Microorganism, and method for producing ornithine or citrulline using same

By introducing exogenous glutamine synthase from Aureibacillus halotolerans or Bacillus subtilis into Corynebacterium microorganisms, the production of ornithine and citrulline is enhanced, addressing the need for high-yield methods in amino acid production.

WO2026111105A1PCT designated stage Publication Date: 2026-05-28CJ CHEILJEDANG CORP
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
CJ CHEILJEDANG CORP
Filing Date
2025-08-12
Publication Date
2026-05-28

AI Technical Summary

Technical Problem

There is a growing need for high-yield methods to produce ornithine and citrulline, which are amino acids with applications in muscle building, reducing body fat, and treating liver conditions, as existing target-specific approaches for amino acid production in Corynebacterium strains are inadequate.

Method used

Introduce exogenous glutamine synthase derived from Aureibacillus halotolerans or Bacillus subtilis into Corynebacterium microorganisms to enhance their ornithine and citrulline production capacity, followed by culturing and recovering these amino acids from the microorganisms.

Benefits of technology

Significantly improves the production capacity of ornithine and citrulline in Corynebacterium strains, achieving higher yields compared to strains without the introduced glutamine synthase.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

The present disclosure relates to a microorganism in which the activity of glutamine synthetase is enhanced, and a method for producing ornithine or citrulline using same, and the microorganism of the present disclosure can be widely used to produce ornithine or citrulline in high yield.
Need to check novelty before this filing date? Find Prior Art

Description

Microorganisms and methods for producing ornithine or citrulline using them

[0001] Cross-citation with related application(s)

[0002] The present disclosure claims the benefit of priority based on Korean Patent Application No. 10-2024-0167779 filed November 21, 2024, and all contents disclosed in the documents of said Korean patent application are incorporated as part of the present disclosure.

[0003] The present disclosure relates to a method for producing ornithine or citrulline, comprising a microorganism with enhanced glutamine synthase activity and the step of culturing said microorganism.

[0004]

[0005] Microorganisms of the genus Corynebacterium, particularly Corynebacterium glutamicum, are Gram-positive microorganisms widely used in amino acid production.

[0006] L-ornithine is a type of amino acid with glutamic acid as its precursor, which is converted into L-citrulline and putrescine in the body. Because it is effective for muscle building and reducing body fat, it is used as a nutritional supplement and is also utilized as a medicine to improve liver cirrhosis and liver dysfunction. Citrulline is known for its physiological effects, such as promoting ammonia metabolism, improving blood flow through vasodilation, lowering blood pressure, neurotransmission, boosting immunity, and scavenging free radicals.

[0007] Target-specific approaches are primarily used for the production of amino acids, such as increasing the expression of genes encoding enzymes involved in amino acid biosynthesis in strains of the genus Corynebacterium or removing genes unnecessary for amino acid biosynthesis (US 9644009 B2).

[0008] With the increasing demand for ornithine and citrulline, there is a growing need for research on methods to produce ornithine and citrulline with high yields.

[0009]

[0010] One example of the present disclosure provides a microorganism of the genus Corynebacterium having the ability to produce ornithine or citrulline, into which the activity of an exogenous glutamine synthetase has been introduced.

[0011] The above glutamine synthase may be derived from Aureibacillus halotolerans or Bacillus subtilis.

[0012] Another example of the present disclosure provides a composition for producing ornithine or citrulline comprising the microorganism.

[0013] Another example of the present disclosure is the step of culturing the microorganism, and

[0014] A method for producing ornithine or citrulline is provided, comprising the step of recovering ornithine or citrulline from the cultured microorganisms, the medium, or both thereof.

[0015] Another example of the present disclosure provides a use for the production of L-arginine by the microorganism.

[0016]

[0017] The present disclosure provides a recombinant strain with enhanced ornithine or citrulline production capacity by deriving an exogenous glutamine synthase that increases the ornithine and / or citrulline production capacity of a microorganism of the genus Corynebacterium and introducing it into an ornithine or citrulline-producing microorganism.

[0018] In the present disclosure, as a representative example of an exogenous glutamine synthase, a glutamine synthase derived from Aureibacillus halotolerans or a glutamine synthase derived from Bacillus subtilis, and the gene encoding them were introduced (expressed) into a microorganism that produces ornithine or citrulline, and it was confirmed that the production capacity of ornithine and / or citrulline was significantly improved compared to a microorganism in which the said gene was not expressed and / or a microorganism in which a glutamine synthase derived from Corynebacterium glutamicum was introduced (expressed).

[0019]

[0020] One example of the present disclosure provides a microorganism of the genus Corynebacterium having the ability to produce ornithine or citrulline, into which the activity of an exogenous glutamine synthetase has been introduced.

[0021] In the present disclosure, "glutamine synthetase (or GlnA protein)" may mean an enzyme (EC: 6.3.1.2) that mediates the ATP-dependent biosynthetic reaction of glutamine from glutamate and ammonia. In the present disclosure, the type I glutamate-ammonia ligase may be used interchangeably with "type I glutamate-ammonia ligase," "glutamine synthetase," and "GlnA protein."

[0022] In one example, the foreign glutamine synthase may be of foreign microbial origin and may consist of an amino acid sequence having 80% or more sequence homology with the amino acid sequence of SEQ ID NO. 1.

[0023] In one example, the foreign glutamine synthase may be derived from a microorganism of the genus Corynebacterium (e.g., Corynebacterium glutamicum), a microorganism of the genus Aureibacillus (e.g., Aureibacillus halotolerans), or a microorganism of the genus Bacillus (e.g., Bacillus subtilis), but is not limited thereto.

[0024] In one example, the glutamine synthase may be derived from Aureibacillus halotolerans. The sequence of the glutamine synthase derived from Aureibacillus halotolerans can be obtained from GenBank of NCBI, a known database (e.g., NCBI Reference Sequence: WP_133580410.1).

[0025] In one example, the glutamine synthase derived from Aureibacillus halotorrens may be a protein comprising the amino acid sequence of SEQ ID NO. 1, or a protein having sequence identity or homology of 80% or more, 81% or more, 82% or more, 83% or more, 83.11% or more, 85% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, 99.5% or more, or 99.9% or more with respect to the amino acid sequence of SEQ ID NO. 1. Specifically, the glutamine synthase derived from Aureibacillus halotorrens may be composed of the amino acid sequence of SEQ ID NO. 1.

[0026] In one example, the glutamine synthase may be derived from Bacillus subtilis. The sequence of the glutamine synthase derived from Bacillus subtilis can be obtained from GenBank of NCBI, a known database (e.g., NCBI Reference Sequence: WP_003231737.1).

[0027] In one example, the glutamine synthase derived from Bacillus subtilis may be a protein comprising the amino acid sequence of SEQ ID NO. 3, or a protein having sequence identity or homology of 80% or more, 81% or more, 82% or more, 83% or more, 83.11% or more, 85% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, 99.5% or more, or 99.9% or more with respect to the amino acid sequence of SEQ ID NO. 3, and specifically, the glutamine synthase derived from Bacillus subtilis may be composed of the amino acid sequence of SEQ ID NO. 3.

[0028]

[0029] The above-mentioned microorganism of the genus Corynebacterium may have the activity of glutamine synthase derived from Aureibacillus halothorax or Bacillus subtilis introduced, or may additionally contain or express glutamine synthase derived from Aureibacillus halothorax or Bacillus subtilis.

[0030] The microorganism into which the activity of the glutamine synthase derived from Aureibacillus halothorax is introduced may be a recombinant microorganism into which a polynucleotide encoding the glutamine synthase derived from Aureibacillus halothorax described above is introduced. In one example, the polynucleotide encoding the glutamine synthase of SEQ ID NO. 1 may be a polynucleotide having at least 60%, at least 70%, at least 75%, at least 76%, at least 77%, at least 77.39%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or at least 99.9% sequence identity or homology with the nucleic acid sequence of SEQ ID NO. 2. Specifically, the polynucleotide encoding the glutamine synthase derived from Aureibacillus halotorerans may be composed of the nucleic acid sequence of SEQ ID NO. 2.

[0031] The microorganism into which the activity of the glutamine synthase derived from Bacillus subtilis is introduced may be a recombinant microorganism into which a polynucleotide encoding the glutamine synthase derived from Bacillus subtilis described above is introduced. In one example, the polynucleotide encoding the glutamine synthase of SEQ ID NO. 3 may be a polynucleotide having at least 60%, at least 70%, at least 75%, at least 76%, at least 77%, at least 77.39%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or at least 99.9% sequence identity or homology with the nucleic acid sequence of SEQ ID NO. 4. Specifically, the polynucleotide encoding the glutamine synthase derived from Bacillus subtilis may be composed of the nucleic acid sequence of SEQ ID NO. 4.

[0032] In the foregoing, the term "homology" refers to the degree of correspondence with a given amino acid sequence or base sequence and may be expressed as a percentage. In this disclosure, a homologous sequence having the same or similar activity as a given amino acid sequence or base sequence is indicated as "% homology." For example, this can be verified by using standard software, specifically BLAST 2.0, to calculate parameters such as score, identity, and similarity, or by comparing sequences by Southern hybridization experiments under defined strict conditions, and the defined appropriate hybridization conditions may be determined by methods within the scope of the art and well known to those skilled in the art (e.g., J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; FM Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York).

[0033] The Corynebacterium microorganism into which the activity of the above-mentioned foreign glutamine synthase (e.g., glutamine synthase derived from Aureibacillus halothorax or Bacillus subtilis) has been introduced may be a Corynebacterium microorganism having the ability to produce ornithine or citrulline.

[0034] In the present disclosure, the terms “ornithine or citrulline-producing Corynebacterium microorganism” or “Corynebacterium microorganism having ornithine or citrulline-producing ability” refer to cases where a Corynebacterium microorganism having ornithine or citrulline-producing ability has increased ornithine or citrulline-producing ability by being mutated to introduce (express) the activity of a foreign-derived glutamine synthase (e.g., derived from Aureibacillus halotorens or Bacillus subtilis), and / or cases where a Corynebacterium microorganism not having ornithine or citrulline-producing ability becomes ornithine or citrulline-producing ability by being mutated to introduce (express) the foreign glutamine synthase (e.g., derived from Aureibacillus halotorens or Bacillus subtilis). It may be used. In this disclosure, "microorganism" encompasses single-celled bacteria and may be used interchangeably with "cell."

[0035] In the present disclosure, the microorganism prior to being mutated to introduce (express) the foreign glutamine synthase (e.g., glutamine synthase derived from Aureibacillus halotorerans or Bacillus subtilis) may be referred to as a “parent microorganism or parent strain or host cell” to distinguish it from the mutated microorganism.

[0036] In one example, the genus Corynebacterium microorganism may be selected from all genus Corynebacterium microorganisms having the ability to produce ornithine and / or citrulline amino acids. In one example, the genus Corynebacterium microorganism, e.g., the parent strain before mutation, may be (1) a genus Corynebacterium microorganism that naturally has the ability to produce ornithine or citrulline, or (2) a genus Corynebacterium microorganism that naturally has the ability to produce ornithine or citrulline, or a strain that has no or significantly less ornithine or citrulline production ability, into which a mutation has been introduced to have the ability to produce ornithine or citrulline or to have an improved ability to produce ornithine or citrulline.

[0037] The above-mentioned microorganisms of the genus Corynebacterium may include, but are not limited to, Corynebacterium glutamicum, Corynebacterium stationis, Brevibacterium lactofermentum, Brevibacterium flavum, Corynebacterium thermoaminogenes, Corynebacterium efficiens, etc. More specifically, the above-mentioned microorganism of the genus Corynebacterium may be Corynebacterium glutamicum.

[0038] In one example, the microorganism into which the activity of glutamine synthase derived from Aureibacillus halothorax or Bacillus subtilis has been introduced may have an increased ornithine and / or citrulline production capacity compared to a non-modified microorganism of the same species and / or a microorganism expressing glutamine synthase derived from a microorganism of a different genus or a microorganism of a different species.

[0039] The above-mentioned non-modified microorganism is a microorganism that does not express glutamine synthase derived from Aureibacillus halothorax or Bacillus subtilis, and may refer to a microorganism of the same species into which a mutation causing the expression of glutamine synthase derived from Aureibacillus halothorax or Bacillus subtilis has not been introduced, or a microorganism prior to the introduction of said mutation.

[0040] In the present disclosure, "a variant that introduces / expresses the activity of a glutamine synthase derived from Aureibacillus halotorens or Bacillus subtilis" may mean any operation that causes a parent strain to express the glutamine synthase derived from Aureibacillus halotorens or Bacillus subtilis as described above. In one example, a variant that causes the expression of a glutamine synthase derived from Aureibacillus halotorens or Bacillus subtilis may be the introduction of a polynucleotide encoding the glutamine synthase derived from Aureibacillus halotorens or Bacillus subtilis, or a recombinant vector containing the same, into the parent strain.

[0041] The above "microorganism into which the activity of glutamine synthase derived from Aureibacillus halotorerans or Bacillus subtilis has been introduced" or "microorganism mutated to express glutamine synthase derived from Aureibacillus halotorerans or Bacillus subtilis" may be a microorganism into which a polynucleotide encoding glutamine synthase derived from Aureibacillus halotorerans or Bacillus subtilis, or a recombinant vector containing the same has been introduced, and may be one in which ornithine and / or citrulline production ability is conferred or increased compared to a non-mutated microorganism and / or a microorganism expressing glutamine synthase derived from a microorganism of another genus or a microorganism of another species.

[0042] The above "microorganism expressing glutamine synthase derived from a microorganism of a different genus or a different species" may be a microorganism expressing glutamine synthase derived from a microorganism of a different genus or a different species other than Aureibacillus halothorelans or Bacillus subtilis, and specifically, may be a microorganism expressing glutamine synthase derived from a microorganism of the genus Corynebacterium (e.g., Corynebacterium glutamicum). In one embodiment, the microorganism expressing glutamine synthase derived from a microorganism of a different genus or a different species other than Aureibacillus halothorelans or Bacillus subtilis may be a microorganism into which a gene encoding glutamine synthase derived from Corynebacterium glutamicum ATCC13869 (SEQ No. 6) or a gene encoding glutamine synthase derived from Corynebacterium glutamicum ATCC13032 (SEQ No. 37) has been introduced, but is not limited thereto.

[0043] In one example, the parent strain may be of the wild type or mutated to increase the ornithine and / or citrulline production capacity, for example, in which the protein activity involved in the biosynthesis or metabolism of ornithine and / or citrulline is regulated (increased (promoted) or decreased (inhibited)) compared to the wild type, but is not limited thereto.

[0044]

[0045] The term "introduction of activity" in the present disclosure may mean that the activity of a protein that was not present or was insufficient within a microorganism is newly introduced or increased within the microorganism. Specifically, this includes, but is not limited to, inserting or delivering a gene encoding a protein that was not present in the microorganism into the microorganism to enable expression, or inducing a mutation that enhances the expression of a protein that was not expressed or was barely expressed within the microorganism.

[0046] Meanwhile, in the present disclosure, variations such as the introduction of activity, enhancement of activity, or weakening of activity may occur through a process called transformation. In the present disclosure, the term "transformation" refers to introducing a vector containing a polynucleotide encoding a specific protein or a promoter sequence with strong or weak activity into a host cell to enable the protein encoded by the polynucleotide to be expressed within the host cell or to induce a mutation in the chromosomes of the host cell. Furthermore, the polynucleotide includes DNA and RNA encoding a target protein. The polynucleotide may be introduced in any form as long as it is capable of being introduced into a host cell to induce expression or mutation. For example, the polynucleotide may be introduced into the host cell in the form of an expression cassette, which is a gene structure containing all elements necessary for self-expression. The expression cassette may typically include a promoter, a transcription termination signal, a ribosome binding site, and a translation termination signal operably connected to the polynucleotide. The above expression cassette may be in the form of a self-replicating expression vector. Additionally, the polynucleotide may be introduced into a host cell in its own form and operably linked to a sequence required for expression in the host cell, but is not limited thereto.

[0047] In addition, the term "operably linked" as used above means that a promoter sequence and a gene sequence are functionally linked to initiate and mediate the transcription of a polynucleotide encoding a specific protein of the present disclosure.

[0048] As used in this disclosure, the term “vector” means a DNA product containing a sequence of nucleotides of a polynucleotide encoding said target protein, which is operably linked to a suitable regulatory sequence to enable the expression of said target protein within a suitable host. The regulatory sequence comprises a promoter capable of initiating transcription, any operator sequence for regulating such transcription, a sequence coding for a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation. After being transformed into a suitable host cell, the vector may replicate or function independently of the host genome and may be incorporated into the genome itself.

[0049] The vectors used in this disclosure are not particularly limited as long as they are capable of replicating within a host cell, and any vector known in the art may be used. Examples of commonly used vectors include plasmids, cosmids, viruses, and bacteriophages in their natural or recombinant state. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A may be used as phage vectors or cosmid vectors, and pBR-based, pUC-based, pBluescriptII-based, pGEM-based, pTZ-based, pCL-based, and pET-based vectors may be used as plasmid vectors. The vectors available for use in this disclosure are not particularly limited, and known expression vectors may be used. Specifically, vectors such as pDZ, pDC, pDCM2, pDC24, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC, and pCES208 can be used.

[0050]

[0051] In this disclosure, the term "weakening" of the activity of a polypeptide is a concept that includes both reduced activity and lack of activity relative to intrinsic activity. Such weakening may be used interchangeably with terms such as inactivation, deficiency, down-regulation, decrease, reduce, and attenuation.

[0052] The above weakening may include cases where the activity of the polypeptide itself is reduced or eliminated compared to the polypeptide activity originally possessed by the microorganism due to mutations in the polynucleotide encoding the polypeptide, etc.; cases where the overall degree and / or concentration (expression amount) of polypeptide activity within the cell is lower than that of the natural strain due to inhibition of gene expression of the polynucleotide encoding it or inhibition of translation into polypeptide; cases where the expression of the polynucleotide does not occur at all; and / or cases where there is no polypeptide activity even if the polynucleotide is expressed. The above "intrinsic activity" refers to the activity of a specific polypeptide originally possessed by the parent strain, wild-type, or non-modified microorganism prior to the change in traits caused by genetic mutations due to natural or artificial factors. This may be used interchangeably with "activity prior to modification." The statement that the activity of a polypeptide is "inactivated, deficient, reduced, downregulated, lowered, or attenuated" relative to its intrinsic activity means that the activity of a specific polypeptide has decreased compared to the activity originally possessed by the parent strain or non-transformed microorganism prior to the transformation.

[0053] The attenuation of the activity of such polypeptides can be performed by any method known in the art, but is not limited thereto, and can be achieved by the application of various methods well known in the art (e.g., Nakashima N et al., Bacterial cellular engineering by genome editing and gene silencing. Int J Mol Sci. 2014;15(2):2773-2793, Sambrook et al. Molecular Cloning 2012 et al.).

[0054]

[0055] Specifically, the weakening of the polypeptide of the present disclosure is

[0056] 1) Deletion of all or part of a gene encoding a polypeptide;

[0057] 2) Modification of the expression regulatory region (or expression regulatory sequence) to reduce the expression of the gene encoding the polypeptide;

[0058] 3) Modification of the amino acid sequence constituting the polypeptide so as to remove or weaken the activity of the polypeptide (e.g., deletion / substitution / addition of one or more amino acids in the amino acid sequence);

[0059] 4) Modification of the gene sequence encoding the polypeptide so as to remove or weaken the activity of the polypeptide (e.g., deletion / substitution / addition of one or more nucleotides on the nucleotide sequence of the polypeptide gene to code for a polypeptide modified so as to remove or weaken the activity of the polypeptide);

[0060] 5) A modification of the nucleotide sequence encoding the start codon or the 5'-UTR region of the gene transcript encoding the polypeptide;

[0061] 6) Introduction of an antisense oligonucleotide (e.g., antisense RNA) that binds complementarily to the transcript of the gene encoding the polypeptide;

[0062] 7) Addition of a sequence complementary to the Shine-Dalgarno sequence to the upstream end of the Shine-Dalgarno sequence of a polypeptide-coding gene to form a secondary structure incapable of ribosome attachment;

[0063] 8) Addition of a reverse-transcribed promoter to the 3' end of the ORF (open reading frame) of a gene sequence encoding a polypeptide (Reverse transcription engineering, RTE);

[0064] 9) Regulation of cellular localization of proteins (polypeptides); or

[0065] 10) It may be a combination of two or more selected from 1) to 9) above, but is not specifically limited thereto.

[0066] for example,

[0067] The deletion of part or all of the gene encoding the polypeptide mentioned above 1) may be the removal of the entire polynucleotide encoding the intrinsic target polypeptide within the chromosome, the replacement with a polynucleotide in which some nucleotides have been deleted, or the replacement with a marker gene.

[0068] Additionally, modification of the expression regulatory region (or expression regulatory sequence) described in 2) above may be a deletion, insertion, non-conservative or conservative substitution, or a combination thereof, resulting in a mutation on the expression regulatory region (or expression regulatory sequence), or replacement with a sequence having weaker activity. The expression regulatory region includes, but is not limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating the termination of transcription and translation.

[0069] In addition, the above 3) a nucleotide sequence modification coding for a start codon or 5'-UTR region of a gene transcript coding for a polypeptide may, for example, be a substitution with a nucleotide sequence coding for another start codon that has a lower polypeptide expression rate compared to the intrinsic start codon, but is not limited thereto.

[0070] In addition, the modification of the amino acid sequence or polynucleotide sequence of 4) and 5) above may be a sequence variation occurring by deletion, insertion, non-conservative or conservative substitution, or a combination thereof, of the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide to weaken the activity of the polypeptide, or a replacement with an amino acid sequence or polynucleotide sequence modified to have weaker activity or an amino acid sequence or polynucleotide sequence modified to have no activity, but is not limited thereto. For example, gene expression may be inhibited or weakened by introducing a variation within the polynucleotide sequence to form a stop codon, but is not limited thereto.

[0071] For the introduction of an antisense oligonucleotide (e.g., antisense RNA) that binds complementarily to the transcript of the gene encoding the polypeptide 6) mentioned above, refer to the literature [Weintraub, H. et al., Antisense-RNA as a molecular tool for genetic analysis, Reviews - Trends in Genetics, Vol. 1(1) 1986].

[0072] 7) Adding a sequence complementary to the Shine-Dalgarno sequence to the front of the Shine-Dalgarno sequence of a polypeptide-coding gene to form a secondary structure in which ribosome attachment is impossible may make mRNA translation impossible or slow it down.

[0073] Reverse transcription engineering (RTE) of a promoter that is transcribed in the opposite direction to the 3' end of the ORF (open reading frame) of the gene sequence encoding the polypeptide above may weaken the activity by creating an antisense nucleotide complementary to the transcript of the gene encoding the polypeptide.

[0074] The above 9) regulation of the intracellular localization of the protein (polypeptide) may involve targeting the protein (polypeptide) to a specific intracellular organelle or a specific intracellular space. For example, it may involve targeting to the periplasm or cytoplasm through the addition or removal of a leader sequence that functions for the targeting of the protein (polypeptide), but is not limited thereto.

[0075] Such weakening of polypeptide activity may involve a reduction in the activity or concentration expression of the corresponding polypeptide relative to the activity or concentration of the polypeptide expressed in the wild-type or pre-modification microbial strain, or a decrease in the amount of product produced from said polypeptide, but is not limited thereto.

[0076]

[0077] In the present disclosure, the term “enhancement” of polypeptide activity means that the activity of the polypeptide is increased compared to its intrinsic activity. Such enhancement may be used interchangeably with terms such as activation, up-regulation, overexpression, and increase. Here, activation, enhancement, up-regulation, overexpression, and increase may include exhibiting activity that was not originally possessed, or exhibiting improved activity compared to the intrinsic activity or activity prior to modification. The “intrinsic activity” refers to the activity of a specific polypeptide originally possessed by the parent strain or the non-modified microorganism prior to the change in traits caused by genetic mutations due to natural or artificial factors. This may be used interchangeably with “activity prior to modification.” "Enhancement," "upregulation," "overexpression," or "increase" of polypeptide activity relative to intrinsic activity means that it has been enhanced compared to the activity and / or concentration (expression amount) of a specific polypeptide originally possessed by the parent strain or non-modified microorganism prior to transformation.

[0078] The above enhancement can be achieved by introducing an exogenous polypeptide or by enhancing the activity and / or concentration (expression amount) of the intrinsic polypeptide. Whether the activity of the polypeptide is enhanced can be confirmed by an increase in the activity level, expression amount, or amount of product released from the polypeptide.

[0079] The enhancement of the activity of the above polypeptide may be achieved by applying various methods well known in the art, and is not limited to, as long as the activity of the target polypeptide can be enhanced compared to that of the microorganism before modification. Specifically, it may utilize, but is not limited to, gene engineering and / or protein engineering known to a person skilled in the art, which are routine methods of molecular biology (e.g., Sitnicka et al. Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012, etc.).

[0080] Specifically, the enhancement of the polypeptide of the present disclosure is

[0081] 1) Increase in the intracellular copy number of polynucleotides encoding polypeptides;

[0082] 2) Replace the chromosomal gene expression regulatory region encoding a polypeptide with a potent sequence;

[0083] 3) A modification of the nucleotide sequence encoding the start codon or the 5'-UTR region of the gene transcript encoding the polypeptide;

[0084] 4) Modification of the amino acid sequence of the polypeptide to enhance polypeptide activity;

[0085] 5) Modification of the polynucleotide sequence encoding the polypeptide to enhance polypeptide activity (e.g., modification of the polynucleotide sequence of the polypeptide gene to code for a polypeptide modified to enhance polypeptide activity);

[0086] 6) Introduction of an exogenous polypeptide exhibiting polypeptide activity or an exogenous polynucleotide encoding the same;

[0087] 7) Codon optimization of polynucleotides encoding polypeptides;

[0088] 8) Analyze the tertiary structure of the polypeptide to select and modify or chemically modify the exposed sites;

[0089] 9) Regulation of the cellular localization of proteins (polypeptides); or

[0090] 10) It may be a combination of two or more selected from 1) to 9) above, but is not specifically limited thereto.

[0091] More specifically,

[0092] The increase in the intracellular copy number of the polynucleotide encoding the above 1) polypeptide may be achieved by introducing into a host cell a vector to which the polynucleotide encoding the said polypeptide is operably linked, which can replicate and function independently of the host. Alternatively, it may be achieved by introducing one or more copies of the polynucleotide encoding the said polypeptide into the chromosomes within the host cell. The introduction into the chromosomes may be performed by introducing into the host cell a vector capable of inserting said polynucleotide into the chromosomes within the host cell, but is not limited thereto. The said vector is as described above.

[0093] Replacing the gene expression regulatory region (or expression regulatory sequence) on the chromosome encoding the polypeptide mentioned in 2) above with a sequence having potent activity may, for example, involve deletion, insertion, non-conservative or conservative substitution, or a combination thereof, to further enhance the activity of the expression regulatory region, or may involve a sequence mutation, or replacement with a sequence having stronger activity. The expression regulatory region may include, but is not limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating the termination of transcription and translation. As an example, the original promoter may be replaced with a potent promoter, but is not limited thereto.

[0094] Examples of known strong promoters include, but are not limited to, CJ1 to CJ7 promoters (US Patent No. 7662943 B2), lac promoter, trp promoter, trc promoter, tac promoter, lambda phage PR promoter, PL promoter, tet promoter, gapA promoter, SPL7 promoter, SPL13(sm3) promoter (US Patent No. 10584338 B2), O2 promoter (US Patent No. 10273491 B2), tkt promoter, yccA promoter, lysCP1 promoter (US Patent No. 8426577 B2).

[0095] The above 3) modification of the nucleotide sequence encoding the start codon or 5'-UTR region of the gene transcript encoding the polypeptide may, for example, be a substitution with a nucleotide sequence encoding another start codon that has a higher polypeptide expression rate compared to the intrinsic start codon, but is not limited thereto.

[0096] The modification of the amino acid sequence or polynucleotide sequence of 4) and 5) above may involve the occurrence of sequence mutations in the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide by deletion, insertion, non-conservative or conservative substitution, or a combination thereof, to enhance the activity of the polypeptide, or may involve replacement with an amino acid sequence or polynucleotide sequence modified to have stronger activity or an amino acid sequence or polynucleotide sequence modified to increase activity, but is not limited thereto. Specifically, the replacement may be performed by inserting the polynucleotide into the chromosome by homologous recombination, but is not limited thereto. The vector used in this case may additionally include a selection marker to confirm whether chromosome insertion has occurred. The selection marker is as described above.

[0097] The introduction of an exogenous polynucleotide exhibiting the activity of the polypeptide mentioned in 6) above may be the introduction into a host cell of an exogenous polynucleotide encoding a polypeptide that exhibits the same or similar activity as the polypeptide. As long as the exogenous polynucleotide exhibits the same or similar activity as the polypeptide, there are no restrictions on its origin or sequence. The method used for the introduction may be performed by a person skilled in the art by appropriately selecting a known transformation method, and the polypeptide may be generated and its activity increased by the expression of the introduced polynucleotide within the host cell.

[0098] The above 7) codon optimization of a polynucleotide encoding a polypeptide may be a codon optimization of the intrinsic polynucleotide such that transcription or translation increases within the host cell, or a codon optimization of the extrinsic polynucleotide such that optimized transcription or translation occurs within the host cell.

[0099] 8) Analyzing the tertiary structure of the polypeptide above to select and modify or chemically modify an exposed site may, for example, involve determining a template protein candidate based on the degree of sequence similarity by comparing the sequence information of the polypeptide to be analyzed with a database in which sequence information of known proteins is stored, and confirming the structure based on this to select and modify or chemically modify an exposed site.

[0100] The above 9) regulation of the intracellular localization of a protein (polypeptide) may involve targeting the protein (polypeptide) to a specific intracellular organelle or a specific intracellular space. For example, it may involve targeting to the periplasm or cytoplasm through the addition or removal of a leader sequence that functions for the targeting of the protein (polypeptide), but is not limited thereto.

[0101] Such enhancement of polypeptide activity may involve increasing the activity or concentration of the corresponding polypeptide based on the activity or concentration of the polypeptide expressed in the wild-type or pre-modification microbial strain, or increasing the amount of the product produced from said polypeptide, but is not limited thereto.

[0102]

[0103] Modification of part or all of a polynucleotide in the microorganism of the present disclosure may be induced by (a) homologous recombination using a vector for chromosome insertion within the microorganism or genome editing using engineered nucleases (e.g., CRISPR-Cas9) and / or (b) treatment by light and / or chemicals such as ultraviolet rays and radiation, but is not limited thereto. The method of modifying part or all of the gene may include methods using DNA recombination technology. For example, deletion of part or all of the gene may be achieved by inducing homologous recombination by injecting a nucleotide sequence or vector containing a nucleotide sequence homologous to the target gene into the microorganism. The injected nucleotide sequence or vector may include a dominant selection marker, but is not limited thereto.

[0104]

[0105] Another example of the present disclosure provides a method for increasing the ornithine and / or citrulline production capacity of a microorganism of the genus Corynebacterium or a method for conferring ornithine and / or citrulline production capacity to a microorganism of the genus Corynebacterium, comprising the step of introducing (transforming) the above-mentioned foreign glutamine synthase (e.g., glutamine synthase derived from Aureibacillus halotolerans or Bacillus subtilis), a polynucleotide encoding the same, or a recombinant vector containing said polynucleotide into said microorganism of the genus Corynebacterium.

[0106] The glutamine synthase derived from *Aureibacillus halothorax*, glutamine synthase derived from *Bacillus subtilis*, polynucleotides, and microorganisms of the genus *Corynebacterium* are as described above.

[0107]

[0108] Another example of the present disclosure provides a method for producing ornithine and / or citrulline, comprising the step of culturing a microorganism of the genus Corynebacterium in a medium to which the activity of the above-mentioned foreign glutamine synthase (e.g., glutamine synthase derived from Aureibacillus halotolerans or Bacillus subtilis) has been introduced.

[0109] In this disclosure, the term "culture" means growing the microorganisms of the genus Corynebacterium of this disclosure under appropriately controlled environmental conditions. The culture process of this disclosure may be carried out according to suitable media and culture conditions known in the art. Such culture process can be easily adjusted and used by those skilled in the art depending on the strain selected. Specifically, the culture may be batch, continuous, and / or fed-batch, but is not limited thereto.

[0110] In this disclosure, the term "medium" refers to a substance mixed with nutrients as the main component required to culture the microorganisms of the genus Corynebacterium of this disclosure, and supplies nutrients and growth factors, including water, which is indispensable for survival and growth. Specifically, the medium and other culture conditions used for culturing the microorganisms of the genus Corynebacterium of this disclosure may be any medium used for culturing ordinary microorganisms without special limitations; however, the microorganisms of the genus Corynebacterium of this disclosure may be cultured under aerobic conditions while controlling the temperature, pH, etc., in a conventional medium containing a suitable carbon source, nitrogen source, phosphorus, inorganic compounds, amino acids, and / or vitamins.

[0111] In the present disclosure, the carbon source may include carbohydrates such as glucose, saccharose, lactose, fructose, sucrose, maltose, etc.; sugar alcohols such as mannitol, sorbitol, etc.; organic acids such as pyruvate, lactic acid, citric acid, etc.; and amino acids such as glutamic acid, methionine, lysine, etc. Additionally, natural organic nutrient sources such as starch hydrolysate, molasses, blackstrap molasses, rice bran, cassava, sugarcane residue, and corn steep liquid may be used. Specifically, carbohydrates such as glucose and sterilized pre-treated molasses (i.e., molasses converted into reducing sugars) may be used, and other carbon sources in appropriate amounts may be used in various ways without limitation. These carbon sources may be used individually or in combination of two or more types, but are not limited thereto.

[0112] The above nitrogen sources may include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, ammonium nitrate, etc.; and organic nitrogen sources such as amino acids such as glutamic acid, methionine, glutamine, etc., peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquid, casein hydrolysate, fish or its decomposition products, defatted soybean cake or its decomposition products, etc. These nitrogen sources may be used alone or in combination of two or more types, but are not limited thereto.

[0113] The above ingredients may include monopotassium phosphate, dipotassium phosphate, or corresponding sodium-containing salts. Inorganic compounds may include sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, etc., and may also include amino acids, vitamins, and / or suitable precursors. These components or precursors may be added to the culture medium in a batch or continuous manner. However, they are not limited thereto.

[0114] In addition, during the cultivation of the microorganisms of the genus Corynebacterium disclosed in this disclosure, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc., may be added to the medium in an appropriate manner to adjust the pH of the medium. In addition, during cultivation, an antifoaming agent such as a fatty acid polyglycol ester may be used to suppress the formation of bubbles. Furthermore, to maintain an aerobic state of the medium, oxygen or an oxygen-containing gas may be injected into the medium, or nitrogen, hydrogen, or carbon dioxide gas may be injected without gas injection to maintain an anaerobic and microaerobic state, but is not limited thereto.

[0115] In the culture of the present disclosure, the culture temperature may be maintained at 20 to 45°C, specifically 25 to 40°C, and culture may be performed for about 10 to 160 hours, but is not limited thereto.

[0116] Ornithine and / or citrulline produced by the culture of the present disclosure may be secreted into the medium or remain within the cell.

[0117] The method for producing ornithine and / or citrulline of the present disclosure may additionally include, for example, prior to the step of preparing a microorganism of the genus Corynebacterium of the present disclosure, the step of preparing a medium for culturing said microorganism, or a combination thereof (in any order).

[0118] The method for producing ornithine and / or citrulline of the present disclosure may further include the step of recovering ornithine and / or citrulline from a culture medium (a culture medium in which the culture is performed) or from a microorganism of the genus Corynebacterium. The recovery step may further include the step of recovery after the culture step.

[0119] The above recovery may involve collecting the desired ornithine-based amino acids using a suitable method known in the art according to the culture method of the microorganisms disclosed in this disclosure, for example, batch, continuous, or fed-batch culture methods. For example, various chromatographic methods such as centrifugation, filtration, treatment with a crystallizing protein precipitating agent (salting out), extraction, ultrasonic disruption, ultrafiltration, dialysis, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity chromatography, HPLC, or a combination thereof may be used, and the desired ornithine and / or citrulline may be recovered from the culture medium or microorganisms using a suitable method known in the art.

[0120] Additionally, the method for producing ornithine and / or citrulline amino acids of the present disclosure may further include a purification step. The purification may be performed using a suitable method known in the art. In one example, where the method for producing ornithine and / or citrulline of the present disclosure includes both a recovery step and a purification step, the recovery step and the purification step may be performed sequentially or discontinuously regardless of the order, or simultaneously or integrated into a single step, but are not limited thereto.

[0121] In the method of the present disclosure, the glutamine synthase derived from *Aureibacillus halothorax*, the glutamine synthase derived from *Bacillus subtilis*, the polynucleotide, and the microorganism of the genus *Corynebacterium* are as described above.

[0122]

[0123] Another example of the present disclosure is to provide a composition for producing ornithine and / or citrulline comprising a microorganism of the genus Corynebacterium of the present disclosure, a culture medium in which said microorganism is cultured, or a combination thereof.

[0124] The compositions of the present disclosure may further comprise any suitable excipients commonly used in compositions for the production of ornithine and / or citrulline, and such excipients may be, for example, preservatives, wetting agents, dispersants, suspending agents, buffers, stabilizers or isotonic agents, but are not limited thereto.

[0125] In the composition of the present disclosure, the microorganisms of the genus Corynebacterium, the culture medium, etc. are as described above.

[0126]

[0127] Another example provides a use for the above microorganism in the production of L-arginine.

[0128] Another example provides a use for the above microorganism in the preparation of a composition for L-arginine production.

[0129]

[0130] Another example of the present disclosure provides a microorganism, method, composition, product, process, or use characterized by one or more elements disclosed in the present disclosure.

[0131]

[0132] It was confirmed that microorganisms with enhanced glutamine synthase activity through the introduction of the foreign gene of the present disclosure have increased productivity of ornithine and citrulline. Accordingly, the microorganisms of the present disclosure can be widely utilized to produce ornithine or citrulline in high yield.

[0133] The present disclosure is described in more detail below by way of examples. However, the following examples are merely preferred embodiments for illustrating the present disclosure and are therefore not intended to limit the scope of the rights of the present disclosure. Meanwhile, technical matters not described in the present disclosure can be fully understood and easily implemented by a person skilled in the art who is proficient in the technical field of the present disclosure or a similar technical field.

[0134]

[0135] Example 1. Production of L-ornithine microorganisms with enhanced glutamine synthase activity and evaluation of L-ornithine production capacity

[0136] Example 1-1. Construction of a plasmid for the introduction of the glutamine synthase gene

[0137] To determine the effect of introducing the glutamine synthase (type 1 glutamate-ammonia ligase) gene on L-ornithine production, recombinant plasmid vectors introduced with the glutamine synthase gene (glnA) derived from Corynebacterium glutamicum, Aureibacillus halotolerans, and Bacillus subtilis were constructed as follows.

[0138] Specifically, to reinforce the glutamine synthase gene (BBD29_RS10525;glnA) within the Corynebacterium glutamicum chromosome, BBD29_RS15405 (SEQ No. 7), known as the gene encoding a transposon in Corynebacterium glutamicum, was used as the insertion site (Journal of Biotechnology 104, 5-25 Jorn Kalinowski et al, 2003). To replace the BBD29_RS10525 gene in an reinforced form, a BBD29_RS15405 deletion and target gene insertion vector was constructed. To construct the vector, PCR was performed using primer pairs SEQ Nos. 9 and 10 and SEQ Nos. 11 and 12, with the chromosome of Corynebacterium glutamicum ATCC13869 as a template.

[0139] PfuUltra™ high-reliability DNA polymerase (Stratagene) was used as the polymerase for the PCR reaction, and the PCR conditions were denaturation at 95°C for 30 seconds; annealing at 55°C for 30 seconds; and polymerization at 72°C for 1 minute. The denaturation, annealing, and polymerization reactions were repeated 28 times to obtain DNA fragments of 791 bp and 804 bp, respectively. The obtained DNA products were purified using a PCR Purification kit (QUIAGEN), and the purified DNA fragments were treated with the restriction enzyme SmaI. Then, the pDC24 vector (SEQ No. 36), which was heat-treated at 65°C for 20 minutes, and the BBD29_RS15405 deletion vector pDC24ΔBBD29_RS15405 were constructed by cleaning according to the provided manual using an Infusion Cloning Kit (TaKaRa).

[0140] Then, in order to further enhance the activity of glutamine synthase, a plasmid was constructed to further enhance the glnA gene using the lysCP1 promoter (Korean Patent No. 10-0930203) (Sequence No. 15), which is known as a strong promoter.

[0141] Specifically, PCR was performed using the chromosome of Corynebacterium glutamicum ATCC13869 as a template and the primer pair of SEQ ID NOs 18 and 19 to obtain a glnA gene fragment derived from Corynebacterium glutamicum. Additionally, a lysCP1 promoter fragment was obtained using the primer pair of SEQ ID NOs 16 and 17 as a pDZ-lysCP1 template. Furthermore, PCR was performed using the chromosome of Aureibacillus halotolerans as a template and the primer pair of SEQ ID NOs 20 and 21 to obtain a glnA gene fragment derived from Aureibacillus halotolerans, and PCR was performed using the chromosome of Bacillus subtilis 168 as a template and the primer pair of SEQ ID NOs 22 and 23 to obtain a glnA gene fragment derived from Bacillus subtilis.

[0142] PfuUltra™ high-reliability DNA polymerase (Stratagene) was used as the polymerase for the PCR reaction, and the PCR conditions were denaturation at 95°C for 30 seconds; annealing at 55°C for 30 seconds; and polymerization at 72°C for 1 minute. The denaturation, annealing, and polymerization reactions were repeated 28 times to obtain a 386 bp DNA fragment of the lysCP1 promoter region, a 1434 bp DNA fragment of the glnA gene derived from Corynebacterium glutamicum, a 1338 bp DNA fragment of the glnA gene derived from Aureibacillus halothorax, and a 1335 bp DNA fragment of the glnA gene derived from Bacillus subtilis, respectively.

[0143] PCR was performed using the above lysCP1 promoter region DNA fragment and the respective glnA gene DNA fragments as templates, with primers of SEQ ID NOs. 16 and 19 and primers of SEQ ID NOs. 16 and 21. The PCR conditions were denaturation at 95°C for 5 minutes, followed by denaturation at 95°C for 30 seconds; and annealing at 55°C for 30 seconds. After repeating polymerization at 72°C for 2 minutes 28 times, a polymerization reaction was performed at 72°C for 5 minutes to obtain an 1820 bp lysCP1_glnA(C.gl) DNA fragment containing a lysCP1 promoter and a glnA gene derived from Corynebacterium glutamicum, a 1724 bp lysCP1_glnA(A.ht) DNA fragment containing a lysCP1 promoter and a glnA gene derived from Aureibacillus halotorerans, and a 1721 bp lysCP1_glnA(B.su) DNA fragment containing a lysCP1 promoter and a glnA gene derived from Bacillus subtilis.

[0144] The DNA fragments obtained above were purified using a PCR purification kit (QIAGEN) and used as insert DNA fragments for vector construction. After treating the purified DNA fragments with the restriction enzyme ScaI, the molar concentration (M) ratio of the pDC24ΔBBD29_RS15405 vector, which was heat-treated at 65°C for 20 minutes, and the insert DNA fragments was set to 1:2, and plasmids expressing each glnA gene were obtained by cloning according to the provided manual using the In-Fusion® HD Cloning Kit (Clontech). The vector containing the glnA gene derived from Corynebacterium glutamicum and the lysCP1 promoter was named "pDC24-ΔBBD29_RS15405::lysCP1_glnA(C.gl)", the vector containing the glnA gene derived from Aureibacillus halotorrens and the lysCP1 promoter was named "pDC24-ΔBBD29_RS15405::lysCP1_glnA(A.ht)", and the vector containing the glnA gene derived from Bacillus subtilis and the lysCP1 promoter was named "pDC24-ΔBBD29_RS15405::lysCP1_glnA(B.su)".

[0145] The sequences of the primers used in Example 1-1 are indicated in Table 1 below.

[0146] Name Sequence (5'-> 3') Sequence Number RS15405-5'-FaacgacggccagtgaattcGCTCGAATGCCTGACTGACA Sequence Number 9 RS15405-5'-RgtttAGTACTaaaccggaagggccAAAGGACGACTTCACGGTTA Sequence Number 10 RS15405-3'-FccggtttAGTACTaaacaggaagagccATTGAGGATGCGAAACTGT Sequence Number 11 RS15405-3'-RtgcatgcctgcaggtcgacGTAATCGAATCACCGGCCAG Sequence Number 12 RS15405-FACGTGTGCTGACTTCTCATG Sequence Number 13 RS15405-RCTCATTAGTGCAAAGGTATC Sequence Number 14lysCP1-FGTCGTCCTTTGGCCCTTCCGGTTTAGTggcccttccggtttagt Sequence No. 16lysCP1-RTTCCGGGGTTTCAAACGCCATatgtgtgcacctttcgatctacg Sequence No. 17glnA(C.gl) -FtagatcgaaaggtgcacacatATGGCGTTTGAAACCCCGGAA Sequence No. 18glnA(C.gl)-RCCTCAATGGCTCTTCCTGTTTAGTTTAGCAGTCGAAGTACAATTC Sequence No. 19glnA(A.ht) -FGTCGTCCTTTGGCCCTTCCGGTTTAGTggcccttccggtttagt Sequence No. 20glnA(A.ht)-RCTCTTCCTGTTTAGTTTAGTAAAGGGTAAGGTACTGC Sequence No. 21glnA(B.su)-FtagatcgaaaggtgcacacatATGGCAAAGTACACTAGAGAAGATA Sequence No. 22glnA(B.su)-RCTCTTCCTGTTTAGTTTAATACTGAGACATATACTGTTCG Sequence No. 23

[0147] Example 2-1. Production of an L-ornithine-producing microorganism with an additionally introduced glutamine synthase gene

[0148] In order to determine whether the introduction of the glnA gene derived from Corynebacterium glutamicum, Aureibacillus halotorens, or Bacillus subtilis has an effect of increasing L-ornithine production capacity in Corynebacterium glutamicum strains capable of producing L-ornithine, the known L-ornithine-producing Corynebacterium glutamicum strains C. gl::argF*_argR*_ΔlysE_PgapA-Son (Korean Published Patent No. 10-2023-0167496), C. gl::argF*_argR*_carA(g1t), C. gl::argF*_argR*_carB(a1t), and C. gl::argF*_argR*_PbetP-carA (Korean Published Patent A strain with enhanced glutamine synthase (GlnA) activity was produced by introducing the glnA gene into (No. 10-2023-0136407) using the following method.

[0149] Specifically, the vectors pDC24-ΔBBD29_RS15405::lysCP1_glnA(C.gl), pDC24-ΔBBD29_RS15405::lysCP1_glnA(A.ht), and pDC24-ΔBBD29_RS15405::lysCP1_glnA(B.su) prepared in Example 1-1 above were transformed into the Corynebacterium glutamicum strains C. gl::argF*_argR*_ΔlysE_PgapA-Son, C. gl::argF*_argR*_carA(g1t), C. gl::argF*_argR*_carB(a1t), and C. gl::argF*_argR*_PbetP-carA, respectively, by chromosomal homologous recombination to obtain recombinant strains (van der Rest et al. al., Appl Microbiol Biotechnol 52:541-545, 1999).

[0150] The recombinant strains obtained above are respectively "C.gl::argF*_argR*_ΔlysE_PgapA-Son-ΔBBD29_RS15405::lysCP1_glnA(C.gl)", "C.gl::argF*_argR*_carA(g1t)-ΔBBD29_RS15405::lysCP1_glnA(C.gl)", "C.gl::argF*_argR*_carB(a1t)-ΔBBD29_RS15405::lysCP1_glnA(C.gl)", "C. gl::argF*_argR*_PbetP-carAΔBBD29_RS15405::lysCP1_glnA(C.gl) " "C.gl::argF*_argR*_ΔlysE_PgapA-Son-ΔBBD29_RS15405::lysCP1_glnA(A.ht)", "C.gl::argF*_argR*_carA(g1t)-ΔBBD29_RS15405::lysCP1_glnA(A.ht)", "C.gl::argF*_argR*_carB(a1t)-ΔBBD29_RS15405::lysCP1_glnA(A.ht)", "C.gl::argF*_argR*_PbetP-carAΔBBD29_RS15405::lysCP1_glnA(A.ht)", It was named "C.gl::argF*_argR*_ΔlysE_PgapA-Son-ΔBBD29_RS15405::lysCP1_glnA(B.su)", "C.gl::argF*_argR*_PbetP-carA-ΔBBD29_RS15405::lysCP1_glnA(B.su)", "C.gl::argF*_argR*_carA(g1t)-ΔBBD29_RS15405::lysCP1_glnA(B.su)", "C.gl::argF*_argR*_carB(a1t)-ΔBBD29_RS15405::lysCP1_glnA(B.su)".

[0151]

[0152] Example 1-3. Confirmation of increased L-ornithine production capacity in L-ornithine-producing microorganisms with additionally introduced glutamine synthase gene

[0153] Twelve recombinant strains of Corynebacterium glutamicum produced in Examples 1-2 above and four known L-ornithine-producing Corynebacterium glutamicum strains were cultured in flasks in the following manner to analyze their L-ornithine production ability.

[0154] Specifically, each strain was inoculated into a 250 ml Corner-Baffle flask containing 25 ml of seed medium and cultured at 30°C for 20 hours with shaking at 200 rpm. Then, 1 ml of seed culture was inoculated into a 250 ml Corner-Baffle flask containing 24 ml of production medium and cultured at 33°C for 42 hours with shaking at 200 rpm. After the culture was completed, the production of L-ornithine was measured using HPLC. The above experiment was repeated three times, and the average values ​​of the analysis results are shown in Table 2 below.

[0155]

[0156] <Seed Medium (pH 7.0)>

[0157] Glucose 20 g, Peptone 10 g, Yeast extract 5 g, Urea 1.5 g, KH2PO44 g, K2HPO48 g, MgSO4·7H2O 0.5 g, Biotin 0.1 mg, Thiamine HCl 1 mg, Calcium-Pantothenic Acid 22 mg, Nicotinamide 2 mg (based on 1 liter of distilled water)

[0158]

[0159] Production Medium (pH 7.0)

[0160] Raw sugar 50 g, (NH4)2SO4 25 g, Yeast extract 1 g, KH2PO 40.55 g, MgSO4·7H2O 0.6 g, L-arginine 0.2 g, Biotin 0.9 mg, Thiamine hydrochloride 4.5 mg, Calcium pantothenic acid 4.5 mg, Nicotinamide 30 mg, MnSO 49 mg, FeSO 49 mg, ZnSO 40.45 mg, CuSO 40.45 mg, CaCO3 30 g (based on 1 liter of distilled water)

[0161] 균주L-오르니틴(g / ℓ)3BT 평균향상도C. glutamicum WT0-C. gl::argF*_argR*_17.2-C. gl::argF*_argR*_ΔlysE_PgapA-Son19.1-C. gl::argF*_argR*_PbetP-carA20.9-C. gl::argF*_argR*_carA(g1t)20.1-C. gl::argF*_argR*_carB(a1t)20.5-C.gl::argF*_argR*_ΔlysE_PgapA-Son-ΔBBD29_RS15405::lysCP1_glnA(C.gl)20.78.4%C. gl::argF*_argR*_PbetP-carA-ΔBBD29_RS15405::lysCP1_glnA(C.gl)20.1-3.8%C. gl::argF*_argR*_carA(g1t) -ΔBBD29_RS15405::lysCP1_glnA(C.gl)22.612.4%C. gl::argF*_argR*_carB(a1t) -ΔBBD29_RS15405::lysCP1_glnA(C.gl)21.75.9%C.gl::argF*_argR*_ΔlysE_PgapA-Son-ΔBBD29_RS15405::lysCP1_glnA(A.ht)22.75.18%. gl::argF*_argR*_PbetP-carA-ΔBBD29_RS15405::lysCP1_glnA(A.ht)22.05.3%C. gl::argF*_argR*_carA(g1t) -ΔBBD29_RS15405::lysCP1_glnA(A.ht)24.722.9%C. gl::argF*_argR*_carB(a1t) -ΔBBD29_RS15405::lysCP1_glnA(A.ht)25.725.4%C.gl::argF*_argR*_ΔlysE_PgapA-Son-ΔBBD29_RS15405::lysCP1_glnA(B.su)28.6.2%. gl::argF*_argR*_PbetP-carA-ΔBBD29_RS15405::lysCP1_glnA(B.su)23.412.0%C.gl::argF*_argR*_carA(g1t)-ΔBBD29_RS15405::lysCP126.5.5.9%C.gl::argF*_argR*_carB(a1t)-ΔBBD29_RS15405::lysCP1_glnA(B.su)26.529.3%.

[0162] As a result, as shown in Table 2 above,

[0163] It was confirmed that the L-ornithine productivity of a Corynebacterium strain into which a glutamine synthase gene derived from Aureibacillus halothorax or a glutamine synthase gene derived from Bacillus subtilis was additionally introduced into the same parent strain was significantly increased compared to a Corynebacterium strain into which a glutamine synthase gene derived from Corynebacterium glutamicum was additionally introduced.

[0164] From the above results, it was confirmed that the introduction of the glnA gene derived from *Aureibacillus halotorensis* or the glnA gene derived from *Bacillus subtilis* increases the production capacity of L-ornithine in microorganisms of the genus *Corynebacterium*.

[0165]

[0166] Example 2. Production of L-citrulline microorganisms with enhanced glutamine synthase activity and evaluation of L-citrulline production capacity

[0167] Example 2-1: Preparation of L-citrulline-producing microorganisms

[0168] To construct an L-citrulline-producing microorganism, a vector was constructed that substitutes glutamic acid at protein sequence 47 of argR(ANU33619.1) with a stop codon.

[0169] Specifically, using the genome of wild-type Corynebacterium glutamicum (C. glutamicum) ATCC 13869 as a template, a homologous recombinant A arm was amplified using the primer pair of SEQ ID NOs 28 and 29, and a homologous recombinant B arm was amplified using the primer pair of SEQ ID NOs 30 and 31. Subsequently, a plasmid was obtained using the same method as described in Example 1-1, and this plasmid was named pDC24-argR(E47*).

[0170] To produce a microorganism with improved L-citrulline production ability, a vector was constructed by substituting phenylalanine at protein sequence 68 of argG (ANU33620.1) with a stop codon.

[0171] Using the genome of Corynebacterium glutamicum (C. glutamicum) ATCC13869 as a template, the homologous recombinant A arm was amplified using primers SEQ ID NOs 32 and 33, and the homologous recombinant B arm was amplified using primers SEQ ID NOs 34 and 35. Subsequently, a plasmid was obtained in the same manner as above, and this plasmid was named pDC24-argG(F68*).

[0172]

[0173] The primer sequences used in Example 2-1 are listed in Table 3 below.

[0174] Sequence No. Name Sequence (5' -> 3') Sequence No. 28 Primer 1 CGGTACCCGGGGATCCCTCGTGCGGAATTCGTGGAG Sequence No. 29 Primer 2 ATCCAGCAGCAATTCAGACA Sequence No. 30 Primer 3 CTGAATTGCTGCTGGATTAAGGCATCGATATCACCCA Sequence No. 31 Primer 4 ATGCCTGCAGGTCGACCCTTCATTTTAAGTTCCTTG Sequence No. 32 Primer 5 CGGTACCCGGGGATCCTTCATCGATAGGGTGGG Sequence No. 33 Primer 6 GTACTCCTCAGCTTACTCATCCTTTGCATCAACA Sequence No. 34 Primer 7 AGTAAGCTGAGGAGTACTGCCTGCCAACCATCAA Sequence No. 35 Primer 8 ATGCCTGCAGGTCGACCGACTGGCTTGCCACCCT

[0175] Using the constructed pDC24-argR(E47*) vector, wild-type Corynebacterium glutamicum ATCC 13869 was transformed by electro-pulse (Appl. Microbiol. Biotechnol. (1999) 52:541-545), and a secondary crossover was performed to obtain a strain in which the 139th nucleotide sequence of argR was replaced from guanine (g) to thymine (t) and the 47th protein sequence was replaced with a stop codon. PCR and sequencing analysis were performed using the primer pair SEQ ID NOs 28 and 31, which can amplify the adjacent region including the site where the gene was inserted, and the genetic modification was confirmed. The microorganism obtained in this way was named C. gl::argR*.

[0176] To construct a microorganism with enhanced citrulline production from C. gl::argR*, the microorganism was obtained using the pDC24-argG(F68*) vector in the manner described above. PCR and sequencing analysis were performed using the primer pair of SEQ ID NOs 32 and 35, which can amplify adjacent regions including the site where the gene was inserted, and the genetic modification was confirmed. The microorganism obtained in this way was named C. gl::argR*_argG*.

[0177]

[0178] Example 2-2. Production of an L-citrulline-producing microorganism with an additionally introduced glutamine synthase gene

[0179] In order to determine whether the introduction of the glnA gene derived from Corynebacterium glutamicum, Aureibacillus halothoreans, or Bacillus subtilis has an effect of increasing L-citrulline production capacity in a Corynebacterium glutamicum strain capable of producing L-citrulline, a strain with enhanced glutamine synthase activity was prepared from the C. gl::argR*_argG* strain prepared in Example 2-1 by the following method.

[0180] Specifically, the pDC24-ΔBBD29_RS15405::lysCP1_glnA(C.gl), pDC24-ΔBBD29_RS15405::lysCP1_glnA(A.ht), and pDC24-ΔBBD29_RS15405::lysCP1_glnA(B.su) vectors prepared in Example 1-1 above were transformed into the Corynebacterium glutamicum C.gl::argR*_argG* strain by chromosomal homologous recombination using the electro-pulse method to obtain a recombinant strain (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). The above recombinant strains were named C.gl::argR*_argG* :lysCP1_glnA(C.gl), C.gl::argR*_argG* ::lysCP1_glnA(A.ht), and C. gl::argR*_argG*::lysCP1_glnA(B.su), respectively.

[0181]

[0182] Example 2-3. Confirmation of increased L-citrulline production capacity in L-citrulline-producing microorganisms with additionally introduced glutamine synthase gene

[0183] To analyze L-citrulline production capacity, three recombinant strains of Corynebacterium glutamicum produced in Example 2-1 and the strain of Corynebacterium glutamicum C.gl::argR*_argG* were cultured in flasks in the following manner to analyze L-citrulline production capacity.

[0184] Specifically, each strain was inoculated into a 250 ml Corner-Baffle flask containing 25 ml of seed medium and cultured at 30°C for 20 hours with shaking at 200 rpm. Then, 1 ml of seed culture was inoculated into a 250 ml Corner-Baffle flask containing 24 ml of production medium and cultured at 33°C for 42 hours with shaking at 200 rpm. After the culture was completed, the production of L-ornithine was measured using HPLC. The above experiment was repeated three times, and the average values ​​of the analysis results are shown in Table 4 below.

[0185]

[0186] <Seed Medium (pH 7.0)>

[0187] Glucose 20 g, Peptone 10 g, Yeast extract 5 g, Urea 1.5 g, KH2PO44 g, K2HPO48 g, MgSO4·7H2O 0.5 g, Biotin 0.1 mg, Thiamine HCl 1 mg, Calcium-Pantothenic Acid 22 mg, Nicotinamide 2 mg (based on 1 liter of distilled water)

[0188]

[0189] Production Medium (pH 7.0)

[0190] Raw sugar 50 g, (NH4)2SO4 25 g, Yeast extract 1 g, KH2PO 40.55 g, MgSO4·7H2O 0.6 g, L-arginine 0.2 g, Biotin 0.9 mg, Thiamine hydrochloride 4.5 mg, Calcium pantothenic acid 4.5 mg, Nicotinamide 30 mg, MnSO 49 mg, FeSO 49 mg, ZnSO 40.45 mg, CuSO 40.45 mg, CaCO3 30 g (based on 1 liter of distilled water)

[0191] Strain Name L-Citrulline (g / ℓ) 3BT Average Improvement C.gl::argR*_argG* 3.5-C.gl::argR*_argG* ::lysCP1_glnA(C.gl) 3.88%C.gl::argR*_argG* ::lysCP1_glnA(A.ht) 4.14%C. gl::argR*_argG*::lysCP1_glnA(B.su) 3.911%

[0192] As a result, as shown in Table 4 above, it was confirmed that the C.gl::argR*_argG* ::lysCP1_glnA(C.gl) strain with enhanced glutamine synthase activity derived from Corynebacterium glutamicum showed an increase in L-citrulline production of about 8% compared to the citrulline-producing Corynebacterium strain (C. gl::argR*_argG*) without the additional introduction of the glutamine synthase gene, and the C.gl::argR*_argG* ::lysCP1_glnA(A.ht) strain with enhanced glutamine synthase activity derived from Aureibacillus halotorerans showed an increase in L-citrulline concentration of about 14% compared to the parent strain without the additional introduction of the glutamine synthase gene. In addition, it was confirmed that the C. gl::argR*_argG*::lysCP1_glnA(B.su) strain, which has enhanced activity of glutamine synthase derived from Bacillus subtilis, showed an increase in L-citrulline concentration of approximately 11% compared to the parent strain.

[0193] From the above results, it was confirmed that the introduction of the glnA gene derived from Corynebacterium glutamicum, Aureibacillus halothorax, or Bacillus subtilis increases the L-citrulline production capacity of microorganisms of the genus Corynebacterium, and in particular, it was confirmed that the enhancement of glutamine synthase activity by the introduction of the glnA gene derived from Aureibacillus halothorax or Bacillus subtilis is effective in improving L-citrulline production.

[0194]

[0195] For the time being, each description and embodiment disclosed in this disclosure may be applied to each other description and embodiment. All possible combinations of the various elements disclosed in this disclosure fall within the scope of the invention proposed in this disclosure. Furthermore, the scope of the invention of this disclosure is not to be limited by the specific descriptions provided below, and insofar as a person skilled in the art can recognize or identify a number of equivalents to the specific embodiments described in this disclosure, such equivalents are intended to be included in the invention proposed in this disclosure.

Claims

1. Microorganisms of the genus Corynebacterium capable of producing ornithine or citrulline, into which the activity of an exogenous glutamine synthetase has been introduced.

2. A microorganism of the genus Corynebacterium according to claim 1, wherein the foreign glutamine synthase comprises an amino acid sequence having at least 80% sequence homology with the amino acid sequence of SEQ ID NO. 1 or the amino acid sequence of SEQ ID NO.

3.

3. A microorganism of the genus Corynebacterium, wherein the foreign glutamine synthase is derived from Aureibacillus halotolerans or Bacillus subtilis.

4. A microorganism of the genus Corynebacterium, wherein the foreign glutamine synthase is composed of the amino acid sequence of SEQ ID NO. 1 or the amino acid sequence of SEQ ID NO.

3.

5. In paragraph 1, the Corynebacterium microorganism is a Corynebacterium microorganism into which a polynucleotide encoding the foreign glutamine synthase has been introduced.

6. A microorganism of the genus Corynebacterium, wherein the polynucleotide of claim 5 comprises a nucleic acid sequence having at least 80% sequence identity with the nucleic acid sequence of SEQ ID NO. 2 or the nucleic acid sequence of SEQ ID NO.

4.

7. In any one of claims 1 to 6, the Corynebacterium microorganism is a Corynebacterium microorganism having increased production capacity of ornithine or citrulline compared to a Corynebacterium microorganism to which the activity of the foreign glutamine synthase has not been introduced.

8. In any one of claims 1 to 6, the Corynebacterium genus microorganism is Corynebacterium glutamicum.

9. A step of culturing a microorganism of the genus Corynebacterium having the ability to produce ornithine or citrulline, into which the activity of an exogenous glutamine synthetase has been introduced, in a medium, and A method for producing ornithine or citrulline, comprising the step of recovering ornithine or citrulline from the cultured microorganisms, the medium, or both.

10. A method for producing ornithine or citrulline according to claim 9, wherein the foreign glutamine synthase is composed of an amino acid sequence having at least 80% sequence homology with the amino acid sequence of SEQ ID NO.

1.

11. A method for producing ornithine or citrulline according to claim 9, wherein the foreign glutamine synthase is derived from Aureibacillus halotolerans or Bacillus subtilis.

12. A method for producing ornithine or citrulline according to claim 9, wherein the foreign glutamine synthase is composed of the amino acid sequence of SEQ ID NO. 1 or the amino acid sequence of SEQ ID NO.

3.

13. A method for producing ornithine or citrulline, wherein, in any one of claims 9 to 12, the microorganism of the genus Corynebacterium is Corynebacterium glutamicum.

14. Use of a microorganism of the genus Corynebacterium according to any one of paragraphs 1 to 6 for the production of L-arginine.