Mutant microorganism exhibiting enhanced 1,4-butanediol production capability, and method for producing 1,4-butanediol by using same

Abstract

The present invention relates to a mutant microorganism exhibiting enhanced 1,4-butanediol production capability and a method for producing 1,4-butanediol by using same, wherein attenuation of serine / threonine protein kinase activity in the mutant microorganism enhances the flux of the 1,4-butanediol biosynthetic pathway, thereby enabling efficient production of 1,4-butanediol.

Description

Mutant microorganism with enhanced 1,4-butanediol production capacity and method for producing 1,4-butanediol using the same

[0001] The present invention relates to a mutant microorganism with improved 1,4-butanediol production capacity and a method for producing 1,4-butanediol using the same.

[0002] 1,4-butanediol (1,4-BDO) is used throughout the chemical industry as a solvent, polymer intermediate, and fine chemical intermediate. 1,4-butanediol is primarily produced through a process of reacting acetylene with formaldehyde followed by the addition of hydrogen. It can also be produced from maleic anhydride and propylene oxide. However, there are problems such as disruptions in raw material supply and increased production costs due to unstable international oil prices, as well as greenhouse gases and waste generation resulting from the use of fossil fuels.

[0003] To complement these chemical production processes, low-cost and eco-friendly biological processes for producing 1,4-butanediol using biomass as a raw material are currently being developed. Microorganisms primarily produce 1,4-butanediol using α-ketoglutarate or succinyl-CoA as precursors, and recently, a glutamic acid-based metabolic pathway for 1,4-butanediol production in E. coli has been developed. However, microbial 1,4-butanediol production processes face limitations, such as relatively low production yields, due to the generation of unnecessary byproducts like acetate and lactate during metabolic processes and the self-degradation of the produced 1,4-butanediol. Therefore, continuous efforts are required to develop microorganisms capable of producing 1,4-butanediol at high yields using genetic engineering techniques to overcome these limitations.

[0004] [Prior Art Literature]

[0005] [Patent Literature]

[0006] European Registered Patent No. 3050970

[0007] European Registered Patent No. 2782893

[0008] The present invention aims to provide a mutant microorganism with improved 1,4-butanediol production capacity.

[0009] In addition, the present invention aims to provide a method for producing 1,4-butanediol using the above-mentioned mutant microorganism.

[0010] One aspect of the present invention provides a mutant microorganism with enhanced 1,4-butanediol production capacity and weakened serine / threonine-protein kinase activity.

[0011] The “serine / threonine protein kinase” used in the present invention is an enzyme that catalyzes protein phosphorylation using ATP and is involved in the reaction of converting α-ketoglutarate, which is a precursor of 1,4-butanediol, into succinyl-CoA in the biosynthetic pathway of 1,4-butanediol. The serine / threonine protein kinase in the present invention may be a polypeptide encoded by the NCgl2655 gene or the pknG gene and having serine / threonine protein kinase activity, but is not limited thereto.

[0012] Nucleic acid and protein sequence information for the above serine / threonine-protein kinase can be obtained through known sequence databases (e.g., GenBank, UniProt).

[0013] The terms “reduced activity” or “reduced activity” as used in the present invention refer to a decrease in the activity of a target polypeptide or protein compared to its intrinsic activity or the absence of such activity, and may be used interchangeably with terms such as inactivation, deficiency, reduction, or lowering. Such reduced activity may include, but is not limited to, cases where the activity of the polypeptide itself is reduced or eliminated compared to the activity of the polypeptide possessed by the original microorganism, i.e., the wild type or the microorganism before modification, due to a nucleotide modification of the gene encoding the polypeptide; cases where the overall degree of polypeptide activity (expression level) is lower than that of the original microorganism due to inhibition of expression or translation of the target gene caused by a modification of the regulatory region of the gene encoding the polypeptide; cases where there is no polypeptide activity even if the gene encoding the polypeptide is expressed.

[0014] Here, the nucleotide modification refers to a difference from the original polynucleotide sequence due to wholly or partially deleted, substituted, added, or a combination thereof in the polynucleotide sequence of a gene encoding a polypeptide. The regulatory region modification refers to a difference from the original polynucleotide sequence due to wholly or partially deleted, substituted, added, or a combination thereof in the polynucleotide sequence of an element constituting a regulatory region, such as a promoter or enhancer, and may, for example, be replaced with a weak promoter to reduce or suppress gene expression. Here, deletion means a change in which a base, nucleotide, polynucleotide, or nucleic acid is removed; substitution means a change in which a base, nucleotide, polynucleotide, or nucleic acid is replaced with another base, nucleotide, polynucleotide, or nucleic acid; and addition means a change in which another base, nucleotide, polynucleotide, or nucleic acid is added.

[0015] According to one embodiment of the present invention, the weakening of activity may be a nucleotide modification, a promoter modification, or a combination thereof of a gene encoding serine / threonine-protein kinase.

[0016] The above serine / threonine-protein kinase may be encoded by the nucleotide sequence of SEQ ID NO. 1 or composed of the amino acid sequence of SEQ ID NO. 2.

[0017] The base sequence or amino acid sequence of the serine / threonine-protein kinase according to the present invention may consist of or essentially include a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% homology or identity when compared to the base sequence of SEQ ID NO. 1 or the amino acid sequence of SEQ ID NO. 2, and may have an original function. Here, “homology” or “identity” means the percentage of agreement between two sequences when a reference base sequence or amino acid sequence and any other base sequence or amino acid sequence are aligned to correspond as much as possible and analyzed.

[0018] The term “improved 1,4-butanediol production capacity” as used in the present invention means that the productivity of 1,4-butanediol is increased compared to the microorganism (parent strain) prior to mutation. The parent strain refers to a wild-type or mutant microorganism that is the subject of mutation, and includes the subject that is directly subjected to mutation or transformed into a recombinant vector, etc.

[0019] In the present invention, the parent strain refers to a microorganism before its traits are altered by genetic mutation due to natural or artificial factors, and, for example, may be a microorganism that does not produce 1,4-butanediol because it lacks an enzyme acting on the 1,4-butanediol production pathway, or may be a 1,4-butanediol-producing microorganism that expresses an enzyme involved in the 1,4-butanediol production pathway or a gene encoding it. The above-mentioned 1,4-butanediol-producing microorganism may be modified with respect to genes encoding related enzymes through modifications of the endogenous gene sequence (nucleic acid deletion, addition, substitution, etc.), insertion of foreign genes into the genome, or introduction of plasmids (vectors) containing foreign genes, for example, having a 1,4-butanediol biosynthetic pathway from glutamic acid, including enzymatic reactions converting glutamic acid to 4-aminobutyric acid (glutamic acid decarboxylase, gadB gene), enzymatic reactions converting 4-aminobutyric acid to succinate semialdehyde (4-aminobutyrate aminotransferase, gabT gene), enzymatic reactions converting succinate semialdehyde to 4-hydroxybutyrate (aldehyde reductase, yqhD gene), and It may include, but is not limited to, an enzymatic reaction that converts 4-hydroxybutyrate to 1,4-butanediol (carboxylic acid reductase, car gene / aldehyde reductase, yqhD gene).

[0020] According to one embodiment of the present invention, the mutant microorganism may be of the genus Corynebacterium.

[0021] Specifically, the mutant microorganisms are of the genus Corynebacterium, including Corynebacterium glutamicum, Corynebacterium crudilactis, Corynebacterium deserti, Corynebacterium callunae, Corynebacterium suranareeae, Corynebacterium lubricantis, Corynebacterium doosanense, Corynebacterium efficiens, Corynebacterium uterequi, and Corynebacterium stationis. Corynebacterium pacaense, Corynebacterium singulare, Corynebacterium humireducens, Corynebacterium marinum, Corynebacterium halotolerans, Corynebacterium spheniscorum, Corynebacterium freiburgense, Corynebacterium striatum, Corynebacterium canis, Corynebacterium ammoniagenes, Corynebacterium renale, Corynebacterium pollutisoli,It may be one or more selected from the group consisting of Corynebacterium imitans, Corynebacterium caspium, Corynebacterium testudinoris, Corynebacterium pseudopelargi, and Corynebacterium flavescens, but is not limited thereto.

[0022] According to one embodiment of the present invention, the mutant microorganism may be Corynebacterium glutamicum.

[0023] The mutant microorganism with improved 1,4-butanediol production capacity according to the present invention exhibits increased 1,4-butanediol production capacity compared to the microorganism prior to mutation (parent strain), and in particular, compared to the parent strain, the 1,4-butanediol production capacity increases by at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, or increases by 1.1 times, 1.5 times, 2 times, 2.5 times, 3 times, 3.5 times, 4 times, 4.5 times, 5 times, 5.5 times, 6 times, 6.5 times, 7 times, 7.5 times, It may be increased by 8, 8.5, 9, 9.5, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 times, but is not limited thereto. For example, a mutant microorganism with weakened serine / threonine-protein kinase activity may have a 1,4-butanediol production of 0.5 times or more compared to the parent strain, specifically 0.5 to 20 times (preferably 1 to 10 times).

[0024] A composition containing a mutant microorganism according to the present invention can be used as a composition for producing 1,4-butanediol.

[0025]

[0026] A mutant microorganism with enhanced 1,4-butanediol production capacity according to one embodiment of the present invention can be implemented through a gene inactivation method or a recombinant vector to delete a gene encoding an intrinsic serine / threonine-protein kinase in a parent strain.

[0027] The above gene inactivation method can be carried out through known methods. Examples include the CaCl₂ method (Cohen, SN et al., Proc. Natl. Acac. Sci. USA, 9:2110-2114 (1973)), the Hanahan method (Cohen, SN et al., Proc. Natl. Acac. Sci. USA, 9:2110-2114 (1973); and Hanahan, D., J. Mol. Biol., 166:557-580 (1983)) and the electroporation method (Dower, WJ et al., Nucleic. Acids Res., 16:6127-6145 (1988)), but are not limited thereto.

[0028] As used in the present invention, the term "vector" refers to any type of nucleic acid sequence carrier structure used as a means to deliver and express a target gene to a mutation target (host cell). Unless otherwise specified, the vector may mean a structure in which a carried nucleic acid sequence is inserted into the host cell genome to be expressed and / or expressed independently. Such a vector comprises an essential regulatory element operably linked to enable the expression of the gene insertion, where "operably linked" means that the target gene and its regulatory sequence are linked in a manner in which they are functionally coupled to enable gene expression, and the "regulatory element" comprises a promoter for performing transcription, any operator sequence for regulating transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation.

[0029] The vector used in the present invention is not particularly limited as long as it is capable of replicating within a host cell, and any vector known in the art may be used. Examples of such vectors include plasmids, cosmids, viruses, and bacteriophages in their natural or recombinant state. For example, phage vectors or cosmid vectors include pWE15, M13, λMBL3, λMBL4, λIXII, λASHII, λAPII, λt10, λt11, Charon4A, Charon21A, etc., and plasmid vectors include pBR-based, pUC-based, pBluescriptII-based, pGEM-based, pTZ-based, pCL-based, and pET-based vectors, but are not limited thereto.

[0030] The above vector can typically be constructed as a vector for cloning or as a vector for expression. The vector for expression may be a conventional one used in the art to express foreign genes or proteins in plants, animals, or microorganisms, and may be constructed through various methods known in the art.

[0031] The “recombinant vector” used in the present invention may be constructed using a prokaryotic or eukaryotic cell as a host, and may be capable of replication independently of the host cell’s genome or may be sealed to the genome itself. The host cell is capable of replication by the vector and may include a replication origin, which is a specific nucleotide sequence at which replication is initiated. For example, when the vector used is an expression vector and the host is a prokaryotic cell, it generally includes a potent promoter capable of proceeding transcription (e.g., pLλ promoter, CMV promoter, trp promoter, lac promoter, tac promoter, T7 promoter), a ribosome binding site for initiating translation, and a transcription / translation termination sequence. When the host is a eukaryotic cell, the replication origins included in the vector that operate in eukaryotic cells include, but are not limited to, f1 replication origins, SV40 replication origins, pMB1 replication origins, adeno replication origins, AAV replication origins, and BBV replication origins. In addition, promoters derived from the genome of mammalian cells (e.g., metallothionine promoters) or promoters derived from mammalian viruses (e.g., adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, cytomegalovirus promoter, HSV tk promoter) may be used and generally have a polyadenylation sequence as a transcription termination sequence.

[0032] The above-mentioned recombinant vector may include a selection marker, which is intended to select transformants (host cells) transformed by the vector. Since only cells expressing the selection marker can survive in a medium treated with the selection marker, the selection of transformed cells is possible. Representative examples of the selection marker include ampicillin, kanamycin, streptomycin, and chloramphenicol, but are not limited thereto.

[0033] A transformant can be produced by inserting the above-mentioned recombinant vector into a host cell, and the transformant may be obtained by introducing the recombinant vector into a suitable host cell. Any host cell known in the art may be used as a cell capable of stably and continuously cloning or expressing the above-mentioned expression vector.

[0034] When transforming a prokaryotic cell to produce a recombinant microorganism, various intestinal bacteria such as Escherichia coli (E. coli JM109, E. coli BL21, E. coli RR1, E. coli LE392, E. coli B, E. coli X 1776, E. coli W3110, E. coli XL1-Blue), Corynebacterium, Bacillus (Bacillus subtilis, Bacillus thuringiensis), Salmonella typhimurium, Serratia marcescens, and Pseudomonas (Pseudomonas) may be used as host cells, but are not limited thereto.

[0035] When transforming into a eukaryotic cell to produce a recombinant microorganism, host cells such as yeast (e.g., Saccharomyces cerevisiae), insect cells, plant cells, and animal cells, such as Sp2 / 0, CHO K1, CHO DG44, PER.C6, W138, BHK, COS7, 293, HepG2, Huh7, 3T3, RIN, MDCK cell lines, etc., may be used, but are not limited thereto.

[0036] As used in this invention, “transformation” refers to a phenomenon in which external DNA is introduced into a host cell to artificially induce a genetic change, and “transformant” refers to a host cell into which external DNA is introduced to stably maintain the expression of a target gene.

[0037] The above transformation may be performed by selecting a vector introduction technique suitable for the host cell to express the target gene or a recombinant vector containing it within the host cell. For example, vector introduction may be performed by electroporation, heat shock, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, lithium acetate-DMSO method, or a combination thereof, but is not limited thereto. The transformed gene may be included without limitation, whether inserted into the chromosomes of the host cell or located extrachromosomally, as long as it can be expressed within the host cell.

[0038] The above transformant comprises cells that have been transfected, transformed, or infected with a recombinant vector according to the present invention in vivo or in vitro, and may be used interchangeably with recombinant host cells, recombinant cells, or recombinant microorganisms.

[0039] The transgenic body of the present invention may be one other than a human.

[0040] The genes inserted into the recombinant vector for transformation of the present invention can be introduced into a host cell, such as a microorganism of the genus Corynebacterium, through homologous recombination crossing.

[0041] According to one embodiment of the present invention, the host cell may be a microorganism of the genus Corynebacterium, for example, the microorganism of the genus Corynebacterium may be Corynebacterium glutamicum.

[0042]

[0043] In addition, another aspect of the present invention provides a method for producing 1,4-butanediol comprising the steps of: culturing the mutant microorganism in a medium; and recovering 1,4-butanediol from the mutant microorganism or the medium in which the mutant microorganism is cultured.

[0044] The above culture may be carried out according to appropriate media and culture conditions known in the art, and a person skilled in the art can easily adjust and use the media and culture conditions. Specifically, the media may be liquid media, but is not limited thereto. The culture method may include, for example, batch culture, continuous culture, fed-batch culture, or a combination thereof, but is not limited thereto.

[0045] According to one embodiment of the present invention, the medium must satisfy the requirements of a specific strain in an appropriate manner and may be appropriately modified by a person skilled in the art. For culture media for microorganisms of the genus Corynebacterium, reference may be made to the known literature (Manual of Methods for General Bacteriology. American Society for Bacteriology. Washington DC, USA, 1981), but is not limited thereto.

[0046] According to one embodiment of the present invention, the culture medium may contain various carbon sources, nitrogen sources, and trace element components. Carbon sources that may be used include sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch, and cellulose; oils and fats such as soybean oil, sunflower oil, castor oil, and coconut oil; fatty acids such as palmitic acid, stearic acid, and linoleic acid; alcohols such as glycerol and ethanol; and organic acids such as acetic acid. These substances may be used individually or as a mixture, but are not limited thereto. Nitrogen sources that may be used include peptone, yeast extract, meat broth, malt extract, corn steep liquid, soybean meal, and urea or inorganic compounds, such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate. Nitrogen sources may also be used individually or as a mixture, but are not limited thereto. Sources of phosphorus that may be used may include, but are not limited to, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or corresponding sodium-containing salts. Additionally, the culture medium may contain metal salts such as magnesium sulfate or iron sulfate necessary for growth, but are not limited thereto. Furthermore, essential growth substances such as amino acids and vitamins may be included. In addition, suitable precursors may be used in the culture medium. The medium or individual components may be added to the culture solution in a batch or continuous manner in a manner suitable for the culture process, but are not limited thereto.

[0047] According to one embodiment of the present invention, the medium may contain 1,4-butanediol.

[0048] According to one embodiment of the present invention, the pH of the culture medium can be adjusted by adding compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, and sulfuric acid to the microbial culture medium in an appropriate manner during cultivation. Additionally, bubble formation can be suppressed by using an antifoaming agent such as a fatty acid polyglycol ester during cultivation. Furthermore, oxygen or an oxygen-containing gas (e.g., air) can be injected into the culture medium to maintain an aerobic state of the culture medium. The temperature of the culture medium can typically be 20 to 45°C, for example, 25 to 40°C. The cultivation period can continue until a desired amount of useful material is obtained, for example, 10 to 160 hours.

[0049] According to one embodiment of the present invention, the step of recovering 1,4-butanediol from the cultured mutant microorganism or a culture medium containing the same may involve collecting or recovering 1,4-butanediol produced from the medium using a suitable method known in the art according to the culture method. For example, methods such as centrifugation, filtration, extraction, spraying, drying, evaporation, precipitation, crystallization, electrophoresis, fractional dissolution (e.g., ammonium sulfate precipitation), and chromatography (e.g., ion exchange, affinity, hydrophobicity, and size exclusion) may be used, but are not limited thereto.

[0050] According to one embodiment of the present invention, the step of recovering the 1,4-butanediol may involve removing biomass by low-speed centrifugation of the culture medium and separating the obtained supernatant through ion exchange chromatography.

[0051] According to one embodiment of the present invention, the step of recovering the 1,4-butanediol may include a process of purifying the 1,4-butanediol.

[0052] The mutant microorganism according to the present invention can efficiently produce 1,4-butanediol by strengthening the flow of the 1,4-butanediol biosynthetic pathway through weakened activity of serine / threonine-protein kinase.

[0053] The present invention will be described in more detail below. However, this description is provided merely as an example to aid in understanding the invention, and the scope of the invention is not limited by this exemplary description.

[0054]

[0055] Example 1. Production of Corynebacterium glutamicum with an established 1,4-BDO production pathway

[0056] 1-1. Construction of Vectors for gadB, gabT, yqhD, car, and sfp Gene Introduction

[0057] A pathway for the biosynthesis of 1,4-butanediol from glutamic acid was constructed by introducing the gadB, gabT, yqhD, car, and sfp genes into Corynebacterium glutamicum ATCC13032.

[0058] Chromosomal DNA of Corynebacterium glutamicum ATCC13032 was amplified by PCR using primers 1 and 2, 3 and 4, 7 and 8, 33 and 34, 35 and 36, and 37 and 8, respectively, to obtain fragments containing the gabT gene. DNA of pCES208H36EcGADmut (ACS Omega. 2022 Aug 23; 7(33): 29106-29115.) containing the gadB gene (derived from Escherichia coli) was amplified by PCR using primers 5 and 6, respectively, using a template. The PCR products obtained therefrom were amplified by crossover PCR and then inserted into the restriction enzyme HindIII and XbaI sites of the pK19mobSacB vector (ATCC, 87098). This vector was named pk19mobsacB-gadB(E89Q,△452-466)gabT.

[0059] Chromosomal DNA of Corynebacterium glutamicum ATCC13032 was amplified by PCR using primers 9 and 10, primers 11 and 12, and primers 15 and 16, respectively, using the ATCC13032 template. Chromosomal DNA of Escherichia coli K-12 MG1655, which inherently contains the yqhD gene, was amplified by PCR using primers 13 and 14, respectively, using the chromosomal DNA of Escherichia coli K-12 MG1655 as a template. The resulting PCR products were amplified by crossover PCR and then inserted into the restriction enzyme HindIII and XbaI sites of the pK19mobSacB vector. This vector was named pk19mobsacB-yqhD.

[0060] Chromosomal DNA of Corynebacterium glutamicum ATCC13032 was amplified by PCR using primers 17 and 18, primers 19 and 20, and primers 23 and 24, respectively. The E. coli expression vector pKE112CAR3pptase (Polymers (Basel). 2019 11(7):1184), containing the car gene (derived from Mycobacterium abscessus), was amplified by PCR using primers 21 and 22, respectively, using the car gene as a template. The PCR products obtained were amplified by crossover PCR and then inserted into the restriction enzyme HindIII and XbaI sites of the pK19mobSacB vector. This vector was named pk19mobsacB-car.

[0061] To insert the sfp gene required to activate the enzymatic activity of the CAR gene, the chromosomal DNA of Corynebacterium glutamicum ATCC13032 was amplified by PCR using primers 25 and 26, 27 and 28, and 31 and 32, respectively. The E. coli expression vector pKE112CAR3pptase (Polymers (Basel). 2019 11(7):1184), containing the sfp gene (derived from Bacillus subtilis), was amplified by PCR using primers 29 and 30, respectively, using a template. The PCR products obtained therefrom were amplified by crossover PCR and then inserted into the restriction enzyme HindIII and XbaI sites of the pK19mobSacB vector. This vector was named pk19mobsacB-sfp.

[0062] Here, the Wizard Genomic DNA Purification Kit (Promega) was used to extract chromosomal DNA from each strain. The nucleotide sequences of the amplified gadB, gabT, yqhD, car, and sfp genes are shown in Table 1 below, and the primers used for PCR are shown in Table 2 below. PCR was performed using a Thermocycler (TP600, TAKARA BIO Inc.) in the presence of 1 unit of PrimeSTAR Max DNA Polymerase (Takara) by adding 1 pM of oligonucleotide and 10 ng of template DNA to a reaction mixture containing 100 μM of each deoxynucleotide triphosphate (dATP, dCTP, dGTP, dTTP).

[0063] The pk19mobsacB-gadB(E89Q,△452-466)gabT, pk19mobsacB-yqhD, pk19mobsacB-car, and pk19mobsacB-sfp vectors, constructed using NEBuilder HiFi DNA Assembly Master Mix (NEB) and restriction enzymes HindIII (NEB) and XbaI (NEB), were each transformed into E. coliDH5a (HIT Competent cells™, Cat No. RH618) and plated on LB-agar plates containing 50 μg / ml kanamycin, and incubated at 37°C for 24 hours. The final colonies formed were isolated to confirm that the insert was present in the vector, and the vectors were isolated and used to prepare a mutant strain of Corynebacterium glutamicum into which the glutamic acid-1,4-butanediol pathway was introduced.

[0064] 서열번호유전자 및 염기서열 (5'-3')3Escherichia coli유래, gadB 유전자AAGTACAGAACGCCTCTTACCAGGTTGCCGCTTATCTGGCGGATGAAATCGCCAAACTGGGGCCGTATGAGTTCATCTGTACGGGTCGCCCGGACGAAGGCATCCCGGCGGTTTGCTTCAAACTGAAAGATGGTGAAGATCCGGGATACACCCTGTATGACCTCTCTGAACGTCTGCGTCTGCGCGGCTGGCAGGTTCCGGCCTTCACTCTCGGCGGTGAAGCCACCGACATCGTGGTGATGCGCATTATGTGTCGTCGCGGCTTCGAAATGGACTTTGCTGAACTGTTGCTGGAAGACTACAAAGCCTCCCTGAAATATCTCAGCGATCACTGA4Corynebacterium glutamicum유래, gabT 유전자AGACCCGCGCGCAAGAAATCGAGACCATCATCCGCGATGAATTCGCGCAGCTGAGTGCCTTCCCGGAGGTCGCCGAAATCCGCGGCCGCGGAGCAATGATGGCCATTGAGCTTATCGACGCTACCGGCCGCCCGAACGCAGCTTTAACCGCCGCAGTGGCTGCGCGCGCAAAAGCTGAAGGTGTGCTGCTGCTGACTTGCGGCACCGATGGCAACGTCATCCGCCTGCTGCCACCACTGGTCATTGCAGAGGACACTCTCCGTGATGGTCTTCAGGTGTTAGTCGCAGCCCTAGAGCGCGAAACCGCGCACCAGAAGGTGGGCTAA5Escherichia coli유래, yqhD 유전자CCCACCTCTCCGACTACGGTCTGGACGGCAGCTCCATCCCGGCTTTGCTGAAAAAACTGGAAGAGCACGGCATGACCCAACTGGGCGAAAATCATGACATTACGTTGGATGTCAGCCGCCGTATATACGAAGCCGCCCGCtaa6Mycobacterium abscessus유래,car 유전자ttctatgaattggatgccgacggcaatcggcagcgcgctcactatgacggtgtgcccggcgatttcaccgccgcatcgatcaccgccatcggcggtgtgaacgtggtagacggttaccgcagcttcgacgtgttcaacccgcaccatgacggtgtctcgatggataccttcgtcgactggctgatcgacgcaggctacaagatcgcgcggatcgacgattacgaccagtggctcgcccggttcgagctggccctcaagggattgcccgagcagcagcggcaacagtcggtgttgccacttctcaagatgtacgagaagccgcaaccggcgatcgacggaagtgcacttccgaccgcagaattcagtcgcgccgtgcacgaggcgaaggtcggagacagcggtgagataccgcacgtcaccaaggagctgatcctcaagtacgccagcgatattcagctgttgggcctggtgtag7Bacillus subtilis유래,sfp 유전자ATGAAGATTTACGGAATTTATATGGACCGCCCGCTTTCACAGGAAGAAAATGAACGGTTCATGTCTTTCATATCACCTGAAAAACGGGAGAAATGCCGGAGATTTTATCATAAAGAAGATGCTCACCGCACCCTGCTGGGAGATGTGCTCGTTCGCTCAGTCATAAGCAGGCAGTATCAGTTGGACAAATCCGATATCCGCTTTAGCACGCAGGAATACGGGAAGCCGTGCATCCCTGATCTTCCCGACGCTCATTTCAACATTTCTCACTCCGGACGCTGGGTCATTTGCGCGTTTGATTCACAGCCGATCGGCATAGATATCGAAAAAACGAAACCGATCAGCCTTGAGATCGCCAAGCGCTTCTTTTCAAAAACAGAGTACAGCGACCTTTTAGCAAAAGACAAGGACGAGCAGACAGACTATTTTTATCATCTATGGTCAATGAAAGAAAGCTTTATCAAACAGGAAGGCAAAGGCTTATCGCTTCCGCTTGATTCCTTTTCAGTGCGCCTGCACCAGGACGGACAAGTATCCATTGAGCTTCCGGACAGCCATTCCCCATGCTATATCAAAACGTATGAGGTCGATCCCGGCTACAAAATGGCTGTATGCGCCGCACACCCTGATTTCCCCGAGGATATCACAATGGTCTCGTACGAAGAGCTTTTATAA,

[0065] Sequence Number Primer Name Primer Sequence (5'-3') 8 Primer 1aacagctatgaccatgattacgccaCAAGGATTACGAGCTCGTTGGTGAG 9 Primer 2CTTCGGATCTAAACGATCTGGGCTTTTACCTTCGTTTCGC 10 Primer 3CGAAGGTAAAAGCCCAGATCGTTTAGATCCGAAGGAAAAC 11 Primer 4ACTTGCTTCTTATCCATTGTATGTCCTCCTGGACTTCGTG 12 Primer 5AGTCCAGGAGGACATACAATGGATAAGAAGCAAGTAACGG 13 Primer 6gcagctaagtagggtTCAGTGATCGCTGAGATATTTCAGG 14 Primer 7CTCAGCGATCACTGACAAAAAGCCGGACCCTTGCTTTAAG 15 Primer 8ggtacccggggatcctctagTGCTCATGCAGTACCTGC 16 Primer 9TGATTACGCCAAGCTGGGCGATGGCGGCGAATCCG17 Primer 10CCTTCGGATCTAAACGATCTTTCCTTAAGTGCTGATTCGC18 Primer 11GCGAATCAGCACTTAAGGAAAGATCGTTTAGATCCGAAGG19 Primer 12CAGATTAAAGTTGTTcatTGTATGTCCTCCTGGACTTCG20 Primer 13GTCCAGGAGGACATACAatgAACAACTTTAATCTGCACAC21 Primer 14TCAGAACCTGTAGGTCttaGCGGGCGGCTTCGTATATACG22 Primer 15CGAAGCCGCCCGCtaaGACCTACAGGTTCTGACAATTTAAATCTC23 Primer 16CCGGGGATCCTCTAGCTGGGACTTCAGCAACATCG24 Primer 17aacagctatgaccatgattacgccaTCCGACCTGGCCGGTGATGG25 Primer 18agctaagtagggtGAGCCAAGATTAGCGCTGAAAAGTAGC26 Primer 19GCGCTAATCTTGGCTCaccctacttagctgccaattattc27 PrimerPrimer 20ggagatcgtttcagtcatgggtaaaaaatcctttcgtagg28 Primer 21aaggattttttacccatgactgaaacgatctccacagcgg29 Primer 22GTCTGTAATCAGCGTCCTActacaccaggcccaacagctg30 Primer 23ttgggcctggtgtagTAGGACGCTGATTACAGACGTGTCC31 Primer 24ggtacccggggatcctctagTCTGCTCTAAAGAGCGGCGGGTGG32 Primer 25gaccaTGATTACGCCAAGCTCGACGCAGAAGGTGTGATCC33 Primer 26aattggcagctaagtagggtTTAGCCCACCTTCTGGTGCG34 Primer 27CAGAAGGTGGGCTAAaccctacttagctgccaattattcc35 Primer 28TAAATTCCGTAAATCTTCATgggtaaaaaatcctttcgta36 Primer 29aaggatttttttacccATGAAGATTTACGGAATTTATATGG37 Primer 30TCACGGCAAAGCGAGGTACTTATAAAAGCTCTTCGTACG38 Primer 31CGTACGAAGAGCTTTTATAAGTACCTCGCTTTGCCGTGAC39 Primer 32ggtacCCGGGGATCCTCTAGCGAAGCTTGCCGTGTGCAGG40 Primer 33TCTCAGCGATCACTGAaccctacttagctgccaattattc41 Primer 34GTATGAGAGATCTTCCACgggtaaaaaatcctttcgtagg42 Primer 35aaggatttttttacccGTGGAAGATCTCTCATACCGCATCC43 Primer 36CAAGGGTCCGGCTTTTTGTTAGCCCACCTTCTGGTGCGCG44Primer 37CAGAAGGTGGGCTAACAAAAAGCCGGACCCTTGCTTTAAG

[0066]

[0067] 1-2. Production of mutant strains with an established 1,4-BDO production pathway

[0068] After introducing the pk19mobsacB-gadB(E89Q,△452-466)gabT vector prepared in Example 1-1 above into a competent cell Corynebacterium glutamicum ATCC13032 strain by electroporation using an electroporator (BIO-RAD), the vector was plated onto 2YT KM agar medium (containing tryptone 16 g / l, yeast extract 10 g / L, NaCl 5 g / L, agar 20 g / L, and kanamycin 30 mg / L) and cultured in a 30°C incubator for 2 days to obtain colonies. Among the colonies in which primary homologous recombination was induced, those confirmed by PCR were cultured in 2YT liquid medium (containing tryptone 16 g / L, yeast extract 10 g / L, and NaCl 5 g / L) for 12 hours, and then plated onto 2YT sucrose agar medium (containing tryptone 16 g / L, yeast extract 10 g / L, NaCl 5 g / L, agar 20 g / L, and sucrose 100 g / L) to remove antibiotic markers through secondary homologous recombination. The selected colonies were finally confirmed to have the gadB and gabT genes introduced as intended through PCR and sequencing analysis.

[0069] Subsequently, the above process was carried out sequentially using the pk19mobsacB-yqhD, pk19mobsacB-car, and pk19mobsacB-sfp vectors produced in Example 1-1 above to produce a Corynebacterium glutamicum mutant strain in which the gadB, gabT, yqhD, car, and sfp genes were introduced to establish a pathway for producing 1,4-butanediol from glutamic acid, and this strain was named WB04-P001.

[0070]

[0071] Example 2. Production of a Corynebacterium glutamicum mutant with the NCgl2655 gene deletion

[0072] 2-1. Construction of a Vector for NCgl2655 Gene Deletion

[0073] A vector was constructed to remove the NCgl2655 gene encoding serine / threonine-protein kinase in Corynebacterium glutamicum.

[0074] Chromosomal DNA of Corynebacterium glutamicum ATCC13032 was used as a template and amplified by PCR using primers 1 and 2 and primers 3 and 4 of Table 3, respectively. The resulting PCR products were amplified by crossover PCR and then inserted into the restriction enzyme HindIII and XbaI sites of the pK19mobSacB vector (ATCC, 87098). This vector was named pk19mobsacB-△pknG.

[0075] Here, the Wizard Genomic DNA Purification Kit (Promega) was used to extract chromosomal DNA from the strain.

[0076] PCR was performed using a Thermocycler (TP600, TAKARA BIO Inc.) by adding 1 pM of oligonucleotide and 10 ng of template DNA to a reaction mixture containing 100 μM of each deoxynucleotide triphosphate (dATP, dCTP, dGTP, dTTP) and in the presence of 1 unit of PrimeSTAR Max DNA Polymerase (Takara).

[0077] The constructed pk19mobsacB-△pknG vector was transformed into E. coliDH5a (HIT Competent cells™, Cat No. RH618), plated on LB-agar plates containing 50 μg / ml kanamycin, and cultured at 37°C for 24 hours. The final colonies formed were isolated to confirm that the insert was present in the vector, and the vector was isolated and used to produce a Corynebacterium glutamicum mutant with the NCgl2655 gene deleted.

[0078] Sequence Number Primer Name Primer Sequence (5'-3') 45 Primer 1 ctatgaccatgattacgccaGCGACATTTTCGGTGACCCC 46 Primer 2 ATAGCCCCAAGTCAAAACAGTTATCCTTCATCGTTTTCTG 47 Primer 3 AAACGATGAAGGATAACTGTTTTGACTTGGGGCTATTTGG 48 Primer 4 gctcggtacccggggatcctACATGGTGGCACTGGGACGG

[0079]

[0080] 2-2. Production of NCgl2655 gene deletion mutant

[0081] The pk19mobsacB-△pknG vector produced using an electrophorator (BIO-RAD) was transformed into the WB04-P001 of Example 1, which was made into competent cells, and plated on 2YT KM agar medium (containing tryptone 16 g / l, yeast extract 10 g / L, NaCl 5 g / L, agar 20 g / L, and kanamycin 30 mg / L) and cultured in a 30°C incubator for 2 days to obtain colonies. Among the colonies in which primary homologous recombination was induced, those confirmed by PCR were cultured in 2YT liquid medium (containing tryptone 16 g / L, yeast extract 10 g / L, and NaCl 5 g / L) for 12 hours, and then plated onto 2YT sucrose agar medium (containing tryptone 16 g / L, yeast extract 10 g / L, NaCl 5 g / L, agar 20 g / L, and sucrose 100 g / L) to remove antibiotic markers through secondary homologous recombination. The selected colonies were finally confirmed to have the NCgl2655 gene deleted as intended through PCR and sequencing analysis. The mutant strain with the deleted NCgl2655 gene was named WB04-P015.

[0082]

[0083] Experimental Example 1. Evaluation of 1,4-BDO Production Capacity

[0084] The 1,4-BDO production capacity of the variant with the NCgl2655 gene deleted, produced in Example 2, was evaluated in comparison to WB04-P001 of Example 1, which was used as the parent strain.

[0085] The parent strain or mutant strain was inoculated into flask medium (containing glucose 10%, MgSO4 0.25%, yeast extract 2.5%, KH2PO4 0.25%, (NH4)2SO4 2.5%, FeSO4 100 ppm, peptone 2.5%, biotin 100 µg / L, nicotinamide 25 ppm and CPN 25 ppm) and cultured at 30°C for 24 hours. After the culture was finished, the culture medium was filtered through a 0.45 μm filter, and then the 1,4-butanediol content in the culture medium was analyzed using high-performance liquid chromatography (HPLC) (Agilent, 1260 infinity II) equipped with a column (Avantor HPLC Column Apollo C18). 0.1 M phosphate buffer was used as the mobile phase, and analysis was performed using an RI detector for 15 minutes at a temperature of 40°C and a flow rate of 0.8 mL / min. The results are shown in Table 4 below.

[0086] Strain 1,4-BDO (g / L)WB04-P0010.3WB04-P0150.8

[0087] As shown in Table 4 above, it was confirmed that when the NCgl2655 gene was deleted (WB04-P015), the production of 1,4-BDO increased by approximately 3.6 times compared to the parent strain (WB04-P001) expressing the NCgl2655 gene. These results suggest that the production efficiency of 1,4-BDO can be improved by strengthening the flow of the 1,4-BDO production pathway through weakening the activity of the NCgl2655 gene or the protein encoded by it.

[0088]

[0089] The present invention has been described above with reference to its preferred embodiments. Those skilled in the art will understand that the present invention may be embodied in modified forms without departing from the essential characteristics of the invention. Therefore, the disclosed embodiments should be considered in an illustrative rather than a restrictive sense. The scope of the invention is defined by the claims, not by the foregoing description, and all variations within the scope of the claims should be interpreted as being included in the invention.

Claims

1. A mutant microorganism with weakened serine / threonine-protein kinase activity and enhanced 1,4-butanediol production capacity.

2. In Claim 1, A mutant microorganism in which the above-mentioned weakening of activity is a nucleotide modification, promoter modification, or a combination thereof of the gene encoding serine / threonine-protein kinase.

3. In Claim 1, The above-mentioned mutant microorganism is a mutant microorganism of the genus Corynebacterium.

4. A step of culturing the variant microorganism of Claim 1 in a medium; and A method for producing 1,4-butanediol comprising the step of recovering 1,4-butanediol from the above-mentioned mutant microorganism or a medium in which the mutant microorganism is cultured.