Compositions and methods for delivering syntaxin-binding protein-1
An isolated nucleic acid and AAV particle deliver STXBP1 to CNS cells using WPRE and specific promoters, effectively treating STXBP1-related disorders by normalizing synaptic transmission and ameliorating symptoms.
Patent Information
- Application Number
- PCT/US2025/053072
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-10-30
- Filing Date
- 2025-10-29
- Publication Date
- 2026-05-07
AI Technical Summary
Current therapies for STXBP1-related disorders, such as STXBP1 encephalopathy and epileptic encephalopathy, primarily target symptoms rather than the underlying cause, and there is a need for effective methods to deliver STXBP1 to CNS cells for targeted treatment.
The development of an isolated nucleic acid comprising a syntaxin-binding protein 1 (STXBP1)-encoding sequence, a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE), and a recombinant adeno-associated virus (AAV) particle for delivering STXBP1 to CNS cells, which includes specific promoters and microRNA binding sites to regulate expression.
This approach enables targeted delivery and expression of STXBP1 in CNS cells, potentially ameliorating symptoms like epilepsy, cognitive impairment, and neurodevelopmental disabilities by normalizing synaptic transmission, thereby addressing the underlying cause of STXBP1-related disorders.
Smart Images

Figure IMGF000022_0001 
Figure IMGF000023_0001 
Figure IMGF000024_0001
Abstract
Description
Attorney Docket No. 14640.0302-00304COMPOSITIONS AND METHODS FOR DELIVERING SYNTAXIN-BINDING PROTEIN-1Related Applications
[0001] This application claims the benefit of and priority to U.S. Provisional Application No. 63 / 714,098, filed on October 30, 2024, the contents of which are incorporated herein by reference in their entirety.Sequence Listing
[0002] The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing file, entitled 14640_0302-00304_SL.xml, was created on October 10, 2025, and is 102,035 bytes in size. The information in electronic format of the Sequence Listing is incorporated herein by reference in its entirety.Field
[0003] Described herein are polynucleotides, e.g., viral genomes, encoding syntaxinbinding protein-1 (STXBP1). Also described herein are vectors, e.g., adeno-associated virus (AAV) particles, comprising said polynucleotides, and related compositions, methods of making, and / or methods of delivery to a cell or subject. In some embodiments, the disclosure provides methods or uses for the treatment of STXBP1 Developmental and Epileptic Encephalopathy (DEE) and / or other STXBP1 -related disorders.Background
[0004] Syntaxin-binding protein 1 (STXBP1), also known as Muncl8-1, is part of the synaptic fusion machinery that enables vesicles to fuse with the plasma membrane. Other names for STXBP1 include P67, DEE4, NSEC1, UNC18, N-Secl, RBSEC1, unc-18A, and uncl8-l. STXBP1 regulates neurotransmitter transmission by interacting with the SNARE complex. The SNARE complex is primarily composed of SNAP-25, vesicular associated membrane protein and syntaxin- 1. SNAP-25 and syntaxin- 1 form the target membrane vesicle protein (T-SNARE), which binds to synaptic vesicle protein (VAMP). STXBP1 has a complex, arched tertiary structure. The arch comprises four closely connected domains, 1, 2, 3a and 3b. Domains 1 and 3a form an arched gap. STXBP1 primarily regulates vesicle fusion by interacting with syntaxin-1. Domain 3a of STXBP1 is in close contact with the Habc domain of syntaxin- 1, and domain 1 of STXBP1 binds to the N-terminal domain of syntaxin-Attorney Docket No. 14640.0302-003041. STXBP1 regulates vesicle docking and fusion by interacting with the SNARE complex. STXBP1 affects the released vesicles and participates in the transmission of neurotransmitters. STXBP1 is prominently involved in the early process of neurotransmitter release.
[0005] STXBP1 is essential for presynaptic vesicle release. It is rapidly phosphorylated by protein kinase C upon neuronal depolarization.
[0006] STXBP1 is encoded by the STXBP1 gene (Ensembl Gene ID No. ENSG00000136854), which is located on chromosome 9. It is expressed in the brain and spinal cord, and highly enriched in axons. Expression of STXBP1 is highest in the retina and cerebellum. STXBP1 is also found outside the brain.
[0007] Mutations in the STXBP1 gene are known to cause disease in human subjects.Abnormal expression of STXBP1 plays a role in the pathogenesis of a variety of neurological diseases, including STXBP1 encephalopathy, epileptic encephalopathy, STXBP1 developmental and epileptic encephalopathy (DEE), Ohtahara syndrome, developmental encephalopathy, West syndrome, early myoclonic epileptic encephalopathy, Lennox-Gaustaut syndrome, autism (e.g., autism with STXBP1 mutations and optionally further mutations), Dravet syndrome (not caused by mutations in SCN1A), and Rett syndrome phenotype (not caused by mutation of MECP2 or CDKL5).
[0008] STXBP1 expression is also abnormal in STXBP1 encephalopathy. There are an estimated 750 known cases of STXBP1 encephalopathy worldwide, and has an estimated incidence of 3.3-3.8 per 100,000 births.
[0009] Patients with STXBP1 mutations and / or STXBP1 encephalopathy often present with epilepsy. Some patients with STXBP1 mutations present with autistic features, including aggressive behavior, self-mutilation, hyperactivity, compulsive symptoms, episodes of psychosis and / or auditory hallucinations. Phenotypes range from severe neonatal epilepsy to infantile-onset epilepsy.
[0010] Many patients with STXBP1 mutations also present with non-epileptic movement disorders, including truncal and limb ataxia, generalized tremors, and dystonia. Patients often present with unremitting epileptic activity.
[0011] Some patients with STXBP1 mutations have only STXBP1 -related neurodevelopment disabilities without seizures. Not all patients with STXBP1 mutations have seizures.Attorney Docket No. 14640.0302-00304
[0012] Patients with STXBP1 encephalopathy are reliant on caregivers for the duration of their lives. Moreover, 40% of patients become non-ambulatory and lifespan is expected to be significantly reduced to about 30 years.
[0013] STXBP1 encephalopathy is caused by haploinsufficiency. Thus, disease may occur where there is a mutation to only a single functional copy of the STXBP1 gene. Diseasecausing mutations include missense, nonsense, frameshift, splice-site, and whole gene deletions. There are about 135 known pathogenic variants of the STXBP1 gene.
[0014] STXBP1 Developmental and Epileptic Encephalopathy (DEE) is a severe and early- onset presentation of STXBP1 encephalopathy. Patients typically exhibit early-onset seizures, including infantile spasms, intractable epilepsy, unremitting severe seizures, gross and fine motor changes, and cognitive impairment.
[0015] Interneurons may be more affected by haploinsufficiency than excitatory neurons.
[0016] Studies have demonstrated that heterozygous STXBP1 knock-out mice display impaired glutamate and GABA transmission, increased anxiety, increased aggression, and impaired emotional learning, in addition to modest seizure phenotype.
[0017] Studies in mice demonstrated that normalizing the excitatory synaptic transmission in STXBP1 heterozygotic knockout mice reduces aggression. This indicated a therapeutic option for managing aggressiveness in patients with STXBP1 mutations.
[0018] Existing therapies target the symptoms of STXBP1 encephalopathy. Existing first line treatment comprises anti-epileptic drugs such as levetiracetam and phenobarbital. Existing second line treatment comprises further anti-epileptic drugs such as clobazam, topiramate. Existing third line treatment comprises further anti-epileptic drugs and / or interventions. Known interventions for existing third line treatment include adrenocorticotropic hormone, ketogenic diet and vagal nerve stimulation.
[0019] No approved therapies target the underlying cause of STXBP1 mutations. There is a high unmet need for such treatments driven by the high seizure rate and shortened lifespan of patients with STXBP1 mutations.
[0020] Thus, there remains a long-felt need to develop pharmaceutical compositions and methods that can be delivered to the CNS for the treatment of diseases associated with STXBP1 mutations. In particular, a need exists for treatments targeting neurons, including GABAergic and glutamatergic neurons.
[0021] Adeno-associated viruses (AAVs) have emerged as a widely studied and utilized viral particles for delivery of therapeutically effective polypeptides to mammalian cells. See, e.g., Tratschin et al., Mol. Cell Biol., 5(11):3251-3260 (1985) and Grimm et al., Hum. GeneAttorney Docket No. 14640.0302-00304Then, 10(15):2445-2450 (1999), the relevant contents of each of which are incorporated herein by reference in their entirety.
[0022] However, there remains a need for effective methods for delivering STXBP1 to a target cell or tissue, e.g., a CNS cell or tissue, e.g., for treatment of an STXBP1 -related disorder or a symptom thereof.Summary
[0023] In some embodiments, the present disclosure provides an isolated nucleic acid comprising a syntaxin-binding protein 1 (STXBPl)-encoding sequence and a woodchuck hepatitis virus posttranscriptional regulatory element (WPRE). In some embodiments, the STXBP1 -encoding sequence is a human STXBP1 -encoding sequence.
[0024] In some embodiments, the STXBP1 -encoding sequence encodes an STXBP1 comprising the amino acid sequence of SEQ ID NOs: 3 or any one of SEQ ID NOs: 18-29. In some embodiments, the STXBP1 -encoding sequence encodes an STXBP1 comprising the amino acid sequence of SEQ ID NO: 3.
[0025] In some embodiments, the STXBP1 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 4 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the STXBP1 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 4.
[0026] In some embodiments, the STXBP1 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 5 or a nucleotide sequence that is at least 96% (e.g., at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the STXBP1 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 5.
[0027] In some embodiments, the WPRE is positioned 3’ relative to the STXBP1 -encoding sequence. In some embodiments, the WPRE comprises the nucleotide sequence of SEQ ID NO: 8 or any one of SEQ ID NOs: 39-43, or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the WPRE comprises the nucleotide sequence of SEQ ID NO: 8.
[0028] In some embodiments, the isolated nucleic acid further comprises a promoter operably linked to the STXBP1 -encoding sequence. In some embodiments, the promoter is a human synapsin 1 (hSYNl) promoter, a human elongation factor 1 alpha promoter (EFla) promoter, or an endogenous STXBP1 promoter (ePro). In some embodiments, the promoter is a hSYNl promoter. In some embodiments, the promoter comprises the nucleotide sequenceAttorney Docket No. 14640.0302-00304 of SEQ ID NO: 7 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the promoter comprises the nucleotide sequence of SEQ ID NO: 7.
[0029] In some embodiments, the isolated nucleic acid further comprises a polyadenylation (poly A) sequence. In some embodiments, the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 9 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 9.
[0030] In some embodiments, the isolated nucleic acid further comprises at least one inverted terminal repeat (ITR). In some embodiments, the at least one ITR comprises a 5’ ITR and a 3’ ITR. In some embodiments, the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 6 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 6. In some embodiments, the 3’ ITR comprises the nucleotide sequence of SEQ ID NO: 10 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical thereto. In some embodiments, the 3’ ITR comprises the nucleotide sequence of SEQ ID NO: 10.
[0031] In some embodiments, the isolated nucleic acid further comprises a nucleotide sequence encoding one or more microRNA (miR) binding sites, optionally wherein the one or more miR binding sites reduces or prevents expression of STXBP1 in dorsal root ganglia. In some embodiments, the one or more miR binding sites comprises one, two, three, or four miR183 binding sites.
[0032] In some embodiments, the isolated nucleic acid comprises a nucleotide sequence encoding four miR183 binding sites, optionally wherein the four miR183 binding sites are identical. In some embodiments, each of the four miR183 binding sites is encoded by a nucleotide sequence comprising the nucleotide sequence of SEQ ID NO: 1. In some embodiments, each of the four miR183 binding sites is encoded by the nucleotide sequence of SEQ ID NO: 1. In some embodiments, the miR183 binding sites are separated by a spacer, optionally wherein the spacer is encoded by the nucleotide sequence GATAGTTA.
[0033] In some embodiments, the isolated nucleic acid further comprises a nucleotide sequence encoding a microRNA183 (miR183) binding site series, comprising the nucleotide sequence of SEQ ID NO: 2 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In someAttorney Docket No. 14640.0302-00304 embodiments, the miR183 binding site series is encoded by a nucleotide sequence comprising the nucleotide sequence of SEQ ID NO: 2. In some embodiments, the miR183 binding site series is encoded by the nucleotide sequence of SEQ ID NO: 2.
[0034] In some embodiments, the present disclosure provides an isolated nucleic acid comprising, in 5’ to 3’ order: a) a 5’ inverted terminal repeat (ITR); b) a promoter; c) a syntaxin-binding protein 1 (STXBPl)-encoding sequence; d) a woodchuck hepatitis virus posttranscriptional regulatory element (WPRE); e) a polyadenylation (poly A) sequence; and f) a 3’ ITR.
[0035] In some embodiments, a) the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 6 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; b) the promoter comprises the nucleotide sequence of SEQ ID NO: 7 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; c) the STXBP1 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 4 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; d) the WPRE comprises the nucleotide sequence of SEQ ID NO: 8 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 9 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and / or f) the 3’ ITR comprises the nucleotide sequence of SEQ ID NO: 10 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.
[0036] In some embodiments, a) the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 6 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; b) the promoter comprises the nucleotide sequence of SEQ ID NO: 7 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; c) the STXBP1 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 4 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; d) the WPRE comprises the nucleotide sequence of SEQ ID NO: 8 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; e) the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 9 or a nucleotide sequence that is at least 95% (e.g.,Attorney Docket No. 14640.0302-00304 at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and f) the 3’ ITR sequence comprises the nucleotide sequence of SEQ ID NO: 10 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.
[0037] In some embodiments, a) the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 6 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; b) the promoter comprises the nucleotide sequence of SEQ ID NO: 7 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; c) the STXBP1 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 4 or SEQ ID NO: 5; d) the WPRE comprises the nucleotide sequence of SEQ ID NO: 8 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; e) the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 9 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and f) the 3’ ITR sequence comprises the nucleotide sequence of SEQ ID NO: 10 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.
[0038] In some embodiments, a) the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 6 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; b) the promoter comprises the nucleotide sequence of SEQ ID NO: 7 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; c) the STXBP1 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 4 or SEQ ID NO: 5; d) the WPRE comprises the nucleotide sequence of SEQ ID NO: 8; e) the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 9 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and f) the 3’ ITR sequence comprises the nucleotide sequence of SEQ ID NO: 10 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.
[0039] In some embodiments, a) the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 6 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; b) the promoter comprises the nucleotide sequence of SEQ ID NO: 7; c) the STXBP1 -encoding sequence comprises theAttorney Docket No. 14640.0302-00304 nucleotide sequence of SEQ ID NO: 4 or SEQ ID NO: 5; d) the WPRE comprises the nucleotide sequence of SEQ ID NO: 8; e) the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 9 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and f) the 3’ ITR sequence comprises the nucleotide sequence of SEQ ID NO: 10 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.
[0040] In some embodiments, a) the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 6; b) the promoter comprises the nucleotide sequence of SEQ ID NO: 7; c) the STXBP1- encoding sequence comprises the nucleotide sequence of SEQ ID NO: 4 or SEQ ID NO: 5; d) the WPRE comprises the nucleotide sequence of SEQ ID NO: 8; e) the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 9 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and f) the 3’ ITR sequence comprises the nucleotide sequence of SEQ ID NO: 10 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.
[0041] In some embodiments, a) the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 6; b) the promoter comprises the nucleotide sequence of SEQ ID NO: 7; c) the STXBP1- encoding sequence comprises the nucleotide sequence of SEQ ID NO: 4 or SEQ ID NO: 5; d) the WPRE comprises the nucleotide sequence of SEQ ID NO: 8; e) the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 9 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and f) the 3’ ITR sequence comprises the nucleotide sequence of SEQ ID NO: 10.
[0042] In some embodiments, a) the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 6; b) the promoter comprises the nucleotide sequence of SEQ ID NO: 7; c) the STXBP1- encoding sequence comprises the nucleotide sequence of SEQ ID NO: 4; d) the WPRE comprises the nucleotide sequence of SEQ ID NO: 8; e) the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 9; and f) the 3’ ITR sequence comprises the nucleotide sequence of SEQ ID NO: 10.
[0043] In some embodiments, a) the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 6; b) the promoter comprises the nucleotide sequence of SEQ ID NO: 7; c) the STXBP1- encoding sequence comprises the nucleotide sequence of SEQ ID NO: 5; d) the WPRE comprises the nucleotide sequence of SEQ ID NO: 8; e) the polyA sequence comprises theAttorney Docket No. 14640.0302-00304 nucleotide sequence of SEQ ID NO: 9; and f) the 3’ ITR sequence comprises the nucleotide sequence of SEQ ID NO: 10.
[0044] In some embodiments, the isolated nucleic acid comprises the nucleotide sequence of SEQ ID NO: 11 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the isolated nucleic acid comprises a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to SEQ ID NO: 11. In some embodiments, the isolated nucleic acid comprises the nucleotide sequence of SEQ ID NO: 11. In some embodiments, the isolated nucleic acid comprises the nucleotide sequence of SEQ ID NO: 12.
[0045] In some embodiments, the isolated nucleic acid further comprises a nucleotide sequence encoding one or more microRNA (miR) binding sites, wherein the one or more miR binding sites reduces or prevents expression of STXBP1 in dorsal root ganglia. In some embodiments, the nucleotide sequence encoding the one or more miR binding sites comprises the nucleotide sequence of SEQ ID NO: 1.
[0046] In some embodiments, the nucleotide sequence encoding the one or more miR binding sites encodes four miR binding sites, wherein each of the four miR binding sites is encoded by a nucleotide sequence comprising the nucleotide sequence of SEQ ID NO: 1.
[0047] In some embodiments, the isolated nucleic acid further comprises a nucleotide sequence encoding a microRNA (miR) binding site series, wherein the nucleotide sequence encoding the miR binding site series comprises the nucleotide sequence of SEQ ID NO: 2.
[0048] In some embodiments, the isolated nucleic acid comprises the nucleotide sequence of SEQ ID NO: 17. In some embodiments, the isolated nucleic acid comprises comprising the nucleotide sequence of SEQ ID NO: 16.
[0049] In some embodiments, the present disclosure provides a recombinant viral genome comprising an isolated nucleic acid disclosed herein. In some embodiments, the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 11 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.
[0050] In some embodiments, the recombinant viral genome comprises a) a 5’ inverted terminal repeat (ITR) comprising the nucleotide sequence of SEQ ID NO: 6 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; b) a promoter comprising the nucleotide sequence of SEQ IDAttorney Docket No. 14640.0302-00304NO: 7 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; c) a syntaxin-binding protein 1 (STXBPl)-encoding sequence comprising the nucleotide sequence of SEQ ID NO: 4 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; d) a woodchuck hepatitis virus posttranscriptional regulatory element (WPRE) comprising the nucleotide sequence of SEQ ID NO: 8 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; e) a polyadenylation (poly A) sequence comprising the nucleotide sequence of SEQ ID NO: 9 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and f) a 3’ ITR sequence comprising the nucleotide sequence of SEQ ID NO: 10 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.
[0051] In some embodiments, a) the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 6; b) the promoter comprises the nucleotide sequence of SEQ ID NO: 7; c) the STXBP1- encoding sequence comprises the nucleotide sequence of SEQ ID NO: 4; d) the WPRE comprises the nucleotide sequence of SEQ ID NO: 8; e) the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 9; and f) the 3’ ITR sequence comprises the nucleotide sequence of SEQ ID NO: 10.
[0052] In some embodiments, a) the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 6; b) the promoter comprises the nucleotide sequence of SEQ ID NO: 7; c) the STXBP1- encoding sequence comprises the nucleotide sequence of SEQ ID NO: 5; d) the WPRE comprises the nucleotide sequence of SEQ ID NO: 8; e) the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 9; and f) the 3’ ITR sequence comprises the nucleotide sequence of SEQ ID NO: 10.
[0053] In some embodiments, the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 11. In some embodiments, the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 12.
[0054] In some embodiments, the recombinant viral genome further comprises a nucleotide sequence encoding one or more microRNA (miR) binding sites, wherein the one or more miR binding sites reduce or prevent expression of STXBP1 in dorsal root ganglia. In some embodiments, the nucleotide sequence encoding the one or more miR binding sites comprises the nucleotide sequence of SEQ ID NO: 1. In some embodiments, the recombinant viralAttorney Docket No. 14640.0302-00304 genome encodes four binding miR binding sites, wherein each of the four miR binding sites is encoded by a nucleotide sequence comprising the nucleotide sequence of SEQ ID NO: 1.
[0055] In some embodiments, the recombinant viral genome further comprises a nucleotide sequence encoding a microRNA (miR) binding site series, wherein the nucleotide sequence encoding the miR binding site series comprises the nucleotide sequence of SEQ ID NO: 2.
[0056] In some embodiments, the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 17. In some embodiments, the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 16.
[0057] In some embodiments, the present disclosure provides an adeno-associated virus (AAV) particle comprising: (i) an AAV capsid; and (ii) a recombinant viral genome disclosed herein or a recombinant viral genome comprising an isolated nucleic acid disclosed herein.
[0058] In some embodiments, the AAV capsid comprises an AAV1 capsid or a variant thereof, an AAV2 capsid or a variant thereof, an AAV3 capsid or a variant thereof, an AAV3b capsid or a variant thereof, an AAV4 capsid or a variant thereof, an AAV5 capsid or a variant thereof, an AAV6 capsid or a variant thereof, an AAV7 capsid or a variant thereof, an AAV8 capsid or a variant thereof, an AAVrh8 capsid or a variant thereof, an AAV9 capsid or a variant thereof, an AAVPHP.B capsid or a variant thereof, an AAVPHP.N capsid or a variant thereof, a VOY101 capsid or a variant thereof, an AAVrhlO capsid or a variant thereof, an AAVrh32.33 capsid or a variant thereof, or an AAVrh74 capsid or a variant thereof.
[0059] In some embodiments, AAV capsid comprises an AAV9 capsid variant.
[0060] In some embodiments, the recombinant viral genome comprises: a) a 5’ inverted terminal repeat (ITR) comprising the nucleotide sequence of SEQ ID NO: 6; b) a promoter comprising the nucleotide sequence of SEQ ID NO: 7; c) a syntaxin-binding protein 1 (STXBPl)-encoding sequence comprising the nucleotide sequence of SEQ ID NO: 4 or SEQ ID NO: 5; d) a woodchuck hepatitis virus posttranscriptional regulatory element (WPRE) comprising the nucleotide sequence of SEQ ID NO: 8; e) optionally a nucleotide sequence encoding a microRNA (miR) binding site, wherein the nucleotide sequence encoding the miR binding site comprises the nucleotide sequence of SEQ ID NO: 1; f) a polyadenylation (poly A) sequence comprising the nucleotide sequence of SEQ ID NO: 9; and g) a 3’ ITR sequence comprising the nucleotide sequence of SEQ ID NO: 10.
[0061] In some embodiments, the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 11. In some embodiments, the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 12. In some embodiments, the recombinant viralAttorney Docket No. 14640.0302-00304 genome comprises the nucleotide sequence of SEQ ID NO: 16. In some embodiments, the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 17.
[0062] In some embodiments, the present disclosure provides a cell comprising an isolated nucleic acid, a recombinant viral genome, or an AAV particle disclosed herein.
[0063] In some embodiments, the cell is a mammalian cell (e.g., an HEK293 cell), an insect cell (e.g., an Sf9 cell), or a bacterial cell.
[0064] In some embodiments, the present disclosure provides a method of making an AAV particle, the method comprising: (i) providing a cell comprising a recombinant viral genome disclosed herein or a recombinant viral genome comprising an isolated nucleic acid disclosed herein, and a nucleic acid encoding an AAV capsid; and (ii) incubating the cell under conditions suitable to encapsulate the recombinant viral genome in the AAV capsid; thereby making the AAV particle. In some embodiments, the recombinant viral genome comprises: a) a 5’ inverted terminal repeat (ITR) comprising the nucleotide sequence of SEQ ID NO: 6; b) a promoter comprising the nucleotide sequence of SEQ ID NO: 7; c) a syntaxin-binding protein 1 (STXBPl)-encoding sequence comprising the nucleotide sequence of SEQ ID NO: 4 or SEQ ID NO: 5; d) a woodchuck hepatitis virus posttranscriptional regulatory element (WPRE) comprising the nucleotide sequence of SEQ ID NO: 8; e) optionally a nucleotide sequence encoding a microRNA (miR) binding site, wherein the nucleotide sequence encoding the miR binding site comprises the nucleotide sequence of SEQ ID NO: 1; f) a polyadenylation (poly A) sequence comprising the nucleotide sequence of SEQ ID NO: 9; and g) a 3’ ITR sequence comprising the nucleotide sequence of SEQ ID NO: 10.
[0065] In some embodiments, the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 11. In some embodiments, the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 12. In some embodiments, the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 16. In some embodiments, the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 17.
[0066] In some embodiments, the method further comprises, prior to step (i), introducing into the cell a nucleic acid comprising the recombinant viral genome.
[0067] In some embodiments, the method further comprises, prior to step (i), introducing into the cell the nucleic acid encoding the AAV capsid.
[0068] In some embodiments, the cell comprises a mammalian cell (e.g., an HEK293 cell), an insect cell (e.g., an Sf9 cell), or a bacterial cell.
[0069] In some embodiments, the present disclosure provides a pharmaceutical composition comprising an AAV particle disclosed herein and a pharmaceutically acceptable excipient.Attorney Docket No. 14640.0302-00304
[0070] In some embodiments, the present disclosure provides a method of delivering syntaxin-binding protein 1 (STXBP1) to a cell, comprising administering an effective amount of an isolated nucleic acid, a recombinant viral genome, an AAV particle, or a pharmaceutical composition disclosed herein.
[0071] In some embodiments, the cell is in a subject. In some embodiments, the subject has, has been diagnosed with having, or is at risk of having an STXBP1 -related disorder.
[0072] In some embodiments, the present disclosure provides a method of treating a subject having or diagnosed with having an STXBP1 -related disorder, or treating at least one symptom thereof, comprising administering to the subject an effective amount of an isolated nucleic acid, a recombinant viral genome, an AAV particle, or a pharmaceutical composition disclosed herein. In some embodiments, the STXBP1 -related disorder is an STXBP1 -related neurodegenerative or neuromuscular disorder. In some embodiments, the STXBP1 -related neurodegenerative or neuromuscular disorder is STXBP1 encephalopathy, epileptic encephalopathy, STXBP1 developmental and epileptic encephalopathy (DEE), Ohtahara syndrome, developmental encephalopathy, West syndrome, early myoclonic epileptic encephalopathy, Lennox-Gastaut syndrome, autism (e.g., autism with STXBP1 mutations and optionally further mutations), Dravet syndrome (not caused by mutations in SCN1A), or Rett syndrome phenotype (not caused by mutation of MECP2 or CDKL5).
[0073] In some embodiments, the present disclosure provides a method of treating a subject having or diagnosed with having an STXBP1 -related disorder, or treating at least one symptom thereof, wherein the STXBP1 -related disorder is STXBP1 encephalopathy, STXBP1 developmental and epileptic encephalopathy (DEE), or STXBP1 -related neurodevelopmental disabilities without seizures, comprising administering to the subject an effective amount of an isolated nucleic acid, a recombinant viral genome, an AAV particle, or a pharmaceutical composition disclosed herein.
[0074] In some embodiments, the subject has one or more mutations in the STXBP1 gene.
[0075] In some embodiments, the subject has a reduced level of STXBP1 activity as compared to a reference level in an individual who does not have an STXBP1 -related disorder.
[0076] In some embodiments, the treating results in prevention of progression of the disorder or at least one symptom thereof in the subject.
[0077] In some embodiments, the treating results in amelioration of at least one symptom of the disorder in the subject, e.g., as indicated by one or more biomarkers. In some embodiments, the one or more biomarkers comprises: (i) increased release of theAttorney Docket No. 14640.0302-00304 neurotransmitters glutamate and / or gamma-aminobutyric acid (GABA); or (ii) reduction in abnormal electroencephalographic activity. In some embodiments, the at least one symptom comprises epilepsy, autistic features, ataxia, generalized tremors, developmental delay, progressive encephalopathy, progressive dementia, ataxia, myoclonus, oculomotor dysfunction, bulbar palsy, generalized weakness, trembling of a limb, depression, visual hallucinations, cognitive decline, dystonia, or a combination thereof.
[0078] In some embodiments, the subject is a human.
[0079] In some embodiments, the isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition is delivered to a cell, tissue, or region of the central nervous system (CNS) of the subject. In some embodiments, the cell, tissue, or region of the CNS comprises a cell, tissue, or region of the striatum, thalamus, cerebellum, cortex, hippocampus, dentate gyrus, or a combination thereof. In some embodiments, the cell of the CNS comprises a neuron (e.g., a cornu ammonis 1 (CAI) neuron, cornu ammonis 2 (CA2) neuron, cornu ammonis 3 (CA3) neuron, deep cerebellar nuclei neuron, glutamatergic neuron, GABAergic neuron, or a combination thereof).
[0080] In some embodiments, the isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition is delivered to the subject via intravenous administration.
[0081] In some embodiments, the method further comprises evaluating, e.g., measuring, the level of STXBP1 gene expression, STXBP1 mRNA expression, and / or STXBP1 protein expression, in the subject, e.g., in a cell, tissue, or fluid of the subject. In some embodiments, the level of STXBP1 protein expression is measured by an enzyme-linked immunosorbent assay (ELISA), a Western blot, or an immunohistochemistry assay. In some embodiments, the evaluating the level of STXBP1 gene, mRNA, and / or protein expression is performed before and after administering the isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition; optionally wherein the subject’s level of STXBP1 gene, mRNA, and / or protein expression before administration is compared to the subject’s level of STXBP1 gene, mRNA, and / or protein expression after administration.
[0082] In some embodiments, the method comprises evaluating the level of STXBP1 gene, mRNA, and / or protein expression in a cell or tissue of the CNS in the subject. In some embodiments, the cell or tissue of the CNS comprises a cell or tissue of the striatum, thalamus, cerebellum, cortex, hippocampus, dentate gyrus or a combination thereof. In some embodiments, the cell of the CNS comprises a neuron (e.g., cornu ammonis 1 (CAI) neuron,Attorney Docket No. 14640.0302-00304 cornu ammonis 2 (CA2) neuron, cornu ammonis 3 (CA3) neuron, deep cerebellar nuclei neuron, glutamatergic neuron, GABAergic neuron, or a combination thereof).
[0083] In some embodiments, the subject’s level of STXBP1 protein expression after administration of the isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition is increased relative to the subject’s level of STXBP1 protein expression before administration of the isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition. In some embodiments, the method further comprises evaluating, e.g., measuring, the level of STXBP1 activity in the subject, e.g., in a cell or tissue of the subject.
[0084] In some embodiments, administering the isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition to the subject results in an increase in: (i) the level of STXBP1 activity in a cell, tissue, or fluid (e.g., a cell or tissue of the CNS, e.g., the striatum, thalamus, cerebellum, cortex, hippocampus, dentate gyrus, cornu ammonis 1 (CAI) neurons, cornu ammonis 2 (CA2) neurons, cornu ammonis 3 (CA3) neurons, deep cerebellar nuclei neurons, glutamatergic neurons, GABAergic neurons, or a combination thereof) of the subject, relative to baseline and / or relative to the level of STXBP1 activity in a cell, tissue, or fluid of an individual with an STXBP1 -related disorder who has not been administered the isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition; (ii) the number and / or level of viral genomes (VG) per cell level in a cell or tissue of the CNS (e.g., striatum, thalamus, cerebellum, cortex, hippocampus, dentate gyrus, CAI neurons, CA2 neurons, CA3 neurons, deep cerebellar nuclei neurons, glutamatergic neurons, GABAergic neurons, or a combination thereof) of the subject, relative to the number and / or level of VG per cell in a peripheral cell or tissue of the subject; and / or (iii) the level of STXBP1 gene, mRNA and / or protein expression in a cell or tissue (e.g., a cell or tissue of the CNS (e.g., striatum, thalamus, cerebellum, cortex, hippocampus, dentate gyrus, CAI neurons, CA2 neurons, CA3 neurons, deep cerebellar nuclei neurons, glutamatergic neurons, GABAergic neurons, or a combination thereof) of the subject relative to baseline and / or relative to the level of STXBP1 gene, mRNA, and / or protein expression in a cell or tissue of an individual with an STXBP1 -related disorder who has not been administered the isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition.
[0085] In some embodiments, the method further comprises administering to the subject at least one additional agent and / or therapy suitable for treating the STXBP1 -related disorder or for treating at least one symptom thereof. In some embodiments, the at least one additionalAttorney Docket No. 14640.0302-00304 agent and / or therapy comprises one or more anti-epileptic drugs (e.g., bromide, clobazam, felbamate, ganaxolone, lamotrigine, levetiracetam, phenobarbital, topiramate, valproate, or a combination thereof).
[0086] In some embodiments, the method further comprises administering an immunosuppressant to the subject. In some embodiments, the immunosuppressant comprises a corticosteroid (e.g., prednisone, prednisolone, methylprednisolone, and / or dexamethasone), adrenocorticotropic hormone, rapamycin, mycophenolate mofetil, tacrolimus, rituximab, and / or eculizumab hydroxychloroquine.
[0087] In some embodiments, the present disclosure provides an isolated nucleic acid, a recombinant viral genome, an AAV particle, or a pharmaceutical composition disclosed herein for use in the treatment of an STXBP1 -related disorder in a subject, or for use in the treatment of a subject having at least one symptom of an STXBP1 -related disorder; optionally wherein the STXBP1 -related disorder is STXBP1 encephalopathy, epileptic encephalopathy, STXBP1 developmental and epileptic encephalopathy (DEE), Ohtahara syndrome, developmental encephalopathy, West syndrome, early myoclonic epileptic encephalopathy, Lennox-Gastaut syndrome, autism (e.g., autism with STXBP1 mutations and optionally further mutations), Dravet syndrome (not caused by mutations in SCN1A), or Rett syndrome phenotype (not caused by mutation of MECP2 or CDKL5). In some embodiments, the subject has, has been diagnosed with having, or is at risk of having the STXBP1 -related disorder; optionally wherein the STXBP1 -related disorder is STXBP1 encephalopathy, epileptic encephalopathy, STXBP1 developmental and epileptic encephalopathy (DEE), Ohtahara syndrome, developmental encephalopathy, West syndrome, early myoclonic epileptic encephalopathy, Lennox-Gastaut syndrome, autism (e.g., autism with STXBP1 mutations and optionally further mutations), Dravet syndrome (not caused by mutations in SCN1 A), or Rett syndrome phenotype (not caused by mutation of MECP2 or CDKL5). In some embodiments, the STXBP1 -related disorder is STXBP1 DEE.
[0088] In some embodiments, the present disclosure provides the use of an isolated nucleic acid, a recombinant viral genome, an AAV particle, or a pharmaceutical composition disclosed herein in the manufacture of a medicament for the treatment of an STXBP1 -related disorder in a subject, or for the treatment of at least one symptom of an STXBP1 -related disorder in a subject; optionally wherein the STXBP1 -related disorder is STXBP1 encephalopathy, epileptic encephalopathy, STXBP1 developmental and epileptic encephalopathy (DEE), Ohtahara syndrome, developmental encephalopathy, West syndrome, early myoclonic epileptic encephalopathy, Lennox-Gastaut syndrome, autism (e.g., autismAttorney Docket No. 14640.0302-00304 with STXBP1 mutations and optionally further mutations), Dravet syndrome (not caused by mutations in SCN1 A), or Rett syndrome phenotype (not caused by mutation of MECP2 or CDKL5). In some embodiments, the subject has, has been diagnosed with having, or is at risk of having the STXBP1 -related disorder; optionally wherein the STXBP1 -related disorder is STXBP1 encephalopathy, epileptic encephalopathy, STXBP1 developmental and epileptic encephalopathy (DEE), Ohtahara syndrome, developmental encephalopathy, West syndrome, early myoclonic epileptic encephalopathy, Lennox-Gastaut syndrome, autism (e.g., autism with STXBP1 mutations and optionally further mutations), Dravet syndrome (not caused by mutations in SCN1 A), or Rett syndrome phenotype (not caused by mutation of MECP2 or CDKL5). In some embodiments, the STXBP1 -related disorder is STXBP1 DEE.
[0089] In some embodiments, the present disclosure provides an isolated nucleic acid, a recombinant viral genome, an AAV particle, or a pharmaceutical composition disclosed herein for use in a method of treating a disorder disclosed herein.Brief Description of the Drawings
[0090] FIG. 1A depicts vector genome (VG) quantification (VG / diploid genome) of mice at 28 days post-IV injection of PBS or PHP.eB viral particles carrying Construct 8 (SEQ ID NO: 32), Construct 3 (SEQ ID NO: 13), or Construct 1 (SEQ ID NO: 11). FIG. IB depicts normalized hSTXBPl transgene expression of mice at 28 days post-IV injection of PHP.eB viral particles carrying Construct 8 (SEQ ID NO: 32), Construct 3 (SEQ ID NO: 13), or Construct 1 (SEQ ID NO: 11).
[0091] FIG. 2A and FIG. 2B depict STXBP1 transgene expression (normalized to Gapdh) by detection of RNA abundance of mice at 28 days post-IV injection of PHP.eB viral particles carrying Construct 8 (SEQ ID NO: 32) or Construct 3 (SEQ ID NO: 13).
[0092] FIG. 3 depicts STXBP1 mRNA levels (normalized to P-actin) measured in SH- SY5Y neurons 3 days post-transduction with PHP.eB viral particles carrying Construct 4 (SEQ ID NO: 14), Construct 5 (SEQ ID NO: 15), Construct 9 (SEQ ID NO: 33), Construct 10 (SEQ ID NO: 34), or Construct 11 (SEQ ID NO: 35) at MOI le5 or le4.
[0093] FIG. 4 depicts STXBP1 mRNA levels (normalized to P-actin) measured in GlutaNeurons 3 days post transduction with PHP.eB viral particles carrying Construct 4 (SEQ ID NO: 6541), Construct 5 (SEQ ID NO: 15), Construct 9 (SEQ ID NO: 33), Construct 10 (SEQ ID NO: 34), or Construct 11 (SEQ ID NO: 35) at MOI le5 or le4.
[0094] FIG. 5 is an In Situ Hybridization (ISH) analysis of STXBP1 mRNA expression in the brain in wild-type (WT) mice at 28 days post-IV injection of PBS (top left and bottom leftAttorney Docket No. 14640.0302-00304 panels) or PHP.eB viral particles carrying Construct 1 (SEQ ID NO: 11) (top right and bottom right panels).
[0095] FIG. 6 depicts quantification of ISH analysis of STXBP1 mRNA expression in the brain in WT mice at 28 days post-IV injection of PBS or PHP.eB viral particles carrying Construct 1 (SEQ ID NO: 11) in neurons of the cortex (CTX), cornu ammonis 1 (CAI), cornu ammonis 2 (CA2), cornu ammonis 3 (CA3), dentate gyrus (DG), striatum (STR), thalamus (Thai), deep cerebellar nuclei (DCN), or cerebellum (CB).
[0096] FIG. 7 depicts the frequency after 17-18 days post-transduction of miniature excitatory post-synaptic current (mEPSC) in iPSC-derived glutamatergic neurons co-cultured with astrocytes and transduced with PHP.eB viral particles carrying Construct 1 (SEQ ID NO: 11) relative to control. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.
[0097] FIG. 8A depicts the neocortex and SI pyramidal layer V in which patch clamp studies were conducted. FIG. 8B and FIG. 8C depict results of patch-clamp electrophysiology in neocortical SI layer V pyramidal neurons of control WT mice treated with PBS or WT mice treated with PHP.eB viral particles carrying Construct 10 (SEQ ID NO: 34). *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.
[0098] FIG. 9 depicts EEG analysis of spike-wave discharges (SWD) per hour of total recording in heterozygous (het) STXBP1-KO (mutant) mice injected I.V. with PHP.eB viral particles carrying Construct 1 (SEQ ID NO: 11) as compared to het mice or wild-type control mice (WT) administered PBS. No state is defined. *P<0.05, **P<0.01, ***P<0.001, ****p<0.0001.
[0099] FIG. 10 depicts analysis of freezing behavior of heterozygous (het) STXBP1-KO (mutant) mice injected I.V. with PHP.eB viral particles carrying Construct 1 (SEQ ID NO: 11) as compared to het mice or wild-type control mice (WT) administered PBS.
[0100] FIG. HA and FIG. 11B depict analysis of anxiety -like behavior (on-shelter frequency) (FIG. HA) or hind limb clasping behavior (% time spent clasping) (FIG. HB) in heterozygous (het) STXBP1-KO (mutant) mice injected I.V. with PHP.eB viral particles carrying Construct 1 (SEQ ID NO: 11) as compared to het mice or wild-type control mice (WT) administered PBS. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.
[0101] FIG. 12A and FIG. 12B are depict the percentage of hSTXBPH- neurons in the cortex (FIG. 12A) or hippocampus (FIG. 12B) of heterozygous (het) STXBP1-KO (mutant) mice injected I.V. with PHP.eB viral particles carrying Construct 1 (SEQ ID NO: 11) as compared to het mice or wild-type control mice (WT) administered PBS. LD = low dose. HD = high dose.Attorney Docket No. 14640.0302-00304
[0102] FIG. 13 depicts analysis of freezing behavior of heterozygous (het) STXBP1-KO (mutant) mice injected I.V. with PHP.eB viral particles carrying Construct 1 (SEQ ID NO: 11) as compared to het mice or wild-type control mice (WT) administered PBS. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.
[0103] FIG. 14A depicts analysis of anxiety-like behavior (on-shelter frequency) and FIG. 14B depicts analysis of hind limb clasping behavior (% time spent clasping) in juvenile heterozygous (het) STXBP1-KO (mutant) mice injected I.V. with PHP.eB viral particles carrying Construct 1 (SEQ ID NO: 11) as compared to het mice or wild-type control mice (WT) administered PBS. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.
[0104] FIG. 15 depicts protein analysis of normalized STXBP1 levels in heterozygous (het) STXBP1-KO (mutant) mice injected I.V. with PHP.eB viral particles carrying Construct 1 (SEQ ID NO: 11) as compared to het mice or wild-type control mice (WT) administered PBS.
[0105] FIGs. 16A-16D depict viral genome level (vg / kg) (FIG. 16A), mouse STXBP1 cDNA ratios (FIG. 16B), human STXBPl / mouse STXBP1 cDNA ratios (FIG. 16C), and STXBP1 protein levels (FIG. 16D) in wild type and heterozygous mutant mice injected with PHP.eB viral particles carrying Construct 1 (SEQ ID NO: 11) at low and high doses.
[0106] FIG. 17A depicts double staining of NeuN and hSTXBPl in the whole brain, hippocampus, and cortex of juvenile or adult mice injected with PHP.eB viral particles carrying Construct 1 (SEQ ID NO: 11). FIG. 17B and FIG. 17C depict the percentage of hSTXBPH- neurons in the cortex (FIG. 17B) and hippocampus (FIG. 17C) of juvenile and adult mice injected with PHP.eB viral particles carrying Construct 1.
[0107] FIG. 18A depicts mSTXBPl mRNA levels in mice treated with PHP.eB viral particles carrying Construct 1 (SEQ ID NO: 11) and shown as normalized to wild type mSTXBPl levels. FIG. 18B depicts STXBP1 protein levels in mice injected with PHP.eB viral particles carrying Construct 1 (SEQ ID NO: 11) and shown as levels normalized to those in wild type mice treated with vehicle (PBS) control. FIGs. 18C, 18D, and 18E depict, respectively, excitatory (FIG. 18C), inhibitory (FIG. 18D), and excitatory / inhibitory ratios (FIG. 18E) determined from whole cell patch-clamp electrophysiology of neurons from mice injected with PHP.eB viral particles carrying Construct 1.Attorney Docket No. 14640.0302-00304Detailed DescriptionI. CompositionsA. Nucleic Acids and Viral Genomes1. STXBPl-Encoding Sequence
[0108] In some embodiments, the present disclosure provides a nucleic acid (e.g., an isolated nucleic acid) comprising a polynucleotide encoding STXBP1, also referred to as an STXBP1 -encoding sequence. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) is or is comprised within a viral genome (e.g., recombinant viral genome). Accordingly, in some embodiments, the present disclosure provides an isolated nucleic acid comprising an STXBP1 -encoding sequence and, in some embodiments, the present disclosure provides a viral genome (e.g., recombinant viral genome) comprising said isolated nucleic acid.
[0109] In some embodiments, the STXBP1 -encoding sequence encodes human STXBP1. In some embodiments, the STXBP1 -encoding sequence encodes wildtype STXBP1. In some embodiments, the STXBP1 -encoding sequence encodes an STXBP1 isoform.
[0110] In some embodiments, the STXBP1 -encoding sequence encodes STXBP1 isoform a, STXBP1 isoform b, STXBP1 isoform c, STXBP1 isoform d, STXBP1 isoform e, STXBP1 isoform f, STXBP1 isoform g, or STXBP1 isoform h. In some embodiments, the STXBP1 comprises the amino acid sequence of any one of SEQ ID NOs: 18-29 or an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the STXBP1 comprises the amino acid sequence of any one of SEQ ID NOs: 18-29.
[0111] In some embodiments, the STXBP1 comprises the amino acid sequence of SEQ ID NO: 3 or an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the STXBP1 comprises an amino acid sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO: 3. In some embodiments, the STXBP1 comprises an amino acid sequence that is at least 96% identical to the amino acid sequence of SEQ ID NO: 3. In some embodiments, the STXBP1 comprises an amino acid sequence that is at least 97% identical to the amino acid sequence of SEQ ID NO: 3. In some embodiments, the STXBP1 comprises an amino acid sequence that is at least 98% identical to the amino acid sequence of SEQ ID NO: 3. In some embodiments, the STXBP1 comprises an amino acid sequence that is at least 99% identical to the amino acid sequence of SEQ ID NO: 3. In some embodiments, the STXBP1 comprises the amino acid sequence ofAttorney Docket No. 14640.0302-00304SEQ ID NO: 3. In some embodiments, the STXBP1 consists of the amino acid sequence ofSEQ ID NO: 3.
[0112] Non-limiting examples of STXBP1 amino acid sequences are provided in Table 1.Table 1. Exemplary STXBP1 Amino Acid SequencesAttorney Docket No. 14640.0302-00304Attorney Docket No. 14640.0302-00304
[0113] In some embodiments, the STXBP1 -encoding sequence comprises a human STXBP1 nucleotide sequence. In some embodiments, the STXBP1 -encoding sequence comprises a wildtype STXBP1 nucleotide sequence. In some embodiments, the STXBP1 -encoding sequence comprises a codon-optimized STXBP1 nucleotide sequence. In some embodiments, the STXBP1 -encoding sequence comprises one or more CpG motifs. In some embodiments, the STXBP1 -encoding sequence is CpG-depleted. In some embodiments, the STXBP1- encoding sequence comprises no CpG motifs (i.e., is CpG-free).
[0114] In some embodiments, the STXBP1 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 4 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the STXBP1 -encoding sequence comprises a nucleotide sequence that is at least 95% identical to the nucleotide sequence of SEQ ID NO: 4. In some embodiments, the STXBP1 -encoding sequence comprises a nucleotide sequence that is at least 96% identical to the nucleotide sequence of SEQ ID NO: 4. In some embodiments, the STXBP1 -encoding sequence comprises aAttorney Docket No. 14640.0302-00304 nucleotide sequence that is at least 97% identical to the nucleotide sequence of SEQ ID NO:4. In some embodiments, the STXBP1 -encoding sequence comprises a nucleotide sequence that is at least 98% identical to the nucleotide sequence of SEQ ID NO: 4. In some embodiments, the STXBP1 -encoding sequence comprises a nucleotide sequence that is at least 99% identical to the nucleotide sequence of SEQ ID NO: 4. In some embodiments, the STXBP1 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 4. In some embodiments, the STXBP1 -encoding sequence consists of the nucleotide sequence of SEQ ID NO: 4.
[0115] In some embodiments, the STXBP1 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 5 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the STXBP1 -encoding sequence comprises a nucleotide sequence that is at least 95% identical to the nucleotide sequence of SEQ ID NO: 5. In some embodiments, the STXBP1 -encoding sequence comprises a nucleotide sequence that is at least 96% identical to the nucleotide sequence of SEQ ID NO: 5. In some embodiments, the STXBP1 -encoding sequence comprises a nucleotide sequence that is at least 97% identical to the nucleotide sequence of SEQ ID NO:5. In some embodiments, the STXBP1 -encoding sequence comprises a nucleotide sequence that is at least 98% identical to the nucleotide sequence of SEQ ID NO: 5. In some embodiments, the STXBP1 -encoding sequence comprises a nucleotide sequence that is at least 99% identical to the nucleotide sequence of SEQ ID NO: 5. In some embodiments, the STXBP1 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 5. In some embodiments, the STXBP1 -encoding sequence consists of the nucleotide sequence of SEQ ID NO: 5.
[0116] Non-limiting examples of STXBP1 -encoding sequences are provided in Table 2.Table 2. Exemplary STXBPl-Encoding SequencesAttorney Docket No. 14640.0302-00304Attorney Docket No. 14640.0302-003042. Promoter
[0117] In some embodiments, the present disclosure provides a nucleic acid (e.g., an isolated nucleic acid) comprising a promoter operably linked to an STXBP1 -encoding sequence. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) is or is comprised within a viral genome (e.g., recombinant viral genome). Accordingly, in some embodiments, the present disclosure provides an isolated nucleic acid comprising a promoter operably linked to an STXBP1 -encoding sequence and, in some embodiments, the present disclosure provides a viral genome (e.g., recombinant viral genome) comprising said isolated nucleic acid.
[0118] In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises, in 5’ to 3’ order, (i) a promoter operably linked to an STXBP1 -encoding sequence and (ii) the STXBP1 -encoding sequence.
[0119] In some embodiments, the promoter is or comprises a synapsin 1 promoter. In some embodiments, the promoter is or comprises a human synapsin 1 (“human SYN1” or “hSYNl” “hSYN” or “hSynl” or “hSyn”) promoter.
[0120] In some embodiments, the promoter is or comprises a human elongation factor 1 alpha (“human Efl a” or “EFla”) promoter.
[0121] In some embodiments, the promoter is or comprises an endogenous STXBP1 promoter (“ePro”).
[0122] In some embodiments, the promoter comprises the nucleotide sequence of SEQ ID NO: 7 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the promoter comprises a nucleotide sequence that is at least 95% identical to the nucleotide sequence of SEQ ID NO: 7. In some embodiments, the promoter comprises a nucleotide sequence that is at least 96% identical to the nucleotide sequence of SEQ ID NO: 7. In some embodiments, the promoter comprises a nucleotide sequence that is at least 97% identical to the nucleotide sequence of SEQ ID NO: 7. In some embodiments, the promoter comprises a nucleotide sequence that is at least 98% identical to the nucleotide sequence of SEQ ID NO: 7. In some embodiments, the promoter comprises a nucleotide sequence that is at least 99% identical to the nucleotide sequence of SEQ ID NO: 7. In some embodiments, the promoter comprises the nucleotide sequence of SEQ ID NO: 7. In some embodiments, the promoter consists of the nucleotide sequence of SEQ ID NO: 7.Attorney Docket No. 14640.0302-00304
[0123] In some embodiments, the promoter comprises the nucleotide sequence of SEQ ID NO: 30 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the promoter comprises a nucleotide sequence that is at least 95% identical to the nucleotide sequence of SEQ ID NO: 30. In some embodiments, the promoter comprises a nucleotide sequence that is at least 96% identical to the nucleotide sequence of SEQ ID NO: 30. In some embodiments, the promoter comprises a nucleotide sequence that is at least 97% identical to the nucleotide sequence of SEQ ID NO:30. In some embodiments, the promoter comprises a nucleotide sequence that is at least 98% identical to the nucleotide sequence of SEQ ID NO: 30. In some embodiments, the promoter comprises a nucleotide sequence that is at least 99% identical to the nucleotide sequence of SEQ ID NO: 30. In some embodiments, the promoter comprises the nucleotide sequence of SEQ ID NO: 30. In some embodiments, the promoter consists of the nucleotide sequence of SEQ ID NO: 30.
[0124] In some embodiments, the promoter comprises the nucleotide sequence of SEQ ID NO: 31 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the promoter comprises a nucleotide sequence that is at least 95% identical to the nucleotide sequence of SEQ ID NO: 31. In some embodiments, the promoter comprises a nucleotide sequence that is at least 96% identical to the nucleotide sequence of SEQ ID NO: 31. In some embodiments, the promoter comprises a nucleotide sequence that is at least 97% identical to the nucleotide sequence of SEQ ID NO:31. In some embodiments, the promoter comprises a nucleotide sequence that is at least 98% identical to the nucleotide sequence of SEQ ID NO: 31. In some embodiments, the promoter comprises a nucleotide sequence that is at least 99% identical to the nucleotide sequence of SEQ ID NO: 31. In some embodiments, the promoter comprises the nucleotide sequence of SEQ ID NO: 31. In some embodiments, the promoter consists of the nucleotide sequence of SEQ ID NO: 31.
[0125] Non-limiting examples of promoter sequences are provided in Table 3.Table 3. Exemplary Promoter SequencesAttorney Docket No. 14640.0302-003043. WPRE
[0126] In some embodiments, the present disclosure provides a nucleic acid (e.g., an isolated nucleic acid) comprising an STXBP1 -encoding sequence and a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE). In some embodiments, the nucleic acid (e.g., isolated nucleic acid) is or is comprised within a viral genome (e.g., recombinant viral genome). Accordingly, in some embodiments, the present disclosure provides an isolated nucleic acid comprising an STXBP1 -encoding sequence and a WPRE and, in some embodiments, the present disclosure provides a viral genome (e.g., recombinant viral genome) comprising said isolated nucleic acid.Attorney Docket No. 14640.0302-00304
[0127] In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises, in 5’ to 3’ order, a WPRE and an STXBP1 -encoding sequence. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises, in 5’ to 3’ order, an STXBP1 -encoding sequence and a WPRE. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises, in 5’ to 3’ order, (i) a promoter operably linked to an STXBP1 -encoding sequence, (ii) the STXBP1 -encoding sequence, and (iii) a WPRE.
[0128] In some embodiments, the WPRE comprises the nucleotide sequence of SEQ ID NO:39 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the WPRE comprises the nucleotide sequence of SEQ ID NO: 39. In some embodiments, the WPRE consists of the nucleotide sequence of SEQ ID NO: 39.
[0129] In some embodiments, the WPRE comprises the nucleotide sequence of SEQ ID NO:40 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the WPRE comprises the nucleotide sequence of SEQ ID NO: 40. In some embodiments, the WPRE consists of the nucleotide sequence of SEQ ID NO: 40.
[0130] In some embodiments, the WPRE comprises the nucleotide sequence of SEQ ID NO:41 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the WPRE comprises the nucleotide sequence of SEQ ID NO: 41. In some embodiments, the WPRE consists of the nucleotide sequence of SEQ ID NO: 41.
[0131] In some embodiments, the WPRE comprises the nucleotide sequence of SEQ ID NO:42 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the WPRE comprises the nucleotide sequence of SEQ ID NO: 42. In some embodiments, the WPRE consists of the nucleotide sequence of SEQ ID NO: 42.
[0132] In some embodiments, the WPRE comprises the nucleotide sequence of SEQ ID NO:43 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%,Attorney Docket No. 14640.0302-00304 at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the WPRE comprises the nucleotide sequence of SEQ ID NO: 43. In some embodiments, the WPRE consists of the nucleotide sequence of SEQ ID NO: 43.
[0133] In some embodiments, the WPRE comprises the nucleotide sequence of SEQ ID NO: 8 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the WPRE comprises a nucleotide sequence that is at least 95% identical to the nucleotide sequence of SEQ ID NO: 8. In some embodiments, the WPRE comprises a nucleotide sequence that is at least 96% identical to the nucleotide sequence of SEQ ID NO: 8. In some embodiments, the WPRE comprises a nucleotide sequence that is at least 97% identical to the nucleotide sequence of SEQ ID NO: 8. In some embodiments, the WPRE comprises a nucleotide sequence that is at least 98% identical to the nucleotide sequence of SEQ ID NO: 8. In some embodiments, the WPRE comprises a nucleotide sequence that is at least 99% identical to the nucleotide sequence of SEQ ID NO: 8. In some embodiments, the WPRE comprises the nucleotide sequence of SEQ ID NO: 8. In some embodiments, the WPRE consists of the nucleotide sequence of SEQ ID NO: 8.
[0134] A non-limiting example of a WPRE sequence is provided in Table 4.Table 4. Exemplary WPRE SequenceAttorney Docket No. 14640.0302-00304Attorney Docket No. 14640.0302-003044. MicroRNA Binding Site
[0135] In some embodiments, the present disclosure provides a nucleic acid (e.g., an isolated nucleic acid) comprising an STXBP1 -encoding sequence and a nucleotide sequence encoding at least one microRNA (miR) binding site. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) is or is comprised within a viral genome (e.g., recombinant viral genome). Accordingly, in some embodiments, the present disclosure provides an isolated nucleic acid comprising an STXBP1 -encoding sequence and a nucleotide sequence encoding at least one miR binding site and, in some embodiments, the present disclosure provides a viral genome (e.g., recombinant viral genome) comprising said isolated nucleic acid.
[0136] In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises, in 5’ to 3’ order, an STXBP1 -encoding sequence and a nucleotide sequence encoding at least one miR binding site (e.g., at least one miR183 binding site). In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises, in 5’ to 3’ order, (i) a promoter operably linked to an STXBP1 -encoding sequence, (ii) the STXBP1 -encoding sequence, and (iii) a nucleotide sequence encoding at least one miR binding site (e.g., at least one miR183 binding site). In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises, in 5’ to 3’ order, (i) a promoter operably linked to an STXBP1 -encoding sequence, (ii) the STXBP1 -encoding sequence, (iii) a WPRE, and (iv) a nucleotide sequence encoding at least one miR binding site (e.g., at least one miR183 binding site).
[0137] In some embodiments, the miR binding site prevents, suppresses, or otherwise inhibits expression of STXBP1 in dorsal root ganglia. In some embodiments, the miR binding site is or comprises a miR183 binding site. In some embodiments, the nucleic acid (e.g., an isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises aAttorney Docket No. 14640.0302-00304 nucleotide sequence encoding a miR binding site series comprising at least 2 miR binding sites. In some embodiments, the miR binding site series comprises at least 2, at least 3, at least 4, or at least 5 miR binding sites. In some embodiments, the miR binding site series comprises 1, 2, 3, 4, or 5 miR binding sites. In some embodiments, the miR binding site series consists of 4 miR binding sites. In some embodiments, the miR binding sites of the miR binding site series are continuous. In some embodiments, the miR binding sites of the miR binding site series are separated by a spacer. In some embodiments, the spacer is 1 to 10 nucleotides in length, e.g., 1-6 nucleotides or 5-10 nucleotides in length. In some embodiments, each miR binding site of the miR binding site series is a miR183 binding site. In some embodiments, each miR binding site of the miR binding site series is a miR183 binding site, wherein each miR183 binding site has the same nucleotide sequence.
[0138] In some embodiments, the nucleic acid (e.g., an isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises a nucleotide sequence encoding at least one miR183 binding site, wherein the at least one miR183 binding site is encoded by the nucleotide sequence of AGTGAATTCTACCAGTGCCATA (SEQ ID NO: 1) or a nucleotide sequence that is at least 50% (e.g., at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95%) identical thereto, wherein the nucleotide sequence encoding at least one miR183 binding site comprises the nucleotide sequence of GTGCCAT. In some embodiments, the at least one miR183 binding site is encoded by a nucleotide sequence that is at least 90% identical to the nucleotide sequence of SEQ ID NO: 1 and comprises the nucleotide sequence of GTGCCAT. In some embodiments, the at least one miR183 binding site is encoded by a nucleotide sequence that is at least 95% identical to the nucleotide sequence of SEQ ID NO: 1 and comprises the nucleotide sequence of GTGCCAT. In some embodiments, at least one miR183 binding site is encoded by the nucleotide sequence of SEQ ID NO: 1 or a nucleotide sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, but no more than 10, modifications relative to the nucleotide sequence of SEQ ID NO: 1, wherein the nucleotide sequence encoding the at least one miR183 binding site comprises the nucleotide sequence of GTGCCAT. In some embodiments, the nucleotide sequence encoding the at least one miR183 binding site has no more than 5 modifications relative to the nucleotide sequence of SEQ ID NO: 1, wherein the nucleotide sequence encoding the at least one miR183 binding site comprises the nucleotide sequence of GTGCCAT. In some embodiments, the nucleotide sequence encoding the at least one miR183 binding site has 2 modifications relative to the nucleotide sequence of SEQ ID NO: 1, wherein the nucleotide sequence encoding the at least one miR183 binding siteAttorney Docket No. 14640.0302-00304 comprises the nucleotide sequence of GTGCCAT. In some embodiments, the nucleotide sequence encoding the at least one miR183 binding site has 1 modification relative to the nucleotide sequence of SEQ ID NO: 1, wherein the nucleotide sequence encoding the at least one miR183 binding site comprises the nucleotide sequence of GTGCCAT.
[0139] In some embodiments, the nucleotide sequence encoding the at least one miR183 binding site comprises the nucleotide sequence of SEQ ID NO: 1. In some embodiments, the nucleotide sequence encoding the at least one miR183 binding site consists of the nucleotide sequence of SEQ ID NO: 1.
[0140] In some embodiments, a nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) of the present disclosure comprises a nucleotide sequence encoding multiple miR183 binding sites, which may be referred to as a nucleotide sequence encoding a miR183 binding site series.
[0141] In some embodiments, the miR183 binding site series comprises at least two miR183 binding sites (e.g., 2, 3, 4, or 5 miR183 binding sites), wherein each miR183 binding site is encoded by a nucleotide sequence comprising the nucleotide sequence of SEQ ID NO: 1. In some embodiments, the miR183 binding site series comprises at least two miR183 binding sites (e.g., 2, 3, 4, or 5 miR binding sites), wherein each miR183 binding site is encoded by the nucleotide sequence of SEQ ID NO: 1.
[0142] In some embodiments, the miR183 binding site series comprises 4 miR binding sites. In some embodiments, the miR183 binding site series comprises 4 miR binding sites, wherein each miR183 binding site is encoded by a nucleotide sequence comprising the nucleotide sequence of SEQ ID NO: 1. In some embodiments, the miR183 binding site series comprises 4 miR binding sites, wherein each miR183 binding site is encoded by the nucleotide sequence of SEQ ID NO: 1.
[0143] In some embodiments, each of the miR183 binding sites in the miR183 binding site series is separated by a spacer. In some embodiments, the spacer is 1 to 10 nucleotides in length, e.g., 1-6 nucleotides or 5-10 nucleotides in length. In some embodiments, the spacer is encoded by a nucleotide sequence comprising the nucleotide sequence of GATAGTTA, or a nucleotide sequence having at least one, two, three, or four modifications, but no more than four modifications relative to the nucleotide sequence of GATAGGTA. In some embodiments, each spacer is encoded by a nucleotide sequence comprising the nucleotide sequence of GATAGTTA. In some embodiments, each spacer is encoded by the nucleotide sequence of GATAGTTA.Attorney Docket No. 14640.0302-00304
[0144] In some embodiments, the miR183 binding site series is encoded by the nucleotide sequence of SEQ ID NO: 2 or a nucleotide sequence that is at least 50% (e.g., at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95%) identical thereto, wherein at least one miR183 binding site of the series is encoded by a nucleotide sequence that comprises the nucleotide sequence of GTGCCAT. In some embodiments, the miR183 binding site series is encoded by the nucleotide sequence of SEQ ID NO: 2 or a nucleotide sequence that is at least 50% (e.g., at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95%) identical thereto, wherein each miR183 binding site of the series is encoded by a nucleotide sequence that comprises the nucleotide sequence of GTGCCAT. In some embodiments, the miR183 binding site series is encoded by a nucleotide sequence that is at least 90% identical to the nucleotide sequence of SEQ ID NO: 2, wherein at least one miR183 binding site of the series is encoded by a nucleotide sequence that comprises the nucleotide sequence of GTGCCAT. In some embodiments, the miR183 binding site series is encoded by a nucleotide sequence that is at least 90% identical to the nucleotide sequence of SEQ ID NO: 2, wherein each miR183 binding site of the series is encoded by a nucleotide sequence that comprises the nucleotide sequence of GTGCCAT. In some embodiments, the miR183 binding site series is encoded by a nucleotide sequence that is at least 95% identical to the nucleotide sequence of SEQ ID NO: 2, wherein at least one miR183 binding site of the series is encoded by a nucleotide sequence that comprises the nucleotide sequence of GTGCCAT. In some embodiments, the miR183 binding site series is encoded by a nucleotide sequence that is at least 95% identical to the nucleotide sequence of SEQ ID NO: 2, wherein each miR183 binding site of the series is encoded by a nucleotide sequence that comprises the nucleotide sequence of GTGCCAT. In some embodiments, the nucleotide sequence encoding the miR183 binding site series comprises the nucleotide sequence of SEQ ID NO: 2. In some embodiments, the nucleotide sequence encoding the miR183 binding site series consists of the nucleotide sequence of SEQ ID NO: 2.
[0145] Anon-limiting example of a nucleotide sequence encoding a miR183 binding site series is provided in Table 5.Table 5. Exemplary miR183 Binding Site-Encoding SequenceAttorney Docket No. 14640.0302-003045. Polyadenylation Sequence
[0146] In some embodiments, the present disclosure provides a nucleic acid (e.g., an isolated nucleic acid) comprising an STXBP1 -encoding sequence and a polyadenylation (poly A) sequence. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) is or is comprised within a viral genome (e.g., recombinant viral genome). Accordingly, in some embodiments, the present disclosure provides an isolated nucleic acid comprising an STXBP1 -encoding sequence and a poly A sequence and, in some embodiments, the present disclosure provides a viral genome (e.g., recombinant viral genome) comprising said isolated nucleic acid.
[0147] In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises, in 5’ to 3’ order, an STXBP1 -encoding sequence and a polyA sequence. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises, in 5’ to 3’ order, (i) a promoter operably linked to an STXBP1 -encoding sequence, (ii) the STXBP1 -encoding sequence, and (iii) a polyA sequence. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises, in 5’ to 3’ order, (i) a promoter operably linked to an STXBP1 -encoding sequence, (ii) the STXBP1- encoding sequence, (iii) a WPRE, and (iv) a polyA sequence. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises, in 5’ to 3’ order, (i) a promoter operably linked to an STXBP1 -encoding sequence, (ii) the STXBP1 -encoding sequence, (iii) a WPRE, (iv) a nucleotide sequence encoding at least one miR binding site (e.g., at least one miR183 binding site), and (v) a polyA sequence.
[0148] In some embodiments, the polyA sequence is a bovine growth hormone (BGH) polyA sequence.
[0149] In some embodiments, the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 9 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the polyA sequence comprises a nucleotide sequence that is at least 95% identical to the nucleotide sequence of SEQ ID NO: 9. In some embodiments, the polyA sequence comprises a nucleotide sequence that is at least 96% identical to the nucleotide sequence of SEQ ID NO: 9. In some embodiments, the polyA sequence comprises a nucleotide sequence that is at least 97% identical to the nucleotide sequence of SEQ ID NO: 9. In some embodiments, the polyA sequence comprises a nucleotide sequence that is at least 98% identical to the nucleotide sequence of SEQ ID NO:Attorney Docket No. 14640.0302-003049. In some embodiments, the polyA sequence comprises a nucleotide sequence that is at least 99% identical to the nucleotide sequence of SEQ ID NO: 9. In some embodiments, the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 9. In some embodiments, the polyA sequence consists of the nucleotide sequence of SEQ ID NO: 9.
[0150] Anon-limiting example of a polyA sequence is provided in Table 6.Table 6. Exemplary PolyA Sequence6. Inverted Terminal Repeats (ITRs)
[0151] In some embodiments, a nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) disclosed herein further comprises an ITR. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises two ITRs.
[0152] In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises a 5’ ITR. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises a 3’ ITR. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises a 5’ ITR and a 3’ ITR.
[0153] In some embodiments, the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 6 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to the nucleotide sequence of SEQ ID NO: 6. In some embodiments, the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 6 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 6. In some embodiments, the 5’ ITR consists of the nucleotide sequence of SEQ ID NO: 6.
[0154] In some embodiments, the 3’ ITR comprises the nucleotide sequence of SEQ ID NO: 10 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to the nucleotide sequence of SEQ ID NO: 10. In some embodiments, the 3’ ITR comprises the nucleotide sequence of SEQ ID NO: 10 or a nucleotide sequence that is atAttorney Docket No. 14640.0302-00304 least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical thereto. In some embodiments, the 3’ ITR comprises the nucleotide sequence of SEQ ID NO: 10. In some embodiments, the 3’ ITR consists of the nucleotide sequence of SEQ ID NO: 10.
[0155] Non-limiting examples of ITR sequences are provided in Table 7.Table 7. Exemplary ITR Sequences7. Exemplary ITR-to-ITR Sequences
[0156] In some embodiments, the present disclosure provides a nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprising a nucleotide sequence that is at least 80% (e.g., at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the nucleotide sequence of any one of SEQ ID NOs: 11, 12, 13, 14, 15, 16, and 17.
[0157] In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises a nucleotide sequence that is at least 85% (e.g., at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the nucleotide sequence of any one of SEQ ID NOs: 11, 12, 13, 14, 15, 16, and 17.
[0158] In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the nucleotide sequence of any one of SEQ ID NOs: 11, 12, 13, 14, 15, 16, and 17.
[0159] In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises a nucleotide sequence that is at least 95% identical to the nucleotide sequence of any one of SEQ ID NOs: 11, 12, 13, 14, 15, 16,Attorney Docket No. 14640.0302-00304 and 17. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises a nucleotide sequence that is at least 96% identical to the nucleotide sequence of any one of SEQ ID NOs: 11, 12, 13, 14, 15, 16, and 17. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises a nucleotide sequence that is at least 97% identical to the nucleotide sequence of any one of SEQ ID NOs: 11, 12, 13, 14, 15, 16, and 17. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises a nucleotide sequence that is at least 98% identical to the nucleotide sequence of any one of SEQ ID NOs: 11, 12, 13, 14, 15, 16, and 17. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises a nucleotide sequence that is at least 99% identical to the nucleotide sequence of any one of SEQ ID NOs: 11, 12, 13, 14, 15, 16, and 17.
[0160] In some embodiments, the present disclosure provides a nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of any one of SEQ ID NOs: 11, 12, 13, 14, 15, 16, and 17. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises the nucleotide sequence of SEQ ID NO: 11. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises the nucleotide sequence of SEQ ID NO: 12. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises the nucleotide sequence of SEQ ID NO: 16. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises the nucleotide sequence of SEQ ID NO: 17.
[0161] In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises the ITR-to-ITR sequence (the viral genome) of Construct 1. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises the ITR-to-ITR sequence (the viral genome) of Construct 2. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises the ITR-to-ITR sequence (the viral genome) of Construct 6. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises the ITR-to-ITR sequence (the viral genome) of Construct 7.Attorney Docket No. 14640.0302-00304
[0162] Non-limiting ITR-to-ITR sequences (viral genomes) are provided in Table 8 and Table 9.Table 8. SEQ ID NOs of Exemplary ITR-to-ITR Sequences and ComponentsTable 9. Exemplary Viral GenomesAttorney Docket No. 14640.0302-00304Attorney Docket No. 14640.0302-00304Attorney Docket No. 14640.0302-00304Attorney Docket No. 14640.0302-00304Attorney Docket No. 14640.0302-00304Attorney Docket No. 14640.0302-00304Attorney Docket No. 14640.0302-00304B. Adeno-associated virus (AAV) Capsids and Particles
[0163] AAVs typically have a genome of about 5,000 nucleotides in length and contain one open reading frame encoding the (non- structural) proteins responsible for replication (Rep78, Rep68, Rep52, Rep40, encoded by Rep genes) and another open reading frame encoding the structural proteins of the capsid (VP1, VP2, VP3, encoded by capsid genes or Cap genes). The open reading frames are flanked by two inverted terminal repeat (ITR) sequences, which serve as the origin of replication of the viral genome. The Rep proteins are important for replication and packaging, while the capsid proteins are assembled to create the protein shell of the AAV, or AAV capsid. Alternative splicing and alternate initiation codons and promoters result in the generation of four different Rep proteins from a single open reading frame and the generation of three capsid proteins from a single open reading frame. VP1 is the full- length capsid protein sequence and contains the VP2 and VP3 sequences and VP2 and VP3 are shorter components of the whole, with the VP2 sequence containing the VP3 sequence. Though it varies by AAV serotype, as a non-limiting example, for AAV9 / hu.14 (SEQ ID NO: 123 of US 7,906,111, the relevant contents of which are herein incorporated by reference in their entirety) VP1 refers to amino acids 1-736, VP2 refers to amino acids 138-736, and VP3 refers to amino acids 203-736.
[0164] Changes in the sequence in the VP3 region of a single capsid open reading frame are also changes to VP1 and VP2; however, the percent difference as compared to the parent sequence will be greatest for VP3 since it is the shortest sequence of the three. Though described here in relation to the amino acid sequence, the nucleic acid sequence encoding these proteins can be similarly described. Together, the three capsid proteins assemble to create the AAV capsid. Without being bound by theory, the AAV capsid typically comprises a molar ratio of 1 : 1 : 10 of VP1 :VP2:VP3.
[0165] The AAV particle typically requires a co-helper (e.g., adenovirus) to undergo productive infection in cells. In the absence of such helper functions, the AAV virions essentially enter host cells but do not integrate into the cells’ genome.
[0166] AAV particles may be used as a biological tool, including in gene therapy, due to their relatively simple structure, their ability to infect a wide range of cells (including quiescent and dividing cells) without integration into the host genome and without replicating, and their relatively benign immunogenic profile. Moreover, infection with AAV particles has minimal influence on changing the pattern of cellular gene expression (StilwellAttorney Docket No. 14640.0302-00304 and Samulski et al., Biotechniques, 2003, 34, 148, the relevant contents of which are herein incorporated by reference in their entirety). The genome of the virus may be manipulated to contain a minimum of components for the assembly of a functional recombinant virus, or viral particle, which is loaded with or engineered to target a particular tissue and express or deliver a desired payload.
[0167] Typically, AAV particles for STXBP1 delivery may be recombinant viral particles that are replication defective as they lack sequences encoding functional Rep and Cap proteins within the viral genome. In some cases, the replication-defective AAV particles may lack most or all coding sequences and essentially only contain one or two AAV ITR sequences and a nucleic acid sequence encoding STXBP1 (e.g., human STXBP1). In some cases, the nucleic acid sequence encoding STXBP1 (e.g., human STXBP1) further comprises one or more regulatory elements to modulate transcription or translation.
[0168] In some embodiments, the AAV particles of the present disclosure may be introduced into mammalian cells.
[0169] AAV particles of the present disclosure may be produced recombinantly and may be based on AAV reference sequences. In addition to single-stranded AAV viral genomes (e.g., ssAAVs), the present disclosure also provides for self-complementary AAV (scAAVs) viral genomes. scAAV viral genomes contain DNA strands that anneal together to form doublestranded DNA. By skipping second strand synthesis, scAAVs allow for rapid expression in the transduced cell. In some embodiments, the AAV particle of the present disclosure is an scAAV. In some embodiments, the AAV particle of the present disclosure is an ssAAV.
[0170] Methods for producing and / or modifying AAV particles are disclosed in the art such as pseudotyped AAV particles (International Patent Publication Nos. W0200028004;W0200123001; WO2004112727; W02005005610; and W02005072364, the relevant contents of each of which are incorporated herein by reference in their entirety).
[0171] In some embodiments, an AAV particle of the present disclosure comprises a viral genome (e.g., recombinant viral genome) disclosed herein and an AAV capsid. In some embodiments, the AAV capsid is an AAV capsid variant, wherein the variant comprises a capsid protein that differs from a wildtype AAV capsid protein by one or more insertions, deletions, and / or substitutions. In some embodiments, the AAV capsid or AAV capsid variant comprises a capsid protein selected from the group consisting of: AAV1, AAV2, AAV3, AAV3b, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAV9, AAV9 K449R, VOY101, VOY201, AAVPHP.A, AAVPHP.B, AAVPHP.B2, AAVPHP.B3, AAVPHP.eB, AAVPHP.N, AAVPHP.S, G2B4, G2B5, CAP-B10, AAVrhlO, AAVrh32.33, AAVrh74, a capsid protein ofAttorney Docket No. 14640.0302-00304 an AAV serotype as provided in Table 6 of International Patent Publication No. WO2021230987 (the relevant contents of which are incorporated by reference in their entirety), a capsid protein disclosed in International Patent Publication No. WO2023081648 (the contents of which are incorporated by reference in their entirety), a capsid protein disclosed in International Patent Publication No. WO2023154693 (the contents of which are incorporated by reference in their entirety), a capsid protein disclosed in International Patent Publication No. WO2023235791 (the contents of which are incorporated by reference in their entirety), and a capsid protein disclosed in International Patent Publication No. W02024006741 (the contents of which are incorporated by reference in their entirety), or a variant of any of the foregoing.
[0172] In some embodiments, the AAV capsid variant preferentially targets the brain over the liver. In some embodiments, the AAV capsid variant is AAVPHP.eB or CAP -BIO. See, e.g., Goertsen et al. AAV capsid variants with brain-wide transgene expression and decreased liver targeting after intravenous delivery in mouse and marmoset. Nat Neurosci 25, 106-115 (2022); Seo et al. Multimodal imaging of capsid and cargo reveals differential brain targeting and liver detargeting of systemically-administered AAVs, Biomaterials 288 (2022). In some embodiments, the AAV capsid variant is an AAV9 capsid variant disclosed in International Patent Publication No. WO2023081648 or WO2023235791. In some embodiments, the AAV5 capsid variant is an AAV9 capsid variant disclosed in International Patent Publication No. WO2023154693.
[0173] In some embodiments, the present disclosure provides an AAV particle comprising a viral genome (e.g., recombinant viral genome) disclosed herein and an AAV9 capsid variant.C. Tropism and Biodistribution Properties
[0174] AAV particles and payloads of the disclosure may be delivered to one or more target cells, tissues, organs, or organisms. In some embodiments, the AAV particles demonstrate enhanced tropism for a target cell type, tissue or organ. As a non-limiting example, the AAV particle may have enhanced tropism for cells and tissues of the central or peripheral nervous systems (CNS and PNS, respectively). In some embodiments, an AAV particle may, in addition, or alternatively, have decreased tropism for a cell-type, tissue or organ.
[0175] AAV particles may be modified to enhance the efficiency of delivery. Such modified AAV particles of the present disclosure can be packaged efficiently and can be used to successfully infect the target cells at high frequency and with minimal toxicity.
[0176] In some embodiments, AAV particles may be used to deliver STXBP1 to the central nervous system (see, e.g., U.S. Patent No. 6,180,613; the relevant contents of which areAttorney Docket No. 14640.0302-00304 herein incorporated by reference in their entirety) or to specific tissues of the central nervous system.
[0177] In some embodiments, the AAV capsid of the AAV particle allows for blood brain barrier penetration of the AAV particle following intravenous administration, focused ultrasound (FUS), e.g., coupled with the intravenous administration of microbubbles (FUS- MB), or MRI-guided FUS coupled with intravenous administration. In some embodiments, the AAV capsid allows for blood brain barrier penetration of the AAV particle following intravenous administration.II. AAV Particle Production
[0178] The present disclosure further provides processes and methods for producing an AAV particle comprising an AAV capsid that may be used to contact a target cell to deliver STXBP1.
[0179] In some embodiments, the present disclosure provides a method of making an AAV particle comprising an AAV capsid and a viral genome (e.g., recombinant viral genome) disclosed herein, wherein the method comprises: (i) providing a cell comprising a nucleic acid comprising a viral genome (e.g., recombinant viral genome) comprising an STXBP1- encoding sequence and a nucleic acid encoding the AAV capsid; and (ii) incubating the cell under conditions suitable to encapsulate the viral genome (e.g., recombinant viral genome) in the AAV capsid; thereby making the AAV particle.
[0180] In some embodiments, the method of making an AAV particle comprises, prior to step (i), introducing into the cell the nucleic acid comprising the viral genome (e.g., recombinant viral genome). In some embodiments, the method comprises, prior to step (i), introducing into the cell the nucleic acid encoding the AAV capsid.
[0181] In some embodiments, the AAV capsid is an AAV capsid variant. In some embodiments, the AAV capsid is an AAV9 capsid variant.
[0182] In some embodiments, the cell comprises a mammalian cell (e.g., an HEK293 cell), an insect cell (e.g., an Sf9 cell), or a bacterial cell. In some embodiments, AAV particles are produced in mammalian cells (e.g., HEK293 cells). In some embodiments, AAV particles are produced in insect cells (e.g., Sf9 cells). In some embodiments, the AAV particle is an isolated AAV particle. In some embodiments, the AAV particle is a recombinant AAV particle.
[0183] Any method known in the art may be used for the preparation of AAV particles. For example, methods of making AAV particles are described in U.S. Patent Nos. 6204059, 5756283, 6258595, 6261551, 6270996, 6281010, 6365394, 6475769, 6482634, 6485966,Attorney Docket No. 14640.0302-003046943019, 6953690, 7022519, 7238526, 7291498, 7491508, 5064764, 6194191, 6566118, and 8137948 and International Patent Publication Nos. WO1996039530, W01998010088, WO1999014354, WO1999015685, WO1999047691, W02000055342, W02000075353, and WO200 1023597, as well as in Methods In Molecular Biology, ed. Richard, Humana Press, NJ (1995); O'Reilly et al., Baculovirus Expression Vectors, A Laboratory Manual, Oxford Univ. Press (1994); Samulski et al., J. Vir.63:3822-8 (1989); Kajigaya et al., Proc. Nat'l. Acad. Sci. USA 88: 4646-50 (1991); Ruffing et al., J. Vir. 66:6922-30 (1992); Kimbauer et al., Vir., 219:37-44 (1996); and Zhao et al., Vir.272:382-93 (2000); the relevant contents of each of which are herein incorporated by reference in their entirety. In some embodiments, the AAV particles are made using the methods described in International Patent Publication No. W02015191508, the relevant contents of which are herein incorporated by reference in their entirety.III. Pharmaceutical Compositions
[0184] In some embodiments, the present disclosure provides a pharmaceutical composition comprising a nucleic acid, viral genome, or AAV particle disclosed herein and a pharmaceutically acceptable excipient. Suitable excipients are known in the art, e.g., as described in Remington: The Science and Practice of Pharmacy (Adeboye Adejare ed., 23rd ed. 2020), the relevant contents of which are incorporated by reference herein in their entirety. In some embodiments, a pharmaceutical composition described herein comprises at least one buffering agent, at least one stabilizing agent, at least one osmotic pressure regulator, at least one protective agent, at least one coating agent, at least one binding agent, and least one disintegrant, at least one preservative, at least one solvent, at least one surfactant, at least one cryoprotectant, at least one lubricant, at least one glidant, and / or at least one filler.
[0185] In some embodiments, the pharmaceutical composition comprises an isolated nucleic acid comprising the nucleotide sequence of SEQ ID NO: 4 and a WPRE (e.g., comprising the nucleotide sequence of SEQ ID NO: 8). In some embodiments, the pharmaceutical composition comprises an isolated nucleic acid comprising the nucleotide sequence of SEQ ID NO: 5 and a WPRE (e.g., comprising the nucleotide sequence of SEQ ID NO: 8).
[0186] In some embodiments, the pharmaceutical composition comprises an isolated nucleic acid comprising the nucleotide sequence of SEQ ID NO: 11 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96% at least 97%, at least 98%, or at least 99%) identical thereto. In someAttorney Docket No. 14640.0302-00304 embodiments, the pharmaceutical composition comprises an isolated nucleic acid comprising the nucleotide sequence of SEQ ID NO: 11.
[0187] In some embodiments, the pharmaceutical composition comprises an isolated nucleic acid comprising the nucleotide sequence of SEQ ID NO: 12 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96% at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the pharmaceutical composition comprises an isolated nucleic acid comprising the nucleotide sequence of SEQ ID NO: 12.
[0188] In some embodiments, the pharmaceutical composition comprises an isolated nucleic acid comprising the nucleotide sequence of SEQ ID NO: 16 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96% at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the pharmaceutical composition comprises an isolated nucleic acid comprising the nucleotide sequence of SEQ ID NO: 16.
[0189] In some embodiments, the pharmaceutical composition comprises an isolated nucleic acid comprising the nucleotide sequence of SEQ ID NO: 17 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96% at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the pharmaceutical composition comprises an isolated nucleic acid comprising the nucleotide sequence of SEQ ID NO: 17.
[0190] In some embodiments, the pharmaceutical composition comprises an AAV particle comprising an AAV capsid and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 4 and a WPRE (e.g., comprising the nucleotide sequence of SEQ ID NO: 8). In some embodiments, the pharmaceutical composition comprises an AAV particle comprising an AAV capsid and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 5 and a WPRE (e.g., comprising the nucleotide sequence of SEQ ID NO: 8).
[0191] In some embodiments, the AAV particle of the pharmaceutical composition comprises an AAV capsid and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 11 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96% at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the AAV particle of the pharmaceutical composition comprises an AAV capsid and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 11.Attorney Docket No. 14640.0302-00304
[0192] In some embodiments, the AAV particle of the pharmaceutical composition comprises an AAV capsid and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 12 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96% at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the AAV particle of the pharmaceutical composition comprises an AAV capsid and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 12.
[0193] In some embodiments, the AAV particle of the pharmaceutical composition comprises an AAV capsid and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 16 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96% at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the AAV particle of the pharmaceutical composition comprises an AAV capsid and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 16.
[0194] In some embodiments, the AAV particle of the pharmaceutical composition comprises an AAV capsid and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 17 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96% at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the AAV particle of the pharmaceutical composition comprises an AAV capsid and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 17.
[0195] In some embodiments, the AAV capsid is an AAV9 capsid variant.
[0196] Although pharmaceutical compositions provided herein are principally directed to those that are suitable for administration to humans, it will be understood by the skilled artisan that such compositions may be suitable for administration to any other animal, e.g., non-human mammals. Modification of pharmaceutical compositions suitable for administration to humans in order to render the compositions suitable for administration to various non-human animals is well understood, and the ordinarily skilled veterinary pharmacologist can design and / or perform such modification with merely ordinary, if any, experimentation. Subjects to which administration of the pharmaceutical compositions is contemplated include, but are not limited to, humans and / or other primates; mammals, including commercially relevant mammals such as cattle, pigs, horses, sheep, cats, dogs, mice, and / or rats; and / or birds, including commercially relevant birds such as poultry, chickens, ducks, geese, and / or turkeys.Attorney Docket No. 14640.0302-00304
[0197] In some embodiments, pharmaceutical compositions are administered to humans, e.g., human patients or human subjects.
[0198] A pharmaceutical composition in accordance with the present disclosure may be prepared, packaged, and / or sold in bulk, as a single unit dose, and / or as a plurality of single unit doses. As used herein, a “unit dose” refers to a discrete amount of the pharmaceutical composition comprising a predetermined amount of the active ingredient. The amount of the active ingredient is generally equal to the dosage of the active ingredient which would be administered to a subject and / or a convenient fraction of such a dosage such as, for example, one-half or one-third of such a dosage.IV. Formulations
[0199] Formulations of the pharmaceutical compositions described herein may be prepared by any method known or hereafter developed in the art of pharmacology. In general, such preparatory methods include the step of bringing the active ingredient into association with an excipient and / or one or more other accessory ingredients, and then, if necessary and / or desirable, dividing, shaping, and / or packaging the product into a desired single- or multi-dose unit.
[0200] Relative amounts of the active ingredient, the pharmaceutically acceptable excipient(s), and / or any additional ingredients in a pharmaceutical composition in accordance with the disclosure will vary, depending upon the identity, size, and / or condition of the subject treated and further depending upon the route by which the composition is to be administered. For example, the composition may comprise about 0.1% (w / w) to about 100% (w / w) of the active ingredient, e.g., about 0.1% (w / w) to about 99% (w / w), about 0.5% (w / w) to about 50% (w / w), about 1% (w / w) to about 30% (w / w), about 5% (w / w) to about 80% (w / w), or at least 80% (w / w) active ingredient.
[0201] Isolated nucleic acids, recombinant viral genomes, or AAV particles of the disclosure may be formulated using one or more excipients to: (1) increase stability; (2) increase cell transfection or transduction; (3) permit sustained or delayed release; (4) alter biodistribution (e.g., target the active ingredient to one or more specific tissues or cell types); (5) increase the translation of STXBP1 in vivo, (6) alter the release profile of STXBP1 in vivo and / or (7) allow for regulatable expression of STXBP1.
[0202] Formulations of the present disclosure may include, without limitation, saline, lipidoids, liposomes, lipid nanoparticles, polymers, lipoplexes, core-shell nanoparticles, peptides, proteins, cells transfected with viral vectors (e.g., for transplantation into a subject), nanoparticle mimics, and combinations thereof. In some embodiments, an isolated nucleicAttorney Docket No. 14640.0302-00304 acid, recombinant viral genome, or AAV particle of the present disclosure may be formulated using self-assembled nucleic acid nanoparticles.
[0203] In some embodiments, an isolated nucleic acid, recombinant viral genome, or AAV particle of the present disclosure may be formulated to optimize baricity and / or osmolality. In some embodiments, the baricity and / or osmolality of the formulation may be optimized to ensure optimal drug distribution in the central nervous system or a region or component of the central nervous system.
[0204] In some embodiments, a pharmaceutically acceptable excipient of a formulation disclosed herein may be at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% pure. In some embodiments, the pharmaceutically acceptable excipient is approved for use for humans and for veterinary use. In some embodiments, the pharmaceutically acceptable excipient is approved by the United States Food and Drug Administration (FDA). In some embodiments, the pharmaceutically acceptable excipient is of pharmaceutical grade. In some embodiments, the pharmaceutically acceptable excipient meets the standards of the United States Pharmacopoeia (USP), the European Pharmacopoeia (EP), the British Pharmacopoeia, and / or the International Pharmacopoeia.
[0205] Pharmaceutically acceptable excipients, which, as used herein, include, but are not limited to, any and all solvents, dispersion media, diluents, or other liquid vehicles, dispersion or suspension aids, surface active agents, isotonic agents, thickening or emulsifying agents, preservatives, and the like, may be suited to the particular dosage form desired. Various excipients for formulating pharmaceutical compositions and techniques for preparing the composition are known in the art (including but not limited to those provided in Remington: The Science and Practice of Pharmacy, 23rd Edition, A. Adejare, Elsevier Science, 2020; the relevant contents of which are herein incorporated by reference in their entirety). The use of a conventional excipient medium may be contemplated within the scope of the present disclosure, except insofar as any conventional excipient medium may be incompatible with a substance or its derivatives, such as by producing any undesirable biological effect or otherwise interacting in a deleterious manner with any other component(s) of the pharmaceutical composition.
[0206] In some embodiments, a formulation of the present disclosure may comprise at least one excipient which is an inactive ingredient. As used herein, the term “inactive ingredient” refers to one or more agents that do not contribute to the activity of the pharmaceutical composition included in formulations. In some embodiments, all, none, or some of theAttorney Docket No. 14640.0302-00304 inactive ingredients which may be used in the formulations of the present disclosure may be approved by the United States FDA.
[0207] In some embodiments, a formulation of the present disclosure comprises cations or anions. In some embodiments, the formulation includes metal cations such as, but not limited to, Zn2+, Ca2+, Cu2+, Mg+, or a combination thereof. In some embodiments, the formulation may comprise polymers or polynucleotides complexed with a metal cation (see, e.g., U.S. Patent Nos. 6,265,389 and 6,555,525, the relevant contents of each of which are herein incorporated by reference in their entirety).
[0208] In some embodiments, the disclosure provides a formulation of a pharmaceutical composition comprising an adeno-associated virus (AAV) particle comprising an AAV capsid and a viral genome (e.g., recombinant viral genome) comprising an STXBP1 -encoding sequence comprising the nucleotide sequence of SEQ ID NO: 4 or SEQ ID NO: 5 and a WPRE comprising the nucleotide sequence of SEQ ID NO: 8. In some embodiments, the AAV capsid is an AAV9 capsid variant.
[0209] In some embodiments, a formulation of a pharmaceutical composition comprises an AAV particle comprising an AAV capsid and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 11, 12, 16, or 17, or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96% at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, a formulation of a pharmaceutical composition comprises an AAV particle comprising an AAV capsid and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 11, 12, 16, or 17. In some embodiments, the AAV capsid is an AAV9 capsid variant.V. Uses and Applications
[0210] The compositions of the disclosure may be administered to a subject, e.g., to deliver STXBP1, e.g., to a subject who has, has been diagnosed with having, or is at risk of having a STXBP1 -related disorder. In some embodiments, the subject is a human. In some embodiments, the STXBP1 -related disorder is a neurodegenerative or neuromuscular disorder. In some embodiments, the STXBP1 -related disorder is STXBP1 encephalopathy, epileptic encephalopathy, STXBP1 Developmental and Epileptic Encephalopathy (DEE), Ohtahara syndrome, developmental encephalopathy, West syndrome, early myoclonic epileptic encephalopathy, Lennox-Gaustaut syndrome, autism (e.g., autism with STXBP1 mutations and optionally further mutations), Dravet syndrome (not caused by mutations in SCN1 A), or Rett syndrome phenotype (not caused by mutation of MECP2 or CDKL5)). InAttorney Docket No. 14640.0302-00304 some embodiments, the STXBP1 -related disorder is only STXBP1 -related neurodevelopment disabilities without seizures.
[0211] The compositions may similarly be used in the manufacture of a medicament for administration to a subject having a STXBP1 -related disorder (e.g., a STXBP1 -related neurodegenerative or neuromuscular disorder). In some embodiments, the STXBP1 -related disorder is STXBP1 encephalopathy. In some embodiments, the STXBP1 -related disorder is STXBP1 Developmental and Epileptic Encephalopathy (DEE). In some embodiments, the STXBP1 -related disorder is only STXBP1 -related neurodevelopment disabilities without seizures.
[0212] In some embodiments, the disclosure provides a method of delivering STXBP1 to a cell, comprising administering an effective amount of an isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition disclosed herein, thereby delivering STXBP1. In some embodiments, the cell is in a subject.
[0213] In some embodiments, the disclosure provides a method of delivering STXBP1 to a subject, comprising administering to the subject an effective amount of an isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition disclosed herein.
[0214] In some embodiments, delivery is to a cell or tissue of the central nervous system (CNS). In some embodiments, the subject has an STXBP1 -related disorder. In some embodiments, the cell or tissue of the CNS comprises a cell or tissue of the frontal cortex, sensory cortex, motor cortex, caudate, dentate nucleus, cerebellar cortex, cerebral cortex, brain stem, hippocampus thalamus, and / or putamen. In some embodiments, the cell of the CNS is a neuron. In some embodiments, the cell of the CNS comprises a cornu ammonis 1 (CAI) neuron, cornu ammonis 2 (CA2) neuron, cornu ammonis 3 (CA3) neuron, or deep cerebellar nuclei neuron. In some embodiments, the STXBP1 -related disorder is STXBP1 encephalopathy, epileptic encephalopathy, STXBP1 Developmental and Epileptic Encephalopathy (DEE), Ohtahara syndrome, developmental encephalopathy, West syndrome, early myoclonic epileptic encephalopathy, Lennox-Gaustaut syndrome, autism (e.g., autism with STXBP1 mutations and optionally further mutations), Dravet syndrome (not caused by mutations in SCN1 A), or Rett syndrome phenotype (not caused by mutation of MECP2 or CDKL5)). In some embodiments, the STXBP1 -related disorder is STXBP1 encephalopathy. In some embodiments, the STXBP1 -related disorder is STXBP1 DEE. In some embodiments, the STXBP1 -related disorder is only STXBP1 -related neurodevelopment disabilities without seizures.Attorney Docket No. 14640.0302-00304
[0215] In some embodiments, the disclosure provides a method for treating an STXBP1- related disorder such as an STXBP1 -related neurodegenerative or neuromuscular disorder, or for treating at least one symptom of an STXBP1 -related disorder such as an STXBP1 -related neurodegenerative or neuromuscular disorder, comprising administering to a subject an effective amount of an isolated nucleic acid, recombinant viral genome, an AAV particle or pharmaceutical composition disclosed herein. In some embodiments, the STXBP1 -related disorder is STXBP1 encephalopathy, epileptic encephalopathy, STXBP1 Developmental and Epileptic Encephalopathy (DEE), Ohtahara syndrome, developmental encephalopathy, West syndrome, early myoclonic epileptic encephalopathy, Lennox-Gaustaut syndrome, autism (e.g., autism with STXBP1 mutations and optionally further mutations), Dravet syndrome (not caused by mutations in SCN1 A), or Rett syndrome phenotype (not caused by mutation of MECP2 or CDKL5)). The compositions may similarly be used in the manufacture of a medicament for administration to a subject having a STXBP1 -related disorder (e.g., a STXBP1 -related neurodegenerative or neuromuscular disorder). In some embodiments, the STXBP1 -related disorder is STXBP1 encephalopathy. In some embodiments, the STXBP1- related disorder is STXBP1 DEE. In some embodiments, the STXBP1 -related disorder is only STXBP1 -related neurodevelopment disabilities without seizures.
[0216] In some embodiments, the present disclosure provides an isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition disclosed herein for use in a method of treating a disorder as disclosed herein. In some embodiments, the present disclosure provides an isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition disclosed herein for use in a method of treating an STXBP1- related disorder or for treating at least one symptom of an STXBP1 -related disorder.
[0217] In some embodiments, the present disclosure provides a use of an isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition disclosed herein in the manufacture of a medicament for treating an STXBP1 -related disorder or for treating at least one symptom of an STXBP1 -related disorder. In some embodiments, the STXBP1 -related disorder is STXBP1 encephalopathy, epileptic encephalopathy, STXBP1 Developmental and Epileptic Encephalopathy (DEE), Ohtahara syndrome, developmental encephalopathy, West syndrome, early myoclonic epileptic encephalopathy, Lennox-Gaustaut syndrome, autism (e.g., autism with STXBP1 mutations and optionally further mutations), Dravet syndrome (not caused by mutations in SCN1A), or Rett syndrome phenotype (not caused by mutation of MECP2 or CDKL5)). The compositions may similarly be used in the manufacture of a medicament for administration to a subject having a STXBP1 -relatedAttorney Docket No. 14640.0302-00304 disorder (e.g., a STXBP1 -related neurodegenerative or neuromuscular disorder). In some embodiments, the STXBP1 -related disorder is STXBP1 encephalopathy. In some embodiments, the STXBP1 -related disorder is STXBP1 DEE. In some embodiments, the STXBP1 -related disorder is only STXBP1 -related neurodevelopment disabilities without seizures.
[0218] In some embodiments, the subject has, has been diagnosed with having, or is at risk of having a STXBP1 -related disorder such as a STXBP1 -related neurodegenerative or neuromuscular disorder (e.g., STXBP1 encephalopathy, epileptic encephalopathy, STXBP1 Developmental and Epileptic Encephalopathy (DEE), Ohtahara syndrome, developmental encephalopathy, West syndrome, early myoclonic epileptic encephalopathy, Lennox-Gaustaut syndrome, autism (e.g., autism with STXBP1 mutations and optionally further mutations), Dravet syndrome (not caused by mutations in SCN1 A), or Rett syndrome phenotype (not caused by mutation of MECP2 or CDKL5)). In some embodiments, the STXBP1 -related disorder is STXBP1 encephalopathy. In some embodiments, the STXBP1 -related disorder is STXBP1 DEE. In some embodiments, the STXBP1 -related disorder is only STXBP1 -related neurodevelopment disabilities without seizures.
[0219] In some embodiments, the disclosure provides a method of treating STXBP1 encephalopathy or at least one symptom of STXBP1 encephalopathy in a subject. In some embodiments, an isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition disclosed herein may be administered to a subject to treat STXBP1 encephalopathy or at least one symptom thereof. In some embodiments, the subject has, has been diagnosed with having, or is at risk of having STXBP1 encephalopathy. In some embodiments, the subject has, has been diagnosed with having, or is at risk of having STXBP1 DEE. In some embodiments, the STXBP1 -related disorder is only STXBP1 -related neurodevelopment disabilities without seizures.
[0220] In some embodiments, the disclosure provides a method of treating STXBP1 DEE or at least one symptom of STXBP1 DEE in a subject. In some embodiments, an isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition disclosed herein may be administered to a subject to treat STXBP1 DEE or at least one symptom thereof. In some embodiments, the subject has, has been diagnosed with having, or is at risk of having STXBP1 DEE.
[0221] A subject may have one or more mutations in the STXBP1 gene. In some embodiments, the subject has lower STXBP1 activity as compared to STXBP1 activity in an individual who does not have an STXBP1 -related disorder.Attorney Docket No. 14640.0302-00304
[0222] Delivery of a payload construct comprising a STXBP1 -encoding sequence may alleviate or reduce symptoms that result from abnormal level and / or function of a gene product (e.g., an absence or defect in a protein) in a subject in need thereof or that otherwise confers a benefit to a CNS disorder in a subject in need thereof.
[0223] In some embodiments, the treatment may result in prevention of progression of an STXBP1 -related disorder. In some embodiments, treatment may result in prevention of progression of at least one symptom of an STXBP1 -related disorder. As a non-limiting example, progression of the disorder or symptom may be assessed by tests or diagnostic tools known to those skilled in the art or by a change in the pathological features of the brain, CSF, muscle, or other tissues of the subject. In some embodiments, the treatment may result in stabilizing the condition of a subject who has, has been diagnosed with having, or is at risk of having an STXBP1 -related disorder. In some embodiments, the treatment may result in stabilizing the condition of at least one symptom of an STXBP1 -related disorder. In some embodiments, the treatment may result in amelioration (e.g., reducing the severity of) at least one symptom of an STXBP1 -related disorder. In some embodiments, the treatment reverses or partially reverses at least one symptom of an STXBP1 -related disorder. In some embodiments, the treatment may prevent or delay the onset of one or more symptoms of an STXBP1 -related disorder. In some embodiments, the treatment improves at least one symptom of a STXBP1 -related disorder. In some embodiments, the STXBP1 -related disorder is STXBP1 encephalopathy, epileptic encephalopathy, STXBP1 DEE, Ohtahara syndrome, developmental encephalopathy, West syndrome, early myoclonic epileptic encephalopathy, Lennox-Gaustaut syndrome, autism (e.g., autism with STXBP1 mutations and optionally further mutations), Dravet syndrome (not caused by mutations in SCN1 A), or Rett syndrome phenotype (not caused by mutation of MECP2 or CDKL5)). In some embodiments, the STXBP1 -related disorder is STXBP1 encephalopathy, STXBP1 DEE, or an STXBP1 -related neurodevelopment disability without seizures.
[0224] In some embodiments, the at least one symptom comprises epilepsy, autistic features, ataxia, generalized tremors, reduced STXBP1 activity, accumulation of glucocerebroside and other glycolipids, e.g., within immune cells (e.g., macrophages), build-up of synuclein aggregates (e.g., Lewy bodies), developmental delay, progressive encephalopathy, progressive dementia, ataxia, myoclonus, oculomotor dysfunction, bulbar palsy, generalized weakness, trembling of a limb, depression, visual hallucinations, cognitive decline, dystonia, or a combination thereof. In some embodiments, amelioration of at least one symptom and / or prevention of progression of the disorder is assessed by one or more biomarkers in theAttorney Docket No. 14640.0302-00304 subject. In some embodiments, the one or more biomarkers comprises increased release of the neurotransmitter glutamate and / or GABA, reduction in accumulation of neurofilament light chain (e.g., in a biofluid such as cerebrospinal fluid), or reduction in abnormal electroencephalographic activity as evidence of improved STXBP1 activity.
[0225] In some embodiments, the methods disclosed herein further comprise evaluating, e.g., measuring, the level of STXBP1 expression, e.g., STXBP1 gene expression, STXBP1 mRNA expression, and / or STXBP1 protein expression, in the subject, e.g., in a cell, tissue, or fluid of the subject. STXBP1 protein expression may be measured by an enzyme-linked immunosorbent assay (ELISA), a Western blot, or an immunohistochemistry assay. In some embodiments, evaluating the level of STXBP1 expression (e.g., STXBP1 gene expression, STXBP1 mRNA expression, and / or STXBP1 protein expression) is performed before and / or after administration of the AAV particle or pharmaceutical composition, optionally wherein the level of STXBP1 expression (e.g., STXBP1 gene expression, STXBP1 mRNA expression, and / or STXBP1 protein expression) before administration is compared to the level of STXBP1 expression after administration.
[0226] In some embodiments, the level of STXBP1 expression (e.g., STXBP1 gene expression, STXBP1 mRNA expression, and / or STXBP1 protein expression) may be evaluated in a cell or tissue of the CNS. In some embodiments, the cell or tissue of the CNS comprises a cell or tissue of the frontal cortex, sensory cortex, motor cortex, caudate, dentate nucleus, cerebellar cortex, cerebral cortex, brain stem, hippocampus thalamus, and / or putamen. In some embodiments, the cell of the CNS is a neuron. In some embodiments, the cell of the CNS comprises a CAI neuron, CA2 neuron, CA3 neuron, or deep cerebellar nuclei neuron.
[0227] In some embodiments, the level of STXBP1 expression (e.g., STXBP1 gene expression, STXBP1 mRNA expression, and / or STXBP1 protein expression) may be evaluated in a cell of a peripheral tissue (e.g., liver, heart, muscle, or spleen). In some embodiments, the cell of a peripheral tissue is a muscle cell.
[0228] In some embodiments, the subject’s level of STXBP1 expression (e.g., STXBP1 gene expression, STXBP1 mRNA expression, and / or STXBP1 protein expression) after administration is increased relative to the subject’s level of STXBP1 expression (e.g., STXBP1 gene expression, STXBP1 mRNA expression, and / or STXBP1 protein expression) before administration.
[0229] In some embodiments, the administration of an isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition disclosed herein results in anAttorney Docket No. 14640.0302-00304 increase in the level of STXBP1 activity in a cell, tissue, (e.g., a cell or tissue of the CNS, e.g., a cell or tissue of the frontal cortex, sensory cortex, motor cortex, caudate, dentate nucleus, cerebellar cortex, cerebral cortex, brain stem, hippocampus, thalamus, and / or putamen; or a CAI neuron, CA2 neuron, CA3 neuron, or deep cerebellar nuclei neuron), and / or fluid (e.g., CSF and / or serum), of the subject, relative to baseline and / or relative to the level of STXBP1 activity in a cell, tissue, or fluid of an individual with an STXBP1 -related disorder who has not been administered the isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition.
[0230] In some embodiments, the administration of an isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition disclosed herein results in an increase in the level and / or number of viral genomes (VG) per cell in a tissue of the CNS (e.g., a cell or tissue of the frontal cortex, sensory cortex, motor cortex, caudate, dentate nucleus, cerebellar cortex, cerebral cortex, brain stem, hippocampus, thalamus, and / or putamen; or a CAI neuron, CA2 neuron, CA3 neuron, or deep cerebellar nuclei neuron), of the subject relative to the number and / or level of VG per cell in a peripheral tissue of the subject.
[0231] In some embodiments, the administration an isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition disclosed herein results in an increase in the level of STXBP1 mRNA expression in a cell or tissue (e.g., a cell or tissue of the CNS, e.g., a cell or tissue of the frontal cortex, sensory cortex, motor cortex, caudate, dentate nucleus, cerebellar cortex, cerebral cortex, brain stem, hippocampus, thalamus, and / or putamen; or a CAI neuron, CA2 neuron, CA3 neuron, or deep cerebellar nuclei neuron), of the subject relative to baseline and / or relative to the level of STXBP1 mRNA expression in a cell or tissue of an individual with an STXBP1 -related disorder who has not been administered the isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition.
[0232] In some embodiments, a method of delivery or treating provided herein further comprises administering to the subject at least one additional agent and / or therapy suitable for treatment of an STXBP1 -related disorder or at least one symptom thereof. In some embodiments, the at least one additional agent and / or therapy comprises one or more antiepileptic drugs (e.g., bromide, clobazam, felbamate, ganaxolone, lamotrigine, levetiracetam, phenobarbital, topiramate, valproate, or a combination thereof).
[0233] In some embodiments, a method of delivery or treating provided herein further comprises administering to the subject an immunosuppressant. In some embodiments, theAttorney Docket No. 14640.0302-00304 immunosuppressant comprises adrenocorticotropic hormone, a corticosteroid (e.g., prednisone, prednisolone, methylprednisolone, and / or dexamethasone), eculizumab hydroxychloroquine, mycophenolate mofetil, rapamycin, rituximab, and / or tacrolimus.
[0234] In some embodiments, the present disclosure encompasses the delivery of pharmaceutical, prophylactic, diagnostic, or imaging compositions comprising an isolated nucleic acid, recombinant viral genome, or AAV particle disclosed herein, in combination with agents that may improve their bioavailability, reduce and / or modify their metabolism, and / or modify their distribution within the body.
[0235] In some embodiments, the pharmaceutical compositions described herein are used as research tools, particularly in in vitro investigations using human cell lines such as HEK293T and in vivo testing in nonhuman primates which will occur prior to human clinical trials.
[0236] In some embodiments, the disclosure provides a method of delivering (e.g., by intravenous injection) an isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition disclosed herein to a subject for treating an STXBP1 -related disorder (e.g., STXBP1 DEE) or at least one symptom thereof, comprising administering to the subject an effective amount of the isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition, wherein the isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition comprises an STXBP1 -encoding sequence comprising the nucleotide sequence of SEQ ID NO: 4 or SEQ ID NO: 5 and a WPRE comprising the nucleotide sequence of SEQ ID NO: 8.
[0237] In some embodiments, the disclosure provides a method of delivering (e.g., by intravenous injection) an isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition disclosed herein to a subject for treating an STXBP1 -related disorder (e.g., STXBP1 DEE) or at least one symptom thereof, comprising administering to the subject an effective amount of the isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition, wherein the isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition comprises the nucleotide sequence of SEQ ID NO: 11, 12, 16, or 17, or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98, or at least 99%) identical thereto.
[0238] In some embodiments, the disclosure provides a method of delivering (e.g., by intravenous injection) an isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition disclosed herein to a subject for treating an STXBP1 -related disorder (e.g., STXBP1 DEE) or at least one symptom thereof, comprising administering toAttorney Docket No. 14640.0302-00304 the subject an effective amount of the isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition, wherein the isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition comprises the nucleotide sequence of SEQ ID NO: 11, 12, 16, or 17.VI. DeliveryA. Delivery to Cells
[0239] In some aspects, the present disclosure provides a method of delivering to a cell or tissue any of the above-described isolated nucleic acids, recombinant viral genomes, or AAV particles, comprising contacting the cell or tissue with said isolated nucleic acids, recombinant viral genomes, or AAV particles, or contacting the cell or tissue with a formulation comprising said isolated nucleic acids, recombinant viral genomes, or AAV particles, or contacting the cell or tissue with any of the described compositions, including pharmaceutical compositions. In some embodiments, the method of delivering the isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition is an in vitro method of delivering to a cell or tissue. In some embodiments, the method is an in vivo method of delivering to a cell or tissue. In some embodiments, the method is an ex vivo method of delivering to a cell or tissue. In some embodiments, the isolated nucleic acids, recombinant viral genomes, AAV particles, or pharmaceutical compositions are delivered to a cell, tissue, or region of the CNS. In some embodiments, the isolated nucleic acids, recombinant viral genomes, AAV particles, or pharmaceutical compositions are delivered to a cell or tissue of the CNS, e.g., a cell or tissue of the frontal cortex, sensory cortex, motor cortex, caudate, dentate nucleus, cerebellar cortex, cerebral cortex, brain stem, hippocampus, thalamus, and / or putamen; or a CAI neuron, CA2 neuron, CA3 neuron, or deep cerebellar nuclei neuron), and / or fluid (e.g., CSF and / or serum). In some embodiments, the isolated nucleic acids, recombinant viral genomes, AAV particles, or pharmaceutical compositions are delivered to a cell or tissue of the frontal cortex, sensory cortex, motor cortex, caudate, dentate nucleus, cerebellar cortex, cerebral cortex, brain stem, hippocampus, thalamus, and / or putamen. In some embodiments, the AAV particles are delivered to a CAI neuron, CA2 neuron, CA3 neuron, or deep cerebellar nuclei neuron.B. Delivery to Subjects
[0240] In some aspects, the present disclosure additionally provides a method of delivering to a subject, including a mammalian subject, any of the above-described isolated nucleic acids, recombinant viral genomes, AAV particles, or pharmaceutical compositions,Attorney Docket No. 14640.0302-00304 comprising administering to the subject said isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition.
[0241] In some embodiments, delivery bypasses anatomical blockages (e.g., the blood brain barrier).
[0242] In some embodiments, the isolated nucleic acids, recombinant viral genomes, AAV particles, or pharmaceutical compositions may be formulated and delivered to a subject by a route which increases the speed of drug effect as compared to oral delivery.
[0243] In some embodiments, delivery uses intrathecal infusion.
[0244] In some embodiments, delivery uses a bolus infusion.
[0245] In some embodiments, the delivery uses a continuous and / or bolus infusion. Each site of delivery may use a different dosing regimen, or the same dosing regimen may be used for each site of delivery. As a non-limiting example, the sites of delivery may be in the cervical and the lumbar region. As another non-limiting example, the sites of delivery may be in the cervical region. As another non-limiting example, the sites of delivery may be in the lumbar region.
[0246] In some embodiments, the delivery uses a single route of administration.
[0247] In some embodiments, delivery uses a multi-site route of administration. In some embodiments, delivery may be via administration at 2, 3, 4, 5, or more than 5 sites.
[0248] In some embodiments, delivery comprises sustained delivery over a period of minutes, hours, or days. The infusion rate may be changed depending on the subject, distribution, formulation, or another delivery parameter known to those in the art.
[0249] In some embodiments, if continuous delivery (continuous infusion) is used, the continuous infusion may be for 1 hour, 2, hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, 24 hours, or more than 24 hours.
[0250] In some embodiments, the subject’s intracranial pressure may be evaluated prior to administration. The route, volume, concentration of the isolated nucleic acid, recombinant viral genome, or AAV particle, infusion duration and / or vector titer may be optimized based on the intracranial pressure of a subject.
[0251] In some embodiments, delivery uses systemic delivery. In some embodiments, the systemic delivery may be by intravascular administration.Attorney Docket No. 14640.0302-00304
[0252] In some embodiments, delivery uses injection into the CSF pathway. Non-limiting examples of delivery to the CSF pathway include intrathecal and intracerebroventricular administration.
[0253] In some embodiments, delivery uses direct (intraparenchymal) injection into the substance of an organ, e.g., one or more regions of the brain.
[0254] In some embodiments, delivery uses subpial injection into the spinal cord. For example, subjects may be placed into a spinal immobilization apparatus. A dorsal laminectomy may be performed to expose the spinal cord. Guiding tubes and XYZ manipulators may be used to assist catheter placement. Subpial catheters may be placed into the subpial space by advancing the catheter from the guiding tube and AAV particles may be inj ected through the catheter (Miyanohara et al. , Mol Ther Methods Clin Dev. 2016; 3 : 16046). In some embodiments, delivery uses injection into the cervical subpial space. In some embodiments, delivery uses injection into the thoracic subpial space.
[0255] In some embodiments, delivery uses direct injection to the CNS of a subject. In some embodiments, direct injection is intracerebral injection, intraparenchymal injection, intrathecal injection, intra-ci sterna magna injection, or any combination thereof. In some embodiments, direct injection to the CNS of a subject comprises convection enhanced delivery (CED). In some embodiments, administration comprises peripheral injection. In some embodiments, peripheral injection is intravenous injection.
[0256] In some embodiments, delivery to a subject results in an increase in an STXBP1 level in the CNS (e.g., a cell or tissue of the CNS, e.g., the cortex, striatum, thalamus, cerebellum, brainstem, and / or spinal cord, and / or fluid (e.g., CSF and / or serum)) as compared to a baseline level in the subject.
[0257] In some embodiments, delivery to a subject results in an increase in an STXBP1 level in the CNS (e.g., a cell or tissue of the CNS, e.g., the cortex, striatum, thalamus, cerebellum, and / or brainstem), and / or fluid (e.g., CSF and / or serum) of the subject by transducing cells in these CNS regions. Transduction may also be referred to as the number of cells that are positive for STXBP1.
[0258] In some embodiments, delivery of AAV particles comprising a viral genome encoding STXBP1 as described herein to the CNS (e.g., a cell or tissue of the CNS, e.g., a cell or tissue of the frontal cortex, sensory cortex, motor cortex, caudate, dentate nucleus, cerebellar cortex, cerebral cortex, brain stem, hippocampus, thalamus, and / or putamen; or a CAI neuron, CA2 neuron, CA3 neuron, or deep cerebellar nuclei neuron)), and / or fluid (e.g., CSF and / or serum) of the subject by transducing cells in these CNS regions may lead to anAttorney Docket No. 14640.0302-00304 increased expression of STXBP1 in one or more of those regions. In some embodiments, the increased STXBP1 expression may lead to improved survival and / or function of various cell types in these CNS regions and / or improvement of at least one symptom of a STXBP1- related disorder, such as an STXBP1 encephalopathy, epileptic encephalopathy, STXBP1 Developmental and Epileptic Encephalopathy (DEE). Ohtahara syndrome, developmental encephalopathy, West syndrome, early myoclonic epileptic encephalopathy, Lennox-Gaustaut syndrome, autism (e.g., autism with STXBP1 mutations and optionally further mutations), Dravet syndrome (not caused by mutations in SCN1 A), or Rett syndrome phenotype (not caused by mutation of MECP2 or CDKL5).In some embodiments, the increased STXBP1 expression may lead to improved survival and / or function of various cell types in these CNS regions and / or improvement of at least one symptom of STXBP1 DEE.
[0259] In some embodiments, delivery to a subject results in the widespread distribution of STXBP1 throughout the CNS, e.g., by administering an isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition disclosed herein to the thalamus of the subject. In some embodiments, the increased expression of STXBP1 may lead to a stabilization or reduction in at least one symptom of a STXBP1 -related disorder such as epilepsy, autistic features, ataxia, generalized tremors, reduced STXBP1 activity, accumulation of glucocerebroside and other glycolipids, e.g., within immune cells (e.g., macrophages), build-up of synuclein aggregates (e.g., Lewy bodies), developmental delay, progressive encephalopathy, progressive dementia, ataxia, myoclonus, oculomotor dysfunction, bulbar palsy, generalized weakness, trembling of a limb, depression, visual hallucinations, cognitive decline, dystonia, or a combination thereof.C. Administration
[0260] In some embodiments, the present disclosure provides methods comprising administering isolated nucleic acids, viral genomes, AAV particles, or pharmaceutical compositions disclosed herein to a subject in need thereof. In some embodiments, the solated nucleic acids, viral genomes, AAV particles, or pharmaceutical compositions are administered in an amount and a route of administration effective for treating a disease, disorder, and / or condition associated with decreased STXBP1 expression or STXBP1 deficiency or for treating at least one symptom thereof. In some embodiments, the disease, disorder, and / or condition is a STXBP1 -related disorder, such as a STXBP1 -related neurodegenerative or neuromuscular disorder (e.g., STXBP1 encephalopathy, epileptic encephalopathy, STXBP1 Developmental and Epileptic Encephalopathy (DEE). Ohtahara syndrome, developmental encephalopathy, West syndrome, early myoclonic epileptic encephalopathy, Lennox-GaustautAttorney Docket No. 14640.0302-00304 syndrome, autism (e.g., autism with STXBP1 mutations and optionally further mutations), Dravet syndrome (not caused by mutations in SCN1 A), or Rett syndrome phenotype (not caused by mutation of MECP2 or CDKL5)).
[0261] Compositions in accordance with the disclosure may be formulated in unit dosage form for ease of administration and uniformity of dosage. It will be understood, however, that the total daily usage of the compositions of the present disclosure may be decided by the attending physician within the scope of sound medical judgment. The specific therapeutically effective, prophylactically effective, or appropriate imaging dose level for any particular patient will depend upon a variety of factors including the disorder being treated and the severity of the disorder; the activity of the specific compound employed; the specific composition employed; the age, body weight, general health, sex, and diet of the patient; the time of administration, route of administration, and rate of excretion of the specific protein employed; the duration of the treatment; drugs used in combination or coincidental with the specific compound employed; and like factors well known in the medical arts.
[0262] In some embodiments, the desired dosage may be delivered using multiple administrations (e.g., two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, or more administrations). When multiple administrations are employed, split dosing regimens such as those described herein may be used. As used herein, a “split dose” is the division of single unit dose or total daily dose into two or more doses, e.g., two or more administrations of the single unit dose. As used herein, a “single unit dose” is a dose of any therapeutic composition administered in one dose / at one time / single route / single point of contact, i.e., single administration event. In some embodiments, a single unit dose is provided as a discrete dosage form (e.g., a tablet, capsule, patch, loaded syringe, vial, etc.). As used herein, a “total daily dose” is an amount given or prescribed in 24-hour period. It may be administered as a single unit dose. The viral particles may be formulated in buffer only or in a formulation described herein.
[0263] In some embodiments, a pharmaceutical composition described herein can be formulated into a topical, intranasal, pulmonary, intratracheal, or injectable dosage form. In some embodiments, a pharmaceutical composition described herein can be formulated in a dosage form suitable for intravenous, intraocular, intravitreal, intramuscular, intracardiac, intraperitoneal, and / or subcutaneous administration.
[0264] In some embodiments, delivery of the isolated nucleic acids, recombinant viral genomes, AAV particles, or pharmaceutical compositions described herein results in minimalAttorney Docket No. 14640.0302-00304 serious adverse events (SAEs) as a result of the delivery of the isolated nucleic acids, recombinant viral genomes, AAV particles, or pharmaceutical compositions.VII. Combinations
[0265] In some embodiments, the present disclosure encompasses the delivery of pharmaceutical, prophylactic, diagnostic, or imaging compositions, comprising an active agent (e.g., an isolated nucleic acid, recombinant viral genome, AAV particle) described herein in combination with one or more agents that may improve the composition or active agent’s bioavailability, reduce and / or modify their metabolism, modify their distribution within the body, and / or elicit or enhance a therapeutic effect. The combination agent may be, without limitation, a therapeutic, prophylactic, diagnostic, or imaging agent.
[0266] The phrase “in combination with,” is not intended to require that the agents must be administered at the same time and / or formulated for delivery together, although these methods of delivery are within the scope of the present disclosure. Compositions can be administered concurrently with, before, or after one or more other desired therapeutics or medical procedures. In general, each agent will be administered at a dose and / or on a time schedule determined for that agent.
[0267] The therapeutic agents may be approved by the US Food and Drug Administration or may be in clinical trial or at the preclinical research stage. The therapeutic agents may utilize any therapeutic modality known in the art, with non-limiting examples including gene silencing or interference ( / .< ., miRNA, siRNA, RNAi, shRNA), gene editing ( / .< ., TALEN, CRISPR / Cas9 systems, zinc finger nucleases), and gene, protein, or enzyme replacement.
[0268] In some embodiments, the combination agent comprises at least one additional therapeutic agent and / or therapy. In some embodiments, the at least one additional therapeutic agent and / or therapy comprises an agent and / or therapy suitable for treating an STXBP1- related disorder or at least one symptom thereof. In some embodiments, the STXBP1 -related disorder is an STXBP1 -related neurodegenerative or neuromuscular disorder (e.g., STXBP1 encephalopathy, epileptic encephalopathy, STXBP1 Developmental and Epileptic Encephalopathy (DEE). Ohtahara syndrome, developmental encephalopathy, West syndrome, early myoclonic epileptic encephalopathy, Lennox-Gaustaut syndrome, autism (e.g., autism with STXBP1 mutations and optionally further mutations), Dravet syndrome (not caused by mutations in SCN1 A), or Rett syndrome phenotype (not caused by mutation of MECP2 or CDKL5)).
[0269] In some embodiments, the at least one additional therapeutic agent and / or therapy comprises an agent and / or therapy for treating STXBP1 DEE.Attorney Docket No. 14640.0302-00304
[0270] In some embodiments, the at least one additional therapeutic agent and / or therapy comprises one or more anti-epileptic drugs (e.g., bromide, clobazam, felbamate, ganaxolone, lamotrigine, levetiracetam, phenobarbital, topiramate, valproate, or a combination thereof).
[0271] In some embodiments, the at least one additional therapeutic agent and / or therapy comprises an immunosuppressant. In some embodiments, the immunosuppressant may be administered to the subject prior to administration of an isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition described herein. In some embodiments, the immunosuppressant may be administered to the subject simultaneously with administration of an isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition described herein. In some embodiments, the immunosuppressant may be administered to the subject after administration of an isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition described herein. In some embodiments, the isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition is administered to a subject who is receiving or has received an immunosuppressant. In some embodiments, the immunosuppressant comprises a corticosteroid (e.g., prednisone, prednisolone, methylprednisolone, and / or dexamethasone), rapamycin, mycophenolate mofetil, tacrolimus, rituximab, and / or eculizumab hydroxychloroquine. In some embodiments, the corticosteroid comprises prednisone, prednisolone, methylprednisolone, and / or dexamethasone. In some embodiments, the immunosuppressant comprises adrenocorticotropic hormone.VIII. Measurement of Expression
[0272] Expression of STXBP1 from viral genomes may be determined using various methods known in the art such as, but not limited to immunochemistry (e.g., IHC), enzyme- linked immunosorbent assay (ELISA), affinity ELISA, ELISPOT, flow cytometry, immunocytology, surface plasmon resonance analysis, kinetic exclusion assay, liquid chromatography-mass spectrometry (LCMS), high-performance liquid chromatography (HPLC), BCA assay, immunoelectrophoresis, Western blot, SDS-PAGE, protein immunoprecipitation, PCR, and / or in situ hybridization (ISH). In some embodiments, transgenes encoding STXBP1 delivered in different AAV capsids or variants may have different expression levels in dorsal root ganglion (DRG).
[0273] In some embodiments, STXBP1 is detectable by an enzyme-linked immunosorbent assay (ELISA).
[0274] In some embodiments, STXBP1 is detectable by an immunohistochemistry assay.
[0275] In some embodiments, STXBP1 is detectable by Western blot.Attorney Docket No. 14640.0302-00304
[0276] In some embodiments, expression of a STXBP1 gene, mRNA, and / or protein is measured in a cell or tissue of a subject who is receiving or has received an isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition described herein. In some embodiments, the STXBP1 gene, mRNA, and / or protein expression is measured in a cell or tissue of the CNS (e.g., a cell or tissue of the frontal cortex, sensory cortex, motor cortex, caudate, dentate nucleus, cerebellar cortex, cerebral cortex, brain stem, hippocampus, thalamus, and / or putamen; or a CAI neuron, CA2 neuron, CA3 neuron, or deep cerebellar nuclei neuron) of the subject by transducing cells in these CNS regions. In some embodiments, the STXBP1 gene, mRNA, and / or protein expression is measured in a peripheral cell or tissue, such as the heart, kidney, muscle (e.g., quadriceps muscle), pancreas, and / or liver.IX. Kits and DevicesA. Kits
[0277] In some aspects, the present disclosure provides a variety of kits for conveniently and / or effectively carrying out methods of the present disclosure. Typically, kits will comprise sufficient amounts and / or numbers of components to allow a user to perform multiple treatments of a subject(s) and / or to perform multiple experiments.
[0278] Any of the vectors, constructs, or STXBP1 sequences (polypeptides or nucleotides) of the present disclosure may be comprised in a kit. In some embodiments, kits may further include reagents and / or instructions for creating and / or synthesizing compounds and / or compositions of the present disclosure. In some embodiments, kits may also include one or more buffers. In some embodiments, kits of the disclosure may include components for making protein or nucleic acid arrays or libraries and thus, may include, for example, solid supports.
[0279] In some embodiments, kit components may be packaged either in aqueous media or in lyophilized form. The container means of the kits will generally include at least one vial, test tube, flask, bottle, syringe or other container means, into which a component may be placed, and suitably aliquoted. Where there is more than one kit component, (labeling reagent and label may be packaged together), kits may also generally contain second, third or other additional containers into which additional components may be separately placed. In some embodiments, kits may also comprise second container means for containing sterile, pharmaceutically acceptable buffers and / or other diluents. In some embodiments, various combinations of components may be comprised in one or more vial. Kits of the present disclosure may also typically include means for containing compounds and / or compositionsAttorney Docket No. 14640.0302-00304 of the present disclosure, e.g., proteins, nucleic acids, and any other reagent containers in close confinement for commercial sale. Such containers may include injection or blow- molded plastic containers into which desired vials are retained.
[0280] In some embodiments, kit components are provided in one and / or more liquid solutions. In some embodiments, liquid solutions are aqueous solutions, with sterile aqueous solutions being particularly used. In some embodiments, kit components may be provided as dried powder(s). When reagents and / or components are provided as dry powders, such powders may be reconstituted by the addition of suitable volumes of solvent. In some embodiments, it is envisioned that solvents may also be provided in another container means. In some embodiments, labeling dyes are provided as dried powders. In some embodiments, it is contemplated that 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 120, 120, 130, 140, 150, 160, 170, 180, 190, 200, 300, 400, 500, 600, 700, 800, 900, 1000 micrograms or at least or at most those amounts of dried dye are provided in kits of the disclosure. In such embodiments, dye may then be resuspended in any suitable solvent, such as DMSO.
[0281] In some embodiments, kits may include instructions for employing kit components as well the use of any other reagent not included in the kit. Instructions may include variations that may be implemented.B. Devices
[0282] In some embodiments, compounds and / or compositions of the present disclosure may be combined with, coated onto or embedded in a device. Devices may include, but are not limited to, dental implants, stents, bone replacements, artificial joints, valves, pacemakers and / or other implantable therapeutic device.
[0283] The present disclosure provides for devices which may incorporate viral vectors that encode one or more STXBP1 molecules. These devices contain in a stable formulation the viral vectors which may be immediately delivered to a subject in need thereof, such as a human patient.
[0284] Devices for administration may be employed to deliver the viral vectors encoding STXBP1 of the present disclosure according to single, multi- or split-dosing regimens taught herein.
[0285] Methods and devices known in the art for multi-administration to cells, organs, and tissues are contemplated for use in conjunction with the methods and compositions disclosed herein as embodiments of the present disclosure.Attorney Docket No. 14640.0302-00304X. Definitions
[0286] At various places in the present specification, substituents of compounds of the present disclosure are disclosed in groups or in ranges. It is specifically intended that the present disclosure include each and every individual sub-combination of the members of such groups and ranges. The following is a non-limiting list of term definitions.
[0287] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains.
[0288] The articles “a,” “an,” and “the” may mean one or more than one unless indicated to the contrary or otherwise evident from the context. Claims or descriptions that include “or” between one or more members of a group are considered satisfied if one, more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process unless indicated to the contrary or otherwise evident from the context. The disclosure includes embodiments in which exactly one member of the group is present in, employed in, or otherwise relevant to a given product or process. The disclosure includes embodiments in which more than one, or the entire group members are present in, employed in, or otherwise relevant to a given product or process.
[0289] The term “comprising” is intended to be open and permits but does not require the inclusion of additional elements or steps.
[0290] Where ranges are given, endpoints are included. Furthermore, it is to be understood that, unless otherwise indicated or otherwise evident from the context and understanding of one of ordinary skill in the art, values that are expressed as ranges can assume any specific value or subrange within the stated ranges in different embodiments of the disclosure, to the tenth of the unit of the lower limit of the range, unless the context clearly dictates otherwise.
[0291] Active Agent: As used herein, the term “active agent” refers to an agent (e.g., a nucleic acid and / or viral genome) that encodes STXBP1 or comprises or encapsulates said agent (e.g., an AAV particle).
[0292] Adeno-Associated Virus: As used herein, the term “adeno-associated virus” or “AAV” refers to a member of the dependovirus genus or a functional variant thereof. Unless stated otherwise, “AAV” may refer to wildtype (i.e., naturally occurring) AAV or recombinant AAV (e.g., an AAV comprising a variant AAV capsid).
[0293] Adeno-Associated Virus (AAV) Particle'. As used herein, an “AAV particle” refers to a particle (also a “virion”) comprising an AAV capsid, e.g., an AAV capsid variant, and a polynucleotide, e.g., a viral genome, e.g., a recombinant viral genome. The cells may beAttorney Docket No. 14640.0302-00304 mammalian cells, e.g., human cells. In some embodiments, an AAV particle of the present disclosure may be produced recombinantly. An AAV particle may be derived from any serotype, described herein or known in the art, including combinations of serotypes (e.g., “pseudotyped” AAV) or from various genomes (e.g., single stranded or self-complementary). In some embodiments, the AAV particle may be replication defective and / or targeted. In some embodiments, the AAV particle may comprise a peptide present in, e.g., inserted into and / or replacing a wildtype amino acid of, a capsid to enhance tropism for a desired target tissue.
[0294] Administering'. As used herein, the term “administering” refers to providing an agent (e.g., an active agent or pharmaceutical composition) to a subject.
[0295] Amelioration'. As used herein, the term “amelioration” or “ameliorating” refers to a lessening of severity of at least one indicator of a disease, disorder, or condition. For example, in the context of a neurodegenerative disorder, amelioration includes the reduction or stabilization of neuron loss.
[0296] Approximately: As used herein, the term “approximately” or “about,” as applied to one or more values of interest, refers to a value that is within 10% of a stated reference value.
[0297] Baseline: The term “baseline,” when used to describe a measurement in a subject receiving or about to receive a treatment, refers to a measurement made before starting the treatment.
[0298] Capsid: As used herein, the term “capsid” refers to the exterior, e.g., a protein shell, of a virus particle, e.g., an AAV particle, that is substantially (e.g., >50%, >60%, >70%, >80%, >90%, >95%, >99%, or 100%) protein. In some embodiments, the capsid is an AAV capsid comprising an AAV capsid protein described herein, e.g., a VP1, VP2, and / or VP3 polypeptide. The AAV capsid protein can be a wild-type AAV capsid protein or a variant, e.g., a structural and / or functional variant from a wild-type or a reference capsid protein, referred to herein as an “AAV capsid variant.” For example, and without limitation, an AAV capsid variant may refer to at least a VP1 protein, a VP2 protein, or a VP3 protein (e.g., all of the VP1, VP2, and VP3 proteins forming the AAV capsid). In some embodiments, the AAV capsid variant described herein has the ability to encapsulate (i.e., encapsidate) a viral genome (e.g., a recombinant viral genome) and / or is capable of entry into a cell, e.g., a mammalian cell.
[0299] Central Nervous System (CNS): As used herein, “central nervous system” or “CNS” refers to the brain and spinal cord, and sub-structures of the brain and spinal cord. Cells found in the CNS include but are not limited to neurons and sub-types thereof, glial cells (microglia, oligodendrocytes, ependymal cells, and astrocytes), choroid plexus cells, and cells related toAttorney Docket No. 14640.0302-00304 blood vessels and coverings. Non-limiting examples of neurons include sensory neurons, motor neurons, interneurons, unipolar cells, bipolar cells, multipolar cells, pseudounipolar cells, pyramidal cells, basket cells, stellate cells, Purkinje cells, Betz cells, amacrine cells, granule cell, ovoid cell, medium aspiny neurons and large aspiny neurons, GABAergic neurons and / or glutamatergic neurons.
[0300] Corresponding to As used herein, the phrase “corresponding to,” in the context of an amino acid sequence, refers to the location of an amino acid in a reference sequence or the equivalent position in a modified sequence when aligned.
[0301] Effective amount. As used herein, the term “effective amount” or “therapeutically effective amount” of an agent is an amount sufficient to effect beneficial or desired results, e.g., sufficient to effect desired expression, delivery, amelioration of an indicator or symptom, or treatment of a disease, disorder, or condition.
[0302] Excipient. As used herein, the term “excipient” refers to an inactive substance that serves as the vehicle or medium for an active pharmaceutical agent or other active substance.
[0303] Fragment: A “fragment,” as used herein, refers to a contiguous portion of a nucleic acid sequence or an amino acid sequence. A fragment may comprise a functional fragment that retains at least one activity of the reference sequence. For example, fragments of proteins may comprise polypeptides obtained by digesting full-length protein isolated from cultured cells. A fragment may also refer to a truncation (e.g., an N-terminal and / or C-terminal truncation) of a protein or a truncation (e.g., at the 5’ and / or 3’ end) of a nucleic acid. A protein fragment may be obtained by expression of a truncated nucleic acid, such that the nucleic acid encodes a portion of the full-length protein.
[0304] Healthy individual: As used herein, the term “healthy individual” refers to an individual who does not have an STXBP1 -related disorder.
[0305] Identity. As used herein, the term “identity” (or “identical to”) refers to the overall relatedness between polymeric molecules, e.g., between oligonucleotide molecules (e.g., DNA molecules and / or RNA molecules) and / or between polypeptide (e.g., protein) molecules. Calculation of the percent identity of two polynucleotide sequences, for example, may be performed by aligning the two sequences for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second nucleic acid sequences for optimal alignment and non-identical sequences can be disregarded for comparison purposes). The nucleotides at corresponding nucleotide positions are then compared. When a position in the first sequence is occupied by the same nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between theAttorney Docket No. 14640.0302-00304 two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which needs to be introduced for optimal alignment of the two sequences. The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. For example, the percent identity between two nucleotide sequences can be determined using methods such as those described in Computational Molecular Biology, Lesk, A. M., ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, D. W., ed., Academic Press, New York, 1993; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; Computer Analysis of Sequence Data, Part I, Griffin, A. M., and Griffin, H. G., eds., Humana Press, New Jersey, 1994; and Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991; the relevant contents of each of which is incorporated herein by reference in its entirety. For example, the percent identity between two nucleotide sequences can be determined using the algorithm of Myers and Miller (CABIOS, 1989, 4:11- 17), which has been incorporated into the ALIGN program (version 2.0) using a PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4. The percent identity between two nucleotide sequences can, alternatively, be determined using the GAP program in the GCG software package using an NWSgapdna.CMP matrix. Methods commonly employed to determine percent identity between sequences include, but are not limited to those disclosed in Carillo, H., and Lipman, D., SIAM J Applied Math., 48: 1073 (1988); the relevant contents of which are incorporated herein by reference in its entirety. Techniques for determining identity are codified in publicly available computer programs. Computer software to determine homology between two sequences include, but are not limited to, GCG program package, Devereux, J., et al., Nucleic Acids Research, 12(1), 387 (1984)), the Basic Local Alignment Search Tool (BLAST, which includes, e.g., BLASTP for protein sequences and BLASTN for nucleic acid sequences), and FASTAAltschul, S. F. et al., J. Molecular Biol., 215, 403 (1990)), EMBOSS Needle, Clustal Omega, Benchling, and Geneious. In preferred embodiments, sequence identity may be determined using BLAST, Clustal Omega, or EMBOSS Needle. In some embodiments, sequence identity is determined by local alignment. In some embodiments, sequence identity is determined by global alignment.
[0306] Inverted terminal repeat'. As used herein, the term “inverted terminal repeat” or “ITR” refers to a cis-regulatory element for the packaging of polynucleotide sequences into viral capsids.Attorney Docket No. 14640.0302-00304
[0307] Isolated. As used herein, the term “isolated” refers to a substance or entity that is altered or removed from the natural state, e.g., altered or removed from at least some of component with which it is associated in the natural state. For example, a nucleic acid or a peptide naturally present in a living animal is not “isolated,” but the same nucleic acid or peptide partially or completely separated from the coexisting materials of its natural state is “isolated.” An isolated nucleic acid or protein can exist in substantially purified form, or can exist in a non-native environment such as, for example, a host cell. For example, isolated polynucleotides could be part of an AAV particle and / or be part of a composition, and still be isolated in that such AAV particle or composition is not part of the environment in which it is found in nature.
[0308] miRNA binding site: As used herein, a “miRNA binding site” or “miR binding site” refers to an RNA sequence that is bound by a microRNA. The miR binding site is capable of binding, or binds, in whole or in part to a microRNA (miRNA, miR) through complete or partial hybridization. A miR binding site may be encoded or transcribed in series, also referred to as a “miR binding site series,” which includes two or more miR binding sites having the same or a different nucleotide sequence.
[0309] Modification'. As used herein, the term “modification” or “modified,” refers to any substance, compound, or molecule that has been changed in any way. For example, a modification in an amino acid sequence may comprise a substitution (e.g., a conservative substitution), an insertion, and / or a deletion of one or more amino acids in the sequence.
[0310] Neurological disease: As used herein, a “neurological disease” is any disease associated with the central or peripheral nervous system and components thereof (e.g., neurons).
[0311] Operably linked: As used herein, the phrase “operably linked” refers to a functional connection between two or more molecules, constructs, transcripts, entities, moieties or the like.
[0312] Peripheral Nervous System (PNS): As used herein, the term “peripheral nervous system” or “PNS” refers to parts of the nervous system (e.g., nerves and ganglia) outside the brain and spinal cord in a body. Without limitation, the PNS includes cranial nerves, spinal nerves, roots and / or branches of spinal nerves, peripheral nerves, and neuromuscular junctions.
[0313] Position'. The term “position,” as used herein in the context of an amino acid sequence, refers to the location of a particular amino acid or set of amino acids relative to a larger sequence. A position or positions of amino acids may interchangeably be referred to byAttorney Docket No. 14640.0302-00304 an amino acid number or numbers of a reference sequence. Within a sequence, an amino acid position is counted from the V-terminus.
[0314] Preventing'. As used herein, the term “preventing” refers to partially or completely delaying onset of an infection, disease, disorder and / or condition; partially or completely delaying onset of one or more symptoms, features, or clinical manifestations of a particular infection, disease, disorder, and / or condition; partially or completely delaying onset of one or more symptoms, features, or manifestations of a particular infection, disease, disorder, and / or condition; partially or completely delaying progression from an infection, a particular disease, disorder and / or condition; and / or decreasing the risk of developing pathology associated with the infection, the disease, disorder, and / or condition. The term “prevention” or “preventing” of an infection, disease, disorder and / or condition may be considered a subset within the meaning with the term “treatment” or “treating” of the infection, disease, disorder and / or condition.
[0315] Recombinant: As used herein, the term “recombinant” refers to a biomolecule (e.g., nucleic acid or protein), cell, or organism - including but not limited to a nucleic acid, viral genome, and / or AAV particle disclosed herein - that is engineered from and / or contains genetic material from different sources (e.g., from at least two different sources). “Recombinant” may also be used in reference to technologies or laboratory techniques that combine different sources of genetic material.
[0316] Region: As used herein, the term “region” refers to a sequence portion, domain, zone, or general area. Regions may comprise terminal regions. When referring to a protein or protein module, a region may comprise a linear sequence of amino acids within the protein or protein module or may comprise a three-dimensional area. When referring to a polynucleotide, a region may comprise a linear sequence of nucleic acids along the polynucleotide or may comprise a three-dimensional area, secondary structure, or tertiary structure. In some embodiments, regions comprise terminal regions. As used herein, a “terminal region” refers to regions located at the ends or termini of a given agent. In proteins, terminal regions may comprise N- and / or C-termini. N-termini refer to the end of a protein comprising an amino acid with a free amino group (i.e., the start of a protein). C-termini refer to the end of a protein comprising an amino acid with a free carboxyl group. N- and / or C- terminal regions may comprise the N- and / or C-termini as well as neighboring amino acids. When referring to polynucleotides, terminal regions may comprise 5’ and / or 3’ termini. 5’ and / or 3 ’-terminal regions may comprise the 5’ and / or 3 / termini as well as neighboring nucleotides.Attorney Docket No. 14640.0302-00304
[0317] Sample: As used herein, the term “sample” or “biological sample” refers to a subset of tissues, cells, nucleic acids, or a component or part of the body (e.g, a body fluid, including but not limited to blood, mucus, lymphatic fluid, synovial fluid, cerebrospinal fluid, saliva, amniotic fluid, amniotic cord blood, urine, vaginal fluid, and semen).
[0318] Serotype: As used herein, the term “serotype” refers to distinct variations in a capsid of an AAV based on surface antigens which allow epidemiologic classifications of the AAVs at the sub-species level.
[0319] Similarity: As used herein, the term “similarity” refers to the overall relatedness between polymeric molecules, e.g., between polynucleotide molecules (e.g., DNA molecules and / or RNA molecules) and / or between polypeptide molecules. Calculation of percent similarity of polymeric molecules to one another can be performed in the same manner as a calculation of percent identity, except that calculation of percent similarity takes into account conservative substitutions as is understood in the art.
[0320] Spacer: As used herein, a “spacer” is generally any selected nucleic acid sequence of, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length, which is located between two or more consecutive miR binding site sequences. As used herein, spacers may also be more than 10 nucleotides in length, e.g., 20, 30, 40, or 50 or more than 50 nucleotides.
[0321] Subject: As used herein, the term “subject” (or “patient”) refers to any organism to which a composition in accordance with the disclosure may be administered, e.g, for experimental, diagnostic, prophylactic, and / or therapeutic purposes. Similarly, “subject” or “patient” refers to an organism who may seek, who may require, who is receiving, or who will receive treatment or who is under care by a trained professional for a particular disease, disorder, or condition. Typical subjects include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and humans). As used herein, a subject or patient may be susceptible to, suspected of having, or have an STXBP1 -related disorder.
[0322] STXBP 1 -related disorder: As used herein, a “STXBP1 -related disorder” refers to a disease, disorder, or condition in which one or more symptoms is caused by or associated with a deficiency of syntaxin-binding protein- 1 (STXBP 1) in a subject.
[0323] Substantially: As used herein, the term “substantially” refers to the qualitative condition of exhibiting total or near-total extent or degree of a characteristic or property of interest. One of ordinary skill in the biological arts will understand that biological and chemical phenomena rarely, if ever, go to completion and / or proceed to completeness or achieve or avoid an absolute result. The term “substantially” is therefore used herein toAttorney Docket No. 14640.0302-00304 capture the potential lack of completeness inherent in many biological and chemical phenomena.
[0324] Suffering from'. An individual who is “suffering from” a disease, disorder, and / or condition has been diagnosed with or displays one or more symptoms of a disease, disorder, and / or condition.
[0325] Susceptible to: An individual who is “susceptible to” a disease, disorder, and / or condition has not been diagnosed with and / or may not exhibit symptoms of the disease, disorder, and / or condition but harbors a propensity to develop a disease or its symptoms. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition may be characterized by one or more of the following: (1) a genetic mutation associated with development of the disease, disorder, and / or condition; (2) a genetic polymorphism associated with development of the disease, disorder, and / or condition; (3) increased and / or decreased expression and / or activity of a protein and / or nucleic acid associated with the disease, disorder, and / or condition; (4) habits and / or lifestyles associated with development of the disease, disorder, and / or condition; (5) a family history of the disease, disorder, and / or condition; and (6) exposure to and / or infection with a microbe associated with development of the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition will develop the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition will not develop the disease, disorder, and / or condition.
[0326] Target Cell: As used herein, a “target cell” refers to one or more cells of interest. The target cell may be found in vitro, in vivo, in situ, or in the tissue or organ of an organism. The organism may be an animal, preferably a mammal, more preferably a human and most preferably a human subject. In the context of delivery of an AAV particle, a target cell may refer to one or more cells to which the AAV particle is delivered (e.g., preferentially delivered) and / or one or more cells that the AAV particle transduces. A target cell may be comprised in a “target tissue.”
[0327] Therapeutic Agent: The term “therapeutic agent” refers to any agent that, when administered to a subject, elicits a desired biological and / or pharmacological effect.
[0328] Therapeutically Effective Outcome'. As used herein, the term “therapeutically effective outcome” means an outcome that is sufficient in a subject suffering from or susceptible to a disease, disorder, and / or condition, to treat, improve symptoms of, delay progression of symptoms, diagnose, prevent, and / or delay the onset of the disease, disorder, and / or condition.Attorney Docket No. 14640.0302-00304
[0329] Treating'. As used herein, the term “treating” refers to partially or completely alleviating (e.g., alleviating at least one symptom), ameliorating, improving, relieving, delaying onset of, inhibiting or slowing progression of (e.g., stabilizing), reducing severity of, reducing incidence of, and / or preventing one or more symptoms or features of a particular infection, disease, disorder, and / or condition. Treatment may be administered to a subject who does not exhibit signs of a disease, disorder, and / or condition and / or to a subject who exhibits only early signs of a disease, disorder, and / or condition (e.g., a subject exhibiting at least one symptom) for the purpose of decreasing the risk of developing pathology associated with the disease, disorder, and / or condition.
[0330] Unmodified. As used herein, “unmodified” refers to any substance, compound or molecule prior to being changed in any way. Unmodified may, but does not always, refer to the wild-type or native form of a biomolecule or entity. Molecules or entities may undergo a series of modifications whereby each modified product may serve as the “unmodified” starting molecule or entity for a subsequent modification.
[0331] Variant: The term “variant” refers to a polypeptide or polynucleotide that has an amino acid or a nucleotide sequence that has at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) sequence identity to a reference sequence. The variant may be a functional variant. As used herein, the term “functional variant” refers to a polypeptide variant or a polynucleotide variant that differs in sequence from a reference sequence but has at least one activity in common with the reference sequence.
[0332] Viral genome '. As used herein, a “viral genome,” “vector genome,” or “VG” is a polynucleotide comprising at least one nucleotide sequence encoding STXBP1. A viral genome encodes at least one copy of STXBP1. A viral genome may be a recombinant viral genome.EXAMPLESExample 1: hSTXBPl expression is significantly elevated with addition of WPRE in the payload construct
[0333] This example describes the effects of WPRE on expression of hSTXBPl transgene.
[0334] PHP.eB viral particles comprising an hSynl-driven hSTXBPl-WPRE payload (Construct 1 (SEQ ID NO: 11)) were delivered by intravenously (I V.) to wild-type (WT) mice (C57BL / 6J). PHP.eB is an AAV9 variant (see, e.g., US20170166926A1, the relevant contents of which are hereby incorporated by reference in its entirety). The human synapsinAttorney Docket No. 14640.0302-00304(hSyn) promoter is located in the proximal region of the endogenous human SYN1 gene. The promoter drives selective expression in neurons in the CNS and sustained long term transgene expression.
[0335] Male WT mice (group B; n=3) were injected with recombinant viral particles at a high dose carrying Construct 1 (SEQ ID NO: 11) via tail vein at 6 weeks of age. A control group (A) of male WT mice (n=3) were injected with Vehicle (PBS) via tail vein at 38 days of age.
[0336] PHP.eB viral particles comprising a hSyn-driven hSTXBPl payload without WPRE (Construct 8 (SEQ ID NO: 32) and Construct 3 (SEQ ID NO: 13)) were delivered by I.V. to a WT (C57BL / 6J) mice. Male WT mice (group C) were injected with PHP.eB recombinant viral particles carrying Construct 8 (SEQ ID NO: 32) (n=2; 1 early term, at +4 days) and Construct 3 (SEQ ID NO: 13) (n=3), at a high dose, via tail vein at 51 days of age. Table 10 provides the viral genome sequence (i.e., the ITR-to-ITR sequence) of Construct 8.Table 10. Viral Genome of Construct 8Attorney Docket No. 14640.0302-00304
[0337] In each study group, treatment duration was 28 days. In each study, tissue samples were collected and frozen in liquid nitrogen and stored at -80°C. Molecular and histological assays for measurement of vector genomes and transgene expression were conducted. To extract RNA, frozen tissue was homogenized using QIAzol lysis reagent and a bead mill. Lysate was transferred to a new tube, supplemented with chloroform, and centrifuged. The aqueous phase was transferred to a new tube, supplemented with 70% ethanol, and RNA was purified following protocol instructions (i.e., Qiagen RNeasy® Plus Universal Mini Cat. No. 73404). RNA was then stored at -80°C until use. DNAwas extracted. To extract DNA from retained interphase and organic phase layers, a custom extraction buffer was mixed with the samples and centrifuged to generate a new aqueous layer containing total DNA. The aqueous layer was transferred to a new tube, precipitated with 100% isopropanol, and centrifuged. The DNA pellet was washed with two rounds of 75% ethanol, dried at 70°C, resuspended in DNase / RNase-free water and stored at -80°C until use. Vector Genome was quantified via dPCR. DNAwas quantified, adjusted using UltraPure DNase / RNase-free water. DNAwas either digested with Hpall as a separate reaction, or Hpall enzyme was supplemented into dPCR master mix. 1-200 ng of total DNAwas added to each dPCR reaction with primer / probe sets to target mouse TFRC, bGH poly-A sequence, and / or hSyn promoter sequence.
[0338] VG Primer / probes:TFRC (Taqman® Catalog No. 4458366), hSyn A - FWD: GCCTACCTGACGACCGA (SEQ ID NO: 36),Attorney Docket No. 14640.0302-00304 hSyn A - REV: CTCGCCGCATCCTGTTT (SEQ ID NO: 37), hSyn A - PRB: ACCCACTGGACAAGCACCCAA (SEQ ID NO: 38).
[0339] dPCR reactions and detection were performed following standard recommendations from QIAcuity® dPCR system. Vector Genomes / Diploid Genome were calculated. Number of diploid genomes was determined by dividing the copy number of host genomes (i.e., copies of mouse TFRC (transferrin receptor 1) in half. Vector genome per diploid genome (VG / DG) was calculated by dividing vector genome copies (i.e., copies bGH poly-A or hSyn promoter) by the number of diploid genomes. Measurements taken after restriction digestion. Normalization did not alter VG / Host Genome. Gene copies normalized to theoretical 200ng DNA input. Gene copies normalized to measured DNA input. For analysis of transgene expression, RT-qPCR was conducted normalized to hSTXBPl, mSTXBPl, mSDHA, and mGAPDH. Transgene expression histology was conducted with commercially available ACD Bio probes: hSTXBPl (Catalog No. 111151), mSTXBPl (Catalog No. 111710) and DAPI (widely available). Neuronal nuclei were detected using a commercially available antibody against NeuN (abl77487; Abeam).
[0340] Genome quantification of the PHP.eB viral particles comprising hSynl-driven STXBPlwith WPRE (Construct 1 (SEQ ID NO: 11)) revealed vector genomes per diploid genome were comparable to PHP.eB viral particles comprising hSynl-driven hSTXBPl without WPRE (Construct 8 (SEQ ID NO: 32) and Construct 3 (SEQ ID NO: 13)) (FIG. 1A). Despite this comparability in magnitude of vector genomes, hSTXBPl expression and RNA abundance were significantly elevated when WPRE was in the vector construct (Construct 1 (SEQ ID NO: 11)) compared to vector constructs without WPRE (Constructs 8 and 3) (FIG. IB, FIG. 2A, and FIG. 2B). Indeed, Construct 1 (SEQ ID NO: 11) resulted in hSTXBPl expression that was approximately equal to levels of endogenous (WT mouse) STXBP1 (FIG. 2A and FIG. 2B). While the impact of WPRE on post-translation and protein levels was known, it was unexpected that WPRE had a significant impact on the increase and abundance of hSTXBPl RNA.Example 2: PHP.eB-packaged hSTXBPl transduction with multiple promoters in multiple cell types
[0341] This example describes the effects of different promoters on expression of hSTXBPl transgene.
[0342] PHP.eB-packaged hSTXBPl constructs driven by different promoters (Constructs 4, 5, and 9-11, see Table 11) were evaluated via transduction in SH-SY5Y - a human neuroblastoma cell line, and GlutaNeurons - a human iPSC-derived cortical glutamatergicAttorney Docket No. 14640.0302-00304 neuron cell line, for expression of hSTXBPl RNA and protein. Cells were transduced with virus at MOI le5 or le4. Cells were harvested 3-days post-transduction and TaqMan™ qPCR for RNA analysis (as described in Example 1). Myc and EGFP tags were used for visualization purposes.Table 11. Tested ConstructsAttorney Docket No. 14640.0302-00304Attorney Docket No. 14640.0302-00304Attorney Docket No. 14640.0302-00304
[0343] hSTXBPl mRNA expression levels from PHP.eB viral particles comprising hSynl- driven hSTXBPl confirmed that the hSynl promoter is an appropriate driver of expression inAttorney Docket No. 14640.0302-00304 neuronal cell types as shown in FIG. 3 (STXBP1 TaqMan™ qPCR in SH-SY5Y) and FIG. 4 (STXBP1 TaqMan™ qPCR Analysis in iCell GlutaNeurons). Detection of hSTXBPl mRNA expression from CpG-deleted hSTXBPl constructs driven by either the endogenous hSTXBPl promoter (ePro) or the EFl A (eukaryotic translation elongation factor la) promoter may have been impacted by the sensitivity or effectiveness of the probe used in this study.Example 3: hSTXBPl mRNA is expressed in neurons of target brain regions in vivo
[0344] This example describes the expression of hSTXBPl mRNA when hSTXBPl transgene is delivered to the brain with an AAV particle.
[0345] PHP.eB viral particles comprising hSynl-driven STXBP1-WPRE (Construct 1 (SEQ ID NO: 11)) were generated and administered intravenously at a high dose in wild-type mice (C57BL6 / J) to explore biodistribution in the brain. Control mice were injected with PBS. Wide biodistribution of hSTXBPl mRNA in the brain was found after BaseScope™ Duplex Fluorescent ISH (in situ hybridization) / IF by ACD was performed. Transgene expression histology was conducted with commercially available probes (ACD) and reagents referenced in Example 1 : hSTXBPl, mSTXBPl and mNeuN (Abeam), and DAPI: Nuclei. No transgene expression was found in WT mice not injected with the vector (PBS-injected WT mice), confirming the specificity of the in situ probe (FIG. 5, lower panel). Double staining with neuN confirmed substantial overlap between hSTXBPl vector-induced STXBP1 overexpression in neurons (FIG. 5, top / bottom right panels). In contrast, wide-spread expression of mSTXBPl was seen in WT mouse injected with PBS injected) (FIG. 5, bottom left panel).
[0346] BaseScope™ ISH confirmed percentage of neurons (and types of neurons) that express hSTXBPl. Quantitation revealed that Construct 1 (SEQ ID NO: l l)-induced hSTXBPl was expressed from 60%-80% of the neurons (FIG. 6, left and middle graphs). Graph labels in FIG. 6 are as follows indicating neuronal cell types: CTX: cortex, CAI: Cornu ammonis 1, CA2: Cornu ammonis 2, CA3: Cornu ammonis 3, DG: Dentate gyrus, STR: Striatum, Thai: Thalamus, DCN: Deep cerebellar nuclei, CB: Cerebellum. Veh = vehicle (control). BaseScope™ ISH also confirmed that mRNA mSTXBPl was found in almost all neurons (FIG. 6, right graph). This provides evidence of a functional hSTXBPl cargo.Attorney Docket No. 14640.0302-00304Example 4: PHP.eB-packaged hSTXBPl payload increases mEPSC frequency and neurotransmitter release in iPSC-derived glutamate neurons - in vitro
[0347] This example provides effects on neurotransmitter release by an hSTXBPl transgene when delivered by an AAV particle.
[0348] iPSC-derived glutamatergic neurons were co-cultured with astrocytes. PHP.eB AAV particles comprising hSynl-driven STXBP1-WPRE (Construct 1 (SEQ ID NO: 11)) were generated and used to transduce the iPSCs. mEPSC (miniature excitatory post-synaptic current) was recorded with electrodes 17-18 days after transduction. mEPSC measures the spontaneous excitatory inputs the recorded neuron receives from other neurons. Higher frequency of mEPSC suggests higher spontaneous synaptic activity in hSTXBPl overexpression. STXBP1 is involved in neurotransmitter release because it is an integral part of the machinery that releases neurotransmitters. In patients afflicted with STXBP1 -related disorders, only up to 50% of a patient’s neurotransmitters are intact and an increase of neurotransmitter release would be a desired functional effect of treatment. As FIG. 7 shows, the frequency of the mEPSC excitatory post-synaptic currents was significantly increased in the transduced iPSC-derived glutamate neurons relative to control (Ctrl), providing evidence of the functional effect of Construct 1 in neurotransmitter release.Example 5: PHP.eB-packaged hSTXBPl payload increases excitatory synaptic transmission in WT mice
[0349] This example provides effects on excitatory synaptic transmission in wild-type (WT) mice by an hSTXBPl transgene when delivered by an AAV particle. PHP.eB viral particles comprising hSyn-driven STXBP1-WPRE-EGFP (Construct 10 (SEQ ID NO: 34) with Myc and p2A-EGFP linker / tags for visual purposes) were generated and administered I.V at a high dose in wild-type mice (C57BL6 / J). Control mice were injected with PBS. Tissue from neocortex was collected and patch-clamp ex vivo electrophysiology in somatosensory cortex SI layer V pyramidal neurons was performed. Results in FIG. 8A, FIG. 8B, and FIG. 8C show STXBP1 overexpression increased the frequency of excitatory synaptic transmission events and glutamate neuron release in the WT mice treated with PHP.eB viral particles carrying Construct 10 (SEQ ID NO: 34), demonstrating functional efficacy of the hSTXBPl payload in vivo. The hSTXBPl payload in Construct 1 (SEQ ID NO: 11) is the same as the hSTXBPl payload in Construct 10, without the addition of the Myc and GFP tags and linkers.Attorney Docket No. 14640.0302-00304Example 6: PHP.eB-packaged hSTXBPl payload efficacy in mutant mouse model for STXBPl-related disorder
[0350] This example provides effects of an hSTXBPl transgene when delivered by an AAV particle in a mutant mouse model for STXBPl-related disorder. STXBP1 encodes STXBP1 (also known as MUNC18-1), regulating synaptic vesicle fusion and early process of neurotransmitter release via SNARE complex, synaptic plasticity, neuroendocrine release (e.g., thyroxine, insulin). STXBP1 is expressed in the brain, spinal cord, retina, cerebellum, and highly enriched in axons. Loss of function haploinsufficiency results in STXBP1 encephalopathy with severe early onset epilepsy with unremitting epileptic activity + developmental delay and movement disorders.
[0351] Heterozygous (Het) STXBP1-KO (referred herein as mutant mice) display impaired glut / GABA transmission, increased anxiety, impaired emotional learning, but modest seizure phenotype (Chen et al. STXBP1 / Muncl8-1 haploinsufficiency impairs inhibition and mediates key neurological features of STXBP1 encephalopathy, ELife, 2020; 9:e48705; Kovacevic et al., Protein instability, haploinsufficiency, cortical hyper-excitability underlie STXBP1 encephalopathy, Brain, 2018; 144: 1350-1374). This mutant mouse model is used for the study of therapies to restore STXBP1 -regulated synaptic vesicle fusion and neurotransmitter release.
[0352] Adult mice were dosed with PHP.eB AAV particles comprising hSyn-driven STXBP1-WPRE (Construct 1 (SEQ ID NO: 11)) at 11 weeks post-natal. EEG (electroencephalogram) implantation was at 6-7 weeks. I. V. dosing (at high and low dose) was at 11 weeks of age. EEG recording was at 9 and 15 weeks. Vehicle mice were treated with PBS. The study design is shown in Table 12.Table 12. Study Design: Adult Mutant Mice StudyAttorney Docket No. 14640.0302-00304
[0353] EEG analysis was conducted at 16-17 weeks. The hallmark of abnormality of epileptic activity is by spike-wave discharges (SWDs). Active and resting states of the mutant mice were recorded. SWDs were almost absent in PBS-treated WT mice, while mutant PBS- treated mice had up to 20 SWDs per hour. When dosed with AAV viral particles carrying Construct 1 (SEQ ID NO: 11), mutant mice showed powerful reduction in frequency of SWDs at both low and high dose as shown in FIG. 9, providing evidence that Construct 1 normalizes EEG SWDs.
[0354] Behavior testing at 16-17 weeks using the contextual fear conditioning memory model was conducted. PBS-treated WT mice remembered foot shock and froze with the expectation of foot shock, while PBS-treated mutant mice had no freezing behavior. The results show that mutant mice treated with I. V. -delivered AAV particles carrying Construct 1 (SEQ ID NO: 11) spent less time freezing. This provides evidence of restoring memory due to the release of more glutamate. The results also show that the freezing behavior was normalized with high dose of the payload, providing evidence of a dose-dependent reversal of the memory deficit in these mutant mice (FIG. 10).
[0355] Home-cage assessment of anxiety-like behavior and the hind limbing clasping test were conducted at 16-17 weeks of age. Anxiety -like behavior of the mice was assessed using the PhenoTyper (Noldus Information Technology) home-cage monitoring system over three days. The cumulative number of visits to OnShelter zone during the dark phase (OnShelter zone number - dark) was determined as a surrogate indicator of anxiety-like behavior in mice. The hind limb clasping test measures motor deficits, including dystonia and spasticity, in mice. The mice were suspended by the tail, with their ventral side to a camera. The proportion of total time spent clasping the hind limbs over the total recording time (% of time spent clasping) is determined. The results show that mutant mice treated with I. V. -delivered AAV particles carrying Construct 1 (SEQ ID NO: 11), at both low and high dose, normalized the hind limb clasping behavior to wild-type levels. This provides evidence of ameliorated anxiety-like behavior (FIG. HA) and motor function dystonia (FIG. 11B). ISH data confirmed that greater than 80% neocortex neurons were targeted in the mutant mice by the PHP.eB AAV viral particles carrying Construct 1 (SEQ ID NO: 11) (FIG. 12A and FIG.12B) LD = low dose; HD = high dose.
[0356] A study was also conducted in juvenile mutant mice. The study design is shown in Table 13.Attorney Docket No. 14640.0302-00304Table 13. Study Design: Juvenile Mutant Mice Study (Animals dosed at postnatal day (PND) 18-20)
[0357] Behavior testing at 8-9 weeks using the contextual fear conditioning memory model was conducted in the juvenile mice. PBS-treated WT mice remembered foot shock and froze with the expectation of foot shock, while PBS-treated mutant mice had no freezing behavior. The results showed that mutant juvenile mice treated with I.V. PHP.eB AAV particles carrying Construct 1 (SEQ ID NO: 11) spent less time freezing. This provides evidence of restoring memory due to the release of more glutamate. The results also show that the freezing behavior was normalized at both low dose and high dose of the payload (FIG. 13).
[0358] Home-cage assessment of anxiety-like behavior test and the hind limbing clasping test were conducted at 8-9 weeks of age. The results show that mutant juvenile mice treated with I.V. AAV particles carrying Construct 1 (SEQ ID NO: 11), at both low and high dose, normalized the anxiety-like behavior (FIG. 14A) and motor function dystonia (FIG. 14B). This provides evidence of ameliorated anxiety-like behavior and motor function dystonia.Example 7: hSTXBPl protein analysis in mutant payload-treated mice
[0359] This example provides analysis of hSTXBPl protein level from an hSTXBPl transgene when delivered by an AAV particle in a mutant mouse.
[0360] Tissue samples (collected 4 weeks post-injection) from WT mice (PBS-treated) and mutant mice groups (treated as in above studies) were analyzed for hSTXBPl protein via MSD (Meso Scale Discovery). MSD assay, according to standard protocol, was performed in a 96 well format with overnight capture antibody coating. The following day protocol steps included 1 hr blocking, 1 hr sample incubation, 1 hr detection antibody incubation, 1 hr antispecies SULFO tag incubation and then plate was read. Protein values were interpolated from a recombinant standard curve. Capture Ab was Mouse monoclonal anti-STXBPl (Abnova,Attorney Docket No. 14640.0302-00304H00006812-M01), Detection Ab was Rabbit polyclonal anti-STXBPl (Invitrogen, PAS- 30183). Recombinant STXBP1 protein (SinoBiological, 11751-H20B) was used to generate the standard curve.
[0361] In mutant mice, the protein analysis results showed that PHP.eB AAV particles comprising Construct 1 (SEQ ID NO: 11) normalized STXBP1 protein to WT levels at a low dose and drives STXBP1 expression 67% over WT levels at a high dose (FIG. 15).Example 8: hSTXBPl mRNA and protein analysis of AAV viral particles comprising payload in treated heterozygous STXBP1 mutant mice
[0362] This example provides analysis of hSTXBPl mRNA and protein levels from an hSTXBPl transgene when delivered by an AAV particle to adult heterozygous STXBP1 mutant mice. The study was performed on samples obtained from Groups 1-4 in Example 6, Table 12.
[0363] Brain hemisphere samples (excluding cerebellum) were collected for STXBP1 protein analysis by MSD generally according to standard protocol and Example 7.
[0364] Viral transduction efficiency and viral transgene expression were determined using a custom dPCR assay on total extracted DNA and on cDNA made from reverse transcription of total extracted RNA, respectively. Total DNA was extracted from treated mouse brain tissue and quantified using primer / probe sets to recognize vector genomes and host genomes. The resulting number of host genomes were divided in half to yield the number of diploid genomes (DG) and the number of vector genomes (VG) were then divided by the number of diploid genomes. Viral transgene expression was determined using a custom dPCR assay. Total RNA was extracted from treated mouse brain tissue and converted to cDNA via a reverse transcriptase reaction. cDNA was then quantified using primer / probe sets to recognize the coding sequence of the hSTXBPl, mSTXBPl, and a mouse housekeeping gene. The level of human and mouse STXBP1 expression was normalized relative to the housekeeping gene and then the amount of hSTXBPl was divided by the amount of mSTXBPl. VG Primer / probes: TFRC (Taqman® Catalog No. 4458366), hSyn A- FWD: GCCTACCTGACGACCGA (SEQ ID NO: 44), hSyn A - REV: CTCGCCGCATCCTGTTT (SEQ ID NO: 45), hSyn A- PRB: ACCCACTGGACAAGCACCCAA (SEQ ID NO: 46). Expression primer / probes: hSTXBPl (FAM) (Catalog No. Hs01119037_ml), mSTXBPl (HEX) qMmuCIP0041917, GAPDH (mouse housekeeping gene Glyceraldehyde-3 -phosphate dehydrogenase (TEX) - Catalog No. qMmuCEP0039581), Tbp (Tata box binding protein - Catalog No. qMmuCIP0042759), B2M (housekeeping gene mouse Beta-2 microglobulin - Catalog No. qMmuCIP0042770).Attorney Docket No. 14640.0302-00304
[0365] FIG. 16A shows viral genome level (vg / kg) in wild type and heterozygous mutant mice injected with vehicle (PBS) and PHP.eB viral particles carrying Construct 1 (SEQ ID NO: 11) at low and high doses, showing a dose-dependent increase in viral particle uptake per cell in the bulk brain tissue. FIG. 16B shows mouse STXBP1 cDNA ratio in heterozygous mutant and wild type mice injected with vehicle (PBS) and PHP.eB viral particles carrying Construct 1 at low and high doses, showing approximately 40% reduction in mSTXBPl mRNA in the heterozygous mutant mice. FIG. 16C shows human STXBPl / mouse STXBP1 cDNA ratios in wild type and heterozygous mutant mice injected with vehicle (PBS) and PHP.eB viral particles carrying Construct 1 at low and high doses, showing dose-dependent hSTXBPl mRNA expression after delivery of the payload. FIG. 16D shows STXBP1 protein levels in wild type and heterozygous mutant mice injected with vehicle (PBS) and PHP.eB viral particles carrying Construct 1 at low and high doses, showing approximately 33% (low dose) and approximately 60% (high dose) higher STXBP1 protein expression in the mutant animals that were administered viral particles carrying Construct 1. The results show a dose-dependent increase in transduction and hSTXBPl mRNA and protein expression in the bulk brain tissue of heterozygous STXBP1 knockout mutant mice that were administered viral particles carrying Construct 1.Example 9: Delivery of hSTXBPl payload in vivo leads to STXBP1 expression in neurons of target brain regions
[0366] This example describes the evaluation of hSTXBPl expression when hSTXBPl transgene is delivered to the brain with an AAV particle to juvenile and adult heterozygous STXBP1 mutant mice.
[0367] The study included the following: for juvenile (3 week old) mice, Group 1 : PBS (n=2, juvenile wild type C57BL6 mice); Group 2: PBS (n=3, juvenile Heterozygous (HET) STXBP1-KO (referred herein as mutant mice)); Group 3: PHP.eB viral particles carrying Construct 1 (n=13 juvenile HET mutant mice) - I.V tail vein: low dose (LD); Group 4: PHP.eB viral particles carrying Construct 1 (n=16 juvenile HET mutant mice) - I.V. tail vein: high dose (HD). For adult mice, Group 5: PBS (n=6, adult wild type C57BL6 mice); Group 6: PBS (n=6, adult HET mutant mice; Group 7: PHP.eB viral particles carrying Construct 1 (SEQ ID NO: 11) (n=12 adult HET mutant mice) - I.V. tail vein: lowest dose (LLD); Group 8: PHP.eB viral particles carrying Construct 1 (n=7 adult HET mutant mice) - I.V. tail vein: low dose (LD); Group 9: PHP.eB viral particles carrying Construct 1 (n=9 adult HET mutant mice) - I.V. tail vein: high dose (HD). Biodistribution of hSTXBPl expression was assessedAttorney Docket No. 14640.0302-00304 using BaseScope™ Duplex Fluorescent ISH (in situ hybridization) / IF and quantitated, generally as described in Examples 1 and 3 above.
[0368] No transgene expression was found in WT or Het mutant mice not injected with the viral particles (WT Vehicle and HET Vehicle), confirming the specificity of the in situ probe (FIG. 17A). Double staining with neuN confirmed substantial overlap between hSTXBPl vector-induced STXBP1 overexpression in neurons (FIG. 17A, PHP.eB at low or high doses).
[0369] BaseScope™ ISH confirmed percentage of neurons that express hSTXBPl in juvenile and adult mutant mice. Quantitation revealed that hSTXBPl (from Construct 1 (SEQ ID NO: 11)) was expressed from over 56% of neurons in the cortex (FIG. 17B) and over 35% of neurons in the hippocampus (FIG. 17C), in both adult juvenile and adult Het STXBP1 mutant mice at low or high dose. This provides evidence of a neuron-targeted delivery of the cargo and increase in STXBP1 expression as delivered by PHP.eB viral particles in juvenile and adult STXBP1 heterozygous subjects.Example 10: hSTXBPl payload reverses the reduction in inhibitory synaptic transmission in STXBP1 heterozygous mutant mice
[0370] This example provides effects on excitatory and inhibitory synaptic transmission in a wild-type (WT) and adult heterozygous STXBP1 mutant mice by an hSTXBPl transgene when delivered by an AAV particle.
[0371] Adult mice were administered PHP.eB particles comprising Construct 1 (SEQ ID NO: 11), intravenously (I. V), or with vehicle (PBS) at a high dose. The study design is shown in Table 14. Acute slice tissue electrophysiology was performed on tissue from neocortex collected from the mice obtained four weeks after administration. CSF, blood, tissues, remaining brain tissue were collected from the mice prior to performing the electrophysiology experiments, and mSTXBPl mRNA and STXBP1 protein levels were determined, generally as described in the previous Examples.Table 14. Study Design: Adult Mutant Mice StudyAttorney Docket No. 14640.0302-00304
[0372] Results in FIG. 18A (mSTXBPl mRNA) confirm that in the STXBP1 heterozygous mutant mice, mouse STXBP1 mRNA levels are reduced to approximately 50% of the WT levels. FIG. 18B shows that STXBP1 protein levels of STXBP1 heterozygous mutant mice are reduced to approximately 45% of the STXBP1 protein levels observed in WT mice, and the administration of PHP.eB viral particles comprising Construct 1 leads to STXBP1 protein levels that are higher than the STXBP1 protein levels of WT mice.
[0373] Ex vivo whole cell patch-clamp electrophysiology in somatosensory cortex SI layer II / III pyramidal neurons was performed in the presence of tetrodoxin, which blocks action potential from neighboring neurons and allows the measurement of excitatory signal (E; measured as miniature excitatory post-synaptic current (mEPSC)) and inhibitory signal (I; measured as miniature inhibitory post-synaptic current (mIPSC)) in the same neuron by changing the potential at which the neurons are held. The mEPSC and mIPSC were measured, and the E / I ratio (frequency of mEPSCs divided by the frequency of mIPSCs), an important parameter for seizure activity, was determined. Results in FIG. 18C, FIG. 18D and FIG. 18E show that neurons from STXBP1 heterozygous mutant mice show a reduction in inhibitory synaptic transmission and an increase in the E / I ratio, and administration of viral particles delivering hSTXBPl transgene in vivo leads to reversal of the reduction in inhibitory synaptic transmission (as shown in FIG. 18D) and reversal of the increase in E / I ratio (as shown in FIG. 18E), demonstrating functional efficacy of the hSTXBPl payload in vivo.
Claims
Attorney Docket No. 14640.0302-00304Claims1. An isolated nucleic acid comprising a syntaxin-binding protein 1 (STXBPl)-encoding sequence and a woodchuck hepatitis virus posttranscriptional regulatory element (WPRE).
2. The isolated nucleic acid of claim 1, wherein the STXBP1 -encoding sequence is a human STXBP1 -encoding sequence.
3. The isolated nucleic acid of claim 1 or claim 2, wherein the STXBP1 -encoding sequence encodes an STXBP1 comprising the amino acid sequence of SEQ ID NOs: 3 or any one of SEQ ID NOs: 18-29.
4. The isolated nucleic acid of any one of claims 1-3, wherein the STXBP1 -encoding sequence encodes an STXBP1 comprising the amino acid sequence of SEQ ID NO: 3.
5. The isolated nucleic acid of any one of claims 1-3, wherein the STXBP1 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 4 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.
6. The isolated nucleic acid of any one of claims 1-5, wherein the STXBP1 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 4.
7. The isolated nucleic acid of any one of claims 1-4, wherein the STXBP1 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 5 or a nucleotide sequence that is at least 96% (e.g., at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.
8. The isolated nucleic acid of claim 7, wherein the STXBP1 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 5.
9. The isolated nucleic acid of any one of claims 1-8, wherein the WPRE is positioned 3’ relative to the STXBP1 -encoding sequence.Attorney Docket No. 14640.0302-0030410. The isolated nucleic acid of any one of claims 1-9, wherein the WPRE comprises the nucleotide sequence of SEQ ID NO: 8 or any one of SEQ ID NOs: 39-43, or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.
11. The isolated nucleic acid of any one of claims 1-10, wherein the WPRE comprises the nucleotide sequence of SEQ ID NO: 8.
12. The isolated nucleic acid of any one of claims 1-11, further comprising a promoter operably linked to the STXBP1 -encoding sequence.
13. The isolated nucleic acid of claim 12, wherein the promoter is a human synapsin 1 (hSYNl) promoter, a human elongation factor 1 alpha promoter (EFla) promoter, or an endogenous STXBP1 promoter (ePro).
14. The isolated nucleic acid of claim 13, wherein the promoter is a hSYNl promoter.
15. The isolated nucleic acid of any one of claims 12-14, wherein the promoter comprises the nucleotide sequence of SEQ ID NO: 7 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.
16. The isolated nucleic acid of any one of claims 12-15, wherein the promoter comprises the nucleotide sequence of SEQ ID NO: 7.
17. The isolated nucleic acid of any one of claims 1-16, further comprising a polyadenylation (poly A) sequence.
18. The isolated nucleic acid of claim 17, wherein the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 9 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.
19. The isolated nucleic acid of claim 17 or claim 18, wherein the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 9.Attorney Docket No. 14640.0302-0030420. The isolated nucleic acid of any one of clams 1-19, further comprising at least one inverted terminal repeat (ITR).
21. The isolated nucleic acid of claim 20, wherein the at least one ITR comprises a 5’ ITR and a 3 ’ ITR.
22. The isolated nucleic acid of claim 21, wherein the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 6 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.
23. The isolated nucleic acid of claim 21 or claim 22, wherein the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 6.
24. The isolated nucleic acid of any one of claims 21-23, wherein the 3’ ITR comprises the nucleotide sequence of SEQ ID NO: 10 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical thereto.
25. The isolated nucleic acid of any one of claims 21-24, wherein the 3’ ITR comprises the nucleotide sequence of SEQ ID NO: 10.
26. The isolated nucleic acid of any one of claims 1-25, further comprising a nucleotide sequence encoding one or more microRNA (miR) binding sites, optionally wherein the one or more miR binding sites reduces or prevents expression of STXBP1 in dorsal root ganglia.
27. The isolated nucleic acid of claim 26, wherein the one or more miR binding sites comprises one, two, three, or four miR183 binding sites.
28. The isolated nucleic acid of claim 26 or claim 27, comprising a nucleotide sequence encoding four miR183 binding sites, optionally wherein the four miR183 binding sites are identical.
29. The isolated nucleic acid of claim 28, wherein each of the four miR183 binding sites is encoded by a nucleotide sequence comprising the nucleotide sequence of SEQ ID NO: 1.Attorney Docket No. 14640.0302-0030430. The isolated nucleic acid of claim 29, wherein each of the four miR183 binding sites is encoded by the nucleotide sequence of SEQ ID NO: 1.
31. The isolated nucleic acid of any one of claims 27-30, wherein the miR183 binding sites are separated by a spacer, optionally wherein the spacer is encoded by the nucleotide sequence GATAGTTA.
32. The isolated nucleic acid of any one of claims 1-25, further comprising a nucleotide sequence encoding a microRNA183 (miR183) binding site series, wherein the nucleotide sequence encoding the miR183 binding site series comprises the nucleotide sequence of SEQ ID NO: 2 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.
33. The isolated nucleic acid of claim 32, wherein the miR183 binding site series is encoded by a nucleotide sequence comprising the nucleotide sequence of SEQ ID NO: 2.
34. The isolated nucleic acid of claim 33, wherein the miR183 binding site series is encoded by the nucleotide sequence of SEQ ID NO: 2.
35. An isolated nucleic acid comprising, in 5’ to 3’ order: a) a 5’ inverted terminal repeat (ITR); b) a promoter; c) a syntaxin-binding protein 1 (STXBPl)-encoding sequence; d) a woodchuck hepatitis virus posttranscriptional regulatory element (WPRE); e) a polyadenylation (poly A) sequence; and f) a 3’ ITR.
36. The isolated nucleic acid of claim 35, wherein: a) the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 6 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto;Attorney Docket No. 14640.0302-00304 b) the promoter comprises the nucleotide sequence of SEQ ID NO: 7 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; c) the STXBP1 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 4 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; d) the WPRE comprises the nucleotide sequence of SEQ ID NO: 8 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; e) the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 9 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and / or f) the 3’ ITR comprises the nucleotide sequence of SEQ ID NO: 10 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.
37. The isolated nucleic acid of claim 35 or claim 36, wherein: a) the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 6 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; b) the promoter comprises the nucleotide sequence of SEQ ID NO: 7 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; c) the STXBP1 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 4 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; d) the WPRE comprises the nucleotide sequence of SEQ ID NO: 8 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; e) the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 9 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; andAttorney Docket No. 14640.0302-00304 f) the 3’ ITR sequence comprises the nucleotide sequence of SEQ ID NO: 10 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.
38. The isolated nucleic acid of any one of claims 35-37, wherein: a) the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 6 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; b) the promoter comprises the nucleotide sequence of SEQ ID NO: 7 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; c) the STXBP1 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 4 or SEQ ID NO: 5; d) the WPRE comprises the nucleotide sequence of SEQ ID NO: 8 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; e) the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 9 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and f) the 3’ ITR sequence comprises the nucleotide sequence of SEQ ID NO: 10 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.
39. The isolated nucleic acid of any one of claims 35-38, wherein: a) the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 6 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; b) the promoter comprises the nucleotide sequence of SEQ ID NO: 7 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; c) the STXBP1 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 4 or SEQ ID NO: 5; d) the WPRE comprises the nucleotide sequence of SEQ ID NO: 8;Attorney Docket No. 14640.0302-00304 e) the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 9 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and f) the 3’ ITR sequence comprises the nucleotide sequence of SEQ ID NO: 10 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.
40. The isolated nucleic acid of any one of claims 35-39, wherein: a) the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 6 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; b) the promoter comprises the nucleotide sequence of SEQ ID NO: 7; c) the STXBP1 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 4 or SEQ ID NO: 5; d) the WPRE comprises the nucleotide sequence of SEQ ID NO: 8; e) the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 9 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and f) the 3’ ITR sequence comprises the nucleotide sequence of SEQ ID NO: 10 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.
41. The isolated nucleic acid of any one of claims 35-40, wherein: a) the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 6; b) the promoter comprises the nucleotide sequence of SEQ ID NO: 7; c) the STXBP1 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 4 or SEQ ID NO: 5; d) the WPRE comprises the nucleotide sequence of SEQ ID NO: 8; e) the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 9 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and f) the 3’ ITR sequence comprises the nucleotide sequence of SEQ ID NO: 10 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.Attorney Docket No. 14640.0302-0030442. The isolated nucleic acid of any one of claims 35-41, wherein: a) the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 6; b) the promoter comprises the nucleotide sequence of SEQ ID NO: 7; c) the STXBP1 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 4 or SEQ ID NO: 5; d) the WPRE comprises the nucleotide sequence of SEQ ID NO: 8; e) the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 9 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and f) the 3’ ITR sequence comprises the nucleotide sequence of SEQ ID NO: 10.
43. The isolated nucleic acid of any one of claims 35-42, wherein: a) the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 6; b) the promoter comprises the nucleotide sequence of SEQ ID NO: 7; c) the STXBP1 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 4; d) the WPRE comprises the nucleotide sequence of SEQ ID NO: 8; e) the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 9; and f) the 3’ ITR sequence comprises the nucleotide sequence of SEQ ID NO: 10.
44. The isolated nucleic acid of any one of claims 35-42, wherein: a) the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 6; b) the promoter comprises the nucleotide sequence of SEQ ID NO: 7; c) the STXBP1 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 5; d) the WPRE comprises the nucleotide sequence of SEQ ID NO: 8; e) the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 9; and f) the 3’ ITR sequence comprises the nucleotide sequence of SEQ ID NO: 10.
45. The isolated nucleic acid of any one of claims 1-44, comprising the nucleotide sequence of SEQ ID NO: 11 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.Attorney Docket No. 14640.0302-0030446. The isolated nucleic acid of claim 45, comprising a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to SEQ ID NO: 11.
47. The isolated nucleic acid of claim 45 or claim 46, comprising the nucleotide sequence of SEQ ID NO: 11.
48. The isolated nucleic acid of claim 45 or claim 46, comprising the nucleotide sequence of SEQ ID NO: 12.
49. The isolated nucleic acid of any one of claims 35-46, further comprising a nucleotide sequence encoding one or more microRNA (miR) binding sites, wherein the one or more miR binding sites reduces or prevents expression of STXBP1 in dorsal root ganglia.
50. The isolated nucleic acid of claim 49, wherein the nucleotide sequence encoding the one or more miR binding sites comprises the nucleotide sequence of SEQ ID NO: 1.
51. The isolated nucleic acid of claim 49 or claim 50, encoding four miR binding sites, wherein each of the four miR binding sites is encoded by a nucleotide sequence comprising the nucleotide sequence of SEQ ID NO: 1.
52. The isolated nucleic acid of any one of claims 35-46, further comprising a nucleotide sequence encoding a microRNA (miR) binding site series, wherein the nucleotide sequence encoding the miR binding site series comprises the nucleotide sequence of SEQ ID NO: 2.
53. The isolated nucleic acid of any one of claims 35-43, 45, 46, and 49-52, comprising the nucleotide sequence of SEQ ID NO: 17.
54. The isolated nucleic acid of any one of claims 35-42, 44-46, and 49-52, comprising the nucleotide sequence of SEQ ID NO: 16.Attorney Docket No. 14640.0302-0030455. A recombinant viral genome comprising the isolated nucleic acid of any one of claims 1-54.
56. A recombinant viral genome comprising the nucleotide sequence of SEQ ID NO: 11 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.
57. The recombinant viral genome of claim 56, comprising: a) a 5’ inverted terminal repeat (ITR) comprising the nucleotide sequence of SEQ ID NO: 6 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; b) a promoter comprising the nucleotide sequence of SEQ ID NO: 7 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; c) a syntaxin-binding protein 1 (STXBPl)-encoding sequence comprising the nucleotide sequence of SEQ ID NO: 4 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; d) a woodchuck hepatitis virus posttranscriptional regulatory element (WPRE) comprising the nucleotide sequence of SEQ ID NO: 8 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; e) a polyadenylation (poly A) sequence comprising the nucleotide sequence of SEQ ID NO: 9 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and f) a 3’ ITR sequence comprising the nucleotide sequence of SEQ ID NO: 10 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.
58. The recombinant viral genome of claim 57, wherein: a) the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 6; b) the promoter comprises the nucleotide sequence of SEQ ID NO: 7; c) the STXBP1 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 4;Attorney Docket No. 14640.0302-00304 d) the WPRE comprises the nucleotide sequence of SEQ ID NO: 8; e) the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 9; and f) the 3’ ITR sequence comprises the nucleotide sequence of SEQ ID NO: 10.
59. The recombinant viral genome of claim 57, wherein: a) the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 6; b) the promoter comprises the nucleotide sequence of SEQ ID NO: 7; c) a the STXBP1 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 5; d) the WPRE comprises the nucleotide sequence of SEQ ID NO: 8; e) the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 9; and f) the 3’ ITR sequence comprises the nucleotide sequence of SEQ ID NO: 10.
60. The recombinant viral genome of any one of claims 56-58, comprising the nucleotide sequence of SEQ ID NO: 11.
61. The recombinant viral genome of claim 56, claim 57, or claim 59, comprising the nucleotide sequence of SEQ ID NO: 12.
62. The recombinant viral genome of any one of claims 56-59, wherein the recombinant viral genome further comprises a nucleotide sequence encoding one or more microRNA (miR) binding sites, wherein the one or more miR binding sites reduce or prevent expression of STXBP1 in dorsal root ganglia.
63. The recombinant viral genome of claim 62, wherein the nucleotide sequence encoding the one or more miR binding sites comprises the nucleotide sequence of SEQ ID NO: 1.
64. The recombinant viral genome of claim 62 or claim 63, encoding four miR binding sites, wherein each of the four miR binding sites is encoded by a nucleotide sequence comprising the nucleotide sequence of SEQ ID NO: 1.
65. The recombinant viral genome of any one of claims 56-59, further comprising a nucleotide sequence encoding a microRNA (miR) binding site series, wherein the nucleotideAttorney Docket No. 14640.0302-00304 sequence encoding the miR binding site series comprises the nucleotide sequence of SEQ ID NO: 2.
66. The recombinant viral genome of any one of claims 56-58 and 62-65, comprising the nucleotide sequence of SEQ ID NO: 17.
67. The recombinant viral genome of any one of claims 56, 57, 59, and 62-65, comprising the nucleotide sequence of SEQ ID NO: 16.
68. An adeno-associated virus (AAV) particle comprising:(i) an AAV capsid; and(ii) the recombinant viral genome of any one of claims 55-67 or a recombinant viral genome comprising the isolated nucleic acid of any one of claims 1-54.
69. The AAV particle of claim 68, wherein the AAV capsid comprises an AAV1 capsid or a variant thereof, an AAV2 capsid or a variant thereof, an AAV3 capsid or a variant thereof, an AAV3b capsid or a variant thereof, an AAV4 capsid or a variant thereof, an AAV5 capsid or a variant thereof, an AAV6 capsid or a variant thereof, an AAV7 capsid or a variant thereof, an AAV8 capsid or a variant thereof, an AAVrh8 capsid or a variant thereof, an AAV9 capsid or a variant thereof, an AAVPHP.B capsid or a variant thereof, an AAVPHP.N capsid or a variant thereof, a VOY101 capsid or a variant thereof, an AAVrhlO capsid or a variant thereof, an AAVrh32.33 capsid or a variant thereof, or an AAVrh74 capsid or a variant thereof.
70. The AAV particle of claim 69, wherein the AAV capsid comprises an AAV9 capsid variant.
71. The AAV particle of any one of claims 68-70, wherein the recombinant viral genome comprises: a) a 5’ inverted terminal repeat (ITR) comprising the nucleotide sequence of SEQ ID NO: 6; b) a promoter comprising the nucleotide sequence of SEQ ID NO: 7; c) a syntaxin-binding protein 1 (STXBPl)-encoding sequence comprising the nucleotide sequence of SEQ ID NO: 4 or SEQ ID NO: 5;Attorney Docket No. 14640.0302-00304 d) a woodchuck hepatitis virus posttranscriptional regulatory element (WPRE) comprising the nucleotide sequence of SEQ ID NO: 8; e) optionally a nucleotide sequence encoding a microRNA (miR) binding site, wherein the nucleotide sequence encoding the miR binding site comprises the nucleotide sequence of SEQ ID NO: 1; f) a polyadenylation (poly A) sequence comprising the nucleotide sequence of SEQ ID NO: 9; and g) a 3’ ITR sequence comprising the nucleotide sequence of SEQ ID NO: 10.
72. The AAV particle of claim 71, wherein the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 11.
73. The AAV particle of claim 71, wherein the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 12.
74. The AAV particle of claim 71, wherein the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 16.
75. The AAV particle of claim 71, wherein the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 17.
76. A cell comprising the isolated nucleic acid of any one of claims 1-54, the recombinant viral genome of any one of claims 55-67, or the AAV particle of any one of claims 68-75.
77. The cell of claim 76, wherein the cell is a mammalian cell (e.g., an HEK293 cell), an insect cell (e.g., an Sf9 cell), or a bacterial cell.
78. A method of making an AAV particle, the method comprising:(i) providing a cell comprising the recombinant viral genome of any one of claims 55-67 or a recombinant viral genome comprising the isolated nucleic acid of any one of claims 1-54, and a nucleic acid encoding an AAV capsid; andAttorney Docket No. 14640.0302-00304(ii) incubating the cell under conditions suitable to encapsulate the recombinant viral genome in the AAV capsid; thereby making the AAV particle.
79. The method of claim 78, wherein the recombinant viral genome comprises: a) a 5’ inverted terminal repeat (ITR) comprising the nucleotide sequence of SEQ ID NO: 6; b) a promoter comprising the nucleotide sequence of SEQ ID NO: 7; c) a syntaxin-binding protein 1 (STXBPl)-encoding sequence comprising the nucleotide sequence of SEQ ID NO: 4 or SEQ ID NO: 5; d) a woodchuck hepatitis virus posttranscriptional regulatory element (WPRE) comprising the nucleotide sequence of SEQ ID NO: 8; e) optionally a nucleotide sequence encoding a microRNA (miR) binding site, wherein the nucleotide sequence encoding the miR binding site comprises the nucleotide sequence of SEQ ID NO: 1; f) a polyadenylation (poly A) sequence comprising the nucleotide sequence of SEQ ID NO: 9; and g) a 3’ ITR sequence comprising the nucleotide sequence of SEQ ID NO: 10.
80. The method of claim 79, wherein the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 11.
81. The method of claim 79, wherein the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 12.
82. The method of claim 79, wherein the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 16.
83. The method of claim 79, wherein the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 17.
84. The method of any one of claims 78-83, further comprising, prior to step (i), introducing into the cell a nucleic acid comprising the recombinant viral genome.Attorney Docket No. 14640.0302-0030485. The method of any one of claims 78-84, further comprising, prior to step (i), introducing into the cell the nucleic acid encoding the AAV capsid.
86. The method of any one of claims 78-85, wherein the cell comprises a mammalian cell (e.g., an HEK293 cell), an insect cell (e.g., an Sf9 cell), or a bacterial cell.
87. A pharmaceutical composition comprising the AAV particle of any one of claims 68- 75 and a pharmaceutically acceptable excipient.
88. A method of delivering syntaxin-binding protein 1 (STXBP1) to a cell, comprising administering an effective amount of the isolated nucleic acid of any one of claims 1-54, the recombinant viral genome of any one of claims 55-67, the AAV particle of any one of claims 68-75, or the pharmaceutical composition of claim 87.
89. The method of claim 88, wherein the cell is in a subject.
90. The method of claim 89, wherein the subject has, has been diagnosed with having, or is at risk of having an STXBP1 -related disorder.
91. A method of treating a subject having or diagnosed with having an STXBP1 -related disorder, or treating at least one symptom thereof, comprising administering to the subject an effective amount of the isolated nucleic acid of any one of claims 1-54, the recombinant viral genome of any one of claims 55-67, the AAV particle of any one of claims 68-75, or the pharmaceutical composition of claim 87.
92. The method of claim 90 or claim 91, wherein the STXBP1 -related disorder is an STXBP1 -related neurodegenerative or neuromuscular disorder.
93. The method of claim 92, wherein the STXBP1 -related neurodegenerative or neuromuscular disorder is STXBP1 encephalopathy, epileptic encephalopathy, STXBP1 developmental and epileptic encephalopathy (DEE), Ohtahara syndrome, developmental encephalopathy, West syndrome, early myoclonic epileptic encephalopathy, Lennox-Gastaut syndrome, autism (e.g., autism with STXBP1 mutations and optionally further mutations),Attorney Docket No. 14640.0302-00304Dravet syndrome (not caused by mutations in SCN1 A), or Rett syndrome phenotype (not caused by mutation of MECP2 or CDKL5).
94. A method of treating a subject having or diagnosed with having an STXBP1 -related disorder, or treating at least one symptom thereof, wherein the STXBP1 -related disorder is STXBP1 encephalopathy, STXBP1 developmental and epileptic encephalopathy (DEE), or STXBP1 -related neurodevel opmental disabilities without seizures, comprising administering to the subject an effective amount of the isolated nucleic acid of any one of claims 1-54, the recombinant viral genome of any one of claims 55-67, the AAV particle of any one of claims 68-75, or the pharmaceutical composition of claim 87.
95. The method of any one of claims 89-94, wherein the subject has one or more mutations in the STXBP1 gene.
96. The method of any one of claims 89-95, wherein the subject has a reduced level of STXBP1 activity as compared to a reference level in an individual who does not have an STXBP1 -related disorder.
97. The method of any one of claims 91-96, wherein the treating results in prevention of progression of the disorder or at least one symptom thereof in the subject.
98. The method of any one of claims 91-97, wherein the treating results in amelioration of at least one symptom of the disorder in the subject, e.g., as indicated by one or more biomarkers.
99. The method of claim 98, wherein the one or more biomarkers comprises: (i) increased release of the neurotransmitters glutamate and / or gamma-aminobutyric acid (GABA); or (ii) reduction in abnormal electroencephalographic activity.
100. The method of any one of claims 91-99, wherein the at least one symptom comprises epilepsy, autistic features, ataxia, generalized tremors, developmental delay, progressive encephalopathy, progressive dementia, ataxia, myoclonus, oculomotor dysfunction, bulbar palsy, generalized weakness, trembling of a limb, depression, visual hallucinations, cognitive decline, dystonia, or a combination thereof.Attorney Docket No. 14640.0302-00304101. The method of any one of claims 89-100, wherein the subject is a human.
102. The method of any one of claims 89-101, wherein the isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition is delivered to a cell, tissue, or region of the central nervous system (CNS) of the subject.
103. The method of claim 102, wherein the cell, tissue, or region of the CNS comprises a cell, tissue, or region of the striatum, thalamus, cerebellum, cortex, hippocampus, dentate gyrus, or a combination thereof.
104. The method of claim 102 or claim 103, wherein the cell of the CNS comprises a neuron (e.g., a cornu ammonis 1 (CAI) neuron, cornu ammonis 2 (CA2) neuron, cornu ammonis 3 (CA3) neuron, deep cerebellar nuclei neuron, glutamatergic neuron, GABAergic neuron, or a combination thereof).
105. The method of any one of claims 89-104, wherein the isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition is delivered to the subject via intravenous administration.
106. The method of any one of claims 89-105, further comprising evaluating, e.g., measuring, the level of STXBP1 gene expression, STXBP1 mRNA expression, and / or STXBP1 protein expression, in the subject, e.g., in a cell, tissue, or fluid of the subject.
107. The method of claim 106, wherein the level of STXBP1 protein expression is measured by an enzyme-linked immunosorbent assay (ELISA), a Western blot, or an immunohistochemistry assay.
108. The method of claim 106 or claim 107, wherein the evaluating the level of STXBP1 gene, mRNA, and / or protein expression is performed before and after administering the isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition; optionally wherein the subject’s level of STXBP1 gene, mRNA, and / or protein expression before administration is compared to the subject’s level of STXBP1 gene, mRNA, and / or protein expression after administration.Attorney Docket No. 14640.0302-00304109. The method of any one of claims 106-108, comprising evaluating the level of STXBP1 gene, mRNA, and / or protein expression in a cell or tissue of the CNS in the subject.
110. The method of claim 109, wherein the cell or tissue of the CNS comprises a cell or tissue of the striatum, thalamus, cerebellum, cortex, hippocampus, dentate gyrus or a combination thereof.
111. The method of claim 109 or claim 110, wherein the cell of the CNS comprises a neuron (e.g., cornu ammonis 1 (CAI) neuron, cornu ammonis 2 (CA2) neuron, cornu ammonis 3 (CA3) neuron, deep cerebellar nuclei neuron, glutamatergic neuron, GABAergic neuron, or a combination thereof).
112. The method of any one of claims 106-111, wherein the subject’s level of STXBP1 protein expression after administration of the isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition is increased relative to the subject’s level of STXBP1 protein expression before administration of the isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition.
113. The method of any one of claims 89-112, further comprising evaluating, e.g., measuring, the level of STXBP1 activity in the subject, e.g., in a cell or tissue of the subject.
114. The method of any one of claims 89-113, wherein administering the isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition to the subject results in an increase in:(i) the level of STXBP1 activity in a cell, tissue, or fluid (e.g., a cell or tissue of the CNS, e.g., the striatum, thalamus, cerebellum, cortex, hippocampus, dentate gyrus, cornu ammonis 1 (CAI) neurons, cornu ammonis 2 (CA2) neurons, cornu ammonis 3 (CA3) neurons, deep cerebellar nuclei neurons, glutamatergic neurons, GABAergic neurons, or a combination thereof) of the subject, relative to baseline and / or relative to the level of STXBP1 activity in a cell, tissue, or fluid of an individual with an STXBP1 -related disorder who has not been administered the isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition;Attorney Docket No. 14640.0302-00304(ii) the number and / or level of viral genomes (VG) per cell level in a cell or tissue of the CNS (e.g., striatum, thalamus, cerebellum, cortex, hippocampus, dentate gyrus, CAI neurons, CA2 neurons, CA3 neurons, deep cerebellar nuclei neurons, glutamatergic neurons, GABAergic neurons, or a combination thereof) of the subject, relative to the number and / or level of VG per cell in a peripheral cell or tissue of the subject; and / or(iii) the level of STXBP1 gene, mRNA and / or protein expression in a cell or tissue (e.g., a cell or tissue of the CNS (e.g., striatum, thalamus, cerebellum, cortex, hippocampus, dentate gyrus, CAI neurons, CA2 neurons, CA3 neurons, deep cerebellar nuclei neurons, glutamatergic neurons, GABAergic neurons, or a combination thereof) of the subject relative to baseline and / or relative to the level of STXBP1 gene, mRNA, and / or protein expression in a cell or tissue of an individual with an STXBP1 -related disorder who has not been administered the isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition.
115. The method of any one of claims 90-114, further comprising administering to the subject at least one additional agent and / or therapy suitable for treating the STXBP1 -related disorder or for treating at least one symptom thereof.
116. The method of claim 115, wherein the at least one additional agent and / or therapy comprises one or more anti-epileptic drugs (e.g., bromide, clobazam, felbamate, ganaxolone, lamotrigine, levetiracetam, phenobarbital, topiramate, valproate, or a combination thereof).
117. The method of any one of claims 89-116, further comprising administering an immunosuppressant to the subject.
118. The method of claim 117, wherein the immunosuppressant comprises a corticosteroid (e.g., prednisone, prednisolone, methylprednisolone, and / or dexamethasone), adrenocorticotropic hormone, rapamycin, mycophenolate mofetil, tacrolimus, rituximab, and / or eculizumab hydroxychloroquine.
119. The isolated nucleic acid of any one of claims 1-54, the recombinant viral genome of any one of claims 55-67, the AAV particle of any one of claims 68-75, or the pharmaceutical composition of claim 87 for use in the treatment of an STXBP1 -related disorder in a subject, or for use in the treatment of a subject having at least one symptom of an STXBP1 -relatedAttorney Docket No. 14640.0302-00304 disorder; optionally wherein the STXBP1 -related disorder is STXBP1 encephalopathy, epileptic encephalopathy, STXBP1 developmental and epileptic encephalopathy (DEE), Ohtahara syndrome, developmental encephalopathy, West syndrome, early myoclonic epileptic encephalopathy, Lennox-Gastaut syndrome, autism (e.g., autism with STXBP1 mutations and optionally further mutations), Dravet syndrome (not caused by mutations in SCN1 A), or Rett syndrome phenotype (not caused by mutation of MECP2 or CDKL5).
120. The isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition of claim 119, wherein the subject has, has been diagnosed with having, or is at risk of having the STXBP1 -related disorder; optionally wherein the STXBP1 -related disorder is STXBP1 encephalopathy, epileptic encephalopathy, STXBP1 developmental and epileptic encephalopathy (DEE), Ohtahara syndrome, developmental encephalopathy, West syndrome, early myoclonic epileptic encephalopathy, Lennox-Gastaut syndrome, autism (e.g., autism with STXBP1 mutations and optionally further mutations), Dravet syndrome (not caused by mutations in SCN1 A), or Rett syndrome phenotype (not caused by mutation of MECP2 or CDKL5).
121. The isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition of claim 119 or claim 120, wherein the STXBP1 -related disorder is STXBP1 DEE.
122. Use of the isolated nucleic acid of any one of claims 1-54, the recombinant viral genome of any one of claims 55-67, the AAV particle of any one of claims 68-75, the cell of claim 76 or claim 77, or the pharmaceutical composition of claim 87 in the manufacture of a medicament for the treatment of an STXBP1 -related disorder in a subject, or for the treatment of at least one symptom of an STXBP1 -related disorder in a subject; optionally wherein the STXBP1 -related disorder is STXBP1 encephalopathy, epileptic encephalopathy, STXBP1 developmental and epileptic encephalopathy (DEE), Ohtahara syndrome, developmental encephalopathy, West syndrome, early myoclonic epileptic encephalopathy, Lennox-Gastaut syndrome, autism (e.g., autism with STXBP1 mutations and optionally further mutations), Dravet syndrome (not caused by mutations in SCN1A), or Rett syndrome phenotype (not caused by mutation of MECP2 or CDKL5).Attorney Docket No. 14640.0302-00304123. The use of claim 122, wherein the subject has, has been diagnosed with having, or is at risk of having the STXBP1 -related disorder; optionally wherein the STXBP1 -related disorder is STXBP1 encephalopathy, epileptic encephalopathy, STXBP1 developmental and epileptic encephalopathy (DEE), Ohtahara syndrome, developmental encephalopathy, West syndrome, early myoclonic epileptic encephalopathy, Lennox-Gastaut syndrome, autism (e.g., autism with STXBP1 mutations and optionally further mutations), Dravet syndrome (not caused by mutations in SCN1 A), or Rett syndrome phenotype (not caused by mutation of MECP2 or CDKL5).
124. The use of claim 122 or claim 123, wherein the STXBP1 -related disorder is STXBP1 DEE.
125. The isolated nucleic acid of any one of claims 1-54, the recombinant viral genome of any one of claims 54-67, the AAV particle of any one of claims 68-75, or the pharmaceutical composition of claim 87 for use in a method of treating a disorder according to any one of claims 91-118.
Citation Information
Patent Citations
TARGETING PEPTIDES FOR DIRECTING ADENO-ASSOCIATED VIRUSES (AAVs)
US20170166926A1
Mineral hollow fiber bioreactor for the cultivation of animal cells
US5064764A
Method for improved transduction by recombinant adeno-associated viruses
US5756283A
AAV-mediated delivery of DNA to cells of the nervous system
US6180613B1
An improved method for the production and purification of adenoviral vectors
US6194191B1