Novel marker for genetic recombination and use thereof

A Starmerella bombicola mutant strain with suppressed orotinic acid phosphoribosyltransferase-like protein expression serves as a uracil requirement and 5-FOA resistance marker, addressing safety and efficiency concerns in genetic recombination for sophorolipid production, ensuring compliance with biosafety regulations.

WO2026110266A1PCT designated stage Publication Date: 2026-05-28KAO CORP
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/JP2024/041163
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Filing Date
2024-11-20
Publication Date
2026-05-28

AI Technical Summary

Technical Problem

Existing gene recombination technologies for enhancing sophorolipid production in Starmerella bombicola face challenges such as the risk of foreign gene horizontal transfer and ecosystem disruption, and lack of suitable endogenous selection markers, necessitating the development of safe and efficient genetic manipulation methods.

Method used

Development of a Starmerella bombicola mutant strain with suppressed or inactivated orotinic acid phosphoribosyltransferase-like protein expression, utilizing it as a selection marker for uracil requirement and 5-fluoroorotic acid resistance, enabling efficient genetic recombination and transformation.

Benefits of technology

The mutant strain allows for safe and efficient genetic manipulation of Starmerella bombicola, facilitating glycolipid production while complying with biosafety regulations and enhancing transformation efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure JPOXMLDOC01-APPB-T000001
    Figure JPOXMLDOC01-APPB-T000001
  • Figure 00000066_0000
    Figure 00000066_0000
  • Figure 00000066_0001
    Figure 00000066_0001
Patent Text Reader

Abstract

The present invention provides: a novel marker for genetic recombination of Starmera bombicola; and a method for using the same. The present invention pertains to: a Starmerella bombicola mutant strain in which expression of an orotate phosphoribosyltransferase-like protein or an equivalent protein is suppressed or the protein is inactivated; a uracil auxotrophic selectable marker comprising the gene; and a method for producing a transformant of Starmerella bombicola using the selectable marker.
Need to check novelty before this filing date? Find Prior Art

Description

Novel Marker for Gene Recombination and Its Use

[0001] The present invention relates to a novel marker for gene recombination and its use.

[0002] Sophorolipid is a glycolipid produced by microorganisms, mainly yeasts, in which a long-chain hydroxy fatty acid is bound to sophorose. Since sophorolipid has strong surface activity and is an amphiphilic lipid with excellent biodegradability, its use as a biosurfactant has attracted attention in recent years. Because sophorolipid is a microbial product and mainly composed of nonionic components, it has good skin affinity, so it is used as a penetration enhancer for cosmetics. In addition, since sophorolipid has excellent biodegradability and its effect can be achieved even with a small amount of addition, its use is also progressing in the field of detergents such as dishwashing detergents.

[0003] In order to improve the productivity of sophorolipid by microorganisms, it is necessary to enhance the activity of microorganisms. As a main method for such activity enhancement, gene recombination technology can be mentioned. In the gene recombination of microorganisms, in many cases, selection markers such as drug resistance genes and auxotrophy-related genes are used, and the selection of the target gene-recombinant microorganism is carried out using the traits of drug resistance or auxotrophy that are lost or acquired by these markers as indicators. However, there are concerns about risks such as the horizontally spreading of the introduced foreign gene to another microorganism and having an adverse impact on the ecosystem in the gene-recombinant microorganism into which a foreign gene that the microorganism does not originally have is introduced.

[0004] On the other hand, in the Enforcement Regulations of the Law Concerning the Conservation of Biological Diversity (Cartagena Protocol) regarding the regulation of the use of genetically modified organisms, etc., it is stipulated that even organisms obtained by using gene recombination technology are excluded from the scope of the law if they correspond to self-cloning or natural occurrence, and organisms corresponding to self-cloning or natural occurrence are not included in genetically modified organisms. Therefore, even if gene recombination technology is used to improve the productivity of sophorolipid by microorganisms, it is desirable that the obtained microorganisms correspond to self-cloning or natural occurrence.

[0005] Among yeasts that produce sophorolipids, the non-pathogenic basidiomycete yeast Starmerella bombicola (formerly known as Candida bombicola) is well known. In the modification of Starmerella bombicola, foreign antibiotic resistance genes such as hygromycin resistance genes and noseoslysin resistance genes are often used as markers for recombinant selection. As for selection markers derived from endogenous genes necessary for self-cloning (endogenous selection markers), the ura3 gene, which is involved in uracil requirement, is the only known example (Non-Patent Literature 1), and new endogenous selection markers are needed.

[0006] Meanwhile, in the yeast Saccharomyces cerevisiae, the ura3 gene is also used as a selection marker. In the uracil biosynthesis pathway of Saccharomyces cerevisiae, orotic acid is converted to orotidine monophosphate by orotidine phosphoribosyltransferase, and orotidine monophosphate is converted to uridine monophosphate by orotidine monophosphate decarboxylase. The latter, orotidine monophosphate decarboxylase, is the gene product of the ura3 gene, while the former, orotic acid phosphoribosyltransferase, is the gene product of the ura5 and ura10 genes. There are two genes encoding orotic acid phosphoribosyltransferase, and it has been reported that introducing a mutation into only one of these genes results in a phenotype called leakage (Non-Patent Literature 2). Therefore, it is suggested that using the gene encoding orotinate phosphoribosyltransferase as a selection marker based on uracil requirement is undesirable in terms of screening efficiency.

[0007] (Non-patent document 1) Inge NA Van Bogaert et al., Yeast, 2007, 24: 201-208 (Non-patent document 2) J. de Montigny et al. Current Genetics 17, 105-111, 1990

[0008] The present invention relates to the following 1) to 7): 1) A Star Merella bombicola mutant strain in which orotinic acid phosphoribosyltransferase-like protein or a protein equivalent thereto is suppressed or inactivated. 2) A method for producing a Star Merella bombicola mutant strain, comprising suppressing or inactivating the expression of orotinic acid phosphoribosyltransferase-like protein or a protein equivalent thereto in Star Merella bombicola. 3) A method for producing a Star Merella bombicola transformant, comprising using a gene encoding orotinic acid phosphoribosyltransferase-like protein or a gene equivalent thereto as a selection marker. 4) A transformant obtained by the method described in 3). 5) A method for producing glycolipids, comprising culturing the mutant strain described in 1) or the transformant described in 4). 6) A uracil-required selection marker consisting of a gene encoding orotinic acid phosphoribosyltransferase-like protein or a gene equivalent thereto. 7) A vector or DNA fragment containing a gene encoding orotinic acid phosphoribosyltransferase-like protein or a gene equivalent thereto.

[0009] Growth of the parental strain of Star Merella bombicola (T1Δseq1::ade strain) and mutant strains of Star Merella bombicola (T1Δseq1::ade, Δura::ade strain) in which the gene consisting of the nucleotide sequence shown in Sequence ID No. 1 in the parental strain is disrupted, on potato dextrose agar (PDA, control), minimal agar (Minimal), minimal agar + uracil (Minimal + Uracil), and minimal agar + uracil + 5-fluoroorotic acid (Minimal + Uracil + 5FOA). Growth of the parental Star Merella bombicola strain (NBRC10243), a mutant Star Merella bombicola strain (NBRC10243Δura) in which the gene consisting of the nucleotide sequence shown in SEQ ID NO: 1 in the parental strain was disrupted, and a mutant Star Merella bombicola strain (NBRC10243ΔuraΔseq1::Ura) in which the gene consisting of the nucleotide sequence shown in SEQ ID NO: 1 was reintroduced into the NBRC10243Δura strain, on potato dextrose agar medium (PDA, control), SD-uracil medium (SD-Uracil), and SD+uracil medium (SD+Uracil). Electrophoresis of amplified fragments of the ura3 gene region of single colonies obtained by introducing another gene into the ura3 gene region of the parental Star Merella bombicola strain (T1). Three transformation experiments were conducted, and the results for each experiment, involving eight single colonies, are shown. Detailed description of the invention

[0010] If we can develop new genetic recombination markers usable with Star Merella bombicola, and genetic recombination technologies utilizing them, these could become useful foundational technologies for the production of glycolipids and other substances using Star Merella bombicola.

[0011] This invention relates to providing a novel genetically modified marker for Star Merella bombicola and a method for using the same.

[0012] The inventors have discovered that a mutant strain in which a mutation has been introduced into a specific gene of the reference strain of Star Merella bombicola, which is used in glycolipid production, is conferred with uracil requirement, and that this mutant strain is conferred with resistance to 5-fluoroorotic acid, which is converted into a toxic substance in the uracil biosynthesis pathway of the reference strain. This specific gene can function as a selection marker for genetic recombination in Star Merella bombicola, and a transformation system for Star Merella bombicola can be constructed using this.

[0013] This invention provides a Star Merella bombicola mutant strain exhibiting uracil requirement through the introduction of a mutation in a specific gene. This specific gene can function as a selection marker for uracil requirement in Star Merella bombicola, enabling efficient transformation of Star Merella bombicola using the presence or absence of uracil requirement as an indicator.

[0014] All patent, non-patent, and other publications cited herein are incorporated herein by reference in their entirety.

[0015] (1. Definitions) In this specification, the identity of an amino acid sequence or nucleotide sequence is calculated by the Lipman-Pearson method (Science, 1985, 227:1435-1441). Specifically, it is calculated by performing the analysis using the homology analysis (Search homology) program of the genetic information processing software GENETYX Ver. 12, with the Unit size to compare (ktup) set to 2.

[0016] In this specification, "at least 90% identity" with respect to an amino acid sequence or nucleotide sequence means identity of 90% or more, preferably 95% or more, more preferably 97% or more, even more preferably 98% or more, and even more preferably 99% or more.

[0017] In this specification, "amino acid sequence in which one or more amino acids are deleted, substituted, added, or inserted" means an amino acid sequence in which one to twenty, preferably one to ten, more preferably one to eight, even more preferably one to five, and even more preferably one to three amino acids are deleted, substituted, added, or inserted. Also, "nucleotide sequence in which one or more nucleotides are deleted, substituted, added, or inserted" means a nucleotide sequence in which one to sixty, preferably one to thirty, more preferably one to twenty-four, even more preferably one to fifteen, and even more preferably one to nine nucleotides are deleted, substituted, added, or inserted. In this specification, "addition" of an amino acid or nucleotide includes the addition of an amino acid or nucleotide to one end and both ends of a sequence.

[0018] In this specification, "upstream" and "downstream" with respect to a gene refer to the upstream and downstream regions in the transcription direction of the gene. For example, "a gene located downstream of a promoter" means that the gene is located on the 3' side of the promoter in the DNA sense strand, and the upstream of a gene means the 5' region of the gene in the DNA sense strand.

[0019] In this specification, "operable linkage" between a regulatory region such as a promoter and a gene means that the gene and the regulatory region are linked in such a way that the gene can be expressed under the control of the regulatory region. Procedures for "operable linkage" between a gene and a regulatory region are well known to those skilled in the art.

[0020] In this specification, the term "inherent" used with respect to the function, properties, or traits of a cell is used to indicate that the function, property, or trait is inherently present in the cell. In contrast, the term "external" is used to indicate a function, property, or trait that is not inherently present in the cell but has been introduced from outside. For example, an "external" gene or polynucleotide is a gene or polynucleotide that has been introduced into a cell from outside. An external gene or polynucleotide may originate from the same species of organism as the cell into which it was introduced, or from a different species of organism (i.e., a different gene or polynucleotide).

[0021] In this specification, "polynucleotide" may be in the form of single-stranded or double-stranded DNA, RNA, or artificial nucleic acids, or it may be cDNA or chemically synthesized DNA that does not contain introns.

[0022] In this specification, "uracil-dependent" means that a cell requires uracil supplied from an external source for growth. Uracil-dependent microbial strains cannot grow substantially in uracil-free media, but can grow in uracil-containing media. For example, under the conditions shown in the examples below, uracil-dependent microbial strains cannot grow in minimal solid media without uracil, but can grow in minimal solid media containing uracil.

[0023] In this specification, "5-fluoroorotic acid (5-FOA) resistance" means that cells can grow in the presence of 5-FOA, an analog of orotic acid, an intermediate metabolite in the uracil biosynthesis pathway. 5-FOA-resistant microbial strains can grow in both 5-FOA-free and 5-FOA-containing media. However, since the 5-FOA-resistant microbial strains described herein are also uracil-requiring microbial strains, each medium must contain uracil. Furthermore, uridine may be added to each medium to improve growth. For example, 5-FOA-resistant microbial strains can grow in both minimal solid media containing uracil and minimal solid media containing both 5-FOA and uracil, under the conditions shown in the examples below. Furthermore, in 5-FOA-sensitive microbial strains that are not resistant to 5-FOA, 5-FOA is converted to toxic 5-fluorouracil via the uracil biosynthesis pathway, and these microbial strains become lethal in the presence of 5-FOA.

[0024] In this specification, "self-cloning" refers to an organism obtained using genetic engineering technology in which the donor of the inserted DNA in the recombinant organism and the host belong to the same species. In this specification, "natural occurrence" refers to an organism obtained using genetic engineering technology in which the donor of the inserted DNA in the recombinant organism and the host are classified as different species, but it has been shown that gene exchange occurs between the two in nature, and both the donor of the inserted DNA in the recombinant organism and the host belong to these two species. In this specification, "mutation" refers to a change that occurs in genetic information, and includes those caused by errors during DNA replication, DNA damage and replication errors due to chemicals, DNA or chromosome damage due to radiation, and gene destruction due to transposon transposition.

[0025] (2. Starmerella bombicola mutant strain) The inventors have introduced a mutation into the gene encoding a polypeptide consisting of the amino acid sequence shown in Sequence ID No. 2 of the reference strain of Starmerella bombicola, which is used in glycolipid production, thereby conferring uracil requirement. The amino acid sequence shown in Sequence ID No. 2 is an amino acid sequence based on a specific ORF that the inventors found as a result of ORF analysis performed on Starmerella bombicola, for which ORF analysis had not been sufficiently performed in the past. As shown in the examples below, Starmerella bombicola strains without a mutation in the gene encoding the polypeptide consisting of the amino acid sequence shown in Sequence ID No. 2 can grow in both uracil-containing and uracil-free media, whereas Starmerella bombicola mutant strains with a mutation in the gene encoding the polypeptide consisting of the amino acid sequence shown in Sequence ID No. 2 can grow in uracil-containing media but not in uracil-free media. Therefore, the polypeptide consisting of the amino acid sequence shown in Sequence ID No. 2 is presumed to be a polypeptide involved in the uracil biosynthesis pathway of Star Merella bombicola, and further, due to the similarity of the amino acid sequences, it is highly likely to be a polypeptide possessing orotate phosphoribosyltransferase activity. Accordingly, the polypeptide consisting of the amino acid sequence shown in Sequence ID No. 2 was named the orotate phosphoribosyltransferase-like protein of Star Merella bombicola. In uracil-independent Star Merella bombicola, if the expression of the orotate phosphoribosyltransferase-like protein is suppressed or if the function of the protein is reduced or lost, the protein is inactivated, resulting in uracil biosynthesis failure or inability to synthesize uracil, thus conferring uracil requirement to Star Merella bombicola. Conversely, in Star Merella bombicola, which has become uracil-dependent due to the suppression of orotinic acid phosphoribosyltransferase-like protein expression or the reduction or loss of its function, normal expression of the protein can relieve the uracil dependency of Star Merella bombicola.In other words, the orotate phosphoribosyltransferase-like protein of Star Merella bombicola is a protein that has the ability to remove the uracil requirement of Star Merella bombicola, which is uracil-requiring. In other words, it is a protein that has the function of making Star Merella bombicola uracil-free. Furthermore, Star Merella bombicola strains that do not have mutations in the gene encoding the orotate phosphoribosyltransferase-like protein of Star Merella bombicola, which consists of the amino acid sequence shown in Sequence ID No. 2, can grow in 5-FOA-free medium regardless of the presence or absence of uracil, but cannot grow in 5-FOA-containing medium. This is thought to be because 5-FOA is converted to toxic 5-fluorouracil via the uracil biosynthesis pathway. On the other hand, a Star Merella bombicola mutant strain having a mutation in the gene encoding the orotate phosphoribosyltransferase-like protein of Star Merella bombicola, which consists of the amino acid sequence shown in Sequence ID No. 2, can grow in both 5-FOA-containing and 5-FOA-free media in the presence of uracil, but cannot grow in either medium in the absence of uracil. This is thought to be because the mutation inhibits the conversion of 5-FOA to 5-fluorouracil in this mutant strain. In uracil-independent Star Merella bombicola, if the expression of the orotate phosphoribosyltransferase-like protein is suppressed, or if the function of the protein is reduced or lost, thereby inactivating the protein, 5-FOA resistance is conferred to the Star Merella bombicola. Conversely, in Star Merella bombicola that has become resistant to 5-FOA due to the suppression of orotinic acid phosphoribosyltransferase-like protein expression or the reduction or loss of its function, normal expression of the protein makes the Star Merella bombicola 5-FOA sensitive.As reported in Non-Patent Document 2, Saccharomyces cerevisiae has two genes encoding orotate phosphoribosyltransferase, and mutations in only one of these genes are insufficient to adequately inhibit the function of orotate phosphoribosyltransferase. It is therefore quite surprising that in Star Merella bombicola, mutations in only one gene can confer sufficient uracil requirement and 5-FOA resistance.

[0026] This invention provides a Star Merella bombicola mutant (hereinafter referred to as the "mutant of the present invention"). The mutant of the present invention has suppressed or inactivated expression of orotinic acid phosphoribosyltransferase-like protein or an equivalent protein. The mutant of the present invention can be produced in Star Merella bombicola by suppressing or inactivating the expression of orotinic acid phosphoribosyltransferase-like protein or an equivalent protein. The mutant of the present invention exhibits uracil requirement due to the suppression or inactivation of the expression of orotinic acid phosphoribosyltransferase-like protein or an equivalent protein. Furthermore, the mutant of the present invention exhibits 5-FOA resistance due to the suppression or inactivation of the expression of orotinic acid phosphoribosyltransferase-like protein or an equivalent protein.

[0027] Here, "orotinic acid phosphoribosyltransferase-like protein" refers to the orotinic acid phosphoribosyltransferase-like protein of Star Merella bombicola, and is preferably a polypeptide consisting of the amino acid sequence shown in Sequence ID No. 2.

[0028] Furthermore, the "protein equivalent to orotinic acid phosphoribosyltransferase-like protein" refers to a protein having the same function as the orotinic acid phosphoribosyltransferase-like protein of Star Merella bombicola, and includes homologs, orthologs, or variants thereof of the orotinic acid phosphoribosyltransferase-like protein of Star Merella bombicola. The protein equivalent to orotinic acid phosphoribosyltransferase-like protein is preferably a polypeptide consisting of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 2. An example of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 2 is an amino acid sequence in which one or more amino acids are deleted, substituted, added, or inserted from the amino acid sequence shown in SEQ ID NO: 2.

[0029] Preferably, the mutant strain of the present invention is a mutant strain in which the expression of orotinic acid phosphoribosyltransferase-like protein or a protein equivalent thereto is suppressed compared to the pre-mutation strain (parent strain). In one embodiment, the mutant strain of the present invention may be a mutant strain in which the expression level of orotinic acid phosphoribosyltransferase-like protein or a protein equivalent thereto is reduced to 50% or less, preferably 40% or less, more preferably 30% or less, even more preferably 20% or less, even more preferably 10% or less, and still more preferably 5% or less compared to the parent strain. Even more preferably, the mutant strain of the present invention may be a mutant strain in which the expression level of orotinic acid phosphoribosyltransferase-like protein or a protein equivalent thereto is absent to an undetectable degree (below the expression level of a negative control or background). The expression level of the protein or polypeptide can be measured by commonly used protein expression quantification methods, such as, but not limited to, colorimetric quantification, fluorescence quantification, Western blotting, ELISA, radioimmunoassay, etc.

[0030] Means for suppressing or inactivating the expression of orotinic acid phosphoribosyltransferase-like protein or a corresponding protein in Star Merella bombicola include methods of deleting or inactivating the encoding gene, methods of inactivating mRNA transcribed from the encoding gene, methods of suppressing the translation of mRNA from the encoding gene by RNA interference using siRNA, methods of reducing the activity of the protein by mutating the encoding gene, and methods of inactivating the protein by inhibitors such as aptamers or antibodies. In a preferred embodiment, the mutant strain of the present invention is a mutant strain in which the gene encoding orotinic acid phosphoribosyltransferase-like protein or a corresponding gene is deleted or inactivated.

[0031] Here, the "gene encoding orotinic acid phosphoribosyltransferase-like protein" refers to the gene encoding the orotinic acid phosphoribosyltransferase-like protein of Star Merella bombicola, and is preferably a gene consisting of the nucleotide sequence shown in Sequence ID No. 1.

[0032] Furthermore, the "gene corresponding to the gene encoding orotinic acid phosphoribosyltransferase-like protein" is a gene encoding a protein corresponding to the orotinic acid phosphoribosyltransferase-like protein of Star Merella bombicola described above, preferably a gene consisting of a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in SEQ ID NO: 1, and more preferably a gene consisting of a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in SEQ ID NO: 1, and also a gene encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2, or a polypeptide consisting of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 2. An example of a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in SEQ ID NO: 1 is a nucleotide sequence in which one or more nucleotides are deleted, substituted, added, or inserted from the nucleotide sequence shown in SEQ ID NO: 1.

[0033] Means of deleting or inactivating the Star Merella bombicola gene include introducing mutagenesis (deletion, insertion, substitution, or addition) to one or more nucleotides in the nucleotide sequence of the target gene, substituting or inserting another nucleotide sequence into the said nucleotide sequence, or deleting part or all of the said nucleotide sequence. Alternatively, similar mutagenesis, nucleotide sequence substitution, insertion, or deletion may be performed on regulatory regions such as the promoter region of the target gene. For example, the target gene can be inactivated by reducing or eliminating promoter activity and thereby reducing or eliminating mRNA transcription from the target gene through mutagenesis of the promoter that controls the expression of the target gene, or by replacing it with a lower-expression promoter.

[0034] Specific methods for introducing the above-mentioned mutations, or for substituting, inserting, or deleting nucleotide sequences, can be those known in the field for genetic modification of microorganisms. Examples of such methods include, but are not limited to, ultraviolet irradiation, site-directed mutagenesis, homologous recombination using SOE-PCR (splicing by overlap extension PCR: Gene, 1989, 77:61-68), and genome editing using artificial DNA nucleases (or programmeable nucleases).

[0035] After introducing the above-mentioned mutations or substituting, inserting, or deleting nucleotide sequences, the mutant strain of the present invention can be obtained by selecting cells with the desired mutations through gene analysis or evaluation of the expression level of mRNA or polypeptide encoded by the target gene.

[0036] Alternatively, by confirming uracil requirement and / or 5-FOA resistance in the mutant strain prepared by the above procedure, a mutant strain of the present invention in which the gene encoding orotinic acid phosphoribosyltransferase-like protein or an equivalent gene is deleted or inactivated can also be obtained.

[0037] When the method for deleting or inactivating a gene is homologous recombination using SOE-PCR, a mutant strain lacking the target gene can be obtained by culturing cells into which a gene deletion DNA fragment to replace the target gene DNA has been introduced on a medium containing 5-FOA and separating the growing colonies. Furthermore, the mutation may be confirmed by performing the gene analysis or evaluation of polypeptide expression levels described above. By following the above procedure, a mutant strain of the present invention can be obtained in which the gene encoding orotinic acid phosphoribosyltransferase-like protein or an equivalent gene is deleted or inactivated.

[0038] (3. Method for Producing Transformants) The gene encoding orotate phosphoribosyltransferase-like protein or an equivalent gene is a gene involved in the uracil requirement and 5-FOA resistance of Star Merella bombicola, and can function as a nutritional (uracil) requirement selection marker (endogenous selection marker) derived from the endogenous genes of Star Merella bombicola. By utilizing this gene, it is possible to produce transformants of Star Merella bombicola. Therefore, the present invention also provides a method for producing transformants of Star Merella bombicola, which includes using the gene encoding orotate phosphoribosyltransferase-like protein or an equivalent gene as a selection marker.

[0039] In the method for producing transformants of the present invention, a gene encoding orotate phosphoribosyltransferase-like protein or an equivalent gene is used as a selection marker for selecting transformants. The gene encoding orotate phosphoribosyltransferase-like protein or an equivalent gene is preferably an isolated gene. Here, an isolated gene means a gene that exists independently of the genomic DNA of the organism from which it originates, and includes genes cleaved from the genomic DNA of the organism from which it originates, as well as genes synthesized genetically or chemically. The gene encoding orotate phosphoribosyltransferase-like protein or an equivalent gene can be prepared from Star Merella bombicola containing the gene by conventional methods of extracting genomic DNA, or by extracting RNA and synthesizing cDNA by reverse transcription. For example, the gene encoding orotate phosphoribosyltransferase-like protein in Star Merella bombicola can be prepared from Star Merella bombicola strain NBRC10243. A gene corresponding to the gene encoding the orotate phosphoribosyltransferase-like protein of Star Merella bombicola can be prepared by modifying the gene encoding the orotate phosphoribosyltransferase-like protein of Star Merella bombicola using various known mutagenesis techniques. Alternatively, the gene encoding the orotate phosphoribosyltransferase-like protein of Star Merella bombicola, or a gene corresponding thereto, can be prepared by genetically engineering or chemically synthesizing the corresponding nucleotide sequence based on the amino acid sequence shown in Sequence ID No. 2 or an amino acid sequence having at least 90% identity thereto. Hereinafter, the gene encoding the orotate phosphoribosyltransferase-like protein, or a gene corresponding thereto, may be referred to as the selection marker of the present invention.

[0040] In the method for producing transformants of the present invention, the Star Merella bombicola mutant strain of the present invention can be used as a host. The mutant strain of the present invention has suppressed or inactivated expression of orotinic acid phosphoribosyltransferase-like protein or an equivalent protein, is uracil-requiring, and is 5-FOA resistant. The mutant strain of the present invention can be used as a host in the method for producing transformants of Star Merella bombicola of the present invention, and in particular as a host in the method for producing transformants of Star Merella bombicola, in which transformants are selected based on the presence or absence of uracil requirement as an indicator.

[0041] Alternatively, in the method for producing transformants of the present invention, a uracil-independent Star Merella bombicola strain (hereinafter referred to as the uracil-independent strain) can be used as the host. The uracil-independent strain may be a naturally occurring strain or an artificially created mutant, as long as it does not require uracil supplied from an external source for growth. The uracil-independent strain does not have suppressed or inactivated expression of orotinic acid phosphoribosyltransferase-like protein or an equivalent protein, and is not 5-FOA resistant, i.e., is 5-FOA sensitive. The uracil-independent strain can be used as a host in the method for producing transformants of Star Merella bombicola of the present invention, particularly as a host in the method for producing transformants of Star Merella bombicola in which transformants are selected based on the presence or absence of 5-FOA resistance.

[0042] The present invention provides a method for producing transformants in which a target polynucleotide is introduced into a host organism. The target polynucleotide is not particularly limited and may be any polynucleotide. For example, the above-mentioned selection marker may be both a selection marker and the target polynucleotide to be introduced into the host organism. The target polynucleotide may be derived from an organism of the same species as the host organism into which it is introduced, or from an organism of a different species from the host organism. However, in order for the resulting transformant to be self-cloned or a natural occurrence, a polynucleotide derived from a microorganism of the same species as the host organism or a microorganism of a different species from the host organism in which gene exchange between the two has been shown to occur in nature is preferred, and a polynucleotide derived from an organism of the same species as the host organism is more preferred. The target polynucleotide may be isolated from nature, synthesized, or produced using genetic engineering techniques. Furthermore, the target polynucleotide may be codon-optimized to suit the host species. Information on codons used by various organisms is available from the Codon Usage Database ([www.kazusa.or.jp / codon / ]).

[0043] In the method for producing transformants of the present invention, to introduce the target polynucleotide into a host, for example, the mutant strain of the present invention may be used as the host, and the target polynucleotide and the selection marker of the present invention may be introduced. Alternatively, the uracil-free strain may be used as the host, and the target polynucleotide may be introduced such that the selection marker of the present invention is deleted or inactivated in the host genome.

[0044] As a means for introducing the polynucleotide of interest and the selection marker of the present invention into the mutant strain of the present invention of the host, for example, introducing a vector or DNA fragment containing the polynucleotide of interest and the selection marker of the present invention into the host, introducing a vector or DNA fragment containing the polynucleotide of interest and a vector or DNA fragment containing the selection marker of the present invention into the host can be mentioned. Preferably, introducing a vector or DNA fragment containing the polynucleotide of interest and the selection marker of the present invention into the host can be mentioned. Further, as a means for introducing the polynucleotide of interest into the genome of the uracil non-requiring strain of the host so that the selection marker of the present invention is deleted or inactivated, for example, introducing a polynucleotide containing the polynucleotide of interest and deleting or inactivating the selection marker of the present invention in the host genome can be mentioned. More specifically, a polynucleotide consisting of the nucleotide sequence of the upstream adjacent region of the selection marker of the present invention in the host genome or a nucleotide sequence having at least 90% identity thereto and the polynucleotide of interest and a polynucleotide consisting of the nucleotide sequence of the downstream adjacent region of the selection marker of the present invention in the host genome or a nucleotide sequence having at least 90% identity thereto are linked in this order. Introducing a vector or DNA fragment containing the polynucleotide into the host, and by homologous recombination, the polynucleotide of interest is introduced instead of the selection marker of the present invention in the host genome. The length of the above adjacent region is not particularly limited, but from the viewpoints of homologous recombination efficiency and operability, each is preferably independently 0.5 to 3 kb, more preferably 0.5 to 1 kb.

[0045] The above vector may be a vector capable of autonomous replication and replication outside the chromosome, or a vector integrated into the chromosome. The type of the vector is not particularly limited, and examples include plasmids, cosmids, phages, viruses, YACs, BACs, etc. Among these, plasmid vectors are preferred. Those skilled in the art can select a suitable vector according to the type of the host. The plasmid vector may be prepared according to the host, or a commercially available product may be used.

[0046] Examples of the above DNA fragments include, for example, PCR-amplified DNA fragments and restriction enzyme-digested DNA fragments.

[0047] In the above vector or DNA fragment, when it contains the selection marker of the present invention, in addition to the selection marker, it preferably further includes a control region operably linked thereto. Also, when the polynucleotide for the purpose of introduction into the host contained in the above vector or DNA fragment contains a gene, in the above vector or DNA fragment, in addition to the gene, it preferably further includes a control region operably linked thereto. The control region is a sequence for expressing the selection marker and / or the gene in the host into which the vector or DNA fragment has been introduced, and examples include expression regulatory regions such as promoters and terminators, replication origins, and secretion signal regions for secreting the expressed protein extracellularly. The type of the control region is not particularly limited, and a commonly used promoter or secretion signal sequence can be appropriately selected and used according to the host to be introduced. For example, preferred examples of the control sequence include a promoter derived from Starmerella bombicola, a secretion signal sequence, and the like.

[0048] The polynucleotide for the purpose of introduction into the host contained in the above vector or DNA fragment may be introduced into the nucleus of the host or may be introduced into the host genome. As a means for introducing into the genome, homologous recombination methods can be mentioned.

[0049] As a method for introducing the above vector or DNA fragment into the host, any commonly used method such as electroporation, particle gun method, lithium acetate method, heat treatment method, etc. can be used.

[0050] Transformed organisms into which the target polynucleotide has been introduced can be selected using the selection marker of the present invention. For example, when using the mutant strain of the present invention as a host, transformed organisms into which the target polynucleotide has been introduced can be selected using the presence or absence of uracil requirement as an indicator. Alternatively, the introduction of the target polynucleotide can be confirmed by examining the DNA sequence of the transformed organism by PCR or the like. Furthermore, for example, when using a uracil-non-requiring strain as a host, transformed organisms into which the target polynucleotide has been introduced can be selected using the presence or absence of 5-FOA resistance as an indicator. In this case, since the transformed organism is uracil-requiring, it is necessary to select it in the presence of uracil. Alternatively, the introduction of the target polynucleotide can be confirmed by examining the DNA sequence of the transformed organism by PCR or the like.

[0051] Furthermore, the method for producing transformants of the present invention makes it possible to produce transformants in which a target endogenous polynucleotide of the host genome is deleted or inactivated. The target endogenous polynucleotide is not particularly limited as long as it is a polynucleotide contained in the host genome before transformation, and may be any polynucleotide.

[0052] In the method for producing transformants of the present invention, in order to delete or inactivate a target endogenous polynucleotide in the host genome, for example, the mutant strain of the present invention may be used as a host, and the selection marker of the present invention may be introduced so as to delete or inactivate the target endogenous polynucleotide in the host genome.

[0053] As a means of introducing the selection marker of the present invention so that a target endogenous polynucleotide is deleted or inactivated in the genome of a mutant strain of the host, for example, one can introduce a polynucleotide that contains the selection marker of the present invention and deletes or inactivates the target endogenous polynucleotide in the host genome. More specifically, one can introduce into the host a vector or DNA fragment containing a polynucleotide in which a polynucleotide consisting of a nucleotide sequence of the upstream adjacent region of the target endogenous polynucleotide in the host genome or a nucleotide sequence having at least 90% identity thereto, the selection marker of the present invention, and a polynucleotide consisting of a nucleotide sequence of the downstream adjacent region of the target endogenous polynucleotide in the host genome or a nucleotide sequence having at least 90% identity thereto are linked in this order, and the selection marker of the present invention is introduced in place of the target endogenous polynucleotide in the host genome by homologous recombination. The length of the above adjacent region is not particularly limited, but from the viewpoint of homologous recombination efficiency and operability, each is preferably 0.5 to 3 kb, more preferably 0.5 to 1 kb. Details of the vector or DNA fragment and the method for introducing the vector or DNA fragment into the host are the same as those described above for introducing the target polynucleotide into the host in the method for producing the transformant of the present invention.

[0054] Transformants in which a target endogenous polynucleotide in the host genome is deleted or inactivated can be selected using the selection marker of the present invention. For example, using the mutant strain of the present invention as a host, transformants in which a target endogenous polynucleotide in the host genome is deleted or inactivated can be selected using the presence or absence of uracil requirement as an indicator. Alternatively, the deletion or inactivation of the target endogenous polynucleotide can be confirmed by examining the DNA sequence of the transformant by PCR or the like.

[0055] In a preferred embodiment, the method for producing the transformant of the present invention is carried out by the following steps (A) and (B). By this method, the target polynucleotide is introduced into the host. (A) Introducing the target polynucleotide and the selection marker of the present invention into the mutant strain of the present invention; (B) Selecting uracil-independent cells as transformants.

[0056] In step (A), the target polypeptide and the selection marker of the present invention are introduced into the host mutant strain of the present invention. The selection marker of the present invention is a gene related to uracil requirement and 5-FOA resistance in Star Merella bombicola. The mutant strain of the present invention used as a host is uracil-requiring and 5-FOA resistant, but cells into which the selection marker of the present invention has been introduced become uracil-independent. Therefore, by selecting uracil-independent cells in step (B), transformants into which the target polynucleotide has been introduced into the mutant strain of the present invention can be selected. Specifically, by culturing cells in a uracil-free medium and selecting the cells that have grown, transformants into which the target polynucleotide has been introduced into the mutant strain of the present invention can be selected. At this time, the transformants become 5-FOA sensitive, so the uracil-free medium does not contain 5-FOA.

[0057] A method for producing a transformant of the present invention, comprising steps (A) and (B) above, preferably comprises (A') introducing the target polynucleotide and the selection marker of the present invention into the genome of a mutant strain of the present invention, and (B) selecting uracil-independent cells as transformants. A method for producing a transformant of the present invention, comprising steps (A') and (B), may further comprise step (C) removing the selection marker of the present invention introduced in step (A') from the genome of the transformant selected in step (B) (first transformant), and step (D) selecting 5-FOA-resistant cells as transformants (second transformants). The removal of the selection marker of the present invention may be carried out according to methods for genetic modification of microorganisms known in the art. Cells from which the selection marker of the present invention has been removed from the genome of the first transformant selected in step (B) become 5-FOA-resistant. Therefore, by selecting 5-FOA-resistant cells, specifically by culturing cells in a 5-FOA-containing medium and selecting the cells that have grown, a second transformant from which the selection marker of the present invention has been removed from the genome of the first transformant can be selected. At this point, the second transformant becomes uracil-requiring, and therefore the 5-FOA-containing medium contains uracil. Since the second transformant selected in step (D) corresponds to the mutant strain of the present invention, it becomes possible to perform steps (A) and (B), steps (A') and (B), or steps (A') and (B) to (D) anew using the second transformant as the host.

[0058] Alternatively, the method for producing a transformant of the present invention, including steps (A') and (B) above, may further include, as step (E), introducing a new target polynucleotide (the second target polynucleotide) into the genome of the transformant selected in step (B) (the first transformant into which the first target polynucleotide has been introduced) such that the selection marker of the present invention in the genome of the first transformant is deleted or inactivated, and as step (F), selecting a 5-FOA-resistant cell as the transformant (the second transformant). Steps (E) and (F) correspond to steps (K) and (L) described later, respectively, with the first transformant in step (E) corresponding to the uracil-non-requiring strain in step (K). Since the second transformant selected in step (F) corresponds to the mutant strain of the present invention, it becomes possible to perform steps (A) and (B), steps (A') and (B) or steps (A'), (B), (E) and (F) anew using the second transformant as the host.

[0059] By repeating steps (A') and (B) to (D) or steps (A'), (B), (E), and (F) multiple times, a transformant of Star Merella bombicola into which multiple target polynucleotides have been introduced can be obtained. For repetition, the transformant obtained in step (D) or step (F) may be used as the host in step (A') of the next cycle. The number of repetitions is not particularly limited and can be any number, but preferably 2 to 10 times, more preferably 2 to 5 times. When repeating steps (A') and (B) to (D) or steps (A'), (B), (E), and (F) multiple times, steps (C) and (D) or steps (E) and (F) may be omitted in the last repetition as needed.

[0060] In another preferred embodiment, the method for producing a transformant of the present invention is carried out by the following steps (G) and (H): By such method, a target endogenous polynucleotide of interest in the host genome is deleted or inactivated. (G) Introducing a selection marker of the present invention into the genome of a mutant strain of the present invention such that a target endogenous polynucleotide of interest in the genome of the mutant strain of the present invention is deleted or inactivated; (H) Selecting uracil-free cells as transformants.

[0061] In step (G), the select marker of the present invention is introduced into the genome of the mutant strain of the present invention of the host in such a manner that the target endogenous polynucleotide in the genome of the mutant strain of the present invention is deleted or inactivated. Step (G) is preferably carried out by introducing a polynucleotide into the genome of the mutant strain of the present invention that contains the select marker of the present invention and deletes or inactivates the target endogenous polynucleotide in the genome of the mutant strain of the present invention, and more preferably by introducing a polynucleotide into the genome of the mutant strain of the present invention in such a manner that a polynucleotide consisting of a nucleotide sequence of the upstream adjacent region of the target endogenous polynucleotide in the genome of the mutant strain of the present invention or a nucleotide sequence having at least 90% identity thereto is linked in this order to the target endogenous polynucleotide and a polynucleotide consisting of a nucleotide sequence of the downstream adjacent region of the target endogenous polynucleotide in the genome of the mutant strain of the present invention or a nucleotide sequence having at least 90% identity thereto is linked in this manner. In step (G), the target endogenous polynucleotide in the genome of the mutant strain of the present invention is deleted or inactivated by homologous recombination and the select marker of the present invention is introduced. Cells into which the select marker of the present invention has been introduced into the mutant strain of the present invention become uracil-free. Therefore, by selecting uracil-independent cells in step (H), it is possible to select transformants in which the target endogenous polynucleotide of the mutant strain genome of the present invention has been deleted or inactivated and the selection marker of the present invention has been introduced. Specifically, by culturing cells in a uracil-free medium and selecting the cells that have grown, it is possible to select transformants in which the target endogenous polynucleotide of the mutant strain genome of the present invention has been deleted or inactivated and the selection marker of the present invention has been introduced. In this case, the transformants become 5-FOA sensitive, so the uracil-free medium does not contain 5-FOA.

[0062] The method for producing a transformant of the present invention, including steps (G) and (H) above, may further include step (I) removing the selection marker of the present invention introduced in step (G) from the genome of the transformant selected in step (H) (first transformant), and step (J) selecting 5-FOA-resistant cells as the transformant (second transformant). The removal of the selection marker of the present invention may be carried out according to methods for genetic modification of microorganisms known in the art. Cells from which the selection marker of the present invention has been removed from the genome of the first transformant selected in step (H) become 5-FOA-resistant. Therefore, by selecting 5-FOA-resistant cells, specifically by culturing cells in a 5-FOA-containing medium and selecting the cells that have grown, a second transformant from which the selection marker of the present invention has been removed from the genome of the first transformant can be selected. At this time, since the second transformant is uracil-requiring, the 5-FOA-containing medium contains uracil. Since the second transformant selected in step (J) corresponds to the mutant strain of the present invention, it becomes possible to perform steps (G) and (H) or steps (G) to (J) anew using the second transformant as the host.

[0063] By repeating steps (G) to (J) above multiple times, transformants of Star Merella bombicola in which multiple target endogenous polynucleotides are deleted or inactivated can be obtained. For each repetition, the transformant obtained in step (J) can be used as the host in step (G) of the next cycle. The number of repetitions is not particularly limited and can be any number, but preferably 2 to 10 times, more preferably 2 to 5 times. When repeating steps (G) to (J) above multiple times, steps (I) and (J) in the last repetition may be omitted as needed.

[0064] In another preferred embodiment, the method for producing transformants of the present invention is carried out by the following steps (K) and (L): By this method, the target polynucleotide is introduced into the host genome. (K) The target polynucleotide is introduced into the genome of a uracil-free strain such that the selection marker of the present invention in the genome of the uracil-free strain is deleted or inactivated; (L) 5-FOA-resistant cells are selected as transformants.

[0065] In step (K), the target polynucleotide is introduced into the genome of a uracil-independent Star Merella bombicola strain of the host in such a manner that the select marker of the present invention in the genome of the uracil-independent strain is deleted or inactivated. Step (K) is preferably carried out by introducing a polynucleotide containing the target polynucleotide and causing the select marker of the present invention in the genome of the uracil-independent strain to be deleted or inactivated, and more preferably by introducing a polynucleotide in which a polynucleotide consisting of a nucleotide sequence of the upstream adjacent region of the select marker of the present invention in the genome of the uracil-independent strain or a nucleotide sequence having at least 90% identity thereto is linked in this order: the target polynucleotide and a polynucleotide consisting of a nucleotide sequence of the downstream adjacent region of the select marker of the present invention in the genome of the uracil-independent strain or a nucleotide sequence having at least 90% identity thereto. In step (K), homologous recombination deletes or inactivates the selection marker of the present invention in the genome of a uracil-free host strain, and introduces the target polynucleotide. Cells in which the selection marker of the present invention is deleted or inactivated in the host uracil-free host strain become 5-FOA resistant. Therefore, by selecting 5-FOA resistant cells in step (L), transformants in which the selection marker of the present invention in the genome of a uracil-free host strain has been deleted or inactivated and the target polynucleotide has been introduced can be selected. Specifically, by culturing cells in a 5-FOA-containing medium and selecting the cells that have grown, transformants in which the selection marker of the present invention in the genome of a uracil-free host strain has been deleted or inactivated and the target polynucleotide has been introduced can be selected. At this time, the transformants become uracil-requiring, so the 5-FOA-containing medium contains uracil.

[0066] The method for producing a transformant of the present invention, including steps (K) and (L) described above, may further include, as step (M), introducing a new target polynucleotide (second target polynucleotide) and the marker of the present invention into the genome of the transformant selected in step (L) (first transformant into which the first target polynucleotide has been introduced), and as step (N), selecting a uracil-independent cell as the transformant (second transformant). Steps (M) and (N) correspond to steps (A') and (B) described above, respectively, with the first transformant in step (M) corresponding to the mutant strain of the present invention in step (A'). Since the second transformant selected in step (N) corresponds to the uracil-independent strain, it becomes possible to perform steps (K) and (L) or steps (K) to (N) anew using the second transformant as the host.

[0067] By repeating steps (K) to (N) above multiple times, transformants of Star Merella bombicola into which multiple target polynucleotides have been introduced can be obtained. For repetition, the transformant obtained in step (N) may be used as the host in step (K) of the next cycle. The number of repetitions is not particularly limited and can be any number, but preferably 2 to 10 times, more preferably 2 to 5 times. When repeating steps (K) to (N) above multiple times, steps (M) and (N) in the last repetition may be omitted as necessary.

[0068] By appropriately combining each step of the above-described method for producing the transformant of the present invention, a transformant can be obtained in which one or more target polynucleotides are introduced and / or in which one or more target endogenous polynucleotides are deleted or inactivated.

[0069] (4. Method for Producing Glycolipids) Star Merella bombicola is known to produce glycolipids using hydrocarbon chains of various lengths, fatty acids, etc., as substrates. Therefore, by culturing the mutant strain of the present invention described in 2 above or the transformant obtained by the method for producing the transformant of the present invention described in 3 above (hereinafter referred to as the transformant of the present invention) with a substrate of an appropriate chain length, glycolipids containing constituent hydrocarbon chains, fatty acids, etc., of a desired chain length can be efficiently produced. Accordingly, the present invention also provides a method for producing glycolipids, which includes culturing the mutant strain of the present invention or the transformant of the present invention.

[0070] The glycolipid is not particularly limited as long as it is a glycolipid that can be produced from the mutant strain or transformant of the present invention, but preferably, as the sugar constituting the sugar or sugar chain, there are glycolipids containing glucose or its acetylated derivatives, more preferably, as the sugar or sugar chain, there are glycolipids containing glucose, sophorose, cellobiose or their acetylated derivatives, even more preferably, sophorolipids, Bola-type sophorolipids, Bola-type sophorosides, alkyl sophorosides, alkyl glucosides, Bola-type glucosides, acidic glucolipids and / or cellobiose lipids, even more preferably, sophorolipids, Bola-type sophorosides and / or alkyl sophorosides, and still most preferably, sophorolipids.

[0071] The transformant used in the method for producing glycolipids of the present invention is not particularly limited as long as it is a transformant obtained by the method for producing transformants of the present invention. For example, a transformant modified to improve the glycolipid production capacity of Star Merella bombicola is preferably used. Examples of a transformant modified to improve the glycolipid production capacity of Star Merella bombicola include a transformant in which polypeptides involved in suppressing the production capacity of the target glycolipid in Star Merella bombicola are suppressed or inactivated, a transformant in which polypeptides involved in improving the production capacity of the target glycolipid are enhanced, and a transformant in which the expression of various enzymes for producing the target glycolipid is enhanced.

[0072] In a preferred embodiment, the transformant used in the method for producing glycolipids of the present invention is a transformant in which a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 25 or an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 25 is suppressed or inactivated by the method for producing transformants of the present invention. The polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 25 or an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 25 is a putative transcription factor protein, and more preferably a putative transcription factor protein having two Zinc Finger C2H2 type DNA-binding domains. The presence or absence of Zinc Finger C2H2 type DNA-binding domains in a polypeptide can be confirmed, for example, by analyzing the amino acid sequence using NCBI's CD search, but the method of analyzing the presence or absence of such domains is not limited to this. The transformant is preferably a transformant in which a gene encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 25 or an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 25 is deleted or inactivated; more preferably a transformant in which a gene consisting of the nucleotide sequence shown in SEQ ID NO: 24 or a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in SEQ ID NO: 24 is deleted or inactivated; and even more preferably a transformant in which a gene encoding a polypeptide consisting of the nucleotide sequence shown in SEQ ID NO: 24 or a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in SEQ ID NO: 24, and an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 25 is deleted or inactivated. Here, the polypeptide consisting of the amino acid sequence shown in Sequence ID No. 25 is encoded in the nucleotide sequence shown in Sequence ID No. 24 in Star Merella bombicola, and it has been reported that in Star Merella bombicola mutants in which this polypeptide is suppressed or inactivated, the sophorolipid production capacity is improved compared to the parent strain (Japanese Patent Publication No. 6725506).A specific example of the above-mentioned transformant is the Star Merella bombicola NBRC10243ΔuraΔseq1::Ura strain, which is shown in the examples below. The NBRC10243ΔuraΔseq1::Ura strain is considered to be a self-cloning strain because, through transformation using an orotinic acid phosphoribosyltransferase-like protein-deficient strain as a host, a gene consisting of the nucleotide sequence indicated by SEQ ID NO: 24, which is present in the genome of Star Merella bombicola NBRC10243 strain, is inserted in a way that replaces the gene consisting of the nucleotide sequence indicated by SEQ ID NO: 1, which is present in the genome of NBRC10243 strain.

[0073] In another preferred embodiment, the transformant used in the method for producing glycolipids of the present invention is a transformant in which FAO1 (fatty alcohol oxidase 1) or a protein equivalent thereto is suppressed or inactivated by the method for producing transformants of the present invention. Here, "FAO1" is FAO1 of Star Merella bombicola, which is a polypeptide having aliphatic alcohol oxidase activity, and is preferably a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 43. Also, "protein equivalent to FAO1" is a protein having the same function as FAO1 of Star Merella bombicola, and includes homologs, orthologs, or variants thereof of FAO1 of Star Merella bombicola. The protein equivalent to FAO1 is preferably a polypeptide consisting of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 43. An example of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 43 is an amino acid sequence in which one or more amino acids are deleted, substituted, added, or inserted from the amino acid sequence shown in SEQ ID NO: 43. The transformant is preferably a transformant in which a gene encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 43 or an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 43 is deleted or inactivated; more preferably a transformant in which a gene consisting of the nucleotide sequence shown in SEQ ID NO: 42 or a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in SEQ ID NO: 42 is deleted or inactivated; and even more preferably a transformant in which a gene encoding a polypeptide consisting of the nucleotide sequence shown in SEQ ID NO: 42 or a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in SEQ ID NO: 42, and an amino acid sequence consisting of the amino acid sequence shown in SEQ ID NO: 43 or an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 43 is deleted or inactivated.Furthermore, it has been reported that the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 43 is encoded by the nucleotide sequence shown in SEQ ID NO: 42 in Star Merella bombicola, and that in Star Merella bombicola mutant strains in which this polypeptide is suppressed or inactivated, the production of Bola-type sophorosides, alkyl sophorosides, alkyl glucosides, and Bola-type glucosides becomes possible (Appl Microbiol Biotechnol. 2016 Nov;100(22):9519-9528).

[0074] In another preferred embodiment, the transformant used in the method for producing glycolipids of the present invention is a transformant in which CYP52M1 (CYP52M1 cytochrome P450 monooxygenese) or a protein equivalent thereto is suppressed or inactivated by the method for producing transformants of the present invention. Here, "CYP52M1" is CYP52M1 of Star Merella bombicola, and is a polypeptide having hydroxylation activity at the ω or ω-1 position of a fatty acid or aliphatic alcohol, preferably a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 45. Furthermore, "protein equivalent to CYP52M1" is a protein having the same function as CYP52M1 of Star Merella bombicola, and includes homologs, orthologs, or variants thereof of CYP52M1 of Star Merella bombicola. The protein equivalent to CYP52M1 is preferably a polypeptide consisting of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 45. An example of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 45 is an amino acid sequence in which one or more amino acids are deleted, substituted, added, or inserted from the amino acid sequence shown in SEQ ID NO: 45. The transformant is preferably a transformant in which a gene encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 45 or an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 45 is deleted or inactivated; more preferably a transformant in which a gene consisting of the nucleotide sequence shown in SEQ ID NO: 44 or a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in SEQ ID NO: 44 is deleted or inactivated; and even more preferably a transformant in which a gene encoding a polypeptide consisting of the nucleotide sequence shown in SEQ ID NO: 44 or a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in SEQ ID NO: 44, and an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 45 is deleted or inactivated.Furthermore, the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 45 is encoded in the nucleotide sequence shown in SEQ ID NO: 44 in Star Merella bombicola. It has been reported that Star Merella bombicola mutant strains in which the cyp52M1 gene and fao1 gene are disrupted exhibit good production of Bola-type sophorosides and suppress the production of sophorolipids as a by-product (International Publication No. 2020 / 104582).

[0075] In another preferred embodiment, the transformant used in the method for producing glycolipids of the present invention is a transformant in which CYP52N1 (CYP52N1 cytochrome P450 monooxygenese) or a protein equivalent thereof is suppressed or inactivated by the method for producing transformants of the present invention. Here, "CYP52N1" refers to CYP52N1 of Star Merella bombicola, and, similar to CYP52M1 above, is a polypeptide having hydroxylation activity at the ω or ω-1 position of a fatty acid or aliphatic alcohol (Inge NA Van Bogaert et al., FEMS Yeast Res., 2009, 9(1): 87-94), and preferably a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 47. Furthermore, "proteins corresponding to CYP52N1" refer to proteins having the same function as CYP52N1 of Star Merella Bombicola, and include homologs, orthologs, or variants thereof of CYP52N1 of Star Merella Bombicola. Preferably, proteins corresponding to CYP52N1 are polypeptides consisting of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 47. Examples of amino acid sequences having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 47 include amino acid sequences in which one or more amino acids are deleted, substituted, added, or inserted from the amino acid sequence shown in SEQ ID NO: 47.The transformant is preferably a transformant in which a gene encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 47 or an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 47 is deleted or inactivated; more preferably a transformant in which a gene consisting of the nucleotide sequence shown in SEQ ID NO: 46 or a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in SEQ ID NO: 46 is deleted or inactivated; and even more preferably a transformant in which a gene encoding a polypeptide consisting of the nucleotide sequence shown in SEQ ID NO: 46 or a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in SEQ ID NO: 46, and the amino acid sequence shown in SEQ ID NO: 47 or an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 47 is deleted or inactivated. Note that the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 47 is encoded in the nucleotide sequence shown in SEQ ID NO: 46 in Star Merella Bombicola.

[0076] In another preferred embodiment, the transformant used in the method for producing glycolipids of the present invention is a transformant in which CYP52E3 (CYP52E3 cytochrome P450 monooxygenese) or a protein equivalent thereof is suppressed or inactivated by the method for producing transformants of the present invention. Here, "CYP52E3" refers to CYP52E3 of Star Merella bombicola, and, similar to CYP52M1 above, is a polypeptide having hydroxylation activity at the ω or ω-1 position of a fatty acid or aliphatic alcohol (Inge NA Van Bogaert et al., FEMS Yeast Res., 2009, 9(1): 87-94), and preferably a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 49. Furthermore, "proteins corresponding to CYP52E3" refer to proteins having the same function as CYP52E3 of Star Merella bombicola, and include homologs, orthologs, or variants thereof of CYP52E3 of Star Merella bombicola. Preferably, proteins corresponding to CYP52E3 are polypeptides consisting of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 49. Examples of amino acid sequences having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 49 include amino acid sequences in which one or more amino acids are deleted, substituted, added, or inserted from the amino acid sequence shown in SEQ ID NO: 49.The transformant is preferably a transformant in which a gene encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 49 or an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 49 is deleted or inactivated; more preferably a transformant in which a gene consisting of the nucleotide sequence shown in SEQ ID NO: 48 or a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in SEQ ID NO: 48 is deleted or inactivated; and even more preferably a transformant in which a gene encoding a polypeptide consisting of the nucleotide sequence shown in SEQ ID NO: 48 or a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in SEQ ID NO: 48, and the amino acid sequence shown in SEQ ID NO: 49 or an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 49 is deleted or inactivated. Note that the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 49 is encoded in the nucleotide sequence shown in SEQ ID NO: 48 in Star Merella Bombicola.

[0077] In another preferred embodiment, the transformant used in the method for producing glycolipids of the present invention is a transformant in which UGTB1 (UDP-glucosyltransferase B1) or a protein equivalent thereto is suppressed or inactivated by the method for producing transformants of the present invention. Here, "UGTB1" is UGTB1 of Star Merella bombicola, which is a polypeptide having glycosyltransferase activity to hydroxylated fatty acids using UDP-glucose as a donor, and is preferably a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 51. Furthermore, "protein equivalent to UGTB1" is a protein having the same function as UGTB1 of Star Merella bombicola, and includes homologs, orthologs, or variants thereof of UGTB1 of Star Merella bombicola. The protein equivalent to UGTB1 is preferably a polypeptide consisting of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 51. An example of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 51 is an amino acid sequence in which one or more amino acids are deleted, substituted, added, or inserted from the amino acid sequence shown in SEQ ID NO: 51. The transformant is preferably a transformant in which a gene encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 51 or an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 51 is deleted or inactivated; more preferably a transformant in which a gene consisting of the nucleotide sequence shown in SEQ ID NO: 50 or a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in SEQ ID NO: 50 is deleted or inactivated; and even more preferably a transformant in which a gene encoding a polypeptide consisting of the nucleotide sequence shown in SEQ ID NO: 50 or a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in SEQ ID NO: 50, and an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 51 is deleted or inactivated.Furthermore, the polypeptide consisting of the amino acid sequence shown in Sequence ID No. 51 is encoded in the nucleotide sequence shown in Sequence ID No. 50 in Star Merella bombicola. It has been reported that glutolipids can be produced in Star Merella bombicola mutants in which the ugtB1 gene is disrupted (Sofie Lodens et al., Biotechnol Bioeng., 2020, 117(2): 453-465). In addition, it has been reported that alkylglucosides and alkylsophorosides can be produced in Star Merella bombicola mutants in which the ugtB1 gene, fao1 gene, and cyp52M1 gene are disrupted (International Publication No. 2021 / 229017).

[0078] In another preferred embodiment, the transformant used in the method for producing glycolipids of the present invention is a transformant in which UGTA1 (UDP-glucosyltransferase A1) or a protein equivalent thereto is suppressed or inactivated by the method for producing transformants of the present invention. Here, "UGTA1" refers to UGTA1 of Star Merella bombicola, which, like UGTB1 above, is a polypeptide having glycosyltransferase activity to hydroxylated fatty acids using UDP-glucose as a donor (Karen MJ Saerens et al., FEMS Yeast Res., 2015, 15(7): fov075), and is preferably a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 53. Furthermore, "protein equivalent to UGTA1" refers to a protein having the same function as UGTA1 of Star Merella bombicola, and includes homologs, orthologs, or variants thereof of UGTA1 of Star Merella bombicola. The protein corresponding to UGTA1 is preferably a polypeptide consisting of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 53. An example of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 53 is an amino acid sequence in which one or more amino acids are deleted, substituted, added, or inserted from the amino acid sequence shown in SEQ ID NO: 53.The transformant is preferably a transformant in which a gene encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 53 or an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 53 is deleted or inactivated; more preferably a transformant in which a gene consisting of the nucleotide sequence shown in SEQ ID NO: 52 or a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in SEQ ID NO: 52 is deleted or inactivated; and even more preferably a transformant in which a gene encoding a polypeptide consisting of the nucleotide sequence shown in SEQ ID NO: 52 or a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in SEQ ID NO: 52, and an amino acid sequence consisting of the amino acid sequence shown in SEQ ID NO: 53 or an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 53 is encoded in the nucleotide sequence shown in SEQ ID NO: 52 in Star Merella Bombicola.

[0079] In another preferred embodiment, the transformant used in the method for producing glycolipids of the present invention is a transformant in which AT (acetyl transferase) or a protein equivalent thereto is suppressed or inactivated by the method for producing transformants of the present invention. Here, "AT" is AT of Star Merella bombicola, which is a polypeptide having acetylation activity of the OH portion of a sugar, and is preferably a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 55. Also, "protein equivalent to AT" is a protein having the same function as AT of Star Merella bombicola, and includes homologs, orthologs, or variants thereof of AT of Star Merella bombicola. The protein equivalent to AT is preferably a polypeptide consisting of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 55. An example of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 55 is an amino acid sequence in which one or more amino acids are deleted, substituted, added, or inserted from the amino acid sequence shown in SEQ ID NO: 55. The transformant is preferably a transformant in which a gene encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 55 or an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 55 is deleted or inactivated; more preferably a transformant in which a gene consisting of the nucleotide sequence shown in SEQ ID NO: 54 or a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in SEQ ID NO: 54 is deleted or inactivated; and even more preferably a transformant in which a gene encoding a polypeptide consisting of the nucleotide sequence shown in SEQ ID NO: 54 or a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in SEQ ID NO: 54, and an amino acid sequence consisting of the amino acid sequence shown in SEQ ID NO: 55 or an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 55 is deleted or inactivated. Note that the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 55 is encoded in the nucleotide sequence shown in SEQ ID NO: 54 in Star Merella Bombicola.It has been reported that non-acetylated sophorolipids are produced in Star Merella bombicola mutants in which the at gene is disrupted (Karen MJ Saerens et al., Biotechnol Bioeng., 2011, 108(12): 2923-2931).

[0080] In another preferred embodiment, the transformant used in the method for producing glycolipids of the present invention is a transformant in which SBLE (Starmerella Bombicola Lactone Esterase) or a protein equivalent thereto is suppressed or inactivated by the method for producing transformants of the present invention. Here, "SBLE" refers to the SBLE of Starmerella Bombicola, which is a polypeptide having sophorolipid lactonization activity, and is preferably a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 57. Furthermore, "protein equivalent to SBLE" refers to a protein having the same function as the SBLE of Starmerella Bombicola, and includes homologs, orthologs, or variants thereof of the SBLE of Starmerella Bombicola. The protein equivalent to SBLE is preferably a polypeptide consisting of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 57. An example of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 57 is an amino acid sequence in which one or more amino acids are deleted, substituted, added, or inserted from the amino acid sequence shown in SEQ ID NO: 57. The transformant is preferably a transformant in which a gene encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 57 or an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 57 is deleted or inactivated; more preferably a transformant in which a gene consisting of the nucleotide sequence shown in SEQ ID NO: 56 or a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in SEQ ID NO: 56 is deleted or inactivated; and even more preferably a transformant in which a gene encoding a polypeptide consisting of the nucleotide sequence shown in SEQ ID NO: 56 or a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in SEQ ID NO: 56, and an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 57 is deleted or inactivated.Furthermore, the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 57 is encoded in the nucleotide sequence shown in SEQ ID NO: 56 in Star Merella bombicola. It has been reported that the proportion of acidic sophorolipids is increased in Star Merella bombicola mutants in which the sble gene is disrupted (Katarzyna Ciesielska et al., Appl Microbiol Biotechnol., 2016, 100(22): 9529-9541). In addition, it has been reported that the production of non-acetylated Bola-type sophorolipids becomes possible in Star Merella bombicola mutants in which both the sble and at genes are disrupted (International Publication No. 2015 / 028278).

[0081] In another preferred embodiment, the transformant used in the method for producing glycolipids of the present invention is a transformant in which MDR1 (multidrug resistance protein 1) or a protein equivalent thereto is enhanced in expression by the method for producing transformants of the present invention. Here, "MDR1" refers to MDR1 of Star Merella bombicola, which is a transporter polypeptide responsible for the extracellular and extracellular transport of sophorolipids, and is preferably a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 59. Furthermore, "protein equivalent to MDR1" refers to a protein having the same function as MDR1 of Star Merella bombicola, and includes homologs, orthologs, or variants thereof of MDR1 of Star Merella bombicola. The protein equivalent to MDR1 is preferably a polypeptide consisting of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 59. An example of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 59 is an amino acid sequence in which one or more amino acids are deleted, substituted, added, or inserted from the amino acid sequence shown in SEQ ID NO: 59. The transformant is preferably a transformant in which a gene encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 59 or an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 59 is enhanced in expression. More preferably, the transformant is a transformant in which a gene consisting of the nucleotide sequence shown in SEQ ID NO: 58 or a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in SEQ ID NO: 58 is enhanced in expression. Even more preferably, the transformant is a transformant in which a gene encoding a polypeptide consisting of the nucleotide sequence shown in SEQ ID NO: 58 or a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in SEQ ID NO: 58, and an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 59 is enhanced in expression. Note that the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 59 is encoded in the nucleotide sequence shown in SEQ ID NO: 58 in Star Merella Bombicola.It has been reported that in Star Merella bombicola mutants in which the mdr1 gene is disrupted, the productivity of sophorolipids and Bola-type sophorolipids is significantly reduced (Silke Claus et al., BMC Genomics, 2022, 23(1): 22).

[0082] In another preferred embodiment, the transformant used in the method for producing glycolipids of the present invention is a transformant in which MFE-2 (multifunctional enzyme type 2) or a protein equivalent thereto is suppressed or inactivated by the method for producing transformants of the present invention. Here, "MFE-2" refers to MFE-2 of Star Merella bombicola, which is a polypeptide involved in the beta-oxidative degradation of fatty acids. Furthermore, "protein equivalent to MFE-2" refers to a protein having the same function as MFE-2 of Star Merella bombicola, and includes homologs, orthologs, or variants thereof of MFE-2 of Star Merella bombicola. It has been reported that sophorolipids having a medium-chain fatty acid backbone are produced in Star Merella bombicola mutants in which the mfe-2 gene is disrupted (Inge NA Van Bogaert et al., FEMS Yeast Res., 2009, 9(4): 610-617).

[0083] In the method for producing glycolipids of the present invention, the mutant strain or transformant of the present invention is cultured in a medium containing substrates such as fatty acids, fatty acid alkyl esters, triacylglycerols, diacylglycerols, monoacylglycerols, oils and fats, alkanes, alkenes, alkynes, and alcohols. The glycolipids can be produced by recovering the glycolipids from the culture medium after cultivation and purifying them as appropriate if necessary.

[0084] As the culture medium used for the above cultivation, a conventional medium containing a carbon source, a nitrogen source, inorganic salts, and, if necessary, organic micronutrients such as amino acids and vitamins can be used. Furthermore, the medium may be either a synthetic medium or a natural medium.

[0085] The carbon and nitrogen sources included in the culture medium may be of any type available to the mutant or transformant being cultured. Examples of carbon sources include sugars such as glucose, glycerol, fructose, sucrose, maltose, mannose, galactose, starch hydrolysates, and molasses; organic acids such as acetic acid and citric acid; and alcohols such as ethanol. These carbon sources can be used individually or in combination of two or more. Examples of nitrogen sources include ammonia; ammonium salts such as ammonium sulfate, ammonium carbonate, ammonium chloride, ammonium phosphate, and ammonium acetate; nitrates; and urea.

[0086] Examples of the inorganic salts mentioned above include phosphates, magnesium salts, calcium salts, iron salts, and manganese salts. Examples of the organic micronutrients mentioned above include amino acids, vitamins, fatty acids, nucleic acids, and peptones, casamino acids, yeast extracts, and hydrolyzed soy protein containing these. When using nutrient-requiring mutants or transformants that require amino acids or other nutrients for growth, the required nutrients may be supplemented.

[0087] Preferred examples of substrates that may be included in the culture medium include C12-22 fatty acids and their alkyl esters, triacylglycerols, diacylglycerols and monoacylglycerols containing C12-22 fatty acids or their alkyl esters, oils and fats containing C12-22 fatty acids or their alkyl esters, C12-22 alkanes, C12-22 alkenes, C12-22 alkynes, and C12-22 alcohols. More preferred examples include C12-18 fatty acids and their alkyl esters, triacylglycerols, diacylglycerols and monoacylglycerols containing C12-C18 fatty acids or their alkyl esters, oils and fats containing C12-C18 fatty acids or their alkyl esters, C12-18 alkanes, C12-18 alkenes, C12-18 alkynes, and C12-18 alcohols. Further preferred examples include C12-C18 fatty acids and their alkyl esters, triacylglycerols containing C12-C18 fatty acids or their alkyl esters, and C12-C18 alcohols.

[0088] More detailed examples of the above substrates include, but are not limited to, the above C12-22 fatty acids may be saturated or unsaturated fatty acids, and may be straight-chain or branched fatty acids, such as lauric acid, tridecyl acid, myristic acid, pentadecyl acid, palmitic acid, margaric acid, stearic acid, isostearic acid, nonadecyl acid, arachidic acid, behenic acid, palmitoleic acid, oleic acid, linoleic acid, α-linolenic acid, γ-linolenic acid, arachidonic acid, eicosapentaenoic acid, and docosahexaenoic acid; the above C12-22 fatty acids may be alkyl esters of the above fatty acids having 1 to 4 carbon atoms, preferably methyl esters and ethyl esters; and oils and fats containing the above C12-22 fatty acids or their alkyl esters may include coconut oil, palm oil, palm kernel oil, olive oil, rapeseed oil, rice bran oil, soybean oil, castor oil, and mahua oil.

[0089] Furthermore, the above C12-22 alkanes may be straight-chain or branched-chain, and include dodecane, tridecane, tetradecane, pentadecane, hexadecane, heptadecane, octadecane, nonadecane, icosane, henicosane, docosane, etc.; the above C12-22 alkenes may be straight-chain or branched-chain, and include 1-dodecene, 1-tridecene, 1-tetradecene, 1-pentadecane, 1-hexadecane Examples include 1-heptadecene, 1-octadecene, 1-nonadecene, 1-icosene, 1-henicosene, and 1-docosene; the above C12-22 alkynes may be straight-chain or branched-chain, and examples include 1-dodecine, 1-tridecine, 1-tetradecine, 1-pentadecene, 1-hexadecene, 1-heptadecene, 1-octadecine, 1-nonadecene, 1-icosine, 1-henicosine, and 1-docosine.

[0090] Furthermore, the C12-22 alcohols mentioned above may be saturated or unsaturated alcohols, and may be straight-chain or branched-chain alcohols. Examples include lauryl alcohol, tridecyl alcohol, myristyl alcohol, pentadecyl alcohol, cetyl alcohol, heptadecyl alcohol, stearyl alcohol, isostearyl alcohol, nonadecyl alcohol, arachidyl alcohol, behenyl alcohol, palmitrail alcohol, oleyl alcohol, linoleyl alcohol, and linolenyl alcohol.

[0091] The substrates listed above can be used individually or in combination of two or more. Preferably, fatty acids with chain lengths of any C12 to C18 or their alkyl esters, or triacylglycerols, diacylglycerols, monoacylglycerols, or oils and fats containing them, or alkanes, alkenes, alkynes, or alcohols with chain lengths of any C12 to C18 are used. More preferably, fatty acids with chain lengths of any C12 to C18 or their alkyl esters, or alcohols with chain lengths of any C12 to C18 are used. Even more preferably, fatty acids with chain lengths of any C16 to C18 or their alkyl esters, or alcohols with chain lengths of any C16 to C18 are used. Even more preferably, fatty acids with a C18 chain length or their alkyl ester, or alcohols with a C18 chain length are used. Even more preferably, oleic acid or its alkyl ester, or oleyl alcohol is used. Rapeseed oil, in which triacylglycerols rich in oleic acid are the main component as constituent fatty acids, is also preferably used.

[0092] The amount of the above-mentioned substrate that may be contained in the culture medium (when the substrate is added) is preferably 0.1% by mass / volume or more, more preferably 0.5% by mass / volume or more, even more preferably 1% by mass / volume or more, even more preferably 2% by mass / volume or more, even more preferably 3% by mass / volume or more, and even more preferably 5% by mass / volume or more in terms of the amount of glycolipid produced, and preferably 40% by mass / volume or less, more preferably 30% by mass / volume or less, even more preferably 25% by mass / volume or less, even more preferably 20% by mass / volume or less, even more preferably 15% by mass / volume or less, and even more preferably 10% by mass / volume or less in terms of the production efficiency of glycolipids. Alternatively, preferably 0.1 to 40 mass / volume%, 0.1 to 30 mass / volume%, 0.1 to 25 mass / volume%, 0.1 to 20 mass / volume%, 0.1 to 15 mass / volume%, 0.1 to 10 mass / volume%, 0.5 to 40 mass / volume%, 0.5 to 30 mass / volume%, 0.5 to 25 mass / volume%, 0.5 to 20 mass / volume%, 0.5 to 15 mass / volume%, 0.5 to 10 mass / volume%, 1 to 40 mass / volume%, 1 to 30 mass / volume%, 1 to 25 mass / volume%, 1 to 20 mass / volume%, 1 to 15 mass / body The volume is % in volume, 1-10 mass / volume%, 2-40 mass / volume%, 2-30 mass / volume%, 2-25 mass / volume%, 2-20 mass / volume%, 2-15 mass / volume%, 2-10 mass / volume%, 3-40 mass / volume%, 3-30 mass / volume%, 3-25 mass / volume%, 3-20 mass / volume%, 3-15 mass / volume%, 3-10 mass / volume%, 5-40 mass / volume%, 5-30 mass / volume%, 5-25 mass / volume%, 5-20 mass / volume%, 5-15 mass / volume%, or 5-10 mass / volume%. In this specification, volume means volume at 25°C and 1 atmosphere.

[0093] The culture conditions can be any conditions under which glycolipids are fermented and produced by the mutant strain or transformant of the present invention. Culture is preferably carried out under aerobic conditions, and general methods such as aerated stirring culture and shaking culture can be applied. The culture temperature is preferably 20 to 33°C, more preferably 25 to 30°C, and even more preferably 28 to 30°C. The initial pH of the culture medium (at 30°C) is preferably 2 to 7, more preferably 3 to 6. The culture time is preferably about 24 to 200 hours, and more preferably 50 to 200 hours.

[0094] In the above culture, the mutant strain or transformant of the present invention may be cultured under conditions that allow cells to proliferate to produce glycolipids through fermentation, or the mutant strain or transformant of the present invention may be cultured in a dormant state, i.e., in a state where growth and proliferation have stopped, to produce glycolipids through fermentation.

[0095] The method for recovering glycolipids from the culture medium after incubation is not particularly limited and can be carried out according to known recovery methods. For example, glycolipids in the culture medium can be recovered or purified by solvent extraction using ethyl acetate, butanol, etc., fractional precipitation, liquid-liquid partitioning, column chromatography, high-performance liquid chromatography, etc., either alone or in appropriate combinations.

[0096] As exemplary embodiments of the present invention, the following compositions, manufacturing methods, uses, or methods are further disclosed herein. However, the present invention is not limited to these embodiments.

[0097] [1] A Star Merella bombicola mutant in which the expression of orotinic acid phosphoribosyltransferase-like protein or a protein equivalent thereto is suppressed or inactivated. [2] The mutant according to [1], wherein the orotinic acid phosphoribosyltransferase-like protein is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2, and the protein equivalent to the orotinic acid phosphoribosyltransferase-like protein is a polypeptide consisting of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 2. [3] The mutant according to [1] or [2], in which the gene encoding the orotinic acid phosphoribosyltransferase-like protein or a gene equivalent thereto is deleted or inactivated. [4] The mutant according to [3], wherein the gene encoding the orotinic acid phosphoribosyltransferase-like protein is a gene consisting of the nucleotide sequence shown in SEQ ID NO: 1, and the gene equivalent to the gene encoding the orotinic acid phosphoribosyltransferase-like protein is a gene consisting of a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in SEQ ID NO: 1. [5] A mutant strain that requires uracil, as described in any one of items [1] to [4].

[0098] [6] A method for producing a Star Merella bombicola mutant, comprising suppressing or inactivating the expression of an orotinic acid phosphoribosyltransferase-like protein or a protein equivalent thereto in Star Merella bombicola. [7] The method according to [6], wherein the orotinic acid phosphoribosyltransferase-like protein is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2, and the protein equivalent thereto is a polypeptide consisting of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 2. [8] The method according to [6] or [7], wherein the gene encoding the orotinic acid phosphoribosyltransferase-like protein or a gene equivalent thereto is deleted or inactivated. [9] The method according to [8], wherein the gene encoding the orotinic acid phosphoribosyltransferase-like protein is a gene consisting of the nucleotide sequence shown in SEQ ID NO: 1, and the gene equivalent thereto is a gene consisting of a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in SEQ ID NO: 1.

[10] A method for producing a uracil-requiring Star Merella bombicola mutant, as described in any one of [6] to [9].

[0099]

[11] A method for producing a transformant of Star Merella bombicola, comprising using a gene encoding an orotinic acid phosphoribosyltransferase-like protein or an equivalent gene as a selection marker.

[12] The method according to

[11] , comprising using a mutant strain described in any one of [1] to [5] as a host.

[13] The method according to

[11] or

[12] , comprising selecting a transformant as an indicator of the presence or absence of uracil requirement.

[14] The method according to

[11] or

[12] , comprising selecting a transformant as an indicator of a combination of the presence or absence of uracil requirement and the presence or absence of 5-FOA resistance.

[0100]

[15] A method according to any one of

[11] to

[13] , comprising the following steps (A) and (B): (A) Introducing a gene encoding a target polynucleotide and an orotinic acid phosphoribosyltransferase-like protein or an equivalent gene into a mutant strain according to any one of [1] to [5]; (B) Selecting uracil-independent cells as transformants.

[16] A method according to any one of

[11] to

[14] , comprising the following steps (A') and (B) to (D): (A') Introducing a gene encoding a target polynucleotide and an orotinic acid phosphoribosyltransferase-like protein or an equivalent gene into the genome of a mutant strain according to any one of [1] to [5]; (B) Selecting uracil-free cells as the first transformant; (C) Removing the gene encoding an orotinic acid phosphoribosyltransferase-like protein or an equivalent gene introduced in step (A) from the genome of the first transformant selected in step (B); (D) Selecting 5-FOA-resistant cells as the second transformant.

[17] The method according to

[16] , wherein steps (A') and (B) to (D) are repeated multiple times.

[18] A method according to any one of

[11] to

[14] , comprising the following steps (A'), (B), (E), and (F): (A') introducing a gene encoding a first target polynucleotide and an orotinic acid phosphoribosyltransferase-like protein or an equivalent gene into the genome of a mutant strain according to any one of [1] to [5]; (B) selecting uracil-free cells as the first transformant; (E) introducing a second target polynucleotide into the genome of the first transformant selected in step (B) such that the selection marker of the present invention introduced in step (A') into the genome of the first transformant is deleted or inactivated; (F) selecting 5-FOA-resistant cells as the second transformant.

[19] A method according to

[18] , wherein steps (A'), (B), (E), and (F) are repeated multiple times.

[0101]

[20] A method according to any one of

[11] to

[13] , comprising the following steps (G) and (H): (G) Introducing a gene encoding an orotinic acid phosphoribosyltransferase-like protein or an equivalent gene into the genome of any one of [1] to [5] such that the target endogenous polynucleotide in the genome of the mutant is deleted or inactivated; (H) Selecting uracil-independent cells as transformants.

[21] A method according to any one of

[11] to

[14] , comprising the following steps (G) to (J): (G) Introducing a gene encoding orotinic acid phosphoribosyltransferase-like protein or an equivalent gene into the genome of any one of [1] to [5] such that a target endogenous polynucleotide in the genome of the mutant is deleted or inactivated; (H) Selecting uracil-independent cells as the first transformant; (I) Removing the gene encoding orotinic acid phosphoribosyltransferase-like protein or an equivalent gene introduced in step (G) from the genome of the first transformant selected in step (H); (J) Selecting 5-FOA-resistant cells as the second transformant.

[22] The method according to

[21] , wherein steps (G) to (J) are repeated multiple times.

[0102]

[23] A method according to any one of

[11] ,

[12] , and

[14] , comprising the following steps (K) and (L): (K) Introducing the target polynucleotide into the genome of a uracil-independent Star Merella bombicola strain such that a gene encoding orotinic acid phosphoribosyltransferase-like protein or an equivalent gene in the genome of the uracil-independent Star Merella bombicola strain is deleted or inactivated; (L) Selecting 5-FOA-resistant cells as transformants.

[24] A method according to any one of

[11] to

[14] , comprising the following steps (K) to (N): (K) Introducing a first target polynucleotide into the genome of a uracil-independent Star Merella bombicola strain such that a gene encoding or equivalent of an orotate phosphoribosyltransferase-like protein in the genome of the uracil-independent Star Merella bombicola strain is deleted or inactivated; (L) Selecting 5-FOA-resistant cells as the first transformants; (M) Introducing a second target polynucleotide and a gene encoding or equivalent of an orotate phosphoribosyltransferase-like protein into the genome of the first transformants selected in step (L); (N) Selecting uracil-independent cells as the second transformants.

[25] The method according to

[24] , wherein steps (K) to (N) are repeated multiple times.

[0103]

[26] The method according to any one of

[11] to

[25] , wherein the gene encoding the orotinic acid phosphoribosyltransferase-like protein is a gene consisting of the nucleotide sequence shown in SEQ ID NO: 1, and the gene corresponding to the gene encoding the orotinic acid phosphoribosyltransferase-like protein is a gene consisting of a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in SEQ ID NO: 1.

[27] The method according to any one of

[11] to

[26] , wherein the mutant strain is a mutant strain that does not contain foreign genes.

[28] The method according to any one of

[15] to

[19] and

[23] to

[27] , wherein the target polynucleotide is a polynucleotide derived from the same organism as the mutant strain.

[0104] A transformant obtained by the method described in any one of the following paragraphs:

[29]

[11] to

[28] .

[30] A transformant according to

[29] , wherein a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 25 or an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 25 is suppressed or inactivated.

[31] A transformant according to

[29] or

[30] , wherein a gene consisting of the nucleotide sequence shown in SEQ ID NO: 24 or a gene consisting of a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in SEQ ID NO: 24 is deleted or inactivated.

[0105] A method for producing glycolipids, comprising culturing a mutant strain according to any one of items [1] to [5] or a transformant according to any one of items

[29] to

[31] .

[33] The method according to

[32] , wherein the glycolipid is selected from sophorolipid, Bola-type sophorolipid, Bola-type sophoroside, alkyl sophoroside, alkyl glucoside, Bola-type glucoside, acid glucolipid and cellobiose lipid, preferably selected from sophorolipid, Bola-type sophoroside and alkyl sophoroside, and more preferably sophorolipid.

[34] The method according to

[32] or

[33] , wherein the culture medium for the culture contains the following substrates: at least one substrate selected from the group consisting of C12-C22 fatty acids and their alkyl esters, triacylglycerols, diacylglycerols and monoacylglycerols containing C12-C22 fatty acids or their alkyl esters, oils and fats containing C12-C22 fatty acids or their alkyl esters, C12-C22 alkanes, C12-C22 alkenes, C12-C22 alkynes, and C12-C22 alcohols; At least one substrate selected from the group consisting of C12-C18 fatty acids and their alkyl esters, triacylglycerols, diacylglycerols and monoacylglycerols containing C12-C18 fatty acids or their alkyl esters, oils and fats containing C12-C18 fatty acids or their alkyl esters, C12-C18 alkanes, C12-C18 alkenes, C12-C18 alkynes, and C12-C18 alcohols; or at least one substrate selected from the group consisting of C12-C18 fatty acids and their alkyl esters, triacylglycerols containing C12-C18 fatty acids or their alkyl esters, and C12-C18 alcohols.

[35] The content of the substrate in the culture medium is preferably 0.1 mass / vol.% or more, more preferably 0.5 mass / vol.% or more, even more preferably 1 mass / vol.% or more, even more preferably 2 mass / vol.% or more, even more preferably 3 mass / vol.% or more, even more preferably 5 mass / vol.% or more, and preferably 40 mass / vol.% or less, more preferably 30 mass / vol.% or less, even more preferably 25 mass / vol.% or less, even more preferably 20 mass / vol.% or less, even more preferably 15 mass / vol.% or less, even more preferably 10 mass / vol.% or less, or preferably 0.1 to 40 mass / vol.%, 0.1 to 30 mass / vol.%, 0.1 to 25 mass / vol.%, 0.1 to 20 mass / vol.%, 0.1 to 15 mass / vol.%, 0.1 to 10 mass / vol.%, 0.5 to 40 mass / Volume%, 0.5–30 mass / volume%, 0.5–25 mass / volume%, 0.5–20 mass / volume%, 0.5–15 mass / volume%, 0.5–10 mass / volume%, 1–40 mass / volume%, 1–30 mass / volume%, 1–25 mass / volume%, 1–20 mass / volume%, 1–15 mass / volume%, 1–10 mass / volume%, 2–40 mass / volume%, 2–30 mass / volume%, 2–25 mass / volume%, 2–20 mass / The method according to

[34] , wherein the amount is vol%, 2-15 mass / vol%, 2-10 mass / vol%, 3-40 mass / vol%, 3-30 mass / vol%, 3-25 mass / vol%, 3-20 mass / vol%, 3-15 mass / vol%, 3-10 mass / vol%, 5-40 mass / vol%, 5-30 mass / vol%, 5-25 mass / vol%, 5-20 mass / vol%, 5-15 mass / vol%, or 5-10 mass / vol%.

[36] The method according to any one of

[32] to

[35] , further comprising recovering glycolipids from the culture medium after cultivation.

[0106]

[37] A uracil-requiring selective marker comprising a gene encoding orotate phosphoribosyltransferase-like protein or an equivalent gene, preferably an isolated gene encoding orotate phosphoribosyltransferase-like protein or an equivalent isolated gene.

[38] The uracil-requiring selective marker according to

[37] , wherein the gene encoding orotate phosphoribosyltransferase-like protein is a gene comprising the nucleotide sequence shown in SEQ ID NO: 1, and the gene equivalent to the gene encoding orotate phosphoribosyltransferase-like protein is a gene comprising a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in SEQ ID NO: 1.

[39] Use of a gene encoding orotate phosphoribosyltransferase-like protein or an equivalent gene, preferably an isolated gene encoding orotate phosphoribosyltransferase-like protein or an equivalent isolated gene, as a uracil-requiring selective marker.

[40] The use according to

[39] , wherein the gene encoding the orotinic acid phosphoribosyltransferase-like protein is a gene consisting of the nucleotide sequence shown in SEQ ID NO: 1, and the gene corresponding to the gene encoding the orotinic acid phosphoribosyltransferase-like protein is a gene consisting of a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in SEQ ID NO: 1.

[41] A vector or DNA fragment containing a gene encoding an orotinic acid phosphoribosyltransferase-like protein or a gene corresponding thereto.

[42] The vector or DNA fragment according to

[41] , wherein the gene encoding the orotinic acid phosphoribosyltransferase-like protein is a gene consisting of the nucleotide sequence shown in SEQ ID NO: 1, and the gene corresponding to the gene encoding the orotinic acid phosphoribosyltransferase-like protein is a gene consisting of a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in SEQ ID NO: 1.

[0107] The present invention will be described in more detail below using examples, but the technical scope of the present invention is not limited to the following examples.

[0108] Example 1 (1) Extraction of genomic DNA from NBRC10243 strain Using Gentoru-kun (for yeast) High Recovery (Takara Bio Inc.), genomic DNA was extracted and purified from NBRC10243 strain (ATCC22214 strain), the reference strain of Star Merella bombicola, according to the attached protocol.

[0109] (2) Unless otherwise specified, PrimeSTAR Max DNA Polymerase (Takara Bio Inc.) was used for all PCR operations from the preparation of the template plasmid pbJK13 for the introduced DNA fragment. Genomic DNA fragment 1 was amplified using the genomic DNA of strain NBRC10243 as a template with primers of SEQ ID NO: 3 (GCCAAGCTTGCATGCGTTGAGCTCGTAACTCAGTGGAAGATTGAG) and SEQ ID NO: 4 (CAAACTGAAAATGTCTACCGCGGCCTAG). Similarly, genomic DNA fragment 2 was amplified using the primers for SEQ ID NO: 5 (GACATTTTCAGTTTGACTATGGAAATTAATGAAGAATTGGGCTGGCCGGCAG) and SEQ ID NO: 6 (TCTGCAGACATAGCCGAAATTCTACTGTGAG), and genomic DNA fragment 3 was amplified using the primers for SEQ ID NO: 7 (GGCTATGTCTGCAGAAGCGGGACAAGTATAGGACTGAGTTCAGCAAATAG) and SEQ ID NO: 8 (AGAGTCGACCTGCAGCAGTGCAAGTTCTGCCGCTGTAAATTTCGGTTCCAC). Furthermore, vector DNA fragments were amplified using pHSG298 (Takara Bio Inc.) as a template, with the primers for SEQ ID NO: 9 (GCATGCAAGCTTGGCACTGGCCGTC) and SEQ ID NO: 10 (CTGCAGGTCGACTCTAGAGGATCCCCG). The four PCR products described above were purified using NucleoSpin Gel and PCR Clean-up (Takara Bio Inc.), and then ligated using In-Fusion HD cloning kit (Clontech Inc.). The resulting plasmid solution was used to transform ECOS Competent E. Coli DH5α strain (Nippon Gene Inc.), and the cell suspension was spread onto LB agar medium containing kanamycin and left to stand overnight at 37°C. The resulting colonies were used as templates, and colony PCR was performed using Sapphire Amp (Takara Bio Inc.) as the enzyme.The introduction of the target DNA fragment was confirmed using primers for SEQ ID NO: 11 (CTCTTCGCTATTACGCCAGC) and SEQ ID NO: 12 (CACTTTATGCTTCCGGCTCG). Transformants containing the plasmid in which gene introduction was confirmed were inoculated into 2 mL of LB liquid medium containing kanamycin and cultured overnight at 37°C. Plasmid purification was performed from this culture medium using NucleoSpin Plasmid EasyPure (Takara Bio Inc.) to obtain plasmid pbJK13, which contained a DNA fragment in which genomic DNA fragment 2 was inserted between 887 bp upstream and 902 bp downstream of the gene shown in SEQ ID NO: 1. Note that genomic DNA fragment 2 was conveniently sandwiched between the upstream and downstream sequences, but any sequence is acceptable, and it is not required.

[0110] (3) Preparation of introduced DNA fragments Using plasmid pbJK13 as a template, a DNA fragment was amplified by ligating the upstream 887 bp, genomic DNA fragment 2, and downstream 902 bp of the gene shown in SEQ ID NO: 1 (hereinafter also referred to as the ura gene) using the primers of SEQ ID NO: 13 (GTTGAGCTCGTAACTCAGTGGAAG) and SEQ ID NO: 14 (CAGTGCAAGTTCTGCCGCTG). The obtained PCR product was treated with DpnI (Takara Bio Inc.), and the DNA fragment was further purified using NucleoSpin Gel and PCR Clean-up (Takara Bio Inc.). Sequence verification of the obtained DNA fragments confirmed that all of these DNA fragments consist of gene sequences present in the genome of strain NBRC10243.

[0111] (4) Insertion of DNA fragments into the T1Δseq1::ade strain and preparation of T1Δseq1::ade,Δura::ade strains Using the DNA fragments obtained in (3), the Star Merella bombicola T1Δseq1::ade strain (uracil-free) described in Example 2 of PCT / JP2024 / 037995 was transformed by electroporation (neppazine). The transformed cell saturation was spread onto minimal agar + uracil + 5-fluoroorotic acid (5-FOA) medium (0.7 mass / vol.% yeast nitrogen base (amino acid-free), 2 mass / vol.% glucose, 0.03 mass / vol.% uracil, 0.1 mass / vol.% 5-FOA, 1.5 mass / vol.% agar) and cultured statically at 30°C. Using the obtained colonies as templates, PCR was performed using primers for SEQ ID NO: 15 (CTCTTGGTAGCAAAGAGGCCAC) and SEQ ID NO: 16 (CACCTTTTCTATCGAGGATG), and the amplified fragments were sequenced. It was confirmed that the introduced DNA fragments were incorporated into the genome, and this strain was designated as the T1Δseq1::ade,Δura::ade strain. In this mutant strain, genomic DNA fragment 2 is inserted, replacing the DNA sequence containing SEQ ID NO: 1 in the genome.

[0112] (5) Phenotypic confirmation of T1Δseq1::ade, Δura::ade strains Three T1Δseq1::ade, Δura::ade strains isolated from different colonies obtained in (4), along with the host strain T1Δseq1::ade, were inoculated into potato dextrose agar (PDA) medium (0.4 mass / vol.% potato extract, 2 mass / vol.% glucose, 1.5 mass / vol.% agar), minimal agar medium (0.7 mass / vol.% yeast nitrogen base (amino acid-free), 2 mass / vol.% glucose, 1.5 mass / vol.% agar), minimal agar + uracil medium (0.7 mass / vol.% yeast nitrogen base (amino acid-free), 2 mass / vol.% glucose, 0.03 mass / vol.% uracil, 1.5 mass / vol.% agar), and minimal agar + uracil + 5-FOA medium, and then incubated statically at 30°C. As a result, growth was observed in the host strain on minimal agar medium, while growth was not observed in the acquired T1Δseq1::ade,Δura::ade strain, confirming that uracil requirement was conferred by the deletion of the DNA sequence of Sequence ID No. 1 (Figure 1). Furthermore, growth was not observed in the host strain on minimal agar + uracil + 5-FOA medium, while growth was observed in the T1Δseq1::ade,Δura::ade strain, confirming that 5-FOA resistance was conferred by the deletion of the DNA sequence of Sequence ID No. 1 (Figure 1).

[0113] Example 2 (1) Extraction of genomic DNA from NBRC10243 strain Using Gentoru-kun (for yeast) High Recovery (Takara Bio Inc.), genomic DNA was extracted and purified from NBRC10243 strain (ATCC22214 strain), the reference strain of Star Merella bombicola, according to the attached protocol.

[0114] (2) Unless otherwise specified, PrimeSTAR Max DNA Polymerase (Takara Bio Inc.) was used for all PCR operations performed after the preparation of the template plasmid pbJK19 for the introduced DNA fragment. Genomic DNA fragment 1 was amplified using the genomic DNA of strain NBRC10243 as a template with primers for SEQ ID NO: 3 (GCCAAGCTTGCATGCGTTGAGCTCGTAACTCAGTGGAAGATTGAG) and SEQ ID NO: 4 (CAAACTGAAAATGTCTACCGCGGCCTAG). Similarly, genomic DNA fragment 4 was amplified using primers for SEQ ID NO: 17 (GACATTTTCAGTTTGAGCGGGACAAGTATAGGACTGAGTTCAGCAAATAG) and SEQ ID NO: 8 (AGAGTCGACCTGCAGCAGTGCAAGTTCTGCCGCTGTAAATTTCGGTTCCAC). Furthermore, using pHSG298 (Takara Bio Inc.) as a template, the vector DNA fragment was amplified using primers for Sequence ID No. 9 (GCATGCAAGCTTGGCACTGGCCGTC) and Sequence ID No. 10 (CTGCAGGTCGACTCTAGAGGATCCCCG). After purifying each DNA fragment from the three PCR products using NucleoSpin Gel and PCR Clean-up (Takara Bio Inc.), they were ligated using In-Fusion HD cloning kit (Clontech Inc.). The resulting plasmid solution was used to transform ECOS Competent E. Coli DH5α strain (Nippon Gene Inc.), and the cell suspension was spread onto LB agar medium containing kanamycin and left to stand overnight at 37°C. Using the resulting colonies as a template, colony PCR was performed using Sapphire Amp (Takara Bio Inc.) as the enzyme. The introduction of the target DNA fragment was confirmed using primers for SEQ ID NO: 11 (CTCTTCGCTATTACGCCAGC) and SEQ ID NO: 12 (CACTTTATGCTTCCGGCTCG). Transformants containing plasmids in which gene introduction was confirmed were inoculated into 2 mL of LB liquid medium containing kanamycin and incubated overnight at 37°C.Plasmid pbJK19 was obtained from this culture medium using NucleoSpin Plasmid EasyPure (Takara Bio Inc.), which contained a DNA fragment in which the upstream 887bp and downstream 902bp of the gene shown in Sequence ID No. 1 were ligated.

[0115] (3) Preparation of introduced DNA fragments Using plasmid pbJK19 as a template, a DNA fragment was amplified using primers from Sequence ID No. 13 (GTTGAGCTCGTAACTCAGTGGAAG) and Sequence ID No. 14 (CAGTGCAAGTTCTGCCGCTG) to ligate the upstream 887bp and downstream 902bp of the gene shown in Sequence ID No. 1 (hereinafter also referred to as the ura gene). The obtained PCR product was treated with DpnI (Takara Bio), and the DNA fragment was further purified using NucleoSpin Gel and PCR Clean-up (Takara Bio). The obtained DNA fragment was sequenced and confirmed to consist entirely of gene sequences present in the genome of strain NBRC10243.

[0116] (4) Insertion of DNA fragments into NBRC10243 strain and preparation of NBRC10243Δura strain Using the DNA fragments obtained in (3), Star Merella bombicola NBRC10243 strain (uracil-free) was transformed by electroporation (neppazine). The transformed cell saturates were spread onto 5-fluoroorotic acid (5-FOA)-containing SD medium (4.7 mass / vol.% Minimum SD Agar Base (Clontech), 0.08 mass / vol.% -Ura DO Supplement (Clontech), 0.05 mass / vol.% uracil, 0.1 mass / vol.% uridine, 0.1 mass / vol.% 5-FOA, pH adjusted to 6.8 with NaOH aqueous solution) and incubated statically at 30°C. Using the obtained colonies as templates, PCR was performed using primers for SEQ ID NO: 15 (CTCTTGGTAGCAAAGAGGCCAC) and SEQ ID NO: 16 (CACCTTTTCTATCGAGGATG), and sequencing analysis (analysis of fragment length by electrophoresis) was performed on the amplified fragments. It was confirmed that the introduced DNA fragments were introduced into the genome and that the DNA sequence shown in SEQ ID NO: 1 was missing, and this strain was designated as NBRC10243Δura.

[0117] Example 3 (1) Preparation of template plasmid pbJK68 for introduced DNA fragments Using the genomic DNA of strain NBRC10243 as a template, genomic DNA fragment 5 was amplified using the primers of SEQ ID NO: 18 (GCCAAGCTTGCATGCTCCAATTTCTAAGGCGCAAGCGACGCTTCTAG) and SEQ ID NO: 19 (TCAATTGGTAAGAGGGAACGCGTAGCGAAG). Similarly, genomic DNA fragment 6 was amplified using the primers of SEQ ID NO: 20 (CCTCTTACCAATTGAGTTGAGCTCGTAACTCAGTGGAAGATTGAG) and SEQ ID NO: 21 (CATTCGGACAACAATCAGTGCAAGTTCTGCCGCTGTAAATTTCG), and genomic DNA fragment 7 was amplified using the primers of SEQ ID NO: 22 (ATTGTTGTCCGAATGCTCTGCGACGGCTC) and SEQ ID NO: 23 (AGAGTCGACCTGCAGCCCAACGCCTTGACAAGCTTTCCAAATAGAG). Furthermore, using pHSG298 (Takara Bio Inc.) as a template, the vector DNA fragments were amplified using primers for Sequence ID No. 9 (GCATGCAAGCTTGGCACTGGCCGTC) and Sequence ID No. 10 (CTGCAGGTCGACTCTAGAGGATCCCCG). After purifying each DNA fragment from the four PCR products using NucleoSpin Gel and PCR Clean-up (Takara Bio Inc.), they were ligated using In-Fusion HD cloning kit (Clontech Inc.). The resulting plasmid solution was used to transform ECOS Competent E. Coli DH5α strain (Nippon Gene Inc.), and the cell suspension was spread onto LB agar medium containing kanamycin and left to stand overnight at 37°C. Using the resulting colonies as a template, colony PCR was performed using Sapphire Amp (Takara Bio Inc.) as the enzyme. The introduction of the target DNA fragment was confirmed using primers for SEQ ID NO: 11 (CTCTTCGCTATTACGCCAGC) and SEQ ID NO: 12 (CACTTTATGCTTCCGGCTCG). Transformants containing plasmids in which gene introduction was confirmed were inoculated into 2 mL of LB liquid medium containing kanamycin and incubated overnight at 37°C.Plasmid pbJK68 was obtained from this culture medium by purifying the plasmid using NucleoSpin Plasmid EasyPure (Takara Bio Inc.). This plasmid contained a DNA fragment in which 887 bp upstream of the gene shown in SEQ ID NO: 1, the gene shown in SEQ ID NO: 1, and 902 bp downstream of the gene shown in SEQ ID NO: 1 were inserted between 1 kbp upstream and 1 kbp downstream of the gene shown in SEQ ID NO: 24 (hereinafter also referred to as the seq1 gene).

[0118] (2) Preparation of introduced DNA fragments Using plasmid pbJK68 as a template, DNA fragments were amplified using primers of SEQ ID NO: 26 (TCCAATTTCTAAGGCGCAAGCGAC) and SEQ ID NO: 27 (CCCAACGCCTTGACAAGCTTTCC). The obtained PCR products were treated with DpnI (Takara Bio Inc.), and the DNA fragments were further purified using NucleoSpin Gel and PCR Clean-up (Takara Bio Inc.). The obtained DNA fragments were sequenced and confirmed to consist entirely of gene sequences present in the genome of strain NBRC10243.

[0119] (3) Insertion of DNA fragments into the NBRC10243Δura strain and preparation of the NBRC10243ΔuraΔseq1::Ura strain Using the DNA fragments obtained in (2), the Star Merella bombicola NBRC10243Δura strain (uracil-requiring) was transformed by electroporation (neppazine). The transformed cell saturates were spread onto uracil-free SD-uracil medium (4.7 mass / vol.% Minimum SD Agar Base (Clontech), 0.08 mass / vol.% -Ura DO Supplement (Clontech), pH adjusted to 6.8 with NaOH aqueous solution) and cultured statically at 30°C. Using the obtained colonies as templates, PCR was performed using primers for SEQ ID NO: 28 (CTAACCAACCTCGAGCCCTAACAC) and SEQ ID NO: 29 (CATGATTGAGTGACGTACGATG), and sequencing analysis (analysis of fragment length by electrophoresis) was performed on the amplified fragments. It was confirmed that the gene shown in SEQ ID NO: 1 was introduced in a manner that replaced the gene region shown in SEQ ID NO: 24, and this strain was designated as NBRC10243ΔuraΔseq1::Ura strain.

[0120] Example 4 (1) Phenotypic confirmation of NBRC10243Δura strain and NBRC10243ΔuraΔseq1::Ura strain The NBRC10243Δura strain and NBRC10243ΔuraΔseq1::Ura strain obtained in Examples 2 and 3 and the host strain NBRC10243 were cultured in YPD liquid medium for 24 hours, and then a bacterial cell dilution was prepared using 1 M sorbitol solution to achieve an OD600 of 1. 5 μL of each of these dilutions was inoculated into potato dextrose agar (PDA), SD-uracil medium, and SD+uracil medium (4.7 mass / vol% Minimum SD Agar Base (Clontech), 0.08 mass / vol% Ura DO Supplement (Clontech), 0.1 mass / vol% uracil, pH adjusted to 6.8 with NaOH aqueous solution), and cultured statically at 30°C. As a result, the NBRC10243Δura strain did not grow in SD-uracil medium, but did grow in SD+uracil medium, confirming that disruption of the gene shown in Sequence ID No. 1 causes uracil requirement. Furthermore, in the NBRC10243ΔuraΔseq1::Ura strain, in which the gene shown in SEQ ID NO: 1 was reintroduced, growth was observed in SD-uracil medium, confirming that the uracil requirement had been removed (Figure 2). From these results, we found that by using the gene shown in SEQ ID NO: 1, it is possible to repeatedly perform genetic engineering without using foreign genes.

[0121] Example 5 (1) Confirmation of glycolipid production of NBRC10243Δura strain and NBRC10243ΔuraΔseq1::Ura strain The NBRC10243Δura strain and NBRC10243ΔuraΔseq1::Ura strain obtained in Examples 2 and 3 were inoculated into glycolipid production medium 2 (0.1 mass / vol. urea, 2 mass / vol. % yeast extract, 5 mass / vol. % oleic acid, 12.5 mass / vol. % glucose) and cultured with shaking at 30°C. After 96 hours of culture, 5 mL of the culture solution was collected, 5 mL of hexane was added, and the mixture was stirred for 5 seconds. After centrifugation at 3000 rpm and 25°C for 5 minutes, the hexane fraction of the supernatant was removed. Next, 5 mL of ethyl acetate was added to the remaining solution and the mixture was stirred for 5 seconds. After centrifugation at 3000 rpm and 25°C for 5 minutes, the entire ethyl acetate fraction was recovered. The recovered ethyl acetate fraction was volatilized by nitrogen gas blowing, and the glycolipids containing dissolved sophorolipids were precipitated. The weight of the precipitated glycolipids was measured, and the glycolipid concentration in the culture medium was calculated. The results are shown in Table 1. It was confirmed that glycolipids containing sophorolipids were produced in each strain.

[0122]

[0123] Comparative Example: Genetic Recombination Using the ura3 Marker (1) Preparation of Template Plasmid pbJK6 for Introduced DNA Fragments Using the genomic DNA of strain NBRC10243 as a template, genomic DNA fragment 8 was amplified using the primers of SEQ ID NO: 30 (GCCAAGCTTGCATGCAACAAGGCCGAGTATGTCGACGTTTCCAG) and SEQ ID NO: 31 (ATTATTTCTCTACAGTAGTGCCCGTGCCCTC). Similarly, genomic DNA fragment 9 was amplified using the primers of SEQ ID NO: 32 (CTGTAGAGAAATAATATGGCTGCGATGGCTGCGTGTGCCTTG) and SEQ ID NO: 33 (AACTGTTTGAGAAAACTAGATGCCCTTGTGAATGCGTGATGCAAG), and genomic DNA fragment 10 was amplified using the primers of SEQ ID NO: 34 (TTTTCTCAAACAGTTCCTTCAATGCAAC) and SEQ ID NO: 35 (AGAGTCGACCTGCAGGAAGCAGGCGAGTCGGAGCATATAC). Furthermore, using pHSG298 (Takara Bio Inc.) as a template, the vector DNA fragments were amplified using primers for Sequence ID No. 9 (GCATGCAAGCTTGGCACTGGCCGTC) and Sequence ID No. 10 (CTGCAGGTCGACTCTAGAGGATCCCCG). After purifying each DNA fragment from the four PCR products using NucleoSpin Gel and PCR Clean-up (Takara Bio Inc.), they were ligated using In-Fusion HD cloning kit (Clontech Inc.). The resulting plasmid solution was used to transform ECOS Competent E. Coli DH5α strain (Nippon Gene Inc.), and the cell suspension was spread onto LB agar medium containing kanamycin and left to stand overnight at 37°C. Using the resulting colonies as a template, colony PCR was performed using Sapphire Amp (Takara Bio Inc.) as the enzyme. The introduction of the target DNA fragment was confirmed using primers for SEQ ID NO: 11 (CTCTTCGCTATTACGCCAGC) and SEQ ID NO: 12 (CACTTTATGCTTCCGGCTCG). Transformants containing plasmids in which gene introduction was confirmed were inoculated into 2 mL of LB liquid medium containing kanamycin and incubated overnight at 37°C.Plasmid pbJK6 was obtained from this culture medium by purifying the plasmid using NucleoSpin Plasmid EasyPure (Takara Bio Inc.). The plasmid contained a DNA fragment in which a genomic DNA sequence including the gene shown in SEQ ID NO: ZZ37 was inserted between 1 kbp upstream and 1 kbp downstream of the gene shown in SEQ ID NO: 36 (hereinafter also referred to as the ura3 gene).

[0124] (2) Preparation of the introduced DNA fragment Using plasmid pbJK6 as a template, the DNA fragment was amplified using primers of SEQ ID NO: 38 (AACAAGGCCGAGTATGTCGAC) and SEQ ID NO: 39 (GAAGCAGGCGAGTCGGAGCATATAC). The obtained PCR product was treated with DpnI (Takara Bio Inc.), and the DNA fragment was further purified using NucleoSpin Gel and PCR Clean-up (Takara Bio Inc.). The obtained DNA fragment was sequenced and confirmed to be a DNA fragment in which a genomic DNA sequence containing the gene shown in SEQ ID NO: 37 (a gene encoding a phosphoribosylglycinamide formyltransferase-like protein) was inserted between 1 kbp upstream and 1 kbp downstream of the gene shown in SEQ ID NO: 36.

[0125] (3) Insertion of DNA fragments into the T1 strain Using the DNA fragments obtained in (2), the Star Merella bombicola T1 strain (adenine-requiring) described in Example 1 of PCT / JP2024 / 037995 was transformed by electroporation (neppazine). The transformed cell saturation was spread onto minimal agar medium and left to stand at 30°C for 5 days. The obtained colonies were again spread onto minimal agar medium and cultured at 30°C, after which multiple single colonies were obtained. The T1 strain used as the host is adenine-requiring and therefore cannot grow on the minimal agar medium used for selection. In other words, the obtained colonies are presumed to be strains in which adenine requirement has been removed by introducing the gene shown in Sequence ID No. 37.

[0126] (4) Confirmation of DNA fragment-introduced strains Using the colonies obtained in (3) as templates, PCR was performed using the primers for SEQ ID NO: 40 (CATGCGATATCATGATACCATACTC) and SEQ ID NO: 41 (GAGTGTCAGATTAGCCTCCGACATAG), and sequencing analysis of the amplified fragments (analysis of fragment length by electrophoresis) was performed. The transformation described in (3) was performed three times, and eight single colonies were obtained from each attempt, for a total of 24 colonies being examined. In all colonies, as designed, two bands were simultaneously observed: one in which the gene shown in SEQ ID NO: 37 was knocked into the ura3 gene region shown in SEQ ID NO: 36, and another in which the ura3 region was not disrupted (native band) (Figure 3). Furthermore, none of the colonies showed growth in a culture medium containing 5-FOA. These results highlight the challenges in using the gene shown in SEQ ID NO: 36 (ura3) as a genetically modified marker.

Claims

1. A Star Merella bombicola mutant in which orotinic acid phosphoribosyltransferase-like protein or an equivalent protein is suppressed or inactivated.

2. The mutant strain according to claim 1, wherein the orotinic acid phosphoribosyltransferase-like protein is a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 2, and the protein corresponding to the orotinic acid phosphoribosyltransferase-like protein is a polypeptide comprising an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO:

2.

3. The mutant strain according to claim 1 or 2, wherein a gene encoding orotinic acid phosphoribosyltransferase-like protein or an equivalent gene is deleted or inactivated.

4. The mutant strain according to claim 3, wherein the gene encoding the orotinic acid phosphoribosyltransferase-like protein is a gene consisting of the nucleotide sequence shown in SEQ ID NO: 1, and the gene corresponding to the gene encoding the orotinic acid phosphoribosyltransferase-like protein is a gene consisting of a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in SEQ ID NO:

1.

5. A mutant strain according to any one of claims 1 to 4, which is uracil-requiring.

6. A method for producing a Star Merella bombicola mutant, comprising suppressing or inactivating the expression of orotinic acid phosphoribosyltransferase-like protein or an equivalent protein in Star Merella bombicola.

7. The method according to claim 6, wherein the orotinic acid phosphoribosyltransferase-like protein is a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 2, and the protein corresponding to the orotinic acid phosphoribosyltransferase-like protein is a polypeptide comprising an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO:

2.

8. The method according to claim 6 or 7, which is a method for producing a uracil-requiring Star Merella bombicola mutant.

9. A method for producing a transformant of Star Merella bombicola, comprising using a gene encoding an orotinic acid phosphoribosyltransferase-like protein or an equivalent gene as a selection marker.

10. The method according to claim 9, comprising using the mutant strain described in any one of claims 1 to 5 as a host.

11. The method according to claim 9, comprising the following steps (A) and (B): (A) introducing a gene encoding a target polynucleotide and an orotinic acid phosphoribosyltransferase-like protein or an equivalent gene into a mutant strain according to any one of claims 1 to 5; (B) selecting uracil-free cells as transformants.

12. The method according to claim 9, comprising the following steps (G) and (H): (G) introducing a gene encoding an orotinic acid phosphoribosyltransferase-like protein or an equivalent gene into the genome of the mutant strain according to any one of claims 1 to 5 such that a target endogenous polynucleotide in the genome of the mutant strain is deleted or inactivated; (H) selecting uracil-independent cells as transformants.

13. The method according to claim 9, comprising the following steps (K) and (L): (Q) introducing the target polynucleotide into the genome of a uracil-independent Star Merella bombicola strain such that a gene encoding or equivalent of an orotate phosphoribosyltransferase-like protein in the genome of the uracil-independent Star Merella bombicola strain is deleted or inactivated; (R) selecting 5-fluoroorotate (5-FOA) resistant cells as transformants.

14. A transformant obtained by the method described in any one of claims 9 to 13.

15. The transformant according to claim 14, wherein a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 25 or an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 25 is suppressed or inactivated.

16. A method for producing glycolipids, comprising culturing a mutant strain according to any one of claims 1 to 5 or a transformant according to claim 14 or 15.

17. The method according to claim 16, wherein the glycolipid is selected from sophorolipid, Bola-type sophorolipid, Bola-type sophoroside, alkyl sophoroside, alkyl glucoside, Bola-type glucoside, acidic glucolipid, and cellobiose lipid.

18. A uracil-required selection marker consisting of a gene encoding an orotinic acid phosphoribosyltransferase-like protein or an equivalent gene.

19. The uracil-required selection marker according to claim 18, wherein the gene encoding the orotinic acid phosphoribosyltransferase-like protein is a gene consisting of the nucleotide sequence shown in SEQ ID NO: 1, and the gene corresponding to the gene encoding the orotinic acid phosphoribosyltransferase-like protein is a gene consisting of a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in SEQ ID NO:

1.

20. A vector or DNA fragment containing a gene encoding an orotinic acid phosphoribosyltransferase-like protein or an equivalent gene.