Oligonucleotides with new internucleoside linkage

Internucleoside linkages in oligonucleotides address the inefficiencies of cellular uptake and endosomal trapping by providing cationic groups, enhancing delivery and therapeutic efficacy.

WO2026099473A1PCT designated stage Publication Date: 2026-05-15VICO THERAPEUTICS BV
View PDF 16 Cites 0 Cited by

Patent Information

Application Number
PCT/EP2025/082436
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2025-10-01
Filing Date
2025-11-10
Publication Date
2026-05-15

AI Technical Summary

Technical Problem

Existing oligonucleotide delivery methods, particularly for antisense oligonucleotides (AONs), face inefficiencies in cellular uptake and endosomal trapping, leading to low therapeutic efficacy and potential cytotoxicity due to their anionic character and large size.

Method used

The introduction of internucleoside linkages, such as those represented by formulas (I) and (II), which provide cationic groups under physiological conditions, enhancing interactions with cellular membranes and promoting endosomal disruption, thereby improving cellular uptake and delivery.

Benefits of technology

The internucleoside linkages enhance cellular uptake and delivery of oligonucleotides, increasing their therapeutic potency and reducing off-target effects, allowing for more efficient targeting and stability in the cellular milieu.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure EP2025082436_15052026_PF_FP_ABST
    Figure EP2025082436_15052026_PF_FP_ABST
Patent Text Reader

Abstract

The current invention provides an improved oligonucleotide and its use for treating, ameliorating, preventing, delaying and / or treating a human genetic disorder, said oligonucleotide comprising an internucleoside linkage of the following formula (I).
Need to check novelty before this filing date? Find Prior Art

Description

[0001] OLIGONUCLEOTIDES WITH NEW INTERNUCLEOSIDE LINKAGE

[0002] Field

[0003] The invention relates to the field of human genetics. The invention in particular relates to the use of antisense oligonucleotides (AONs) with improved characteristics enhancing clinical applicability as further defined herein.

[0004] Background of the invention

[0005] In the recent years, a large share of synthetic oligonucleotides, in particular AONs, is widely used, for instance, for diagnostics, in sequencing, and in gene synthesis as well as gene therapy. Synthesis of oligonucleotides, in particular AONs, for use in therapies is a growing area within an increasing market. Solid phase oligonucleotide synthesis is a conventionally used method for creating custom oligonucleotides, including the AONs. Solid phase oligonucleotide synthesis is a well-known technology and has become essential in life-sciences.

[0006] The structure and modifications of synthesized oligonucleotides can significantly impact their cellular uptake. Cellular uptake refers to the process by which cells internalize substances from their external environment. The size, shape, surface charge, and / or chemical composition of the oligonucleotides can significantly affect their interaction with the cell membrane and subsequent uptake. For instance, smaller nanoparticles may enter cells more easily than larger ones, and surface modifications can enhance or inhibit uptake.

[0007] Santorelli et al. (2022) investigates a method for modifying DNA during solid-phase synthesis by using sulfonyl azides as reactive intermediates. Sulfonyl azides are employed to introduce chemical handles and functional groups directly onto the DNA strand, allowing for further chemical modifications post-synthesis. This approach allows for site-specific modifications and the incorporation of multiple functional groups into the DNA sequence. For instance, taurine azide is used to introduce a sulfonamide linkage onto the AON’s backbone. Taurine’s primary amine is left as the remaining functional group. This moiety might increase the overall hydrophilicity, may improve the AON’s interaction with aqueous environments or enable specific binding interactions based on charge. Taurine-modified DNA may prove advantageous in contexts where robust, charge-based interactions with other molecules or surfaces are sought. However, the synthetic intermediates, at least the ones disclosed by Santorelli et al. (2022), are not meant for use of any kind, neither diagnostic nor therapeutic.

[0008] Traditional methods of oligonucleotide synthesis have enabled the production of custom sequences, but the introduction of functional groups to oligonucleotides post-synthesis is often labor-intensive, inefficient, and limited in scope. Hence, it is an object of the invention to provide improved oligonucleotides, in particular AONs, with improved characteristics that overcome the limitations of conventional post-synthetic modifications, offering for example higher efficiency, better scalability, and broader applicability, such as various gene-related therapies. Such oligonucleotides are described below in more detail. In an embodiment, such oligonucleotides of the invention are antisense oligonucleotides (AONs) of the invention (or AON or ASO of the invention).

[0009] Summary of the invention

[0010] One of the major constraints on the therapeutic use of oligonucleotides, in particular AONs, is inefficient delivery to their sites of action in the cytosol or nucleus of cells. Due to the anionic character and large size of oligonucleotides, in particular AONs, the uptake in cells is not very effective. Even after the uptake, the large portion of AONs remains trapped within the endosomes. It is estimated that around 1 to 2 % of oligonucleotides, in particular AONs, are able to escape the endosomes to become an effective therapeutic agents (Dowdy et al., 2022). Attempts to improve the delivery of oligonucleotides, in particular AONs, using for instance cell penetrating peptides, modified sugar chemistries etc. often resulted in large side effects like increased cytotoxicity and aggregation. Taurine and / orguanidine linkages give an extra positive charge to the oligonucleotides, in particular AONs, which may lead to increased interactions with the cellular / endosomal membranes and might enhance uptake and endosomal disruption. Moreover, taurine and guanidine chemically resemble the amino acids lysine and arginine respectively, both of which are preferentially used in well-studied cell penetrating peptides.

[0011] In accordance with at least one aspect of the invention, an oligonucleotide which comprises an internucleoside linkage according to the invention is provided. Furthermore, in accordance with at least one aspect of the invention, an oligonucleotide for use as a medicament which comprises an internucleoside linkage according to the invention is provided.

[0012] In a first aspect, provided herein is an oligonucleotide comprising an internucleoside linkage represented by formula (IV): wherein L is a linear chain of 1 up to 6 units independently selected from -CH2-, - CHCH2-, -O-, -NH- or -N(CH3)-; wherein Xi and X3 are independently -O- or -S-; wherein X2 is -OH or -SH; wherein Z is a group comprising a non-hydrogen atom, preferably a nitrogen atom; wherein Z-NH is cationic under physiological conditions; and wherein is a bond to a nucleoside or to a terminal group. In an embodiment, an oligonucleotide according to a first aspect of the invention is provided, wherein L is a linear chain of 1 up to 4 units and wherein Z comprises 1 up to 6 carbon atoms and 0 up to 4 nitrogen atoms, preferably wherein Z has a formula C1-6N0-4H1-10.

[0013] In an embodiment, an oligonucleotide according to a first aspect of the invention is provided, wherein Z is -C(=NH)-NH2.

[0014] In an embodiment, an oligonucleotide according to a first aspect of the invention is provided, wherein the oligonucleotide is for use as a medicament.

[0015] In a second aspect, provided herein is an oligonucleotide for use as a medicament, comprising an internucleoside linkage represented by formula (I):

[0016] O xf

[0017] W-S-N=P-X

[0018] 11 12o x3

[0019] (I) wherein Xi and X3 are independently -O- or -S-; wherein X2 is -OH or -SH; wherein W is a group that is cationic under physiological conditions; and wherein is a bond to a nucleoside or to a terminal group.

[0020] In an embodiment, an oligonucleotide for use according to a second aspect of the invention is provided, wherein W comprises 1 up to 10 carbon atoms and 1 up to 5 nitrogen atoms, preferably wherein W has a formula C1-10N1-5H1-15.

[0021] In an embodiment, an oligonucleotide for use according to a second aspect of the invention is provided, wherein the internucleoside linkage represented by formula (I) is represented by formula (II): o 11 x 11

[0022] L-S-N=P-X2

[0023] Y 6 X3

[0024] (II) wherein L is a linear chain of 1 up to 10 units, preferably 1 up to 6 units, independently selected from -CH2-, -CH2CH2-, -O-, -NH- or -N(CH3)-; and wherein Y is a group that is cationic under physiological conditions.

[0025] In an embodiment, an oligonucleotide for use according to a second aspect of the invention is provided, wherein L is a linear chain of 1 up to 6 units, preferably 1 to 4 units, and Y comprises 1 up to 10 carbon atoms and 1 up to 5 nitrogen atoms, more preferably wherein Y has a formula C1-10N1-5H1-10.

[0026] In an embodiment, an oligonucleotide according to a second aspect of the invention is provided for use, wherein Y is -NH2 or -NH-C(=NH)-NH2.

[0027] In an embodiment, an oligonucleotide for use according to a second aspect of the invention is provided, wherein Y is -NH-C(=NH)-NH2.

[0028] In an embodiment an oligonucleotide according to a first aspect of the invention, or an oligonucleotide for use according to a second aspect is provided, wherein L is -CH2-CH2-.

[0029] In an embodiment an oligonucleotide or an oligonucleotide for use according to a first aspect and second aspect of the invention is provided, wherein the internucleoside linkage is represented by formula (VII) or (IX):

[0030] (VII) (IX)

[0031] In an embodiment an oligonucleotide or an oligonucleotide for use according to a first aspect and second aspect of the invention is provided, wherein the internucleoside linkage is represented by (IX)

[0032] In an embodiment an oligonucleotide or an oligonucleotide for use according to a first aspect and second aspect of the invention is provided, wherein the length of said oligonucleotide is from 16 to 42 nucleotides. In an embodiment, such an oligonucleotide or an oligonucleotide for use comprises 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 internucleoside linkages as defined in any embodiment of the first and second aspects of the invention.

[0033] In an embodiment an oligonucleotide or an oligonucleotide for use according to a first aspect and second aspect of the invention is provided, wherein the efficiency of gymnosis of an oligonucleotide or of the oligonucleotide of use is improved compared to the efficiency of gymnosis of an oligonucleotide lacking any internucleoside linkage as identified in any one of the embodiments of the first and second aspects of the invention, but having otherwise the same sequence and preferably chemistry.

[0034] In an embodiment an oligonucleotide or an oligonucleotide for use according to a first aspect and second aspect of the invention is provided, wherein said oligonucleotide comprises 1 , 2, 3, 4, or 5 internucleoside linkages as defined in any one of the embodiments of the first and second aspects of the invention in at least one wing of said oligonucleotide, preferably in both wings of said oligonucleotide.

[0035] In an embodiment an oligonucleotide or an oligonucleotide for use according to a first aspect and second aspect of the invention is provided, wherein said oligonucleotide comprises 1 up to 3 internucleoside linkages as defined in any one of the embodiments of the first and second aspects of the invention, wherein said linkage is positioned at the 5’ and / or 3’ of the oligonucleotide.

[0036] In an embodiment an oligonucleotide or an oligonucleotide for use according to a first aspect and second aspect of the invention is provided, wherein said oligonucleotide further comprises at least one internucleoside linkage as defined in any one of the embodiments of the first and second aspects of the invention, wherein said linkage is positioned in the central portion of the oligonucleotide.

[0037] In an embodiment an oligonucleotide or an oligonucleotide for use according to a first aspect and second aspect of the invention is provided, wherein the internucleoside linkage defined in any one of the embodiments of the first and second aspects of the invention is represented by formula (VII) or (IX).

[0038] In an embodiment an oligonucleotide or an oligonucleotide for use according to a first aspect and second aspect of the invention is provided, wherein said oligonucleotide is an antisense oligonucleotide and / or a single stranded oligonucleotide.

[0039] In an embodiment an oligonucleotide or an oligonucleotide for use according to a first aspect and second aspect of the invention is provided, wherein a nucleotide of said oligonucleotide is modified compared to an RNA nucleotide, preferably wherein said modification is selected from the group consisting of a modified base, a modified sugar and another modified internucleoside linkage than the one defined in any one of the embodiments of the first and second aspects of the invention .

[0040] In an embodiment an oligonucleotide or an oligonucleotide for use according to a first aspect and second aspect of the invention is provided, wherein the modified base is 5-methylcytosine and / or 5-methyluracil, the modified sugar is 2’-O-methyl and / or the other modified internucleoside linkage is phosphorothioate.

[0041] In an embodiment an oligonucleotide or an oligonucleotide for use according to a first aspect and second aspect of the invention is provided, wherein said oligonucleotide is at least 90% reverse complementary with a region of a target transcript and / or remains in association to its target when there are up to 20% of mismatched nucleotides.

[0042] In an embodiment an oligonucleotide or an oligonucleotide for use according to a first aspect and second aspect of the invention is provided, wherein said oligonucleotide comprises or consists of a base sequence represented by SEQ ID NOs: 1 , 211 , 212, 213, 214, 215, and 219.

[0043] In an embodiment an oligonucleotide or an oligonucleotide for use according to a first aspect and second aspect of the invention is provided, wherein said oligonucleotide comprises or consists of a base sequence represented by SEQ ID NOs: 3-6, 93, 94, 96, 99-114, 116-131 , 133-148, 150-171 , 173-178, 217, and 218.

[0044] In an embodiment an oligonucleotide or an oligonucleotide for use according to a first aspect and second aspect of the invention is provided, wherein said oligonucleotide:

[0045] - modulates, preferably reduces, a detectable amount of a mutant transcript and / or

[0046] - modulates, preferably reduces, the translation rate of said mutant transcript and thus the amount of corresponding mutant protein and / or

[0047] - induces the specific degradation of the mutant transcript, preferably wherein said oligonucleotide reduces or inhibits the amount of said mutant protein, and / or

[0048] - is used for splicing modulation activities such as exon skipping or exon inclusion, and / or gene or RNA editing activities such as ADAR-recruiting activity, CRISPR, Retron Library Recombineering (RLR), Cas-CLOVER Nucleases, NgAgo protein gene editing, Zinc Finger Nucleases, FANA antisense oligonucleotide, Transcription activator-like effector nucleases (TALENs), and / or

[0049] - gene activation activities, and / or wherein the oligonucleotides modulates, preferably increases, the amount of at least a transcript molecule, and / or at least a target protein and / or a target RNA.

[0050] In an embodiment an oligonucleotide or an oligonucleotide for use according to a first aspect and second aspect of the invention is provided, wherein the oligonucleotide is a gapmer.

[0051] In a third aspect, provided herein is a composition comprising an oligonucleotide or an oligonucleotide for use according to a fist and second aspect described herein, preferably wherein said composition comprises at least one excipient that may further aid in enhancing the targeting and / or delivery of said composition and / or said oligonucleotide to a tissue and / or cell and / or into a tissue and / or cell.

[0052] In an embodiment, provided herein is an oligonucleotide for use according to a second aspect of the invention or a composition for use according to a third aspect, for use in treating, delaying, ameliorating and / or preventing a human genetic disease.

[0053] In an embodiment, provided herein is an oligonucleotide for use according to a second aspect of the invention or a composition for use according to a third aspect, wherein administration of said oligonucleotide or composition is via an intravenous, subcutaneous, intraventricular, intrathecal, intramuscular, intranasal, enteral, intravitreal, intracerebral, epidural or oral route.

[0054] In a fourth aspect, provided herein is a method for treating, delaying, ameliorating and / or preventing a human genetic disease by administering an oligonucleotide as defined in a first and second aspect of the invention, or a composition as defined in a third aspect.

[0055] In an embodiment, provided is an oligonucleotide, preferably according to a first and second aspect of the invention for nucleic acid editing such as gene or RNA editing, said oligonucleotide comprising: a) an internucleoside linkage as defined in any one of earlier embodiments of the first and second aspects of the invention, b) a base sequence capable of hybridizing with a target region in a target nucleic acid, wherein the resulting hybridized duplex comprises an editing window, and c) a mismatch-forming nucleotide positioned within the editing window and opposite of a nucleotide to be edited

[0056] In an embodiment, the oligonucleotide for nucleic acid editing is for use as a medicament.

[0057] In an embodiment, provided is the oligonucleotide for nucleic acid editing or such an oligonucleotide for use, wherein the oligonucleotide comprises at least one conformationally restricted nucleotide (CRN).

[0058] In an embodiment, provided is the oligonucleotide for nucleic acid editing or such an oligonucleotide for use, wherein the oligonucleotide comprises at least one internal CRN.

[0059] In an embodiment, provided is the oligonucleotide for nucleic acid editing or such an oligonucleotide for use, wherein the oligonucleotide further comprises at least one CRN positioned at the 5’ and / or 3’ terminus of the oligonucleotide. In an embodiment, provided is the oligonucleotide for nucleic acid editing or such an oligonucleotide for use, wherein the CRN further comprises a modified base, preferably a 5- methylcytosine.

[0060] In an embodiment, provided is the oligonucleotide for nucleic acid editing or such an oligonucleotide for use, wherein the CRN is a Bridged Nucleic Acid (BNA), and preferably wherein the BNA is a Locked Nucleic Acid (LNA).

[0061] In an embodiment, provided is the oligonucleotide for nucleic acid editing or such an oligonucleotide for use, wherein the length of the oligonucleotide is from 26 to 50 nucleotides, preferably from 30 to 45 nucleotides, more preferably from 32 to 49 nucleotides, even more preferably from 37 to 41 nucleotides, most preferably 39 nucleotides.

[0062] In an embodiment, provided is the oligonucleotide for nucleic acid editing or such an oligonucleotide for use, wherein the oligonucleotide comprises at least 1 , 2, 3, 4, 5, 6, 7, 8, 9 or 10 internucleoside linkages as defined in the first and second aspects of the invention.

[0063] In an embodiment, provided is the oligonucleotide for nucleic acid editing or such an oligonucleotide for use, wherein the efficiency of gymnosis of the oligonucleotide or of the oligonucleotide for use is improved compared to the efficiency of gymnosis of an oligonucleotide lacking any internucleoside linkage as identified in any one of the embodiments of the first and second aspects of the invention but having otherwise the same sequence and preferably chemistry.

[0064] In an embodiment, provided is the oligonucleotide for nucleic acid editing or such an oligonucleotide for use, wherein the oligonucleotide is an antisense oligonucleotide and / or a single-stranded oligonucleotide.

[0065] In an embodiment, provided is the oligonucleotide for nucleic acid editing or such an oligonucleotide for use, wherein the oligonucleotide, in addition to the mismatch-forming nucleotide, further comprises another non-complementary or a further modified nucleotide, preferably wherein the modified nucleotide is chemically modified.

[0066] In an embodiment, provided is the oligonucleotide for nucleic acid editing or such an oligonucleotide for use, wherein the non-complementary nucleotide comprises a mismatch or a wobble base, and preferably is an inosine nucleotide, and wherein the chemically modified nucleotide comprises a modified base, more preferably 5-methylcytosine and / or 5-methyluracil, and / or a 2’ modification of the sugar ring, even more preferably 2-O’-methyl, and / or another modified internucleoside linkage, most preferably a phosphorothioate and / or a phosphoryl guanidine (PN) linkage. In an embodiment, provided is the oligonucleotide for nucleic acid editing or such an oligonucleotide for use, wherein the oligonucleotide comprises one or more phosphorothioate internucleoside linkages, preferably wherein the oligonucleotide comprises phosphorothioate internucleoside linkages between the most terminal two nucleotides at the 5’ terminus and / or between the most terminal two nucleotides at the 3’ terminus of the oligonucleotide, and / or the oligonucleotide comprises one or more phosphoryl guanidine (PN) internucleoside linkages, preferably wherein the phosphoryl guanidine (PN) is dimethylimidazolidin-2- ylidene (dmi) phosphoramidate (PN-dmi-phosphoramidate), optionally wherein the one or more phosphoryl guanidine (PN) internucleoside linkages occur between the first and second nucleotide in the 3’ position of the mismatch-forming nucleotide opposite of a target nucleotide

[0067] In an embodiment, provided is the oligonucleotide for nucleic acid editing or such an oligonucleotide for use, wherein the mismatch-forming nucleotide positioned opposite of a nucleotide to be edited comprises a cytosine base or a cytosine base analogue, wherein the cytosine base analogue is preferably a pyridine base, more preferably 6-amino-5 nitro-2(1 H)- pyridinone (Benner’s Z base), and wherein the uracil base analogue is a purine base, most preferably wherein the purine base is an N3-uridine.

[0068] In an embodiment, provided is the oligonucleotide for nucleic acid editing or such an oligonucleotide for use, wherein the target nucleic acid is a protein-coding RNA or a non-coding RNA.

[0069] In an embodiment, provided is the oligonucleotide for nucleic acid editing or such an oligonucleotide for use, wherein the target nucleic acid comprises an endogenous proteincoding MECP2 RNA encoding a human Methyl CpG Binding Protein 2 (MECP2).

[0070] In an embodiment, provided is the oligonucleotide for nucleic acid editing or such an oligonucleotide for use, or a composition comprising said oligonucleotide for use in medicine, preferably for use in treating, inhibiting, and / or preventing a genetic disease associated or linked with a target nucleic acid, more preferably a disease of the central nervous system, even more preferably wherein the disease of the central nervous system is caused by mutations of the gene encoding MECP2 in a subject, and most preferably wherein the disease is Rett syndrome. In a further aspect, provided is an in vitro or an ex vivo method for editing a nucleotide comprised in a target nucleic acid in a cell, said method comprising contacting the cell with an editing oligonucleotide or such an oligonucleotide for use, wherein the cell is a human cell, preferably a cell of the central nervous system.

[0071] Description of the invention

[0072] Various features of the aspects and embodiments of this invention are further described below. It is noted that headings used throughout this specification are to assist navigation only and should not be interpreted as definitive, and that features described in different sections may be relevant for all aspects and embodiments described herein and may thus be combined as appropriate.

[0073] Oligonucleotide

[0074] In one aspect, the invention provides an oligonucleotide which comprises an internucleoside linkage represented by formula (I): wherein Xi and X3 are independently -O- or -S-, wherein X2 is -OH or -SH, wherein W is a group that is cationic under physiological conditions, wherein is a bond to a nucleoside or to a terminal group. An oligonucleotide according to this aspect may be called an oligonucleotide of or according to the invention. Wherever an oligonucleotide is mentioned in this application, reference is made to an oligonucleotide of the invention, unless explicitly mentioned otherwise.

[0075] In a preferred embodiment, an oligonucleotide comprising an internucleoside linkage represented by formula (I) is provided, wherein W comprises 1 up to 10 carbon atoms and 1 up to 5 nitrogen atoms, preferably wherein W has a formula C1-10N1-5H1-15.

[0076] In an embodiment, the invention provides an oligonucleotide of the invention wherein the internucleoside linkage represented by formula (I) is represented by formula (II), wherein Xi,

[0077] X2, X3, and -~vv are the same as in formula (I):

[0078] O X-] ii i L-S-N=P-X2! 6 x3

[0079] (II) wherein L is a linear chain of 1 up to 10 units, preferably 1 up to 6 units, independently selected from -CH2-, -CH2CH2-, -O-, -NH- or -N(CH3)-, wherein Y is a group that is cationic under physiological conditions. Preferably, Y has a molecular weight equal to or lower than 200 Da.

[0080] In an embodiment, an oligonucleotide comprising an internucleoside linkage represented by formula (II) is provided, wherein L is a linear chain of 1 up to 6 units, preferably 1 to 4 units, and Y comprises 1 up to 10 carbon atoms and 1 up to 5 nitrogen atoms, more preferably wherein Y has a formula C1-10N1-5H1-10. Most preferably Y has a molecular weight equal to or lower than 200 Da.

[0081] In an embodiment, the invention provides an oligonucleotide of the invention wherein the internucleoside linkage represented by formula (I) is represented by formula (III), wherein Xi, X2, X3, Y, and are the same as in formula (II):

[0082] (III).

[0083] In an embodiment, the invention provides an oligonucleotide of the invention wherein the internucleoside linkage represented by formula (I) is represented by formula (IV), L, Xi, X2, X3, and -~w are the same as in formula (II): wherein Z-NH is cationic under physiological conditions. Preferably, Z comprises a nonhydrogen atom. More preferably, Z comprises a nitrogen atom. Preferably, Z has a molecular weight equal to or lower than 185 Da.

[0084] In an embodiment, an oligonucleotide comprising an internucleoside linkage represented by formula (IV) is provided, wherein Z is a group comprising 1 up to 6 carbon atoms and 0 up to 4 nitrogen atoms, preferably wherein Z has a formula C1-6N0-4H1-10. Most preferably, Z has a molecular weight equal to or lower than 185 Da.

[0085] In an embodiment, the invention provides an oligonucleotide of the invention wherein the internucleoside linkage represented by formula (I) is represented by formula (V), Xi, X2, X3, Z, and are the same as in formula (IV):

[0086] (V).

[0087] In an aspect, the invention provides an oligonucleotide of the invention for use as a medicament. Wherever an oligonucleotide of the invention is mentioned in this application, the oligonucleotide for use as a medicament according to this aspect is also disclosed.

[0088] In an embodiment, the invention provides an oligonucleotide of the invention for use as a medicament, wherein the internucleoside linkage represented by formula (I) is represented by formula (II), (III) (IV) or (V), as described above.

[0089] The oligonucleotides comprising an internucleoside linker (e.g. internucleoside linkage; see definition of terms ‘’internucleoside linker” and "internucleoside linkage” on page 13) represented by formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), may improve the cellular uptake and / or delivery. The internucleoside linker or linkage in the oligonucleotide of the invention gives a positive charge to the oligonucleotide under physiological conditions which may lead to increased interactions with the cellular / endosomal membrane and might enhance uptake and / or endosomal disruption. The ability to functionalize DNA and / or RNA this way also improves its compatibility with various drug delivery systems. These modifications can be used to create more stable and targeted delivery vehicles, such as liposomes or nanoparticles, which can further enhance the efficacy and safety of the medicament. The functionalized oligonucleotide of this invention can be used to create a wide range of medicaments, from gene therapy vectors to antisense oligonucleotides and / or aptamers. This versatility allows for the development of treatments for a broad spectrum of diseases, including genetic disorders, cancers, and / or viral infections. It is noted that the enhanced cellular uptake may also increase the overall prophylactic and / or therapeutic potency and / or efficacy of the oligonucleotides of the invention. The oligonucleotides of the invention may exhibit enhanced binding affinity to a negatively charged cell surface receptors or targets. Hence, this might improve the targeting ability and ensure that the medicament is delivered more efficiently to the desired cells and / or tissues, as well as reduce off-target effects.

[0090] Additional preferences and definitions relating to structures (I), (II), (III), (IV), (V), (VI) and (VIII) are presented below, e.g. specifying Xi, X2, Xs,W, L, Y and Z. These preferences and definitions apply mutatis mutandis to all the oligonucleotides of the invention and the oligonucleotides of the invention for use as a medicament provided in the aspects and embodiments above.

[0091] Phosphor-bound Xi, X2 and X3 In embodiments, Xi is -O-, X2 is -OH or -SH, and X3 is -O- or -S-; or Xi is -S-, X2 is -OH or -SH, and X3 is -O- or -S-; or Xi is -O- or -S-, X2 is -OH, and X3 is -O- or -S-; or Xi is -O- or -S-, X2 is -SH, and X3 is -O- or -S-; or Xi is -O- or -S-, X2 is -OH or -SH, and X3 is -O-; or Xi is -O- or -S-, X2 is -OH or -SH, and X3 is -S-.

[0092] In embodiments, Xi is -O-, X2 is -OH and X3 is -O-; or Xi is -O-, X2 is -SH and X3 is -O-; or Xi is -O-, X2 is -OH and X3 is -S-; or Xi is -O-, X2 is -SH and X3 is -S-; Xi is -S-, X2 is -OH and X3 is - O-; or Xi is -S-, X2 is -SH and X3 is -O-; or Xi is -S-, X2 is -OH and X3 is -S-; or Xi is -S-, X2 is - SH and X3 is -S-.

[0093] In preferred embodiments, Xi and X3 are -O- and X2 is -OH or -SH. Preferably, the internucleoside linker represented by formula (I) is represented by formula (II), (III), (IV), (V), (VI), or (VIII).

[0094] In preferred embodiments, Xi and X3 are -O- and X2 is -OH. Preferably, the internucleoside linker represented by formula (I) is represented by formula (II), (III), (IV), (V), (VI), or (VIII).

[0095] In preferred embodiments, Xi and X3 are -O- and X2 is -SH. Preferably, the internucleoside linker represented by formula (I) is represented by formula (II), (III), (IV), (V), (VI), or (VIII). An internucleoside linker wherein X2 is -SH may provide more stability, and / or suitable for various applications in molecular and cell biology research and therapy. Specifically, it can stabilize the oligonucleotide backbone against nuclease degradation, and / or effectively increase the oligonucleotide’s half-life in the cellular milieu.

[0096] Xi and X2 are connected to a nucleoside comprised in the oligonucleotide or to a terminal group comprised in the oligonucleotide, as represented by the bonds -~vv to such moieties. Preferably, the terminal group is a phosphate group or a hydroxyl group, wherein said phosphate group or hydroxyl group is not covalently bound to other parts of the oligonucleotide (besides via -vw ).

[0097] Linker L

[0098] A linear chain of n units independently selected from a set of chemical subgroups is any chemical supergroup consisting of n units selected from the set of chemical subgroups, allowing a single chemical subgroup to be selected multiple times, in such a way that n-2 units (i.e. the non-terminal units) are attached to 2 other units each and that 2 units (i.e. the terminal units) are attached to 1 other unit each (i.e. the penultimate units). As an example, a linear chain of 3 units independently selected from -A- and -B- means -A-A-A-, -B-A-A-, -A-B-A-, -A-A-B-, -B-B- A-, -B-A-B-, -A-B-B- or -B-B-B-. Without prejudice to the meaning of Linker (L), the terms ‘’internucleoside linkage” and ‘’internucleoside linker” are used interchangeably throughout the application.

[0099] In embodiments, W comprises L as described herein. Embodiments and preferences relating to L can be applied mutatis mutandis to the oligonucleotides according to this embodiment.

[0100] In embodiments, L is a linear chain of 1 up to 10, 1 up to 9, 1 up to 8, 1 up to 7, 1 up to 6, 1 up to 5, 1 up to 4, 1 up to 3, or 1 up to 2 units independently selected from -CH2-, -CHCH2-, -O-, - NH- or -N(CH3)-. In a preferred embodiment, L is a linear chain of 1 up to 4 units independently selected from -CH2-, -CHCH2-, -O-, -NH- or -N(CH3). Preferably, the internucleoside linker represented by formula (II), wherein L is explicitly drawn, is represented by formula (IV). In embodiments, L is a linear chain of 2 up to 10, 2 up to 9, 2 up to 8, 2 up to 7, 2 up to 6, 2 up to 5, 2 up to 4, or 2 up to 3 units independently selected from -CH2-, -CHCH2-, -O-, -NH- or - N(CH3)-. Preferably, the internucleoside linker represented by formula (II), wherein L is explicitly drawn, is represented by formula (IV).

[0101] In embodiments, L is a linear chain of 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 units independently selected from -CH2-, -CHCH2-, -O-, -NH- or -N(CH3)-. Preferably, the internucleoside linker represented by formula (II), wherein L is explicitly drawn, is represented by formula (IV).

[0102] In embodiments, L is a linear chain of 1 up to 10, 1 up to 9, 1 up to 8, 1 up to 7, 1 up to 6, 1 up to 5, 1 up to 4, 1 up to 3, or 1 up to 2 units independently selected from -CH2-, -CHCH-, -O-, - NH- or -N(CH3)-. In a preferred embodiment, L is a linear chain of 1 up to 4 units independently selected from -CH2-, -CHCH-, -O-, -NH- or -N(CH3). Preferably, the internucleoside linkage represented by formula (II), wherein L is explicitly drawn, is represented by formula (IV). In embodiments, L is a linear chain of 2 up to 10, 2 up to 9, 2 up to 8, 2 up to 7, 2 up to 6, 2 up to 5, 2 up to 4, or 2 up to 3 units independently selected from -CH2-, -CHCH-, -O-, -NH- or -N(CHs)- . Preferably, the internucleoside linkage represented by formula (II), wherein L is explicitly drawn, is represented by formula (IV).

[0103] In embodiments, L is a linear chain of 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 units independently selected from -CH2-, -CHCH-, -O-, -NH- or -N(CH3)-. Preferably, the internucleoside linkage represented by formula (II), wherein L is explicitly drawn, is represented by formula (IV).

[0104] In embodiments, L is a linear chain of 1 up to 10, 1 up to 9, 1 up to 8, 1 up to 7, 1 up to 6, 1 up to 5, 1 up to 4, 1 up to 3, or 1 up to 2 units independently selected from -CH2-, -O-, -NH- or - N(CH3)-. In a preferred embodiment, L is a linear chain of 1 up to 4 units independently selected from -CH2-, -O-, -NH- or -N(CH3). Preferably, the internucleoside linkage represented by formula (II), wherein L is explicitly drawn, is represented by formula (IV). In embodiments, L is a linear chain of 2 up to 10, 2 up to 9, 2 up to 8, 2 up to 7, 2 up to 6, 2 up to 5, 2 up to 4, or 2 up to 3 units independently selected from -CH2-, -O-, -NH- or -N(CH3)-. Preferably, the internucleoside linkage represented by formula (II), wherein L is explicitly drawn, is represented by formula (IV).

[0105] In embodiments, L is a linear chain of 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 units independently selected from -CH2-, -O-, -NH- or -N(CH3)-. Preferably, the internucleoside linkage represented by formula (II), wherein L is explicitly drawn, is represented by formula (IV).

[0106] In embodiments, L is a linear chain of 1 up to 10, 1 up to 9, 1 up to 8, 1 up to 7, 1 up to 6, 1 up to 5, 1 up to 4, 1 up to 3, or 1 up to 2 units independently selected from -CH2-, -O-, or -NH-. Preferably, the internucleoside linker represented by formula (I) is represented by formula (III). In embodiments, L is a linear chain of 2 up to 10, 2 up to 9, 2 up to 8, 2 up to 7, 2 up to 6, 2 up to 5, 2 up to 4, or 2 up to 3 units independently selected from -CH2-, -O-, or -NH-. Preferably, the internucleoside linker represented by formula (II), wherein L is explicitly drawn, is represented by formula (IV).

[0107] In embodiments, L is a linear chain of 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 units independently selected from -CH2-, -O-, or -NH-. Preferably, the internucleoside linker represented by formula (II), wherein L is explicitly drawn, is represented by formula (IV).

[0108] In embodiments, L is a linear chain of 1 up to 10, 1 up to 9, 1 up to 8, 1 up to 7, 1 up to 6, 1 up to 5, 1 up to 4, 1 up to 3, or 1 up to 2 units independently selected from -CH2- and -O-. Preferably, the internucleoside linker represented by formula (I) is represented by formula (III). In embodiments, L is a linear chain of 2 up to 10, 2 up to 9, 2 up to 8, 2 up to 7, 2 up to 6, 2 up to 5, 2 up to 4, or 2 up to 3 units independently selected from -CH2- and -O-. Preferably, the internucleoside linker represented by formula (II), wherein L is explicitly drawn, is represented by formula (IV).

[0109] In embodiments, L is a linear chain of 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 units independently selected from -CH2- and -O-. Preferably, the internucleoside linker represented by formula (II), wherein L is explicitly drawn, is represented by formula (IV).

[0110] In embodiments, L is a C1-10, C1-9, C1-8, C1-7, C1-6, C1-5, C1-4, C1-3, or C1-2 alkylene. Preferably, the internucleoside linker represented by formula (I) is represented by formula (III). It is understood that a CX-Y alkylene is an alkylene having from X up to Y carbon atoms, which may be linear or branched.

[0111] In embodiments, L is a C2-10, C2-9, C2-8, C2-7, C2-6, C2-5, C2-4, or C2-3 alkylene. Preferably, the internucleoside linker represented by formula (II), wherein L is explicitly drawn, is represented by formula (IV).

[0112] In embodiments, L is a C10, C9, Cs, C7, Ce, C5, C , C3, C2, or Ci alkylene. Preferably, the internucleoside linker represented by formula (II), wherein L is explicitly drawn, is represented by formula (IV).

[0113] In embodiments, L is ethylene (-CH2CH2-, C2 alkylene) or methylene (-CH2-, Ci alkylene), preferably an ethylene. Preferably, the internucleoside linker represented by formula (II), wherein L is explicitly drawn, is represented by formula (IV).

[0114] In embodiments, L is ethylene. Preferably, the internucleoside linker represented by formula (II), wherein L is explicitly drawn, is represented by formula (IV).

[0115] Cationic groups l / l< Y and Z

[0116] In embodiments, W has a molecular weight equal to or lower than 1000, 950, 900, 850, 800, 750, 700, 650, 600, 550, 500, 450, 400, 350, 300, 250, 200, 195, 190, 185, 180, 175, 170, 165, 160, 155, 150, 145, 140, 135, 130, 125, 120, 115, 110, 105, 100, 95, 90, 85, 80, 75, 70, 65, or 60 Da.

[0117] In embodiments, Y has a molecular weight equal to or lower than 1000, 950, 900, 850, 800, 750, 700, 650, 600, 550, 500, 450, 400, 350, 300, 250, 200, 195, 190, 185, 180, 175, 170, 165, 160, 155, 150, 145, 140, 135, 130, 125, 120, 115, 110, 105, 100, 95, 90, 85, 80, 75, 70, 65, or 60 Da.

[0118] In embodiments, Z has a molecular weight equal to or lower than 1000, 950, 900, 850, 800, 750, 700, 650, 600, 550, 500, 450, 400, 350, 300, 250, 200, 195, 190, 185, 180, 175, 170, 165, 160, 155, 150, 145, 140, 135, 130, 125, 120, 115, 110, 105, 100, 95, 90, 85, 80, 75, 70, 65, 60, 55, 50, or 45 Da.

[0119] W in formula (l),Y in formulae (II) and (III) and Z-NH in formulae (IV) and (V) are cationic under physiological conditions. Preferably, “under physiological conditions” means in an aqueous solution with a pH between 7.35 and 7.45, at a temperature between 36.5°C and 37.5°C, at a pressure of 1 atm. Hence, “cationic under physiological conditions” means that the predominant equilibrated form of W, Y or Z-NH under such conditions is positively charged. Such a positive charge could be the result of a protonation equilibrium that has shifted towards a protonated form under the physiological conditions or could be of a chemically more permanent nature due to a positive charge on an atom not bearing a hydrogen atom. For example, Y = histidinyl (due to protonation under physiological conditions) and Y = -N(CH3)3+(due to a positively charged N atom bound to 3 C atoms and the L group) would be positively charged under physiological conditions.

[0120] In embodiments, W comprises Y or Z-NH as described herein. Embodiments and preferences relating to L can be applied mutatis mutandis to the oligonucleotides according to this embodiment.

[0121] In embodiments, the atom comprised in W, Y or Z-NH that is formally positively charged under physiological conditions is not comprised in a ring.

[0122] In embodiments, the atom comprised in W, Y or Z-NH that is formally positively charged under physiological conditions is a nitrogen atom. Preferably, the nitrogen atom is part of an amine, a guanidine or an amidine.

[0123] In embodiments, W, Y and Z-NH are Bnansted basic groups whose predominant form under physiological conditions is cationic.

[0124] In embodiments, W or Y comprises a nitrogen atom, preferably with a free electron pair.

[0125] In embodiments, W or Y comprises an amino group (-NR2), an amidino group (-C(=NR)NR2), a guanidinyl group (-N(R)-C(=NR)-NR2), a histidinyl group, a pyridyl group, an imidazolyl group, or a pyrrolidinyl group, wherein each R is independently H or a C1-4 alkyl, preferably wherein each R is H. In these embodiments and the embodiments below, a C1-4 alkyl may be both a linear n-alkyl or a branched alkyl.

[0126] In embodiments, Y is an amino group (-NR2), an amidino group (-C(=NR)NR2), a guanidinyl group (-N(R)-C(=NR)-NR2), a histidinyl group, a pyridyl group, an imidazolyl group, or a pyrrolidinyl group, wherein each R is independently H or a C1-4 alkyl, preferably wherein each R is H.

[0127] In embodiments, Y is an amino group (-NR2) or a guanidinyl group (-N(R)-C(=NR)-NR2), wherein each R is independently H or a C1-4 alkyl, preferably wherein each R is H.

[0128] In embodiments, Y is -NH2 or -N(H)-C(=NH)-NH2. In embodiments, Z comprises a nitrogen atom, preferably with a free electron pair.

[0129] In embodiments, Z comprises hydrogen (-H), a C1-4 alkyl group, an amino group (-NR2), an amidino group (-C(=NR)NR2), a guanidinyl group (-N(R)-C(=NR)-NR2), a histidinyl group, a pyridyl group, an imidazolyl group, or a pyrrolidinyl group, wherein each R is independently H or a C1-4 alkyl, preferably wherein each R is H.

[0130] In embodiments, Z is hydrogen (-H), a C1-4 alkyl group, an amino group (-NR2), an amidino group (-C(=NR)NR2), a guanidinyl group (-N(R)-C(=NR)-NR2), a histidinyl group, a pyridyl group, an imidazolyl group, or a pyrrolidinyl group, wherein each R is independently H or a C1- 4 alkyl, preferably wherein each R is H.

[0131] In embodiments, Z is hydrogen (H), a C1-4 alkyl group or an amidino group (C(=NR)NR2), wherein each R is independently H or a C1-4 alkyl, preferably wherein each R is H.

[0132] In embodiments, Z is hydrogen (H) or C(=NH)NH2.

[0133] In embodiments, Z is not -H. In other words, Z comprises a non-hydrogen atom.

[0134] In embodiments, Z is not -H and comprises a nitrogen atom, preferably with a free electron pair. In embodiments, Z comprises a C1-4 alkyl group, an amino group (-NR2), an amidino group (- C(=NR)NR2), a guanidinyl group (-N(R)-C(=NR)-NR2), a histidinyl group, a pyridyl group, an imidazolyl group, or a pyrrolidinyl group, wherein each R is independently H or a C1-4 alkyl, preferably wherein each R is H.

[0135] In embodiments, Z is a C1-4 alkyl group, an amino group (-NR2), an amidino group (- C(=NR)NR2), a guanidinyl group (-N(R)-C(=NR)-NR2), a histidinyl group, a pyridyl group, an imidazolyl group, or a pyrrolidinyl group, wherein each R is independently H or a C1-4 alkyl, preferably wherein each R is H.

[0136] In embodiments, Z is a C1-4 alkyl group or an amidino group (-C(=NR)NR2), wherein each R is independently H or a C1-4 alkyl, preferably wherein each R is H.

[0137] In embodiments, Z is -C(=NH)NH2.

[0138] In embodiments, W is a group comprising 1 up to 10, or 1 up to 9, or 1 up to 8, or 1 up to 7, or 1 up to 6, or 1 up to 5, or 1 up to 4, or 1 up to 3 carbon atoms; and 1 to 5 nitrogen atoms.

[0139] In embodiments, W is a group comprising 1 up to 10, or 1 up to 9, or 1 up to 8, or 1 up to 7, or 1 up to 6, or 1 up to 5, or 1 up to 4, or 1 up to 3 carbon atoms; and 1 to 4 nitrogen atoms.

[0140] In embodiments, W is a group comprising 1 up to 10, or 1 up to 9, or 1 up to 8, or 1 up to 7, or 1 up to 6, or 1 up to 5, or 1 up to 4, or 1 up to 3 carbon atoms; and 1 to 3 nitrogen atoms.

[0141] In embodiments, W is a group comprising 1 up to 10, or 1 up to 9, or 1 up to 8, or 1 up to 7, or 1 up to 6, or 1 up to 5, or 1 up to 4, or 1 up to 3 carbon atoms; and 2 to 5 nitrogen atoms.

[0142] In embodiments, W is a group comprising 1 up to 10, or 1 up to 9, or 1 up to 8, or 1 up to 7, or 1 up to 6, or 1 up to 5, or 1 up to 4, or 1 up to 3 carbon atoms; and 2 to 4 nitrogen atoms.

[0143] In embodiments, W is a group comprising 1 up to 10, or 1 up to 9, or 1 up to 8, or 1 up to 7, or 1 up to 6, or 1 up to 5, or 1 up to 4, or 1 up to 3 carbon atoms; and 2 to 3 nitrogen atoms.

[0144] In embodiments, W is a group comprising 1 up to 10, or 1 up to 9, or 1 up to 8, or 1 up to 7, or 1 up to 6, or 1 up to 5, or 1 up to 4, or 1 up to 3 carbon atoms; and 3 to 5 nitrogen atoms. In embodiments, W is a group comprising 1 up to 10, or 1 up to 9, or 1 up to 8, or 1 up to 7, or 1 up to 6, or 1 up to 5, or 1 up to 4, or 1 up to 3 carbon atoms; and 3 to 4 nitrogen atoms.

[0145] In embodiments, Y is a group comprising 1 up to 6, or 1 up to 5, or 1 up to 4, or 1 up to 3, or 1 up to 2 carbon atoms; and 1 up to 5 nitrogen atoms.

[0146] In embodiments, Y is a group comprising 1 up to 6, or 1 up to 5, or 1 up to 4 , or 1 up to 3, or 1 up to 2 carbon atoms; and 1 up to 4 nitrogen atoms.

[0147] In embodiments, Y is a group comprising 1 up to 6, or 1 up to 5, or 1 up to 4 , or 1 up to 3, or 1 up to 2 carbon atoms; and 1 up to 3 nitrogen atoms.

[0148] In embodiments, Y is a group comprising 1 up to 6, or 1 up to 5, or 1 up to 4, or 1 up to 3, or 1 up to 2 carbon atoms; and 2 up to 5 nitrogen atoms.

[0149] In embodiments, Y is a group comprising 1 up to 6, or 1 up to 5, or 1 up to 4, or 1 up to 3, or 1 up to 2 carbon atoms; and 2 up to 4 nitrogen atoms.

[0150] In embodiments, Y is a group comprising 1 up to 6, or 1 up to 5, or 1 up to 4, or 1 up to 3, or 1 up to 2 carbon atoms; and 2 up to 3 nitrogen atoms.

[0151] In embodiments, Z is a group comprising 1 up to 6, or 1 up to 5, or 1 up to 4, or 1 up to 3, or 1 up to 2 carbon atoms; and 0 up to 4 nitrogen atoms.

[0152] In embodiments, Z is a group comprising 1 up to 6, or 1 up to 5, or 1 up to 4 , or 1 up to 3, or 1 up to 2 carbon atoms; and 0 up to 3 nitrogen atoms.

[0153] In embodiments, Z is a group comprising 1 up to 6, or 1 up to 5, or 1 up to 4 , or 1 up to 3, or 1 up to 2 carbon atoms; and 0 up to 2 nitrogen atoms.

[0154] In embodiments, Z is a group comprising 1 up to 6, or 1 up to 5, or 1 up to 4, or 1 up to 3, or 1 up to 2 carbon atoms; and 1 up to 4 nitrogen atoms.

[0155] In embodiments, Z is a group comprising 1 up to 6, or 1 up to 5, or 1 up to 4, or 1 up to 3, or 1 up to 2 carbon atoms; and 1 up to 3 nitrogen atoms.

[0156] In embodiments, Z is a group comprising 1 up to 6, or 1 up to 5, or 1 up to 4, or 1 up to 3, or 1 up to 2 carbon atoms; and 1 up to 2 nitrogen atoms.

[0157] In a preferred embodiment, Z comprises 1 up to 6 carbon atoms and 0 up to 4 nitrogen atoms.

[0158] Wherever a group is said to be represented by a (net molecular) formula CiNjHk, it is understood that the group consists of i carbon atoms, j nitrogen atoms and k hydrogen atoms. This definition can be extended to other types of atoms and to ranges of atomic indices. E.g., C1-10N1-5H1-15 refers to a group consisting carbon, nitrogen and hydrogen atoms, comprising exactly 1 up to 10 carbon atoms, exactly 1 up to 5 nitrogen atoms, and exactly 1 to 15 hydrogen atoms.

[0159] In embodiments, W is C1-3N1-3H1-15, C1-3N1-4H1-15, C1-3N1-5H1-15, C1-4N1-3H1-15, C1-4N1-4H1-15, C1- 4N1-5H1-15, C1-5N1-3H1-15, C1-5N1-4H1-15, C1-5N1 -5H1-15, C1-6N1-3H1-15, C1-6N1-4H1-15, C1-6N1-5H1-15, C1- 7N1-3H1-15, C1-7N1-4H1-15, C1-7N1-5H1-15, C1-8N1 -3H1-15, C1-8N1-4H1-15, C1-8N1-5H1-15, C1-9N1-3H1-15, Ci- 9N1-4H1-15, C1-9N1-5H1-15, C1-10N1-3H1-15, C1-10N1-4H1-15, C1-10N1-5H1-15, C2-3N1-3H1-15, C2-3N1-4H1-15, C2-3N1-5H1-15, C2-4N1-3H1-15, C2-4N1-4H1-15, C2-4N1-5H1-15, C2-5N1-3H1-15, C2-5N1-4H1-15, C2-5N1-5H1-15, C2-6N1-3H1-15, C2-6N1-4H1-15, C2-6N1-5H1-15, C2-7N1-3H1-15, C2-7N1-4H1-15, C2-7N1-5H1-15, C2-8N1-3H1-15, C2-8N1-4H1-15, C2-8N1-5H1-15, C2-9N1-3H1-15, C2-9N1-4H1-15, C2-9N1-5H1-15, C2-10N1-3H1-15, C2-10N1-4H1-15, or C2-10N1-5H1-15.

[0160] In embodiments, Y is C1-2N1-3H1-10, C1-2N1-4H1-10, C1-2N1-5H1-10, C1-3N1-3H1-10, C1-3N1-4H1-10, C1-3N1- 5H 1-10, C1-4N1-3H1-10, C1-4N1-4H1-10, C1-4N1-5H1-10, C1.5N1.3H 1-10, C1-5N1-4H 1-10, C1-5N1-5H 1-10, C1-6N1- 3H1-10, C1-6N1-4H1-10, C1-6N1-5H1-10.

[0161] In embodiments, Z is C1-2N0-2H1-10, C1-2N0-3H1-10, C1-2N0-4H1 -10, C1-3N0-2H1-10, C1-3N0-3H1-10, C1-3N0- 4H1-10, C1-4N0-2H1-10, C1-4N0-3H1-10, C1-4N0-4H1-10, C1-5N0-2H1-10, C1-5N0-3H1-10, C1-5N0-4H1-10, Ci-eNo- 2H 1-10, C1-6N0-3H1-10, or C1-6N0-4H1-10.

[0162] Particularly preferred compounds

[0163] In embodiments, L is ethylene, and Y is -NH2. The corresponding internucleoside linkage is represented by formula (VI), wherein Xi, X2 and X3 are as defined for formula (I):

[0164] (VI).

[0165] In embodiments, Xi and X3 are -O-, X2 is -OH, L is ethylene, and Y is -NH2 Preferably, the oligonucleotide is for use as a medicament. The corresponding internucleoside linkage is represented by formula (VII):

[0166] (VII).

[0167] Oligonucleotides according to the invention wherein L is ethylene and Z is -NH2 comprise a taurine moiety. Taurine is known to resemble lysine, chemically, functionally and / or structurally. Hence, such oligonucleotides may exhibit a surprisingly better performance in cellular uptake and increase interactions with the cellular and / or endosomal membranes. For instance, the positively charged taurine group (under physiological conditions) may be beneficial for renal absorption.

[0168] In embodiments, L is ethylene, and Y is -N(H)-C(=NH)-NH2 The corresponding internucleoside linkage is represented by formula (VIII):

[0169] (VIII). In embodiments, Xi and X3 are -O-, X2 is -OH, L is ethylene, and Y is -N(H)-C(=NH)-NH2 Preferably, the oligonucleotide is for use as a medicament. The corresponding internucleoside linkage is represented by formula (IX), wherein Xi, X2 and X3 are as defined for formula (I):

[0170] Oligonucleotides according to the invention wherein Y is -N(H)-C(=NH)-NH2 comprise a guanidine moiety. Guanidine is known to resemble arginine, chemically, functionally and / or structurally. Hence, such oligonucleotides may exhibit a better performance in cellular uptake and increase interactions with the cellular and / or endosomal membranes. For instance, the positively charged guanidine group (under physiological conditions) may be beneficial for renal absorption.

[0171] In embodiments, Xi and X3 are -O-, X2 is -OH, L is methylene, and Y is -NH2 Preferably, the oligonucleotide is for use as a medicament.

[0172] In embodiments, Xi and X3 are -O-, X2 is -OH, L is methylene, and Y is -N(H)-C(=NH)-NH2 Preferably, the oligonucleotide is for use as a medicament.

[0173] In embodiments, Xi and X3 are -O-, X2 is -SH, L is ethylene, and Y is -NH2 Preferably, the oligonucleotide is for use as a medicament.

[0174] In embodiments, Xi and X3 are -O-, X2 is -SH, L is ethylene, and Y is -N(H)-C(=NH)-NH2 Preferably, the oligonucleotide is for use as a medicament.

[0175] In embodiments, Xi and X3 are -O-, X2 is -SH, L is methylene, and Y is -NH2 Preferably, the oligonucleotide is for use as a medicament.

[0176] In embodiments, Xi and X3 are -O-, X2 is -SH, L is methylene, and Y is -N(H)-C(=NH)-NH2 Preferably, the oligonucleotide is for use as a medicament.

[0177] In some embodiments, at least one of the internucleoside linkages of the oligonucleotide according to the invention is represented by formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX). Preferred formulas are (VII) and (IX). Thus, in some embodiments, at least one of the naturally occurring 3' to 5' phosphodiester moieties present in RNA is replaced by a non-natural moiety represented by formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX).

[0178] An oligonucleotide having 10 nucleotides may contain 9 linkages, linking the 10 ribose units of the 10 nucleotides together. Additionally, there may be one or more last linkage(s) present at one or both sides of the oligonucleotide, which is only connected to one nucleotide.

[0179] In preferred embodiments, an oligonucleotide as described herein comprises one or more artificial or modified internucleoside linkage of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VI I) or (IX). In some embodiments, an oligonucleotide as described herein comprises 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 artificial or modified internucleoside linkage of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX).

[0180] In some embodiments, all internucleoside linkages of the oligonucleotide as described herein consist of modified or artificial internucleoside linkage of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX). This means that all internucleoside linkages in the oligonucleotide are modified or artificial, and are represented by formula (I), (II), (III), (IV), (V),

[0181] (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX).

[0182] Alternatively, an oligonucleotide as described herein may predominantly contain modified or artificial internucleoside linkage of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX). For example, all except 1 , 2, 3, 4, 5, 6, 7, 8, 9 or 10 internucleoside linkages may be modified or artificial and represented by formula (I), (II), (III), (IV), (V), (VI),

[0183] (VII), (VIII) and / or (IX), preferably (VII) or (IX).

[0184] In some embodiments, an oligonucleotide as described herein comprises 1 , 2, 3, 4, 5, 6 artificial or modified internucleoside linkages of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX).

[0185] In some embodiments, an oligonucleotide as described herein comprises 1 , 2, 3 artificial or modified internucleoside linkages of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX).

[0186] In some embodiments, the artificial or modified internucleoside linkage of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII), and / or (IX), preferably (VII) or (IX), may be positioned at the termini of the oligonucleotide, and / or within the oligonucleotide sequence. Said linkage(s) may be located at the 3' terminus, at the 5' terminus, at both termini, or within 1-5 nucleotides of either terminus (e.g. wing if the oligonucleotide is a gapmer) and may additionally or alternatively be positioned internally within the central region of the oligonucleotide. As used herein, the term “central region” refers to the contiguous region of an antisense oligonucleotide that is complementary to a target nucleic acid sequence and is responsible for mediating the oligonucleotide’s primary antisense activity. In embodiments where the antisense oligonucleotide is a gapmer, the central portion comprises a series of nucleotides, typically deoxyribonucleotides, that hybridize to the target RNA to form a DNA:RNA duplex capable of recruiting RNase H and promoting cleavage of the RNA strand. The central portion (e.g. gap), of a gapmer oligonucleotide is generally flanked on both the 5' and 3' ends by regions containing chemically modified ribonucleotides (e.g. as “wings”). As used herein, the term “wing” refers to a region of an oligonucleotide that includes, and extends inward from, a terminus of the oligonucleotide (i.e., the 3' and / or 5' terminus). A wing thus comprises the terminal nucleotide(s) and may include one or more additional nucleotides positioned within approximately 1 to 5 nucleotides from the respective terminus. Accordingly, an internucleoside linkage or any other chemical modification described as being located at a wing is understood to be positioned at, or within several nucleotides of the corresponding terminus. In an embodiment, an oligonucleotide as described herein comprises 1 artificial or modified internucleoside linkage of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), positioned at the 5’ and / or 3’ wing or terminus of the oligonucleotide.

[0187] In an embodiment, an oligonucleotide as described herein comprises 2 artificial or modified internucleoside linkages of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), positioned at the 5’ and / or 3’ wing or terminus of the oligonucleotide.

[0188] In an embodiment, an oligonucleotide as described herein comprises 3 artificial or modified internucleoside linkages of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), positioned at the 5’ and / or 3’ wing or terminus of the oligonucleotide.

[0189] In an embodiment, an oligonucleotide as described herein comprises at least 1 artificial or modified internucleoside linkages of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX) positioned at the 5’ and / or 3’ wing or terminus of the oligonucleotide and at least 1 artificial or modified internucleoside linkage of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX) positioned internally in the central region of the oligonucleotide.

[0190] In a preferred embodiment, an oligonucleotide described herein comprises 1 up to 3 internucleoside linkages of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), positioned at the 5’ and / or 3’ wing or terminus of the oligonucleotide.

[0191] Oligonucleotides encompassed herein are listed in the section Exemplary oligonucleotides. Exemplary embodiments are listed below: oligonucleotide comprising 1 artificial or modified internucleoside linkage of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX) positioned at the 5’ wing or terminus of the oligonucleotide oligonucleotide comprising 1 artificial or modified internucleoside linkage of formula

[0192] (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX) positioned at the 3’ wing or terminus of the oligonucleotide oligonucleotide comprising 1 artificial or modified internucleoside linkage of formula (I),

[0193] (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX) positioned at both the 5’ and 3’ wings or termini of the oligonucleotide oligonucleotide comprising 2 artificial or modified internucleoside linkages of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX) positioned at the 5’ wing or terminus of the oligonucleotide oligonucleotide comprising 2 artificial or modified internucleoside linkages of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX) positioned at the 3’ wing or terminus of the oligonucleotide oligonucleotide comprising 2 artificial or modified internucleoside linkages of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX) positioned at at both the 5’ and 3’ wings or termini of the oligonucleotide oligonucleotide comprising 3 artificial or modified internucleoside linkages of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX) positioned at the 5’ wing or terminus of the oligonucleotide oligonucleotide comprising 3 artificial or modified internucleoside linkages of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX) positioned at the 3’ wing or terminus of the oligonucleotide oligonucleotide comprising 3 artificial or modified internucleoside linkages of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX) positioned at both the 5’ the 3’ wings or termini of the oligonucleotide

[0194] Without prejudice, an oligonucleotide comprising an internucleoside linkage of formula of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VI I) or (IX) at its wing or terminus and / or wings or termini may further comprise at least one such linkage internally, preferably in the central region of the oligonucleotide.

[0195] In another embodiment, an oligonucleotide described herein further comprises at least one internucleoside linkage of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX) positioned in the central portion of the oligonucleotide.

[0196] In all preceding embodiments, oligonucleotides comprising internucleoside linkages of formula VII or IX are preferred. Accordingly, such an oligonucleotide may comprise: oligonucleotide comprising 1 artificial or modified internucleoside linkage of formula (VII) or (IX) positioned at the 5’ wing or terminus of the oligonucleotide oligonucleotide comprising 1 artificial or modified internucleoside linkage of formula (VII) or (IX) positioned at the 3’ wing or terminus of the oligonucleotide oligonucleotide comprising 1 artificial or modified internucleoside linkage of formula (VII) or (IX) positioned at both the 5’ and 3’ wings or termini of the oligonucleotide oligonucleotide comprising 2 artificial or modified internucleoside linkages of formula (VII) or (IX) positioned at the 5’ wing or terminus of the oligonucleotide oligonucleotide comprising 2 artificial or modified internucleoside linkages of formula (VII) or (IX) positioned at the 3’ wings or terminus of the oligonucleotide oligonucleotide comprising 2 artificial or modified internucleoside linkages of formula (VII) or (IX) positioned at at both the 5’ and 3’ wings or termini of the oligonucleotide oligonucleotide comprising 3 artificial or modified internucleoside linkages of formula (VII) or (IX) positioned at the 5’ wing or terminus of the oligonucleotide oligonucleotide comprising 3 artificial or modified internucleoside linkages of formula (VII) or (IX) positioned at the 3’ wing or terminus of the oligonucleotide oligonucleotide comprising 3 artificial or modified internucleoside linkages of formula (VII) or (IX) positioned at both the 5’ the 3’ wings or termini of the oligonucleotide

[0197] Without prejudice, an oligonucleotide comprising an internucleoside linkage of formula VII or IX at its wing or terminus and / or wings or termini may further comprise at least one such linkage internally, preferably in the central region of the oligonucleotide. In one embodiment, an internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX) and present in the oligonucleotide of the invention is not an internucleotide linkage as disclosed in formula (X), (XI), (XII) or (XIII).

[0198] Isomery

[0199] The (chemical) formulae presented in this application for the oligonucleotides and the internucleoside linkers comprised therein may exist in one or more particular geometric, optical, enantiomeric, diastereoisomeric, epimeric, stereoisomeric, tautomeric, (de)protonated, isotopomeric, isotopologues, isotopologic, conformational, or anomeric forms, including but not limited to, cis and trans-forms; E and Z forms; c, t, and r forms; endo- and exo-forms; R, S, and meso-forms; D and L forms; d and I forms; (+) and (-) forms; keto, enol, and enolate forms; syn and anti forms; synclinal and anticlinal forms; a and p forms; axial and equatorial forms; boat, chair, twist, envelope, and half chair forms; and combinations thereof, hereinafter collectively referred to as “isomers” (or “isomeric forms”).

[0200] Any reference to a compound or a class of compounds, either by a name or by a formula, is meant as a reference to the set of all isomers falling in that class, unless explicitly mentioned otherwise. This includes both the isomers mentioned above and all structural isomers, unless it is clear that they are explicitly excluded. For example, a C1-4 alkyl may refer to n-butyl and tert-butyl, together with all their isomers as mentioned above. A reference to n-butyl, on the other hand, only refers to n-butyl and its stereoisomers, isotopomers, isotopologues, etc., and not to tert-butyl.

[0201] If a compound or a class of compounds refers to multiple species, reference is made to both the isolated species and to any equimolar or non-equimolar mixture of the species.

[0202] As a non-limiting example, a internucleoside linkage represented by formula (I) wherein X2 is OH may be represented by at least formula (l-OH-1) or formula (l-OH-2), representing two tautomers of the phosphoramidite. o x ouH xf

[0203] W-S- N=p-OH W-S- N- P=O

[0204] O X3 O X3

[0205] (l-OH-1) (l-OH-2)

[0206] An oligonucleotide comprising an internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX) may comprise an additional modification as described later herein (i.e. a sugar modification, a base modification and / or an additional modified internucleoside linkage).

[0207] General definition of oligonucleotide An oligonucleotide is known in the art to be a polymeric molecule, such as a DNA and / or RNA molecule, typically a single-stranded DNA and / or RNA molecule, consisting of repeating monomers. The monomeric units are typically nucleotides (RNA nucleotides or DNA nucleotides) or modified nucleotides (“nucleotide analogues”). The most common naturally occurring nucleotides in RNA are adenosine monophosphate (A), cytidine monophosphate (C), guanosine monophosphate (G), and uridine monophosphate (U). These consist of a pentose sugar ribose, a 5’-linked phosphate group which is linked via a phosphate ester, and a T-linked base. A nucleotide without a phosphate group is known as a nucleoside. The most common naturally occurring nucleotides in DNA are deoxyadenosine monophosphate (A), deoxycytidine monophosphate (C), deoxyguanosine monophosphate (G), and deoxythymidine monophosphate (T). These consist of a pentose sugar 2’-deoxyribose, a 5’- linked phosphate group which is linked via a phosphate ester, and a T-linked base. The abbreviations A, C, G, T and U as used herein may be used to refer to a nucleobase (or base), a corresponding nucleoside, or a corresponding nucleotide. The term “nucleotide” as used herein includes both naturally occurring nucleotides as well as nucleotide analogues (described in more detail later herein), unless indicated otherwise. The term “oligonucleotide” as used herein encompasses salt forms of an oligonucleotide or that possess an ionizable group. An ionizable group may be a base or acid and may be charged or neutral. An ionizable group may be present as ion pair with an appropriate counterion that carries opposite charges. Non-limiting examples of cationic counterions include sodium, potassium, cesium, Tris, lithium, calcium, magnesium, trialkylammonium, triethylammonium and tetraalkylammonium. Non-limiting examples of anionic counterions are chloride, bromide, iodide, lactate, mesylate, besylate, triflate, acetate, trifluoroacetate, dichloroacetate, tartrate, lactate and citrate. Examples of counterions have been described (e.g. Kumar, Pharm. Technol., 2008, 3, 128). In some embodiments, an oligonucleotide as described herein is an oligonucleotide salt, for example a sodium salt.

[0208] In an embodiment, the oligonucleotide is chirally pure as described in WO2014 / 010250.

[0209] In some embodiments, oligonucleotides described herein are non-naturally occurring oligonucleotides. For example, they may comprise at least one modified sugar, modified base, or an additional modified linkage as described in more detail later herein. The presence of modifications, including linkage, sugar, and base modifications, may provide the oligonucleotide with attractive properties such as improved stability and resistance properties to degradation by exonucleases and endonucleases. Furthermore, the presence of modifications may improve safety, bio-distribution, stability, cellular uptake, intracellular trafficking, target binding affinity, duplex stability, and immunogenicity compared to an oligonucleotide consisting of non-modified DNA and / or non-modified RNA nucleotides. In some embodiments, the oligonucleotide of the invention is represented by a nucleotide sequence comprising or consisting of a sequence that binds (or is able to bind), hybridizes (or is able to hybridize), targets and / or is reverse complementary to a RNA transcript. In such embodiment, the oligonucleotide may also be named an antisense oligonucleotide or AON or ASO.

[0210] When a structural formula or chemical name or sequence of an oligonucleotide is understood by the skilled person to have chiral centers, yet no chirality is indicated, for each chiral center individual reference is made to all three of either the racemic mixture, the pure R enantiomer, and the pure S enantiomer.

[0211] In some embodiments, oligonucleotides described herein are isolated oligonucleotides. The term “isolated” refers to the separation of a compound from other components present during its production. “Isolated” is not meant to exclude artificial or synthetic mixtures with other compounds or materials, or the presence of impurities that do not substantially interfere with the fundamental activity, and that may be present, for example, due to incomplete purification, or the addition of stabilizers. In the context of oligonucleotides, the term “isolated” may refer to a molecule that is separated from sequences with which it is immediately contiguous in a naturally occurring sequence. For example, an “isolated” oligonucleotide may comprise a DNA molecule inserted into a vector, such as a plasmid or virus vector. In the context of oligonucleotides, the term “isolated” may also refer to synthetic oligonucleotides, i.e. chemically synthesized oligonucleotides.

[0212] Chemical synthesis of oligonucleotides is routine in the art and provides rapid and inexpensive access to custom-made oligonucleotides of a desired sequence and a desired chemistry. The most common method is solid-phase synthesis using phosphoramidite chemistry. Reference is made to “Synthesis of Therapeutic Oligonucleotides”. Eds: Satoshi Obika, Mitsuo Sekine. Springer; 1st ed. 2018, Singapore, incorporated herein by reference. Thus, in some embodiments, an oligonucleotide as described herein may be a synthetic oligonucleotide.

[0213] Sugar of the oligonucleotide

[0214] The sugar connects the base and the phosphate and is therefore often referred to as the scaffold of the nucleotide. A modification in the pentose sugar is therefore often referred to as a scaffold modification. A sugar modification may therefore be called a scaffold modification. For severe modifications, the original pentose sugar might be replaced in its entirety by another moiety that similarly connects the base and the phosphate. Preferred sugars and scaffolds and modified sugars and scaffolds including artificial sugars and scaffolds are described later herein.

[0215] As described above, oligonucleotides as described above may comprise “natural” sugars or scaffolds as well as modified sugars or scaffolds (including artificial sugars or scaffolds). Combinations of distinct modified or artificial sugars or scaffolds within one molecule are encompassed.

[0216] Oligonucleotides of this invention may comprise RNA nucleotides (and modified RNA nucleotides or RNA nucleotide analogues), DNA nucleotides (and modified DNA nucleotides or DNA nucleotide analogues), and combinations thereof. In some embodiments, an oligonucleotide as described herein comprises both RNA nucleotides or modifications thereof and DNA nucleotides or modifications thereof. The same holds for abasic nucleotides of the oligonucleotide.

[0217] In some embodiments, an oligonucleotide as described herein comprises 1 , 2, 3, 4, or 5 DNA nucleotides or modifications thereof and the remainder RNA nucleotides or modifications thereof. In preferred embodiments, an oligonucleotide as described herein comprises 1 or 2, preferably 2 DNA nucleotides or modifications thereof, and the remainder RNA nucleotides or modifications thereof. In other words, an oligonucleotide as described herein is an RNA oligonucleotide wherein 1 , 2, 3, 4, or 5, preferably 1 or 2, RNA nucleotides are replaced with DNA nucleotides.

[0218] An oligonucleotide comprising an internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), may comprise one or more modified or artificial sugars.

[0219] In preferred embodiments, an oligonucleotide as described herein comprises one or more modified or artificial sugars. In some embodiments, an oligonucleotide as described herein comprises 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 or 42 modified sugars. In some embodiments, an oligonucleotide as described herein comprises at least 1 , 2, 3, 4, 5, 6, 7, 8, 9,10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 or 42 modified or artificial sugars.

[0220] In some embodiments, all the sugars of an oligonucleotide as described herein may be modified or artificial sugars. Alternatively, an oligonucleotide as described herein may predominantly contain modified or artificial sugars. For example, all except 1 , 2, 3, 4, 5, 6, 7, 8, 9 or 10 sugars may be modified or artificial sugars. Modified or artificial sugar (or scaffold) as described herein may include a modified version of the ribosyl moiety, such as 2’-0-modified RNA such as 2’-O-alkyl or 2’-O-(substituted)alkyl e.g. 2’-O-methyl, 2’-0-(2-cyanoethyl), 2’-0-(2-methoxy)ethyl (2’-MOE), 2’-0-(2-thiomethyl)ethyl, 2’- O-butyryl, 2’-0-propargyl, 2’-O-acetalester (such as e.g. Biscans et al. Bioorg. Med. Chem. 2015, 23, 5360), 2’-O-allyl, 2’-0-(2S-methoxypropyl), 2’-0-( / V-(aminoethyl)carbamoyl)methyl) (2’-AECM), 2’-0-(2-carboxyethyl) and carbamoyl derivatives (Yamada et al. Org. Biomol. Chem. 2014, 12, 6457), 2’-0-(3-amino)propyl, 2’-0-(2-(dimethylamino)ethyl), 2’-O-(2- amino)ethyl, 2’-0-(3-(dimethylamino)propyl); 2’-deoxy (DNA); 2’-0-(haloalkoxy)methyl (Arai K. et al. Bioorg. Med. Chem. 2011 , 21, 6285) e.g. 2’-0-(2-chloroethoxy)methyl (MCEM), 2’-O-(2,2- dichloroethoxy)methyl (DCEM); 2’-0-alkoxycarbonyl e.g. 2’-0-[2-(methoxycarbonyl)ethyl] (MOCE), 2’-0-[2-( / V-methylcarbamoyl)ethyl] (MCE), 2’-0-[2-( / V, / V-dimethylcarbamoyl)ethyl] (DCME), 2’-0-[2-(methylthio)ethyl] (2’-MTE), 2’-(w-0-serinol); 2’-halo e.g. 2’-F, FANA (2’-F arabinosyl nucleic acid); 2’,4’-difluoro-2’-deoxy; carbasugar and azasugar modifications; 3’-O- substituted e.g. 3’-O-methyl, 3’-0-butyryl, 3’-0-propargyl; 4’-substituted e.g. 4’-aminomethyl-2’- O-methyl or 4’-aminomethyl-2’-fluoro; 5’-subtituted e.g. 5’-methyl or CNA (0stergaard et al. ACS Chem. Biol. 2014, 22, 6227); and their derivatives.

[0221] Modified or artificial sugar (or scaffold) as described herein may also include a bicyclic nucleic acid monomer (BNA) which may be a bridged nucleic acid monomer. Each occurrence of said BNA may result in a monomer that is independently chosen from the group consisting of a conformationally restricted nucleotide (CRN) monomer, a locked nucleic acid (LNA) monomer, an unlocked nucleic acid (UNA) monomer (Lankjaer N et al. Bioorg. Med. Chem. 2009, 17, 5420), a xylo-LNA monomer, an a-LNA monomer, an a-L-LNA monomer, a p-D-LNA monomer, a 2’-amino-LNA monomer, a 2’-(alkylamino)-LNA monomer, a 2’-(acylamino)-LNA monomer, a 2’- / V-substituted-2’-amino-LNA monomer, a 2’-thio-LNA monomer, a (2’-O,4’-C) constrained ethyl (cEt) BNA monomer, a (2’-O,4’-C) constrained methoxyethyl (cMOE) BNA monomer, a 2’,4’-BNANC(N-H) monomer, a 2’,4’-BNANC(N-Me) monomer, a 2’,4’-BNANC(N-Bn) monomer, an ethylene-bridged nucleic acid (ENA) monomer, a carba LNA (cLNA) monomer, a 3,4-dihydro- 2 / 7-pyran nucleic acid (DpNA) monomer, a 2’-C-bridged bicyclic nucleotide (CBBN) monomer, a heterocyclic-bridged BNA monomer (such as triazolyl or tetrazolyl-linked), an amido-bridged BNA monomer, an urea-bridged BNA monomer, a sulfonamide-bridged BNA monomer, a bicyclic carbocyclic nucleotide monomer, a TriNA monomer, an a-L-TriNA monomer, a bicyclo DNA (bcDNA) monomer, an abcDNA monomer, an F-bcDNA monomer, a tricyclo DNA (tcDNA) monomer, an F-tcDNA monomer, an oxetane nucleotide monomer, a locked PMO monomer derived from 2’-amino-LNA, a guanidine-bridged nucleic acid (GuNA) monomer, a spirocyclopropylene-bridged nucleic acid (scpBNA) monomer, cyclohexenyl nucleic acid (CeNA) monomer, altriol nucleic acid (ANA) monomer, hexitol nucleic acid (HNA) monomer, fluorinated HNA (F-HNA) monomer, pyranosyl-RNA (p-RNA) monomer, 3'-deoxypyranosyl- DNA (p-DNA) monomer, glycol- or glycerol-based nucleic acid (GNA) monomer, threose-based nucleic acid (TNA) monomer, acyclic threoninol-based nucleic acid (aTNA) monomer and derivatives thereof.

[0222] In another embodiment, BNA scaffold modifications for use herein include cEt (2'- O,4'-C constrained ethyl) LNA (doi: 10.1021 / ja710342q), cMOE (2'-O,4'-C constrained methoxyethyl) LNA (Seth et al., J. Org. Chem. 2010, 75, 1569-1581), 2',4'-BNANC (N-H), 2',4'-BNANC (N- Me), ethylene-bridged nucleic acid (ENA) (doi: 10.1093 / nass / l.1 .241), carba LNA (cLNA) (doi: 10.1021 / jol00170g), DpNA (Osawa et al., J. Org. Chem., 2015, 80 (21), pp 10474-10481), 2'- C-bridged bicyclic nucleotide (CBBN, as in e.g. WO 2014 / 145356 (MiRagen Therapeutics)), heterocyclic-bridged LNA (as in e.g. WO 2014 / 126229 (Mitsuoka Y et al.)), amido-bridged LNA (as in e.g. Yamamoto et al. Org. Biomol. Chem. 2015, 13, 3757), urea-bridged LNA (as in e.g. Nishida et al. Chem. Commun. 2010, 46, 5283), sulfonamide-bridged LNA (as in e.g. WO 2014 / 112463 (Obika S et al.)), bicyclic carbocyclic nucleosides (as in e.g. WO 2015 / 142910 (lonis Pharmaceuticals)), TriNA (Hanessian et al., J. Org. Chem., 2013, 78 (18), pp 9064-9075), a-L-TriNA, bicyclo DNA (bcDNA) (Bolli et al., Chem Biol. 1996 Mar;3(3): 197- 206), F-bcDNA (DOI: 10.1021 / jo402690j) , tricyclo DNA (tcDNA) (Murray et al., Nucl. Acids Res., 2012, Vol. 40, No. 13 6135-6143), F-tcDNA (doi: 10.1021 / acs.joc.5b00184), or an oxetane nucleotide monomer (Nucleic Acids Res. 2004, 32, 5791 -5799). In other embodiments, BNA scaffold modifications for use herein include those disclosed in WO 2011 / 097641 (ISIS / lonis Pharmaceuticals) and WO 2016 / 017422 (Osaka University).

[0223] Thus, in some embodiments, an oligonucleotide as described herein comprises an internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), and preferred sugar modifications include:

[0224] - 2’-0-modified RNA, more preferably 2’-O-alkyl or 2’-0-(substituted)alkyl, even more preferably 2’-O-methyl (2’-OMe) or 2’-0-(2-methoxy)ethyl (2’-MOE)

[0225] - BNA, more preferably a CRN monomer or a locked nucleic acid (LNA) monomer, even more preferably an LNA monomer.

[0226] More preferred sugar modifications are 2’-OMe, 2’-MOE, 2’-Fluoro, and a locked nucleic acid (LNA); most preferably 2’-OMe and LNA.

[0227] In one embodiment, an oligonucleotide comprises an internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VI I), (VIII) and / or (IX), preferably (VII) or (IX), and in preferred sugar modifications comprises BNA modifications as selected from the set consisting of:

[0228] - a single BNA scaffold modification in the monomer at the 5'-terminus,

[0229] - a single BNA scaffold modification in the monomer at the 3'-terminus,

[0230] - two BNA scaffold modifications where one is in the monomer at the 5'-terminus and the other is in the monomer at the 3 '-terminus, - two BNA scaffold modifications, one in the monomer at the 5'-terminus and the other in the adjacent monomer,

[0231] - two BNA scaffold modifications, one in the monomer at the 3 '-terminus and the other in the adjacent monomer, and

[0232] - four BNA scaffold modifications, one in the monomer at the 5'-terminus, one in the monomer adjacent to the 5'-terminus, one in the monomer at the 3'-terminus and one in the monomer adjacent to the 3'-terminus;

[0233] In an embodiment, 1 , 2, 3, 4 or 5 additional BNA scaffold modifications are present in the oligonucleotide, wherein said oligonucleotide comprises 2'-O- substituted RNA monomers linked by phosphorothioate backbone linkages, wherein all cytosine bases are 5- methylcytosine, optionally wherein also all uracil bases are 5- methyluracil bases.

[0234] Thus, in some embodiments, an oligonucleotide as described herein comprises an internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), and one or more sugar modifications which are selected from the group consisting of: 2’-O-methyl, 2’-0-methoxyethyl, 2’-Fluoro, and locked nucleic acid (LNA), preferably selected from the group consisting of 2’-O-methyl and locked nucleic acid (LNA).

[0235] In some embodiments, all RNA nucleotides present in an oligonucleotide of this invention have a modified ribosyl moiety as described above and comprises an internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX). Thus, the RNA nucleotides present in an oligonucleotide of this invention are preferably selected from the group consisting of: 2’-0-modified RNA, more preferably 2’-O-alkyl or 2’-O- (substituted)alkyl, even more preferably 2’-O-methyl (2’-OMe) or 2’-0-(2-methoxy)ethyl (2’- MOE), most preferably 2’-O-methyl (2’-OMe).

[0236] In some embodiments, an oligonucleotide of this invention comprises an internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), and comprises one or more sugar modifications comprising one or more BNAs, more preferably one or more CRNs or LNAs, even more preferably one or more LNAs. In preferred embodiments, the one or more BNAs (more preferably one or more CRNs or LNAs, even more preferably one or more LNA) occur at the 5’ and / or 3’ terminus of the oligonucleotide. Thus, for example, oligonucleotides of this disclosure may comprise 1 LNA at the 5’ terminus and 1 LNA at the 3’ terminus.

[0237] Base of the oligonucleotide

[0238] A base, sometimes called a nucleobase, may be selected from one of the natural DNA or RNA nucleobases (adenine, cytosine, guanine, thymine, and uracil). A base may also be a natural base analogue (“modified base”), including artificial bases. Cytosine, thymine, and uracil are pyrimidine bases, and are generally linked to the scaffold through their 1 -nitrogen. Adenine and guanine are purine bases and are generally linked to the scaffold through their 9-nitrogen. Preferred bases and modified bases including artificial bases are described later herein.

[0239] As described above, oligonucleotides as described above comprising an internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), may comprise “natural” nucleobases as well as modified nucleobases (including artificial bases). Combinations of distinct modified or artificial bases within one molecule are encompassed.

[0240] The term “base modification” or “modified base” as identified herein refers to the modification of a naturally occurring base in RNA (i.e. pyrimidine or purine base) or to the de novo synthesis of a base. This de novo synthesized base could be qualified as “modified” by comparison to an existing base.

[0241] If such a base is a modified base or if a base analogue is being used, said modified base or base analogue should preferably keep the same base pair specificity as the base it replaces. “Base pairing” refers to the binding of two bases (or nucleobases) to each other by hydrogen bonds. Specifically, a nucleobase analogue replacing cytosine is capable of base pairing with guanine, a nucleobase analogue replacing guanine is capable of base pairing with cytosine, a nucleobase analogue replacing adenine is capable of base pairing with uracil and a nucleobase analogue replacing uracil is capable of base pairing with adenine.

[0242] In preferred embodiments, an oligonucleotide as described herein comprising an internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), comprises one or more modified or artificial bases. In some embodiments, an oligonucleotide as described herein comprises 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 or 42 modified bases. In some embodiments, an oligonucleotide as described herein comprises at least 1 , 2, 3, 4, 5, 6, 7, 8, 9,10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 3334, 35, 36, 37, 38, 39, 40, 41 or 42 modified or artificial bases.

[0243] In some embodiments, all the bases of an oligonucleotide as described herein may be modified or artificial bases. Alternatively, an oligonucleotide as described herein may predominantly contain modified or artificial bases. For example, all except 1 , 2, 3, 4, 5, 6, 7, 8, 9 or 10 bases may be modified or artificial bases.

[0244] Modified or artificial bases as used herein may include modified versions of the natural purine and pyrimidine bases (e.g. adenine, uracil, guanine, cytosine, and thymine), such as hypoxanthine (as present in e.g. inosine), orotic acid, agmatidine, lysidine, pseudouracil, N1- methylpseudouracil, dihydrouracil, N3-uracil, N1 -methyl-pseudouracil, 5-formylcytosine, 5- acetylcytosine, 5-hydroxycytosine, N6-methyladenine, 8-oxoadenine, 7-methyladenine, 1- methylguanine, 7-methylguanine, N2,N2-dimethylguanine, N2,N2,7-trimethylguanine, N2,7- dimethylguanine, 6-amino-5-nitropyridin-2-one 2-thiopyrimidine (e.g. 2-thiouracil, 2- thiothymine), G-clamp and its derivatives, 5-substituted pyrimidine (e.g. 5-halouracil, 5- propynyluracil, 5-propynylcytosine, 5-aminomethyluracil, 5-hydroxymethyluracil, 5-methyluracil (thymine), 5-methylcytosine, 5-aminomethylcytosine, 5-hydroxymethylcytosine, Super T), 7- deazaguanine, 7-deazaadenine, 2,6-diaminopurine, 7-aza-2,6-diaminopurine, 8-aza-7- deazaguanine, 8-aza-7-deazaadenine, 8-aza-7-deaza-2,6-diaminopurine, Super G, Super A, and N4-ethylcytosine, or derivatives thereof; N2-cyclopentylguanine (cPent-G), N2-cyclopentyl- 2-aminopurine (cPent-AP), and N2-propyl-2-aminopurine (Pr-AP), or derivatives thereof; and degenerate or universal bases, like 2,6-difluorotoluene or absent bases like abasic sites (e.g.

[0245] 1 -deoxyribose, 1 ,2-dideoxyribose, 1-deoxy-2-0-methylribose; or pyrrolidine derivatives in which the ring oxygen has been replaced with nitrogen (azaribose)). Examples of derivatives of Super A, Super G and Super T can be found in US patent 6,683,173 (Epoch Biosciences), which is incorporated here by reference.

[0246] Preferred modified bases include 5-methylcytosine, 5-methyluracil, hypoxanthine (e.g. as included in inosine), cytosine analogues, and uracil analogues. A cytosine analogue may be a pyrimidine base or a pyridine base, preferably a pyridine base. A particular example of a cytosine analogue which is a pyrimidine base is pseudoisocytosine or a 6-amino-5-nitropyridin-

[0247] 2-one (Benner’s Z base) or 2', 2'-difluoro 2'deoxycytidine (gemcitabine). In a preferred embodiment, a uracil analogue is a uridine, more preferably N3-Uridine. Therefore, in preferred embodiments, the nucleotide residue opposite the target adenosine is N3-Uridine, These cytosine and uracil analogues are preferred for oligonucleotides used for RNA editing, preferably recruiting ADAR. Particularly preferred modified bases include 5-methylcytosine, 5- methyluracil, hypoxanthine (e.g. as included in inosine),

[0248] In some embodiments, an oligonucleotide as described herein comprises an internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), and may comprise one or more modified or artificial bases. In some embodiments, the one or more modified or artificial bases are selected from the group consisting of 5- methylcytosine, 5-methyluracil, hypoxanthine (e.g. as included in inosine), cytosine analogues, and uracil analogues, preferably selected from the group consisting of 5-methylcytosine, hypoxanthine (e.g. as included in inosine), and cytosine analogues. In some embodiments, the one or more modified or artificial bases include one or more 5-methylcytosine, one or more hypoxanthines (e.g. as included in inosine), and one or more cytosine analogues. In some embodiments, oligonucleotides as described herein comprise one or more cytosine analogues. A preferred number of cytosine analogues is 1.

[0249] In some embodiments, oligonucleotides of the invention comprises an internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), and comprises one or more hypoxanthine bases, for example one or more inosines. For example, 1 , 2, 3, 4, or 5 inosines may be present. If more than 1 inosine is present, they are typically separated by at least one nucleotide that is not inosine. Typically, an inosine is used to replace the “natural” DNA base thymine or the “natural” RNA base uracil. A preferred number of inosines is 3.

[0250] In another embodiment, oligonucleotides of the invention do not comprise any hypoxanthine bases. In an embodiment, oligonucleotides of the invention do not comprise any inosine.

[0251] In some embodiments, an oligonucleotide of the invention comprising an internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), may comprise at least one base modification that increases binding affinity to target strands, increases melting temperature of the resulting duplex of said oligonucleotide with its target, and / or decreases immunostimulatory effects, and / or increases biostability, and / or improves biodistribution and / or intra-tissue distribution, and / or cellular uptake and trafficking. In an embodiment, an oligonucleotide of the invention comprises a 5-methylpyrimidine base. A 5- methylpyrimidine base is selected from a 5-methylcytosine and / or a 5-methyluracil and / or a thymine, in which thymine is identical to 5-methyluracil. Where an oligonucleotide of the invention has two or more such base modifications, said base modifications may be identical, for example all such modified bases in the oligonucleotide are 5-methylcytosine, or said base modifications may be combinations of different base modifications, for example the oligonucleotide may have one or more 5-methylcytosines and one or more 5-methyluracils.

[0252] The terms “thymine” and “5 -methyluracil” may be interchanged throughout the application. As used herein the expression “oligonucleotide comprises a 5-methylpyrimidine” means that at least one of the cytosine nucleobases of said oligonucleotide has being modified by substitution of the hydrogen at the 5-position of the pyrimidine ring with a methyl group, i.e. a 5-substituted cytosine, and / or that at least one of the uracil nucleobases of said oligonucleotide has been modified by substitution of the proton at the 5-position of the pyrimidine ring with a methyl group (i.e. a 5 -methyluracil). As used herein, the expression “the substitution of a hydrogen with a methyl group in position 5 of the pyrimidine ring” may be replaced by the expression “the substitution of a pyrimidine with a 5-methylpyrimidine,” with pyrimidine referring to only uracil, only cytosine, or both. Where an oligonucleotide of the invention has two or more such base modifications, said base modifications may be identical, for example all such modified bases in the oligonucleotide are 5-methylcytosine, or said base modifications may be combinations of different base modifications, for example the oligonucleotide may have one or more 5- methylcytosines and one or more 5-methyluracils.

[0253] In some embodiments, an oligonucleotide of the invention (comprising an internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), comprises one or more 5-methylcytosines. In some embodiments, a single 5- methylcytosine is present. In some embodiments, the one or more 5-methylcytosines comprise at least one 5-methylcytosine at the 5’ terminus. In some embodiments, the single 5- methylcytosine occurs at the 5’ terminus. Thus, oligonucleotides described herein may have a 5’ terminal residue comprising a 5-methylcytosine. In some embodiments, the one or more 5- methylcytosines comprise at least one 5-methylcytosine at the 3’ terminus. In some embodiments, the single 5-methylcytosine occurs at the 3’ terminus. Thus, oligonucleotides described herein may have a 3’ terminal residue comprising a 5-methylcytosine.

[0254] In some embodiments, the one or more 5-methylcytosines comprise at least one 5- methylcytosine at the 5’ terminus and at least one at the 3’ terminus. In some embodiments, one 5-methylcytosine occurs at the 5’ terminus and one at the 3’ terminus. Thus, oligonucleotides described herein may have a 5’ terminal residue comprising a 5- methylcytosine and a 3’terminal residue comprising a 5-methylcytosine.

[0255] In some embodiment, an oligonucleotide of the invention comprising an internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), may comprise a 5-methylcytosine and / or a 5-methyluracil base means that at least one of the cytosine nucleobases of said oligonucleotide has been modified by substitution of the proton at the 5-position of the pyrimidine ring with a methyl group (i.e. a 5-methylcytosine), and / or that at least one of the uracil nucleobases of said oligonucleotide has been modified by substitution of the proton at the 5-position of the pyrimidine ring with a methyl group (i.e. a 5-methyluracil),. Within the context of the invention, the expression “the substitution of a proton with a methyl group in position 5 of the pyrimidine ring” may be replaced by the expression “the substitution of a pyrimidine with a 5-methylpyrimidine,” with pyrimidine referring to only uracil, only cytosine or both. If said oligonucleotide comprises 1 , 2, 3, 4, 5, 6, 7, 8, 9 or more cytosines, and / uracils, , at least 1 , 2, 3, 4, 5, 6, 7, 8, 9 or more cytosines and / or uracils respectively have been modified this way. Preferably all cytosines and / or uracils have been modified this way or replaced by 5- methylcytosine and / or 5-methyluracil respectively. No need to say that the invention could only be applied to oligonucleotides comprising at least one cytosine and / or uracil respectively, in their sequence.

[0256] ‘Thymine’ and ‘5-methyluracil’ may be interchanged throughout the document.

[0257] Internucleoside linkage of the oligonucleotide A nucleotide is generally connected to neighbouring nucleotides through condensation of its 5’- phosphate moiety to the 3’-hydroxyl moiety of the neighbouring nucleotide monomer. Similarly, its 3’-hydroxyl moiety is generally connected to the 5’-phosphate of a neighbouring nucleotide monomer. This forms phosphodiester bonds. The phosphodiesters and the scaffold form an alternating copolymer. The bases are grafted to this copolymer, namely to the scaffold moieties. Because of this characteristic, the alternating copolymer formed by linked monomers of an oligonucleotide is often called the backbone of the oligonucleotide. Because the phosphodiester bonds connect neighbouring monomers together, they are often referred to as backbone linkages, internucleoside linkages or simply linkages or simply backbone. It is understood that when a phosphate group is modified so that it is instead an analogous moiety such as a phosphorothioate, such a moiety is still referred to as the “backbone linkage”, “internucleoside linkage”, or simply “linkage” or simply “backbone” of the monomer. This is referred to as a linkage modification. In general terms, the backbone of an oligonucleotide is thus comprised of alternating scaffolds and (backbone) linkages. Preferred linkages and linkage modifications including artificial linkages are described later herein.

[0258] Thus an oligonucleotide having 10 nucleotides may contain 9 linkages, linking the 10 ribose units of the 10 nucleotides together. Additionally, there may be one or more last linkage(s) present at one or both sides of the oligonucleotide, which is only connected to one nucleotide. The terms “linkage”, “internucleoside linkage”, “backbone linkage” and “backbone” are also meant to indicate such a pendant linkage.

[0259] In some embodiments, an oligonucleotide comprising an internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), further comprises at least another modified internucleoside linkage. In some embodiments, this other modified internucleoside linkage consists of a phosphorothioate moiety, linking two ribose units. Thus, in some embodiments, an oligonucleotide comprising an internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), further comprises at least one of the naturally occurring 3' to 5' phosphodiester moieties present in RNA which has been replaced by a non-natural moiety.

[0260] As described above, oligonucleotides of this invention comprising an internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), may also comprise “natural” phosphodiester linkages as well as other modified linkages (including artificial linkages). Combinations of distinct modified or artificial linkages within one molecule are encompassed.

[0261] Modified or artificial linkages as disclosed herein may include modified versions of the phosphodiester present in natural DNA and RNA, such as phosphorothioate (PS), chirally pure phosphorothioate, (R)-phosphorothioate, (S)-phosphorothioate, phosphorodithioate (PS2), phosphonoacetate (PACE), phosphonoacetamide (PACA), thiophosphonoacetate (thioPACE), thiophosphonoacetamide, phosphorothioate prodrug, H-phosphonate, methyl phosphonate, and other alkyl phosphonate (such as 3’-alkylene phosphonate and 5’-alkylene phosphonate Chiral phosphonate, phosphinate, thionophosphoramidate, thionoalkylphosphonate, thionoalkylphosphotriester, selenophosphate), methyl phosphonothioate, methyl phosphate, methyl phosphorothioate, ethyl phosphate, ethyl phosphorothioate, boranophosphate, boranophosphorothioate, methyl boranophosphate, methyl boranophosphorothioate, methyl boranophosphonate, methyl boranophosphonothioate, phosphate, phosphotriester, aminoalkylphosphotriester, and their derivatives. Among these, phosphorothioate (PS) is preferred.

[0262] Modified or artificial linkages as disclosed herein may also include phosphoryl guanidines, acylphosphoramidates, sulfonylphosphoramidates, phosphoramidite, phosphoramidate, N3’->P5’ phosphoramidate, phosphordiamidate, phosphorothiodiamidate, sulfamate, dimethylenesulfoxide, amide, sulfonate, siloxane, sulfide, sulfone, formacetyl, thioformacetyl, methylene formacetyl, alkenyl, methylenehydrazino, sulfonamide, amide, triazole, oxalyl, carbamate, methyleneimino (MMI), and thioacetamido nucleic acid (TANA); and their derivatives. Among these, phosphoryl guanidines are preferred.

[0263] In some embodiments, an oligonucleotide as described herein comprising an internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), comprises one or more additional / distinct modified or artificial internucleoside linkages. In some embodiments, an oligonucleotide as described herein comprises 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 modified or artificial internucleoside linkages. In some embodiments, an oligonucleotide as described herein comprises at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 modified or artificial internucleoside linkages. In some embodiments, an oligonucleotide as described herein comprises 10 or 11 modified or artificial internucleoside linkages. In some embodiments, an oligonucleotide as described herein comprises at least 10 or 11 modified or artificial internucleoside linkages.

[0264] Modified or artificial internucleoside linkages preferably occur in the 5’ and 3’ termini of the oligonucleotides. Another preferred location for a modified or artificial internucleoside linkages is between the first and second nucleotide residue 3’ of the nucleotide residue opposite the target adenosine. This preferred location of modified or artificial internucleoside linkage is preferred for oligonucleotides for RNA editing, more preferably for those recruiting ADAR as later defined herein.

[0265] In preferred embodiments, modified or artificial internucleoside linkages may be selected from the group consisting of: phosphorothioate internucleoside linkages and phosphoryl guanidine internucleoside linkages. A preferred example of a phosphoryl guanidine internucleoside linkage is dimethylimidazolidin-2-ylidene (dmi)-phosphoramidate. In preferred embodiments, an oligonucleotide as described herein comprising an internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VI I) or (IX), comprises one or more additional or distinct artificial or modified internucleoside linkage, preferably phosphorothioate internucleoside linkages. In some embodiments, an oligonucleotide as described herein comprises 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 artificial or modified internucleoside linkage, preferably phosphorothioate internucleoside linkages. In some embodiments, an oligonucleotide as described herein comprises at least 1 , 2, 3, 4, 5, 6, 7, 8, 9,10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40 or 41 artificial or modified internucleoside linkage, preferably phosphorothioate internucleoside linkages. In some embodiments, an oligonucleotide as described herein comprises 17 artificial or modified internucleoside linkage, preferably phosphorothioate internucleoside linkages. In some embodiments, an oligonucleotide as described herein comprises at least 17 artificial or modified internucleoside linkage, preferably phosphorothioate internucleoside linkages.

[0266] In some embodiments, an oligonucleotide as described herein may also consist of modified or artificial internucleoside linkage, preferably internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), and phosphorothioate internucleoside linkages. This means that all internucleoside linkages in the oligonucleotide are modified or artificial, preferably are as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), and phosphorothioate internucleoside linkages. Alternatively, an oligonucleotide as described herein may predominantly contain modified or artificial internucleoside linkage, preferably as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), and phosphorothioate internucleoside linkages. For example, all except 1 , 2, 3, 4, 5, 6, 7, 8, 9 or 10 internucleoside linkages may be modified or artificial, preferably as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), and phosphorothioate internucleoside linkages.

[0267] In preferred embodiments of oligonucleotides comprising one or more phosphorothioate linkages, phosphorothioate linkages occur in the 5’ and 3’ termini of the oligonucleotides.

[0268] Thus, in some embodiments, an oligonucleotide as described herein comprises an oligonucleotide comprising an internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), and phosphorothioate internucleoside linkages between the terminal two, three, four, five, or six residues at the 5’ terminus and / or between the terminal two, three, four, five, or six residues at the 3’ terminus. Phosphorothioate linkages preferably occur both at the 5’ terminus and the 3’ terminus. This preferred location of modified or artificial internucleoside linkage is preferred for oligonucleotides for RNA editing, more preferably for those recruiting ADAR as later defined herein. In preferred embodiments, an oligonucleotide as described herein (comprising an internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), comprises one or more phosphoryl guanidine internucleoside linkages.

[0269] In preferred embodiments, an oligonucleotide as described herein (comprising an internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), comprises one or more phosphoryl guanidine internucleoside linkages (PN internucleoside linkages), preferably wherein the phosphoryl guanidine is dimethylimidazolidin-2-ylidene (dmi)-phosphoramidate (PN-dmi-phosphoramidate) .

[0270] In some embodiments, an oligonucleotide as described herein (comprising an internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), comprises 1 , 2, or 3 phosphoryl guanidine internucleoside linkages (PN internucleotide linkages), preferably 1 , 2 or 3 PN-dmi-phosphoramidate internucleoside linkages.

[0271] In some embodiments, an oligonucleotide as described herein (comprising an internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), comprises 3 phosphoryl guanidine internucleoside linkages (PN internucleoside linkages), preferably 3 PN-dmi-phosphoramidate internucleoside linkages.

[0272] In some embodiments, an oligonucleotide as described herein (comprising an internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), comprises at least 1 , 2, or 3 phosphoryl guanidine internucleoside linkages (PN internucleoside linkages), preferably at least 1 , 2 or 3 PN-dmi-phosphoramidate internucleoside linkages.

[0273] In some embodiments, an oligonucleotide (comprising an internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), comprises one or more (1 , 2, 3) phosphoryl guanidine linkages (PN linkages) (preferably (dmi)- phosphoramidate, (PN-dmi-phosphoramidate)), said phosphoryl guanidine linkages (PN linkages) (preferably (dmi)-phosphoramidate, (PN-dmi-phosphoramidate)) occur adjacent to the 5’ terminus, adjacent to the 3’ terminus, and / or between the first and second nucleotide residue 3’ of the nucleotide residue opposite the target adenosine. The target adenosine is a feature of the oligonucleotide used for RNA editing when recruiting ADAR.

[0274] Several types of phosphoramidate linkages (PN linkages) already exist, such as PN-dmi- phosphoramidate (PNdmi), PN-mesyl (PNms), PN-busyl (PNbs), PN-tosyl (PNts), represented by the following formulae:

[0275] (PNbs) (Formula (XII)) (PNts) (Formula (XIII))

[0276] Phosphoramidate linkages (PN linkages) of formula (X), (XI), (XII) and (XIII) have been described previously in WO 2018 / 156056 A1 .

[0277] We show in example 7 that the oligonucleotides of the invention (comprising an internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX)) outperform those comprising formulae (X) (corresponding to PNdmi), (XI) (corresponding to PNms), (XII) (corresponding to PNbs), (XIII) (corresponding to PNts).

[0278] Therefore, in one embodiment, an internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX) and present in the oligonucleotide of the invention is not an internucleoside linkage as disclosed in formula (X), (XI), (XII) or (XIII).

[0279] In this context, “adjacent” means directly next to (or contiguous with) the nucleotide residue opposite the target adenosine.

[0280] In some embodiment, an oligonucleotide (comprising an internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), comprises a (at least 1 , 2, 3) phosphoryl guanidine linkage (PN linkage) (preferably (dmi)- phosphoramidate, (PN-dmi-phosphoramidate internucleoside linkages)) adjacent to the 5’ terminus, a (at least 1 , 2, 3) phosphoryl guanidine linkage (PN linkage) (preferably (dmi)- phosphoramidate, (PN-dmi-phosphoramidate internucleoside linkages)) adjacent to the 3’ terminus, and a (at least 1 2 3) phosphoryl guanidine linkage (PN linkage) (preferably (dmi)- phosphoramidate, (PN-dmi-phosphoramidate internucleoside linkages)) between the first and second nucleotide residue 3’ of the nucleotide residue opposite the target adenosine. The target adenosine is a feature of the oligonucleotide used for RNA editing when recruiting ADAR.

[0281] In this context, “adjacent” means directly next to (or contiguous with) the nucleotide residue opposite the target adenosine. Combination of modifications in the oligonucleotide

[0282] It is customary to combine an internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), in an oligonucleotide with additional modifications such as additional modified and / or artificial internucleoside linkages, nucleobases and / or sugar or scaffold moieties, such as those described above, in the same molecule. The present invention therefore further encompasses the combination of the number and pattern of internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), earlier defined herein with the combination of modified and / or artificial internucleoside linkages, nucleobases and / or sugar or scaffold moieties, such as those described above, in the same molecule.

[0283] In some embodiments, oligonucleotides as described herein comprising an internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), further comprise a modified and / or artificial sugar or scaffold moiety and a modified and / or artificial nucleobase such as those earlier described herein.

[0284] In some embodiments, oligonucleotides as described herein comprising an internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), further comprise a modified and / or artificial sugar or scaffold moiety and an additional type of internucleoside linkage, preferably a modified and / or artificial linkage such as those earlier described herein.

[0285] In some embodiments, oligonucleotides as described herein comprising an internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), further comprise a modified and / or artificial nucleobase and an additional type of internucleoside linkage, preferably a modified and / or artificial linkage such as those earlier described herein.

[0286] In some embodiments, oligonucleotides as described herein comprising an internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), further comprise a modified and / or artificial sugar or scaffold moiety, a modified and / or artificial nucleobase and an additional type of internucleoside linkage, preferably a modified and / or artificial linkage such as those earlier described herein.

[0287] In some embodiments, an oligonucleotide of the invention, comprising an internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), further comprises a 2’-O-methyl RNA nucleotide residue and has a backbone wherein at least one phosphate moiety is replaced by a phosphorothioate moiety and it comprises less than 42 nucleotides (i.e. it comprises 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 or 42 nucleotides). Preferably, the oligonucleotide further has a 5-methylpyrimidine base.

[0288] In some embodiments, an oligonucleotide of the invention, consists of 2’-O-methyl RNA nucleotide residues and has a backbone wherein all internucleoside linkage are represented by formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), and comprises less than 42 nucleotides (i.e. it comprises 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 or 42 nucleotides). Preferably, the oligonucleotide further has a 5-methylpyrimidine base.

[0289] In some embodiments, the oligonucleotide of the invention comprises an internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), and a phosphorothioate linkage and a 2’-O-methyl RNA nucleotide residue. Such oligonucleotide comprises a 2’-O-methyl RNA residue, which is connected through a phosphorothioate linkage or through an internucleoside linkage of formula (I), (II), (III), (IV), (V), (VI), (VII), (VI 11) and / or (IX), preferably (VII) or (IX), to the next nucleotide in the sequence. This next nucleotide may be, but not necessarily, another 2’-O-methyl phosphorothioate RNA nucleotide residue or another 2-O’-methyl RNA nucleotide residue comprising as internucleoside linkage one of (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX).

[0290] Alternatively, such oligonucleotide consists of 2’-O-methyl RNA nucleotide residues having for internucleoside linkage one of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), wherein all nucleotides comprise a 2’-O-methyl moiety and a moiety of formula (I), (II), (III), (IV), (V), (VI), (VI I), (VIII) and / or (IX), preferably (VII) or (IX).

[0291] Alternatively, such oligonucleotide consists of 2’-O-methyl phosphorothioate RNA nucleotide residues and 2’-O-methyl RNA nucleotide residues with an internucleoside linkage of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX).

[0292] In some embodiments, an oligonucleotide of the invention comprises a 2’-O-methyl RNA nucleotide residues, has a backbone wherein at least one internucleoside linkage has been replaced by a compound of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), and preferably comprises one or more 5-methylpyrimidine bases.

[0293] In some embodiments an oligonucleotide of the invention comprises a modified base which is 5-methylcytosine and / or 5-methyluracil, a modified sugar which is 2-O’-methyl and / or a modified internucleoside linkage which is as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX). In some embodiments an oligonucleotide of the invention comprises a modified internucleoside linkage which is as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), and further comprises the following internucleoside linkage modifications: phosphodiester internucleoside linkages between the terminal six, eight, ten, twelve, or twenty-four residues at the 5’ terminus and between the terminal seven, nine, eleven, thirteen, or fifteen residues at the 3’ terminus; a phosphoryl guanidine linkage (a PN linkage) (preferably (dmi)-phosphoramidate,

[0294] In some embodiments, an oligonucleotide as described herein comprising a modified internucleoside linkage which is as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), further comprises 1 , 2, or 3 phosphoryl guanidine internucleoside linkages (PN internucleoside linkages) (preferably (dmi)-phosphoramidate) internucleoside linkages (PN-dmi-phosphoramidate internucleoside linkages).

[0295] In an embodiment, the PN linkage is adjacent to the 5’ terminus and / or adjacent to the 3’ terminus.

[0296] In an embodiment, the PN-dmi-phosphoramidate linkage is adjacent to the 5’ terminus and / or adjacent to the 3’ terminus.

[0297] In an embodiment, the PN linkage is between the first and second nucleotide residue 3’ of the nucleotide residue opposite the target adenosine.

[0298] In an embodiment, the PN-dmi-phosphoramidate linkage is between the first and second nucleotide residue 3’ of the nucleotide residue opposite the target adenosine.

[0299] Optionally one, two, three, or four, preferably four, phosphodiester linkages to the phosphoryl guanidine linkage (PN linkage) (preferably (dmi)-phosphoramidate, PN-dmi-phosphoramidate) in the 5’ terminus and the 3’ terminus.

[0300] In some embodiments, oligonucleotides as described herein comprising an internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), further comprise the following sugar modifications: each RNA nucleotide is 2’-0-modified RNA, more preferably 2’-O-alkyl or 2’-O- (substituted) alkyl, even more preferably 2’-O-methyl (2’-OMe) or 2’-O-(2- methoxy)ethyl (2’-MOE);

[0301] 1 or 2 BNA, preferably 1 BNA at the 5’ terminus and 1 BNA at the 3’ terminus, more preferably a CRN monomer or a locked nucleic acid (LNA) monomer; even more preferably an LNA; or advantageously, a combination of the above. In some embodiments, oligonucleotides as described herein comprising an internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), further comprise the following sugar modifications: each RNA nucleotide is 2’-0-modified RNA, more preferably 2’-O-alkyl, 2’-O- (substituted) alkyl or 2’-halo even more preferably 2’-O-methyl (2’-OMe), 2’-O-(2- methoxy)ethyl (2’-MOE), 2’-Fluoro or 2’-FANA;

[0302] 1 or 2 BNA, preferably 1 BNA at the 5’ terminus and 1 BNA at the 3’ terminus, more preferably a CRN monomer or a locked nucleic acid (LNA) monomer; even more preferably an LNA; or advantageously, a combination of the above.

[0303] In some embodiments, oligonucleotides as described herein comprising an internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), further comprise the following sugar modifications: each RNA nucleotide is 2’-0-modified RNA, more preferably 2’-O-alkyl or 2’-O- (substituted)alkyl, even more preferably 2’-O-methyl (2’-OMe) or2’-0-(2-methoxy)ethyl (2 -MOE);

[0304] 1 or 2 BNA, preferably 1 BNA at the 5’ terminus and 1 BNA at the 3’ terminus, more preferably a CRN monomer or a locked nucleic acid (LNA) monomer; even more preferably an LNA;

[0305] 2’-deoxy (DNA) at the position opposite the target adenosine and at the position 3’ of the position opposite the target adenosine; or advantageously, a combination of two or all of the above.

[0306] This is a preferred oligonucleotide structure for oligonucleotide used for RNA editing (preferably recruiting ADAR) as later explained herein.

[0307] In some embodiments, oligonucleotides as described herein comprising an internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), are 2’-0-modified RNA oligonucleotides (preferably 2’-O-alkyl or2’-0-(substituted)alkyl, even more preferably 2’-O-methyl (2’-OMe) or 2’-0-(2-methoxy)ethyl (2’-MOE, most preferably 2’-O-methyl) comprising the following sugar modifications:

[0308] 1 or 2 BNA, preferably 1 BNA at the 5’ terminus and 1 BNA at the 3’ terminus, more preferably a CRN monomer or a locked nucleic acid (LNA) monomer; even more preferably an LNA;

[0309] 2’-deoxy (DNA) at the position opposite the target adenosine and at the position 3’ of the position opposite the target adenosine; or advantageously, a combination of the above.

[0310] This is a preferred oligonucleotide structure for oligonucleotide used for RNA editing (preferably recruiting ADAR) as later explained herein. In some embodiments, oligonucleotides as described herein for RNA editing (preferably for recruiting ADAR) comprising an internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), further comprise the following nucleobase modifications:

[0311] 1 , 2, 3, 4, or 5, preferably 3, hypoxanthines (preferably inosines); a 5-methylcytosine base preferably at the 5’ terminus and / or preferably at the 3’ terminus; a cytosine analogue, preferably 6-amino-5-nitropyridin-2-one (Benner’s Z base) or pseudoisocytosine or 2', 2'-difluoro 2'deoxycytidine (gemcitabine), more preferably 6- amino-5-nitropyridin-2-one an uracil analogue, preferably uridine, more preferably N3-uridine; or advantageously, a combination of two or all of the above.

[0312] The cytosine analogue or the uracil analogue are preferably present at the nucleotide opposite the adenosine to be deaminated by ADAR when the oligonucleotide is used for RNA editing (preferably recruiting ADAR) as later explained herein.

[0313] In some embodiments, oligonucleotides as described herein comprising an internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), further comprise the following nucleobase modifications:

[0314] 1 , 2, 3, 4, or 5, preferably 3, hypoxanthines (preferably inosines); a 5-methylcytosine base preferably at the 5’ terminus and / or preferably at the 3’ terminus; or advantageously, a combination of two or all of the above.

[0315] In some embodiments, an oligonucleotide as described herein comprising a modified internucleoside linkage which is as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VI I) or (IX), further comprises:

[0316] 1 , 2, or 3 phosphoryl guanidine internucleoside linkages (PN internucleoside linkages) (preferably (dmi)-phosphoramidate) internucleoside linkages (PN-dmi- phosphoramidate internucleoside linkages), and

[0317] 1 , 2 or 3 BNA, preferably 1 BNA at the 5’ terminus and 1 BNA at the 3’ terminus, more preferably a CRN monomer or a locked nucleic acid (LNA) monomer; even more preferably an LNA;

[0318] In some embodiments, oligonucleotides as described herein comprising an internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), further comprise the following sugar modifications: each RNA nucleotide is 2’-0-modified RNA, more preferably 2’-O-alkyl or 2’- O-(substituted)alkyl, even more preferably 2’-O-methyl (2’-OMe) or 2’-O-(2- methoxy)ethyl (2’-MOE); 1 or 2 BNA, preferably 1 BNA at the 5’ terminus and 1 BNA at the 3’ terminus, more preferably a CRN monomer or a locked nucleic acid (LNA) monomer; even more preferably an LNA;

[0319] 1 , 2, or 3 phosphoryl guanidine internucleoside linkages (PN internucleoside linkages) (preferably (dmi)-phosphoramidate) internucleoside linkages (PN-dmi- phosphoramidate internucleoside linkages),

[0320] 2’-deoxy (DNA) at the position opposite the target adenosine and at the position 3’ of the position opposite the target adenosine; or advantageously, a combination of two or all of the above.

[0321] This is a preferred oligonucleotide structure for oligonucleotide used for RNA editing (preferably recruiting ADAR) as later explained herein.

[0322] In some embodiments, oligonucleotides as described herein comprising an internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), and have the following modifications:

[0323] 2’-0-modified RNA oligonucleotides (preferably 2’-O-alkyl or 2’-O- (substituted)alkyl, even more preferably 2’-O-methyl (2’-OMe) or 2’-0-(2-methoxy)ethyl (2’- MOE, most preferably 2’-O-methyl)

[0324] 1 or 2 BNA, preferably 1 BNA at the 5’ terminus and 1 BNA at the 3’ terminus, more preferably a CRN monomer or a locked nucleic acid (LNA) monomer; even more preferably an LNA;

[0325] 2’-deoxy (DNA) at the position opposite the target adenosine and at the position 3’ of the position opposite the target adenosine; or advantageously, a combination of the above.

[0326] This is a preferred oligonucleotide structure for oligonucleotide used for RNA editing (preferably recruiting ADAR) as later explained herein.

[0327] In some embodiments, oligonucleotides as described herein (preferably for RNA editing (preferably for recruiting ADAR)) comprising an internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), and further comprise the following nucleobase modifications:

[0328] 1 , 2, 3, 4, or 5, preferably 3, hypoxanthines (preferably inosines); a 5-methylcytosine base preferably at the 5’ terminus and / or preferably at the 3’ terminus; a cytosine analogue, preferably 6-amino-5-nitropyridin-2-one (Benner’s Z base) or pseudoisocytosine or 2', 2'-difluoro 2'deoxycytidine (gemcitabine), more preferably 6-amino-5-nitropyridin-2-one an uracil analogue, preferably uridine, more preferably N3-Uridine; or advantageously, a combination of two or all of the above.

[0329] The cytosine analogue or the uracil analogue are preferably present at the nucleotide opposite the adenosine to be deaminated by ADAR when the oligonucleotide is used for RNA editing (preferably recruiting ADAR) as later explained herein.

[0330] A preferred oligonucleotide of the invention comprising an internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), further comprises or consists of an RNA molecule or a modified RNA molecule. In a preferred embodiment, an oligonucleotide is single stranded. The skilled person will understand that it is however possible that a single stranded oligonucleotide may form an internal double stranded structure. However, this oligonucleotide is still named a single stranded oligonucleotide in the context of this invention. A single stranded oligonucleotide has several advantages compared to a double stranded siRNA oligonucleotide: (i) its synthesis is expected to be easier than two complementary siRNA strands; (ii) there is a wider range of chemical modifications possible to enhance uptake in cells, a better (physiological) stability and to decrease potential generic adverse effects; (iii) siRNAs have a higher potential for non-specific effects (including off-target genes) and exaggerated pharmacology (e.g. less control possible of effectiveness and selectivity by treatment schedule or dose) and (iv) siRNAs are less likely to act in the nucleus and cannot be directed against introns.

[0331] In another preferred embodiment, any of the oligonucleotides as described in the previous paragraph (i.e. comprising an internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), may further comprise:

[0332] (a) at least one base modification selected from 2-thiouracil, 2-thiothymine, 5- methylcytosine, 5-methyluracil, thymine,; and / or

[0333] (b) at least one sugar modification selected from 2’-O-methyl, 2’-0-(2-methoxy)ethyl, 2’- deoxy (DNA), 2’-F, 2’-FANA, morpholino, a bridged nucleotide or BNA, or the oligonucleotide comprises both bridged nucleotides and 2’-deoxy modified nucleotides (BNA / DNA mixmers);

[0334] (c) at least one backbone modification selected from (another) phosphorothioate or phosphordiamidate, and / or

[0335] (d) at least 1 , 2, or 3 phosphoryl guanidine internucleoside linkages (PN internucleoside linkages) (preferably (dmi)-phosphoramidate) internucleoside linkages (PN-dmi- phosphoramidate internucleoside linkages).

[0336] In another preferred embodiment, the oligonucleotide according to the invention comprising an internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), is modified over its entire length with one or more of the same modification, selected from (a) one of the base modifications; and / or (b) one of the sugar modifications; and / or (c) another of the backbone modifications.

[0337] With the advent of nucleic acid mimicking technology, it has become possible to generate molecules that have a similar, preferably the same hybridization characteristics in kind not necessarily in amount as nucleic acid itself. Such functional equivalents are of course also suitable for use in the invention.

[0338] The skilled person will understand that not each sugar, base, and / or backbone may be modified the same way. Several distinct modified sugars, bases and / or backbones may be combined into one single oligonucleotide of the invention.

[0339] A person skilled in the art will also recognize that there are many synthetic derivatives of oligonucleotides.

[0340] Preferably, said oligonucleotide comprises RNA, as RNA / RNA duplexes are very stable. It is preferred that an RNA oligonucleotide comprises a modification providing the RNA with an additional property, for instance resistance to endonucleases, exonucleases, and RNaseH, additional hybridisation strength, increased stability (for instance in a bodily fluid), increased or decreased flexibility, increased activity, reduced toxicity, increased intracellular transport, tissue-specificity, etc. In addition, the mRNA complexed with the oligonucleotide of the invention is preferably not susceptible to RNaseH cleavage. Preferred modifications have been identified above.

[0341] Oligonucleotides containing at least in part naturally occurring DNA nucleotides are useful for inducing degradation of DNA-RNA hybrid molecules in the cell by RNase H activity (EC.3.1.26.4).

[0342] Naturally occurring RNA ribonucleotides or RNA-like synthetic ribonucleotides comprising oligonucleotides are encompassed herein to form double stranded RNA-RNA hybrids that act as enzyme-dependent antisense through the RNA interference or silencing (RNAi / siRNA) pathways, involving target RNA recognition through sense-antisense strand pairing followed by target RNA degradation by the RNA-induced silencing complex (RISC).

[0343] Alternatively or in addition, an oligonucleotide can interfere with the processing or expression of precursor RNA or messenger RNA (steric blocking, RNaseH independent processes) in particular but not limited to RNA splicing and exon skipping, by binding to a target sequence of RNA transcript and getting in the way of processes such as translation or blocking of splice donor or splice acceptor sites. Moreover, the oligonucleotide may inhibit the binding of proteins, nuclear factors and others by steric hindrance and / or interfere with the authentic spatial folding of the target RNA and / or bind itself to proteins that originally bind to the target RNA and / or have other effects on the target RNA, thereby contributing to the destabilization of the target RNA, preferably pre-mRNA, and / or to the decrease in amount of diseased or toxic transcript and / or protein in diseases like HD as identified later herein. In some embodiments, the internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), is combined with other internucleoside linkage modifications, sugar modifications, and nucleobase modifications described above for the nucleobases of the oligonucleotide are combined in the same oligonucleotide / molecule.

[0344] In some embodiments, an oligonucleotide of this invention comprises or consists of any one of SEQ ID NOs:3-6 Also encompassed are oligonucleotides having a base sequence comprising or consisting of a sequence having up to 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 mutation(s) compared to the base sequence of any one of SEQ ID NOs: 3-6. Mutations include additions, insertions, deletions and substitutions. Also encompassed are oligonucleotides having a base sequence comprising or consisting of a sequence having at least 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity with any one of SEQ ID NOos: 3-6. Mutations include additions, insertions, deletions and substitutions. A preferred level of sequence identity is 80%. Another preferred level of sequence identity is 85%. Another preferred level of sequence identity is 90%. Another preferred level of sequence identity is 95%. Another preferred level of sequence identity is 97%.

[0345] It is understood that, in the context of any of the oligonucleotide described throughout this invention, the term “comprising” may be replaced with the term “consisting essentially of’ or “consisting”. In other words, in some embodiments, the oligonucleotides described herein consist essentially of a sequence that is capable of hybridizing with a region in the target RNA molecule, or consist of a sequence that is capable of hybridizing with a region in the target RNA molecule comprising said repetitive unit.

[0346] It is also viable that an oligonucleotide or an oligonucleotide for use, wherein said oligonucleotide comprises an internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), and wherein a nucleotide of said oligonucleotide is modified compared to an RNA oligonucleotide, preferably wherein said modification is selected from the group consisting of a modified base, a modified sugar and another modified internucleoside linkage than the one defined in any one of formula (I), (II), (III), (IV), (V), (VI), (VI I), (VIII) and / or (IX), preferably (VII) or (IX), of the invention.

[0347] Gapmer oligonucleotides

[0348] In an embodiment, an oligonucleotide of the invention comprising an internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), is a gapmer. In an embodiment, the oligonucleotide of the invention comprising an internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX),, further consists of a 5’ wing, a 3’ wing and a central part. In an embodiment, the oligonucleotide of the invention, consisting of a 5’ wing, a 3’ wing, and a central part (gap) is single stranded. Such structure (a 5’ wing, a 3’ wing, and a central part (gap)) may also be called gapmer. Said structure is attractive as it allows the oligonucleotide to bind towards target mRNA and to recruit RNaseH. The recruited RNaseH has at least one of the following effects on the targeted mutant allele: to silence, inactivate, knock down, break down, decrease or reduce its levels.

[0349] The presence of the wings provides the oligonucleotide stability and resistance properties to degradation by exonucleases. Implementation of chemical modifications in the gap and / or wings, comprising base, scaffold, and / or linkage modifications, may improve safety, biodistribution, stability, cellular uptake, intracellular trafficking, target binding affinity, duplex stability and the efficiency of the oligonucleotide of the invention compared to an oligonucleotide consisting of non-modified DNA and / or non-modified RNA analogues. This effect may be at least due to the presence of the modified RNA wings and / or the modified DNA central part. Finetuning of DNA and / or RNA base, scaffold, and / or linkage modifications at specific positions in the oligonucleotide (precision chemistry) may result in oligonucleotides with most favorable characteristics for clinical application.

[0350] In an embodiment, the central part / region (gap) of the oligonucleotide of the invention may comprise an internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), and it may further comprise DNA nucleotides or DNA nucleotide analogues. In a preferred embodiment, the base and sugar of this part of the antisense oligonucleotide are not modified. However, in a more preferred embodiment, an internucleoside linkage (or the whole backbone) in this central part is modified. In an embodiment, the modified internucleoside linkage is as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX). Additionally, it may be a phosphorothioate and / or a phosphoramidate internucleoside linkage. A nucleotide of the central part / region of said antisense oligonucleotide may have at least one internucleoside linkage modification and / or at least one base modification compared to an antisense oligonucleotide with a full non-modified DNA central part.

[0351] In an embodiment, a wing of the oligonucleotide of the invention comprises an internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), and further comprises modified RNA nucleotides and / or additional / distinct modified internucleoside linkages.

[0352] In an embodiment, both wings of the oligonucleotide comprise modified RNA nucleotides and / or modified internucleoside linkages including internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX). A wing of said antisense oligonucleotide may have at least one internucleoside linkage modification including internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), and / or at least one sugar modification and / or at least one base modification compared to a non-modified RNA-based antisense oligonucleotide. In an embodiment, the modified internucleoside linkage may also include a phosphorothioate or a phosphoramidate internucleoside linkage.

[0353] In one embodiment, the oligonucleotide of the invention comprises at least one internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), in at least one wing. In one embodiment, the oligonucleotide of the invention comprises at least one internucleoside linkage of formula (VI) in at least one wing. In one embodiment, the oligonucleotide of the invention comprises at least one internucleoside linkage of formula (VIII) in at least one wing. In one embodiment, the oligonucleotide of the invention comprises at least one internucleoside linkage of formula (VI) and / or (VIII) in both wings. In one embodiment, the oligonucleotide of the invention comprises at least one internucleoside linkage of formula (VI) in both wings. In one embodiment, the oligonucleotide of the invention comprises at least one internucleoside linkage of formula (VIII) in both wings.

[0354] In an embodiment, the oligonucleotide of the invention comprises 1 , 2, 3, 4, or 5 internucleoside linkage of formula (VI) and / or 1 , 2, 3, 4, or 5 internucleoside linkage of formula (VIII) in at least one wing. Preferably, the oligonucleotide of the invention comprises 1 , 2, 3, 4, 5 internucleoside linkage of formula (VI) in at least one wing. Preferably, the oligonucleotide of the invention comprises 1 , 2, 3, 4, 5 internucleoside linkage of formula (VIII) in at least one wing. Preferably, the oligonucleotide of the invention comprises 1 , 2, 3, 4, or 5 internucleoside linkage of formula (VI) and / or 1 , 2, 3, 4, or 5 internucleoside linkage of formula (VIII) in both wings. Preferably, the oligonucleotide of the invention comprises 1 , 2, 3, 4, 5 internucleoside linkage of formula (VI) in both wings. Preferably, the oligonucleotide of the invention comprises 1 , 2, 3, 4, 5 internucleoside linkage of formula (VIII) in both wings.

[0355] In an embodiment, the gapmer oligonucleotide of the invention comprises 1 , 2, 3, 4, or 5 internucleoside linkage of formula (VI) and / or 1 , 2, 3, 4, or 5 internucleoside linkage of formula (VIII) in at least one wing. Preferably, the gapmer oligonucleotide of the invention comprises 1 , 2, 3, 4, 5 internucleoside linkage of formula (VI) in at least one wing. Preferably, the gapmer oligonucleotide of the invention comprises 1 , 2, 3, 4, 5 internucleoside linkage of formula (VIII) in at least one wing. Preferably, the gapmer oligonucleotide of the invention comprises 1 , 2, 3, 4, or 5 internucleoside linkage of formula (VI) and / or 1 , 2, 3, 4, or 5 internucleoside linkage of formula (VIII) in both wings. Preferably, the gapmer oligonucleotide of the invention comprises 1 , 2, 3, 4, 5 internucleoside linkage of formula (VI) in both wings. Preferably, the gapmer oligonucleotide of the invention comprises 1 , 2, 3, 4, 5 internucleoside linkage of formula (VIII) in both wings. In an embodiment, the gapmer oligonucleotide of the invention comprises 1 internucleoside linkage of formula (VI) and / or 1 internucleoside linkage of formula (VIII) in at least one wing. Even more preferably in one embodiment, the gapmer oligonucleotide of the invention comprises 1 internucleoside linkage of formula (VI) in at least one wing. Even more preferably in one embodiment, the gapmer oligonucleotide of the invention comprises 1 internucleoside linkage of formula (VIII) in at least one wing. Even more preferably in one embodiment, the gapmer oligonucleotide of the invention comprises 1 internucleoside linkage of formula (VI) and / or 1 internucleoside linkage of formula (VIII) in both wings. Even more preferably in one embodiment, the gapmer oligonucleotide of the invention comprises 1 internucleoside linkage of formula (VI) in both wings. Even more preferably in one embodiment, the gapmer oligonucleotide of the invention comprises 1 internucleoside linkage of formula (VIII) in both wings.

[0356] In an embodiment, the gapmer oligonucleotide of the invention comprises 3 internucleoside linkages of formula (3 internucleosidernucleoside linkages of formula (VIII) in at least one wing. Even more preferably in one embodiment, the gapmer oligonucleotide of the invention comprises 3 internucleoside linkages of formula (VI) in at least one wing. Even more preferably in one embodiment, the gapmer oligonucleotide of the invention comprises 3 internucleoside linkages of formula (VIII) in at least one wing. Even more preferably in one embodiment, the gapmer oligonucleotide of the invention comprises 3 internucleoside linkage of formula (Vl)and / or 3 internucleoside linkages of formula (VIII) in both wings. Even more preferably in one embodiment, the gapmer oligonucleotide of the invention comprises 3 internucleoside linkages of formula (VI) in both wings. Even more preferably in one embodiment, the gapmer oligonucleotide of the invention comprises 3 internucleoside linkages of formula (VIII) in both wings. It is an advantageous that the embodiments of this invention exhibits better and / or improved effects in comparison to a gapmer oligonucleotide lacking any internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), linkages in the at least one wing.

[0357] In some embodiments, the artificial or modified internucleoside linkage of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII), and / or (IX), preferably (VII) or (IX), may be positioned at the termini of the gapmer oligonucleotide, and / or within the gapmer sequence. Said linkage(s) may be located at the 3' terminus, at the 5' terminus, at both termini, or within 1-5 nucleotides of either terminus (e.g. wing if the gapmer oligonucleotide is a gapmer) and may additionally or alternatively be positioned internally within the central region of the gapmer oligonucleotide. As used herein, the term “central region” refers to the contiguous region of an antisense gapmer oligonucleotide that is complementary to a target nucleic acid sequence and is responsible for mediating the gapmer oligonucleotide’s primary antisense activity. In embodiments where the antisense gapmer oligonucleotide is a gapmer, the central portion comprises a series of nucleotides, typically deoxyribonucleotides, that hybridize to the target RNAto form a DNA:RNA duplex capable of recruiting RNase H and promoting cleavage of the RNA strand. The central portion (e.g. gap), of a gapmer gapmer oligonucleotide is generally flanked on both the 5' and 3' ends by regions containing chemically modified ribonucleotides (e.g. as “wings”). As used herein, the term “wing” refers to a region of a gapmer oligonucleotide that includes, and extends inward from, a terminus of the gapmer oligonucleotide (i.e., the 3' and / or 5' terminus). A wing thus comprises the terminal nucleotide(s) and may include one or more additional nucleotides positioned within approximately 1 to 5 nucleotides from the respective terminus. Accordingly, an internucleoside linkage or any other chemical modification described as being located at a wing is understood to be positioned at, or within several nucleotides of the corresponding terminus.

[0358] In an embodiment, a gapmer oligonucleotide as described herein comprises 1 artificial or modified internucleoside linkage of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), positioned at the 5’ and / or 3’ wing or terminus of the gapmer oligonucleotide.

[0359] In an embodiment, a gapmer oligonucleotide as described herein comprises 2 artificial or modified internucleoside linkages of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), positioned at the 5’ and / or 3’ wing or terminus of the gapmer oligonucleotide.

[0360] In an embodiment, a gapmer oligonucleotide as described herein comprises 3 artificial or modified internucleoside linkages of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), positioned at the 5’ and / or 3’ wing or terminus of the gapmer oligonucleotide.

[0361] In an embodiment, a gapmer oligonucleotide as described herein comprises at least 1 artificial or modified internucleoside linkages of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX) positioned at the 5’ and / or 3’ wing or terminus of the gapmer oligonucleotide and at least 1 artificial or modified internucleoside linkage of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX) positioned internally in the central region of the gapmer oligonucleotide.

[0362] In a preferred embodiment, a gapmer oligonucleotide described herein comprises 1 up to 3 internucleoside linkages of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), positioned at the 5’ and / or 3’ wing or terminus of the gapmer oligonucleotide.

[0363] Gapmer oligonucleotides encompassed herein are listed in the section Exemplary gapmer oligonucleotides. Exemplary embodiments are listed below: gapmer oligonucleotide comprising 1 artificial or modified internucleoside linkage of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX) positioned at the 5’ wing or terminus of the gapmer oligonucleotide gapmer oligonucleotide comprising 1 artificial or modified internucleoside linkage of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX) positioned at the 3’ wing or terminus of the gapmer oligonucleotide gapmer oligonucleotide comprising 1 artificial or modified internucleoside linkage of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX) positioned at both the 5’ and 3’ wings or termini of the gapmer oligonucleotide gapmer oligonucleotide comprising 2 artificial or modified internucleoside linkages of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX) positioned at the 5’ wing or terminus of the gapmer oligonucleotide gapmer oligonucleotide comprising 2 artificial or modified internucleoside linkages of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX) positioned at the 3’ wing or terminus of the gapmer oligonucleotide gapmer oligonucleotide comprising 2 artificial or modified internucleoside linkages of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX) positioned at at both the 5’ and 3’ wings or termini of the gapmer oligonucleotide gapmer oligonucleotide comprising 3 artificial or modified internucleoside linkages of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX) positioned at the 5’ wing or terminus of the gapmer oligonucleotide gapmer oligonucleotide comprising 3 artificial or modified internucleoside linkages of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX) positioned at the 3’ wing or terminus of the gapmer oligonucleotide gapmer oligonucleotide comprising 3 artificial or modified internucleoside linkages of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX) positioned at both the 5’ the 3’ wings or termini of the gapmer oligonucleotide

[0364] Without prejudice, a gapmer oligonucleotide comprising an internucleoside linkage of formula of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX) at its wing or terminus and / or wings or termini may further comprise at least one such linkage internally, preferably in the central region of the gapmer oligonucleotide.

[0365] In another embodiment, a gapmer oligonucleotide described herein further comprises at least one internucleoside linkage of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX) positioned in the central portion of the gapmer oligonucleotide.

[0366] In all preceding embodiments, gapmer oligonucleotides comprising internucleoside linkages of formula VII or IX are preferred. Accordingly, such a gapmer oligonucleotide may comprise: gapmer oligonucleotide comprising 1 artificial or modified internucleoside linkage of formula (VII) or (IX) positioned at the 5’ wing or terminus of the gapmer oligonucleotide gapmer oligonucleotide comprising 1 artificial or modified internucleoside linkage of formula (VII) or (IX) positioned at the 3’ wing or terminus of the gapmer oligonucleotide gapmer oligonucleotide comprising 1 artificial or modified internucleoside linkage of formula (VII) or (IX) positioned at both the 5’ and 3’ wings or termini of the gapmer oligonucleotide gapmer oligonucleotide comprising 2 artificial or modified internucleoside linkages of formula (VII) or (IX) positioned at the 5’ wing or terminus of the gapmer oligonucleotide gapmer oligonucleotide comprising 2 artificial or modified internucleoside linkages of formula (VII) or (IX) positioned at the 3’ wings or terminus of the gapmer oligonucleotide gapmer oligonucleotide comprising 2 artificial or modified internucleoside linkages of formula (VII) or (IX) positioned at at both the 5’ and 3’ wings or termini of the gapmer oligonucleotide gapmer oligonucleotide comprising 3 artificial or modified internucleoside linkages of formula (VII) or (IX) positioned at the 5’ wing or terminus of the gapmer oligonucleotide gapmer oligonucleotide comprising 3 artificial or modified internucleoside linkages of formula (VII) or (IX) positioned at the 3’ wing or terminus of the gapmer oligonucleotide gapmer oligonucleotide comprising 3 artificial or modified internucleoside linkages of formula (VII) or (IX) positioned at both the 5’ the 3’ wings or termini of the gapmer oligonucleotide

[0367] Without prejudice, a gapmer oligonucleotide comprising an internucleoside linkage of formula VII or IX at its wing or terminus and / or wings or termini may further comprise at least one such linkage internally, preferably in the central region of the gapmer oligonucleotide.

[0368] As shown in example 7, the gapmer oligonucleotides of the invention (comprising an internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX)) outperform those comprising formulae (X) (corresponding to PNdmi), (XI) (corresponding to PNms), (XII) (corresponding to PNbs), (XIII) (corresponding to PNts).

[0369] Therefore, in one embodiment, an internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX) and present in the gapmer oligonucleotide of the invention is not an internucleoside linkage as disclosed in formula (X), (XI), (XII) or (XIII).

[0370] Therefore in an embodiment, the efficiency of gymnosis of a gapmer oligonucleotide of the invention comprising an internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), is improved compared to the efficiency of gymnosis of a gapmer oligonucleotide lacking any internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), but having otherwise the same sequence and, preferably, chemistry. This difference in terms of efficiency may be of at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%. Gymnosis may be assessed using techniques known to the skilled person as described earlier hereinabove. For example, gymnosis may be assessed as in the experimental part. In short, cells are being cultured. Medium is replaced with medium comprising the oligonucleotide to be tested. Concentrations to be used may be 0, 1 or 10 pM of oligonucleotide. 40 hours to 55 hours (preferably 48 hours) after addition of the oligonucleotide, the cells were harvested and RNA was isolated.

[0371] In a preferred embodiment, a gapmer comprising an internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), may further comprise one or more chemically modified nucleotides. Examples of chemically modified nucleotides are presented earlier herein and may encompass sugar and base modifications. Sugar modifications include but are not limited to 2'-O-methyl (2'-OMe) sugar modifications, 2'- O-methoxyethyl (2'-MOE), 2-Fluoro (f), 2-FANA and / or LNA (L) sugar modifications. Within a gapmer oligonucleotide, such sugar modifications are located in one or both wings of the oligonucleotide.

[0372] Preferred base modifications are 5-methylcytosine as well as other cytosine base analogues, preferably a pseudoisocytosine, more preferably 2', 2'-difluoro 2'deoxycytidine (gemcitabine), and most preferably is 6-amino-5 nitro-2(1 H)-pyridinone (Benner’s Z base). Uracil base analogues, preferably N3-Uridine, are also encompassed.

[0373] In a preferred embodiment, a gapmer described herein comprises:

[0374] (a) at least 1 , at least 2, at least 3, at least 4, at least 5 or at least 6 internucleoside linkages PNtau linkages (represented by formula VII) or PNgua linkages (represented by formula (IX)); and / or

[0375] (b) one or more sugar modifications selected from 2'-OMe, 2'-MOE, 2-Fluoro, 2-FANA and / or LNA, wherein the sugar modifications are present in the same region (i.e., wings or termini) as the internucleoside PNtau or PNgua linkages; and / or

[0376] (c) one or more modified bases selected from 5-methylcytosine, pseudoisocytosine, more preferably 2', 2'-difluoro 2'deoxycytidine (gemcitabine), most preferably 6-amino-5 nitro-2(1 H)- pyridinone (Benner’s Z base) and / or uracil base analogues, preferably N3-Uridine.

[0377] As herein defined, an oligonucleotide may comprise nucleotides with (RNaseH resistant) chemical substitutions at least one of its 5’or 3’ ends, to provide intracellular stability, and comprises less than 9, more preferably less than 6 consecutive (RNaseH sensitive) deoxyribose nucleotides in the rest of its sequence. The rest of the sequence is preferably the center of the sequence.

[0378] Gapmers have been extensively described in WO 2007 / 089611 , which is incorporated by reference in its entirety. Gapmers are designed to enable the recruitment and / or activation of RNaseH. Without wishing to be bound by theory, it is believed that RNaseH is recruited and / or activated via binding to the central region of the gapmer made of deoxyriboses. An oligonucleotide of the invention which is preferably substantially independent of or independent of RNaseH is designed in order to have a central region which is substantially not able or is not able to recruit and / or activate RNaseH. In a preferred embodiment, the rest of the sequence of said oligonucleotide, more preferably its central part comprises less than 9, 8, 7, 6, 5, 4, 3, 2, 1 , or no deoxyribose. Accordingly, this oligonucleotide of the invention is preferably partly to fully replaced as earlier defined herein. “Partly replaced” means that the oligonucleotide comprises at least some of nucleotides that have been replaced, preferably at least 50% of its nucleotides have been replaced, or at least 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95% have been replaced. 100% replacement of nucleotides corresponds to “fully replaced”.

[0379] The advantageous effects that gapmers may offer are, for instance, increased nuclease resistance due to the modified RNA flanks, enhanced binding affinity to target RNA, reduced off-target effects, ability to induce RNase H-mediated cleavage, and / or potential for both nuclear and cytoplasmic activity. Hence, optimizing an internucleoside linkage in gapmer oligonucleotides, such as, an oligonucleotide of the invention (i.e. an oligonucleotide comprising an internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), or composition comprising said oligonucleotide), may exhibit improved activities thereof to some extent compared to the same activity of its counterpart oligonucleotide with no internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX).

[0380] In this context “to some extent” means at least 30, 40, 50, 60, 70, 80, 90, 100% of at least one of the activities of the counterpart oligonucleotide with no internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX). A counterpart oligonucleotide is an oligonucleotide that would be identical with the oligonucleotide of the invention comprising an internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), except that it does not comprise said internucleoside linkage (i.e. same length, same chemistry).

[0381] The further increase / optimisation of at least one of the activities of the oligonucleotide of the invention compared to the corresponding activity of its counterpart oligonucleotide may be of an increase of at least 1 , 5, 10, 20, 30, 40, 50%.

[0382] Mixmer oligonucleotide

[0383] In an embodiment, an oligonucleotide of the invention comprising an internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), is a mixmer.

[0384] Mixmer describes an oligomer that include both sugar-modified nucleosides and DNA nucleosides, but not enough continuous DNA nucleoside length for RNaseH to bind to them. Up to three or up to four continuous DNA nucleosides can be included in suitable mixmers. In an embodiment, it is also viable that the oligonucleotide of the invention is a mixmer. For example, LNA and DNA are interspersed throughout the sequence of the oligonucleotide of the invention. The mixmer of the invention may be specific to the targeted sequence, and it can show higher efficacy than, for instance, an all-LNA oligonucleotide with the equivalent sequence.

[0385] In an embodiment, the mixmer of the invention, or their contiguous nucleotide sequence, are comprised of alternating sections of DNA nucleosides and sugar-modified nucleosides. Non- RNaseH recruiting oligonucleotides can be created by alternating short portions of DNA nucleosides with areas of sugar-modified nucleosides, which when integrated into the oligonucleotide generate a conformation resembling RNA. The sugar modified nucleosides have the advantage of being sugar modified nucleosides with affinity enhancement.

[0386] In some embodiments, the artificial or internucleoside linkages of formula (I), (II), (III), (IV), (V),

[0387] (VI), (VII), (VIII), and / or (IX), preferably (VII) or (IX), may be positioned at the termini of the mixmer, and / or within the mixmer central sequence. Said linkage(s) may be located at the 3' terminus, at the 5' terminus, at both termini, or within 1 -5 nucleotides of either terminus, and may additionally or alternatively be positioned internally within the central region of the mixmer. In an embodiment, an mixmer as described herein comprises 1 artificial or modified internucleoside linkage of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably

[0388] (VII) or (IX), positioned at the 5’ and / or 3’ terminus of the mixmer.

[0389] In an embodiment, an mixmer as described herein comprises 2 artificial or modified internucleoside linkages of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), positioned at the 5’ and / or 3’ terminus of the mixmer.

[0390] In an embodiment, an mixmer as described herein comprises 3 artificial or modified internucleoside linkages of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), positioned at the 5’ and / or 3’ terminus of the mixmer.

[0391] In an embodiment, an mixmer as described herein comprises at least 1 artificial or modified internucleoside linkages of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX) positioned at the 5’ and / or 3’ terminus of the mixmer and at least 1 artificial or modified internucleoside linkage of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX) positioned internally in the central region of the mixmer.

[0392] In a preferred embodiment, an mixmer described herein comprises 1 up to 3 internucleoside linkages of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), positioned at the 5’ and / or 3’ terminus of the mixmer.

[0393] Oligonucleotides encompassed herein are listed in the section Exemplary mixmers. Exemplary embodiments are listed below: mixmer comprising 1 artificial or modified internucleoside linkage of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX) positioned at the 5’ terminus of the mixmer mixmer comprising 1 artificial or modified internucleoside linkage of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX) positioned at the 3’ terminus of the mixmer mixmer comprising 1 artificial or modified internucleoside linkage of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX) positioned at both the 5’ and 3’ termini of the mixmer mixmer comprising 2 artificial or modified internucleoside linkages of formula (I), (II), (III), (IV), (V), (VI), (VI I), (VIII) and / or (IX), preferably (VI I) or (IX) positioned at the 5’ terminus of the mixmer mixmer comprising 2 artificial or modified internucleoside linkages of formula (I), (II), (III), (IV), (V), (VI), (VI I), (VIII) and / or (IX), preferably (VI I) or (IX) positioned at the 3’ terminus of the mixmer mixmer comprising 2 artificial or modified internucleoside linkages of formula (I), (II), (III), (IV), (V), (VI), (VII), (VI 11) and / or (IX), preferably (VI I) or (IX) positioned at at both the 5’ and 3’ termini of the mixmer mixmer comprising 3 artificial or modified internucleoside linkages of formula (I), (II), (III), (IV), (V), (VI), (VI I), (VIII) and / or (IX), preferably (VI I) or (IX) positioned at the 5’ terminus of the mixmer mixmer comprising 3 artificial or modified internucleoside linkages of formula (I), (II), (III), (IV), (V), (VI), (VI I), (VIII) and / or (IX), preferably (VI I) or (IX) positioned at the 3’ terminus of the mixmer mixmer comprising 3 artificial or modified internucleoside linkages of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX) positioned at both the 5’ the 3’ termini of the mixmer

[0394] In another embodiment, an mixmer described herein further comprises at least one internucleoside linkage of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX) positioned in the central portion of the mixmer.

[0395] As used herein, the term “central portion” refers to the contiguous region of an antisense mixmer that is complementary to a target nucleic acid sequence and is responsible for mediating the mixmer’s primary antisense activity.

[0396] In all preceding embodiments, mixmers comprising internucleoside linkages of formula VII or IX are preferred. Accordingly, such an mixmer may comprise: mixmer comprising 1 artificial or modified internucleoside linkage of formula (VII) or (IX) positioned at the 5’ terminus of the mixmer mixmer comprising 1 artificial or modified internucleoside linkage of formula (VII) or (IX) positioned at the 3’ terminus of the mixmer mixmer comprising 1 artificial or modified internucleoside linkage of formula (VII) or (IX) positioned at both the 5’ and 3’ termini of the mixmer mixmer comprising 2 artificial or modified internucleoside linkages of formula (VII) or

[0397] (IX) positioned at the 5’ terminus of the mixmer mixmer comprising 2 artificial or modified internucleoside linkages of formula (VII) or

[0398] (IX) positioned at the 3’ terminus of the mixmer mixmer comprising 2 artificial or modified internucleoside linkages of formula (VII) or

[0399] (IX) positioned at at both the 5’ and 3’ termini of the mixmer mixmer comprising 3 artificial or modified internucleoside linkages of formula (VII) or

[0400] (IX) positioned at the 5’ terminus of the mixmer mixmer comprising 3 artificial or modified internucleoside linkages of formula (VII) or

[0401] (IX) positioned at the 3’ terminus of the mixmer mixmer comprising 3 artificial or modified internucleoside linkages of formula (VII) or

[0402] (IX) positioned at both the 5’ the 3’ termini of the mixmer

[0403] Without prejudice, an mixmer comprising an internucleoside linkage of formula VII or IX at its terminus and / or termini may further comprise at least one such linkage internally, preferably in the central region of the mixmer.

[0404] Therefore, in one embodiment, an internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX) and present in the mixmer oligonucleotide of the invention is not an internucleotide linkage as disclosed in formula (X), (XI), (XII) or (XIII).

[0405] Therefore in an embodiment, the efficiency of gymnosis of a mixmer oligonucleotide of the invention comprising an internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), is improved compared to the efficiency of gymnosis of a mixmer oligonucleotide lacking any internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), linkages (but having otherwise the same sequence and preferably chemistry). This difference in terms of efficiency may be of at least 1 %, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%. Gymnosis may be assessed using techniques known to the skilled person as described earlier hereinabove. For example, gymnosis may be assessed as in the experimental part. In short, cells are being cultured. Medium is replaced with medium comprising the oligonucleotide to be tested. Concentrations to be used may be 0, 1 or 10 pM of oligonucleotide. 40 hours to 55 hours (preferably 48 hours) after addition of the oligonucleotide, the cells were harvested and RNA was isolated.

[0406] An oligonucleotide for nucleic acid editing such as a DNA or RNA editing oligonucleotide

[0407] In an embodiment, an oligonucleotide of the invention comprising an internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), is a DNA or RNA editing oligonucleotide. In this embodiment, the nucleic acid molecule to be edited (also called target molecule) is an DNA or an RNA molecule. In an embodiment, the molecule is an RNA molecule within the nucleus (e.g., a primary transcript, pre-mRNA, or mRNA (e.g., an mRNA prior to transport out of the nucleus)). In an embodiment, the RNA is a non-coding RNAs such as long non-coding RNAs (IncRNAs), long intergenic non-coding RNAs (lincRNAs) and microRNAs (miRNAs). In a particular embodiment, the nucleic acid molecule to be edited is endogenous and / or a nuclear transcript.

[0408] In an embodiment, the oligonucleotide of the invention may recruit and may optimize the recruitment of full length Adenosine Deaminase Acting on RNA (ADARs) to the target RNA that may include, in addition to target RNA sequences, the presence of sequences that are not normally included in the target RNA. ADAR could in theory act on both pre-mRNA and on mature RNA. Oligonucleotides of the invention capable of effecting ADAR-mediated deamination of a target adenosine in a target RNA molecule may be denoted as “RNA editing oligonucleotides”.

[0409] Accordingly, in an aspect, there is provided an RNA editing oligonucleotide capable of effecting ADAR-mediated deamination of a target adenosine in a target RNA molecule encoding a target protein, wherein the oligonucleotide comprises a sequence that is capable of hybridizing with a region in the target RNA molecule comprising said target adenosine, and wherein the target adenosine is part of a codon encoding a posttranslational modification site in the target protein.

[0410] Thus, in preferred embodiments, an oligonucleotide of the invention as described herein (i.e. comprising an internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), is capable of effecting ADAR-mediated deamination of a target adenosine in a target RNA molecule, wherein the oligonucleotide comprises a sequence that is capable of hybridizing with a region in the target RNA molecule comprising said target adenosine.

[0411] In an embodiment, the oligonucleotide is capable of recruiting ADAR and thus indirectly effecting ADAR-mediated deamination of a target adenosine by virtue of a sequence and / or a structure of said oligonucleotide. This sequence may comprise a BoxB sequence as disclosed in details in WO 2019 / 071274 (incorporated by reference in its entirety). The oligonucleotide may comprise a tandem of two BoxB sequences, located upstream and downstream of the target deamination site, respectively. BoxB sequences may comprise:

[0412] SEQ ID NO:7: GCCCUGAAAAAGGGC (SEQ ID NO: 48 from WO2019 / 071274)

[0413] SEQ ID NO:8: GGCCCUGAAAAAGGGCC (SEQ ID NO: 49 from WO2019 / 071274) or may have at least 80%, 85%, 90%, 95%, 97%, 99%, or 100% homology or identity, particularly at least 95%, 97%, 99%, or 100% identity, to SEQ ID NO: 48 or 49. An ADAR-recruiting sequence may comprise a R / G binding site from GluR2. Example of such a sequence comprises:

[0414] SEQ ID NO:9: GUGGAAUAGUAUAACAAUAUGCUAAAUGUUGUUAUAGUAUCCCAC (SEQ ID NO: 70 from WO2019 / 071274) or a sequence which has at least 80%, 85%, 90%, 95%, 97%, 99%, or 100% homology or identity, particularly at least 95%, 97%, 99%, or 100% identity).

[0415] In another embodiment, alternatively or in combination with one or all of the sequences disclosed above, the oligonucleotide may exhibit a secondary structure that allows ADAR recruitment and thus indirectly allows ADAR-mediated deamination. Such structures may comprise mismatches that cause the formation of single- and / or double-stranded bulges, mismatches that reduce off-target deamination, and internal loops. An oligonucleotide may comprise at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, including 1 to 5, or 1 to 10, or 1 to 15 mismatches upstream and / or downstream of the adenosine to be edited in the target nucleotide, wherein said mismatches are expected to reduce off-target editing as disclosed in WO 2019 / 071274 and in Vogel, et al. (2014) Angew Chem. Int. Ed. Engl., 53 :6267-6271. In addition, mismatches that create double-stranded bulges may be recognised by ADAR (also disclosed in WO 2019 / 071274). Each internal loop may comprise at least 2, 3, 4, 5, 6, 7, 8, 9, 10 or more mismatched nucleotides. Such loops have been disclosed in WO 2019 / 071274 and in Lehman et al, (1999), J. Mol. Biol., 29(1):1 -13.

[0416] This concept of applying RNA editing strategy could be broadly used to target any RNA molecule, preferably any RNA coding for a protein whose expression is linked to or associated with a disease or condition. The disease or condition may be a brain disease or condition. A subject may be a human being. Protein expression may be assessed using any technique known to the skilled person (such as western blotting, capillary immunoassay, FACS analysis, immunohistochemistry).

[0417] It is possible that the oligonucleotides of the invention may further optimize guide RNA (gRNA) to direct Cas nucleases to specific DNA sequences for gene editing. Typically, the recruitment of Cas proteins maybe improved / optimized . Additionally, different Cas variants can be recruited for different effects on the target RNA.

[0418] In the context of the invention, guide RNA may also include single guide RNA (sgRNA). sgRNA is a short synthetic RNA molecule that guides Cas9 or other Cas proteins to a specific DNA target sequence for gene editing. As an example, sgRNAs may contain an AON-sensing loop that can be activated by a complementary AON of the invention. AON-responsive sgRNAs allow for conditional activation of CRISPR-based transcriptional regulators (CRISPR-TRs). This provides a way to control CRISPR activity using AONs as external triggers. Therefore, the applications of an oligonucleotide of the invention may add an extra layer of regulation to CRISPR-Cas systems.

[0419] In an embodiment, provided herein is an oligonucleotide for nucleic acid editing comprising a) an internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VI I) or (IX), b) a base sequence capable of hybridizing with a target region in a target nucleic acid, wherein the resulting hybridized duplex comprises an editing window, and c) a mismatch-forming nucleotide positioned within the editing window and opposite of a nucleotide to be edited.

[0420] As understood herein, nucleic acid editing refers to the targeted alteration of DNA or RNA sequences using engineered or endogenous enzymes. In the context of the invention, such enzymes are referred to as editing enzymes. Non-limiting examples of targeted nucleic acid alterations include but are not limited to single or multiple base substitutions, deletions and / or insertions. In the context of the invention, site-specific base substitutions (e.g., OG to T«A or A«T to G«C) are preferred. Such base conversions can be achieved using a base editor comprising a catalytically impaired CRISPR-associated (Cas) variant such as a "dead" Cas (dCas) or nickase Cas, which is incapable of inducing nucleic acid cleavage. dCas variants acting on DNA (e.g. derived from Cas9 for a Type II or Cas12a for a Type V-A systems) or on RNA (e.g. derived from Cas13 for a Type VI systems) are known to the person skilled in the art. In a base editor, a dCas or a Cas nickase variant is typically fused to an enzymatically active nucleotide deaminase domain, such as an adenine or cytidine deaminase, to mediate targeted base substitutions without introducing nucleic acid strand breaks.

[0421] Therefore, an oligonucleotide for nucleic acid editing (e.g. editing oligonucleotide) according to the invention may include auxiliary sequences for recruitment of editing enzymes. In some embodiments, the oligonucleotide may comprise a 5' direct repeat (DR) for recruitment of Type V-A Cas editing enzymes (e.g. Cas12a) or a trans-activating CRISPR RNA (crRNA), also known as a guide RNA scaffold necessary for recruitment of Type II Cas editing enzymes (e.g., Cas9). Alternatively, such an oligonucleotide may comprise sequences capable of recruiting Type VI CRISPR / Cas editing enzymes or variants thereof (e.g., Cas13). Accordingly, in certain embodiments, the editing oligonucleotide disclosed herein is a guide RNA capable of recruiting a Cas editing enzyme or a version thereof.

[0422] In alternative embodiments, an editing oligonucleotide according to the invention comprises sequences and / or secondary structures which function as recruitment portions for endogenous or engineered Adenosine Deaminases Acting on RNA (ADAR) enzymes, preferably human ADARs. Said oligonucleotides are capable of effecting ADAR-mediated RNA editing, and particularly ADAR-mediated deamination of target adenosines comprised in said target RNA. Such ADAR recruitment regions have been described earlier hereinabove and include the R / G binding site from GluR2, Box-B sequences and / or derivatives thereof as well as secondary structures such as internal loops, bulges, etc.

[0423] In an embodiment, an editing oligonucleotide according to the invention is for use as a medicament. Therapeutic uses of the editing oligonucleotide or compositions comprising it are described later herein. Wherever the editing oligonucleotide according to the invention is mentioned in this application, the oligonucleotide for use as a medicament according to this aspect is also disclosed.

[0424] In a preferred embodiment, an editing oligonucleotide or an editing oligonucleotide for use according to the invention is an antisense and / or a single-stranded oligonucleotide.

[0425] Such an oligonucleotide can facilitate endogenous ADAR recruitment in the absence of ADAR recruitment portions. Surprisingly, despite lacking ADAR-recruiting sequences or ADAR- recruiting chemical linkers (e.g. BG linker), an antisense editing oligonucleotide according to the invention retains the capacity of recruiting endogenous ADAR and inducing target adenosine deamination, while also having the advantage of being shorter, and hence easier and cheaper to manufacture. In embodiments, an antisense editing oligonucleotide according to the invention is at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, and preferably 75% shorter than an oligonucleotide that comprises ADAR-recruitment portions. Typically, the oligonucleotide may comprise from 26 to 50 nucleotides, or comprises 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides. Accordingly, in some embodiments, oligonucleotides as described herein may comprise, consist of or essentially consist of a sequence that is capable of hybridizing with a region in the target RNA molecule (e.g. target region) comprising the target adenosine to be deaminated, said target RNA comprising a protein-coding or a non-coding RNA. As used herein, the wording “capable of hybridizing ” does not mean that the sequence that is capable of hybridizing with a region in the target RNA molecule comprising said target adenosine, needs to be 100% complementary to the target RNA molecule. Rather, the sequence - not including the mismatch at the target adenosine to be edited - may be at least 80%, 85%, 90%, 95%, 97%, 99%, or 100% complementary, particularly at least 95%, 97%, 99%, or 100% complementary to the target RNA. In embodiments, an oligonucleotide according to the invention comprises the reverse complement (e.g. is reverse complementary to) of a region of the target RNA, said target RNA comprising the adenosine to be deaminated. In preferred embodiments, an oligonucleotide according to the invention comprises, consists of or essentially consists of the reverse complement (e.g. is reverse complementary to) to a region of said target RNA, said target RNA comprising the adenosine to be deaminated.

[0426] In preferred embodiments, oligonucleotides described herein are thus antisense oligonucleotides (e.g. AONs or ASOs). In some embodiments, an oligonucleotide as described herein is capable of recruiting an endogenous ADAR. More particularly, it may also be said that the double-stranded complex formed between the oligonucleotides according to the invention and the target RNA recruits an endogenous ADAR. The double stranded complex may form a further complex with the ADAR enzyme. In exemplary embodiments, the minimal length of an editing oligonucleotide according to the invention, wherein the oligonucleotide is able to form a double-stranded complex with the target RNA and recruit ADAR is at least 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38 and preferably 39 nucleotides. Such complex comprising the oligonucleotide, the target RNA and an ADAR enzyme is subsequently capable of effecting ADAR-mediated deamination of a target adenosine in the target RNA molecule. In the context of the invention, ADAR recruitment refers to the process in which an endogenous ADAR enzyme is attracted to and binds with a doublestranded complex formed between an oligonucleotide according to the invention and a target RNA. This recruitment facilitates the formation of a further complex that includes the ADAR enzyme, the oligonucleotide, and the target RNA. Once recruited, the ADAR enzyme catalyses the deamination of the target adenosine in the target RNA, converting it to inosine (I) in an ADAR-mediated RNA editing process.

[0427] In some embodiments, the ADAR enzyme is ADAR1 or ADAR2, preferably ADAR2. Human ADAR enzymes are preferred. ADAR enzymes catalyse the deamination of adenine to inosine, which is structurally similar to guanosine (G) so preferentially base pairs with cytosine (C) and is translated by the ribosome as G. Accordingly, if a deaminated (e.g. edited) adenosine is in a coding region of a (pre-)mRNA, it can recode the protein sequence. Furthermore, deamination of an adenosine nucleotide occurring in a non-coding region of a pre-mRNA or in a non-coding RNA can alter the processing and / or function of the RNA.

[0428] In an embodiment, provided herein is an editing oligonucleotide or an editing oligonucleotide for use according to the invention, wherein the target nucleic acid is a protein-coding RNA or a non-coding RNA.

[0429] In some embodiments, a non-coding RNA is a functional RNA that does not encode a protein. In these embodiments, the target molecule may be identified as a precursor long non-coding RNA (e.g. pre-lnc RNA). In some embodiments, the non-coding RNA results from alternative splicing of a precursor mRNA (pre-mRNA). In some embodiments, the non-coding RNA is a long non-coding RNA (IncRNA), a microRNA (miRNA), a circular RNA (circRNA), small nucleolar RNA (snoRNA) and / or a small nuclear RNA (snRNA).

[0430] In some embodiments, a target RNA is a protein-coding RNA, for instance a precursor mRNA (pre-mRNA) or a mature messenger RNA (mRNA). ADAR could in theory act on both pre- mRNA and on mature mRNA. Thus, in exemplary embodiments, an oligonucleotide described herein is capable of effecting ADAR-mediated deamination of a target adenosine comprised in a region of a target pre-mRNA, wherein the pre-mRNA is processed to an mRNA encoding a target protein. In embodiments, the target adenosine is comprised in a region of target mRNA encoding a target protein.

[0431] In a preferred embodiment, provided herein is an editing oligonucleotide or an editing oligonucleotide for use according to the invention, wherein the target nucleic acid comprises an endogenous protein-coding MECP2 RNA encoding a human Methyl CpG Binding Protein 2 (MECP2).

[0432] In humans, there are ten transcript variants of MECP2 (cDNAs represented by SEQ ID NOs: 37-46) that encode four protein isoforms (SEQ ID NO: 47-50). As understood herein, a MECP2 RNA or a MECP2 protein encompasses the totality of known splice variants and protein isoforms identified for the murine (cDNAs represented by SEQ ID NOs: 87 and 88 encode the murine MECP2 transcript variants 1 and 2, which in turn encode the protein isoforms 1 and 2 represented by SEQ ID NOs: 89 and 90, respectively) and more preferably for the human MECP2 locus. In an embodiment, an oligonucleotide described herein is capable of editing a target adenosine within a target codon, which may be present in a corresponding genomic locus or in all ten transcript variants of the human MECP2 gene (SEQ ID NOs: 37-46) that encode the corresponding four MECP2 protein isoforms (SEQ ID NO: 47-50). In a particular embodiment, an oligonucleotide described herein is capable of effecting ADAR-mediated deamination of a target adenosine within a target codon, which is present in transcript variants 1 and 2 (SEQ ID NOs: 37 and 38) of human MECP2 that encode MECP2 protein isoforms 1 and 2, respectively (SEQ ID NOs: 47 and 48).

[0433] In an embodiment, the target codon is a stop codon or a codon comprising a G to A missense mutation, wherein both codons are correctable by ADAR-mediated deamination of the target adenosine. In a particular embodiment, the target codon comprising the target adenosine to be deaminated is a stop codon caused by a non-sense mutation in the target RNA comprising MECP2 protein-coding RNA encoding MECP2 protein. In a particular embodiment, said stop codon comprises a C to T non-sense mutation which generates a truncated MECP2 protein. In a particular embodiment, an oligonucleotide as described herein is capable of correcting a stop codon by effecting ADAR-mediated deamination of a target adenosine positioned in the 3’ position of said codon in a MECP2 (pre-)mRNA molecule encoding a MECP2 protein. In embodiments, a non-sense mutation resulting from a C to T substitution is a R168X, R270X, R294X, and preferably is R255X. In preferred embodiments, a C to T substitution results in a R255X mutation leading to a premature stop codon of the human MECP2 protein or its murine orthologue. In a particular embodiment, the correction of a target adenosine, which is a part of a target codon, and preferably a stop codon, is able to restore the function and / or levels of MECP2 protein. In a particular embodiment, the mouse ortholog of MECP2 has a R255X mutation leading to a premature stop codon, which is corrected to R255W by means of an ADAR-mediated deamination with an oligonucleotide described herein. The cDNA sequences encoding the two recognized transcript variants of the murine MECP2 protein comprising a R255X mutation are represented by SEQ ID NO: 51 in and SEQ ID NO: 52, whereas the corresponding truncated protein isoforms are represented by SEQ ID NO: 53 in and SEQ ID NO: 54. The corrected versions of the two transcript isoforms of the murine MECP2 protein as well as their corresponding full-length protein isoforms are represented by SEQ ID NOs: 55 and 56 in and SEQ ID NOs: 57 and 58, respectively. In a particular embodiment, the human MECP2 protein has a R255X mutation leading to a premature stop codon, which is corrected to R255W by means of an ADAR-mediated deamination with an oligonucleotide described herein. The cDNA sequences encoding the ten recognised transcript variants of the human MECP2 protein comprising a R255X mutation are represented by SEQ ID NOs: 59-68, whereas the corresponding truncated protein isoforms are represented by SEQ ID NOs: 69-72. The corrected versions of the ten transcript isoforms of the human MECP2 protein as well as their corresponding four full-length protein isoforms are represented by SEQ ID NOs: 73-82 (corrected transcript isoforms) and SEQ ID NOs: 83-86 (corrected full-length protein isoforms). In embodiments, an oligonucleotide according to the invention is capable of effecting ADAR- mediated deamination of a target adenosine within a target codon R255X, which is present in transcript variants 1 -10 of human MECP2 (SEQ ID NO: 59-68) that encode MECP2 diseasecausing protein isoforms 1 - 4, respectively (SEQ ID NO: 69-72). In embodiments, ADAR- mediated deamination of a target adenosine within a target codon R255X results in edited human MECP2 transcript variant 1-10 (SEQ ID NOs: 73-82) encoding the corresponding restored full-length MECP2 protein (SEQ ID NO: 83-86). In a particular embodiment, an oligonucleotide according to the invention is capable of effecting ADAR-mediated deamination of a target adenosine within a target codon R255X, which is present in transcript variants 1 and / or 2 of human MECP2 protein (SEQ ID NOs: 59 and / or 60) that encode MECP2 diseasecausing protein isoforms 1 and / or 2, respectively (SEQ ID NOs: 69 and / or 70, respectively). In a particular embodiment, ADAR-mediated deamination of a target adenosine within a target codon R255X results in edited human MECP2 transcript variant 1 and / or 2 (SEQ ID NO: 73 and / or 74) encoding the corresponding restored full-length MECP2 protein (SEQ ID NO: 83 and / or 84).

[0434] In some embodiments, the target codon comprising the target adenosine to be deaminated is a codon comprising a G to A mis-sense mutation in the target RNA comprising a MECP2 protein-coding RNA encoding a dysfunctional MECP2 protein. In a particular embodiment, an oligonucleotide as described herein is capable of correcting a codon comprising a missense G to A mutation by effecting ADAR-mediated deamination of the mutated target adenosine comprised in a MECP2 (pre-)mRNA molecule encoding a MECP2 protein. In embodiments, missense mutations resulting from a G to A substitution are R106Q (CAA), W104X (UAG), and R306H (CAC). In a particular embodiment, missense mutations resulting from a G to A substitution affect the Methyl DNA Binding Domain (MBD) of human MECP2 protein (e.g. MeCP2 R106Q and MeCP2 W104X) or the NCoR interaction domain (NID) of human MECP2 protein (e.g. R306H) and are all correctable by ADAR-mediated deamination of the mutated target adenosine using an oligonucleotide described herein. In a particular embodiment, missense mutations resulting from a G to A substitution are R106Q (CAA), W104X (UAG), and R306H (CAC), and are found in the murine ortholog of MECP2 protein.

[0435] Internucleoside linkage represented by formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX)

[0436] In some embodiments, at least one of the internucleoside linkages of the editing oligonucleotide or of the editing oligonucleotide for use according to the invention is represented by formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX) as defined hereinabove. Preferred formulas are (VII) and (IX). Thus, in some embodiments, at least one of the naturally occurring 3' to 5' phosphodiester moieties present in RNA is replaced by a non-natural moiety represented by formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX).

[0437] The number and placement of internucleoside linkages represented by formula (I), (II), (III),

[0438] (IV), (V), (VI), (VII), (VIII) and / or (IX) are not particularly limited within the editing oligonucleotide or the editing oligonucleotide for use.

[0439] In exemplary embodiments, an editing oligonucleotide or an editing oligonucleotide for use according to the invention comprises at least 1 , 2, 3, 4, 5, 6, 7, 8, 9 o 10 internucleoside linkages represented by formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX) ( preferably (VII) or (IX)).

[0440] In exemplary embodiments, an editing oligonucleotide or an editing oligonucleotide for use according to the invention comprises not more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 internucleoside linkages represented by formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX) (preferably (VII) or (IX)).

[0441] In a particular embodiment, an editing oligonucleotide as described herein has a minimum length of 26 nucleotides and may comprise 1 , 2, 3, 4, 5, 6, 7, 8, 9 or 10 internucleoside linkages represented by any one of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX) (preferably (VII) or (IX)). The same applies mutatis mutandis to oligonucleotides for nucleic acid editing having a length in the range of 25 up to 50 nucleotides.

[0442] In a preferred embodiment, an oligonucleotide for nucleic acid editing according to the invention comprises 4 internucleoside linkages represented by any one of formula (I), (II), (III), (IV), (V),

[0443] (VI), (VII), (VIII) and / or (IX) (preferably (VII) or (IX)).

[0444] In further embodiments, the number of internucleoside linkages represented by any one of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX) (preferably (VII) or (IX)) constitutes not more than 50% of the total number of internucleoside linkages within the oligonucleotide. For example, in an embodiment, an oligonucleotide of 25 nucleotides may comprise not more than 12 internucleoside linkages represented by any one of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX) (preferably (VII) or (IX)) An oligonucleotide of 30 nucleotides may comprise not more than 15 internucleoside linkages represented by any one of formula (I), (II), (III), (IV),

[0445] (V), (VI), (VII), (VIII) and / or (IX) (preferably (VII) or (IX)). An oligonucleotide of 35 nucleotides may comprise not more than 17 internucleoside linkages represented by any one of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX) (preferably (VII) or (IX)). An oligonucleotide of 40 nucleotides may comprise not more than 20 internucleoside linkages represented by any one of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX) (preferably (VII) or (IX)). An oligonucleotide of 45 nucleotides may comprise not more than 22 internucleoside linkages represented by any one of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX) (preferably

[0446] (VII) or (IX)). An oligonucleotide of 50 nucleotides may comprise not more than 25 internucleoside linkages represented by any one of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX) (preferably (VII) or (IX)). Such internucleoside linkages can be present in any region of the oligonucleotide. In one embodiment, the internucleoside linkages represented by any one of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX) (preferably (VI I) or (IX)) may be positioned at the 5’ and / or 3’ end of the oligonucleotide. In another embodiment, the internucleoside linkages may be positioned within, up- or downstream from the region comprising the editing window of the oligonucleotide. In a particular embodiment, the mismatch-forming nucleotide comprised within the editing window of the oligonucleotide may be linked to one or to both of its neighbouring nucleotides in the 5’ and / or 3’ direction with an internucleoside linkage represented by any one of formulas (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX) (preferably (VII) or (IX)).

[0447] In one embodiment, an editing oligonucleotide according to the invention comprises at least one internucleoside linkage represented by any one of formulas (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX) (preferably (VII) or (IX)) and positioned upstream of a mismatch-forming nucleotide. In the context of the invention, a nucleotide or an internucleoside linkage positioned upstream of the mismatch-forming oligonucleotide are denoted as having the -nth position from the mismatch-forming nucleotide. Similarly, nucleotides positioned downstream from the mismatch-forming nucleotide are denoted as having the +nth position from the mismatchforming nucleotide.

[0448] For example, an internucleoside linkage represented by any one of formulas (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX) (preferably (VII) or (IX)) may occupy the -1st, -2nd, -3rd, -4th, -5th , -6th, -7th, -8th, -9th, -10th, -11th, -12th, -13th position upstream from the mismatchforming nucleotide. In embodiments, an editing oligonucleotide provided herein has internucleoside linkage represented by any one of formulas (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX) (preferably (VII) or (IX)) positioned at the -1st, -2nd, -3rd, -4th, -5th, -6th, -7th, -8th, -9th, -10th, -11th, -12th, -13th position upstream from the mismatch-forming nucleotide. In a preferred embodiment, an editing oligonucleotide according to the invention comprises at least one internucleoside linkage represented by any one of formulas (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX) (preferably (VII) or (IX)) and positioned at the ninth nucleotide upstream of the mismatch-forming nucleotide (e.g. at the 9th position upstream from the mismatchforming nucleotide). In another preferred embodiment, an editing oligonucleotide according to the invention comprises at least one internucleoside linkage represented by any one of formulas

[0449] (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX) (preferably (VI I) or (IX)) and positioned at the eleventh nucleotide upstream of the mismatch-forming nucleotide (e.g. at the 11thposition upstream from the mismatch-forming nucleotide). In yet another embodiment, the editing oligonucleotide comprises two internucleoside linkages represented by any one of formulas (I),

[0450] (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX) (preferably (VII) or (IX)) and positioned at the ninth and the eleventh nucleotide upstream of the mismatch-forming nucleotide (e.g. at the 9thand the 11thposition upstream from the mismatch-forming nucleotide).

[0451] In an embodiment, an editing oligonucleotide as described herein comprises 1 artificial or modified internucleoside linkage of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), positioned at the 5’ and / or 3’ terminus of the editing oligonucleotide. In an embodiment, an editing oligonucleotide as described herein comprises 2 artificial or modified internucleoside linkages of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), positioned at the 5’ and / or 3’ terminus of the editing oligonucleotide.

[0452] In an embodiment, an editing oligonucleotide as described herein comprises 3 artificial or modified internucleoside linkages of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), positioned at the 5’ and / or 3’ terminus of the editing oligonucleotide.

[0453] In an embodiment, an editing oligonucleotide as described herein comprises at least 1 artificial or modified internucleoside linkages of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX) positioned at the 5’ and / or 3’ terminus of the editing oligonucleotide and at least 1 artificial or modified internucleoside linkage of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX) positioned internally in the central region of the editing oligonucleotide.

[0454] In a preferred embodiment, an editing oligonucleotide described herein comprises 1 up to 3 internucleoside linkages of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), positioned at the 5’ and / or 3’ terminus of the editing oligonucleotide.

[0455] Oligonucleotides encompassed herein are listed in the section Exemplary editing oligonucleotides. Exemplary embodiments are listed below: editing oligonucleotide comprising 1 artificial or modified internucleoside linkage of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX) positioned at the 5’ terminus of the editing oligonucleotide editing oligonucleotide comprising 1 artificial or modified internucleoside linkage of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX) positioned at the 3’ terminus of the editing oligonucleotide editing oligonucleotide comprising 1 artificial or modified internucleoside linkage of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX) positioned at both the 5’ and 3’ termini of the editing oligonucleotide editing oligonucleotide comprising 2 artificial or modified internucleoside linkages of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX) positioned at the 5’ terminus of the editing oligonucleotide editing oligonucleotide comprising 2 artificial or modified internucleoside linkages of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX) positioned at the 3’ terminus of the editing oligonucleotide editing oligonucleotide comprising 2 artificial or modified internucleoside linkages of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX) positioned at both the 5’ and 3’ termini of the editing oligonucleotide editing oligonucleotide comprising 3 artificial or modified internucleoside linkages of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX) positioned at the 5’ terminus of the editing oligonucleotide editing oligonucleotide comprising 3 artificial or modified internucleoside linkages of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX) positioned at the 3’ terminus of the editing oligonucleotide editing oligonucleotide comprising 3 artificial or modified internucleoside linkages of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX) positioned at both the 5’ the 3’ termini of the editing oligonucleotide

[0456] In another embodiment, an editing oligonucleotide described herein further comprises at least one internucleoside linkage of formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX) positioned in the central portion of the editing oligonucleotide.

[0457] As used herein, the term “central portion” refers to the contiguous region of an antisense editing oligonucleotide that is complementary to a target nucleic acid sequence and is responsible for mediating the editing oligonucleotide’s primary antisense activity. In embodiments where the antisense editing oligonucleotide is an editing oligonucleotide, the central portion comprises the mismatch-forming nucleotide.

[0458] In all preceding embodiments, editing oligonucleotides comprising internucleoside linkages of formula VII or IX are preferred. Accordingly, such an editing oligonucleotide may comprise: editing oligonucleotide comprising 1 artificial or modified internucleoside linkage of formula (VII) or (IX) positioned at the 5’ terminus of the editing oligonucleotide editing oligonucleotide comprising 1 artificial or modified internucleoside linkage of formula (VII) or (IX) positioned at the 3’ terminus of the editing oligonucleotide editing oligonucleotide comprising 1 artificial or modified internucleoside linkage of formula (VII) or (IX) positioned at both the 5’ and 3’ termini of the editing oligonucleotide editing oligonucleotide comprising 2 artificial or modified internucleoside linkages of formula (VII) or (IX) positioned at the 5’ terminus of the editing oligonucleotide editing oligonucleotide comprising 2 artificial or modified internucleoside linkages of formula (VII) or (IX) positioned at the 3’ terminus of the editing oligonucleotide editing oligonucleotide comprising 2 artificial or modified internucleoside linkages of formula (VII) or (IX) positioned at both the 5’ and 3’ termini of the editing oligonucleotide editing oligonucleotide comprising 3 artificial or modified internucleoside linkages of formula (VII) or (IX) positioned at the 5’ terminus of the editing oligonucleotide editing oligonucleotide comprising 3 artificial or modified internucleoside linkages of formula (VII) or (IX) positioned at the 3’ terminus of the editing oligonucleotide editing oligonucleotide comprising 3 artificial or modified internucleoside linkages of formula (VII) or (IX) positioned at both the 5’ the 3’ termini of the editing oligonucleotide

[0459] Without prejudice, an editing oligonucleotide comprising an internucleoside linkage of formula VII or IX at its terminus and / or termini may further comprise at least one such linkage internally, preferably in the central region of the editing oligonucleotide.

[0460] In an embodiment, an internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX) and present in editing oligonucleotide of the invention is not an internucleoside linkage as disclosed in formula (X), (XI), (XII) or (XIII).

[0461] In an embodiment, an editing oligonucleotide comprising an internucleoside linkage as identified herein is such that the efficiency of gymnosis of the oligonucleotide is improved compared to the efficiency of gymnosis of an oligonucleotide lacking any internucleoside linkage as identified herein but having otherwise the same sequence and preferably same chemistry (i.e. control oligonucleotide). Therefore in an embodiment, the efficiency of gymnosis of an editing oligonucleotide of the invention comprising an internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), is improved compared to the efficiency of gymnosis of an editing oligonucleotide lacking any internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), linkages (but having otherwise the same sequence and preferably chemistry). This difference in terms of efficiency may be of at least 1 %, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%. Gymnosis may be assessed using techniques known to the skilled person as described earlier hereinabove. For example, gymnosis may be assessed as in the experimental part. In short, cells are being cultured. Medium is replaced with medium comprising the oligonucleotide to be tested. Concentrations to be used may be 0, 1 or 10 pM of oligonucleotide. 40 hours to 55 hours (preferably 48 hours) after addition of the oligonucleotide, the cells were harvested and RNA was isolated.

[0462] Thus, in an embodiment, provided herein is an editing oligonucleotide or an editing oligonucleotide for use according to the invention, wherein the efficiency of gymnosis of the oligonucleotide or of the oligonucleotide for use is improved compared to the efficiency of gymnosis of an oligonucleotide lacking any internucleoside linkage represented by any one of formulas (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX) but having otherwise the same sequence and preferably chemistry.

[0463] As described earlier herein, an improvement of gymnosis, or cellular uptake is quite attractive as it can be an indirect way of improving the activity of a given dose of an oligonucleotide for a nucleic acid editing according to the invention. In an embodiment, an improved gymnosis of the oligonucleotide results in improved editing efficiency of a target nucleic acid. Editing efficiency is assessed based on methods available to a person skilled in the art. In one embodiment, editing efficiency is assessed based on the levels of full-length protein restoration, preferably of mouse, and even more preferably of human MECP2 protein. In an embodiment, RNA-editing can be assessed by quantifying the relative copies of mutant and edited mRNA using quantitative digital PCR (dPCR). Such assays can be conducted in cell cultures comprising a mutation correctable by editing, wherein the cell culture is transfected with an oligonucleotide for nucleic acid editing as described herein and is compared to mock- transfected cells. Alternatively, such assays can be conducted in vivo, for example using a suitable mouse model.

[0464] In preferred embodiments, an editing oligonucleotide or an editing oligonucleotide for use according to the invention leads to 1 %, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% improvement of editing efficiency by virtue of improved gymnosis when compared to an oligonucleotide equivalent to it but for the presence of internucleoside linkage represented by formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX).

[0465] Base sequence and an editing window comprising a mismatch-forming nucleotide

[0466] An oligonucleotide for nucleic acid editing of the invention comprises a base sequence capable of hybridizing with a target region within a target nucleic acid (e.g. RNA or DNA).

[0467] “Hybridisation” has been defined in a more general context hereinabove. Thus, in some embodiments, the editing oligonucleotides disclosed herein comprise a sequence that is capable of specifically hybridising with a region in the target nucleic acid comprising a target nucleotide to be edited, preferably a target adenosine. A preferred level of complementarity of such sequence is at least 80%. Another preferred level of complementarity is at least 85%. Another preferred level of complementarity is at least 90%. Therefore, in a preferred embodiment, provided herein is an oligonucleotide for nucleic acid editing, wherein the oligonucleotide comprises, consists or essentially consists of a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or at least 99% complementary with the target nucleic acid, wherein the target nucleic acid comprises a nucleotide to be edited, preferably an adenosine. In embodiments, the length of the base sequence determines the total length of the editing oligonucleotide.

[0468] In an embodiment, an editing oligonucleotide or an editing oligonucleotide for use according to the invention has a length from 26 to 50 nucleotides, preferably from 30 to 45 nucleotides, more preferably from 32 to 49 nucleotides, even more preferably from 37 to 41 nucleotides, most preferably 39 nucleotides.

[0469] In particular, the hybridized duplex formed between the oligonucleotide and the target nucleic acid comprises an editing window (e.g. an editing region), defined as a region within the hybridized sequence in which one or more nucleotides of the target nucleic acid are rendered accessible to an editing enzyme (e.g. an enzyme capable of nucleic acid editing). In some embodiments, the editing is a base editor comprising a Cas variant fused to an enzymatically active nucleotide deaminase domain, such as an adenine or cytidine deaminase, to facilitate targeted base conversions.

[0470] In some embodiments, human RNA-specific adenosine deaminases such as ADAR, and more specifically ADAR2 may also be fused to a catalytically inactive Cas protein to direct target adenosine deamination in a target RNA. In preferred embodiments, an editing oligonucleotide described herein is capable of effecting endogenous ADAR-mediated deamination of target adenosine.

[0471] The editing window cr editing region comprises a mismatch positioned opposite of a nucleotide to be edited. Herein, the region comprising the mismatch-forming nucleotide positioned opposite of the target nucleotide to be edited as well as the nucleotides adjacent to said mismatch-forming nucleotide may be called the editing window, or the editing region of the oligonucleotide. In an embodiment, the editing region comprises a mismatch-forming nucleotide opposite of an adenosine to be deaminated.

[0472] In a particular embodiment, the editing region comprises a triplet (e.g. a group of three nucleotides), said triplet comprising the mismatch-forming nucleotide opposite of the adenosine to be deaminated as well as 1 nucleotide upstream (denoted as -1) and 1 nucleotide downstream (denoted as +1) from the mismatch-forming nucleotide.

[0473] In another embodiment, the editing region may comprise 2, 1 nucleotides at the 5’ terminus side of the nucleotide opposite the adenosine to be edited and 1 , 2, 3, 4, 5 nucleotides at the 3’ terminus side of the nucleotide opposite the adenosine to be deaminated.

[0474] Thus, in embodiments, the editing region may comprise at least 3, 4, 5, 6, 7, 8 or 9 nucleotides including the mismatch-forming nucleotide opposite of the adenosine to be deaminated.

[0475] The editing region may also occur at or near the middle of the oligonucleotide, but also closer to the 5’ terminus or closer to the 3’ terminus. The editing oligonucleotide described herein may be further optimized by optimizing its editing region. The editing region may be optimised by optimising its position within the oligonucleotide. In some embodiments, the editing region is not within the first 1 , 2, 3, 4 or 5 residues at the 5’ terminus and not within the last 5, 4, 3, 2 or 1 residues at the 3’ terminus. In a particular embodiment, the length of the 5’ sequence preceding the mismatch-forming nucleotide of the oligonucleotide may be at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26 and preferably 23, 24, and most preferably 25 residues. In a particular embodiment, the length of the 3’ sequence downstream from the mismatch-forming nucleotide of the oligonucleotide may be at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12 and preferably 13 residues. In a particular embodiment, the length of the 3’ sequence downstream from the mismatch-forming nucleotide of the oligonucleotide is 13 residues.

[0476] In exemplary embodiments, an editing oligonucleotide described herein has a preferred length of 39 residues, wherein the length of the 5’ sequence preceding the mismatch-forming nucleotide is 25 residues, followed by the mismatch-forming nucleotide, and by a sequence of 13 residues downstream from the mismatch-forming nucleotide. In other exemplary embodiments, an oligonucleotide described herein has a length of 49 residues, wherein the length of the 5’ sequence preceding the mismatch-forming nucleotide is 35 residues, followed by the mismatch-forming nucleotide, and by a sequence of 13 residues downstream from the mismatch-forming nucleotide.

[0477] In some embodiments, the mismatch-forming nucleotide positioned opposite the target adenosine to be deaminated comprises a cytosine base or a cytosine base analogue. The type of cytosine analogue used in this context is not particularly limited. For example, suitable cytosine analogues are described in WO2020 / 252376, which is incorporated herein by reference in its entirety.

[0478] In an embodiment, provided herein is an editing oligonucleotide or an editing oligonucleotide for use relating to invention, wherein the mismatch-forming nucleotide positioned opposite of the target adenosine comprises a cytosine base or a cytosine base analogue, or comprises an uracil base or an uracil base analogue, wherein the cytosine base analogue is preferably a pyridine base, most preferably 6-amino-5 nitro-2(1 H)-pyridinone (Benner’s Z base), and wherein the uracil base analogue is preferably a purine base, most preferably wherein the purine base is an N3-uridine.

[0479] In some embodiments, the cytosine analogue is a pyrimidine base or a pyridine base, preferably a pyridine base. A particular example of a cytosine analogue which is a pyrimidine base is pseudoisocytosine. A particular example of a cytosine analogue which is a pyridine base is 6- amino-5-nitropyridin-2-one (also known as 6-amino 5-nitro-2(1 H)-pyridinone or Benner’s Z base). Therefore, in preferred embodiments, the base of mismatch-forming nucleotide positioned opposite the target adenosine to be deaminated is 6-amino-5-nitropyridin-2-one. In some other preferred embodiments, the base of mismatch-forming nucleotide positioned opposite the target adenosine to be deaminated is 2', 2'-difluoro 2'deoxycytidine (gemcitabine). Increased deamination efficiencies may also be attained by providing a uracil base (or an analogue thereof) opposite the adenosine to be edited. Accordingly, in some embodiments, the nucleotide residue opposite the target adenosine comprises uracil or an uracil analogue. In some embodiments, the nucleotide residue opposite the target adenosine comprises an uracil analogue which is a uridine. A particular example of an uracil analogue which is a uridine is N3- uridine. Therefore, in preferred embodiments, the nucleotide residue opposite the target adenosine is N3-uridine.

[0480] In some embodiments, the mismatch-forming nucleotide positioned opposite the target adenosine to be deaminated comprises an adenine base or an adenine base analogue. In some embodiments, the mismatch-forming nucleotide positioned opposite the target adenosine to be deaminated comprises an adenine base analogue which is a purine. A particular example of an adenine analogue which is a purine base is a 7,8-Dihydro-8-oxoadenine (also known as 8- oxoadenine). Therefore, in preferred embodiments, the mismatch-forming nucleotide within the editing region is 8-oxoadenine.

[0481] Apart from the base, particular sugar chemistries of the mismatch-forming nucleotide within the editing region may also enhance the deamination reaction. In particular, the 2’ position of the sugar group is preferably not substituted, meaning that it comprises an -H at this position (e.g. in the case of a DNA residue) or an -OH at this position (e.g. in the case of an RNA residue). Preferably, the 2’ position of the sugar group comprises -H (e.g. in the case of a DNA residue). Thus, in some embodiments, the mismatch-forming nucleotide opposite of the target adenosine to be deaminated comprises a 2’-deoxyribose sugar. In some embodiments the mismatchforming nucleotide opposite of the target adenosine to be deaminated is a DNA nucleotide. The same optional preferences apply to the sugar chemistry of the residue that is 3’ adjacent to the mismatch-forming nucleotide opposite the target adenosine. In this context, “adjacent” means directly next (or contiguous) to the nucleotide residue opposite the target adenosine. Thus, in some embodiments, the 2’ position of the sugar group of the residue that is 3’ adjacent to the nucleotide residue opposite the target adenosine is not substituted, meaning that it comprises an -H at this position (e.g. in the case of a DNA residue) or an -OH at this position (e.g. in the case of an RNA residue). Preferably, the 2’ position of the sugar group comprises -H (e.g. in the case of a DNA residue). In some embodiments, the nucleotide residue that is 3’ adjacent to the nucleotide residue opposite the target adenosine comprises a 2’-deoxyribose sugar. In some embodiments, the nucleotide residue that is 3’ adjacent to the mismatch-forming nucleotide opposite of the target adenosine is a DNA nucleotide. In some embodiments, the nucleotide that is 3’ adjacent to the mismatch-forming nucleotide opposite the target adenosine has a G base and preferably has a C base. In some embodiments, the nucleotide that is 3’ adjacent to the mismatch-forming nucleotide opposite the target adenosine to be deaminated comprises a modified thymine base (e.g. 5-methyl-uracil), preferably 5-methyl-4-pyrimidinone. Apart from the sugar scaffold of the mismatch-forming nucleotide or of the nucleotide that is 3’ adjacent to the mismatch-forming nucleotide, particular internucleoside linkage in the editing region of the oligonucleotide may also enhance the deamination reaction.

[0482] In a particular embodiment, the phosphoryl guanidine linkage (PN linkage), preferably the (dmi)- phosphoramidate internucleoside linkage (also called PN-dmi-phosphoramidate linkage) is present between the first and second nucleotide residues positioned 3’ of the mismatch-forming nucleotide. In a particular embodiment, the phosphorothioate linkage (PS linkage), is present between the first and second nucleotide residues that are 3’ adjacent to the mismatch-forming nucleotide. In a particular embodiment, a combination of a PN and a PS linkage is present between the first and second nucleotide residues that are 3’ of the mismatch-forming nucleotide.

[0483] Conformationally restricted nucleotide (CRN)

[0484] The ability of an oligonucleotide described herein to effect nucleic acid editing and preferably ADAR-mediated deamination of a target adenosine within a target RNA is significantly enhanced due to the presence of at least one conformationally restricted nucleotide (e.g. CRN). In one embodiment, an oligonucleotide according to the invention comprises an internal CRN. In one embodiment, the internal CRN may be positioned 5’ to the mismatch-forming nucleotide and / or 3’ to the mismatch-forming nucleotide. As understood herein, nucleotides positioned 5’ to the mismatch-forming nucleotide are denoted as having the -nth position from the mismatchforming nucleotide. For example, an internal CRN may occupy the -1st, -2nd, -3rd, -4th, -5th, - 6th, -7th, -8th, -9th, -10th, -11th, -12th, and up to the -13th position 5’ to the mismatch-forming nucleotide. In embodiments, an oligonucleotide provided herein has at least one internal CRN positioned at the -1st, -2nd, -3rd, -4th, -5th, -6th, -7th, -8th, -9th, -10th, -11th, -12th, and up to the -13th position 5’ to the mismatch-forming nucleotide. In another embodiment, the internal CRN may be positioned 3’ to the mismatch-forming nucleotide. Similarly, nucleotides positioned downstream from the mismatch-forming nucleotide are denoted as having the +nth position from the mismatch-forming nucleotide. Accordingly, an “internal CRN positioned 3’ to the mismatch-forming nucleotide” may occupy the +1 st, +2nd, +3rd, +4th, +5th, +-6th, +7th, +8th, +9th, +1 Oth, +11th, +12th, and up to the +13th position 3’ to the mismatch-forming nucleotide. In the context of the invention, the terms “internal CRN”, an “internal CRN positioned 3’ to the mismatch-forming nucleotide” and “an internal CRN positioned 5’ to the mismatch-forming nucleotide” are used interchangeably. In an embodiment, the oligonucleotide has only internal CRN and does not have any CRN positioned at the 5’ and / or 3’terminus of the oligonucleotide. In another embodiment, the oligonucleotide comprises an internal CRN and a CRN positioned at the 5’ and / or the 3’ terminus of the oligonucleotide. In another embodiment, the oligonucleotide only comprises a CRN positioned at the 5’ and / or the 3’ terminus of the oligonucleotide and does not comprise any internal CRN.

[0485] As understood herein, the term “conformationally restricted nucleotide” refers to a chemically modified nucleotide (e.g. nucleotide analogue), wherein the sugar moiety is altered to impose steric or electronic constraints that restrict its conformational flexibility. In an embodiment, these modifications typically stabilize a preferred non-planar conformation of the sugar moiety (such as the 3’-endo conformation) and therefore may lead to enhanced binding affinity, nuclease resistance, and / or selectivity in hybridization with complementary nucleic acid target sequences. In preferred embodiments, the terms CRN and nucleotide comprising a conformationally restricted sugar moiety are used interchangeably.

[0486] Thus, in an embodiment an editing oligonucleotide or an editing oligonucleotide for use according to the invention comprises at least one conformationally restricted nucleotide (CRN) positioned at the 5’ and / or at the 3’ terminus of the oligonucleotide, wherein the CRN is a Bridged Nucleic Acids (BNAs), and preferably wherein the BNA is a Locked Nucleic Acid (LNA). In embodiments, the activity of the editing oligonucleotide according to the invention disclosed herein may be further enhanced when a modified or an artificial internucleoside linkage links the CRN (i.e nucleotide comprising a conformationally restricted sugar moiety) to its neighbour nucleotide. In an embodiment, the internal CRN is linked to one of its 5’ or 3’ neighbour nucleotides by at least one modified or artificial internucleoside linkage. In an embodiment, the internal CRN is linked to both of its 5’ and 3’ neighbour nucleotides by a modified or artificial internucleoside linkage. In another embodiment, a modified or artificial internucleoside linkage links the CRN positioned at the 5’ and / or 3’ termini of the editing oligonucleotide to a neighbour nucleotide. If there are more than one CRN (i.e. nucleotide comprising a conformationally restricted sugar moiety) at the 5’ and / or 3’ termini, the modified or artificial internucleoside linkage may link both CRNs (i.e. nucleotides comprising said conformationally restricted sugar moieties). If there are more than one internal CRN (i.e. nucleotide comprising a conformationally restricted sugar moiety), the modified or artificial internucleoside linkage may link both CRNs (i.e. nucleotides comprising said conformationally restricted sugar moieties). Preferred internucleoside linkages in this context are a phosphorothioate (PS) or a phosphoryl guanidine (PN) (preferably a dimethylimidazolidin-2-ylidene (dmi) phosphoramidate (PN-dmi- phosphoramidate, or PN-dmi) linkage.

[0487] In some embodiments, modified internucleoside linkages linking the CRN to its neighbour nucleotide are represented by formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX). In one embodiment, an internal CRN is linked to one of its 5’ or 3’ neighbour nucleotides by an internucleoside linkage represented by formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX). In another embodiment, the internal CRN is linked to both of its 5’ and 3’ neighbour nucleotides by a linkage represented by formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX). If there are more than one CRN (i.e. nucleotide comprising a conformationally restricted sugar moiety) at the 5’ and / or 3’ termini, the linkage represented by formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX) may link both CRNs (i.e. nucleotides comprising said conformationally restricted sugar moieties). If there are more than one internal CRN (i.e. nucleotide comprising a conformationally restricted sugar moiety, the linkage represented by formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX) may link both CRNs (i.e. nucleotides comprising said conformationally restricted sugar moieties).

[0488] Examples of nucleotides that cannot be considered conformationally restricted nucleotides in the context of the invention comprise sugar moieties that do not belong to the group of conformationally restricted sugars according to the invention and include the group of 2’-O- substituted RNA nucleotide analogues comprising 2’-O-methyl, 2’-C-(2-cyanoethyl), 2’-O-(2- methoxy)ethyl (2’-MOE), 2’-0-(2-thiomethyl)ethyl, 2’-O-butyryl, 2’-C-propargyl, 2’-O-allyl, and 2’-0-(2S-methoxypropyl), 2’-0-(N-(aminoethyl)carbamoyl)methyl (2’-AECM), 2’-O-(2- carboxyethyl), 2’-0-(3-amino)propyl, 2’-0-(3-(dimethylamino)propyl), 2’-0-(2-amino)ethyl, 2’- 0-(2-(dimethylamino)ethyl) and carbamoyl derivatives (Yamada et al. Org. Biomol. Chem. 2014, 12, 6457).

[0489] Also included is the group of 2’-C-alkoxycarbonyl derivatives such as 2’-O-[2- (methoxycarbonyl)ethyl] (MOCE), 2’-0-[2-(N-methylcarbamoyl)ethyl] (MCE), 2’-O-[2-(N,N- dimethylcarbamoyl)ethyl] (DCME), 2’-0-[2-(methylthio)ethyl] (2’-MTE), 2’-(oj-0-serinol). Other ribose modifications that are considered not to be conformationally restricted comprise 2’-halo: e.g., 2’-fluoro, including FANA (2’-F arabinosyl nucleic acid), 2’,4’-difluoro-2’-deoxy, carbasugar and azasugar modifications and unlocked nucleic acid (UNA) monomer (Lankjaer et al., Bioorg. Med. Chem., 2009). The following nucleotides comprising modifications at alternative sugar positions are also considered to be non-conformationally restricted: 3’-O-substituted: e.g., 3’- O-methyl, 3’-O-butyryl, 3’-0-propargyl, 4’-substituted: e.g., 4’-aminomethyl-2’-0-methyl, 4’- aminomethyl-2’-fluoro and 5’-substituted: e.g., 5’-methyl, or CNA (0stergaard et al., ACS Chem. Biol., 2014). Furthermore, nucleotides comprising non-conformationally restricted sugar moieties are 2’-deoxy (i.e., DNA), 2’-0-(haloalkoxy)methyl (Arai et al., Bioorg. Med. Chem., 2011), such as 2’-0-(2-chloroethoxy)methyl (MCEM) and 2’-0-(2,2-dichloroethoxy)methyl (DCEM).

[0490] In preferred embodiments, editing oligonucleotides according to the invention display advantageous characteristics relative to oligonucleotides comprising a modified nucleotide analogue with a ribose sugar substitution such as 2’-O-Methyl (2’-OMe) or 2’-C-Methoxyethyl (2’-MOE) at the 5’ and / or 3’ termini.

[0491] In preferred embodiments, editing oligonucleotides comprising at least one internal CRN according to the invention display advantageous characteristics relative to oligonucleotides comprising a modified nucleotide analogue with a ribose sugar substitution such as 2’-O-Methyl (2’-OMe) or 2’-C-Methoxyethyl (2’-MOE) at the same position. In some embodiments, oligonucleotides comprising at least one CRN positioned at the 5’ and / or 3’ termini display advantageous characteristics relative to oligonucleotides comprising a modified nucleotide analogue with a ribose sugar substitution such as 2’-O-Methyl (2’-OMe) or 2’-C-Methoxyethyl (2’-MOE) at their 5’ and / or 3’ termini. In further embodiments, oligonucleotides comprising at least one internal CRN and at least one terminal CRN positioned at the 5’ and / or 3’ termini display advantageous characteristics relative to oligonucleotides comprising a modified nucleotide analogue with a ribose sugar substitution such as 2’-O-Methyl (2’-OMe) or 2’-O- Methoxyethyl (2’-MOE) at the corresponding positions.

[0492] As understood herein, CRNs (i.e. nucleotides comprising conformationally restricted sugar moieties) may be selected from the group of bridged nucleic acids (BNA). Bridged nucleic acids (BNAs) are types of nucleotides in which the pucker of the ribose sugar is constrained in the 3’- endo conformation via a bridge between the 2’ and 4’ carbon atoms. The group of BNAs may comprise a locked nucleic acid (LNA) monomer, a xylo-LNA monomer, an a-LNA monomer, an a-L-LNA monomer, a p-D-LNA monomer, a 2’-amino-LNA monomer, a 2’-(alkylamino)-LNA monomer, a 2’-(acylamino)-LNA monomer, a 2’-N-substituted-2’-amino-LNA monomer, a 2’- thio-LNA monomer, a (2’-O,4’-C) constrained ethyl (cEt) BNA monomer, a (2’-O,4’-C) constrained methoxyethyl (cMOE) BNA monomer, a 2’,4’-BNANC(N-H) monomer, a 2’, 4’- BNANC(N-Me) monomer, a 2’,4’-BNANC(N-Bn) monomer, an ethylene-bridged nucleic acid (ENA) monomer, a carba LNA (cLNA) monomer, a 3,4-dihydro-2H-pyran nucleic acid (DpNA) monomer, a 2’-C-bridged bicyclic nucleotide (CBBN) monomer, a heterocyclic-bridged BNA monomer (such as triazolyl or tetrazolyl-linked), an amido-bridged BNA monomer, an urea- bridged BNA monomer, a sulfonamide-bridged BNA monomer, a bicyclic carbocyclic nucleotide monomer, a TriNA monomer, an a-L-TriNA monomer, a bicyclo DNA (bcDNA) monomer, an abcDNA monomer, an F-bcDNA monomer, a tricyclo DNA (tcDNA) monomer, an F-tcDNA monomer, an oxetane nucleotide monomer, a locked PMO monomer derived from 2’-amino- LNA, a guanidine-bridged nucleic acid (GuNA) monomer, a spirocyclopropylene-bridged nucleic acid (scpBNA) monomer, cyclohexenyl nucleic acid (CeNA) monomer , altriol nucleic acid (ANA) monomer, hexitol nucleic acid (HNA) monomer, fluorinated HNA (F-HNA) monomer, pyranosyl-RNA (p-RNA) monomer, 3'-deoxypyranosyl-DNA (p-DNA) monomer.

[0493] The most commonly used variations are locked nucleic acid (LNA), 2’,4’-constrained 2’-O-ethyl (constrained ethyl) BNA (cEt) and, 2’-O,4’-C-ethylene-bridged nucleic acid (ENA).

[0494] In a preferred embodiment, the CRN (i.e. nucleotide comprising a conformationally restricted sugar moiety) is a BNA. Preferred BNA include a 2’,4’-Constrained 2’-O-ethyl BNA (cEt-BNA), a 2’-O,4’-C-Ethylene-Bridged Nucleic Acid (ENA), and more preferred is a Locked Nucleic Acid (LNA).

[0495] The editing oligonucleotide according to the invention comprising a CRN may further comprise a modified base. The term “base modification” or “modified base” as identified herein refers to the modification of a naturally occurring base in RNA (i.e. pyrimidine or purine base) or to the de novo synthesis of a base. This de novo synthesized base could be qualified as “modified” by comparison to an existing base. If such a base is a modified base or if a base analogue is being used, said modified base or base analogue should preferably keep the same base pair specificity as the base it replaces. “Base pairing” refers to the binding of two bases (or nucleobases) to each other by hydrogen bonds. Specifically, a nucleobase analogue replacing cytosine is capable of base pairing with guanine, a nucleobase analogue replacing guanine is capable of base pairing with cytosine, a nucleobase analogue replacing adenine is capable of base pairing with uracil and a nucleobase analogue replacing uracil is capable of base pairing with adenine. Modified or artificial bases as used herein may include modified versions of the natural purine and pyrimidine bases (e.g. adenine, uracil, guanine, cytosine, and thymine), such as hypoxanthine (as present in e.g. inosine), orotic acid, agmatidine, lysidine, pseudouracil, N1 - methylpseudouracil, dihydrouracil, N3-uracil, N1 -methyl-pseudouracil, 5-formylcytosine, 5- acetylcytosine, 5-hydroxycytosine, N6-methyladenine, 8-oxoadenine, 7-methyladenine, 1- methylguanine, 7-methylguanine, N2,N2-dimethylguanine, N2,N2,7-trimethylguanine, N2,7- dimethylguanine, 6-amino-5-nitropyridin-2-one 2-thiopyrimidine (e.g. 2-thiouracil, 2- thiothymine), G-clamp and its derivatives, 5-substituted pyrimidine (e.g. 5-halouracil, 5- propynyluracil, 5-propynylcytosine, 5-aminomethyluracil, 5-hydroxymethyluracil, 5-methyluracil (thymine), 5-methylcytosine, 5-aminomethylcytosine, 5-hydroxymethylcytosine, Super T), 7- deazaguanine, 7-deazaadenine, 2,6-diaminopurine, 7-aza-2,6-diaminopurine, 8-aza-7- deazaguanine, 8-aza-7-deazaadenine, 8-aza-7-deaza-2,6-diaminopurine, Super G, Super A, and N4-ethylcytosine, or derivatives thereof; N2-cyclopentylguanine (cPent-G), N2-cyclopentyl- 2-aminopurine (cPent-AP), and N2-propyl-2-aminopurine (Pr-AP), or derivatives thereof; and degenerate or universal bases, like 2,6-difluorotoluene or absent bases like abasic sites (e.g. 1 -deoxyribose, 1 ,2-dideoxyribose, 1-deoxy-2-0-methylribose; or pyrrolidine derivatives in which the ring oxygen has been replaced with nitrogen (azaribose)). Examples of derivatives of Super A, Super G and Super T can be found in US patent 6,683,173 (Epoch Biosciences), which is incorporated here by reference.

[0496] Preferred modified bases include 5-methylcytosine, 5-methyluracil, hypoxanthine (e.g. as included in inosine), cytosine analogues, and uracil analogues. Non-limiting examples of cytosine and uracil analogues are discussed herein below in the context of the mismatchforming nucleotide. In an embodiment disclosed herein, an oligonucleotide comprising an LNA with a modified base, preferably an internal LNA with methyl-cytosine, exhibits an improved parameter over an oligonucleotide with an unmodified LNA. Such a parameter may include improved duplex stability, improved hybridization specificity, enhanced nuclease resistance and / or reduced immune stimulation.

[0497] In an embodiment, at least one and preferably two internal CRNs are present. In exemplary embodiments, such an oligonucleotide further comprises at least one additional CRN positioned at the 5’ and / or at the 3’ terminus of an oligonucleotide. Therefore, such an oligonucleotide, may comprise the following configurations of CRNs:

[0498] • at least one internal CRN (and in an embodiment, it does not comprise a CRN positioned at the 5’ and / or 3’ terminus of the oligonucleotide),

[0499] • at least two internal CRN (and in an embodiment, it does not comprise a CRN positioned at the 5’ and / or 3’ terminus of the oligonucleotide),

[0500] • at least three internal CRN (and in an embodiment, it does not comprise a CRN positioned at the 5’ and / or 3’ terminus of the oligonucleotide),

[0501] • at least one internal CRN and at least one CRN positioned at the 3’ terminus of the oligonucleotide

[0502] • at least one internal CRN and at least one CRN positioned at the 5’ terminus of the oligonucleotide

[0503] • at least one internal CRN and two additional CRNs, of which one is positioned at the 3’ terminus of the oligonucleotide, whereas the other is positioned at the 5’ terminus of the oligonucleotide

[0504] • at least one internal CRN and two CRNs positioned at the 3’ terminus of the oligonucleotide

[0505] • at least one internal CRN and two CRNs positioned at the 5’ terminus of the oligonucleotide

[0506] • at least one internal CRN and two CRNs positioned at the 3’ terminus of the oligonucleotide as well as two CRNs positioned at the 5’ terminus of the oligonucleotide

[0507] In preferred embodiments, an oligonucleotide according to the invention comprises two internal CRNs positioned 5’ to the mismatch-forming nucleotide and may further comprise at least one terminal CRN positioned at the 5’ and / or at the 3’ terminus of the oligonucleotide.

[0508] In the context of the invention “internal CRN” means that the CRN is not located at one or at both termini of the oligonucleotide. It means said CRN is located at any other places within the base sequence of the oligonucleotide. As used herein, the term “internal CRN3” refers to a CRN that is not located within the two most terminal nucleotides at either the 5' and / or 3' termini of the oligonucleotide.

[0509] In each of these embodiments, the CRN (i.e. nucleotide comprising a conformationally restricted sugar moiety) may be a BNA such as a 2’,4’-Constrained 2’-O-ethyl BNA (cEt-BNA), a 2’-O,4’-C-Ethylene-Bridged Nucleic Acid (ENA), and preferably the BNA is a Locked Nucleic Acid (LN A).

[0510] In an embodiment, at least one and preferably two CRNs (i.e. nucleotide comprising a conformationally restricted sugar moiety) are positioned at the 5’ and / or at the 3’ terminus of the editing oligonucleotide described herein.

[0511] In an embodiment, at least one CRN (i.e. nucleotide comprising a conformationally restricted sugar moiety) is positioned at the 5’ terminus of an editing oligonucleotide according to a third aspect of the invention. In an embodiment, at least one CRN (i.e. nucleotide comprising a conformationally restricted sugar moiety) is positioned at the 3’ terminus of an editing oligonucleotide according to the invention. In an embodiment, at least one CRN (i.e. nucleotide comprising a conformationally restricted sugar moiety) is positioned at both the 5’ and 3’ termini of an editing oligonucleotide according to the invention. In an embodiment, two CRNs (i.e. nucleotides comprising conformationally restricted sugar moieties) are positioned at the 5’ terminus of an oligonucleotide according to the invention. In an embodiment, two CRNs (i.e. nucleotides comprising conformationally restricted sugar moieties) are positioned at the 3’ terminus of an oligonucleotide according to the invention. In yet another embodiment, two CRNs (i.e. nucleotide comprising conformationally restricted sugar moieties) are positioned at both the 5’ and 3’ termini of an editing oligonucleotide according to the invention.

[0512] In one embodiment, at least one internal CRN (i.e. nucleotide comprising a conformationally restricted sugar moiety) positioned 5’ to the mismatch-forming nucleotide comprises a Bridged Nucleic Acid (BNA), such as 2’,4’-Constrained 2’-O-ethyl BNA (cEt-BNA) or2’-0,4’-C-Ethylene- Bridged Nucleic Acid (ENA), and preferably the BNA is a Locked Nucleic Acid (LNA.)

[0513] In one embodiment, at least one, and preferably two, CRNs (i.e. nucleotides comprising conformationally restricted sugar moieties) positioned at the 5’ and / or 3’ termini of an oligonucleotide described herein comprise a Bridged Nucleic Acid (BNA), such as 2’, 4’- Constrained 2’-O-ethyl BNA (cEt-BNA) or 2’-O,4’-C-Ethylene-Bridged Nucleic Acid (ENA), or Locked Nucleic Acid (LNA) and preferably the BNA is a Locked Nucleic Acid (LNA.)

[0514] In an embodiment, a phosphorothioate (PS) internucleoside linkage links the CRN of the oligonucleotide of the invention to its neighbour nucleotide, each PS and CRN being positioned 5’ to the mismatch-forming nucleotide, at the 5’ and / or 3’ termini of the editing oligonucleotide or at both positions. In an embodiment, if there are two CRNs (i.e. nucleotides comprising conformationally restricted sugar moieties) at the 5’and / or 3’ termini of the oligonucleotide, the PS internucleoside linkage may link each of the CRNs at the 5’ and / or at the 3’termini together.

[0515] In an embodiment, a PN internucleoside linkage links the nucleotide of the editing oligonucleotide of the invention that comprises a CRN (i.e. nucleotide comprising a conformationally restricted sugar moiety) to its neighbour nucleotide, with each PN and CRN being positioned at the 5’ and / or 3’ termini of the oligonucleotide, or at both positions. In an embodiment, if there are two conformationally restricted sugar moieties at the 5’ and / or 3’ termini of the oligonucleotide, the PN internucleoside linkage may link each of the nucleotides comprising a conformationally restricted sugar molecule at the 5’ and / or at the 3’termini together.

[0516] In a preferred embodiment, the PN internucleoside linkage is a PNdmi internucleoside linkage.

[0517] In an embodiment, an internucleoside linkage represented by formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX) links the nucleotide of the editing oligonucleotide of the invention that comprises a CRN (i.e. nucleotide comprising a conformationally restricted sugar moiety) to its neighbour nucleotide. In an embodiment, an internucleoside linkage represented by formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX) links the internal CRN to a neighbouring nucleotide. In an embodiment, the internal CRN is linked to one of its 5’ or 3’ neighbour nucleotides by at least one internucleoside linkage represented by formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX). In an embodiment, the internal CRN is linked to both of its 5’ and 3’ neighbour nucleotides by an internucleoside linkage represented by formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX) In another embodiment, each said linkage and conformationally restricted sugar moiety are being positioned at the 5’ and / or 3’ termini of the editing oligonucleotide. In an embodiment, if there are two conformationally restricted sugar moieties at the 5’and / or 3’ termini of the oligonucleotide, the internucleoside linkage represented by formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX) may link each of the nucleotides comprising a conformationally restricted sugar molecule at the 5’ and / or at the 3’termini together.

[0518] In an embodiment, if there are two internal adjacent conformationally restricted sugar moieties in the oligonucleotide, the internucleoside linkage represented by formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX) may link each of the nucleotides comprising a conformationally restricted sugar molecule together.

[0519] In an embodiment, a PN, a PS and / or an internucleoside linkage represented by formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), are present at such positions in the editing oligonucleotide of the invention.

[0520] In an embodiment, a PN internucleoside linkage links the nucleotide of the editing oligonucleotide of the invention that comprises a conformationally restricted sugar moiety to its neighbour nucleotide at the 5’ terminus and a PS internucleoside linkage links the nucleotide of the oligonucleotide of the invention that comprises a conformationally restricted sugar moiety to its neighbour nucleotide at the 3’ terminus. In an embodiment, if there are two CRNs (i.e. nucleotides with conformationally restricted sugar moieties) at the 5’ and / or 3’ termini of the oligonucleotide, the PN internucleoside linkage may link each of the CRNs (i.e. nucleotides comprising a conformationally restricted sugar molecule) at the 5’ terminus and the PN internucleoside linkage may link each of the CRN at the 3’terminus together. The reverse position of the internucleoside linkage is also encompassed by the invention.

[0521] In a preferred embodiment, the PN internucleoside linkage is a PNdmi internucleoside linkage. In an embodiment, a PN internucleoside linkage links the nucleotide of the editing oligonucleotide of the invention that comprises a conformationally restricted sugar moiety to its neighbour nucleotide at the 5’ terminus and an internucleoside linkage represented by formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX) links the nucleotide of the editing oligonucleotide of the invention that comprises a conformationally restricted sugar moiety to its neighbour nucleotide at the 3’ terminus. In an embodiment, if there are two CRNs (i.e. nucleotides with conformationally restricted sugar moieties) at the 5’ and / or 3’ termini of the editing oligonucleotide, the PN internucleoside linkage may link each of the CRNs (i.e. nucleotides comprising a conformationally restricted sugar molecule) at the 5’ terminus and the internucleoside linkage represented by formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), may link each of the CRN at the 3’terminus together. The reverse position of the internucleoside linkage is also encompassed by the invention.

[0522] In a preferred embodiment, the PN internucleoside linkage is a PNdmi internucleoside linkage. In an embodiment, a PS internucleoside linkage links the nucleotide of the editing oligonucleotide of the invention that comprises a conformationally restricted sugar moiety to its neighbour nucleotide at the 5’ terminus and an internucleoside linkage represented by formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), links the nucleotide of the oligonucleotide of the invention that comprises a conformationally restricted sugar moiety to its neighbour nucleotide at the 3’ terminus. In an embodiment, if there are two CRNs (i.e. nucleotides with conformationally restricted sugar moieties) at the 5’ and / or 3’ termini of the oligonucleotide, the PS internucleoside linkage may link each of the CRNs (i.e. nucleotides comprising a conformationally restricted sugar molecule) at the 5’ terminus and the internucleoside linkage represented by formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), may link each of the CRN at the 3’terminus together. The reverse position of the internucleoside linkage is also encompassed by the invention.

[0523] In an embodiment, if there are two CRNs (i.e. nucleotides with conformationally restricted sugar moieties) at the 5’ and / or 3’ termini of the editing oligonucleotide, a combination of internucleoside linkages may be present. For example, if there are two CRNs at the 5’ and / or 3’ termini of the oligonucleotide, one CRN can be linked by means of a PS or a PN linkage to its neighbour CRN, whereas the second CRN be linked to its neighbour nucleotide by means of an internucleoside linkage represented by formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX). In an embodiment, if there are two internal adjacent conformationally restricted sugar moieties in the oligonucleotide, the internucleoside linkage represented by formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX) may link each of the nucleotides comprising a conformationally restricted sugar molecule together.

[0524] In one embodiment, at least one, and preferably two, CRNs (i.e. nucleotides comprising conformationally restricted sugar moieties) of the editing oligonucleotide, each positioned internally and / or at the 5’ and / or 3’ termini of an oligonucleotide described herein are Bridged Nucleic Acids (BNAs), such as 2’,4’-Constrained 2’-O-ethyl BNA (cEt-BNA), 2’-O,4’-C-Ethylene- Bridged Nucleic Acid (ENA), and / or Locked Nucleic Acid (LNA). A preferred conformationally restricted sugar moiety is an LNA.

[0525] In another embodiment, the CRN (i.e. nucleotide comprising conformationally restricted sugar moiety) positioned internally and / or at one or both termini of the editing oligonucleotide is a BNA, such as LNA, and a modified internucleoside linkage, such as a Phosphorothioate (PS) linkage links said CRN (i.e. nucleotide comprising said conformationally restricted sugar moiety) to its neighbour nucleotide.

[0526] In another embodiment, the conformationally restricted sugar moieties positioned internally and / or at one or both termini of the editing oligonucleotide is a BNA, such as LNA, and a modified internucleoside linkage, such as a PN linkage links said nucleotide comprising said conformationally restricted sugar moiety to its neighbour nucleotide. In an embodiment the PN linkage is a PN-dmi linkage.

[0527] In an embodiment, provided herein is an editing oligonucleotide relating to a third aspect of the invention, wherein the conformationally restricted sugar moiety is Bridged Nucleic Acids (BNAs), and preferably is Locked Nucleic Acid (LNA). In an embodiment, at least one conformationally restricted sugar moiety is BNA, and preferably LNA, and is positioned internally within an oligonucleotide according to the invention.

[0528] In an embodiment, at least one conformationally restricted sugar moiety is a BNAs, and preferably an LNA, and is positioned at the 5’ terminus of an editing oligonucleotide according to the invention. In an embodiment, at least one conformationally restricted sugar moiety is a BNAs, and preferably an LNA, and is positioned at the 3’ terminus of an editing oligonucleotide according to the invention.

[0529] In an embodiment, at least one conformationally restricted sugar moiety is a BNAs, and preferably an LNA, and is positioned at both the 5’ and 3’ termini of an editing oligonucleotide according to the invention.

[0530] In an embodiment, two conformationally restricted sugar moieties are BNAs, and are preferably LNAs, and are positioned at the 5’ terminus of an editing oligonucleotide according to the invention. In an embodiment, two conformationally restricted sugar moieties, are BNAs, and preferably are LNAs and are positioned at the 3’ terminus of an editing oligonucleotide according to the invention.

[0531] In one embodiment, at least one and preferably two Bridged Nucleic Acids (BNAs), even more preferably (at least one or at least two LNAs) or two LNAs are positioned at the 5’ and / or 3’ termini of an editing oligonucleotide described herein.

[0532] In an embodiment, at least one and preferably two internal LNAs are present. In some embodiments, this oligonucleotide does not comprise any LNA positioned at the 5’ and / or at the 3’ terminus. In some other embodiments, such an oligonucleotide further comprises at least one additional LNA positioned at the 5’ and / or at the 3’ terminus of an oligonucleotide. Therefore, such oligonucleotide, may comprise the following configurations of internal and terminal LNAs:

[0533] • at least one internal LNA (and in an embodiment, it does not comprise a LNA positioned at the 5’ and / or 3’ terminus of the oligonucleotide),

[0534] • at least two internal LNA (and in an embodiment, it does not comprise a LNA positioned at the 5’ and / or 3’ terminus of the oligonucleotide),

[0535] • at least three internal LNA (and in an embodiment, it does not comprise a LNA positioned at the 5’ and / or 3’ terminus of the oligonucleotide),

[0536] • at least one internal LNA and at least one LNA positioned at the 3’ terminus of the oligonucleotide

[0537] • at least one internal LNA and at least one LNA positioned at the 5’ terminus of the oligonucleotide

[0538] • at least one internal LNA and two additional LNAs, of which one is positioned at the 3’ terminus of the oligonucleotide, whereas the other is positioned at the 5’ terminus of the oligonucleotide

[0539] • at least one internal LNA and two LNAs positioned at the 3’ terminus of the oligonucleotide

[0540] • at least one internal LNA and two LNAs positioned at the 5’ terminus of the oligonucleotide at least one internal LNA and two LNAs positioned at the 3’ terminus of the oligonucleotide as well as two LNAs positioned at the 5’ terminus of the oligonucleotide

[0541] In the context of the invention “internal LNA” (or internal CRN) means that the LNA (respectively CRN) is not located at one or at both termini of the oligonucleotide. It means said LNA (respectively CRN) is located at any other places within the base sequence of the oligonucleotide. As used herein, the term “internal LNA” (or “internal CRN”) refers to an LNA (or respectively to a CRN) that is not located within the two most terminal nucleotides at either the 5' and / or 3' termini of the oligonucleotide.

[0542] In preferred embodiments, an oligonucleotide according to the invention comprises two internal LNAs. In an embodiment, this oligonucleotide does not comprise other LNAs, meaning it does not comprise any LNA positioned at the 5’ and / or at the 3’ termini of the oligonucleotide. In another embodiment, the oligonucleotide comprising two internal LNAs may further comprise at least one terminal LNA positioned at the 5’ and / or at the 3’ terminus of the oligonucleotide.

[0543] In an embodiment, an oligonucleotide comprising at least one, and preferably two internal BNAs (more preferably two LNAs) leads to at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, and preferably 100% higher level of full-length protein following ADAR-mediated deamination of a target adenosine comprised in a target RNA. In an embodiment, the activity of an oligonucleotide comprising at least one, and preferably two internal BNAs (more preferably two internal LNAs) may be further enhanced by the presence of an additional BNA (preferably an LNA) positioned at the 5’ and / or 3’ terminus of the oligonucleotide. In preferred embodiments, an oligonucleotide according to the invention comprises at least one internal BNA (preferably an LNA), which is combined with a 5’ terminal BNA (preferably an LNA).

[0544] In one embodiment, at least two Bridged Nucleic Acids (BNAs), even more preferably two LNAs are positioned at the 5’ and 3’ termini of an editing oligonucleotide described herein.

[0545] In an embodiment, an editing oligonucleotide comprising at least one, and preferably two BNAs (more preferably two LNAs) at both its 5’ and 3’ termini leads to at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, and preferably 100% higher level of full length protein following ADAR-mediated deamination of a target adenosine comprised in a target RNA.

[0546] In an embodiment, an editing oligonucleotide comprising at least one, and preferably two internal LNAs leads to at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, and preferably 100% higher level of full-length protein restoration following ADAR-mediated deamination of a target adenosine comprised in a target RNA. In an embodiment, the activity of an editing oligonucleotide comprising at least one, and preferably two internal LNAs may be further enhanced by the presence of an additional LNA positioned at the 5’ and / or 3’ terminus of the oligonucleotide. In preferred embodiments, an editing oligonucleotide according to the invention comprises at least one internal LNA, which is combined with a 5’ terminal LNA.

[0547] In an embodiment, an editing oligonucleotide comprising at least one, and preferably two LNAs at both its 5’ and 3’ termini leads to at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, and preferably 100% higher level of full length protein restoration following ADAR-mediated deamination of a target adenosine comprised in a target RNA.

[0548] In an embodiment, functional full-length protein restoration is achieved with an editing oligonucleotide comprising two LNAs (e.g. 2 LNAs at the 5’ terminus or 2 LNAs at the 3’ terminus or one LNA at both the 5’ and the 3’ termini). In another embodiment, detectable levels of full-length protein restoration are achieved with an editing oligonucleotide comprising one LNA (e.g. positioned either at the 5’ or at the 3’ terminus of the oligonucleotide). In the context of the invention, ‘’functional” and / or ‘detectable” levels of full-length protein restoration achieved with an editing oligonucleotide described herein means a measurable increase of full- length protein levels using an assay known to a person skilled in the art. A functional level of full-length protein restoration may be at least 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% and preferably is 100% relative to a control. A detectable level of full-length protein restoration may be at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, and preferably is 50% relative to a control. In an embodiment, a control used to assess the level of full-length protein restoration obtained with an editing oligonucleotide according to the invention is a sample from an untreated patient. In another embodiment, a control used to assess the level of full-length protein restoration is a sample from a healthy individual. In an embodiment, both the functional and detectable levels of full-length protein restoration obtained using an editing oligonucleotide according to the invention have a therapeutic effect (e.g. are sufficient to ameliorate, delay, prevent, inhibit, cure and / or treat a disease).

[0549] The expression “LNA-free termini” as understood herein denotes oligonucleotides that do not comprise an LNA at their 5’ or 3’ termini; instead, such editing oligonucleotides may comprise naturally occurring ribo- or deoxynucleotides or non-LNA nucleotide analogues thereof. In one embodiment, editing oligonucleotides with LNA-free termini may comprise internal LNAs as described later herein.

[0550] In an embodiment, ADAR-mediated deamination of a target adenosine with an oligonucleotide comprising one and preferably two internal LNAs enhances protein restoration by at least 40% (1.4-fold), 50% (1.5-fold), 60% (1.6-fold), 70% (1.7-fold), 80% (1.8-fold), 90% (1.9-fold), 100% (2.0-fold), 110% (2.1-fold), 120% (2.2-fold), 130% (2.3-fold), 140% (2.4-fold), 150% (2.5-fold), 160% (2.6-fold), 170% (2.7-fold), 180% (2.8-fold), 190% (2.9-fold), and preferably 200% (3.0- fold) relative to an LNA-free oligonucleotide. In a further embodiment, such oligonucleotide further comprises at least one terminal LNA positioned at its 5’ and / or 3’ termini.

[0551] In an embodiment, ADAR-mediated deamination of a target adenosine with an editing oligonucleotide comprising one, and preferably two LNAs at both its 5’ and 3’ termini enhances protein restoration by at least 40% (1.4-fold), 50% (1.5-fold), 60% (1.6-fold), 70% (1.7-fold), 80% (1.8-fold), 90% (1.9-fold), 100% (2.0-fold), 110% (2.1 -fold), 120% (2.2-fold), 130% (2.3- fold), 140% (2.4-fold), 150% (2.5-fold), 160% (2.6-fold), 170% (2.7-fold), 180% (2.8-fold), 190% (2.9-fold), and preferably 200% (3.0-fold) relative to an LNA-ends free editing oligonucleotide.

[0552] In an embodiment, functional full-length protein restoration is achieved with an oligonucleotide comprising two LNAs (e.g. 2 internal LNAs or 2 LNAs at the 5’ terminus or 2 LNAs at the 3’ terminus or one LNA at both the 5’ and the 3’ termini). In another embodiment, detectable levels of full-length protein restoration are achieved with an oligonucleotide comprising one LNA (e.g. one internal LNA or one LNA positioned either at the 5’ or at the 3’ terminus of the oligonucleotide). In the context of the invention, ‘’functional” and / or ‘detectable” levels of full- length protein restoration achieved with an oligonucleotide described herein means a measurable increase of full-length protein levels using an assay known to a person skilled in the art. A functional level of full-length protein restoration may be at least 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% and preferably is 100% relative to a control. A detectable level of full-length protein restoration may be at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, and preferably is 50% relative to a control. In an embodiment, a control used to assess the level of full-length protein restoration obtained with an oligonucleotide according to the invention is a sample from an untreated patient. In another embodiment, a control used to assess the level of full-length protein restoration is a sample from a healthy individual. In an embodiment, both the functional and detectable levels of full-length protein restoration obtained using an oligonucleotide according to the invention have a therapeutic effect (e.g. are sufficient to ameliorate, delay, prevent, inhibit, cure and / or treat a disease).

[0553] In embodiments, an oligonucleotide comprising at least one internal LNA may further comprise at least one terminal LNA positioned at the 5’ and / or 3’ termini of the oligonucleotide. In another embodiment, oligonucleotides described herein may comprise only terminal LNAs and no internal LNAs.

[0554] In the context of the invention “internal LNA” (or internal CRN) means that the LNA (respectively CRN) is not located at one or at both termini of the oligonucleotide. It means said LNA (respectively CRN) is located at any other places within the base sequence of the oligonucleotide. As used herein, the term “internal LNA” (or “internal CRN”) refers to an LNA (or respectively to a CRN) that is not located within the two most terminal nucleotides at either the 5' and / or 3' termini of the oligonucleotide.

[0555] In an embodiment, ADAR-mediated deamination of a target adenosine with an oligonucleotide comprising one, and preferably two LNAs at both its 5’ and 3’ termini enhances protein restoration by at least 40% (1.4-fold), 50% (1.5-fold), 60% (1.6-fold), 70% (1.7-fold), 80% (1.8- fold), 90% (1.9-fold), 100% (2.0-fold), 110% (2.1 -fold), 120% (2.2-fold), 130% (2.3-fold), 140% (2.4-fold), 150% (2.5-fold), 160% (2.6-fold), 170% (2.7-fold), 180% (2.8-fold), 190% (2.9-fold), and preferably 200% (3.0-fold) relative to an LNA-ends free oligonucleotide.

[0556] The expression “LNA-ends free editing oligonucleotide” or “LNA-free termini” as understood herein denotes editing oligonucleotides that do not comprise any LNA in their 3’ and / or 5’ termini. It is not ruled out that a LNA may be present internally. In the context of the invention, an oligonucleotide that lacks an internal LNA and / or an LNA positioned at its 5’ and / or 3’ termini, is referred to as an “LNA-free” oligonucleotide.

[0557] The efficiency of ADAR-mediated target adenosine deamination with an editing oligonucleotide described herein may be further enhanced by the number of LNAs positioned at the oligonucleotide’s 5’ and / or 3’ termini and / or by the number of internal LNAs and by the type of internucleoside linkage linking nucleotides comprising said LNA at the 5’ terminal (and / or at the 3’terminus) and / or internal LNA.

[0558] In an embodiment, provided herein is an editing oligonucleotide, wherein the oligonucleotide comprises at least one and preferably two LNAs positioned at both the 5’ and 3’ termini of the oligonucleotide, wherein the most terminal one or two LNAs at the 5’ terminus and the most terminal one or two LNAs at the 3’ terminus of the oligonucleotide are linked by means of a modified or an artificial internucleoside linkage, preferably a phosphorothioate (PS) linkage. In an embodiment, provided herein is an editing oligonucleotide, wherein the oligonucleotide comprises at least one and preferably two LNAs positioned at both the 5’ and 3’ termini of the oligonucleotide, wherein the most terminal one or two LNAs at the 5’ terminus and the most terminal one or two LNAs at the 3’ terminus of the editing oligonucleotide are linked by means of a modified or an artificial internucleoside linkage, which is a PN internucleoside linkage, preferably a PN-dmi internucleoside linkage.

[0559] In one embodiment, an editing oligonucleotide comprising an internucleoside linkage represented by formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), further comprises a CRN, preferably an LNA. Such editing oligonucleotide (comprising an internucleoside linkage represented by formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX)) may further comprise one LNA at the 5’ terminus or one LNA at the 3’ terminus. In a particular embodiment, the editing oligonucleotide comprises at least one LNA at both the 5’ and 3’ termini. In another embodiment, the oligonucleotide comprises two LNAs at the 5’ terminus or two LNAs at the 3’ terminus. In a particular embodiment, the editing oligonucleotide comprises two LNAs at both the 5' and 3' termini. In a further embodiment, the editing oligonucleotide comprises one LNA at the 5' terminus and two LNAs at the 3' terminus. In a further embodiment, the editing oligonucleotide comprises two LNAs at the 3' terminus and one LNA at the 5' terminus.

[0560] In further embodiments, the most terminal LNA at one or both termini is linked via a modified or artificial internucleoside linkage, which differs from the linkage represented by formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX). In further embodiments, the two most terminal LNAs at one or both termini of the editing oligonucleotide are linked via a modified or artificial internucleoside linkage, represented by formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), Types of internucleoside linkages are described earlier hereinabove.

[0561] In an embodiment, if there are two internal adjacent LNAs in the oligonucleotide, the internucleoside linkage represented by formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX) may link each of the nucleotides comprising a conformationally restricted sugar molecule together.

[0562] In an embodiment, at least one and preferably two internal LNAs are present. In exemplary embodiments, such an oligonucleotide further comprises at least one LNA positioned at the 5’ and / or at the 3’ terminus of an oligonucleotide. Therefore, such oligonucleotide, may comprise the following configurations of LNAs in combination with the internucleoside linkage represented by formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX):

[0563] • at least one internal LNA (and in an embodiment, it does not comprise a LNA positioned at the 5’ and / or 3’ terminus of the oligonucleotide),

[0564] • at least two internal LNA (and in an embodiment, it does not comprise a LNA positioned at the 5’ and / or 3’ terminus of the oligonucleotide), • at least three internal LNA (and in an embodiment, it does not comprise a LNA positioned at the 5’ and / or 3’ terminus of the oligonucleotide),

[0565] • at least one internal LNA and at least one LNA positioned at the 3’ terminus of the oligonucleotide

[0566] • at least one internal LNA and at least one LNA positioned at the 5’ terminus of the oligonucleotide

[0567] • at least one internal LNA and two additional LNAs, of which one is positioned at the 3’ terminus of the oligonucleotide, whereas the other is positioned at the 5’ terminus of the oligonucleotide

[0568] • at least one internal LNA and two LNAs positioned at the 3’ terminus of the oligonucleotide

[0569] • at least one internal LNA and two LNAs positioned at the 5’ terminus of the oligonucleotide

[0570] • at least one internal LNA and two LNAs, positioned at the 3’ terminus of the oligonucleotide, whereas the other two are positioned at the 5’ terminus of the oligonucleotide

[0571] In the context of the invention “internal LNA” (or internal CRN) means that the LNA (respectively CRN) is not located at one or at both termini of the oligonucleotide. It means said LNA (respectively CRN) is located at any other places within the base sequence of the oligonucleotide. As used herein, the term “internal LNA” (or “internal CRN”) refers to an LNA (or respectively to a CRN) that is not located within the two most terminal nucleotides at either the 5' and / or 3' termini of the oligonucleotide.

[0572] In preferred embodiments, an oligonucleotide according to the invention comprises two internal LNAs positioned 5’ to the mismatch-forming nucleotide and may further comprise at least one terminal LNA positioned at the 5’ and / or at the 3’ terminus of the oligonucleotide.

[0573] In a particular embodiment, an editing oligonucleotide described herein comprises one LNA at the 5’ terminus or one LNA at the 3’ terminus, wherein the nucleotide comprising the LNA is linked via another nucleotide via a phosphorothioate (PS) linkage. In another embodiment, an editing oligonucleotide comprises one LNA at both the 5’ and 3’ termini, wherein each nucleotide comprising said LNA is linked via another nucleotide via a phosphorothioate (PS) linkage. In further embodiments, an editing oligonucleotide comprises two LNAs at either the 5’ or 3’ terminus, or two LNAs at both the 5' and 3' termini, wherein the nucleotides comprising the two most terminal LNAs positioned at the 5' and 3' termini are linked via a phosphorothioate (PS) linkage.

[0574] In a further embodiment, an editing oligonucleotide described herein comprises one LNA at the 5' terminus and two LNAs at the 3' terminus, wherein the most terminal nucleotide comprising the LNA at the 5' terminus is linked to another nucleotide via a PS linkage and the two most terminal nucleotide comprising the LNAs at the 3' terminus are linked together via a phosphorothioate (PS) linkage. In a further embodiment, an oligonucleotide described herein comprises one LNA at the 3' terminus and two LNAs at the 5' terminus, wherein the most terminal nucleotide comprising the LNA at the 3' terminus is linked to another nucleotide via a PS linkage and the two most terminal nucleotide comprising the LNAs at the 5' terminus are linked together via a phosphorothioate (PS) linkage.

[0575] In an embodiment, if there are two internal adjacent LNAs in the oligonucleotide, the internucleoside linkage represented by formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX) may link each of the nucleotides comprising a conformationally restricted sugar molecule together.

[0576] In further embodiments, the efficiency of ADAR-mediated deamination of a target adenosine with an editing oligonucleotide described herein is further improved by the presence of additional LNAs positioned away from the 5’ and / or 3’ termini of the editing oligonucleotide. As understood herein, the term “away” refers to at least 1 , at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 8, at least 9, at least 10, at least 11 , at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21 , at least 22 nucleotide residues away from the one or two most terminal LNAs positioned at the 5’ and / or 3’ termini of an editing oligonucleotide described herein.

[0577] In an embodiment, it is expected that editing oligonucleotides comprising a terminally positioned CRN, preferably wherein the CRN is a LNA at one or at both of theirtermini in combination with an internal CRN have a higher editing activity compared to editing oligonucleotides with only CRNs at one or both of their termini or oligonucleotides with only internal CRN. In a preferred embodiment, an internal CRN is LNA. In one embodiment, an editing oligonucleotide according to the invention does not comprise an internal stretch of 2’-MOE nucleotide residues, wherein said nucleotide residues are joined with PS linkages.

[0578] In an embodiment, provided herein is an editing oligonucleotide or an editing oligonucleotide for use wherein the editing oligonucleotide further comprises at least one internal CRN located upstream of the mismatch-forming nucleotide, preferably wherein the CRN is an LNA.

[0579] In the context of the invention, nucleotides positioned upstream of the mismatch-forming oligonucleotide are denoted as having the -nth position from the mismatch-forming nucleotide. Similarly, nucleotides positioned downstream from the mismatch-forming nucleotide are denoted as having the +nth position from the mismatch-forming nucleotide.

[0580] For example, an internal CRN, preferably an LNA, may occupy the -1st, -2nd, -3rd, -4th, -5th , -6th, -7th, -8th, -9th, -10th, -11th, -12th, -13th position upstream from the mismatch-forming nucleotide. In embodiments, an editing oligonucleotide provided herein has one internal CRN positioned at the -1st, -2nd, -3rd, -4th, -5th, -6th, -7th, -8th, -9th, -10th, -11th, -12th, -13th position upstream from the mismatch-forming nucleotide. In a preferred embodiment, at least one or both of the internal CRNs are an LNA. In a particular embodiment, an editing oligonucleotide provided herein has two internal CRNs, preferably positioned at the -2nd and - 8th position upstream from the mismatch-forming nucleotide. In embodiments, two additional LNAs positioned upstream of the mismatch-forming nucleotide improve the efficiency of target adenosine deamination when combined with a C or G nucleotide placed in the +1 st position from the mismatch-forming nucleotide.

[0581] Other modifications of the editing oligonucleotide

[0582] In an embodiment, an editing oligonucleotide or an editing oligonucleotide for use according to the invention, in addition to the mismatch-forming nucleotide, further comprises another non- complementary or further modified nucleotide, preferably wherein the modified nucleotide is chemically modified.

[0583] In some embodiments, editing oligonucleotides as described herein comprise up to 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 non-complementary nucleotides in addition to the mismatch-forming nucleotide. For example, editing oligonucleotides or editing oligonucleotides for use as described herein may comprise 1 , 2, 3, 4 or 5 non-complementary nucleotides in addition to the mismatchforming nucleotide. Such additional non-complementary bases may include both mismatches (“mismatch bases”) and wobbles (“wobble bases”). It is understood that a mismatch or mismatch base refers to a base forming a mismatch at an opposite nucleotide in the target RNA. It is also understood that in the context of the invention, “mismatches”, or “mismatch bases” do not denote the “mismatch-forming nucleotide” positioned opposite of the nucleotide to be edited (e.g. adenosine to be deaminated) but refer to additional mismatches.

[0584] Said additional mismatches (e.g., a G mismatch) may be comprised in the sequence that is capable of hybridising with a region in the target nucleic acid, preferably RNA, and serve to reduce off-targeting editing. In some embodiments, editing oligonucleotides as described herein are complementary to the target sequence, preferably perfectly complementary to the target sequence, except for the presence of up to 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 (for example 1 , 2, 3, or 4) mismatches or wobble bases. In embodiments, an editing oligonucleotide described herein and comprising a nucleotide forming a mismatch at the target adenosine to be edited, may comprise up to 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 additional non-complementary nucleotides (including mismatches and / or wobbles.

[0585] For example, 1 , 2, or 3 additional non-complementary residues (including mismatches and / or wobbles, preferably wobbles) may be present. It is understood that a wobble or wobble base refers to a base forming a wobble base pair with an opposite nucleotide in the target RNA. Nucleotides capable of forming wobble pairs are guanine (G), uracil (U) and inosine (I). Inosine nucleotides comprising a hypoxanthine base are preferred in the context of the invention.

[0586] The editing oligonucleotide may be chemically modified (referred to herein as "modified editing oligonucleotide"). Accordingly, in an embodiment, the editing oligonucleotide or the editing oligonucleotide for use is a chemically modified oligonucleotide. In an embodiment, the modification of said oligonucleotide is compared to a (natural) RNA oligonucleotide. A modified editing oligonucleotide comprises a chemically modified nucleotide and / or an additional modified internucleoside linkage different from the internucleoside linkage of the invention represented by formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX). It is to be understood herein that the internucleoside linkage of the invention represented by formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX) can be combined with other modified internucleoside linkages.

[0587] The term modified nucleotide is synonymous with nucleotide analogue. A nucleotide analogue preferably is a nucleotide that comprises a base modification (e.g. a "modified base") and / or a sugar modification (e.g. a 'modified sugar", also referred to as scaffold modification), and / or a modified internucleoside linkage (e.g. a “backbone modification”).

[0588] Suitable base, sugar and backbone modifications have been described earlier hereinabove. In a particular embodiment, base, sugar and backbone modifications described in the context of the mismatch-forming nucleotide also apply to any other nucleotide comprised within the editing oligonucleotide or the editing oligonucleotide for use according to the invention. Preferred modified bases applicable to an editing oligonucleotide or an editing oligonucleotide for use according to the invention include 5-methylcytosine, 5-methyluracil, hypoxanthine (e.g. as included in inosine), cytosine analogues, and uracil analogues. A cytosine analogue may be a pyrimidine base or a pyridine base, preferably a pyridine base. A particular example of a cytosine analogue which is a pyrimidine base is pseudoisocytosine or a 6-amino-5-nitropyridin- 2-one (Benner’s Z base) or 2', 2'-difluoro 2'deoxycytidine (gemcitabine). In a preferred embodiment, a uracil analogue is a uridine, more preferably N3-uridine. Therefore, in preferred embodiments, the nucleotide residue opposite the target adenosine is N3-uridine. These cytosine and uracil analogues are preferred for oligonucleotides used for RNA editing, preferably recruiting ADAR. Particularly preferred modified bases include 5-methylcytosine, 5- methyluracil, hypoxanthine (e.g. as included in inosine),

[0589] In some embodiments, an editing oligonucleotide or an editing oligonucleotide for use according to the invention comprises an internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), and may comprise one or more modified or artificial bases. In some embodiments, the one or more modified or artificial bases are selected from the group consisting of 5-methylcytosine, 5-methyluracil, hypoxanthine (e.g. as included in inosine), cytosine analogues, and uracil analogues, preferably selected from the group consisting of 5-methylcytosine, hypoxanthine (e.g. as included in inosine), and cytosine analogues. In some embodiments, the one or more modified or artificial bases include one or more 5-methylcytosine, one or more hypoxanthines (e.g. as included in inosine), and one or more cytosine analogues.

[0590] Modified or artificial sugar (or scaffold) as described herein may include a modified version of the ribosyl moiety, such as 2’-0-modified RNA such as 2’-O-alkyl or 2’-O-(substituted)alkyl e.g. 2’-O-methyl, 2’-0-(2-cyanoethyl), 2’-0-(2-methoxy)ethyl (2’-MOE), 2’-0-(2-thiomethyl)ethyl, 2’- O-butyryl, 2’-Q-propargyl, 2’-O-acetalester (such as e.g. Biscans et al. Bioorg. Med. Chem. 2015, 23, 5360), 2’-O-allyl, 2’-0-(2S-methoxypropyl), 2’-0-(N-(aminoethyl)carbamoyl)methyl) (2’-AECM), 2’-0-(2-carboxyethyl) and carbamoyl derivatives (Yamada et al. Org. Biomol. Chem. 2014, 12, 6457), 2’-0-(3-amino)propyl, 2’-0-(2-(dimethylamino)ethyl), 2’-O-(2- amino)ethyl, 2’-0-(3-(dimethylamino)propyl); 2’-deoxy (DNA); 2’-0-(haloalkoxy)methyl (Arai K. et al. Bioorg. Med. Chem. 2011 , 21 , 6285) e.g. 2’-0-(2-chloroethoxy)methyl (MCEM), 2’-O-(2,2- dichloroethoxy)methyl (DCEM); 2’-0-alkoxycarbonyl e.g. 2’-0-[2-(methoxycarbonyl)ethyl] (MOCE), 2’-0-[2-(N-methylcarbamoyl)ethyl] (MCE), 2’-0-[2-(N,N-dimethylcarbamoyl)ethyl] (DCME), 2’-0-[2-(methylthio)ethyl] (2’-MTE), 2’-(w-0-serinol); 2’-halo e.g. 2’-F, FANA (2’-F arabinosyl nucleic acid); 2’,4’-difluoro-2’-deoxy; carbasugar and azasugar modifications; 3’-O- substituted e.g. 3’-O-methyl, 3’-O-butyryl, 3’-C-propargyl; 4’-substituted e.g. 4’-aminomethyl-2’- O-methyl or 4’-aminomethyl-2’-fluoro; 5’-subtituted e.g. 5’-methyl or CNA (0stergaard et al. ACS Chem. Biol. 2014, 22, 6227); and their derivatives.

[0591] Preferred modified bases include 5-methylcytosine, 5-methyluracil, hypoxanthine (e.g. as included in inosine), cytosine analogues, and uracil analogues. Non-limiting examples of cytosine and uracil analogues are discussed hereinbelow in the context of the mismatchforming nucleotide.

[0592] In an embodiment disclosed herein, an oligonucleotide comprising a CRN, preferably an LNA with a modified base, even more preferably an internal LNA comprising 5-methylcytosine, exhibits an improved parameter over an oligonucleotide comprising an LNA without a modified base. Such parameter may include improved duplex stability, improved hybridization specificity, enhanced nuclease resistance and / or reduced immune stimulation.

[0593] In an embodiment, at least one and preferably two internal CRNs are present in the editing oligonucleotide. In exemplary embodiments, such an oligonucleotide further comprises at least one additional CRN positioned at the 5’ and / or at the 3’ terminus of an oligonucleotide. Therefore, such oligonucleotide, may comprise the following configurations of CRNs:

[0594] • at least one internal CRN (and in an embodiment, it does not comprise a CRN positioned at the 5’ and / or 3’ terminus of the oligonucleotide),

[0595] • at least two internal CRN (and in an embodiment, it does not comprise a CRN positioned at the 5’ and / or 3’ terminus of the oligonucleotide),

[0596] • at least three internal CRN (and in an embodiment, it does not comprise a CRN positioned at the 5’ and / or 3’ terminus of the oligonucleotide),

[0597] • at least one internal CRN and at least one CRN positioned at the 3’ terminus of the oligonucleotide

[0598] • at least one internal CRN and at least one CRN positioned at the 5’ terminus of the oligonucleotide

[0599] • at least one internal CRN and two additional CRNs, of which one is positioned at the 3’ terminus of the oligonucleotide, whereas the other is positioned at the 5’ terminus of the oligonucleotide • at least one internal CRN and two CRNs positioned at the 3’ terminus of the oligonucleotide

[0600] • at least one internal CRN and two CRNs positioned at the 5’ terminus of the oligonucleotide

[0601] • at least one internal CRN and two CRNs positioned at the 3’ terminus of the oligonucleotide as well as two CRNs positioned at the 5’ terminus of the oligonucleotide

[0602] In a preferred embodiment, an oligonucleotide according to the invention comprises two internal CRNs and may further comprise at least one terminal CRN positioned at the 5’ and / or at the 3’ terminus of the oligonucleotide.

[0603] In the context of the invention, “internal CRN” means that the CRN is not located at one or at both termini of the oligonucleotide. It means said CRN is located at any other place within the base sequence of the oligonucleotide. As used herein, the term “internal CRN3” refers to a CRN that is not located within the two most terminal nucleotides at either the 5' and / or 3' termini of the oligonucleotide.

[0604] Thus, provided herein is an editing oligonucleotide or an editing oligonucleotide for use according to the invention, wherein the non-complementary nucleotide comprises inosine and wherein the chemically modified nucleotide comprises a modified base, preferably 5- methylcytosine and / or 5-methyluracil, and / or a 2’ modification of the sugar ring, more preferably 2-O’-methyl modification, and / or another modified internucleoside linkage, most preferably a phosphorothioate and / or a phosphoryl guanidine (PN) linkage.

[0605] With respect to the additional modified internucleoside linkages, an editing oligonucleotide or an editing oligonucleotide for use according to the invention is provided wherein the oligonucleotide comprises one or more phosphorothioate internucleoside linkages, preferably wherein the oligonucleotide comprises phosphorothioate internucleoside linkages between the most terminal two nucleotides at the 5’ terminus and / or between the most terminal two nucleotides at the 3’ terminus of the oligonucleotide, and / or, the oligonucleotide comprises one or more phosphoryl guanidine (PN) internucleoside linkages, preferably wherein the phosphoryl guanidine (PN) is dimethylimidazolidin-2-ylidene (dmi) phosphoramidate (PN-dmi-phosphoramidate), optionally wherein the one or more phosphoryl guanidine (PN) internucleoside linkages occur between the first and second nucleotide in the 3’ position of the mismatch-forming nucleotide opposite of a target nucleotide In a further aspect, provided herein are compositions comprising the editing oligonucleotides as defined herein. In an embodiment, the composition is a pharmaceutical composition. In an embodiment, such composition is for use in treating, inhibiting, and / or preventing a genetic disease associated or linked with a target RNA, more preferably a disease of the central nervous system, even more preferably wherein the disease of the central nervous system is caused by mutations of the gene encoding MECP2 in a subject, and most preferably wherein the disease is Rett syndrome. In other words, oligonucleotides and compositions as described herein may be for use as a medicament.

[0606] In some embodiments, a pharmaceutical composition comprises an oligonucleotide as described herein, and optionally further comprises one or more pharmaceutically acceptable ingredients.

[0607] In some embodiments, compositions described herein comprise a salt (e.g. a sodium salt) of the oligonucleotides of this disclosure.

[0608] As used herein, “pharmaceutically acceptable ingredients” include pharmaceutically acceptable carriers, fillers, preservatives, solubilizers, vehicles, diluents and / or excipients. Accordingly, the one or more pharmaceutically acceptable ingredients may be selected from the group consisting of pharmaceutically acceptable carriers, fillers, preservatives, solubilizers, vehicles, diluents, and excipients, preferably selected from the group consisting of excipients, vehicles, carriers, and diluents. Such pharmaceutically acceptable carriers, fillers, preservatives, solubilizers, vehicles, diluents and / or excipients may for instance be found in Remington: The Science and Practice of Pharmacy, 23rd edition. Elsevier (2020), incorporated herein by reference.

[0609] In an embodiment, a composition comprises the oligonucleotide of the invention and artificial cerebrospinal fluid as excipient. Artificial cerebrospinal fluid is a fluid that mimics the characteristics of human cerebrospinal fluid. Typically, it contains 150 mM Na, 3.0 mM K, 1.4 mM Ca, 0.8 mM Mg, 1.0 mM P, 155 mM Cl (Davson, H. Physiology of the Cerebrospinal Fluid, J. & A. Churchill, Ltd., London, 1967 and Biology Data Book, Volume III, 2nd ed., Fed. Am. Soc. Exper. Biol., Washington D.C., 1974).

[0610] A further compound may be present in the composition of this disclosure. Said compound may help in delivery of the composition, for example delivery to cell types as described elsewhere herein. Suitable compounds in this context are compounds capable of forming complexes, nanoparticles, micelles and / or liposomes. It is understood that these compounds are capable of delivering oligonucleotides and expression vectors as described herein, complexed or trapped in a vesicle or liposome, through a cell membrane. Many of these compounds are known in the art. Suitable compounds comprise polyethylenimine (PEI), or similar cationic polymers, including polypropyleneimine or polyethylenimine copolymers (PECs) and derivatives; synthetic amphiphiles (SAINT-18); lipofectinTM, DOTAP. A person of skill in the art will know which type of formulation is the most appropriate for a composition as described herein. In some embodiments, a composition as described herein is a liquid composition. In some embodiments, a composition as described herein is a solution. In some embodiments, the solution is an aqueous solution. In some embodiments, the solution is an isotonic aqueous solution. In some embodiments, a composition as described herein is a saline solution, preferably a buffered saline solution (for example a phosphate-buffered saline solution).

[0611] Compositions of this disclosure may be provided as dosage units, preferably single-use dosage units, for example in the form of a single-dose vial. A dosage unit, as used herein, refers to a physically discrete unit of the pharmaceutical composition appropriate for the patient undergoing treatment. The advantage of single use dosage units is that they can be formulated without the use of preservatives. The compositions may be provided as concentrated solutions and diluted before use. In some embodiments, a composition as described herein comprises an oligonucleotide as described herein at a concentration of from 0.1 mg / ml to 200 mg / ml, from 0.5 mg / ml to 100 mg / ml, from 0.5 mg / ml to 50 mg / ml, from 0.5 mg / ml to 10 mg / ml, or from 1 mg / ml to 10 mg / ml. In some embodiments, a composition as described herein is formulated for delivery to the CNS. In some embodiments, a composition as described herein is formulated for intravenous administration. In some embodiments, a composition as described herein is formulated for (direct or indirect) administration to the cerebrospinal fluid (CSF), heart or pancreas, preferably the CSF. Direct administration to the cerebrospinal fluid includes, for example, intrathecal administration and intracerebroventricular administration.

[0612] An aspect disclosed herein relates to an in vitro or an ex vivo method for editing a nucleotide comprised in a target nucleic acid comprised in a target nucleic acid in a cell, said method comprising contacting the cell with an oligonucleotide as described earlier herein, wherein the cell is a human cell, preferably a cell of the central nervous system.

[0613] Some more specific features of the target RNA comprising a protein-coding or a non-coding RNA, therapeutic target codons, and oligonucleotides are already described earlier herein.

[0614] In some embodiments, methods for deaminating a target adenosine in a target RNA encoding a protein in a cell as disclosed herein, are performed in vivo. In an embodiment, the protein encoded by the target RNA is a target protein, associated with a disease treatable with an oligonucleotide according to the invention. As used herein, the term 'a protein associated with a disease' refers to both a causative protein and an intermediary protein involved in regulating the causative variant. In preferred embodiments, methods for deaminating a target adenosine in a target RNA comprising a protein-coding RNA or a non-coding RNA in a cell as disclosed herein, are performed in vitro or ex vivo. In an embodiment, the protein encoded by the target RNA is a target protein, associated with a disease treatable with an oligonucleotide according to the invention. In other words, methods for deaminating a target adenosine in a target RNA comprising a protein-coding or a non-coding RNA in a cell as disclosed herein may be in vitro or ex vivo methods.

[0615] Methods for deaminating a target adenosine in a target RNA comprising a protein-coding RNA encoding a protein in a cell as disclosed herein are preferably performed on cells expressing MECP2 protein. Methods for deaminating a target adenosine in a target RNA comprising a protein-coding RNA encoding a protein in a cell as disclosed herein are therefore preferably performed on cells of the nervous system, and preferably on a cell of the Central Nervous System (e.g. a CNS cell). Central nervous system cells are preferably neurons. In an embodiment, the protein encoded by the target RNA is a target protein associated with a disease treatable with an oligonucleotide according to the invention.

[0616] The cells are preferably mammalian cells such as rodent cells (e.g. mouse or rat cells) or human cells, more preferably human cells.

[0617] In one embodiment, deamination of a target adenosine in a target RNA comprising a proteincoding RNA encoding a target protein according to the methods described herein is directed to a therapeutic target codon, which is a pre-mature stop codon. Said pre-mature stop codon occurs following C>T mutations, resulting in R168X, R270X, R294X codons, and preferably in a R255X codon. In some embodiments, methods of this disclosure will thus result in restoration of the full-length target protein in a cell. In some embodiments, methods of this disclosure will result in restoration of the full-length MECP2 protein in a cell. In other embodiments deamination of a target adenosine in a target RNA comprising a protein-coding RNA encoding a target protein according to the methods described herein leads to the restoration of a missense therapeutic target codon occurring as a result of G>A mutations. In some embodiments, methods for deamination of a target adenosine are directed to R106Q (CAA), W104X (UAG), and R306H (CAC) codons and lead to the restoration of MECP2 protein function.

[0618] In some embodiments, deamination of a target adenosine in a target RNA comprising a proteincoding RNA encoding a protein according to the methods described herein results in increased protein levels relative to an unedited state. In some embodiments, deamination of a target adenosine in a target RNA comprising a protein-coding RNA encoding a protein according to the methods described results in restoration of normal protein levels relative to an unedited state. In the context of the treatments described herein, the methods of the present invention allow for restoration of normal levels or at least near normal levels of protein expression and / or function relative to an untreated state.

[0619] In some embodiments, the increase in protein levels relative to an unedited state may be 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, 80%, 90% and preferably is 100%.

[0620] In some embodiments, the methods for deaminating a target adenosine in a target RNA comprising a protein-coding RNA encoding a protein (preferably a target protein) in a cell as disclosed herein further comprise a step of introducing the oligonucleotide into the cell. Methods for introducing nucleic acids or derivatives thereof into host cells are commonly known to the skilled person using standard molecular techniques, as discussed in standard handbooks such as Current Protocols in Molecular Biology (Ausubel et al.), 3rd edition (2003), John Wiley & Sons, Inc (US) (incorporated herein by reference) and Sambrook and Green, Molecular Cloning. A Laboratory Manual, 4th Edition (2012), Cold Spring Harbor Laboratory Press (incorporated herein by reference).

[0621] In some embodiments, the methods for deaminating a target adenosine in a target RNA comprising a protein-coding RNA encoding a protein in a cell as disclosed herein further comprise a step of identifying the presence of the inosine that results from deamination of the target adenosine. Means and methods for doing so are known to the skilled person. In some embodiments, identifying the presence of the inosine may involve sequencing of the target RNA. In some embodiments, identifying the presence of the inosine may involve sequencing of the target protein (e.g. using mass spectrometry). In some embodiments, the methods for deaminating a target adenosine in a target RNA comprising a protein-coding RNA encoding a protein in a cell as disclosed herein further comprise a step of identifying the presence of a truncated or dysfunctional target protein. Means and methods for doing so are known to the skilled person. In some embodiments, RNA sequencing might serve as a proxy for identifying the presence of a truncated or dysfunctional protein. In other embodiments, the identification of a truncated protein may involve western blotting with an antibody specific for the N- or C- terminus of the target protein.

[0622] Repeat oligonucleotide

[0623] In an embodiment, the oligonucleotides of this invention (comprising an internucleoside linkage as disclosed in formula (I), (II), (III), (IV), (V), (VI), (VII), (VIII) and / or (IX), preferably (VII) or (IX), comprise a sequence which binds (or is able to bind), targets, hybridizes to (or is able to hybridize to) and / or is reverse complementary to a specific sequence of a transcript of a gene which is known to be associated with or involved in a human cis-element repeat instability associated genetic central nervous system or neuromuscular disorder.

[0624] The instable repeat may also be called a repetitive element. Such repetitive element may be present in a RNA transcript having as repetitive nucleotide unit a repetitive nucleotide unit, which is selected from the (CAG)n, (CUG)n, (GCG)n, (CGG)n, (GAA)n, (GCC)n, (CCG)n, (AUUCU)n, (GGGGCC)n, (CCUG)n, (GGCCUG)n, (AUUUC)n, or (UGGAA)n. Such a transcript with such an instable repeat is called a mutant transcript or a target transcript or target RNA molecule.

[0625] A repeat or repetitive element or repetitive sequence or repetitive stretch is herein defined as a repetition of at least 3, 4, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000 or more, of a repetitive unit or repetitive nucleotide unit or repeat nucleotide unit (as (CAG)n, (CUG)n, (GCG)n, (CGG)n, (GAA)n, (GCC)n, (CCG)n, (AUUCU)n, (GGGGCC)n, (CCUG)n, (GGCCUG)n, (AUUUC)n, or (UGGAA)n), comprising a trinucleotide repetitive unit, or alternatively a 4, 5 or 6 nucleotide repetitive unit, in a transcribed gene sequence in the genome of a subject, including a human subject. Accordingly, n is an integer and may be at least 3, 4, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, ...

Claims

Claims1. An oligonucleotide comprising an internucleoside linkage represented by formula (IV):wherein L is a linear chain of 1 up to 6 units independently selected from -CH2-, -CHCH2-, -O-, -NH- or -N(CH3)-; wherein Xi and X3 are independently -O- or -S-; wherein X2 is -OH or -SH; wherein Z is a group comprising a non-hydrogen atom, preferably a nitrogen atom; wherein Z-NH is cationic under physiological conditions; and wherein is a bond to a nucleoside or to a terminal group.

2. An oligonucleotide according to claim 1 , wherein L is a linear chain of 1 up to 4 units and wherein Z comprises 1 up to 6 carbon atoms and 0 up to 4 nitrogen atoms, preferably wherein Z has a formula C1-6N0-4H1-10.

3. An oligonucleotide according to claim 1 or 2, wherein Z is -C(=NH)-NH2.

4. An oligonucleotide according to any one of claims 1-3 for use as a medicament.

5. An oligonucleotide for use as a medicament, comprising an internucleoside linkage represented by formula (I):wherein Xi and X3 are independently -O- or -S-; wherein X2 is -OH or -SH; wherein W is a group that is cationic under physiological conditions, and wherein is a bond to a nucleoside or to a terminal group.

6. An oligonucleotide according to claim 5, wherein W comprises 1 up to 10 carbon atoms and 1 up to 5 nitrogen atoms, preferably wherein W has a formula C1-10N1-5H1-15.

7. An oligonucleotide for use according to claim 5 or 6, wherein the internucleoside linkage represented by formula (I) is represented by formula (II):wherein L is a linear chain of 1 up to 10 units, preferably 1 up to 6 units, independently selected from -CH2-, -CHCH2-, -O-, -NH- or -N(CH3)-; and wherein Y is a group that is cationic under physiological conditions.

8. An oligonucleotide for use according to any one of claims 5-7, wherein L is a linear chain of 1 up to 6 units, preferably 1 up to 4 units, and wherein Y comprises 1 up to 10 carbon atoms and 1 up to 5 nitrogen atoms, more preferably wherein Y has a formula C1-10N1-5H1-10.

9. An oligonucleotide for use according to claim 7, wherein Y is -NH2 or -NH-C(=NH)-NH2.

10. An oligonucleotide for use according to claim 9, wherein Y is -NH-C(=NH)-NH2.

11. An oligonucleotide according to any one of claim 1 to 4, or an oligonucleotide for use according to any one of claims7 to 9 , wherein L is -CH2-CH2-.

12. An oligonucleotide or an oligonucleotide for use according to any one of the preceding claims, wherein the internucleoside linkage is represented by formula (VII) or (IX):

13. An oligonucleotide or an oligonucleotide for use according to any one of the preceding claims, wherein the internucleoside linkage is represented by formula (IX):

14. An oligonucleotide or an oligonucleotide for use according to any one of the preceding claims, wherein the length of said oligonucleotide is from 16 to 42 nucleotides.

15. An oligonucleotide or an oligonucleotide for use according to claim14 , wherein the oligonucleotide comprises 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 internucleoside linkages as defined in any one of claims 1 to 7 .

16. An oligonucleotide or an oligonucleotide for use according to any one of the preceding claims, wherein the efficiency of gymnosis of an oligonucleotide or of the oligonucleotide of use is improved compared to the efficiency of gymnosis of an oligonucleotide lacking any internucleoside linkage as identified in any one of claims 1 to 13 , but having otherwise the same sequence and preferably chemistry.

17. An oligonucleotide or an oligonucleotide for use according to any one of the preceding claims, wherein said oligonucleotide comprises 1 , 2, 3, 4, or 5 internucleoside linkage as defined in any one of claims 1 to 13 in at least one wing of said oligonucleotide, preferably in both wings of said oligonucleotide.

18. An oligonucleotide or an oligonucleotide for use according to claim 17, wherein said oligonucleotide comprises 1 up to 3 internucleoside linkages positioned at the 5’ and / or 3’ wing or terminus of the oligonucleotide.

19. An oligonucleotide or an oligonucleotide for use according to claim 18, wherein said oligonucleotide further comprises at least one internucleoside linkage positioned in the central portion of the oligonucleotide.

20. An oligonucleotide or an oligonucleotide for use according to any one of claims 17-19, wherein the internucleoside linkage is represented by formula (VII) or (IX).

21. An oligonucleotide or an oligonucleotide for use according to any one of the preceding claims, wherein said oligonucleotide is an antisense oligonucleotide and / or a single stranded oligonucleotide.

22. An oligonucleotide or an oligonucleotide for use according to any one of the preceding claims, wherein a nucleotide of said oligonucleotide is modified compared to an RNA nucleotide, preferably wherein said modification is selected from the group consisting of a modified base, a modified sugar and another modified internucleoside linkage than the one defined in any one of claims 1 to13 .

23. An oligonucleotide or an oligonucleotide for use according to claim 21 , wherein the modified base is 5-methylcytosine and / or 5-methyluracil, the modified sugar is 2-O’-methyl and / or the other modified internucleoside linkage is phosphorothioate.19424. An oligonucleotide or an oligonucleotide for use according to any one of the preceding claims, wherein said oligonucleotide is at least 90% reverse complementary with a region of a target transcript and / or remains in association to its target when there are up to 20% of mismatched nucleotides.

25. An oligonucleotide or an oligonucleotide for use according to any one of the preceding claims, wherein said oligonucleotide:- modulates, preferably reduces, a detectable amount of a mutant transcript and / or- modulates, preferably reduces, the translation rate of said mutant transcript and thus the amount of corresponding mutant protein and / or- induces the specific degradation of the mutant transcript, preferably wherein said oligonucleotide reduces or inhibits the amount of said mutant protein, and / or- is used for splicing modulation activities such as exon skipping or exon inclusion, and / or gene or RNA editing activities such as ADAR-recruiting activity, CRISPR, Retron Library Recombineering (RLR), Cas-CLOVER Nucleases, NgAgo protein gene editing, Zinc Finger Nucleases, FANA antisense oligonucleotide, Transcription activator-like effector nucleases (TALENs), and / or- gene activation activities, and / or wherein the oligonucleotides modulates, preferably increases, the amount of at least a transcript molecule, and / or at least a target protein and / or a target RNA.

26. An oligonucleotide or an oligonucleotide for use according to any one of the preceding claims, wherein the oligonucleotide is a gapmer.

27. An oligonucleotide or an oligonucleotide for use according to any one of the preceding claims, wherein the oligonucleotide comprises or consists of a base sequence represented by SEQ ID NOs: 1 , 211 , 212, 213, 214, 215, and 219.

28. An oligonucleotide or an oligonucleotide for use according to any one of the preceding claims, wherein the oligonucleotide comprises or consists of a sequence represented by SEQ ID NOs: 3-6, 93, 94, 96, 99-114, 116-131 , 133-148, 150-171 , 173-178, 217, and 218.

29. A composition comprising an oligonucleotide or an oligonucleotide for use according to any one of the preceding claims, preferably said composition comprising at least one excipient that may further aid in enhancing the targeting and / or delivery of said composition and / or said oligonucleotide to a tissue and / or cell and / or into a tissue and / or cell.19530. An oligonucleotide for use according to any one of claims 5-24 or a composition for use according to claim 29 for use in treating, delaying, ameliorating and / or preventing a human genetic disease.

31. An oligonucleotide for use or a composition for use according to claim 29, wherein administration of said oligonucleotide or composition is via an intravenous, subcutaneous, intraventricular, intrathecal, intramuscular, intranasal, enteral, intravitreal, intracerebral, epidural or oral route.

32. A method for treating, delaying, ameliorating and / or preventing a human genetic disease by administering an oligonucleotide as defined in any one of claims 1-26 or a composition as defined in claim 29 .

33. An oligonucleotide, preferably according to claim 25, for nucleic acid editing such as gene or RNA editing, said oligonucleotide comprising: a) an internucleoside linkage as defined in any one of claims 1-4 and 5-13 , b) a base sequence capable of hybridizing with a target region in a target nucleic acid, wherein the resulting hybridized duplex comprises an editing window, and c) a mismatch-forming nucleotide positioned within the editing window and opposite of a nucleotide to be edited34. An oligonucleotide according to claim 33 for use as a medicament.

35. An oligonucleotide or an oligonucleotide for use according to any one of claims 33 or 34, wherein the oligonucleotide comprises at least one conformationally restricted nucleotide (CRN).

36. An oligonucleotide or an oligonucleotide for use according to any one of claims33-35 , wherein the oligonucleotide comprises at least one internal CRN.

37. An oligonucleotide or an oligonucleotide for use according to any one of claims33-36 , wherein the oligonucleotide further comprises at least one CRN positioned at the 5’ and / or 3’ terminus of the oligonucleotide.

38. An oligonucleotide or an oligonucleotide for use according to any one of claims33-37 , wherein the CRN further comprises a modified base, preferably a 5-methylcytosine.19639. An oligonucleotide or an oligonucleotide for use according to any one of claims 33-38 wherein the CRN is a Bridged Nucleic Acid (BNA), and preferably wherein the BNA is a Locked Nucleic Acid (LNA).

40. An oligonucleotide or an oligonucleotide for use according to any one of claims 33-36, wherein the length of the oligonucleotide is from 26 to 50 nucleotides, preferably from 30 to 45 nucleotides, more preferably from 32 to 49 nucleotides, even more preferably from 37 to 41 nucleotides, most preferably 39 nucleotides.

41. An oligonucleotide or an oligonucleotide for use according to claim40 , wherein the oligonucleotide comprises at least 1 , 2, 3, 4, 5, 6, 7, 8, 9 or 10 internucleoside linkages as defined in any one of claims 1-4 or5-13 .

42. An oligonucleotide or an oligonucleotide for use according to any one of claims 33-41 , wherein the efficiency of gymnosis of the oligonucleotide or of the oligonucleotide for use is improved compared to the efficiency of gymnosis of an oligonucleotide lacking any internucleoside linkage as identified in any one of claims 1 -4 or 5-13 but having otherwise the same sequence and preferably chemistry.

43. An oligonucleotide or an oligonucleotide for use according to any one of claims33-42 , wherein the oligonucleotide is an antisense oligonucleotide and / or a single-stranded oligonucleotide.

44. An oligonucleotide or an oligonucleotide for use according to any one of claims33-43 , wherein the oligonucleotide, in addition to the mismatch-forming nucleotide, comprises a further non-complementary or a further modified nucleotide, preferably wherein the modified nucleotide is chemically modified.

45. An oligonucleotide or an oligonucleotide for use according to any one of claims33-44 , wherein the non-complementary nucleotide comprises a mismatch or a wobble base, and preferably is an inosine nucleotide, and wherein the chemically modified nucleotide comprises a modified base, more preferably 5-methylcytosine and / or 5-methyluracil, and / or a 2’ modification of the sugar ring, even more preferably 2-O’-methyl, and / or another modified internucleoside linkage, most preferably a phosphorothioate and / or a phosphoryl guanidine (PN) linkage.

46. An oligonucleotide or an oligonucleotide for use according to any one of claims33-45, wherein197the oligonucleotide comprises one or more phosphorothioate internucleoside linkages, preferably wherein the oligonucleotide comprises phosphorothioate internucleoside linkages between the most terminal two nucleotides at the 5’ terminus and / or between the most terminal two nucleotides at the 3’ terminus of the oligonucleotide, and / or the oligonucleotide comprises one or more phosphoryl guanidine (PN) internucleoside linkages, preferably wherein the phosphoryl guanidine (PN) is dimethylimidazolidin-2- ylidene (dmi) phosphoramidate (PN-dmi-phosphoramidate), optionally wherein the one or more phosphoryl guanidine (PN) internucleoside linkages occur between the first and second nucleotide in the 3’ position of the mismatch-forming nucleotide opposite of a target nucleotide47. An oligonucleotide or an oligonucleotide for use according to any one of claims33-46 , wherein the mismatch-forming nucleotide positioned opposite of a nucleotide to be edited comprises a cytosine base or a cytosine base analogue, wherein the cytosine base analogue is preferably a pyridine base, more preferably 6-amino-5 nitro-2(1 H)-pyridinone (Benner’s Z base), and wherein the uracil base analogue is a purine base, most preferably wherein the purine base is an N3-uridine.

48. An oligonucleotide or an oligonucleotide for use according to any one of claims33-47 , wherein the target nucleic acid is a protein-coding RNA or a non-coding RNA.

49. An oligonucleotide or an oligonucleotide for use according to any one of claims33-48 , wherein the target nucleic acid comprises an endogenous protein-coding MECP2 RNA encoding a human Methyl CpG Binding Protein 2 (MECP2).

50. An oligonucleotide or an oligonucleotide for use according to any one of claims 33-49 or a composition comprising said oligonucleotide for use in medicine, preferably for use in treating, inhibiting, and / or preventing a genetic disease associated or linked with a target nucleic acid, more preferably a disease of the central nervous system, even more preferably wherein the disease of the central nervous system is caused by mutations of the gene encoding MECP2 in a subject, and most preferably wherein the disease is Rett syndrome.51 . An in vitro or an ex vivo method for editing a nucleotide comprised in a target nucleic acid in a cell, said method comprising contacting the cell with an oligonucleotide, an oligonucleotide for use or a composition as described in any one of claims 33-50, wherein the cell is a human cell, preferably a cell of the central nervous system.198