Methods for generation of transgenic birds for producing recombinant proteins
A site-specific recombinase system efficiently integrates exogenous nucleic acid sequences into avian genomes, addressing inefficiencies in current transgenic bird production methods by enabling rapid development of multiple recombinant protein-expressing lines.
Patent Information
- Application Number
- PCT/US2025/054826
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2025-04-24
- Filing Date
- 2025-11-10
- Publication Date
- 2026-05-15
AI Technical Summary
Current methods for generating transgenic birds, such as chickens, are inefficient and time-consuming, requiring extensive breeding and selection processes, and cannot easily produce multiple lines expressing different recombinant proteins.
The use of a site-specific recombinase system, like Bxbl integrase, to integrate exogenous nucleic acid sequences into the avian genome, allowing for rapid and efficient insertion of recombinant DNA at defined loci, using CRISPR-Cas9 and other programmable nucleases, with selective markers for precise control of transgene expression.
This approach enables rapid generation of transgenic bird lines capable of producing multiple recombinant proteins in eggs, reducing the time required to develop new lines and eliminating the need for extensive breeding.
Smart Images

Figure US2025054826_15052026_PF_FP_ABST
Abstract
Description
[0001] Atorney Docket No.: 58851-0005W01
[0002] METHODS FOR GENERATION OF TRANSGENIC BIRDS FOR PRODUCING RECOMBINANT PROTEINS
[0003] CLAIM OF PRIORITY
[0004] This application claims the benefit of U.S. Provisional Patent Application Nos. 63 / 718,070, filed on November 8, 2024, and 63 / 793,762, filed on April 24, 2025. The entire contents of the foregoing are incorporated herein by reference.
[0005] SEQUENCE LISTING
[0006] This application contains a Sequence Listing that has been submitted electronically as an XML file named “58851-0005W01. XML.” The XML file, created on November 6, 2025, is 25,636 bytes in size. The material in the XML file is hereby incorporated by reference in its entirety.
[0007] BACKGROUND
[0008] Current methods for creating transgenic birds, e.g., chickens, involve manipulating primordial germ cells (PGCs), introducing desired genetic modifications into PGCs, and injecting these modified cells into embryos or adult birds. Subsequent breeding steps are necessary to produce female offspring that express recombinant proteins in eggs. Typically, recombinant protein expression is driven by integration into the endogenous Ovalbumin (OVA) gene locus or by using a recombinant Ovalbumin promoter sequence to target expression in the oviduct, leading to secretion of the protein into egg white.
[0009] These conventional methods rely on techniques such as CRISPR-Cas9-mediated insertion of each individual gene using homology-directed repair (HDR), which is inefficient and requires extensive selection and breeding. The entire process, from PGC manipulation to producing egg-laying transgenic birds, e.g., chickens, typically spans 18 months or longer. Additionally, generating each new line expressing a different recombinant protein requires repeating this complex and time-consuming workflow.
[0010] SUMMARY
[0011] Provided herein are methods of generating a transgenic animal that include (a) generating an exogenous nucleic acid sequence, (b) inserting the exogenous nucleic acid sequence into a genome of an animal, wherein the exogenous nucleic acid sequence Atorney Docket No.: 58851-0005W01 comprises a pair of site-specific recombinase recognition sequences, and wherein the exogenous nucleic acid sequence is inserted into the genome of the animal by using a geneediting agent, thereby generating a transgenic animal, and optionally (c) delivering a transgene and a recombinase to the transgenic animal, wherein the transgene is integrated into the genome of the animal at a site of the site-specific recombinase recognition sequence, and wherein expression of the transgene is under control of an endogenous promoter of the gene locus, thereby altering somatic cells of the transgenic animal.
[0012] In some embodiments, the exogenous nucleic acid sequence further comprises (i) an internal ribosome entry site (IRES), preferably wherein the IRES site is 3’ of the pair of sitespecific recombinase recognition sequences and within 25 nts of the start site of an endogenous gene, and / or (ii) a promoter region. In some embodiments, the promoter region comprises an egg specific promoter. In some embodiments, the pair of site-specific recombinase recognition sequences recognize a serine integrase or a CRE recombinase. In some embodiments, the pair of site-specific recombinase recognition sequences comprise attP / attB sites for Bxbl integrase.
[0013] In some embodiments, the exogenous nucleic acid sequence further comprises a selective marker gene. In some embodiments, the selective marker gene comprises a positive selection marker gene, a negative selection marker gene, or any combination thereof. In some embodiments, the positive selection marker gene comprises an antibiotic resistance gene, a fluorescent marker gene, or a cell surface marker. In some embodiments, the negative selection marker gene comprises Thymidine Kinase (TK) or Diphtheria Toxin (DT-A).
[0014] In some embodiments, the exogenous nucleic acid sequence further comprises a second pair of recombinase recognition sequences. In some embodiments, the second pair of recombinase recognition sequences is recognized by a tyrosine recombinase, a serine integrase, a DNA modifying enzyme, or any combination thereof.
[0015] In some embodiments, the gene-editing agent comprises CRISPR / Cas components. In some embodiments, the animal is an avian species. In some embodiments, the animal is a chicken, quail, duck, pigeon, goose, or turkey.
[0016] Also provided herein are methods of producing a recombinant protein in an egg from a transgenic animal that include (a) generating an exogenous nucleic acid molecule, (b) inserting the exogenous nucleic acid molecule into a genome of an animal, wherein the exogenous nucleic acid molecule comprises a pair of site-specific recombinase recognition sequences, and wherein the exogenous nucleic acid is inserted into the genome of the animal at a locus that encodes a gene expressed in the egg of the transgenic animal by using a gene- Atorney Docket No.: 58851-0005W01 editing agent, thereby generating a transgenic animal, (c) delivering a transgene and a recombinase to the transgenic animal, wherein the transgene is integrated into the genome of the animal at a site of the site-specific recombinase recognition sequence, wherein the transgene encodes the recombinant protein, and wherein expression of the transgene is under control of an endogenous promoter of the gene locus that expresses the gene in the egg of the transgenic animal, and (d) extracting the recombinant protein from the egg of the transgenic animal.
[0017] In some embodiments, the exogenous nucleic acid sequence further comprises an internal ribosome entry site (IRES). In some embodiments, the gene expressed in the egg of the transgenic animal is an ovalbumin or ovamucoid gene. In some embodiments, the pair of site-specific recombinase recognition sequences recognize a serine integrase or a CRE recombinase. In some embodiments, the pair of site-specific recombinase recognition sequences comprise attP / attB sites for Bxbl serine integrase, or 1OXP / LOX2272 sites for CRE recombinase.
[0018] In some embodiments, the exogenous nucleic acid sequence further comprises a selective marker gene. In some embodiments, the selective marker gene comprises a positive selection marker gene, a negative selection marker gene, or any combination thereof. In some embodiments, the positive selection marker gene comprises an antibiotic resistance gene, a fluorescent marker gene, or a cell surface marker. In some embodiments, the negative selection marker gene comprises Thymidine Kinase (TK) or Diphtheria Toxin (DT-A).
[0019] In some embodiments, the exogenous nucleic acid molecule further comprises a second pair of recombinase recognition sequences. In some embodiments, the second pair of recombinase recognition sequences is recognized by a tyrosine recombinase, a serine integrase, a DNA modifying enzyme, or any combination thereof.
[0020] In some embodiments, the gene-editing agent comprises CRISPR / Cas components. In some embodiments, the animal is an avian species. In some embodiments, the animal is a chicken.
[0021] In some embodiments, the transgene and the recombinase are delivered to the transgenic animal by using a viral vector, lipid nanoparticle, virus-like particle, or direct injection. In some embodiments, the viral vector comprises AAV, Adenovirus, or lentivirus. In some embodiments, the exogenous nucleic acid molecule comprises a promoter and a gene for a receptor for the viral vector used to deliver the transgene and the recombinase. In some embodiments, the transgene and the recombinase are delivered to an embryo, an egg, an adult, or sperm of the transgenic animal. Atorney Docket No.: 58851-0005W01
[0022] Also provided herein are methods of generating a transgenic bird, preferably a chicken, quail, or turkey, the method including (a) generating an exogenous nucleic acid sequence, wherein the exogenous nucleic acid sequence comprises a pair of site-specific recombinase recognition sequences and an internal ribosome entry site (IRES), (b) inserting the exogenous nucleic acid sequence into a genome of the bird, wherein the exogenous nucleic acid sequence is inserted into the genome of the bird at a chromosomal site located in or adjacent to an egg specific gene by using a gene-editing agent, thereby generating a transgenic bird, and optionally (c) delivering a transgene and a recombinase to the transgenic bird, wherein the transgene is integrated into the genome of the bird at a site of the sitespecific recombinase recognition sequence, and wherein expression of the transgene is under control of an endogenous promoter of the egg specific gene locus, thereby altering somatic cells of the transgenic animal.
[0023] In some embodiments, the egg specific gene is an Ovalbumin (OVA) gene. In some embodiments, the exogenous nucleic acid is inserted at the 3’ region of the endogenous Ovalbumin (OVA) gene, optionally in exon 1, intron 1, or the 5’ region of exon 2 before the start codon. In some embodiments, the pair of site-specific recombinase recognition sequences recognize a serine integrase or a CRE recombinase. In some embodiments, the pair of site-specific recombinase recognition sequences comprise attP / attB sites for Bxbl integrase.
[0024] In some embodiments, the exogenous nucleic acid sequence further comprises a selective marker gene. In some embodiments, the selective marker gene comprises a positive selection marker gene, a negative selection marker gene, or any combination thereof. In some embodiments, the positive selection marker gene comprises an antibiotic resistance gene, a fluorescent marker gene, or a cell surface marker. In some embodiments, the negative selection marker gene comprises Thymidine Kinase (TK) or Diphtheria Toxin (DT-A).
[0025] In some embodiments, the exogenous nucleic acid sequence further comprises a second pair of recombinase recognition sequences. In some embodiments, the second pair of recombinase recognition sequences is recognized by a tyrosine recombinase, a serine integrase, a DNA modifying enzyme, or any combination thereof. In some embodiments, the gene-editing agent comprises CRISPR / Cas components.
[0026] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Methods and materials are described herein for use in the present invention; other, suitable methods and materials known in the art can also be used. The materials, methods, Atorney Docket No.: 58851-0005W01 and examples are illustrative only and not intended to be limiting. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control.
[0027] Other features and advantages of the invention will be apparent from the following detailed description and figures, and from the claims.
[0028] BRIEF DESCRIPTION OF DRAWINGS
[0029] FIG. 1 is an exemplary schematic drawing of the workflow of generating genetically engineered primordial germ cells (PGCs) by inserting an exogenous nucleic acid sequence (“landing pad”) into the genome of an animal.
[0030] FIG. 2 shows results from Flow Cytometry sorting of PGCs containing a green fluorescent protein (GFP) marker. Scatterplots show individual cells being analyzed and selected for being viable, single cell, and with the highest GFP signal attached to Cas9. Plate map shows individual cells being deposited in each well of a 96-well plate.
[0031] FIG. 3 shows results from PCR analysis of expanded PGC clones. The presence of a knock- in (KI) construct creates a 1400 bp PCR product, and wild-type (WT) alleles a 500 bp product. CT40 Cl 2 is a positive control for correct integration. Cl 1-10 shows a WT amplicon, Cl 1-11 and 1-12 show both WT and knock-in amplicons, and is a heterozygous clone. Clone 2-5 is a homozygous clone, with only KI amplicons.
[0032] FIG. 4 shows results from PCR analysis of expanded PGC clones. The presence of a knock- in (KI) construct creates a 1400 bp PCR product, and wild-type (WT) alleles a 500 bp product. Clone 2-9 shows both WT and knock-in amplicons, and is a heterozygous clone. Clone 2-8 is a homozygous clone, with only KI amplicons.
[0033] FIG. 5 shows results from PCR analysis of expanded PGC clones. Here, the precise and correct integration of the KI construct is detected using primers spanning the 5’ and 3’ homology regions. A correctly integrated knock-in (KI) construct creates a 1989 bp amplicon at the 5’ region using primers 2075 and 2077, and a 1391 bp amplicon at the 3’ end using primers 1989 and 2080. Cl 2-8 and 2-9 show correct 5’ and 3’ integrations.
[0034] FIG. 6 is a graph showing copy number of landing pad in PGC clones. Quantitative PCR was used to detect the copy number of the IRES sequence in the landing pad. Clone 2-9 was previously shown to be a heterozygous knock-in and shows a copy number of near 1 (0.985). Atorney Docket No.: 58851-0005W01
[0035] Clone 2-8 was previously shown to be a homozygous knock-in and shows a copy number of near 2 (1.94).
[0036] FIG. 7 shows results from screening of gonads for landing pad integration. Gonads from 13 chicks born from embryos which were injected with PGC clones 1-11 or 2-25 were screened for the presence of the landing pad. The presence of the landing pad in the gonads is detected by the presence of a 1989 bp amplicon. All but two gonads show contribution of the edited PGCs.
[0037] FIG. 8 shows images of healthy PGCs selected for transfection.
[0038] FIG. 9 shows results from PCR genotyping of PGC clones. Correct knock-in of the landing pad generates a 4747 bp fragment, while the WT allele generates a 1391 bp fragment. In the left panel, clone G2 and D7 show the WT allele while clone E7 shows the knock-in allele. Right panel; clone C2-2 and C2-1 are heterozygous knock-ins, showing both the WT and KI amplicons.
[0039] DETAILED DESCRIPTION
[0040] The disclosure describes methods for generating transgenic bird (e.g., chicken, quail, duck, pigeon, goose, or turkey) lines by using a pre-engineered exogenous nucleic acid sequence ("landing pad" system) inserted into the genome of the animal that allows rapid and efficient integration of recombinant DNA at a specific genomic locus. These methods enable multiple cycles of transgene insertion without the need for repeated genome editing, selection, or extensive breeding. The use of site-specific recombinases, such as serine integrases (e.g., Bxbl), provides high-efficiency integration of transgenes at defined loci, overcoming the limitations of current genome editing approaches.
[0041] The exogenous nucleic acid sequences making up the landing pad can be inserted into the genome of the animal, e.g., into the endogenous ovalbumin locus in such a way as to retain expression of ovalbumin, using programmable nucleases such as CRISPR-Cas9, TALENs, or ZFNs. The landing pad contains specific recognition sequences for a recombinase, such as attP / attB sites for Bxbl, along with selectable markers for positive and negative selection. This system allows for the repeated introduction of different recombinant genes, driving their expression in the oviduct, where the encoded proteins are secreted into the egg white.
[0042] A number of different methods can be used for the introduction of an exogenous nucleic acid sequence into a host cell. Such methods include a variety of techniques such as Atorney Docket No.: 58851-0005W01 vector-mediated gene transfer (e.g., viral infection / transfection, or various other proteinbased or lipid-based gene delivery complexes) as well as techniques facilitating the delivery of “naked” polynucleotides (e.g., electroporation, “gene gun” delivery and various other techniques used for the introduction of polynucleotides). The nucleic acid sequence can be inserted into a host cell by a gene delivery molecule. Examples of gene delivery molecules can include, but are not limited to, liposomes, micelles biocompatible polymers, including natural polymers and synthetic polymers; lipoproteins; polypeptides; polysaccharides; lipopolysaccharides; artificial viral envelopes; metal particles; and bacteria, or viruses, such as baculovirus, adenovirus and retrovirus, bacteriophage, cosmids, plasmids, fungal vectors and other recombination vehicles typically used in the art which have been described for expression in a variety of eukaryotic and prokaryotic hosts, and may be used for gene therapy as well as for simple protein expression.
[0043] As one example, the recombinases and transgenes can be delivered into an animal genome by the use of various delivery methods that can include, but are not limited to, viral vectors (e.g., recombinant Adeno-Associated Virus (rAAV), Adenovirus), lipid nanoparticles (LNPs), virus-like particles (VLPs), or direct transfection into PGCs, embryos, or adult birds (e.g., chickens, turkeys, or quail). By employing this approach, transgenic bird lines can be generated in significantly shorter timeframes, and multiple lines expressing different recombinant proteins can be rapidly developed using the same engineered base line.
[0044] Various non-limiting aspects of these methods are described herein and can be used in any combination without limitation. Additional aspects of various components of the methods described herein are known in the art.
[0045] It must be noted that, as used in the specification and the appended claims, the singular forms “a,” “an” and “the” include plural referents unless the context clearly dictates otherwise.
[0046] As used herein, the terms “about” and “approximately,” when used to modify an amount specified in a numeric value or range, indicate that the numeric value as well as reasonable deviations from the value known to the skilled person in the art. Unless otherwise specified, about means ± 10% of the recited value.
[0047] Methods of Generating a Transgenic Animal
[0048] Provided herein are methods of generating a transgenic animal that include (a) generating an exogenous nucleic acid sequence, (b) inserting the exogenous nucleic acid Atorney Docket No.: 58851-0005W01 sequence into a genome of an animal, wherein the exogenous nucleic acid sequence comprises a pair of site-specific recombinase recognition sequences, wherein the exogenous nucleic acid sequence is inserted into the genome of the animal by using a gene-editing agent, thereby generating a transgenic animal, and optionally (c) delivering a transgene and a sitespecific recombinase to the transgenic animal, wherein the transgene is integrated into the genome of the animal at a site of the site-specific recombinase recognition sequences, and wherein expression of the transgene is under control of an endogenous promoter of the gene locus, thereby altering somatic cells of the transgenic animal.
[0049] In some embodiments, the exogenous nucleic acid sequence comprising the pair of site-specific recombinase recognition sequences is referred to herein as a “landing pad,” wherein a “landing pad” refers to a site-specific recognition sequence or a site-specific recombination site (e.g., an attP site) that is stably integrated into the genome of a host cell. In some embodiments, presence in the host genome of the heterologous site-specific recombination sequence allows a recombinase (e.g., bxbl integrase) to mediate site-specific insertion of a transgene into the host genome.
[0050] Exogenous Nucleic Acid (“Landing Pad”) Integration
[0051] In some embodiments, an exogenous nucleic acid comprises a pair of site-specific recombinase recognition sequences, wherein the exogenous nucleic acid is introduced into the genome of the animal by using a gene-editing agent.
[0052] In some embodiments, the exogenous nucleic acid sequence further includes a promoter region. In some embodiments, the promoter region is positioned between the pair of site-specific recombinase recognition sequences. In some embodiments, the promoter region comprises an egg specific promoter. In some embodiments, the promoter comprises an OVAL promoter. In some embodiments, the promoter region comprises a germline specific promoter.
[0053] In some embodiments, the pair of site-specific recombinase recognition sequences recognizes a tyrosine recombinase or serine recombinase (e.g., phage integrases such as integrases from phages phiC31, R4, and TP-901). Examples of tyrosine recombinases can include tyrosine integrases (e.g., integrases from , HK022, P22, HP1 and L5) and other tyrosine recombinases (e.g., Cre and Flp). Examples of serine recombinases include serine integrases (e.g., integrases from phiC-31, R4, TP901) and other serine recombinases (e.g., y5, Tn3, phage Mu recombinase). In some embodiments, the pair of site-specific recombinase Atorney Docket No.: 58851-0005W01 recognition sequences recognizes a serine integrase. In some embodiments, site-specific recombinases can include integrases that mediate site-specific recombination between two different DNA recognition sequences, the phage attachment site, attP, and the bacterial attachment site, attB. In some embodiments, the site-specific recombinase recognition sequences comprise attP / attB sites for Bxbl integrase.
[0054] In some embodiments, the exogenous nucleic acid sequence further includes a selective marker gene. In some embodiments, a selective marker gene comprises a positive selection marker gene, a negative selection marker gene, or any combination thereof. In some embodiments, a positive selection marker can be used to identify cells into which the vector has stably integrated, wherein the positive selection marker gene can comprise an antibiotic resistance gene, a fluorescent marker gene, or a cell surface marker. For example, the positive selection marker gene can include an antibiotic resistance gene for neomycin, blasticidin, hygromycin and zeocin. In some embodiments, a positive selection marker gene is a fluorescent marker gene, e.g., encoding enhanced green fluorescent protein, and is used to identify cells into which the nucleic acid sequence has stably integrated (e.g., by using fluorescently activated cell sorting, FACS).
[0055] In some embodiments, a negative selection marker gene (e.g., a suicide gene) serves to eliminate cells that have randomly integrated the vector sequence while retaining cells that have undergone homologous recombination at the desired location. In some embodiments, the negative selection marker gene comprises Thymidine Kinase (TK) or Diphtheria Toxin (DT-A). In some embodiments, a negative selection marker gene is a fluorescent marker gene, encoding cyan fluorescent protein, and is used to identify cells (e.g., by FACS) that have randomly integrated the vector sequence.
[0056] In some embodiments, the insertion of the exogenous nucleic acid into the genome of an animal comprises using a gene-editing agent. As used herein, a “gene-editing agent” can refer to an agent that can target and bind to a specific sequence in DNA. In some embodiments, a gene-editing agent comprises CRISPR / Cas components.
[0057] As used herein, the term “CRISPR” refers to a technique of sequence specific genetic manipulation relying on the clustered regularly interspaced short palindromic repeats pathway, which unlike RNA interference regulates gene expression at a transcriptional level. As used herein, a “Cas effector” or “CRISPR-associated protein” can refer to an enzyme or protein that uses CRISPR sequences as a guide to recognize and cleave specific nucleic acid strands that are complementary to the CRISPR sequence. A gene-editing Cas effector can associate with a CRISPR RNA sequence to bind to, and alter DNA or RNA target sequences. Atorney Docket No.: 58851-0005W01
[0058] In some embodiments, the gene-editing agent comprises a gene-editing Cas effector. In some embodiments, the gene-editing Cas effector comprises a Cas9 protein, a Casl3b protein, or a Casl3d protein. In some embodiments, the gene-editing agent further comprises a guide RNA (gRNA), wherein the gRNA is targeted to an individual gene of a cell. The term “guide RNA” or “gRNA” typically combines tracrRNA (transactivating RNA), which binds to Cas9 to activate the complex to create the necessary strand breaks, and crRNA (CRISPR RNA), comprising complimentary nucleotides to the tracrRNA, into a single guide RNA construct. Exemplary methods of employing the CRISPR technique are described in WO 2017 / 091630, which is incorporated by reference in its entirety.
[0059] In some embodiments, a transgenic animal described herein can be produced by integrating an exogenous nucleic acid into the genome. In some embodiments, a transgenic animal can be produced by integrating a transgene into a chromosomal landing pad that has already been inserted into the genome as described herein. In some embodiments, the transgenic animal is an avian species. In some embodiments, the transgenic animal is a chicken, a quail, or a turkey.
[0060] The landing pad described herein is designed to be inserted into a specific locus in the avian genome. This could be, for example, the ovalbumin or ovamucoid gene loci, to target expression of proteins to egg white, or the Albumin or transferrin locus to target the egg yolk. This insertion can be accomplished using programmable nucleases like CRISPR-Cas9, TALENs, or ZFNs, with the aid of homology-directed repair or other genome editing mechanisms. The repair template can be a single stranded DNA template, a double stranded DNA template or a circular template and can contain short (~50 nt) or longer (-500 nt) homology arms. Alternatively, the landing pad may be introduced via prime editing or other RNA-guided DNA repair methods.
[0061] The landing pad typically comprises recognition sequences for site-specific recombinases (e.g., attP / attB sites for Bxbl) and may include positive selection markers such as antibiotic resistance genes (e.g., Neomycin, Ampicillin, Hygromycin), fluorescent proteins (e.g., GFP, RFP), or cell surface markers. Negative selection markers (e.g., Thymidine Kinase (TK), Diphtheria Toxin (DT-A)) may also be included to eliminate undesired integration events. In some embodiments, the landing pads may contain sequences recognized by other recombinases, such as tyrosine recombinases (such as Cre, Flp), other serine integrases (such as phiC31, phiBTl, Al 18, TP901-1), or other DNA modifying enzymes. Atorney Docket No.: 58851-0005W01
[0062] In some embodiments, landing pads may be designed to increase transduction efficiencies by creating cell type-specific overexpression of viral receptors, for example the AAV receptor AAVR (also known as KIAA0319L), or the Adenovirus receptor CAR. AAVR or CAR could be expressed downstream of an egg specific promoter, such as the OVAL promoter, or fused, for example via a 2A peptide, to an egg specific gene, such as the OVAL gene, for example to increase transduction efficiency in the avian oviduct. In some cases, the viral receptor, such as AAVR or CAR, could be expressed downstream of a germline specific promoter, for example that of the DAZL gene, or fused via a 2A-peptide to such a germline specific gene, to increase transduction efficiencies in PGCs circulating in the bloodstream or in the gonad.
[0063] Preferably the landing pad is integrated into the ovalbumin gene (see, e.g., NCBI RefSeq ID NC 052533.1) such that translation from the native OVAL locus is maintained, i.e., the landing pad sequence is designed as not to disrupt translation from the ovalbumin transcript driven from the IRES site replacing the native Kozak sequence. For example, the landing pad can be integrated into exon 1 (nts 1-47 of NCBI RefSeq ID NC 052533.1), intron 1 (nts 48-1636 of NCBI RefSeq ID NC_052533.1), or (most preferably) exon 2 (1637- 1821 of NCBI RefSeq ID NC 052533.1) of the ovalbumin locus, 5’ of the start codon (nts 1654-1656 of NCBI RefSeq ID NC 052533.1), with a sequence (e.g., Internal Ribosome Entry Site (IRES) or 2A peptide sequence) that allows translation of a second gene immediately upstream (e.g., within 25, 20, 15, 10, or 5 nucleotides) of the ovalbumin start codon. Thus, the IRES sites enabled bicistronic translation from a single transcript containing both the inserted transgene after recombination and the native ovalbumin gene. As an alternative to the IRES site, P2A / T2A peptides can be used.
[0064] Alternatively, the landing pad can be placed in the 3’ UTR of the ovalbumin gene, e.g., in exon 8. In this construct, the IRES or P2A / T2A peptide sequence is between the 3’ end of the ovalbumin gene and the 5’ end of the transgene after recombination, again allowing for multi ci str onic translation of both the ovalbumin and the transgene.
[0065] Recombinase-Mediated Transgene Integration
[0066] In some embodiments, the transgene integrated into the genome of an animal can encode any protein or polypeptide useful in industrial or therapeutic applications. Examples of such polypeptides and proteins can include, but are not limited to, enzymes (e.g., proteases, phospholipases), protease inhibitors, hormones (e.g., pituitary hormones), growth factors, Atorney Docket No.: 58851-0005W01 cytokines, chemokines, chemotactins, gonadotrophins, lipid-binding proteins, and immunoglobulins or antibodies. In some embodiments, the polypeptides and proteins of interest can comprise antimicrobial polypeptides (e.g., antibacterial, antifungal, antiviral, and / or antiparasitic polypeptides), and antibodies or antigen-binding antibody fragments thereof.
[0067] In some embodiments, once the landing pad is integrated, site-specific recombinases such as Bxbl can mediate efficient and precise integration of a transgene at the landing pad. Recombinase-mediated integration eliminates the need for the inefficient homology-directed repair (HDR) process typically required by CRISPR-based methods, providing highly predictable and consistent transgene insertion. This approach allows for rapid generation of transgenic lines by integrating the desired gene encoding a recombinant protein into the defined locus.
[0068] Method of Producing a Recombinant Protein from a Transgenic Animal
[0069] The methods described herein can be used to produce a recombinant protein in an egg from the transgenic animal, wherein the methods further include extracting the recombinant protein from the egg of the transgenic animal.
[0070] Protein Secretion in Eggs
[0071] In some embodiments, an egg can be a suitable medium for expression of recombinant proteins. The egg white is poor in lipids, in inorganic ions and carbohydrates and is composed mainly of water and proteins in solution. Egg white proteins include five proteins accounting for the majority (e.g., ovalbumin, conalbumin, ovomucoid, ovomucin a and b and lysozyme), alone accounting for nearly 83-84% of all proteins in the white, wherein all proteins in the egg white are generated by cells in the oviduct, at the magnum. The egg yolk consists essentially of an accumulation of lipids in the form of lipoproteins, wherein other components (e.g., cholesterol, vitamins and liposoluble pigments) are minority. Unlike proteins in the white, all proteins and components of the yolk are synthesized by the liver and are transported by blood circulation and accumulate in the yolk during the development of follicles.
[0072] In some embodiments, the integrated transgene is expressed in the oviduct cells of transgenic birds (e.g., chickens, quail, or turkeys), leading to the secretion of the recombinant protein into the egg white or yolk, depending on the promoter and insertion site used. In some Atorney Docket No.: 58851-0005W01 embodiments, the transgene can target different loci (e.g., Ovalbumin, Ovomucoid, Albumin, Ovotransferrin, Lysozyme, or Apolipoproteins, Ovomucin, Avidin, APOB, APOA1 or APOE, Livetin, Phosvitin) of the avian genome for harvesting the recombinant protein from the egg white or egg yolk.
[0073] Multiple Protein Production with Multiple Recombinase Sites
[0074] In some embodiments, the landing pad design can accommodate multiple rounds of recombinase-mediated integration, allowing for the production of different recombinant proteins in the same transgenic line. In some embodiments, the production of a plurality of different recombinant proteins is achieved by incorporating additional recombinase recognition sites (e.g., attP / attB, LoxP) into the landing pad, enabling successive alterations to the transgene locus. In some embodiments, positive selection markers can be excised using Cre recombinase to allow for further modifications.
[0075] In some embodiments, the landing pad comprises a plurality of recombinase recognition sites specific to different recombinases, arranged in a predetermined configuration to enable sequential or simultaneous modification of the integrated landing pads post-integration. In one embodiment, selection markers are flanked by LoxP sites, permitting their targeted excision through the application of Cre recombinase. In another embodiment, the landing pad is inserted at the 3' region of the endogenous Ovalbumin (OVA) gene, with LoxP sites positioned both upstream and downstream of the OVA gene, thereby enabling complete excision of the endogenous OVA gene in a cell, zygote, or whole organism, upon recombinase-mediated activity.
[0076] Delivery Methods
[0077] The recombinase and transgene can be delivered to target cells by various means, including viral vectors (e.g., AAV, Adenovirus, or lentivirus), lipid nanoparticles, or direct injection into embryos, adult birds, or sperm. For instance, AAV or Adenovirus delivery into the bloodstream of a developing embryo or adult bird can facilitate integration of the recombinant protein cDNA into the OVAL locus, enabling rapid expression of the protein in eggs.
[0078] Infection of cells with a viral vector containing a nucleic acid has the advantage that a large proportion of the targeted cells can receive the nucleic acid. Additionally, molecules Atorney Docket No.: 58851-0005W01 encoded within the viral vector, e.g., by a cDNA contained in the viral vector, are expressed efficiently in cells that have taken up viral vector nucleic acid.
[0079] Retrovirus vectors and adeno-associated virus vectors can be used as a recombinant gene delivery system for the transfer of exogenous genes. These vectors provide efficient delivery of genes into cells, and the transferred nucleic acids are stably integrated into the chromosomal DNA of the host cell. Protocols for producing recombinant retroviruses and for infecting cells in vitro with such viruses can be found in Ausubel, et al., eds., Current Protocols in Molecular Biology, Greene Publishing Associates, (1989), Sections 9.10-9.14, and other standard laboratory manuals. Examples of suitable retroviruses include pLJ, pZIP, pWE and pEM which are known to those skilled in the art. Examples of suitable packaging virus lines for preparing both ecotropic and amphotropic retroviral systems include 'PCrip, TCre, T2 and Am. Retroviruses have been used to introduce a variety of genes into many different cell types, including epithelial cells, in vitro (see for example Eglitis, et al. (1985) Science 230: 1395-1398; Danos and Mulligan (1988) Proc. Natl. Acad. Sci. USA 85:6460- 6464; Wilson et al. (1988) Proc. Natl. Acad. Sci. USA 85:3014-3018; Armentano et al. (1990) Proc. Natl. Acad. Sci. USA 87:6141-6145; Huber et al. (1991) Proc. Natl. Acad. Sci. USA 88:8039-8043; Ferry et al. (1991) Proc. Natl. Acad. Sci. USA 88:8377-8381; Chowdhury et al. (1991) Science 254: 1802-1805; van Beusechem et al. (1992) Proc. Natl. Acad. Sci. USA 89:7640-7644; Kay et al. (1992) Human Gene Therapy 3:641-647; Dai et al. (1992) Proc. Natl. Acad. Sci. USA 89: 10892-10895; Hwu et al. (1993) J. Immunol. 150:4104-4115; U.S. Patent No. 4,868,116; U.S. Patent No. 4,980,286; PCT Application WO 89 / 07136; PCT Application WO 89 / 02468; PCT Application WO 89 / 05345; and PCT Application WO 92 / 07573).
[0080] Another viral gene delivery system useful in the present methods utilizes adenovirus- derived vectors. The genome of an adenovirus can be manipulated, such that it encodes and expresses a gene product of interest but is inactivated in terms of its ability to replicate in a normal lytic viral life cycle. See, for example, Berkner et al., BioTechniques 6:616 (1988); Rosenfeld et al., Science 252:431-434 (1991); and Rosenfeld et al., Cell 68: 143-155 (1992). Suitable adenoviral vectors derived from the adenovirus strain Ad type 5 dl324 or other strains of adenovirus (e.g., Ad2, Ad3, or Ad7 etc.) are known to those skilled in the art. Recombinant adenoviruses can be advantageous in certain circumstances, in that they are not capable of infecting non-dividing cells and can be used to infect a wide variety of cell types, including epithelial cells (Rosenfeld et al., (1992) supra). Furthermore, the virus particle is relatively stable and amenable to purification and concentration, and as above, can be Atorney Docket No.: 58851-0005W01 modified so as to affect the spectrum of infectivity. Additionally, introduced adenoviral DNA (and foreign DNA contained therein) is not integrated into the genome of a host cell but remains episomal, thereby avoiding potential problems that can occur as a result of insertional mutagenesis in situ, where introduced DNA becomes integrated into the host genome (e.g., retroviral DNA). Moreover, the carrying capacity of the adenoviral genome for foreign DNA is large (up to 8 kilobases) relative to other gene delivery vectors (Berkner et al., supra; Haj-Ahmand and Graham, J. Virol. 57:267 (1986)).
[0081] Yet another viral vector system useful for delivery of nucleic acids is the adeno- associated virus (AAV). Adeno-associated virus is a naturally occurring defective virus that requires another virus, such as an adenovirus or a herpes virus, as a helper virus for efficient replication and a productive life cycle. (For a review see Muzyczka et al., Curr. Topics in Micro. And Immunol.158:97-129 (1992). It is also one of the few viruses that may integrate its DNA into non-dividing cells and exhibits a high frequency of stable integration (see for example Flotte et al., Am. J. Respir. Cell. Mol. Biol. 7:349-356 (1992); Samulski et al., J. Virol. 63:3822-3828 (1989); and McLaughlin et al., J. Virol. 62: 1963-1973 (1989). Vectors containing as little as 300 base pairs of AAV can be packaged and can integrate. Space for exogenous DNA is limited to about 4.5 kb. An AAV vector such as that described in Tratschin et al., Mol. Cell. Biol. 5:3251-3260 (1985) can be used to introduce DNA into cells. A variety of nucleic acids have been introduced into different cell types using AAV vectors (see for example Hermonat et al., Proc. Natl. Acad. Sci. USA 81 :6466-6470 (1984); Tratschin et al., Mol. Cell. Biol. 4:2072-2081 (1985); Wondisford et al., Mol. Endocrinol. 2:32-39 (1988); Tratschin et al., J. Virol. 51 :611-619 (1984); and Flotte et al., J. Biol. Chem. 268:3781-3790 (1993).
[0082] Applications
[0083] The methods described herein can be used in the production of a wide range of recombinant proteins, including therapeutic proteins, enzymes, growth factors, and vaccines. They can also be used to rapidly generate novel bird lines for commercial breeding applications, such as those that include improved features for food and agriculture. They can also be used to rapidly generate novel avian lines as animal models, or for polyclonal antibody production. Atorney Docket No.: 58851-0005W01
[0084] EXAMPLES
[0085] The disclosure is further described in the following examples, which do not limit the scope of the disclosure described in the claims.
[0086] Example 1 - Landing pad comprising two heterologous attP sites matching the Bxbl recombinase’s recognition site
[0087] The design of this first landing pad comprises dual heterologous attP site alleles, in cis, separated by a 200 bp spacer of randomly chosen intron DNA sequence, in this case intron 5 of the ovalbumin gene. The attP sites enable Bxbl -mediated recombination where the minimal attachment site of 48 bp attP integrated in the genome of the chicken recombines with a 38 bp site attB in the donor DNA. After Bxbl recombination, a half-site from each attP and attB remains, yielding two 43 bp sites (attL and attR, Left and Right) flanking the inserted DNA.
[0088] Bxbl integrase was selected as it was shown to have the highest efficiency and accuracy of fifteen recombinases (Xu, Z. et al. BMC Biotechnol . 2013 Oct 20: 13:87). Here, two heterologous versions of the attP and attB sites were utilized. The attP-GA site is identical to the wild type attP-GT with the exception of the central GT dinucleotide, which is replaced by GA in attP-GA. This single base pair change restricts recombination solely to that between attP-GT and attB-GT; and between attP-GA and attB-GA. The reason for choosing a dual heterologous attP site strategy is that the donor vector (plasmid, viral vector or linear DNA) can now be designed with two heterologous attB sites in cis, to integrate by Recombination Mediated Cassette Exchange (RMCE), leading to excision and loss of the vector backbone and directional integration of the construct (Low et al., Set Rep. 2022 Mar 31 ; 12(1):5424.) The use of a single attP site, or of two identical attP sites in cis can also lead to correct integration but does not exclude the possibility of integration of the vector backbone or the integration in reverse orientation.
[0089] The 200 bp spacer between the heterologous attP sites reduces steric hindrance and allows the Bxbl enzyme to complex with both attP / attB sites simultaneously. This could be shorter or longer, but a shorter sequence increases the risk of steric hindrance while a longer sequence increases the risk of transcript instability leading to reduced translation. Here, the 200 bp spacer contains intronic sequence from the ovalbumin gene, intron 5. A sequence from the middle of an intron was used, to make sure no splicing signals were present. While other introns of the ovalbumin gene contain transcription factor binding sites or estrogen Atorney Docket No.: 58851-0005W01 response elements, intron 5 does not and is a safer choice. Several ATG sites in the intronic sequence were edited to avoid alternative start codons.
[0090] The second exon of the chicken ovalbumin locus was selected to integrate the landing pad. The first exon is part of the 5’ untranslated region, and the start codon of the ovalbumin gene is present in the second exon. The landing pad was integrated in between the start of the second exon and the start codon.
[0091] Previous studies where transgenes were knocked into the ovalbumin locus have traditionally disrupted the translation of the ovalbumin gene. In case of a heterozygous insertion, the wild type ovalbumin allele is still present, but when the transgene is inserted homozygous or bred to homozygosity, then no ovalbumin protein would be produced. This lack of ovalbumin can lead to smaller, misshapen eggs, and can make these eggs infertile. To enable homozygous expression of the transgene without disrupting egg shape or fertility, the construct was designed such that ovalbumin translation from the native locus is initiated from an added Internal Ribosome Entry Site (IRES) between the landing pad and the ovalbumin start codon. Before recombination with a donor transgene, the landing pad sequence is designed as not to disrupt translation from the ovalbumin transcript driven from the IRES site replacing the native Kozak sequence. Additionally, the IRES sites enabled bicistronic translation from a single transcript containing both the inserted transgene after recombination and the native ovalbumin gene.
[0092] The efficiency of an IRES site to initiate translation of the following open reading frame is highest if the distance to the start codon is the shortest. For that reason, the IRES site was placed outside of the attP sites, immediately adjacent (5’) to the start codon, as opposed to the alternative of the IRES site being part of the donor template and internal to the attP sites, in which case the 43 bp attR site created after recombination would separate the IRES from the start codon.
[0093] Alternative positions for the landing pad are in exon 1 or intron 1 of the ovalbumin locus. When placed in exon 1, the landing pad will be part of the transcribed sequence, similarly to its current place in exon 2, but this option was rejected because it would increase distance between the IRES and start codon. When placed in intron 1, the landing pad would be spliced out and would not remain part of the transcript. In this scenario, the donor template with the transgene would need to contain a splice acceptor site 5’ of the transgene to ensure it remains part of the transcript after transgene integration. While this scenario is less disruptive to the ovalbumin locus before transgene insertion, it was rejected because this structure Atorney Docket No.: 58851-0005W01 would again create a larger distance between the IRES site and the translation initiation site of ovalbumin.
[0094] Alternatively, the landing pad can be placed in the 3’ UTR of the ovalbumin gene, in exon 8. In this construct, the IRES or P2A / T2A peptide sequence would connect the 3’ end of the ovalbumin gene with the 5’ end of the transgene, after recombination. This construct was rejected because the efficiency of translation of the protein following the IRES site is typically reduced to half of that of the first protein or less, and higher production of the transgene was chosen.
[0095] To integrate the landing pad into the correct location of the chicken genome, the construct is flanked by two homology regions. While a range of different lengths are suitable to direct homology directed integration of the construct, 500 bp lengths were chosen for each of the homology regions.
[0096] To increase the efficiency of integration of the landing pad into the genomic locus, a selection marker such as a fluorescent protein or an antibiotic resistance marker driven by their own promoter can be placed in between the attP sites of the landing pad. Following integration of the landing pad, cells can be selected for using antibiotics added to the culture medium, selecting for those cells with the landing pad inserted into the genome. A fluorescent marker allows for bulk or single cell sorting of fluorescent cells. An added advantage is that these fluorescent cells can be sorted after recombination for the absence of fluorescence, because successful RMCE would excise the fluorescent protein and replace it with the transgene.
[0097] To integrate the landing pad into the genome and create transgenic chickens, the standard workflow of editing and injecting Primordial Germ Cells (PGCs) was employed (FIG. 1). It consists of the following steps, following standard protocols for generation of transgenic chickens using PGCs (see, e.g., Van de Lavoir, et al. 2006, Schusser, et al 2013, Idoko-Akoh & McGrew 2023):
[0098] 1. Integrate construct into genome of PGCs in PGC culture
[0099] Primordial Germ Cells were isolated from early-stage embryos, cultured and expanded. PGCs can be freshly isolated or grown from a previously frozen culture. Using chemical transfection or electroporation, the construct consisting of the landing pad and flanking homologous regions was inserted into PGCs without or with a targeted nuclease such as Cas9, OpenCRISPR, TALEN, ZFN. Atorney Docket No.: 58851-0005W01 PGCs with successful integration
[0100] Transfected PGCs were isolated monoclonally through limited dilutions or using an automated cell sorter. When a nuclease tagged with a fluorescent protein is used, cells with high fluorescence can be selected for to enrich for nuclease activity and landing pad integration (FIG. 2). ansion of single cell clones
[0101] Single cell clones were expanded, and genotypes were confirmed by PCR analysis. Genomic DNA was collected from expanded clones and PCR primers designed to detect correct insertion of the landing pad construct. Primers were designed outside of the homologous regions and inside of the landing pad. First, the presence of the transgene was detected with a primer pair inside the landing pad.
[0102] Next, primers were paired to amplify across the homologous regions so that amplicons were generated only when the construct was correctly integrated, and the primers outside of the homologous regions aligned with those inside of the landing pad (FIGs. 3-6). GCs into fertilized eggs
[0103] Fertilized eggs were collected, incubated for about 65 hours until the embryo has developed to Hamburger and Hamilton stage 14-16
[0104] Eggs were opened and transferred to a dish (a small window can also be cut into the egg). About 500 to 3000 PGCs were injected into the vascular system of the developing embryo, the egg was transferred to a surrogate shell (e.g. duck or turkey), and sealed (the small window can also be sealed). The eggs were then incubated to hatch. ng gonads for integration of Landing Pad PGCs
[0105] A sample of putative chimeric chicks were euthanized and their gonads were collected. PCR was used to detect the presence of the landing pad (FIG. 7).ing roosters are reared to sexual maturity germline chimeras
[0106] Analyze sperm of roosters by PCR to identify chimeric animals that contain the transgene in the germ line cells. rmline chimeric roosters with WT hens fully transgenic offspring Atorney Docket No.: 58851-0005W01
[0107] Analyze DNA isolated from feathers, blood or saliva by PCR to identify transgenic offspring. Alternatively, when PGCs with the landing pad integrated were chosen from a different breed, these alternate breed characteristics (e.g. leg or feather color) can be used to identify the transgenic offspring.
[0108] 10. Rear to sexual maturity
[0109] 11. Mate transgenic gl to produce homozygous g2
[0110] Analyze DNA isolated from feathers, blood or saliva by PCR to identify offspring with homozygous (biallelic) integration of the landing pad.
[0111] Animals or embryos with a monoallelically or biallelically integrated landing pad can then be exposed to a donor template containing a transgene and recombinase to integrate the donor template into the genomic locus.
[0112] The recombinase can be stably integrated into the genome and be constitutively expressed or be temporarily expressed using an inducible promoter system such as antibiotic or tamoxifen activated promoters driven by exposure of the egg or animal to these compounds; or inducible systems driven by temperature changes such as heat-shock proteins; or by light-induced promoters. When the recombinase is not integrated into the genome of the animal, it can be delivered simultaneously with the donor template or separately. The recombinase can be delivered as protein, RNA or DNA, as linear or circular DNA, part of a plasmid, or a viral vector.
[0113] The donor template consists of the coding sequence of a transgene flanked by two heterologous versions of the attB site. The attB-GA site is identical to the wild type attB-GT with the exception of the central GT dinucleotide, which is replaced by GA in attB-GA. This single basepair change restricts recombination solely to that between attP-GT and attB-GT; and between attP-GA and attB-GA.
[0114] The delivery of the donor and / or recombinase to an adult hen is only effective in causing expression of the transgene in the eggs of that animal if it is able to insert the transgene in the landing pad locus of the genome of oviductal epithelial cells, which produce the egg white in ovulating hens. Effective delivery can be achieved through systemic injection of a viral or plasmid vector, through local infusion of the oviduct using surgical methods, or through local infusion in the reproductive tract entered via the cloaca or vent.
[0115] Similar versions of the landing pad can be integrated in other loci of the genome to increase the amount of recombinant protein produced. Here, the core structure of the landing Atorney Docket No.: 58851-0005W01 pad can remain the same using identical heterologous attP sequences and IRES, and only the homologous regions surrounding the landing pad structure need to be altered. In this use case, a single donor template delivered with the recombinase can be integrated efficiently into multiple genomic loci simultaneously.
[0116] Alternative attP sequences, or attachment sequences for other recombinases can be used as well. In this case, different donor templates can be delivered sequentially or simultaneously to enable RMCE and integration of multiple transgenic proteins into multiple specific loci.
[0117] In some embodiments, the landing pad described herein comprises SEQ ID NO: 1. In some embodiments, the landing pad described herein comprises SEQ ID NOs: 2, 3, 4, 5, 6, and 7.
[0118] SEQ ID NO: 1 - Landing pad with attP sites matching Bxbl recombinase recognition site
[0119] AAACAGATATTTCTCTACATTTATTTTTAGGGAATAAAAATAAGAAATAAAATAG TCAGCAAGCCTCTGCTTTCTCATATATCTGTCCAAACCTAAAGTTTACTGAAATTT GCTCTTTGAATTTCCAGTTTTGCAAGCCTATCAGATTGTGTTTTAATCAGAGGTAC TGAAAAGTATCAATGAATTCTAGCTTTCACTGAACAAAAATATGTAGAGGCAACT GGCTTCTGGGACAGTTTGCTACCCAAAAGACAACTGAATGCAAATACATAAATA GATTTATGAATATGGTTTTGAACATGCACATGAGAGGTGGATATAGCAACAGAC ACATTACCACAGAATTACTTTAAAACTACTTGTTAACATTTAATTGCCTAAAAAC TGCTCGTAATTTACTGTTGTAGCCTACCATAGAGTACCCTGCATGGTACTATGTA CAGCATTCCATCCTTACATTTTCACTGTTCTGCTGTTTGCTCTAGACAACTCAGAG TTCAGGTTTGTCTGGTCAACCACCGCGGTCTCAGTGGTGTACGGTACAAACCGGG CTCTGAAGGACTTCTGACTTTCACAGATTATATAAATCTCAGGAAAGCAACTAGA TTCGTGCTGGCTCCAAAAGCTGTGCTTTATATAAGCACACTGGCTATACAATAGT TGTACAGTTCAGCTCTTTATAATAGAAACAGACAGAACAAGTATAAATCTTCTAT TGGTCTGTGTCTAGAACAAGAATTCATTCAGTGGGGTTTGTCTGGTCAACCACCG CGGACTCAGTGGTGTACGGTACAAACCGCCCCTCTCCCTCCCCCCCCCCTAACGT TACTGGCCGAAGCCGCTTGGAATAAGGCCGGTGTGCGTTTGTCTATATGTTATTT TCCACCATATTGCCGTCTTTTGGCAATGTGAGGGCCCGGAAACCTGGCCCTGTCT TCTTGACGAGCATTCCTAGGGGTCTTTCCCCTCTCGCCAAAGGAATGCAAGGTCT GTTGAATGTCGTGAAGGAAGCAGTTCCTCTGGAAGCTTCTTGAAGACAAACAAC GTCTGTAGCGACCCTTTGCAGGCAGCGGAACCCCCCACCTGGCGACAGGTGCCTC Atorney Docket No.: 58851-0005W01
[0120] TGCGGCCAAAAGCCACGTGTATAAGATACACCTGCAAAGGCGGCACAACCCCAG
[0121] TGCCACGTTGTGAGTTGGATAGTTGTGGAAAGAGTCAAATGGCTCTCCTCAAGCG
[0122] TATTCAACAAGGGGCTGAAGGATGCCCAGAAGGTACCCCATTGTATGGGATCTG
[0123] ATCTGGGGCCTCGGTGCACATGCTTTACATGTGTTTAGTCGAGGTTAAAAAAACG
[0124] TCTAGGCCCCCCGAACCACGGGGACGTGGTTTTCCTTTGAAAAACACGATGATAA
[0125] TATGGCCACAACCATGGGCTCCATCGGTGCAGCAAGCATGGAATTTTGTTTTGAT
[0126] GTATTCAAGGAGCTCAAAGTCCACCATGCCAATGAGAACATCTTCTACTGCCCCA
[0127] TTGCCATCATGTCAGCTCTAGCCATGGTATACCTGGGTGCAAAAGACAGCACCAG
[0128] GACACAAATAAATAAGGTGAGCCTACAGTTAAAGATTAAAACCTTTGCCCTGCT
[0129] CAATGGAGCCACAGCACTTAATTGTATGATAATGTCCCTTGGAAACTGCATAGCT
[0130] CAGAGGCTGAAAATCTGAAACCAGAGTTATCTAAAAGTGTGGCCACCTCCAACT
[0131] CCCAGAGTGTTACCCAAATGCACTAGCTAGAAATCTTGAAACTGGATTGCATAAC
[0132] TTCTTTTTGTCATAACCATTATTTCAGCTACTATTATTTTCAATTACAGGTTGTTCG
[0133] CTTTGATAAACTTCCAGGATTCGGAGACAGTATTGAAGCTCAGGTACAGAAATA
[0134] ATTTCACCTCCTTCTCT
[0135] SEQ ID NO: 2 - 5’ homologous area
[0136] AAACAGATATTTCTCTACATTTATTTTTAGGGAATAAAAATAAGAAATAAAATAG
[0137] TCAGCAAGCCTCTGCTTTCTCATATATCTGTCCAAACCTAAAGTTTACTGAAATTT
[0138] GCTCTTTGAATTTCCAGTTTTGCAAGCCTATCAGATTGTGTTTTAATCAGAGGTAC
[0139] TGAAAAGTATCAATGAATTCTAGCTTTCACTGAACAAAAATATGTAGAGGCAACT
[0140] GGCTTCTGGGACAGTTTGCTACCCAAAAGACAACTGAATGCAAATACATAAATA
[0141] GATTTATGAATATGGTTTTGAACATGCACATGAGAGGTGGATATAGCAACAGAC
[0142] ACATTACCACAGAATTACTTTAAAACTACTTGTTAACATTTAATTGCCTAAAAAC
[0143] TGCTCGTAATTTACTGTTGTAGCCTACCATAGAGTACCCTGCATGGTACTATGTA
[0144] CAGCATTCCATCCTTACATTTTCACTGTTCTGCTGTTTGCTCTAGACAACTCAGAG TTC
[0145] SEQ ID NO: 3 - GT attP site
[0146] AGGTTTGTCTGGTCAACCACCGCGGTCTCAGTGGTGTACGGTACAAACC
[0147] SEQ ID NO: 4 - Intronic spacer sequence
[0148] GGGCTCTGAAGGACTTCTGACTTTCACAGATTATATAAATCTCAGGAAAGCAACT
[0149] AGATTCGTGCTGGCTCCAAAAGCTGTGCTTTATATAAGCACACTGGCTATACAAT Atorney Docket No.: 58851-0005W01
[0150] AGTTGTACAGTTCAGCTCTTTATAATAGAAACAGACAGAACAAGTATAAATCTTC
[0151] TATTGGTCTGTGTCTAGAACAAGAATTCATTCAGTGG
[0152] SEQ ID NO: 5 - GA attP site
[0153] GGTTTGTCTGGTCAACCACCGCGGACTCAGTGGTGTACGGTACAAACC
[0154] SEQ ID NO: 6 - IRES site
[0155] GCCCCTCTCCCTCCCCCCCCCCTAACGTTACTGGCCGAAGCCGCTTGGAATAAGG
[0156] CCGGTGTGCGTTTGTCTATATGTTATTTTCCACCATATTGCCGTCTTTTGGCAATG
[0157] TGAGGGCCCGGAAACCTGGCCCTGTCTTCTTGACGAGCATTCCTAGGGGTCTTTC
[0158] CCCTCTCGCCAAAGGAATGCAAGGTCTGTTGAATGTCGTGAAGGAAGCAGTTCCT
[0159] CTGGAAGCTTCTTGAAGACAAACAACGTCTGTAGCGACCCTTTGCAGGCAGCGG
[0160] AACCCCCCACCTGGCGACAGGTGCCTCTGCGGCCAAAAGCCACGTGTATAAGAT
[0161] ACACCTGCAAAGGCGGCACAACCCCAGTGCCACGTTGTGAGTTGGATAGTTGTG
[0162] GAAAGAGTCAAATGGCTCTCCTCAAGCGTATTCAACAAGGGGCTGAAGGATGCC
[0163] CAGAAGGTACCCCATTGTATGGGATCTGATCTGGGGCCTCGGTGCACATGCTTTA
[0164] CATGTGTTTAGTCGAGGTTAAAAAAACGTCTAGGCCCCCCGAACCACGGGGACG
[0165] TGGTTTTCCTTTGAAAAACACGATGATAATATGGCCACAACC
[0166] SEQ ID NO: 7 - 3’ homologous area with oval start codon
[0167] ATGGGCTCCATCGGTGCAGCAAGCATGGAATTTTGTTTTGATGTATTCAAGGAGC
[0168] TCAAAGTCCACCATGCCAATGAGAACATCTTCTACTGCCCCATTGCCATCATGTC
[0169] AGCTCTAGCCATGGTATACCTGGGTGCAAAAGACAGCACCAGGACACAAATAAA
[0170] TAAGGTGAGCCTACAGTTAAAGATTAAAACCTTTGCCCTGCTCAATGGAGCCACA
[0171] GCACTTAATTGTATGATAATGTCCCTTGGAAACTGCATAGCTCAGAGGCTGAAAA
[0172] TCTGAAACCAGAGTTATCTAAAAGTGTGGCCACCTCCAACTCCCAGAGTGTTACC
[0173] CAAATGCACTAGCTAGAAATCTTGAAACTGGATTGCATAACTTCTTTTTGTCATA
[0174] ACCATTATTTCAGCTACTATTATTTTCAATTACAGGTTGTTCGCTTTGATAAACTT
[0175] CCAGGATTCGGAGACAGTATTGAAGCTCAGGTACAGAAATAATTTCACCTCCTTC TCT Atorney Docket No.: 58851-0005W01
[0176] Example 2 - Landing pad comprising two heterologous Lox sites matching a Cre recombinase’s recognition site, which flank a monoclonal antibody transgene
[0177] The design of the second landing pad includes a monoclonal antibody (mAh) as a transgene, flanked by two heterologous Lox sites. The general design is largely similar to the first landing pad described in Example 1, in that it is integrated in the same position of the Ovalbumin locus, directly upstream from the start codon in exon 2. As in the first landing pad, the IRES site between the 3’ recombinase attachment site and the start codon of the ovalbumin gene allows for poly-cistronic translation from the single transcript generated.
[0178] The transgene here consists of the light chain of a mAb followed by an IRES site which connects it to the heavy chain of the mAb. This configuration increases light chain production relative to heavy chain, which is recommended for optimal mAb production. Each chain of the mAb is preceded at its 3’ end by a signaling peptide from the chicken lysozyme gene, to enable secretion of the antibody into the lumen of the oviduct.
[0179] A total of 2700 bp separate the heterologous Lox sites. The 5’ lox site is a LoxP site, while the 3’ lox site is a Lox 2272 site. LoxP is the 34 bp wild type attachment site for Cre recombinase, and Lox 2272 is a mutated version that cannot recombine with LoxP. Here, the donor template consists of a transgene flanked by LoxP and Lox2272 in the same orientation, to enable directional integration of the transgene.
[0180] The homology regions of this landing pad are chosen to be asymmetrical in length, with the 5’ end containing 400 bp and the 3’ end 800 bp of homology with the native locus. Similarly, as described in Example 1, the Cre recombinase can be delivered to adult or juvenile chickens or to embryos using the similar array of methods described above.
[0181] In some embodiments, the landing pad described herein comprises SEQ ID NO: 8. In some embodiments, the landing pad described herein comprises SEQ ID NOs: 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, and 19.
[0182] Fertilized chickens were incubated for 2.5 days, to stage HH17. 1 pL of blood was collected from each egg, added to 100 pL of media in 48 well plays. PGCs appeared after 6-8 days. Blood cells had died off by approximately 10 days. The media was partially replaced every other day, and cells were transferred to larger wells when confluent. At around 100,000 cells / mL, cells were counted every other day, and healthy, exponentially dividing, bright round cells with smooth surfaces were selected (FIG. 8).
[0183] Healthy PGCs were selected for transfection. Cells were transfected using a Lonza Nucleofactor 4D. Clones were sorted using FACs flow cytometry. PGC clones were confirmed using PCR, Sanger sequencing, and nanopore sequencing. Clones were then Atorney Docket No.: 58851-0005W01 expanded, and 300-3000 pgcs were injected into Stage 14-16 eggs in 1 pL of media. Eggs were sealed, incubated to hatch as described previously. Roosters were reared to sexual maturity. Sperm of roosters was collected using techniques described previously and PCR was used to identify chimeric animals that contain the transgene in the germ line cells. Germline chimeric roosters were mated WT hens, fully transgenic offspring with PCR, and resulting offspring were reared to sexual maturity. G1 transgenic hens and roosters can be bred to produce homozygous G2 offspring (FIG. 9).
[0184] SEQ ID NO: 8 - Landing pad including mAb transgene
[0185] CTGAAATTTGCTCTTTGAATTTCCAGTTTTGCAAGCCTATCAGATTGTGTTTTAAT CAGAGGTACTGAAAAGTATCAATGAATTCTAGCTTTCACTGAACGAAAATATGTA GAGGCAACTGGCTTCTGGGACAGTTTGCTACCCAAAAGACAACTGAATGCAAAT ACATAAATAGATTTATGAATATGGTTTTGAACATGCACATGAGAGGTGGATATAG CAACAGACACATTACCACAGAATTACTTTAAAACTACTTGTTAACATTTAATTGC CTAAAAACTGCTCGTAATTTACTGTTGTAGCCTACCATAGAGTACCCTGCATGGT ACTATGTACAGCATTCCATCCTTACATTTTCACTGTTCTGCTGTTTGCTCTAGACA ACTCAGAGTTCACCATAACTTCGTATAGCATACATTATACGAAGTTATGCCACCA TGAGGTCTTTGCTAATCTTGGTGCTTTGCTTCCTGCCCCTGGCTGCTCTGGGGGCG CGGCCGCGACTCTAGACCCCTCTCCCTCCCCCCCCCCTAACGTTACTGGCCGAAG CCGCTTGGAATAAGGCCGGTGTGCGTTTGTCTATATGTTATTTTCCACCATATTGC CGTCTTTTGGCAATGTGAGGGCCCGGAAACCTGGCCCTGTCTTCTTGACGAGCAT TCCTAGGGGTCTTTCCCCTCTCGCCAAAGGAATGCAAGGTCTGTTGAATGTCGTG AAGGAAGCAGTTCCTCTGGAAGCTTCTTGAAGACAAACAACGTCTGTAGCGACC CTTTGCAGGCAGCGGAACCCCCCACCTGGCGACAGGTGCCTCTGCGGCCAAAAG CCACGTGTATAAGATACACCTGCAAAGGCGGCACAACCCCAGTGCCACGTTGTG AGTTGGATAGTTGTGGAAAGAGTCAAATGGCTCTCCTCAAGCGTATTCAACAAG GGGCTGAAGGATGCCCAGAAGGTACCCCATTGTATGGGATCTGATCTGGGGCCT CGGTACACATGCTTTACATGTGTTTAGTCGAGGTTAAAAAAACGTCTAGGCCCCC CGAACCACGGGGACGTGGTTTTCCTTTGAAAAACACGATGATAATATGGCCACA ACCATGAGGTCTTTGCTAATCTTGGTGCTTTGCTTCCTGCCCCTGGCTGCTCTGGG GATAACTTCGTATAGGCTATAGTATACGAAGTTATGCGGCCGCGACTCTAGACCC CTCTCCCTCCCCCCCCCCTAACGTTACTGGCCGAAGCCGCTTGGAATAAGGCCGG TGTGCGTTTGTCTATATGTTATTTTCCACCATATTGCCGTCTTTTGGCAATGTGAG GGCCCGGAAACCTGGCCCTGTCTTCTTGACGAGCATTCCTAGGGGTCTTTCCCCT Atorney Docket No.: 58851-0005W01
[0186] CTCGCCAAAGGAATGCAAGGTCTGTTGAATGTCGTGAAGGAAGCAGTTCCTCTG
[0187] GAAGCTTCTTGAAGACAAACAACGTCTGTAGCGACCCTTTGCAGGCAGCGGAAC
[0188] CCCCCACCTGGCGACAGGTGCCTCTGCGGCCAAAAGCCACGTGTATAAGATACA
[0189] CCTGCAAAGGCGGCACAACCCCAGTGCCACGTTGTGAGTTGGATAGTTGTGGAA
[0190] AGAGTCAAATGGCTCTCCTCAAGCGTATTCAACAAGGGGCTGAAGGATGCCCAG
[0191] AAGGTACCCCATTGTATGGGATCTGATCTGGGGCCTCGGTACACATGCTTTACAT
[0192] GTGTTTAGTCGAGGTTAAAAAAACGTCTAGGCCCCCCGAACCACGGGGACGTGG
[0193] TTTTCCTTTGAAAAACACGATGATAATATGGCCACAACCATGGGCTCCATCGGCG
[0194] CAGCAAGCATGGAATTTTGTTTTGATGTATTCAAGGAGCTCAAAGTCCACCATGC
[0195] CAATGAGAACATCTTCTACTGCCCCATTGCCATCATGTCAGCTCTAGCCATGGTA
[0196] TACCTGGGTGCAAAAGACAGCACCAGGACACAGATAAATAAGGTGAGCCTACAG
[0197] TTAAAGATTAAAACCTTTGCCCTGCTCAATGGAGCCACAGCACTTAATTGTATGA
[0198] TAATGTCCCTTGGAAACTGCATAGCTCAGAGGCTGAAAATCTGAAACCAGAGTT
[0199] ATCTAAAAGTGTGGCCACCTCCAACTCCCAGAGTGTTACCCAAATGCACTAGCTA
[0200] GAAATCTTGAAACTGGATTGCATAACTTCTTTTTGTCATAACCATTATTTCAGCTA
[0201] CTATTATTTTCAATTACAGGTTGTTCGCTTTGATAAACTTCCAGGATTCGGAGACA
[0202] GTATTGAAGCTCAGGTACAGAAATAATTTCACCTCCTTCTCTATGTCCCTTTCCTC
[0203] TGGAAGCAAAATACAGCAGATGAAGCAATCTCTTAGCTGTTCCAGGCCCTCTCTG
[0204] ATGAGCAGCTAGTGCTCTGCATCCAGCAGTTGGGAGAACACTGTTCATAAGAAC
[0205] AGAGAAAAAGAAGGAAGTAACAGGGGATTCAGAACAAACAGAAGATAAAACTC
[0206] AGGACAAAAATACTGTGTGAATGAGGAAACTTGTGGATATTTGTACGCTTAAGC
[0207] AAGACAGCTAGATGATTCTGGATAAATGGGTCTGGTTGGAAAAGAAGGAAAGCC
[0208] TGGCTGATCTGCTGGAGC
[0209] SEQ ID NO: 9 - 5’ homologous region
[0210] CTGAAATTTGCTCTTTGAATTTCCAGTTTTGCAAGCCTATCAGATTGTGTTTTAAT
[0211] CAGAGGTACTGAAAAGTATCAATGAATTCTAGCTTTCACTGAACGAAAATATGTA
[0212] GAGGCAACTGGCTTCTGGGACAGTTTGCTACCCAAAAGACAACTGAATGCAAAT
[0213] ACATAAATAGATTTATGAATATGGTTTTGAACATGCACATGAGAGGTGGATATAG
[0214] CAACAGACACATTACCACAGAATTACTTTAAAACTACTTGTTAACATTTAATTGC
[0215] CTAAAAACTGCTCGTAATTTACTGTTGTAGCCTACCATAGAGTACCCTGCATGGT
[0216] ACTATGTACAGCATTCCATCCTTACATTTTCACTGTTCTGCTGTTTGCTCTAGACA
[0217] ACTCAGAGTTCACC Atorney Docket No.: 58851-0005W01
[0218] SEQ ID NO: 10 - LoxP site
[0219] ATAACTTCGTATAGCATACATTATACGAAGTTAT
[0220] SEQ ID NO: 11 - Kozak sequence
[0221] GCCACC
[0222] SEQ ID NO: 12 - Lysozyme signal sequence
[0223] ATGAGGTCTTTGCTAATCTTGGTGCTTTGCTTCCTGCCCCTGGCTGCTCTGGGG
[0224] SEQ ID NO: 13 - Filler
[0225] GCGCGGCCGCGACTCTAGA
[0226] SEQ ID NO: 14 - IRES site
[0227] CCCCTCTCCCTCCCCCCCCCCTAACGTTACTGGCCGAAGCCGCTTGGAATAAGGC
[0228] CGGTGTGCGTTTGTCTATATGTTATTTTCCACCATATTGCCGTCTTTTGGCAATGT
[0229] GAGGGCCCGGAAACCTGGCCCTGTCTTCTTGACGAGCATTCCTAGGGGTCTTTCC
[0230] CCTCTCGCCAAAGGAATGCAAGGTCTGTTGAATGTCGTGAAGGAAGCAGTTCCTC
[0231] TGGAAGCTTCTTGAAGACAAACAACGTCTGTAGCGACCCTTTGCAGGCAGCGGA
[0232] ACCCCCCACCTGGCGACAGGTGCCTCTGCGGCCAAAAGCCACGTGTATAAGATA
[0233] CACCTGCAAAGGCGGCACAACCCCAGTGCCACGTTGTGAGTTGGATAGTTGTGG
[0234] AAAGAGTCAAATGGCTCTCCTCAAGCGTATTCAACAAGGGGCTGAAGGATGCCC
[0235] AGAAGGTACCCCATTGTATGGGATCTGATCTGGGGCCTCGGTACACATGCTTTAC
[0236] ATGTGTTTAGTCGAGGTTAAAAAAACGTCTAGGCCCCCCGAACCACGGGGACGT
[0237] GGTTTTCCTTTGAAAAACACGATGATAATATGGCCACAACC
[0238] SEQ ID NO: 15 - Lysozyme signal sequence
[0239] ATGAGGTCTTTGCTAATCTTGGTGCTTTGCTTCCTGCCCCTGGCTGCTCTGGGG
[0240] SEQ ID NO: 16 - Lox2272
[0241] ATAACTTCGTATAGGCTATAGTATACGAAGTTA
[0242] SEQ ID NO: 17 - Filler
[0243] TGCGGCCGCGACTCTAGA Atorney Docket No.: 58851-0005W01
[0244] SEQ ID NO: 18 - IRES2
[0245] CCCCTCTCCCTCCCCCCCCCCTAACGTTACTGGCCGAAGCCGCTTGGAATAAGGC
[0246] CGGTGTGCGTTTGTCTATATGTTATTTTCCACCATATTGCCGTCTTTTGGCAATGT
[0247] GAGGGCCCGGAAACCTGGCCCTGTCTTCTTGACGAGCATTCCTAGGGGTCTTTCC
[0248] CCTCTCGCCAAAGGAATGCAAGGTCTGTTGAATGTCGTGAAGGAAGCAGTTCCTC
[0249] TGGAAGCTTCTTGAAGACAAACAACGTCTGTAGCGACCCTTTGCAGGCAGCGGA
[0250] ACCCCCCACCTGGCGACAGGTGCCTCTGCGGCCAAAAGCCACGTGTATAAGATA
[0251] CACCTGCAAAGGCGGCACAACCCCAGTGCCACGTTGTGAGTTGGATAGTTGTGG
[0252] AAAGAGTCAAATGGCTCTCCTCAAGCGTATTCAACAAGGGGCTGAAGGATGCCC
[0253] AGAAGGTACCCCATTGTATGGGATCTGATCTGGGGCCTCGGTACACATGCTTTAC
[0254] ATGTGTTTAGTCGAGGTTAAAAAAACGTCTAGGCCCCCCGAACCACGGGGACGT
[0255] GGTTTTCCTTTGAAAAACACGATGATAATATGGCCACAACCATGGGCTCCATCGG CGC
[0256] SEQ ID NO: 19 - 5’ homology area
[0257] AGCAAGCATGGAATTTTGTTTTGATGTATTCAAGGAGCTCAAAGTCCACCATGCC
[0258] AATGAGAACATCTTCTACTGCCCCATTGCCATCATGTCAGCTCTAGCCATGGTAT
[0259] ACCTGGGTGCAAAAGACAGCACCAGGACACAGATAAATAAGGTGAGCCTACAGT
[0260] TAAAGATTAAAACCTTTGCCCTGCTCAATGGAGCCACAGCACTTAATTGTATGAT
[0261] AATGTCCCTTGGAAACTGCATAGCTCAGAGGCTGAAAATCTGAAACCAGAGTTA
[0262] TCTAAAAGTGTGGCCACCTCCAACTCCCAGAGTGTTACCCAAATGCACTAGCTAG
[0263] AAATCTTGAAACTGGATTGCATAACTTCTTTTTGTCATAACCATTATTTCAGCTAC
[0264] TATTATTTTCAATTACAGGTTGTTCGCTTTGATAAACTTCCAGGATTCGGAGACAG
[0265] TATTGAAGCTCAGGTACAGAAATAATTTCACCTCCTTCTCTATGTCCCTTTCCTCT
[0266] GGAAGCAAAATACAGCAGATGAAGCAATCTCTTAGCTGTTCCAGGCCCTCTCTG
[0267] ATGAGCAGCTAGTGCTCTGCATCCAGCAGTTGGGAGAACACTGTTCATAAGAAC
[0268] AGAGAAAAAGAAGGAAGTAACAGGGGATTCAGAACAAACAGAAGATAAAACTC
[0269] AGGACAAAAATACTGTGTGAATGAGGAAACTTGTGGATATTTGTACGCTTAAGC
[0270] AAGACAGCTAGATGATTCTGGATAAATGGGTCTGGTTGGAAAAGAAGGAAAGCC TGGCTGATCTGCTGGAGC Attorney Docket No.: 58851-0005W01
[0271] OTHER EMBODIMENTS
[0272] It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.
Claims
Attorney Docket No.: 58851-0005W01WHAT IS CLAIMED IS:
1. A method of generating a transgenic animal, the method comprising:(a) generating an exogenous nucleic acid sequence;(b) inserting the exogenous nucleic acid sequence into a genome of an animal, wherein the exogenous nucleic acid sequence comprises a pair of site-specific recombinase recognition sequences, and wherein the exogenous nucleic acid sequence is inserted into the genome of the animal by using a gene-editing agent, thereby generating a transgenic animal; and optionally(c) delivering a transgene and a recombinase to the transgenic animal, wherein the transgene is integrated into the genome of the animal at a site of the site-specific recombinase recognition sequence, and wherein expression of the transgene is under control of an endogenous promoter of the gene locus, thereby altering somatic cells of the transgenic animal.
2. The method of claim 1, wherein the exogenous nucleic acid sequence further comprises (i) an internal ribosome entry site (IRES), preferably wherein the IRES site is 3’ of the pair of site-specific recombinase recognition sequences and within 25 nts of the start site of an endogenous gene, and / or (ii) a promoter region.
3. The method of claim 2, wherein the promoter region comprises an egg specific promoter.
4. The method of any one of claims 1-3, wherein the pair of site-specific recombinase recognition sequences recognize a serine integrase or a CRE recombinase.
5. The method of claim 4, wherein the pair of site-specific recombinase recognition sequences comprise attP / attB sites for Bxbl integrase.
6. The method of any one of claims 1-5, wherein the exogenous nucleic acid sequence further comprises a selective marker gene.
7. The method of claim 6, wherein the selective marker gene comprises a positive selection marker gene, a negative selection marker gene, or any combination thereof.Attorney Docket No.: 58851-0005W018. The method of claim 7, wherein the positive selection marker gene comprises an antibiotic resistance gene, a fluorescent marker gene, or a cell surface marker.
9. The method of claim 7, wherein the negative selection marker gene comprises Thymidine Kinase (TK) or Diphtheria Toxin (DT-A).
10. The method of any one of claims 1-9, wherein the exogenous nucleic acid sequence further comprises a second pair of recombinase recognition sequences.
11. The method of claim 10, wherein the second pair of recombinase recognition sequences is recognized by a tyrosine recombinase, a serine integrase, a DNA modifying enzyme, or any combination thereof.
12. The method of any one of claims 1-11, wherein the gene-editing agent comprises CRISPR / Cas components.
13. The method of any one of claims 1-12, wherein the animal is an avian species.
14. The method of claim 13, wherein the animal is a chicken, quail, duck, pigeon, goose, or turkey.
15. A method of producing a recombinant protein in an egg from a transgenic animal, the method comprising:(a) generating an exogenous nucleic acid molecule;(b) inserting the exogenous nucleic acid molecule into a genome of an animal, wherein the exogenous nucleic acid molecule comprises a pair of site-specific recombinase recognition sequences, and wherein the exogenous nucleic acid is inserted into the genome of the animal at a locus that encodes a gene expressed in the egg of the transgenic animal by using a gene-editing agent, thereby generating a transgenic animal;(c) delivering a transgene and a recombinase to the transgenic animal, wherein the transgene is integrated into the genome of the animal at a site of the site-specific recombinase recognition sequence, wherein the transgene encodes theAttorney Docket No.: 58851-0005W01 recombinant protein, and wherein expression of the transgene is under control of an endogenous promoter of the gene locus that expresses the gene in the egg of the transgenic animal; and(d) extracting the recombinant protein from the egg of the transgenic animal.
16. The method of claim 15, wherein the exogenous nucleic acid sequence further comprises an internal ribosome entry site (IRES).
17. The method of claim 16, wherein the gene expressed in the egg of the transgenic animal is an ovalbumin or ovamucoid gene.
18. The method of any one of claims 15-17, wherein the pair of site-specific recombinase recognition sequences recognize a serine integrase or a CRE recombinase.
19. The method of claim 18, wherein the pair of site-specific recombinase recognition sequences comprise attP / attB sites for Bxbl serine integrase, or loxP / Lox2272 sites for CRE recombinase.
20. The method of any one of claims 15-19, wherein the exogenous nucleic acid sequence further comprises a selective marker gene.
21. The method of claim 20, wherein the selective marker gene comprises a positive selection marker gene, a negative selection marker gene, or any combination thereof.
22. The method of claim 21, wherein the positive selection marker gene comprises an antibiotic resistance gene, a fluorescent marker gene, or a cell surface marker.
23. The method of claim 21, wherein the negative selection marker gene comprises Thymidine Kinase (TK) or Diphtheria Toxin (DT-A).
24. The method of any one of claims 15-23, wherein the exogenous nucleic acid molecule further comprises a second pair of recombinase recognition sequences.Attorney Docket No.: 58851-0005W0125. The method of claim 24, wherein the second pair of recombinase recognition sequences is recognized by a tyrosine recombinase, a serine integrase, a DNA modifying enzyme, or any combination thereof.
26. The method of any one of claims 15-25, wherein the gene-editing agent comprises CRISPR / Cas components.
27. The method of any one of claims 15-26, wherein the animal is an avian species.
28. The method of claim 27, wherein the animal is a chicken.
29. The method of any one of claims 1-28, wherein the transgene and the recombinase are delivered to the transgenic animal by using a viral vector, lipid nanoparticle, virus-like particle, or direct injection.
30. The method of claim 29, wherein the viral vector comprises AAV, Adenovirus, or lentivirus.
31. The method of claim 29, wherein the exogenous nucleic acid molecule comprises a promoter and a gene for a receptor for the viral vector used to deliver the transgene and the recombinase.
32. The method of any one of claims 1-31, wherein the transgene and the recombinase are delivered to an embryo, an egg, an adult, or sperm of the transgenic animal.
33. A method of generating a transgenic bird, preferably a chicken, quail, duck, pigeon, goose, or turkey, the method comprising:(a) generating an exogenous nucleic acid sequence, wherein the exogenous nucleic acid sequence comprises a pair of site-specific recombinase recognition sequences and an internal ribosome entry site (IRES);(b) inserting the exogenous nucleic acid sequence into a genome of the bird, wherein the exogenous nucleic acid sequence is inserted into the genome of the bird at a chromosomal site located in or adjacent to an egg specific gene by using a geneediting agent, thereby generating a transgenic bird; and optionallyAttorney Docket No.: 58851-0005W01(c) delivering a transgene and a recombinase to the transgenic bird, wherein the transgene is integrated into the genome of the bird at a site of the site-specific recombinase recognition sequence, and wherein expression of the transgene is under control of an endogenous promoter of the egg specific gene locus, thereby altering somatic cells of the transgenic animal.
34. The method of claim 33, wherein the egg specific gene is an Ovalbumin (OVA) gene.
35. The method of claim 34, wherein the exogenous nucleic acid is inserted at the 3’ region of the endogenous Ovalbumin (OVA) gene, optionally in exon 1, intron 1, or the 5’ region of exon 2 before the start codon.
36. The method of any one of claims 33-35, wherein the pair of site-specific recombinase recognition sequences recognize a serine integrase or a CRE recombinase.
37. The method of claim 36, wherein the pair of site-specific recombinase recognition sequences comprise attP / attB sites for Bxbl integrase.
38. The method of any one of claims 33-37, wherein the exogenous nucleic acid sequence further comprises a selective marker gene.
39. The method of claim 38, wherein the selective marker gene comprises a positive selection marker gene, a negative selection marker gene, or any combination thereof.
40. The method of claim 39, wherein the positive selection marker gene comprises an antibiotic resistance gene, a fluorescent marker gene, or a cell surface marker.
41. The method of claim 40, wherein the negative selection marker gene comprises Thymidine Kinase (TK) or Diphtheria Toxin (DT-A).
42. The method of any one of claims 33-41, wherein the exogenous nucleic acid sequence further comprises a second pair of recombinase recognition sequences.Attorney Docket No.: 58851-0005W0143. The method of claim 42, wherein the second pair of recombinase recognition sequences is recognized by a tyrosine recombinase, a serine integrase, a DNA modifying enzyme, or any combination thereof.
44. The method of any one of claims 33-43, wherein the gene-editing agent comprises CRISPR / Cas components.