR-Cas9-based treatment of myocilin-associated glaucoma." Proc Natl Acad Sci US A. 114(42): 11199-11204 (2017)), the disclosure of which is incorporated herein in-full.

[0052] The disclosure also provides that the combination therapy described herein, comprising PBA and TUDCA, can also be used as a preventative to prevent IOP elevation in subjects who are administered medications that can cause increases in IOP or are administered medications that are contraindicated or have a warning label for subjects who have glaucoma or are at risk for glaucoma. In such a case, the combination therapy of the disclosure may be administered prior to starting medications that can cause increases in IOP. such as corticosteroids, or medications that are contraindicated for subjects that have glaucoma or are at risk for glaucoma, such as tricyclic antidepressants. Examples of corticosteroids include, but are not limited to, betamethasone, budesonide, dexamethasone, hydrocortisone, clobetasol propionate, methylprednisolone, mometasone. amcinonide, cloprednol. cortisol, prednisolone, alclometasone. ciclesonide, clocortolone, deflazacort. fluticasone furoate, triamcinolone acetonide, aldosterone, beclomethasone dipropionate, cortobenzolone, halcinonide, prednisolone acetate, loteprednol etabonate, fluoromethoIone, rimexolone, and difluprednate. In a particular embodiment, the corticosteroid is selected prednisolone acetate, dexamethasone, loteprednol etabonate, fluoromethoIone, rimexolone, and difluprednate. Alternatively, or additionally, the combination therapy may be administered to the subject along with medications that can cause increases in IOP or medications that are contraindicated for subjects that have glaucoma or are at risk for glaucoma. Several different drugs have the potential to cause the elevation of intraocular pressure (IOP). which can occur via an open-angle mechanism or a closed-angle mechanism. Steroid-induced glaucoma is a form of open-angle glaucoma that usually is associated with topical steroid use, but it may develop with inhaled, oral, intravenous, periocular, or intravitreal steroid administration. Medications prescribed for a variety of systemicAtorney docket No. 00058-090W01 conditions (e g., depression, allergies, Parkinson disease) can produce pupillary dilation and precipitate an attack of acute angle-closure glaucoma in anatomically predisposed eyes that have narrow angles. Dietary supplements also have been reported to induce acute angleclosure glaucoma.

[0053] Drug-induced elevation of IOP is more common by an open-angle mechanism. Steroids are a class of drugs that may produce IOP elevation by this mechanism. Steroids are one of the most commonly prescribed drugs, used mainly to treat various autoimmune and inflammatory conditions. Although it has numerous benefits, steroid usage can cause many adverse effects on the eye, the most important being steroid-induced glaucoma and cataract. Steroid-induced iatrogenic glaucoma was described for the first time in the 1950s, with the observation of glaucoma following the use of systemic adrenocorticotropic hormones and topical or systemic steroids. Several factors seem to play a crucial role in causing elevated IOP, mostly due to the increase of the resistance in the outflow mechanisms of the trabecular meshwork (TM). It has been shown that glucocorticoids (GC) can alter microstructure by inducing cross-links in the network of the actin fiber. There also appears to be an increase in collagen and fibronectin deposits in the juxtacanalicular region's extracellular matrix. Corticosteroids have also been show n to influence the turnover of substances and enzymes (z.e., stromelysin, metalloproteinases, tissue plasminogen activator, etc.) in the TM, which give rise to increased outflow resistance in this important structure that regulates IOP levels.

[0054] Ocular hypertension (OHT) can occur after steroid use in susceptible individuals. Steroid-induced glaucoma (SIG), a form of secondary glaucoma, can occur when elevated intraocular pressure (IOP) gives rise to irreversible optic neuropathy. The term "steroid responder" (SR) is used to indicate individuals that show elevated IOP after steroid use, which has been defined in current literature as IOP above 21 mmHg to 24 mmHg and / or an increase of greater than 5 to 10 mmHg compared to baseline with clinical significance.

[0055] IOP elevations are seen most commonly after topical, periocular, or intraocular administration in steroid responders. OHT can also occur after intranasal, inhalational, systemic use. and dermatological applications. Increases in intraocular pressure (IOP) usually occurs 3 to 6 weeks following topical steroid use. Not all patients taking steroids, however, will develop elevated IOP. Risk factors include preexisting primary open-angle glaucoma, a family history' of glaucoma, high myopia, diabetes mellitus, and history of connective tissue disease (especially rheumatoid arthritis). Additionally, the number ofAtorney docket No. 00058-090W01 people responding with an elevated IOP varies with the route of administration. More people respond from topically applied drops (including topically applied creams to the periorbital area) or intravitreal injection. In order of decreasing frequency, incidence of elevated IOP is less with intravenous, parenteral, and inhaled routes of administration. Patients on chronic corticosteroid therapy can remain undiagnosed with an elevated IOP, which can result in glaucomatous optic nerve damage. Steroid-induced IOP elevation typically occurs within a few weeks of beginning steroid therapy. In most cases, the IOP lowers spontaneously to the baseline within a few weeks to months upon stopping the steroid. In rare instances, the IOP remains elevated. Additionally, there may be some patients whose underlying condition necessitates the continued use of corticosteroids despite the elevated IOP. These patients are treated identically to those with primary open-angle glaucoma.

[0056] Most categories of drugs that list glaucoma as a contraindication or adverse effect are concerned with inducing acute angle-closure glaucoma. These medications will incite an attack only in those individuals with occludable angles (i.e., very narrow anterior chamber angles). The classes of medications that have the potential to induce angle closure are topical anticholinergic or sympathomimetic dilating drops, tricyclic antidepressants, monoamine oxidase inhibitors, antihistamines, antiparkinsonian drugs, antipsychotic medications, and antispasmolytic agents. Sulfa containing medications, e.g., topiramate, acetazolamide and trimethoprim-sulfamethoxazole, may induce angle-closure glaucoma by a different angleclosure mechanism, involving anterior rotation of the ciliary body. Typically, the angle closure is bilateral and occurs within the first several doses of the sulfonamide-containing medication. Patients with narrow or wide-open angles are potentially susceptible to this rare and idiosyncratic reaction. The more medications a patient with a narrow angle takes, the higher their chances of developing angle-closure glaucoma. Examples of medications that are contraindicated or having warning labels for subjects with glaucoma, or at risk of having glaucoma, include but are not limited to, ipratropium bromide, tiotropium bromide, botulinum toxin (botox) injections used around the eyes, cold / flu medications containing antihistamines or decongestants, tolterodine, oxybutynin, dilating eye drops, diphenhydramine, loratadine, fexofenadine, cetirizine, sumatriptan, orphenadrine, trihexyphenidyl, scopolamine patches, fluoxetine, paroxetine, amitriptyline, tofranil, duloxetine, topiramate, acetazolamide, trimethoprim-sulfamethoxazole, cimetidine and ranitidine.Atorney docket No. 00058-090W01

[0057] For use in the therapeutic applications described herein, kits and articles of manufacture are also described herein. Such kits can comprise a carrier, package, or container that is compartmentalized to receive one or more containers such as vials, tubes, and the like, each of the container(s) comprising one of the separate elements to be used in a method described herein. Suitable containers include, for example, bottles, vials, syringes, and test tubes. The containers can be formed from a variety of materials such as glass or plastic.

[0058] For example, the container(s) can comprise PBA and TUDCA as described herein, optionally in a composition or in combination with another agent as disclosed herein. The container(s) optionally have a sterile access port (for example the container can be an intravenous solution bag or a vial having a stopper pierceable by a hypodermic injection needle). Such kits optionally comprise an identifying description or label or instructions relating to its use in the methods described herein.

[0059] A kit will typically comprise one or more additional containers, each with one or more of various materials (such as reagents, optionally in concentrated form, and / or devices) desirable from a commercial and user standpoint for use of compounds described herein. Non-limiting examples of such materials include, but are not limited to, buffers, diluents, filters, needles, syringes; carrier, package, container, vial and / or tube labels listing contents and / or instructions for use, and package inserts with instructions for use. A set of instructions will also typically be included.

[0060] A label can be on or associated with the container. A label can be on a container when letters, numbers or other characters forming the label are attached, molded or etched into the container itself, a label can be associated with a container when it is present within a receptacle or carrier that also holds the container, e.g, as a package insert. A label can be used to indicate that the contents are to be used for a specific therapeutic application. The label can also indicate directions for use of the contents, such as in the methods described herein. These other therapeutic agents may be used, for example, in the amounts indicated in the Physicians' Desk Reference (PDR) or as otherwise determined by one of ordinary' skill in the art.

[0061] The disclosure further provides that the compositions, systems and methods described herein can be further defined by the following aspects (aspects 1 to 126):1. A pharmaceutical composition for the treatment of an ocular condition associated with elevated intraocular pressure (IOP), comprising:Atorney docket No. 00058-090W01 a combination therapy comprising therapeutically effective amounts of sodium 4- phenylbutytate (PBA) and tauroursodeoxycholic acid (TUDCA), in a pharmaceutically acceptable carrier, diluent, and / or excipient.2. The pharmaceutical composition of aspect 1 , wherein the ocular condition associated with elevated IOP is selected from glaucoma, ocular hypertension, uveitis, retinal detachment, pigment dispersion syndrome, pseudoexfoliation syndrome, large cataracts, tumors within the eye, steroid-induced ocular hypertension, steroid-induced glaucoma and eye damage from injury or surgery.3. The pharmaceutical composition of aspect 1 or aspect 2, wherein the ocular condition is glaucoma.4. The pharmaceutical composition of any one of aspects 1 to 3, wherein the combination therapy comprises PBA at a concentration of 0.5 mM to 4.0 mM.5. The pharmaceutical composition of any one of aspects 1 to 4, wherein the combination therapy comprises PBA at a concentration of 1.0 mM to 2.0 mM.6. The pharmaceutical composition of any one of aspects 1 to 5, wherein the combination therapy comprises TUDCA at a concentration of 0.3 mM to 3.0 mM.7. The pharmaceutical composition of any one of aspects 1 to 6, wherein the combination therapy comprises TUDCA at a concentration of 0.5 mM to 1.0 mM.8. The pharmaceutical composition of any one of aspects 1 to 7, wherein the pharmaceutical composition is formulated for intravitreal injection, intracameral injection, subretinal injection, or for topical administration to the eye(s).9. The pharmaceutical composition of any one of aspects 1 to 8, wherein the pharmaceutical composition is formulated for topical administration to the eye(s) and is in the form of eye drops, eye ointment, or eye gel.10. The pharmaceutical composition of any one of aspects 1 to 9, wherein the pharmaceutical composition comprises PBA at a concentration (% w / v) from 0.1 to 3.11. The pharmaceutical composition of any one of aspects 1 to 10, wherein the pharmaceutical composition comprises PBA at a concentration (% w / v) from 0.5 to 1.5.12. The pharmaceutical composition of any one of aspects 1 to 11, wherein the pharmaceutical composition comprises TUDCA at a concentration (% w / v) from 0.05 to 1.5.13. The pharmaceutical composition of any one of aspects 1 to 12, wherein the pharmaceutical composition comprises TUDCA at a concentration (% w / v) from 0.1 to 0.8.Atorney docket No. 00058-090W0114. The pharmaceutical composition of any one of aspects 1 to 13, wherein the pharmaceutical composition comprises PBA and TUDCA in a pharmaceutically acceptable carrier, diluent, and / or excipient and a preservative at the following concentrations (% w / v):Concentration (% w / v)PBA 1TUDCA 0.5Dibasic Sodium Phosphate 0.2Hydroxypropyl Methylcellulose 0.5Polysorbate 80 0.05Benzalkonium Chloride 0.01Sodium Chloride 0.75Edetate Disodium (EDTA) 0.01NaOH / HC1 as needed to provide a pH 7.4Purified Water as needed up to 100%.15. The pharmaceutical composition of any one of aspects 1 to 14, wherein the pharmaceutically acceptable diluent comprises buffered saline or purified water.16. The pharmaceutical composition of any one of aspects 1 to 15, wherein the pharmaceutically acceptable earner, diluent, and / or excipient includes sodium citrate, hydroxy ethyl cellulose, sodium hydroxide (to adjust pH), hydrochloric acid (to adjust pH), mannitol, sodium phosphate, dibasic sodium phosphate, carbomer 974P, tyloxapol, edetate disodium, hydroxypropyl methylcellulose, polysorbate 80, sodium chloride, edetate disodium and / or purified water.17. The pharmaceutical composition of any one of aspects 1 to 16, wherein the pharmaceutical composition further comprises a preservative.18. The pharmaceutical composition of aspect 17, wherein the preservative is benzalkonium chloride.19. The pharmaceutical composition of any one of aspects 1 to 18, wherein the pharmaceutical composition further comprises additional medication(s) selected from a prostaglandin analogue, a beta-blocker, a carbonic anhydrase inhibitor, a corticosteroid, a Rho kinase inhibitor, an alpha-adrenergic agonist, and / or a miotic.20. The pharmaceutical composition of any one of aspects 1 to 19, wherein the pharmaceutical composition further comprises additional medication(s) selected fromAtorney docket No. 00058-090W01 bimatoprost, tafluprost, latanoprost, travoprost, betaxolol, timolol, brinzolamide, dorzolamide. brimonidine. and netarsudil.21. The pharmaceutical composition of any one of aspects 1 to 20, wherein the pharmaceutical composition further comprises additional medication(s) selected from prednisolone acetate, dexamethasone, loteprednol etabonate, fluoromethoIone, rimexolone, and difluprednate.22. The pharmaceutical composition of any one of aspects 1 to 21, wherein the pharmaceutical composition further comprises 5-amino-3-(l-hydroxy-2,2,6,6- tetramethylpiperidin-4-yl)-l,2,3-oxadiazol-3-ium chloride (SA-2).23. The pharmaceutical composition of any one of aspects 1 to 22, wherein the pharmaceutical composition further comprises a gene editing therapy, an siRNA, or an antisense oligo that lowers the expression of gene product(s) that causes elevated IOP.24. The pharmaceutical composition of aspect 23, wherein the antisense oligo is selected from miRNA, RNAi, shRNA, siRNA, and aptamers.25. The pharmaceutical composition of aspect 23 or aspect 24, wherein the siRNA is selected from SYL040012, SYL1801 and QPI-1007.26. The pharmaceutical composition of any one of aspects 23 to 25, wherein the gene editing therapy, the siRNA, or the antisense oligo lowers the expression of a protein selected from MYOC, OPTN, CYP1B1 AV1 / CAV2, CDKN2B, TMCO1, SIX1 / SIX6, LRP12 / ZFP, TBK1, GALC. PITX2. PITX3, FOXCI. FOXE3, ANGPTL7. PAX6. LMX1B. MAF PLEKHA7, PCMTD1 / ST18, COL1 1 A1 , LOXL1 and CNTNAP2.27. The pharmaceutical composition of any one of aspects 23 to 26, wherein the gene editing therapy is a CRISPR-Cas9-based system that suppresses or lowers the expression of a myocilin gene.28. The pharmaceutical composition of any one of aspect 27, wherein the myocilin gene encodes a mutant form of myocilin.29. The pharmaceutical composition of aspect 28, wherein the CRISPR-Cas9-based system comprises a guide sequence having the sequence of SEQ ID NO: 1.30. A method of treating or preventing an ocular condition associated with elevated intraocular pressure (IOP) in a subject in need thereof, the method comprising:Atorney docket No. 00058-090W01 administering a combination therapy comprising therapeutically effective amounts of 4- phenylbutytate (PBA) and a tauroursodeoxy cholic acid (TUDCA) to the subject in need thereof.31. The method of aspect 30, wherein the combination therapy has a synergistic effect in reducing elevated IOP.32. The method of aspect 30 or aspect 31. wherein the ocular condition is selected from glaucoma, ocular hypertension, uveitis, retinal detachment, pigment dispersion syndrome, pseudoexfoliation syndrome, large cataracts, tumors within the eye, steroid- induced ocular hypertension, steroid-induced glaucoma and eye damage from injury or surgery.33. The method of any one of aspects 30 to 32, wherein the ocular condition is glaucoma.34. The method of any one of aspects 30 to 33, wherein PBA is administered separately from TUDCA.35. The method of any one of aspects 30 to 34, wherein PBA is administered concurrently or sequentially with TUDCA.36. The method of any one of aspects 30 to 32, wherein a pharmaceutical composition comprises the combination therapy that is administered to the subject in need thereof.37. The method of aspect 36, wherein the pharmaceutical composition is the pharmaceutical composition of any one of aspects 1 to 29.38. The method of aspect 36 or aspect 37, wherein the pharmaceutical composition comprises PBA at a concentration (% w / v) from 0. 1 to 3.39. The method of any one of aspects 36 to 38, wherein the pharmaceutical composition comprises PBA at a concentration (% w / v) from 0.5 to 1.5.40. The method of any one of aspects 36 to 39, wherein the pharmaceutical composition comprises TUDCA at a concentration (% w / v) from 0.05 to 1.5.41. The method of any one of aspects 36 to 40, wherein the pharmaceutical composition comprises TUDCA at a concentration (% w / v) from 0. 1 to 0.8.42. The method of any one of aspects 30 to 40, wherein the combination therapy is administered directly to the eyes of the subject.Atorney docket No. 00058-090W0143. The method of any one of aspects 30 to 42, wherein the combination therapy is administered by intravitreal injection, by intracameral injection, by subretinal injection, or by topical administration to the eye(s).44. The method of any one of aspects 30 to 43, wherein the combination therapy is formulated for topical administration to the eye(s) and is in the form of eye drops, eye ointment, or eye gel.45. The method of any one of aspects 30 to 44, wherein the combination therapy comprises PBA at a concentration of 0.5 mM to 4.0 mM.46. The method of any one of aspects 30 to 45, wherein the combination therapy comprises PBA at a concentration of 1.0 mM to 2.0 mM.47. The method of any one of aspects 30 to 46, wherein the combination therapy comprises TUDCA at a concentration of 0.3 mM to 3.0 mM.48. The method of any one of aspects 30 to 47, wherein the combination therapy comprises TUDCA at a concentration of 0.5 mM to 1.0 mM.49. The method of any one of aspects 30 to 48, wherein the combination therapy is administered in combination with additional medication(s) selected from a prostaglandin analogue, a beta-blocker, a carbonic anhydrase inhibitor, a corticosteroid, a Rho kinase inhibitor, an alpha-adrenergic agonist, and / or a miotic.50. The method of any one of aspects 30 to 49, wherein the combination therapy is administered to the subject in need thereof in combination with additional medication(s) selected from bimatoprost, tafluprost, latanoprost, travoprost, betaxolol, timolol, brinzolamide, dorzolamide, brimonidine, and netarsudil.51. The method of any one of aspects 30 to 50, wherein the combination therapy is administered to the subject in need thereof in combination with additional medication(s) selected from prednisolone acetate, dexamethasone, loteprednol etabonate, fluoromethoIone, rimexolone, and difluprednate.52. The method of any one of aspects 30 to 51, wherein the combination therapy is administered to the subject in need thereof in combination with 5-amino-3-(l-hydroxy- 2,2,6,6-tetramethylpiperidin-4-yl)-l,2,3-oxadiazol-3-ium chloride (SA-2).53. The method of any one of aspects 30 to 52, wherein the combination therapy is administered to the subject in need thereof in combination with gene editing therapy, anAtorney docket No. 00058-090W01 siRNA, or an antisense oligo that lowers the expression of gene product(s) that causes elevated IOP.54. The method of aspect 53, wherein the antisense oligo is selected from siRNA, miRNA, RNAi, shRNA, and aptamers.55. The method of aspect 53 or aspect 54, wherein the antisense oligo is an siRNA selected from SYL040012, SYL1801 and QPI-1007.56. The method of any one of aspects 53 to 55, wherein the gene editing therapy, the siRNA, or the antisense oligo lowers the expression of a protein selected from MYOC, OPTN, CYP1B1 AV1 / CAV2, CDKN2B, TMC01, SIX1 / SIX6, LRP12 / ZFP, TBK1, GALC, PITX2, PITX3, FOXCI, FOXE3, PAX6, LMX1B, MAF PLEKHA7, PCMTD1 / ST18, COL11A1. ANGPTL7, LOXL1 and CNTNAP2.57. The method of any one of aspects 53 to 56, wherein the gene editing therapy is CRISPR-Cas9-based system that suppresses or lowers the expression of a myocilin gene.58. The method of aspect 57, where the myocilin gene encodes a mutant form of myocilin.59. The method of aspect 58, wherein the CRISPR-Cas9-based system comprises a guide sequence having the sequence of SEQ ID NO: 1.60. The method of any one of aspects 53 to 59, wherein the gene editing therapy, the siRNA, or the antisense oligo is delivered to a cell by use of a viral vector, non-viral vector, or by a physical delivery method.61 . The method of aspect 60, wherein the viral vector is selected from Adenoviral vector, lentiviral vector and an AAV vector.62. The method of aspect 60, wherein the non-viral vector is selected from nanoparticles, polymers, micelles, and liposomes.63. The method of aspect 62, wherein the nanoparticles are lipid nanoparticles.64. The method of aspect 62, wherein the polymers are selected from elastin-like polypeptide (ELP), boronic dendrimer, nano-clew, polyethyleneimine (PEI), and carbon nanotubes, PEG (polyethylene glycol), PLL (poly -L-ly sine), chitosan, PLGA (polylactic- cogly colic acid), polymeric nanocapsules, l,2-distearoyl-sn-glycero-3-phosphocholine 280 (DSPC), cholesterol, and l,2-dimyristoyl-rac-glycero-3-methoxypolyethylene gly col-2000 (DMG-281 PEG 2000).Atorney docket No. 00058-090W0165. The method of any one of aspects 30 to 64, wherein the combination therapy is administered to prevent an ocular condition associated with elevated intraocular pressure (IOP) that is induced by, or possibly aggravated by, the administration of a medication or treatment that is used to treat a condition, a disorder or a disease.66. The method of aspect 65, wherein the ocular condition is steroid-induced ocular hypertension or steroid-induce glaucoma, and wherein the medication is a steroid.67. The method of aspect 66, wherein the steroid is a corticosteroid.68. The method of aspect 67, wherein the corticosteroid is selected from betamethasone, budesonide, dexamethasone, hydrocortisone, clobetasol propionate, methylprednisolone, mometasone, amcinonide, cloprednol, cortisol, prednisolone, alclometasone. ciclesonide, clocortolone, deflazacort. fluticasone furoate, triamcinolone acetonide, aldosterone, beclomethasone dipropionate, cortobenzolone, prednisolone acetate, loteprednol etabonate, fluoromethoIone, rimexolone, and difluprednate, and halcinonide.69. The method of aspect 65, wherein the ocular condition is glaucoma, and wherein the medication or treatment is contraindicated or has a warning label for use in subjects who have glaucoma or at risk of developing glaucoma.70. The method of aspect 69, wherein the medication or treatment is selected from ipratropium bromide, tiotropium bromide, botulinum toxin (botox) injections used around the eyes, cold / flu medications containing antihistamines or decongestants, tolterodine, oxybutynin, dilating eye drops, diphenhydramine, loratadine, fexofenadine, cetirizine, sumatriptan, orphenadrine, trihexyphenidyl, scopolamine patches, fluoxetine, paroxetine, amitriptyline, tofranil, duloxetine, topiramate, acetazolamide, trimethoprimsulfamethoxazole, cimetidine and ranitidine.71. The method of any one of aspects 65 to 70, wherein the combination therapy is administered prior to and / or concurrently with the administration of the medication or treatment that is used to treat a condition, a disorder or a disease.72. A method of treating or preventing fibrosis in the trabecular meshwork (TM) in the eyes of a subject in need thereof, the method comprising: administering a combination therapy comprising therapeutically effective amounts of sodium 4-phenylbutytate (PBA) and tauroursodeoxy cholic acid (TUDCA) to the subject in need thereof.Atorney docket No. 00058-090W0173. The method of aspect 72, wherein the subject has undergone a surgical procedure to implant a device to treat an ocular condition.74. The method of aspect 73, wherein the ocular condition is associated with elevated intraocular pressure (IOP) or is cataracts.75. The method of aspect 73 or aspect 74, wherein the ocular condition is glaucoma.76. The method of any one of aspects 72 to 75, wherein PBA is administered separately from TUDCA.77. The method of any one of aspects 72 to 76, wherein PBA is administered concurrently or sequentially with TUDCA.78. The method of any one of aspects 72 to 75, wherein a pharmaceutical composition comprises the combination therapy that is administered to the subject in need thereof.79. The method of aspect 78, wherein the pharmaceutical composition is the pharmaceutical composition of any one of aspects 1 to 29.80. The method of aspect 78 or aspect 79. wherein the pharmaceutical composition comprises PBA at a concentration (% w / v) from 0. 1 to 3.81. The method of any one of aspects 78 to 80, wherein the pharmaceutical composition comprises PBA at a concentration (% w / v) from 0.5 to 1.5.82. The method of any one of aspects 78 to 81, wherein the pharmaceutical composition comprises TUDCA at a concentration (% w / v) from 0.05 to 1.5.83. The method of any one of aspects 78 to 82, wherein the pharmaceutical composition comprises TUDCA at a concentration (% w / v) from 0.1 to 0.8.84. The method of any one of aspects 72 to 83, wherein the combination therapy is administered directly to the eyes of the subject.85. The method of any one of aspects 72 to 84, wherein the combination therapy is administered by intravitreal injection, by intracameral injection, by subretinal injection, or by topical administration to the eye(s).86. The method of any one of aspects 72 to 85, wherein the combination therapy is formulated for topical administration to the eye(s) and is in the form of eye drops, eye ointment, or eye gel.87. The method of any one of aspects 72 to 86, wherein the combination therapy comprises PBA at a concentration of 0.5 mM to 4.0 mM.Atorney docket No. 00058-090W0188. The method of any one of aspects 72 to 87, wherein the combination therapy comprises PBA at a concentration of 1.0 mM to 2.0 mM.89. The method of any one of aspects 72 to 88, wherein the combination therapy comprises TUDCA at a concentration of 0.3 mM to 3.0 mM.90. The method of any one of aspects 72 to 89, wherein the combination therapy comprises TUDCA at a concentration of 0.5 mM to 1.0 mM.91. The method of any one of aspects 72 to 90, wherein the combination therapy is administered in combination with additional medication(s) selected from a prostaglandin analogue, a beta-blocker, a carbonic anhydrase inhibitor, a Rho kinase inhibitor, a corticosteroid, an alpha-adrenergic agonist, and / or a miotic.92. The method of any one of aspects 72 to 91, wherein the combination therapy is administered to the subject in need thereof in combination with additional medication(s) selected from bimatoprost, tafluprost, latanoprost, travoprost, betaxolol, timolol, brinzolamide, dorzolamide, brimonidine, and netarsudil.93. The method of any one of aspects 72 to 92, wherein the pharmaceutical composition further comprises additional medication(s) selected from prednisolone acetate, dexamethasone, loteprednol etabonate, fluoromethoIone, rimexolone, and difluprednate.94. The method of any one of aspects 72 to 93, wherein the combination therapy is administered to the subject in need thereof in combination with 5-amino-3-(l-hydroxy- 2,2,6,6-tetramethylpiperidin-4-yl)-1.2.3-oxadiazol-3-ium chloride (SA-2).95. The method of any one of aspects 72 to 94, wherein the combination therapy is administered to the subject in need thereof in combination w ith a gene editing therapy, an siRNA, or an antisense oligo that lowers the expression of gene product(s) that causes elevated IOP.96. The method of aspect 95, wherein the antisense oligo is selected from siRNA, miRNA, RNAi, shRNA, and aptamers.97. The method of aspect 95 or aspect 96, wherein the antisense oligo is an siRNA selected from SYL040012, SYL1801 and QPI-1007.98. The method of any one of aspects 95 to 97, wherein the gene editing therapy, the siRNA, or the antisense oligo lowers the expression of a protein selected from MYOC, OPTN, CYP1B1 AV1 / CAV2, CDKN2B, TMCO1, SIX1 / SIX6, LRP12 / ZFP, TBK1, GALC,Atorney docket No. 00058-090W01PITX2, PITX3, FOXCI, FOXE3, PAX6, LMX1B, MAF PLEKHA7, PCMTD1 / ST18, ANGPTL7, COL11A1, LOXL1 and CNTNAP2.99. The method of any one of aspects 95 to 98, wherein the gene editing therapy is a CRISPR-Cas9-based system that suppresses or lowers the expression of a myocilin gene.100. The method of aspect 99, where the myocilin gene encodes a mutant form of myocilin.101. The method of aspect 100, wherein the CRISPR-Cas9-based system comprises a guide sequence having the sequence of SEQ ID NO: 1.102. The method of any one of aspects 95 to 101, wherein the gene editing therapy, the siRN A, or the antisense oligo is delivered to a cell by use of a viral vector, non-viral vector, or by a physical delivery method.103. The method of aspect 102, wherein the viral vector is selected from Adenoviral vector, lentiviral vector and an AAV vector.104. The method of aspect 102, wherein the non-viral vector is selected from nanoparticles, polymers, micelles, and liposomes.105. The method of aspect 104, wherein the nanoparticles are lipid nanoparticles.106. The method of aspect 104, wherein the polymers are selected from elastin-like polypeptide (ELP), boronic dendrimer, nano-clew, polyethyleneimine (PEI), and carbon nanotubes, PEG (polyethylene glycol), PLL (poly -L-ly sine), chitosan, PLGA (polylactic- cogly colic acid), polymeric nanocapsules. l,2-distearoyl-sn-glycero-3-phosphocholine 280 (DSPC), cholesterol, and l ,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000 (DMG-281 PEG 2000).107. A method of reducing corticosteroid-induced ER stress or myocilin accumulation in the trabecular meshwork (TM) in the eyes of a subject in need thereof, the method comprising: administering a combination therapy comprising therapeutically effective amounts of sodium 4-phenylbutytate (PBA) and tauroursodeoxy cholic acid (TUDCA), and a topical ophthalmic corticosteroid to the subject in need thereof.108. The method of aspect 107, wherein PBA is administered separately from TUDCA.109. The method of aspect 107 or aspect 108, wherein PBA is administered concurrently or sequentially with TUDCA.Atorney docket No. 00058-090W01110. The method of any one of aspects 107 to 109, wherein the combination therapy is administered separately from the topical ophthalmic corticosteroid.1 11. The method of any one of aspects 107 to 110, wherein the combination therapy is administered concurrently or sequentially with the topical ophthalmic corticosteroid.112. The method of aspect 107, wherein a pharmaceutical composition comprises the combination therapy that is administered to the subject in need thereof.1 13. The method of aspect 112, wherein the pharmaceutical composition is the pharmaceutical composition of any one of aspects 1 to 29.114. The method of aspect 112 or aspect 113, wherein the pharmaceutical composition comprises PBA at a concentration (% w / v) from 0. 1 to 3.115. The method of any one of aspects 112 to 114. wherein the pharmaceutical composition comprises PBA at a concentration (% w / v) from 0.5 to 1.5.116. The method of any one of aspects 112 to 115, wherein the pharmaceutical composition comprises TUDCA at a concentration (% w / v) from 0.05 to 1.5.117. The method of any one of aspects 112 to 116. wherein the pharmaceutical composition comprises TUDCA at a concentration (% w / v) from 0. 1 to 0.8.118. The method of any one of aspects 107 to 117, wherein the combination therapy is administered directly to the eyes of the subject.119. The method of any one of aspects 107 to 118, wherein the combination therapy is administered by intravitreal injection, by intracameral injection, by subretinal injection, or by topical administration to the eye(s).120. The method of any one of aspects 107 to 119, wherein the combination therapy is formulated for topical administration to the eye(s) and is in the form of eye drops, eye ointment, or eye gel.121. The method of any one of aspects 107 to 120, wherein the combination therapy comprises PBA at a concentration of 0.5 mM to 4.0 mM.122. The method of any one of aspects 107 to 121, wherein the combination therapy comprises PBA at a concentration of 1.0 mM to 2.0 mM.123. The method of any one of aspects 107 to 122, wherein the combination therapy comprises TUDCA at a concentration of 0.3 mM to 3.0 mM.124. The method of any one of aspects 107 to 123, wherein the combination therapy comprises TUDCA at a concentration of 0.5 mM to 1.0 mM.Atorney docket No. 00058-090W01125. The method of any one of aspects 107 to 124. wherein the the topical ophthalmic corticosteroid is selected from prednisolone acetate, dexamethasone, loteprednol etabonate, fluoromethoIone, rimexolone, and difluprednate.

[0062] The following examples are intended to illustrate but not limit the disclosure. While they are typical of those that might be used, other procedures known to those skilled in the art may alternatively be used.EXAMPLES

[0063] The invention is illustrated in the following examples, which are provided by way of illustration and are not intended to be limiting.

[0064] Cell culture and stable cell production. Transformed TM3 cells were cultured in DMEM supplemented with 10% FBS (Hyclone Laboratories), 2 mM L-glutamine (Thermo Fisher Scientific), penicillin (10,000 units / mL; Thermo Fisher Scientific), and streptomycin (10 pg / mL; Thermo Fisher Scientific). Cells were maintained in a humidified incubator at 5% CO2 and 37 °C. TM3 cells were transfected with pDsRed2-MYOC plasmids to generate stable cells expressing WT or mutant (Y437H or G364V) MYOC using Lipofectamine 3000 transfection kit (Invitrogen, Life Technologies, Grand Island, NY, USA). These plasmids express MYOC tagged with DsRed at the C-terminus. The confluent transfected cells were then treated with G418 antibiotic (0.6 mg / mL: Gibco, Life Technologies, Grand Island, NY, USA) for 7-10 days and individual colonies were selected and expanded. The cells stably expressing DsRed-tagged MYOC (with or without mutations) were characterized as described in Wordinger et al., Ophthalmol. Vis. Sci. 48(3): 1191-1200 (2007), and maintained in DMEM media (Sigma- Aldrich Corp, St. Louis, MO, USA)) supplemented with G418 antibiotics, 10% FBS (Gibco), and streptomycin (Gibco).

[0065] Intraocular injections for viral delivery. Viral deliveries were performed via intravitreal (IVT) and intracameral (IC) routes. Mouse eyes were anesthetized before injections by topical administration of proparacaine HC1 drops (0.5%) (Akom Inc., Lake Forest, IL, USA). Both IVT and IC bolus injections were performed on mice anesthetized intranasally with isoflurane (2.5%; with 0.8 L / min oxygen). However, in case of slow-IC infusion protocol, mice were anesthetized using xylazine / keta-mine (10 / 100 mg / kg; Vetus; Butler Animal Health Supply, Westbury', NY / Fort Dodge Animal Health, Fort Dodge, IA, USA) cocktail administered intraperitoneally. As required, additional one-quarter to one-halfAtorney docket No. 00058-090W01 of the initial dose was provided for continuous maintenance of the surgical anesthetic state. LV particles (2.5 x io6TU / eyes and 2.5 pL / eye) or various AAV2 (2 x io10GC / eye) were injected via IVT or IC route. Hamilton’s (Reno, NV, USA) glass micro-syringe (10 pL capacity) attached with a 33 gauge 1 -inch-long needle was used for IVT injections as described in Patil et al., Int. J. Mol. Sci. 33(13): 6683 (2022).

[0066] For IC route, mouse eyes were treated topically with 1% cyclopentolate (Mydriacyl, Alcon Laboratories, Fort Worth, TX) to dilate the pupils. Using the same microsyringe system, the 33-gauge needle was inserted through the cornea 1-2 mm from the limbus, positioned parallel to the iris, and pushed towards the chamber angle opposite to the cannulation point. Care was taken to not touch the iris, comeal endothelium, or the anterior lens capsule. The viral solution was slowly released into the anterior chamber over a period of 30 s, after which the needle was kept inside for a further 1 min, before being rapidly withdrawn. For slow infusion, the glass micropipette system was loaded onto a micro-dialysis infusion pump (SP101I Sy ringe Pump; WPI) that delivered the viral solution at a flow rate of 0.083 pL / min over the course of 30 min (total volume delivered, 2.5 pL). A drop of filtered saline was also applied through this procedure to prevent comeal drying.

[0067] IOP measurements. Daytime and nighttime lOPs were measured using a TonoLab rebound tonometer (Colonial Medical Supply) under isoflurane anesthesia. For measuring nighttime lOPs. mice were kept in the dark for 7 hours (3 pm to 10 pm), and lOPs ere measured in the dark using dim red lights. Six individual IOP measurements were obtained in a masked manner and averaged to obtain the final TOP value for each eye. Daytime lOPs were measured between 9 am and 11 am.

[0068] Western blot analysis. TM3 cells were lysed in 1 x RIPA buffer containing protease inhibitors. Cellular lysates were loaded on denaturing 4%-12% gradient polyacrylamide ready made gels (NuPAGE Bis-Tris gels, Life Technologies). The proteins were separated using Invitrogen’s Mini Gel electrophoresis tank at constant voltage (150 V) and transferred onto a methanol-activated PVDF membrane (Immobilon-P, 0.45 pm pore size; Merk Millipore Ltd., St. Louis, MO, USA). The blots were blocked with 5% nonfat dry milk prepared in 1 x PBS with Tween-20 (PBST), followed by overnight incubation at 4 °C with respective primary antibodies (1: 1000 dilutions). The primary antibodies used were MYOC (catalog# ab41552, Abeam) and GAPDH (catalog# 60004-1-Ig, Proteintech) (a loading control). After overnight primary antibody incubation, the blots were w ashed with 1Attorney docket No. 00058-090W01 x PBST and incubated with respective horseradish-peroxidase (HRP)-conjugated secondary antibodies (1:2500 dilution) and developed with enhanced chemiluminescence (ECL) detection reagent (SuperSignal West Femto Maximum Sensitivity Substrate; Life Technologies). Protein bands were visualized using an LI-COR Biosciences Odyssey-Fc image system (Lincoln, NE, USA) and quantified using ImageStudio software (LI-COR Biosciences).

[0069] Ocular tissues were carefully dissected and lysed in RIPA buffer (Thermo Fisher Scientific), as described in Zode et al. (Invest Ophthalmol Vis Sei 53(3): 1557-1565 (2012)). For anterior-segment tissues, iridocorneal rings, including TM and surrounding tissues, were collected. Retina samples contained the entire retina, including the ON region. Approximately 20-30 pg of total protein was applied to each lane and separated on denaturing 4%-12% gradient polyacrylamide ready-made gels (NuPAGE Bis-Tris gels, Invitrogen) before being transferred onto PVDF membranes (MilliporeSigma). The blots were blocked with 10% nonfat dried milk for 1 hour and then incubated overnight with specific primary antibodies at 4 °C on a rotating shaker. Membranes were washed 3 times with phosphate-buffered saline / Tween buffer (PBST) and were incubated with the corresponding HRP-conjugated secondary7antibody for 90 minutes. Proteins were visualized on the LI-COR Odyssey Fc image system, using ECL detection reagents (Super Signal West Femto Maximum Sensitivity Substrate; Invitrogen). The same blot was subsequently incubated with a GAPDH antibody (Cell Signaling Technology) to document equal protein loading.

[0070] Treatment of mice: A recently developed Cre-inducible transgenic mouse line expressing the DsRed-tagged Y437H mutant of human MYOC (Tg.CreMYOCY437H) was used as described in Kaipa et al., JCI Insight 10(5):el88710 (21 Jan. 2025). Under baseline conditions, the mutant MYOC transgene was not expressed. Activation of Cre recombinase excised the loxP-flanked STOP cassette, thereby enabling expression of the DsRed-fused mutant MYOC. Regular PCR genotyping of these transgenic mice was performed using a forward primer (5'-CTCAGCAGATGCTACCGTCA-3') (SEQ ID NO:2) and a reverse primer (5'-TTCATGCGCTTCAAGGTGC-3') (SEQ ID NO:3). Both male and female mice were included in all experiments. The number of animals used in each experiment is indicated in the respective figures or figure legends. At the conclusion of each experiment, mice were euthanized by CO2 inhalation followed by cervical dislocation in accordance withAtorney docket No. 00058-090W01 institutional animal care and use guidelines. To evaluate whether topical treatment with PBA and TUDCA could reduce elevated intraocular pressure (IOP) in Tg-MYOCY437Hmice, IOP elevation was allowed to develop following Cre induction. Cre recombinase was delivered via intracameral injection of virus-like particles (VLPs) carrying Cre protein. IOPS were measured periodically to confirm elevation. At 13 weeks post-Cre induction, Tg-MYOCY437Hmice were randomly assigned to two groups: the treatment group received topical ocular drops containing 0.1% PBA and 0.5% TUDCA twice daily in both eyes, whereas the control group received sterile phosphate-buffered saline (PBS) vehicle on the same schedule. IOPs were monitored throughout the treatment period, and pattern electroretinography (PERG) was performed to assess retinal ganglion cell (RGC) function.

[0071] Human perfusion cultured eyes: Human donor eyes were obtained and managed in compliance with the Declaration of Helsinki. Eyes were obtained from the Willed Body Program at the University of California, Irvine (Irvine, CA) or from Lions World Vision Institute (Tampa, FL) within 3-12 hours postmortem. Both programs were registered with the respective state boards and facilitated the distribution of deceased human remains for research purposes. Prior to tissue processing, serological testing was performed on donor blood to exclude samples positive for blood-bome pathogens. Whole eyes were dissected, and the anterior segments were mounted in a perfusion culture system and maintained for four weeks under sterile conditions. Intraocular pressure (IOP) was continuously monitored throughout the culture period. At the end of the experiment, trabecular meshwork (TM) tissues were isolated and processed for biochemical and morphological analyses. PBA, TUDCA, or a combination of both (0. 1-0.5% w / v) was perfused continuously in one eye, while the contralateral eye received a control vehicle injection. Following injection, eyes were perfused at a constant flow rate of 2.5 pL / min for four days. IOPs are monitored continuously.

[0072] Pattern electroretinography (PERG): RGC function was determined using a binocular snout-pattem electroretinography (PERG) system (JORVEC Corp., Miami, FL, USA), as described in Maddineni et al., Mol Neurodegener 15(1):48 (2020) . Mice were anesthetized with an intraperitoneal injection of a ketamine / xylazine mixture (100 mg / kg and 10 mg / kg, respectively). Anesthetized mice were positioned on a temperature-controlled metal base, 10 cm from LED monitors, and their body temperature was maintained at 37°C using a rectal probe. A small amount of Hypromellose eye drops was applied topically toAtorney docket No. 00058-090W01 prevent corneal dryness during the recording. The PERG signals were recorded simultaneously from both eyes using subcutaneous electrodes placed at the snout (active), the back of the head (reference), and the tail (ground). The signals were generated in response to contrast reversals of gratings displayed on two LED screens operating at slightly different frequencies. Two consecutive readings were averaged and graphically represented.

[0073] Statistics. Prism 9.0 software (GraphPad) was used for statistical analyses. Data are shown as mean ±SEM. For all experiments, n refers to the number of eyes. P < 0.05 was considered statistically significant. The student’s t test (2-tailed) was used to compare 2 groups. For comparison of different treatments, 2-way ANOVA w as used, followed by a Bonferroni post hoc correction. Data analyses were performed in a blinded manner.

[0074] Effects of combined administration of PBA and TUDCA on intracellular myocilin accumulation. PBA has been shown to rescue myocilin-associated glaucoma by reducing mutant myocilin misfolding and reducing glucocorticoid induced IOP elevation. Similar to PBA, TUDCA is also reduces ER stress, preventing cell death via its direct anti- apoptotic effect in various disease models. It was postulated herein that a combination of PBA and TUDCA may be more effective than PBA in lowering IOP and restoring normal TM function. Mutations in myocilin that result in misfolding can lead to glaucoma in people by accumulating intracellularly in ER, causing ER stress and TM cell death, resulting in elevation of IOP. PBA at a concentration of 5 rnM has been shown to reduce mutant myocilin accumulation and rescue a mouse model of myocilin-associated glaucoma. It was first examined herein as to whether a combination of PBA+TUDCA is more effective in reducing mutant myocilin accumulation in TM cells stably expressing mutant myocilin (see FIG. 1). TM3 cells stably expressing mutant myocilin were treated with vehicle (PBS) or various concentrations of PBA alone, TUDCA alone, or a combination of PBA and TUDCA. Confocal imaging of mutant myocilin protein (see FIG. 1) clearly shows that vehicle-treated TM cells exhibited intracellular accumulation of mutant myocilin. PBA at a concentration of 0.5-2 rnM did not reduce intracellular myocilin, but 5 rnM PBA w as able to reduce intracellular mutant myocilin accumulation. TUDCA alone, at concentrations of 0.25-2 mM. did not alter mutant myocilin accumulation in TM cells (see FIG. 1). Interestingly, the combination of PBA+TUDCA dramatically reduced intracellular mutant myocilin accumulation starting from the concentration of PBA 1 mM / TUDCA 0.5 mM (see FIG. 1).Attorney docket No. 00058-090W01These data suggest that PBA and TUDCA acted in a synergistic manner to lower mutant myocilin accumulation at significantly lower concentrations than when used alone.

[0075] Western blot analysis of intracellular mutant myocilin concentration. Next, Western blot analysis was performed with myocilin in TM3 cells stably expressing mutant myocilin treated with various concentrations of PBA alone, TUDCA alone, or a combination of PBA+TUDCA for 48 h (see FIG. 2A). Cellular lysates were subjected to Western blot (FIG 2A). Their analysis using ImageJ (see FIG. 2B) revealed that PBA reduced intracellular mutant myocilin only at a 5 mM concentration. Interestingly, TUDCA only marginally lowered mutant myocilin, with the maximum effect at 2.5 mM. Strikingly, the combination of PBA and TUDCA reduced mutant myocilin significantly and robustly at the lowest dose. These data suggest that PBA+TUDCA lowers mutant myocilin accumulation in TM cells in a synergistic manner.

[0076] A combination of PBA and TUDCA lowered IOP more effectively than PBA alone in human donor eyes. Next, was examined whether PBA+TUDCA improves TM outflow and reduces IOP more effectively than PBA alone in normal donor eyes. Human eyes received were set up for perfusion cultured anterior segment model and PBA was added to perfusion media. Remarkably, PBA (5mM) significantly lowered IOP in normal donors by maximum of 20% over the baseline IOP (see FIG. 3A). Next was examined whether various concentrations of PBA and TUDCA low er IOP in human cultured eyes. While perfusion of vehicle did not alter IOP, PBA and TUDCA at much lower concentrations (1 / 5 of PBA alone) low ered IOP by almost 40% over the baseline (see FIG. 3B). These data further indicate that co-administration of PBA and TUDCA could likely exert a significant therapeutic IOP lowering effect in glaucoma patients by targeting TM outflow-.

[0077] Topical PBA+TUDCA eye drops reduce elevated IOP in mouse model of myocilin glaucoma (Tg-CreMYOCY437Hmice): A recently developed Cre-inducible mouse model of myocilin glaucoma expressing DsRed tagged mutant myocilin was utilized (Kaipa et al., JCI Insight 10(5): el 88710 (Jan 21, 2025). Cre was induced selectively using viral like particles (VLPs) containing cre protein, which has specific tropism to mouse trabecular meshwork (TM) cells. As shown in FIG. 4, a single intracameral injections of Cre induced elevated IOP significantly by week 5 of injections. IOPS continued to higher in Cre-injected Tg-CreMYOCY4 7Hmice compared to control mice. At w eek 13, Tg-CreMYOCY43 / Hmice were divided randomly into two groups; one group received twice daily topical eye drops ofAtorney docket No. 00058-090W010.1% PBA+TUDCA while other group received phosphate buffered saline (PBS) eye drops. IOP measurements revealed that PBA+TUDCA significantly reduced elevated IOP in 7g- CreMYOCY43™ mice.

[0078] Topical eye drops of PBA+TUDCA prevent functional loss of RGCs in Tg- CreMYOCY43711mice: Sustained IOP elevation leads to functional RGC loss as evident from reduced pattern electroretinogram (PERG) amplitudes. PERG amplitude and latency were measured at week 15 of Cre-inj ections. Cre-injected Tg-CreMYOCY437Hmice that were applied PBS eye drops demonstrated significantly reduced PERG amplitude compared to control mice. Unexpectedly, Cre-injected Tg-CreMYOCY437Hmice that were given PBA+TUDCA exhibited significantly improved PERG amplitudes, and these readings were comparable to control mice. These data demonstrate that PBA+TUDCA prevents functional loss of RGCs in mouse model of glaucoma.

[0079] A number of embodiments have been described herein. Nevertheless, it will be understood that various modifications may be made without departing from the spirit and scope of this disclosure. Accordingly, other embodiments are within the scope of the following claims.

Claims

Atorney docket No. 00058-090W01WHAT IS CLAIMED IS:1 . A pharmaceutical composition for the treatment of an ocular condition associated with elevated intraocular pressure (IOP), comprising: a combination therapy comprising therapeutically effective amounts of sodium 4- phenylbutytate (PBA) and tauroursodeoxy cholic acid (TUDCA), in a pharmaceutically acceptable carrier, diluent, and / or excipient.

2. The pharmaceutical composition of claim 1, wherein the ocular condition associated with elevated IOP is selected from glaucoma, ocular hypertension, uveitis, retinal detachment, pigment dispersion syndrome, pseudoexfoliation syndrome, large cataracts, tumors within the eye, steroid-induced ocular hypertension, steroid-induced glaucoma and eye damage from injury or surgery.

3. The pharmaceutical composition of claim 2, wherein the ocular condition is glaucoma.

4. The pharmaceutical composition of claim 1, wherein the combination therapy comprises PBA at a concentration of 0.5 mM to 4.0 mM.

5. The pharmaceutical composition of claim 4, wherein the combination therapy comprises PBA at a concentration of 1.0 mM to 2.0 mM.

6. The pharmaceutical composition of claim 1 , wherein the combination therapy comprises TUDCA at a concentration of 0.3 mM to 3.0 mM.

7. The pharmaceutical composition of claim 6, wherein the combination therapy comprises TUDCA at a concentration of 0.5 mM to 1.0 mM.

8. The pharmaceutical composition of claim 1, wherein the pharmaceutical composition is formulated for intravitreal injection, intracameral injection, subretinal injection, or for topical administration to the eye(s).Atorney docket No. 00058-090W019. The pharmaceutical composition of claim 8. wherein the pharmaceutical composition is formulated for topical administration to the eye(s) and is in the form of eye drops, eye ointment, or eye gel.

10. The pharmaceutical composition of claim 9, wherein the pharmaceutical composition comprises PBA at a concentration (% w / v) from 0.1 to 3.1 1. The pharmaceutical composition of claim 10, wherein the pharmaceutical composition comprises PBA at a concentration (% w / v) from 0.5 to 1.5.

12. The pharmaceutical composition of claim 9, wherein the pharmaceutical composition comprises TUDCA at a concentration (% w / v) from 0.05 to 1.5.

13. The pharmaceutical composition of claim 12, wherein the pharmaceutical composition comprises TUDCA at a concentration (% w / v) from 0.1 to 0.8.

14. The pharmaceutical composition of claim 9, wherein the pharmaceutical composition comprises PBA and TUDCA in a pharmaceutically acceptable carrier, diluent, and / or excipient and a preservative at the following concentrations (% w / v):Concentration (% w / v)PBA 1TUDCA 0.5Dibasic Sodium Phosphate 0.2Hydroxypropyl Methylcellulose 0.5Polysorbate 80 0.05Benzalkonium Chloride 0.01Sodium Chloride 0.75Edetate Disodium (EDTA) 0.01NaOH / HC1 as needed to provide a pH 7.4Purified Water as needed up to 100%.

15. The pharmaceutical composition of claim 1, wherein the pharmaceutically acceptable diluent is buffered saline or purified water.Atorney docket No. 00058-090W0116. The pharmaceutical composition of claim 1. wherein the pharmaceutically acceptable carrier, diluent, and / or excipient includes sodium citrate, hydroxy ethyl cellulose, sodium hydroxide (to adjust pH), hydrochloric acid (to adjust pH), mannitol, sodium phosphate, dibasic sodium phosphate, carbomer 974P, tyloxapol, edetate disodium, hydroxypropyl methylcellulose, polysorbate 80, sodium chloride, edetate disodium and / or purified water.

17. The pharmaceutical composition of claim 1, wherein the pharmaceutical composition further comprises a preservative.

18. The pharmaceutical composition of claim 17, wherein the preservative is benzalkonium chloride.

19. The pharmaceutical composition of claim 1, wherein the pharmaceutical composition further comprises additional medication(s) selected from a prostaglandin analogue, a betablocker, a carbonic anhydrase inhibitor, a corticosteroid, a Rho kinase inhibitor, an alpha- adrenergic agonist, and / or a miotic.

20. The pharmaceutical composition of claim 1, wherein the pharmaceutical composition further comprises additional medication(s) selected from bimatoprost, tafluprost, latanoprost, travoprost, betaxolol, timolol, brinzolamide. dorzolamide, brimonidine. and netarsudil.

21. The pharmaceutical composition of claim 1, wherein the pharmaceutical composition further comprises additional medication(s) selected from prednisolone acetate, dexamethasone, loteprednol etabonate, fluoromethoIone, rimexolone. and difluprednate.

22. The pharmaceutical composition of claim 1, wherein the pharmaceutical composition further comprises 5-amino-3-(l-hydroxy-2,2,6,6-tetramethylpiperidin-4-yl)-l,2,3-oxadiazol- 3-ium chloride (SA-2).

23. The pharmaceutical composition of claim 1, wherein the pharmaceutical composition further comprises a gene editing therapy, an siRNA, or an antisense oligo that lowers the expression of gene product(s) that causes elevated IOP.Atorney docket No. 00058-090W0124. The pharmaceutical composition of claim 23, wherein the antisense oligo is selected from miRNA, RNAi, shRNA, siRNA, and aptamers.

25. The pharmaceutical composition of claim 23, wherein the siRNA is selected from SYL040012, SYL1801 and QPI-1007.

26. The pharmaceutical composition of claim 23, wherein the gene editing therapy, the siRNA, or the antisense oligo lowers the expression of a protein selected from MYOC, OPTN, CYP1B1 AV1 / CAV2, CDKN2B, TMC01, SIX1 / SIX6, LRP12 / ZFP, TBK1, GALC, PITX2, PITX3, FOXCI, FOXE3, ANGPTL7, PAX6, LMX1B, MAF PLEKHA7, PCMTD1 / ST18, COL11A1. LOXL1 and CNTNAP2.

27. The pharmaceutical composition of claim 23, wherein the gene editing therapy is a CRISPR-Cas9-based system that suppresses or lowers the expression of a myocilin gene.

28. The pharmaceutical composition of claim 27, wherein the myocilin gene encodes a mutant form of myocilin.

29. The pharmaceutical composition of claim 28, wherein the CRISPR-Cas9-based system comprises a guide sequence having the sequence of SEQ ID NOT.

30. A method of treating or preventing an ocular condition associated with elevated intraocular pressure (IOP) in a subject in need thereof, the method comprising: administering a combination therapy comprising therapeutically effective amounts of 4- phenylbutytate (PBA) and a tauroursodeoxycholic acid (TUDCA) to the subject in need thereof.

31. The method of claim 30. wherein the combination therapy has a synergistic effect in reducing elevated IOP.

32. The method of claim 30, wherein the ocular condition is selected from glaucoma, ocular hypertension, uveitis, retinal detachment, pigment dispersion syndrome,Atorney docket No. 00058-090W01 pseudoexfoliation syndrome, large cataracts, tumors within the eye, steroid-induced ocular hypertension, steroid-induced glaucoma and eye damage from injury or surgery.

33. The method of claim 32, wherein the ocular condition is glaucoma.

34. The method of claim 30. wherein PBA is administered separately from TUDCA.

35. The method of claim 30, wherein PBA is administered concurrently or sequentially with TUDCA.

36. The method of claim 30. wherein a pharmaceutical composition comprises the combination therapy that is administered to the subject in need thereof.

37. The method of claim 36, wherein the pharmaceutical composition is the pharmaceutical composition of any one of claims 1 to 29.

38. The method of claim 36, wherein the pharmaceutical composition comprises PBA at a concentration (% w / v) from 0.1 to 3.

39. The method of claim 38. wherein the pharmaceutical composition comprises PBA at a concentration (% w / v) from 0.5 to 1 .5.

40. The method of claim 36, wherein the pharmaceutical composition comprises TUDCA at a concentration (% w / v) from 0.05 to 1.5.

41. The method of claim 40, wherein the pharmaceutical composition comprises TUDCA at a concentration (% w / v) from 0.1 to 0.8.

42. The method of claim 30, wherein the combination therapy is administered directly to the eyes of the subject.Atorney docket No. 00058-090W0143. The method of claim 42, wherein the combination therapy is administered by intravitreal injection, by intracameral injection, by subretinal injection, or by topical administration to the eye(s).

44. The method of claim 43, wherein the combination therapy is formulated for topical administration to the eye(s) and is in the form of eye drops, eye ointment, or eye gel.

45. The method of claim 30, wherein the combination therapy comprises PBA at a concentration of 0.5 mM to 4.0 mM.

46. The method of claim 45. wherein the combination therapy comprises PBA at a concentration of 1.0 mM to 2.0 mM.

47. The method of claim 30. wherein the combination therapy comprises TUDCA at a concentration of 0.3 mM to 3.0 mM.

48. The method of claim 47, wherein the combination therapy comprises TUDCA at a concentration of 0.5 mM to 1.0 mM.

49. The method of claim 30, wherein the combination therapy is administered in combination with additional medication(s) selected from a prostaglandin analogue, a betablocker, a carbonic anhydrase inhibitor, a corticosteroid, a Rho kinase inhibitor, an alpha- adrenergic agonist, and / or a miotic.

50. The method of claim 30, wherein the combination therapy is administered to the subject in need thereof in combination with additional medication(s) selected from bimatoprost, tafluprost, latanoprost, travoprost, betaxolol. timolol, brinzolamide, dorzolamide, bnmonidine, and netarsudil.

51. The method of claim 30, wherein the combination therapy is administered to the subject in need thereof in combination with additional medication(s) selected from prednisolone acetate, dexamethasone, loteprednol etabonate, fluoromethoIone, rimexolone, and difluprednate.Atorney docket No. 00058-090W0152. The method of claim 30, wherein the combination therapy is administered to the subject in need thereof in combination with 5-amino-3-(l-hydroxy-2.2.6.6- tetramethylpiperidin-4-yl)-l,2,3-oxadiazol-3-ium chloride (SA-2).

53. The method of claim 30, wherein the combination therapy is administered to the subject in need thereof in combination with gene editing therapy, an siRNA, or an antisense oligo that lowers the expression of gene product(s) that causes elevated IOP.

54. The method of claim 53, wherein the antisense oligo is selected from siRNA, miRNA, RNAi, shRNA, and aptamers.

55. The method of claim 53, wherein the siRNA is selected from SYL040012, SYL1801 and QPI-1007.

56. The method of claim 53. wherein the gene editing therapy, the siRNA, or the antisense oligo lowers the expression of a protein selected from MYOC, OPTN, CYP1B1 AV1 / CAV2, CDKN2B, TMCO1, SIX1 / SIX6, LRP12 / ZFP, TBK1, GALC, PITX2, PITX3, FOXCI, FOXE3, PAX6, LMX1B, MAF PLEKHA7, PCMTD1 / ST18, COL11A1, ANGPTL7, LOXL1 and CNTNAP2.

57. The method of claim 53, wherein the gene editing therapy is a CRISPR-Cas9-based system that suppresses or lowers the expression of a myocilin gene.

58. The method of claim 57. wherein the myocilin gene encodes a mutant form of myocilin.

59. The method of claim 59, wherein the CRISPR-Cas9-based system comprises a guide sequence having the sequence of SEQ ID NO: 1.

60. The method of claim 53, wherein the gene editing therapy, the siRNA, or the antisense oligo is delivered to a cell by use of a viral vector, non-viral vector, or by a physical delivery method.Atorney docket No. 00058-090W0161. The method of claim 60, wherein the viral vector is selected from Adenoviral vector, lentiviral vector and an AAV vector.

62. The method of claim 60, wherein the non-viral vector is selected from nanoparticles, polymers, micelles, and liposomes.

63. The method of claim 62, wherein the nanoparticles are lipid nanoparticles.

64. The method of claim 62, wherein the polymers are selected from elastin-like polypeptide (ELP). boronic dendrimer, nano-clew, polyethyleneimine (PEI), and carbon nanotubes, PEG (polyethylene glycol), PLL (poly-L-lysine), chitosan, PLGA (polylactic- coglycolic acid), polymeric nanocapsules, l,2-distearoyl-sn-glycero-3-phosphocholine 280 (DSPC), cholesterol, and l,2-dimyristoyl-rac-glycero-3-methoxypoly ethylene gly col-2000 (DMG-281 PEG 2000).

65. The method of claim 30, wherein the combination therapy is administered to prevent an ocular condition associated with elevated intraocular pressure (IOP) that is induced by, or possibly aggravated by, the administration of a medication or treatment that is used to treat a condition, a disorder or a disease.

66. The method of claim 65, wherein the ocular condition is steroid-induced ocular hypertension or steroid-induce glaucoma, and wherein the medication is a steroid.

67. The method of claim 66. wherein the steroid is a corticosteroid.

68. The method of claim 67, wherein the corticosteroid is selected from betamethasone, budesonide, dexamethasone, hydrocortisone, clobetasol propionate, methylprednisolone, mometasone. amcinonide, cloprednol, cortisol, prednisolone, alclometasone, ciclesonide, clocortolone, deflazacort, fluticasone furoate, triamcinolone acetonide, aldosterone, beclomethasone dipropionate, cortobenzolone, prednisolone acetate, loteprednol etabonate, fluoromethoIone, rimexolone, and difluprednate, and halcinonide.Atorney docket No. 00058-090W0169. The method of claim 65, wherein the ocular condition is glaucoma, and wherein the medication or treatment is contraindicated or has a warning label for use in subjects who have glaucoma or at risk of developing glaucoma.

70. The method of claim 69, wherein the medication or treatment is selected from ipratropium bromide, tiotropium bromide, botulinum toxin (botox) injections used around the eyes, cold / flu medications containing antihistamines or decongestants, tolterodine, oxybutynin, dilating eye drops, diphenhydramine, loratadine, fexofenadine, cetirizine, sumatriptan, orphenadrine, trihexyphenidyl, scopolamine patches, fluoxetine, paroxetine, amitriptyline, tofranil, duloxetine, topiramate, acetazolamide, trimethoprimsulfamethoxazole, cimetidine and ranitidine.

71. The method of any one of claims 65 to 70, wherein the combination therapy is administered prior to and / or concurrently with the administration of the medication or treatment that is used to treat a condition, a disorder or a disease.

72. A method of treating or preventing fibrosis in the trabecular meshwork (TM) in the eyes of a subject in need thereof, the method comprising: administering a combination therapy comprising therapeutically effective amounts of sodium 4-phenylbutytate (PBA) and tauroursodeoxy cholic acid (TUDCA) to the subject in need thereof.

73. The method of claim 72, wherein the subject has undergone a surgical procedure to implant a device to treat an ocular condition.

74. The method of claim 73, wherein the ocular condition is associated with elevated intraocular pressure (IOP) or is cataracts.

75. The method of claim 73, wherein the ocular condition is glaucoma.

76. The method of claim 72, wherein PBA is administered separately from TUDCA.Atorney docket No. 00058-090W0177. The method of claim 72, wherein PBA is administered concurrently or sequentially with TUDCA.

78. The method of claim 72, wherein a pharmaceutical composition comprises the combination therapy that is administered to the subject in need thereof.

79. The method of claim 78, wherein the pharmaceutical composition is the pharmaceutical composition of any one of claims 1 to 29.

80. The method of claim 78, wherein the pharmaceutical composition comprises PBA at a concentration (% w / v) from 0.1 to 3.

81. The method of claim 80, wherein the pharmaceutical composition comprises PBA at a concentration (% w / v) from 0.5 to 1.5.

82. The method of claim 78, wherein the pharmaceutical composition comprises TUDCA at a concentration (% w / v) from 0.05 to 1.5.

83. The method of claim 82. wherein the pharmaceutical composition comprises TUDCA at a concentration (% w / v) from 0. 1 to 0.8.

84. The method of claim 78, wherein the combination therapy is administered directly to the eyes of the subject.

85. The method of claim 84, wherein the combination therapy is administered by intravitreal injection, by intracameral injection, by subretinal injection, or by topical administration to the eye(s).

86. The method of claim 85, wherein the combination therapy is formulated for topical administration to the eye(s) and is in the form of eye drops, eye ointment, or eye gel.

87. The method of claim 72, wherein the combination therapy comprises PBA at a concentration of 0.5 mM to 4.0 mM.Atorney docket No. 00058-090W0188. The method of claim 87. wherein the combination therapy comprises PBA at a concentration of 1.0 mM to 2.0 mM.

89. The method of claim 72. wherein the combination therapy comprises TUDCA at a concentration of 0.3 mM to 3.0 mM.

90. The method of claim 89, wherein the combination therapy comprises TUDCA at a concentration of 0.5 mM to 1.0 mM.

91. The method of claim 72, wherein the combination therapy is administered in combination with additional medication(s) selected from a prostaglandin analogue, a betablocker, a carbonic anhydrase inhibitor, a Rho kinase inhibitor, a corticosteroid, an alpha- adrenergic agonist, and / or a miotic.

92. The method of claim 72, wherein the combination therapy is administered to the subject in need thereof in combination with additional medication(s) selected from bimatoprost, tafluprost, latanoprost, travoprost, betaxolol, timolol, brinzolamide, dorzolamide. brimonidine. and netarsudil.

93. The method of claim 72, wherein the pharmaceutical composition further comprises additional medication(s) selected from prednisolone acetate, dexamethasone, loteprednol etabonate, fluoromethoIone, rimexolone, and difluprednate.

94. The method of claim 72, wherein the combination therapy is administered to the subject in need thereof in combination with 5-amino-3-(l-hy droxy-2, 2,6,6- tetramethylpiperidin-4-yl)-1.2.3-oxadiazol-3-ium chloride (SA-2).

95. The method of claim 72, wherein the combination therapy is administered to the subject in need thereof in combination with a gene editing therapy, an siRNA, or an antisense oligo that lowers the expression of gene product(s) that causes elevated IOP.

96. The method of claim 95, wherein the antisense oligo is selected from siRNA, miRNA, RNAi, shRNA, and aptamers.Atorney docket No. 00058-090W0197. The method of claim 95. wherein the siRNA is selected from SYL040012, SYL1801 and QPI-1007.

98. The method of claim 95, wherein the gene editing therapy, the siRNA, or the antisense oligo lowers the expression of a protein selected from MYOC, OPTN, CYP1B1 AV1 / CAV2, CDKN2B. TMC01. SIX1 / SIX6, LRP12 / ZFP. TBK1. GALC. PITX2, PITX3, FOXCI, FOXE3, PAX6, LMX1B, MAF PLEKHA7, PCMTD1 / ST18, ANGPTL7, COL11A1, LOXL1 and CNTNAP2.

99. The method of claim 95. wherein the gene editing therapy is a CRISPR-Cas9-based system that suppresses or lowers the expression of a myocilin gene.

100. The method of claim 99, wherein the myocilin gene encodes a mutant form of myocilin.

101. The method of claim 100, wherein the CRISPR-Cas9-based system comprises a guide sequence having the sequence of SEQ ID NO: 1.

102. The method of claim 95. wherein the gene editing therapy, the siRNA, or the antisense oligo is delivered to a cell by use of a viral vector, non-viral vector, or by a physical delivery method.

103. The method of claim 102, wherein the viral vector is selected from Adenoviral vector, lentiviral vector and an AAV vector.

104. The method of claim 102, wherein the non-viral vector is selected from nanoparticles, polymers, micelles, and liposomes.

105. The method of claim 104, wherein the nanoparticles are lipid nanoparticles.

106. The method of claim 104, wherein the polymers are selected from elastin-like polypeptide (ELP), boronic dendrimer, nano-clew, polyethyleneimine (PEI), and carbon nanotubes, PEG (polyethylene glycol), PLL (poly-L-lysine), chitosan, PLGA (polylactic-Atorney docket No. 00058-090W01 coglycolic acid), polymeric nanocapsules, l,2-distearoyl-sn-glycero-3-phosphocholine 280 (DSPC), cholesterol, and l,2-dimyristoyl-rac-glycero-3-methoxy poly ethylene gly col-2000 (DMG-281 PEG 2000).

107. A method of reducing corticosteroid-induced ER stress or myocilin accumulation in the trabecular meshwork (TM) in the eyes of a subject in need thereof, the method comprising: administering a combination therapy comprising therapeutically effective amounts of sodium 4-phenylbutytate (PBA) and tauroursodeoxy cholic acid (TUDCA), and a topical ophthalmic corticosteroid to the subject in need thereof.

108. The method of claim 107, wherein PBA is administered separately from TUDCA.

109. The method of claim 107, wherein PBA is administered concurrently or sequentially with TUDCA.

110. The method of claim 107, wherein the combination therapy is administered separately from the topical ophthalmic corticosteroid.

111. The method of claim 107, wherein the combination therapy is administered concurrently or sequentially with the topical ophthalmic corticosteroid.

112. The method of claim 107, wherein a pharmaceutical composition comprises the combination therapy that is administered to the subject in need thereof.1 13. The method of claim 112, wherein the pharmaceutical composition is the pharmaceutical composition of any one of claims 1 to 29.

114. The method of claim 107, wherein the pharmaceutical composition comprises PBA at a concentration (% w / v) from 0. 1 to 3.

115. The method of claim 114, wherein the pharmaceutical composition comprises PBA at a concentration (% w / v) from 0.5 to 1.5.Atorney docket No. 00058-090W01116. The method of claim 107, wherein the pharmaceutical composition comprises TUDCA at a concentration (% w / v) from 0.05 to 1.5.

117. The method of claim 116, wherein the pharmaceutical composition comprises TUDCA at a concentration (% w / v) from 0.1 to 0.8.

118. The method of claim 107, wherein the combination therapy is administered directly to the eyes of the subject.

119. The method of claim 118, wherein the combination therapy is administered by intravitreal injection, by intracameral injection, by subretinal injection, or by topical administration to the eye(s).

120. The method of claim 119, wherein the combination therapy is formulated for topical administration to the eye(s) and is in the form of eye drops, eye ointment, or eye gel.

121. The method of claim 107, wherein the combination therapy comprises PBA at a concentration of 0.5 mM to 4.0 mM.

122. The method of claim 121, wherein the combination therapy comprises PBA at a concentration of 1.0 mM to 2.0 mM.

123. The method of claim 107, wherein the combination therapy comprises TUDCA at a concentration of 0.3 mM to 3.0 mM.

124. The method of claim 123, wherein the combination therapy comprises TUDCA at a concentration of 0.5 mM to 1.0 mM.

125. The method of claim 107, wherein the the topical ophthalmic corticosteroid is selected from prednisolone acetate, dexamethasone, loteprednol etabonate, fluoromethoIone, rimexolone, and difluprednate.