Yeast product as a postbiotic in the field of oral / dental hygiene and health
A yeast product with specific pH and nutrient composition addresses the need to inhibit Tannerella bacteria, maintaining oral microbiota balance and preventing periodontal diseases by reducing bacterial growth.
Patent Information
- Application Number
- PCT/EP2025/081801
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-11-08
- Filing Date
- 2025-11-04
- Publication Date
- 2026-05-15
AI Technical Summary
There is a need to maintain or restore the balance between non-pathogenic and pathogenic microorganism populations in the oral microbiota to prevent or treat infectious diseases of the oral cavity, particularly by reducing or inhibiting the growth of Tannerella bacteria, especially Tannerella forsythia, which are associated with periodontal diseases.
A yeast product with specific pH and nutrient composition, optionally combined with additional yeast products, is used to inhibit the growth of Tannerella bacteria in the oral microbiota through a preparation process involving fermentation, centrifugation, heating, and concentration.
The yeast product effectively reduces or inhibits the growth of Tannerella bacteria, helping to maintain oral microbiota balance and prevent or treat periodontal diseases.
Smart Images

Figure IMGF000016_0001
Abstract
Description
[0001] Yeast product used as a postbiotic in the field of oral hygiene and health
[0002] technical field
[0003] The present invention relates to the field of oral hygiene and health. The invention relates to a yeast product obtained from a yeast extract, or a composition comprising it, used to maintain or restore the good health of the oral microbiota by reducing or inhibiting the growth of bacteria of the genus Tannerella, preferentially bacteria of the species Tannerella forsythia.
[0004] Technical background
[0005] In mammals, the oral cavity is a complex ecosystem, both open to the outside and the inside, inhabited by numerous microorganisms.
[0006] In humans, the oral cavity is inhabited by more than 700 detected bacterial species (see for example the articles: Marsh et al., Penodontology 2000, 2011, 55, 16-35; Paster et al., Penodontology 2000, 2006, 42, 80-87; Aas et al., J. Clin. Microbiol., 2005, 43, 5721-5732; Dewhirst et al., J. Bacteriol., 2010, 192, 5002-5017).
[0007] For example, in a single individual, the number of resident bacterial species varies from 150 to 250. Most of these species are commensal and necessary to maintain the balance of this ecosystem. However, in certain situations (for example, dietary habits, high carbohydrate intake, smoking, physiological changes such as aging, puberty, and pregnancy), a disruption of this balance occurs and can lead to the development of infectious diseases of the oral cavity.
[0008] The main infectious diseases of the oral cavity in humans are dental caries and periodontal diseases.
[0009] Dental caries are polybacterial diseases characterized by the demineralization of the hard tissues of the tooth. This demineralization is due to the production of acids by fermentative bacteria present within the dental biofilm. Streptococcus mutans and Lactobacillus are considered the main cariogenic bacteria. The World Health Organization (WHO) report on oral health highlights the high prevalence of caries, particularly among young people. Compared to the rest of the world, the risk of childhood caries is much higher in developed countries (North America, Australia, Europe, Japan) due to diets very high in sugar. Periodontal diseases are a group of pathologies affecting the periodontium, that is, the supporting tissues of the tooth—bone and gum tissue. These diseases are divided into two main categories: gingivitis and periodontitis.Gingivitis refers to any inflammation limited to the superficial periodontium. Periodontitis is an advanced infectious lesion of the periodontium and often follows gingivitis. The presence of certain bacteria and an intense immune response lead to the destruction of the periodontium. The transition from a healthy state to periodontal disease is accompanied by a gradual shift towards a flora richer in anaerobic and Gram-negative bacteria. This phenomenon is called anaerobic drift. Among the bacterial species most frequently implicated in periodontal diseases in humans are the red complex, composed of bacteria of the species Porphyromonas gingivalis, Treponema denticola, and Tannerella forsythia. Also implicated are bacteria of the species Fusobacterium nucleatum, whose co-aggregation with Porphyromonas gingivalis appears to improve their survival and pathogenicity (see...).for example the articles: Diaz et al., Microbiology, 2002, 148, 467-472; Saito et al., FEMS Immunol. Med. Microbiol., 2008, 54, 349-355; Polak et al., J. Clin. Periodonto., 2009, 36, 406-410).
[0010] To prevent or treat infectious diseases of the oral cavity, it is helpful to maintain or restore the balance between non-pathogenic and pathogenic microorganism populations within the human oral microbiota. This balance allows for the control of dental biofilm formation, development, and composition. Many pathogenic bacteria can be present in the oral microbiota and can stimulate the formation, development, and composition of dental biofilm, potentially contributing to the development of infectious diseases of the human oral cavity.
[0011] For example, bacteria of the genus Tannerella are frequently found in individuals with periodontal disease. In humans, Tannerella bacteria, particularly Tannerella forsythia, form a bacterial complex known as the "red complex" with Porphyromonas gingivalis and Treponema denticola. This "red complex" is strongly associated with advanced periodontal lesions. The bacteria composing the red complex express numerous virulence factors that allow them to colonize the subgingival space, disrupt the host's defense system, invade and destroy periodontal tissues, and promote the host's destructive immunosuppressive response. Therefore, there is a real need to reduce or inhibit the growth of Tannerella bacteria, especially Tannerella forsythia, in the oral microbiota, thus avoiding the aforementioned drawbacks.
[0012] Summary of the invention
[0013] The invention relates to the non-therapeutic use of a yeast product, or a composition comprising it, to reduce or inhibit the growth of bacteria of the genus Tannerella in the oral microbiota, the yeast product being a yeast extract having a pH between 6.0 and 7.0; and comprising, by weight by total weight of the yeast product, 35 to 65% protein (nitrogen x 6.25), 10 to 30% ash and 3% or less sodium chloride.
[0014] The invention also relates to the non-therapeutic use, for reducing or inhibiting the growth of Tannerella bacteria in the oral microbiota, of the combination of the yeast product as defined above with an additional yeast product comprising at least 20% p-glucans, by weight per total weight of the additional yeast product, or of a composition comprising them.
[0015] The invention also relates to a yeast product, or a composition comprising it, for therapeutic use to reduce or inhibit the growth of bacteria of the genus Tannerella in the oral microbiota, the yeast product being a yeast extract having a pH between 6.0 and 7.0; and comprising, by weight by total weight of the yeast product, 35 to 65% protein (nitrogen x 6.25), 10 to 30% ash and 3% or less sodium chloride.
[0016] In some embodiments, the yeast product is used to reduce or inhibit the growth of bacteria of the species Tannerella forsythia.
[0017] In embodiments, the yeast product is a yeast extract having a pH between 6.1 and 6.9; and comprising, by weight by total weight of the yeast product, 40 to 61% protein (nitrogen x 6.25), 13 to 27% ash and 2% or less sodium chloride.
[0018] In embodiments, the yeast product is a yeast extract having a pH between 6.2 and 6.8; and comprising, by weight by total weight of the yeast product, 45 to 57% protein (nitrogen x 6.25), 16 to 24% ash and 1% or less sodium chloride.
[0019] In some embodiments, the yeast product is obtained by implementing a preparation process comprising the following steps:
[0020] - obtaining a yeast cream by fermentation followed by concentration by centrifugation; - washing the yeast cream obtained by adding water and centrifugal concentration;
[0021] - heating the washed yeast cream to a temperature between 60 and 95°C, preferably between 75 and 90°C;
[0022] - incubation under stirring of the yeast cream heated to a temperature of 55 to 90°C, preferably between 55 and 75°C, for a duration of 1 to 5 hours;
[0023] - separation of yeast extract and yeast cell walls by centrifugation;
[0024] - concentration of the yeast extract by evaporation and / or reverse osmosis; and
[0025] - optionally drying of the concentrated yeast extract.
[0026] In some embodiments, the yeast product is administered to mammals; preferably to humans.
[0027] In some embodiments, the additional yeast product may be chosen from the group consisting of one of the following additional products, or mixtures thereof:
[0028] - an additional yeast product comprising, by weight per total weight of the additional yeast product: at least 20%, preferably between 20 and 30%, of p-glucans; at least 20%, preferably between 20 and 30%, of mannans; 25% or less, preferably between 10 and 25%, of proteins; and 10% or less of glycogen;
[0029] - an additional yeast product comprising, by weight per total weight of the additional yeast product: at least 50%, preferably 50 to 90%, again preferably 50 to 80%, again preferably 50 to 70%, again preferably 50 to 60%, of p-glucans; 5% or less, preferably 1 and 5%, of mannans; 10% or less of protein; and 10% or less of glycogen.
[0030] In embodiments (non-therapeutic use), the product, or a composition comprising it, is administered to a healthy subject.
[0031] In some embodiments, the product, or a composition comprising it, is administered to a subject orally.
[0032] In some embodiments (therapeutic use), the product, or a composition comprising it, is administered to a subject with a disease of the oral cavity, or at risk of having one.
[0033] In some embodiments, the composition comprising the yeast product(s) is selected from a food supplement, a parapharmaceutical composition, or a pharmaceutical composition. The inventors have surprisingly demonstrated that the yeast product, optionally in combination with additional yeast products, reduces or inhibits the growth of Tannerella bacteria in the oral microbiota. These bacteria, along with Porphyromonas gingivalis and Treponema denticola, form a bacterial complex known as the "red complex," which is strongly associated with advanced periodontal lesions.The yeast product, optionally in combination with additional yeast products, or the composition including them, is particularly interesting in that it can be used in healthy subjects (non-therapeutic use) or in subjects with a disease of the oral cavity, or at risk of having one (therapeutic use), these two populations of subjects being distinct.
[0034] Detailed description
[0035] The invention is now described in more detail and in a non-limiting manner in the following description.
[0036] Definitions
[0037] By “Saccharomyces cerevisiae yeast strain”, we mean a relatively homogeneous population of Saccharomyces cerevisiae yeast cells obtained by culturing (or multiplying) the starting strain.
[0038] The term "oral microbiota" refers to all the microorganisms, particularly bacteria, present in the oral cavity. The terms "oral microbiota," "buccal microbiota," "human oral microbiota," "dog and cat oral microbiota," "oral cavity microbiota," "oral flora," and "oral flora" can be used interchangeably. The microorganisms present in the oral microbiota can be non-pathogenic or pathogenic. The balance between non-pathogenic and pathogenic microorganism populations therefore determines, from a clinical and biological perspective, whether the oral microbiota is healthy or not.Des microorganismes présent peuvent être, par exemple, les baccteria appartant au genre Actinomyces, Actinomycetemcomitans, Aggregatibacter, Alloprevotella, Alloscardovia, Anaeroglobus, Atopobium, Bacteroides Bifidobacterium, Capnocytophaga, Catonella, Corynebacterium, Dialister, Eggerthia, Eubacteria, Fusobacterium, Haemophilus, Lachnoanaerobaculum, Leptotrichia, Mogibacterium, Moryella, Neisseriaceae, Olsenella, Oribacterium, Parvimonas, Peptoniphilus, Peptostreptococcus, Propionibacterium, Porphyromonas, Prevotella, Rikenellaceae, Ruminococcaceae, Selenomonas, Shuttleworthia, Slackia, Solobacterium, Stomatobaculum, Streptococcus, Tannerella, Treponema ou Veillonella. Pathogenic microorganisms are for example: Tannerella forsythia (T. forsythia), Porphyromonas gingivalis (P. gingivalis), Treponema denticola (T. denticola), Porphyromonas cangingivalis (P. cangingivalis), Porphyromonas gulae (P. gulae), Porphyromonas endodontalis {P. endodontalis), Prevotella intermedia {P.intermedia), Streptococcus mutans (S. mutans) and Streptococcus sobrinus (S. sobrinus). Non-pathogenic microorganisms include, for example: Streptococcus oralis (S. oralis), and Streptococcus mitis (S. mitis).
[0039] The term "biofilm" refers to the film formed on the surface of teeth and oral mucosa, such as the mucous membranes of the tongue, gums, palate, and cheeks, by the oral microbiota. The terms "biofilm," "dental biofilm," "dental plaque," "polymicrobial biofilm," and "polymicrobial film" can be used interchangeably.
[0040] By "periodontium" we mean all the supporting tissues of the tooth, the gums, the bone tissue, the cementum and the periodontal ligament.
[0041] An "infectious disease of the oral cavity" is a medical condition located in the oral cavity (mouth) that results from infection by a pathogenic microorganism. Infectious diseases of the oral cavity include, but are not limited to, dental caries and periodontal disease.
[0042] By "dental caries" or "cavity", we mean an infectious disease of the tooth, which causes damage to the enamel, dentin and / or cementum (pulp).
[0043] By "periodontal health" we mean the absence of inflammation or the presence of a low level of inflammation in an intact or reduced but stable periodontium.
[0044] Periodontal disease refers to inflammation of the tissues supporting the teeth, namely the bone and gums. These infections are caused by the accumulation of pathogenic bacteria and their toxins on the gum line surrounding the teeth. It initially manifests as gingivitis and then, if left untreated, progresses to periodontitis. The terms "periodontal disease" and "periodontal disease" can be used interchangeably.
[0045] "Gingivitis" refers to inflammation of the gums, stage 1 of periodontal disease. The terms "gingivitis," "gum disease," and "gingival inflammation" can be used interchangeably.
[0046] By "periodontitis" we mean the inflammation of the deep tissues of the periodontium, stage 2 of periodontal disease.
[0047] By "postbiotic" we mean a preparation of inanimate microorganisms and / or their components that confer a health benefit to the host.
[0048] The term "treatment" means a method intended to: (1) delay or prevent the onset of a disease or clinical condition; (2) slow or stop the progression, worsening, or deterioration of disease symptoms; (3) improve disease symptoms; and / or (4) cure the disease. A treatment may be administered before the onset of the disease, for prophylactic action (referred to as "prevention"), or it may be administered after the disease has begun, for therapeutic action. In the context of the invention, the term "treatment" generically refers to the reduction and / or prevention of dental biofilm formation, particularly through the growth of periodontogenic and / or cariogenic bacteria.
[0049] By "physiologically acceptable excipient" is meant any medium or additive which does not interfere with the effectiveness of the biological activity of the active ingredient and which is not excessively toxic to the subject at the concentrations at which it is administered.
[0050] The term “pharmaceutical active ingredient” means any compound or substance whose administration has a therapeutic effect or whose administration has a beneficial effect on the health or general condition of a subject to whom it is administered.
[0051] Unless otherwise stated, all percentages for the quantities indicated are mass percentages. For p-glucan percentages, these are expressed as an equivalent mass of glucose. For mannan percentages, these are expressed as an equivalent mass of mannose.
[0052] Yeast product
[0053] The yeast product is a yeast extract having a pH between 6.0 and 7.0; and comprising, by weight per total weight of the yeast product, 35 to 65% protein (nitrogen x 6.25), 10 to 30% ash and 3% or less sodium chloride.
[0054] Yeast, as a living microorganism, comprises cytoplasm surrounded by a cytoplasmic membrane (also called the inner membrane or cell membrane). The cytoplasm contains intracellular compartments, including the nucleus, mitochondria, and Golgi apparatus. The cytoplasmic membrane is surrounded by a cell wall or cortex (the terms "yeast cell walls" and "yeast cortex" are used interchangeably and refer to the insoluble portion of yeast cells, i.e., the cell wall and the plasma membrane of yeast) composed primarily of p-glucans and mannans. The area between the cell membrane and the cell wall forms the periplasm (also called the periplasmic space).
[0055] Yeast products are obtained from the yeast Saccharomyces cerevisiae, and more specifically from a strain of Saccharomyces cerevisiae. Saccharomyces cerevisiae is also known as brewer's yeast or baker's yeast. Many strains of Saccharomyces cerevisiae are known to the art. They are widely used in the food industry for their role in the production of various foods, including breads and fermented beverages. A yeast strain can be obtained from a clone, a clone being a population of yeast cells derived from a single yeast cell. Culturing a strain of Saccharomyces cerevisiae can be carried out using any suitable method. Yeast culture methods are known in the prior art, and those skilled in the art know how to optimize the culture conditions for each strain according to its specific characteristics.Thus, a Saccharomyces cerevisiae yeast can be obtained by multiplying a strain in an appropriate culture medium, for example, as described in the reference work "Yeast Technology", 2. ème edition, 1991, G. Reed and TW Nagodawithana, published by Van Nostrand Reinhold, ISBN 0-442-31982-8.
[0056] In one embodiment, the yeast product being a yeast extract having a pH between 6.1 and 6.9; and comprising, by weight by total weight of the yeast product, 40 to 61% protein (nitrogen x 6.25), 13 to 27% ash and 2% or less sodium chloride.
[0057] In one embodiment, the yeast product being a yeast extract having a pH between 6.2 and 6.8; and comprising, by weight by total weight of the yeast product, 45 to 57% protein (nitrogen x 6.25), 16 to 24% ash and 1% or less sodium chloride.
[0058] The protein content was measured using the Kjedhl method (6.25 times the total nitrogen). The sodium chloride content was measured using the sodium chloride method. The pH was measured at room temperature (18°C) in a solution containing 8.33% dry matter.
[0059] The yeast product can be in powder form.
[0060] The yeast product may comprise at least 94%, preferably at least 96%, by weight of dry matter per total weight of yeast product. Alternatively, the yeast product may comprise 100% or less, preferably 99% or less, by weight of dry matter per total weight of yeast product. The dry matter content may be measured, for example, by a drying method carried out for 5 hours at 105 °C.
[0061] In one embodiment, the yeast product is soluble. By "soluble" is meant a yeast product which can be homogeneously dissolved in water at a concentration of 50 g / L, under stirring and at a temperature of 50°C, the solution comprising less than 500 mg of solid residues i.e. undissolved.
[0062] The yeast product can be obtained by implementing a preparation process comprising the following steps: - obtaining a yeast cream by fermentation followed by concentration by centrifugation;
[0063] - washing of the yeast cream obtained by adding water and centrifugal concentration;
[0064] - heating the washed yeast cream to a temperature between 60 and 95°C, preferably between 75 and 90°C;
[0065] - incubation under stirring of the yeast cream heated to a temperature of 55 to 90°C, preferably between 55 and 75°C, for a duration of 1 to 5 hours;
[0066] - separation of yeast extract and yeast cell walls by centrifugation;
[0067] - concentration of the yeast extract by evaporation and / or reverse osmosis; and
[0068] - optionally drying of the concentrated yeast extract.
[0069] The yeast product is available under the trade name Springer® 4101 ZO-PW-L from the company Biospringer by Lesaffre (Lesaffre group).
[0070] Springer® Yeast Product 4101 ZO-PW-L is in powder form, has a pH between 6.3 and 6.7 (8.33% solution) and comprises at least 94% by weight dry matter, less than 1% by weight sodium chloride, 7.5 to 9.0% by weight total nitrogen, 46.9 to 56.3% by weight protein (nitrogen x 6.25), and 18 to 22% by weight ash (excluding sodium chloride) by total product weight.
[0071] Additional yeast products
[0072] The yeast product according to the invention can be used in combination with at least one additional yeast product.
[0073] The additional yeast product is an extract of p-glucan-rich cell walls of Saccharomyces cerevisiae yeasts, preferentially rich in (3-1,3 / p-1,6-glucans (p-1,3 / [3-1,6-glucans).
[0074] By "rich in p-glucans" is meant a product comprising at least 20% p-glucans by weight of the total weight of the product. The additional yeast product may comprise from 20 to less than 30%, alternatively from 30 to less than 40%, alternatively from 40 to less than 50%, alternatively from 50 to less than 60%, alternatively from 60 to less than 70%, alternatively from 70 to less than 80%, alternatively from 80 to less than 90%, alternatively at least 90%, of p-glucans, by weight of the total weight of the additional yeast product.
[0075] The p-glucans originating from the yeast cell wall are called "(3-cell wall glucans). These p-glucans are essentially glucose polymers in which the glucose units of the main chain are linked by p-1,3 bonds and whose branches are linked by p-1,6 bonds. p-glucans are insoluble and have low viscosity.
[0076] Mannans from yeast cell walls are called "cell wall mannans." These mannans are polysaccharides composed mainly of mannose, more precisely of copolymers of neutral or acidic sugars (with 5 or 6 carbon atoms), linked together by glycosidic bonds and associated with proteins. In Saccharomyces cerevisiae cell wall mannans, mannose is present as a skeleton of 50 or more mannose residues linked by α-(1,6) chains, branched by short chains of mannose linked by α-(1,2) and α-(1,3) chains.
[0077] In one embodiment, the additional yeast product may comprise, by weight per total weight of the additional yeast product:
[0078] - at least 50%, preferably from 50 to 90%, preferably from 50 to 80%, preferably from 50 to 70%, preferably from 50 to 60%, of p-glucans;
[0079] - 5% or less, preferably between 1 and 5%, of mannans;
[0080] - 10% or less protein; and
[0081] - 10% or less of glycogen.
[0082] This additional yeast product may comprise at least 94%, preferably at least 96%, of dry matter, by weight per total weight of the additional yeast product.
[0083] p-glucans and mannans can be present in a (weight / weight) ratio of 12 to 40, preferentially 15 to 30, very preferentially 18 to 22.
[0084] For example, a product of this type is disclosed in application WO 2023194609 A1 published on October 12, 2023.
[0085] In one embodiment, the additional yeast product may comprise, by weight per total weight of the additional yeast product:
[0086] - at least 20%, preferably between 20 and 30%, of p-glucans;
[0087] - at least 20%, preferably 20 to 30%, of mannans;
[0088] - 25% or less, preferably 10 to 25%, of protein; and
[0089] - 10% or less of glycogen.
[0090] This additional yeast product may comprise at least 94%, preferably at least 96%, of dry matter, by weight per total weight of the additional yeast product.
[0091] For example, a product of this type is disclosed in international application WO 2020152229 A1 published on July 30, 2020. The additional yeast product can be obtained from any process that yields a product rich in p-glucans.
[0092] The additional yeast product corresponds to the insoluble fraction of the yeast. The insoluble fraction can be obtained using conventional production methods. The production method can be biochemical and / or mechanical. For example, the mechanical method can be implemented using glass beads, a high-pressure homogenizer, ultrasound, or microwaves. For example, the biochemical method can be implemented by autolysis, thermal plasmolysis, enzymatic hydrolysis, osmotic shock, or repeated freeze-thaw cycles. In particular, the process may include the following steps: autolysis or enzymatic hydrolysis of the whole yeast; then separation of the insoluble fraction and removal of the soluble fraction; and optionally, drying of the soluble fraction.The soluble fraction is conventionally called "yeast extract" and comprises the majority of amino acids, including glutamic acid, peptides, and minerals. The insoluble fraction comprises yeast cell walls, polymers, polysaccharides, nucleotides, and thermocoagulated proteins. Conventional extraction methods are disclosed in the reference work "Yeast Technology," 2. ème edition, 1991, G. Reed and TW Nagodawithana, published by Van Nostrand Reinhold, ISBN 0-442-31982-8.
[0093] Uses
[0094] The present invention relates to the use of a yeast product as a postbiotic in the field of oral hygiene and health. The yeast product selectively inhibits the growth of host microorganisms, thus conferring a health benefit.
[0095] The yeast product is used to reduce or inhibit the growth of bacteria of the genus Tannerella, particularly the bacterium of the species Tannerella forsythia, in the oral microbiota.
[0096] The action of the yeast product on reducing or inhibiting the growth of bacteria of the genus Tannerella, in particular the bacterium of the species Tannerella forsythia, helps to maintain or restore the good health of the oral microbiota and therefore helps to prevent or treat infectious diseases of the oral cavity, in particular periodontal diseases.
[0097] The use of the yeast product, including its therapeutic or non-therapeutic use, depends on the subject to whom it is administered.
[0098] If the individual is in good health, the yeast product may be administered to maintain their well-being, particularly to maintain satisfactory oral hygiene. This is a non-therapeutic use of the yeast product. The yeast product may be formulated as a food supplement, a parapharmaceutical composition, or any other suitable non-therapeutic form.
[0099] If the individual has an infectious disease of the oral cavity, or is at risk of developing one, the yeast product may be administered to prevent, limit, or treat the disease. This is a therapeutic use of the yeast product. The yeast product may be formulated as a pharmaceutical composition or any other suitable therapeutic form.
[0100] The method according to the invention can be used to treat a first episode of infectious disease of the oral cavity, in particular gingivitis or periodontitis, or a recurrence.
[0101] The yeast product can be administered alone. Alternatively, the product can be administered with another yeast product as defined above. Alternatively, the yeast product can be administered with another therapy, for example, an antibiotic or an antiseptic. Alternatively, the yeast product can be administered with another prebiotic, probiotic, and / or postbiotic product. Alternatively, the yeast product can be administered in combination with a mechanical or surgical procedure, including scaling, root planing, curettage, filling, restoration, or root canal treatment.
[0102] Topics
[0103] The yeast product may be administered to a subject. The subject may already have an infectious disease of the oral cavity, or be at risk of developing one. When the subject has such a disease, the term "patient" may be used interchangeably.
[0104] The yeast product can be administered to a human. This can be a human of any age, including newborns, children, adolescents, adults, and the elderly.
[0105] Effective quantity
[0106] The use of this product to reduce or inhibit the growth of Tannerella bacteria (and the corresponding method of treatment and / or prevention) involves administering an effective amount of the yeast product to the individual. The effective amount, which may be administered in one or more doses, can be determined by a physician, dentist, or other appropriate professional. The exact amount to be administered may vary from individual to individual, depending on the species, age, weight, general condition of the individual, the presence or absence of an infectious disease of the oral cavity, and, if applicable, its nature, severity, and / or extent. The effective amount may also vary depending on the desired therapeutic effect (reduction and / or prevention of dental biofilm formation).
[0107] Form of administration
[0108] The yeast product can be administered as such or in the form of a preparation or composition.
[0109] The yeast product can be administered as a food supplement to reduce or inhibit the growth of bacteria of the genus Tannerella, preferably to reduce or inhibit the growth of bacteria of the species Tannerella forsythia. The food supplement can be in the form of a lozenge, candy, chewing gum, orodispersible powder, powder to be dissolved in water in stick or sachet form, lozenge or chewable tablet, chewing gum, capsule, tablet, biscuit, sweet, drops, or a bottle with a dosing cap.
[0110] The yeast product can be administered as a parapharmaceutical composition to reduce or inhibit the growth of bacteria of the genus Tannerella, preferably to reduce or inhibit the growth of bacteria of the species Tannerella forsythia. The parapharmaceutical composition may be in the form of sachets, powders, capsules, softgels, toothpastes, gummies, or gels.
[0111] The yeast product may be administered as a pharmaceutical composition to reduce or inhibit the growth of bacteria of the genus Tannerella, preferably to reduce or inhibit the growth of bacteria of the species Tannerella forsythia. The pharmaceutical composition may be available by prescription or over the counter. The pharmaceutical composition may be administered using any combination of dosage and route of administration effective in achieving the desired therapeutic or prophylactic effect. The effective amount to be administered may vary from one individual to another, depending on the species, age, weight, general condition of the individual, the presence or absence of an infectious disease of the oral cavity, and, if applicable, its nature, severity, and / or extent, etc.
[0112] The pharmaceutical composition may be intended for topical administration or oral administration.
[0113] The pharmaceutical composition may include a physiologically acceptable excipient. A physiologically acceptable excipient may be one suitable for administration to mammals, particularly humans.
[0114] The pharmaceutical composition may include at least one additional active pharmaceutical ingredient having soothing, anti-irritant, analgesic, pain-relieving, anti-inflammatory, healing, antibiotic, antipyretic or antifungal activity.
[0115] The pharmaceutical composition may include at least one additive, for example an additive chosen from the group consisting of preservatives, sweeteners, flavorings, thickening agents, colorings, humectants, disintegrating agents, absorption accelerators, lubricating agents, and mixtures thereof.
[0116] The pharmaceutical composition may be in any form suitable for administration to a subject, preferably a mammal, most preferably a human, a dog or a cat.
[0117] The pharmaceutical composition may be in the form of tablets, pills, dragees, capsules, pearls, syrups, emulsions, ointments, pastes, gels, powders, sachets or injectable solutions.
[0118] The yeast product, optionally in combination with an additional yeast product, or the composition comprising it(s), may be administered by incorporation into a dental medical device comprising the yeast product, as defined above, to reduce or inhibit the growth of bacteria of the genus Tannerella, preferably to reduce or inhibit the growth of bacteria of the species Tannerella forsythia. The dental device may be a dental implant, a dental crown, a dental bridge, a dental onlay, or a dental prosthesis.
[0119] Example
[0120] The following example illustrates the invention without limiting it.
[0121] Study of the effects of the yeast product Springer® 4101 / 0-PW-L on the Tannerella forsythia population using an in vitro human oral biofilm model
[0122] Preparation of the in vitro human oral biofilm model: For each culture, dental plaque was collected from four to seven patients with periodontal disease by brushing their teeth, followed by mouthwash. The dental biofilm samples were transferred to an anaerobic chamber immediately after collection and then pooled. An artificial saliva culture medium (modified McBain medium) was prepared extemporaneously for each culture and pre-reduced under anaerobic conditions. The culture was performed in twelve-well plates placed on a rotating platform at 37°C under anaerobic conditions. Glass coverslips, placed vertically in the wells, were used as a substrate for the attachment of the dental biofilm. The culture medium was replaced every three days. Cultures were performed in triplicate.
[0123] Yeast product to be tested: Springer® 4101 / 0-PW-L yeast product marketed by Biospringer by Lesaffre (Lesaffre Group). This yeast product, in powder form, has a pH between 6.3 and 6.7 (8.33% solution) and comprises at least 94% by weight of dry matter, less than 1% by weight of sodium chloride, 7.5 to 9.0% by weight of total nitrogen, 46.9 to 56.3% by weight of protein (nitrogen x 6.25), and 18 to 22% by weight of ash (excluding sodium chloride) by total weight of the product. The yeast product was dissolved in demineralized water and sterilized by filtration.
[0124] Amounts of yeast product tested: The yeast product was tested at two different concentrations, namely 5 g / L and 10 g / L.
[0125] Analysis of the composition of bacteria of the genus Tannerella by quantitative polymerase chain reaction (PCR) (method): The population of bacteria of the species Tannerella forsythia was determined by amplification sequencing of the hypervariable V4 region of the 16s ribosomal gene using a quantitative PCR (qPCR) method with the following 5'-3' primers:
[0126] - GACTGTCAGTTGCTAACAGGTAAAGCT (p192)
[0127] - CCAACCTTCCTCACAGCTACG (p193)
[0128] - ACTCTGGCGGGACTG (p194)
[0129] qPCR was performed using the "RT PCR master mix" (Diagenode, Seraing, Belgium) with the "Applied Biosystems 7500 RT PCR system" for 45 cycles, with a denaturation step at 95°C for 15 seconds, followed by a hybridization / elongation step at 60°C for 1 minute. A standard curve was established by genomic DNA analysis of the tested species.
[0130] Analysis of Tannerella bacterial composition by quantitative polymerase chain reaction (PCR) (results): The presence of Tannerella forsythia bacteria in the dental biofilm was measured by qPCR. The results obtained are reported in Table 1 below:
[0131] Table 1
[0132] Conclusion: The yeast product shows potential to inhibit the growth of bacteria of the species Tannerella forsythia.
Claims
DEMANDS 1. Non-therapeutic use of a yeast product, or a composition comprising it, to reduce or inhibit the growth of bacteria of the genus Tannerella in the oral microbiota, the yeast product being a yeast extract having a pH between 6.0 and 7.0; and comprising, by weight by total weight of the yeast product, 35 to 65% protein (nitrogen x 6.25), 10 to 30% ash and 3% or less sodium chloride.
2. Non-therapeutic use according to claim 1, the yeast product being used to reduce or inhibit the growth of Tannerella forsythia bacteria.
3. Non-therapeutic use according to any one of the preceding claims, the yeast product being a yeast extract having a pH between 6.1 and 6.9; and comprising, by weight by total weight of the yeast product, 40 to 61% protein (nitrogen x 6.25), 13 to 27% ash and 2% or less sodium chloride.
4. Non-therapeutic use according to any one of the preceding claims, the yeast product being a yeast extract having a pH between 6.2 and 6.8; and comprising, by weight by total weight of the yeast product, 45 to 57% protein (nitrogen x 6.25), 16 to 24% ash and 1% or less sodium chloride.
5. Non-therapeutic use according to any one of the preceding claims, the yeast product being obtained by implementing a preparation process comprising the following steps: - obtaining a yeast cream by fermentation followed by concentration by centrifugation; - washing of the yeast cream obtained by adding water and centrifugal concentration; - heating the washed yeast cream to a temperature between 60 and 95°C, preferably between 75 and 90°C; - incubation under stirring of the yeast cream heated to a temperature of 55 to 90°C, preferably between 55 and 75°C, for a duration of 1 to 5 hours; - separation of the yeast extract and yeast cell walls by centrifugation; - concentration of the yeast extract by evaporation and / or reverse osmosis; and - optionally drying of the concentrated yeast extract.
6. Non-therapeutic use according to any of the preceding claims, the yeast product being administered to mammals; preferably to humans.
7. Non-therapeutic use according to any of the preceding claims, the product, or a composition comprising it, being administered to a healthy subject.
8. Non-therapeutic use to reduce or inhibit the growth of Tannerella bacteria in the oral microbiota, preferably to reduce or inhibit the growth of Tannerella forsythia bacteria, of the combination of the yeast product according to any of the preceding claims with an additional yeast product comprising at least 20% p-glucans, by weight per total weight of the product, or of a composition comprising them.
9. Non-therapeutic use according to claim 8, the additional yeast product being selectable from the group consisting of one of the following additional products, or mixtures thereof: - an additional yeast product comprising, by weight per total weight of the additional yeast product: at least 20%, preferably between 20 and 30%, of p-glucans; at least 20%, preferably between 20 and 30%, of mannans; 25% or less, preferably between 10 and 25%, of proteins; and 10% or less of glycogen; - an additional yeast product comprising, by weight per total weight of the additional yeast product: at least 50%, preferably 50 to 90%, again preferably 50 to 80%, again preferably 50 to 70%, again preferably 50 to 60%, of p-glucans; 5% or less, preferably 1 and 5%, of mannans; 10% or less of protein; and 10% or less of glycogen.
10. Non-therapeutic use according to claim 8 or 9, the combination of yeast products being administered to mammals; preferably to humans.
11. Non-therapeutic use according to any of the preceding claims, the product being administered to a subject orally.
12. Non-therapeutic use according to any of the preceding claims, the composition comprising the yeast product being selected from a food supplement or a parapharmaceutical composition.
13. Yeast product, or a composition comprising it, for therapeutic use to reduce or inhibit the growth of bacteria of the genus Tannerella in the oral microbiota, preferentially to reduce or inhibit the growth of Tannerella forsythia bacteria, the yeast product being a yeast extract having a pH between 6.0 and 7.0; and comprising, by weight by total weight of the yeast product, 35 to 65% protein (nitrogen x 6.25), 10 to 30% ash and 3% or less sodium chloride.
14. The yeast product, or a composition comprising it, for use according to claim 11, the product being administered to a subject having a disease of the oral cavity, or at risk of having one.
15. The composition comprising the yeast product, for use according to one of claims 13 or 14, the composition being a pharmaceutical composition.