Cellulase mutants and use thereof
By modifying cellulase through protein engineering, mutants with high specific activity were obtained, solving the problems of cellulase stability and cost, and expanding its application range.
Patent Information
- Application Number
- PCT/CN2025/079551
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-11-08
- Filing Date
- 2025-02-27
- Publication Date
- 2026-05-15
AI Technical Summary
Existing cellulases suffer from low stability, poor tolerance to extreme temperatures and pH values, and high production costs, which limit their application scope.
By modifying cellulase through protein engineering, mutants with high amino acid sequence identity to SEQ ID NO:1 were obtained, which included specific amino acid substitutions or combinations to improve their specific activity.
It significantly improves the specific activity of cellulase, reduces production costs, and facilitates its widespread application.
Smart Images

Figure PCTCN2025079551-FTAPPB-I100001
Abstract
Description
A cellulase mutant and its application Technical Field
[0001] This invention relates to the fields of genetic engineering and protein modification technology, specifically to a cellulase mutant and its applications. Background Technology
[0002] Cellulose is a large polysaccharide composed of glucose molecules linked by β-1,4 glycosidic bonds, with the chemical formula (C6H2O). 10 O5) n Cellulose is a major component of plant cell walls and is the most widely distributed and abundant polysaccharide in nature. As a renewable biomass, cellulose has enormous potential to solve the energy crisis and alleviate environmental pollution. The resource utilization of cellulose is an important practical supporting technology for the "dual carbon" goal. While the natural reserves of cellulose are vast, only a very small portion is utilized due to a lack of low-cost and effective technologies and methods for its resource utilization.
[0003] Cellulase research provides an effective pathway for the resource utilization of cellulose. Cellulase is a complex enzyme system mainly composed of three components: β-1,4-endoglucanase, exoglucanase, and β-glucosidase. Endoglucanase randomly acts on the amorphous regions within the cellulose polysaccharide chains, producing oligosaccharides of varying lengths and new chain ends; exoglucanase acts on these cellulose polysaccharide chain ends, producing glucose or cellobiose; and β-glucosidase hydrolyzes cellobiose to produce glucose. The degradation of cellulose involves the synergistic action of these three cellulases, converting large cellulose molecules in nature into smaller sugars and other biological products. Due to its advantages such as being environmentally friendly, capable of working synergistically with other proteins, and having high processing efficiency, cellulase has already occupied an important position in production applications.
[0004] Currently, the use of cellulase to degrade or modify cellulose or cellulose-rich raw materials is widely applied in industries such as textiles, papermaking, feed, food, and energy. However, as a protein, cellulase suffers from low stability, poor tolerance to extreme temperatures and pH values, and high production costs, which limits its application scope. Summary of the Invention
[0005] The purpose of this invention is to provide a neutral cellulase mutant. This invention achieves a mutant protein with significantly increased specific activity through protein engineering modification of cellulase, thereby facilitating its widespread application.
[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution:
[0007] The present invention relates to a cellulase mutant comprising an amino acid sequence having at least 90% identity with SEQ ID NO:1, and comprising an amino acid substitution at at least one position selected from the group consisting of: 14, 19, 75, 109, 118, 123, 130, 167, 176, 177, 192 compared with SEQ ID NO:1.
[0008] In some embodiments of the invention, the amino acid sequence of the mutant has at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99% identity with SEQ ID NO:1.
[0009] In some more specific embodiments, the amino acid sequence of the mutant has at least 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or at least 99.9% identity with SEQ ID NO:1.
[0010] In some embodiments of the present invention, the mutant comprises a substitution of at least one amino acid from the following group: P14A, P19T, S75A, S109N, H118P, M123I / L, I130L / Q, Y167E / F / W, A176S / F, D177S, L192I.
[0011] In some embodiments of the present invention, the mutant contains substitutions selected from the following substitutions and combinations thereof: P14A; P19T; S75A; S109N; H118P; M123I; M123L; I130L; I130Q; Y167E; Y167F; Y167W; A176S; A176F; D177S; L192;
[0012] P14A / P19T;
[0013] P14A / M123I;
[0014] P19T / I130L;
[0015] P19T / Y167E;
[0016] P19T / A176S;
[0017] S75A / S109N;
[0018] S75A / M123I;
[0019] S75A / I130L;
[0020] S75A / A176S;
[0021] S75A / L192I;
[0022] S109N / M123I;
[0023] S109N / I130L;
[0024] S109N / Y167W;
[0025] S109N / A176S;
[0026] S109N / L192I;
[0027] M123I / I130L;
[0028] M123I / Y167W;
[0029] M123I / A176S;
[0030] M123I / L192I;
[0031] I130L / Y167W;
[0032] I130L / A176S;
[0033] I130L / L192I;
[0034] Y167W / A176S;
[0035] Y167W / L192I;
[0036] Y167E / A176F;
[0037] Y167F / L192I;
[0038] D177S / L192I;
[0039] A176S / L192I;
[0040] P14A / M123I / A176F;
[0041] P14A / M123L / A176S;
[0042] P19T / I130L / L192I;
[0043] S75A / I130L / A176F;
[0044] S109N / I130L / D177S;
[0045] M123I / A176S / L192I;
[0046] Y167E / A176F / L192I;
[0047] Y167W / A176S / D177S;
[0048] S75A / I130Q / A176F;
[0049] S109N / I130Q / D177S;
[0050] P19T / I130L / Y167W / A176S;
[0051] I130L / A176S / D177S / L192I;
[0052] I130L / A176F / D177S / L192I;
[0053] I130Q / A176S / D177S / L192I;
[0054] I130Q / A176F / D177S / L192I;
[0055] P14A / P19T / I130L / Y167E / A176F;
[0056] P19T / S75A / M123I / A176S / L192I;
[0057] P14A / S75A / M123I / A176F / L192I;
[0058] S75A / I130Q / A176F / D177S / L192I.
[0059] This invention relates to DNA molecules encoding the above-mentioned cellulase mutants.
[0060] This invention relates to recombinant expression vectors containing the aforementioned DNA molecules.
[0061] This invention relates to a host cell comprising the above-described recombinant expression vector.
[0062] In embodiments of the present invention, the host cell is *Trichoderma reesei*.
[0063] The recombinant expression vector constructed above was transformed into Trichoderma reesei host cells for recombinant expression, and the specific activity of the obtained cellulase mutant was significantly improved.
[0064] Compared to wild-type cellulase, the mutants provided by this invention, each containing a single mutation site of P14A, P19T, S75A, S109N, H118P, M123I, M123L, I130L, I130Q, Y167E, Y167F, Y167W, A176S, A176F, D177S, or L192I, generally exhibited a 10.4%-76.1% increase in specific activity under neutral conditions. Among them, the single-site mutant containing I130L showed the highest specific activity, reaching 183.64 U / mg. This demonstrates that the aforementioned mutation sites provided by this invention can significantly improve the specific activity of wild-type cellulase, achieving unexpected technical effects.
[0065] The cellulase mutant provided by this invention has higher specific activity, which can significantly reduce production costs and promote its widespread application, showing great promise. Detailed Implementation
[0066] This invention utilizes conventional techniques and methods used in the fields of genetic engineering and molecular biology, such as those described in *MOLECULAR CLONING: A LABORATORY MANUAL, 3rd Ed.* (Sambrook, 2001) and *CURRENT PROTOCOLS IN MOLECULAR BIOLOGY* (Ausubel, 2003). These general references provide definitions and methods known to those skilled in the art. However, this invention is not limited to any specific methods, experimental protocols, and reagents described.
[0067] The present invention will now be described in detail with reference to specific embodiments.
[0068] Strains and reagents:
[0069] PCR enzymes were purchased from Takara, seamless cloning enzyme 2X MultiF Seamless Assembly Mix (RK21020) was purchased from ABclonal, E. coli DH5α was purchased from Invitrogen, restriction endonucleases were purchased from Fermentas, lysin was purchased from Sigma, Amp, sorbitol, PEG6000, TrisCaCl2, etc. were purchased from Invitrogen, and plasmid extraction kits and gel purification and recovery kits were purchased from Omega.
[0070] Culture medium formulation:
[0071] Escherichia coli culture medium (LB medium): 0.5% yeast extract, 1% peptone, 1% NaCl, pH 7.0;
[0072] LB+AMP liquid medium: 0.5% yeast extract, 1% peptone, 1% NaCl, 100 μg / mL ampicillin, pH 7.0;
[0073] LB+AMP solid medium: 0.5% yeast extract, 1% peptone, 1% NaCl, 1.5% agar, 100 μg / mL ampicillin, pH 7.0;
[0074] Upper culture medium: 0.1% MgSO4, 1% KH2PO4, 0.6% (NH4)2SO4, 1% glucose, 18.3% sorbitol, 0.35% agarose;
[0075] The lower culture medium consists of 2% glucose, 0.5% (NH4)2SO4, 1.5% KH2PO4, 0.06% MgSO4, 0.06% CaCl2, and 1.5% agar.
[0076] The present invention will now be described in detail with reference to specific embodiments.
[0077] Example 1: Construction of recombinant cellulase plasmid
[0078] To improve the specific activity of wild-type cellulase (amino acid sequence SEQ ID NO: 1, encoding nucleotide sequence SEQ ID NO: 2), the applicant screened for a large number of mutations in amino acids near the active site of the enzyme using directed evolution technology.
[0079] The PCR primers F1 and R1 are designed as follows:
[0080] F1: CGGCCTTCTTGGCCACAGCTCGAGCTGCCGATGGCAAGTCGACCCGC;
[0081] R1: CAGGCTTCGCCACGGAGCTTTAACGCGTTTACAGGCACTGATGATACCAGTC.
[0082] Using the wild-type cellulase gene (SEQ ID NO:2) as a template, PCR amplification was performed using the GeneMorph II random mutagenesis PCR kit (Stratagene) with the above primers. The PCR product was recovered from the gel, digested with EcoRI and NotI, and then ligated into the pET21a vector digested with the same enzymes. The transformed cells were then transformed into Escherichia coli BL21(DE3), plated on LB+Amp plates, and incubated upside down at 37°C. After the transformants appeared, they were picked one by one with a toothpick and transferred to a 96-well plate. 150 μL of LB+Amp medium containing 0.1 mM IPTG was added to each well. The cells were incubated at 37°C and 220 rpm for about 6 h. After centrifugation and discarding the supernatant, the cells were resuspended in buffer and repeatedly freeze-thawed to break the cell wall, obtaining E. coli cell lysate containing cellulase.
[0083] Take 50 μL of lysis buffer into two new 96-well plates and measure their cellulase activity and protein content at 50 °C. Calculate the specific activity of different mutants.
[0084] Experimental results showed that some mutations had no effect on the specific activity of cellulase at 50℃, while others even worsened its specific activity. Still others, although increasing the specific activity of cellulase, significantly altered its enzymatic properties, which did not meet the requirements. Ultimately, the applicant obtained mutation sites that significantly increased specific activity at 50℃, namely: P14A, P19T, S75A, S109N, H118P, M123I, M123L, I130L, I130Q, Y167E, Y167F, Y167W, A176S, A176F, D177S, and L192I.
[0085] Based on wild-type cellulase, this invention provides cellulase mutants containing single mutation sites of P14A, P19T, S75A, S109N, H118P, M123I, M123L, I130L, I130Q, Y167E, Y167F, Y167W, A176S, A176F, D177S, and L192I.
[0086] Example 2 Expression of cellulase in Trichoderma reesei
[0087] Based on the codon preference of Trichoderma, the gene sequence of wild-type cellulase SEQ ID NO:2 and its mutant were optimized and synthesized, and two restriction sites, KpnI and MluI, were added to the 5' and 3' ends of the synthesized sequence, respectively.
[0088] 2.1 Construction of expression vector
[0089] The synthesized plasmid was digested with restriction endonucleases KpnI (Fermentas) and XbaI, respectively; simultaneously, plasmid pTGII was digested with restriction endonucleases KpnI (Fermentas) and XbaI. The digestion products were purified using a gel purification kit, and the two digestion products were ligated using T4 DNA ligase (Fermentas). The ligation products were transformed into Trans5α Escherichia coli (Transgen), and selection was performed using ampicillin. To ensure accuracy, several clones were sequenced (Invitrogen). After successful sequencing, the recombinant plasmid containing the cellulase gene was obtained.
[0090] Plasmids were purified from correctly sequenced E. coli clones using a plasmid medium-quantity preparation kit (Axygen).
[0091] 2.2 Protoplast Preparation
[0092] Spore suspensions of *Trichoderma reesei*, a host fungus with a cellulase gene deficiency, were inoculated onto PDA plates and cultured at 30°C for 6 days. After abundant sporulation, colonies of approximately 1 cm × 1 cm were excised and placed in liquid medium containing 120 mL of YEG+U (0.5% yeast extract, 1% glucose, and 0.1% uridine) and cultured at 30°C with shaking at 220 rpm for 14–16 h. Mycelia were collected by filtration through sterile gauze and washed once with sterile water. The mycelia were then placed in Erlenmeyer flasks containing 20 mL of 10 mg / mL lyase solution (Sigma L1412) and incubated at 30°C with shaking at 90 rpm for 1–2 h. The progress of protoplast transformation was observed under a microscope.
[0093] Add 20 mL of pre-chilled 1.2 M sorbitol (1.2 M sorbitol, 50 mM Tris-Cl, 50 mM CaCl2) to the Erlenmeyer flask, gently mix, filter through sterile Miracloth filter cloth, collect the filtrate, centrifuge at 3000 rpm, 4°C for 10 min; discard the supernatant, add 5 mL of pre-chilled 1.2 M sorbitol solution to resuspend the bacterial cells, centrifuge at 3000 rpm, 4°C for 10 min; discard the supernatant, add an appropriate amount of pre-chilled 1.2 M sorbitol to resuspend and dispense (200 μL / tube, protoplast concentration 10). 8 (units / mL).
[0094] 2.3 Expression vector transformation and strain validation
[0095] All the following procedures were performed on ice. 10 μg of recombinant plasmid was added to a sterile 7 mL centrifuge tube containing 200 μL of protoplast solution. Then, 50 μL of 25% PEG (25% PEG, 50 mM Tris-Cl, 50 mM CaCl2) was added, the bottom of the tube was gently tapped to mix, and the tube was incubated on ice for 20 min. Next, 2 mL of 25% PEG was added, mixed, and incubated at room temperature for 5 min. Then, 4 mL of 1.2 M sorbitol was added, gently mixed, and poured into the melted upper medium maintained at 55°C. After gently mixing, the mixture was spread onto the prepared lower medium and incubated at 30°C for 5–7 days until transformants appeared. Transformants were picked and transferred to lower medium plates for re-screening. After incubation at 30°C for 2 days, strains with smoother colony edges were considered positive transformants.
[0096] Take an appropriate amount of mycelium and place it in a 2 mL centrifuge tube. Add 100 mg of sterile quartz sand and 400 μL of extraction buffer (100 mM Tris-HCl, 100 mM EDTA, 250 mM NaCl, 1% SDS). Vigorously shake with a bead mixer for 2 min. After incubating in a 65 °C water bath for 20 min, add 200 μL of 10 M NH4AC and incubate on ice for 10 min. Centrifuge at 13000 rpm for 10 min. Take the supernatant, add 2 volumes of anhydrous ethanol, and place at -20 °C for 30 min. Centrifuge at 13000 rpm for 10 min and discard the supernatant. Wash twice with 70% ethanol. Air dry, dissolve in water, and store at -20 °C.
[0097] Using the extracted genomic DNA from the transformants as a template, the target gene was amplified by PCR using primers yz-F and yz-R for verification.
[0098] yz-F: CTCCCCATCTACTCATCAACTCA;
[0099] yz-R:ATAAATCACCCGGGGCCATGT.
[0100] PCR amplification conditions were: 94℃ for 5 min; 94℃ for 40 s; 55℃ for 40 s, 72℃ for 1 min, 30 cycles; 72℃ for 7 min, 4℃ for termination and storage; PCR amplification products were recovered using a gel extraction kit and sequenced for analysis, and recombinant Trichoderma reesei engineered strains expressing wild-type cellulase and the above mutants were constructed.
[0101] 2.4 Fermentation Verification
[0102] The above-mentioned engineered Trichoderma reesei strains were inoculated onto PDA plates and cultured at 30°C for 6 days. After the spores were abundant, they were inoculated into 24-well plates for fermentation (1.5% glucose, 1.7% lactose, 2.5% corn steep liquor, 0.44% (NH4)2SO4, 0.09% MgSO4, 2% KH2PO4, 0.04% CaCl2, 0.018% Tween-80, 0.018% trace elements). The plates were cultured at 30°C for 48 hours, and then at 25°C for 72 hours. The fermentation supernatant was then used to determine the cellulase activity and protein content.
[0103] (I) Cellulase Activity Assay
[0104] (1) Definition of cellulase activity
[0105] Under conditions of 50°C and pH 6.0, the amount of enzyme required to release 1 μmol of reducing sugar per minute from a 5 mg / ml sodium carboxymethyl cellulose solution is defined as one enzyme activity unit (U), where the reducing sugar is in equal amounts to glucose.
[0106] (2) Cellulase assay method
[0107] Add 0.5 mL of CMC substrate to each of three test tubes and preheat them together with the enzyme solution at 50°C for 5 min. Add 0.5 mL of the test solution to each of the first and second test tubes and start timing; react in a 50°C water bath for 15 min. After the reaction is complete, add 1.5 mL of DNS reagent to each of the three test tubes, and add 0.5 mL of the enzyme solution to the third test tube. Remove and shake the three test tubes well, and react in a boiling water bath for 5 min. Quickly cool to room temperature and dilute to 5.0 mL with water. Using the solution in the third test tube as a control, measure the absorbance of the solutions in the first and second test tubes at a wavelength of 540 nm. The absorbance should ideally be between 0.25 and 0.35. The absolute value of the difference between the absorbance of the enzyme solution and the absorbance of the control enzyme solution should not exceed 0.015.
[0108] Enzyme activity X = (equivalent amount of glucose / 180 / 15 / 0.5) × n.
[0109] Where: X – enzyme activity unit, U / mL;
[0110] 180 — Glucose converted from micrograms to micromoles;
[0111] 15 — Reaction time between the test solution and the substrate;
[0112] 0.5 — The amount of the enzyme solution to be tested added to the reaction;
[0113] n – dilution factor.
[0114] (II) Protein content determination
[0115] (1) Measurement method:
[0116] The Coomassie Brilliant Blue (Bradford) binding method for protein determination is a combined colorimetric and dye-based method. Coomassie Brilliant Blue G-250 is brownish-red in acidic solution, turning blue upon binding with protein. Within a certain protein concentration range, it obeys Beer's Law and can be measured colorimetrically at 595 nm. It exhibits significant absorption within 3–5 minutes and remains stable for at least 1 hour. In the range of 10–1000 μg / mL, the absorbance is directly proportional to the protein concentration.
[0117] The enzyme solution and Coomassie Brilliant Blue solution were mixed at a volume ratio of 1:5, allowed to stand for 10 minutes, and the protein content was determined by the Coomassie Brilliant Blue (Bradford) binding method.
[0118] (III) Calculation of specific vitality
[0119] Specific activity refers to the number of enzyme activity units per unit weight of protein, usually expressed as U / mg protein. Generally speaking, the higher the specific activity of an enzyme, the purer the enzyme.
[0120] Specific activity calculation formula: Specific activity (U / mg) = Enzyme activity (U / mL) / Protein content (mg / mL).
[0121] The specific activity of the fermentation supernatant of the recombinant wild-type cellulase and its mutant Trichoderma reesei engineered strains constructed in Example 2 of this invention at 50°C is shown in Table 1.
[0122] Table 1. Specific activities of wild-type cellulase and its mutants
[0123] As shown in Table 1, compared with wild-type cellulase, the mutants provided by this invention, each containing a single mutation site (P14A, P19T, S75A, S109N, H118P, M123I, M123L, I130L, I130Q, Y167E, Y167F, Y167W, A176S, A176F, D177S, L192I), generally exhibited a 10.4%-76.1% increase in specific activity under neutral conditions. Among them, the single-site mutant containing I130L showed the highest specific activity, reaching 183.64 U / mg. This demonstrates that the above-mentioned mutation sites provided by this invention can significantly improve the specific activity of wild-type cellulase, achieving unexpected technical effects.
[0124] In summary, the cellulase mutant provided by this invention has significantly improved specific activity, which is beneficial for reducing production costs, promoting its widespread application, and has broad prospects.
Claims
1. A cellulase mutant, characterized in that, The mutant comprises an amino acid sequence having at least 95% identity with SEQ ID NO:1, and having an amino acid substitution at at least one position selected from the group consisting of: 14, 19, 75, 109, 118, 123, 130, 167, 176, 177, 192 compared to SEQ ID NO:
1.
2. The mutant as described in claim 1, characterized in that, The amino acid sequence of the mutant has at least 96%, 97%, 98%, or at least 99% identity with SEQ ID NO:
1.
3. The mutant as described in claim 2, characterized in that, The amino acid sequence of the mutant has at least 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or at least 99.9% identity with SEQ ID NO:
1.
4. The mutant as described in claim 1, characterized in that, The mutant contains a substitution of at least one amino acid from the following group: P14A, P19T, S75A, S109N, H118P, M123I / L, I130L / Q, Y167E / F / W, A176S / F, D177S, L192I.
5. The mutant as described in claim 4, characterized in that, The mutant contains substitutions selected from the following substitutions and combinations thereof: P14A; P19T; S75A; S109N; H118P; M123I; M123L; I130L; I130Q; Y167E; Y167F; Y167W; A176S; A176F; D177S; L192; P14A / P19T; P14A / M123I; P19T / I130L; P19T / Y167E; P19T / A176S; S75A / S109N; S75A / M123I; S75A / I130L; S75A / A176S; S75A / L192I; S109N / M123I; S109N / I130L; S109N / Y167W; S109N / A176S; S109N / L192I; M123I / I130L; M123I / Y167W; M123I / A176S; M123I / L192I; I130L / Y167W; I130L / A176S; I130L / L192I; Y167W / A176S; Y167W / L192I; Y167E / A176F; Y167F / L192I; D177S / L192I; A176S / L192I; P14A / M123I / A176F; P14A / M123L / A176S; P19T / I130L / L192I; S75A / I130L / A176F; S109N / I130L / D177S; M123I / A176S / L192I; Y167E / A176F / L192I; Y167W / A176S / D177S; S75A / I130Q / A176F; S109N / I130Q / D177S; P19T / I130L / Y167W / A176S; I130L / A176S / D177S / L192I; I130L / A176F / D177S / L192I; I130Q / A176S / D177S / L192I; I130Q / A176F / D177S / L192I; P14A / P19T / I130L / Y167E / A176F; P19T / S75A / M123I / A176S / L192I; P14A / S75A / M123I / A176F / L192I; S75A / I130Q / A176F / D177S / L192I.
6. A DNA molecule encoding the cellulase mutant of claim 5.
7. A recombinant expression plasmid comprising the DNA molecule of claim 6.
8. A host cell, characterized in that, The host cell comprises the recombinant expression plasmid of claim 7, and is a non-plant cell or an animal cell.
9. The host cell as described in claim 8, characterized in that, The host cell was Trichoderma reesei.