Immunization method for rapidly enhancing human antibody titer, and method for producing human antibody against desired antigen by using non-human animal

The method accelerates antibody production in non-human animals with human antibody genes to 30 days, enabling rapid induction of high-titer, broad-spectrum neutralizing antibodies, addressing the inefficiencies of existing technologies and ensuring rapid response to viral mutations.

WO2026116459A1PCT designated stage Publication Date: 2026-06-04TOTTORI UNIVERSITY +2
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
TOTTORI UNIVERSITY
Filing Date
2025-11-28
Publication Date
2026-06-04

AI Technical Summary

Technical Problem

Existing antibody production technologies are slow and inefficient, particularly for rapidly mutating viruses like SARS-CoV-2, and there is a need for rapid production of human antibodies with broad-spectrum neutralizing activity to address pandemics and ensure safety for human administration.

Method used

A method involving immunization of non-human animals with human antibody genes within 30 days using a modified rodent artificial chromosome vector, followed by isolation of IgG-positive B cells and production of human antibodies based on their sequences, enabling rapid induction of high-titer, broad-spectrum neutralizing antibodies.

Benefits of technology

This method significantly reduces the time for antibody production to 30 days, allowing for rapid response to viral mutations and production of antibodies that can neutralize unimmunized antigens, enhancing preparedness for pandemics.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000079_0000
    Figure 00000079_0000
  • Figure 00000079_0001
    Figure 00000079_0001
  • Figure 00000079_0002
    Figure 00000079_0002
Patent Text Reader

Abstract

The purpose of the present invention is to provide, as a platform technique that may serve as preparation for pandemics, a rapid antibody production technique in which a non-human animal having a human antibody gene is used. More specifically, the purpose of the present invention is to provide an immunization method with which it is possible to induce, in a short period of time, a high antigen-binding ability of an antibody or a high antibody titer of an antiserum, and a method for producing a human antibody / antiserum with which it is possible to rapidly produce a wide range of neutralizing antibodies. (1) An immunization method for rapidly inducing a human monoclonal antibody having a high ability to bind to a desired antigen or a human polyclonal antibody having a high antibody titer, the method comprising a step for immunizing a non-human animal a plurality of times with a desired antigen or a nucleic acid encoding the antigen within 30 days from the first immunization, the non-human animal having a human antibody gene or locus, and the non-human animal being such that an endogenous gene or locus of the non-human animal corresponding to the human antibody gene or locus is disrupted or deleted, or mutated so as to result in a loss of expression or low expression. (2) A method for producing a human antibody against a desired antigen using a non-human animal, the method comprising: an immunization step for immunizing the non-human animal with the antigen or a nucleic acid encoding the antigen; a human immunoglobulin-positive B cell isolation step for isolating B cells that are human immunoglobulin-positive from a tissue of the immunized non-human animal; an antibody base sequence acquisition step for acquiring the base sequences of antibody light-chain mRNA-derived cDNA and antibody heavy-chain mRNA-derived cDNA prepared from the isolated B cells; and an antibody production step for producing an antibody on the basis of the acquired antibody base sequence, the non-h
Need to check novelty before this filing date? Find Prior Art

Description

An immunization method for rapidly enhancing the titer of human antibodies, and a method for producing human antibodies against a desired antigen using non-human animals.

[0001] This invention relates to a technique for rapidly producing human antibodies in non-human animals that possess human antibody genes.

[0002] Antibodies are used in a wide range of medical fields as treatments for cancer, autoimmune diseases, and infectious diseases. Trastuzumab (humanized anti-HER2 antibody) is indicated for the treatment of breast cancer as a molecularly targeted therapy, and tocilizumab (humanized anti-IL-6 receptor antibody) is used to treat rheumatoid arthritis. In addition, sotrovimab (patient-derived human anti-SARS-CoV-2 spike protein antibody) is a treatment for COVID-19, which has caused a global pandemic in recent years.

[0003] In the general antibody development process, an adjuvant is first added to the antigen, and animals (mice, rats, etc.) are immunized multiple times. The dosage of the antigen depends on its immunogenicity, but is usually 50-200 μg, and the type and amount of adjuvant (incomplete / complete Freund's adjuvant, etc.) are adjusted according to the target antibody. The immunization period is confirmed by titer and antibody titer using antiserum, and usually takes several months, with immunization performed once every two weeks (a total of seven times). Next, B cells are collected from lymph nodes or the spleen, and hybridomas are created to immortalize the antibody-producing cells. A hybridoma is a fusion cell created by fusing B cells and myeloma cells, and has the potential to maintain monoclonal antibody production performance indefinitely. On the other hand, immunization takes several months, and hybridoma creation takes 4-6 months, so antibody production takes about 6 months to a year. For this reason, with conventional technology, it was extremely difficult to respond quickly to rapidly mutating viruses such as SARS-CoV-2.

[0004] In technologies other than hybridoma production, mainly B cell culture methods, phage display methods, and single B cell technology (single B cell analysis) can be mentioned. In the B cell culture method, the properties of antibodies can be analyzed without immortalizing B cells, but there are still issues with throughput due to optimization of culture conditions and the like. The phage display method has high throughput for screening single-chain antibodies (scFv) and the like, but when developing from scFv to full-length IgG, the antigen-binding activity may decrease. Single B cell technology is a technique for decoding antibody gene sequences from single B cells and expressing their cDNAs in Chinese hamster ovary (CHO) cells and the like, and stable expression of antibodies that was impossible with hybridomas can be achieved. Therefore, single B cell technology is considered to be the most appropriate for rapid and high-throughput antibody production.

[0005] Mouse antibodies have been developed as antibody pharmaceuticals and have been conventionally administered to patients. However, since human antibodies (anti-drug antibody: ADA) against mouse antibodies are produced, there have been issues with safety. To overcome this, the development of chimeric mouse antibodies has been promoted, but there are still issues with safety. Therefore, in recent antibody pharmaceutical development, the administration of human antibodies is the mainstream in order to ensure the therapeutic effect and safety for patients. For this purpose, human antibodies are produced from patient-derived specimens. On the other hand, the number of antigen-specific B cells obtained from human peripheral blood-derived B cells is extremely small, and even when antigen-specific B cells are isolated using an antigen probe or the like, the desired antibody can only be obtained from a percentage or less of the total isolated cells, and the efficiency is not good. Furthermore, in clinical research, consideration is required when creating a research plan from an ethical perspective. The present inventor has created a mouse artificial chromosome vector incorporating the human antibody heavy chain gene and the human antibody light chain genes (κ gene and / or λ gene), and by having animals (mice, rats) hold this, has succeeded in creating a fully human antibody-producing animal (Patent Document 1, Patent Document 2, Non-Patent Document 1, Non-Patent Document 2). By using such a fully human antibody-producing animal, it becomes possible to produce antibodies that were extremely difficult in clinical research due to ethical problems.

[0006] Incidentally, the coronavirus that causes COVID-19, Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2), caused a pandemic, resulting in a large number of infections and deaths. SARS-CoV-2 enters host cells via the receptor binding domain (RBD) of the spike protein expressed on its surface. Therefore, the production of neutralizing antibodies targeting the spike protein of this virus has been reported. Furthermore, in order to cope with the rapidly occurring mutations of the spike protein, the development of broad-spectrum neutralizing antibodies that are also effective against mutated viruses is desirable.

[0007] Therefore, there is a need for the development of human antibody drugs for prevention and treatment that can be safely applied to humans. Furthermore, in order to deal with viruses that have a high mutation rate, there is a need for rapid human antibody production technologies and platform technologies that can serve as preparation for future pandemics.

[0008] Patent No. 4318736 Patent No. 6868250

[0009] Satofuka et al. Nature Communication, 2022, 13, 1, pp. 1841-15Satofuka et al. Scientific Reports, 2023, 13, 4225, pp. 1-15

[0010] Therefore, the objective of the present invention is to provide a rapid antibody production technology using non-human animals possessing human antibody genes, as a platform technology that can serve as preparation for pandemics. More specifically, the objective is to provide an immunization method that can induce high antigen-binding ability of antibodies or high antibody titers of antisera in a short period of time, and a method for rapidly producing human antibodies and antisera with broad-spectrum neutralizing activity.

[0011] To solve the above problems, the inventors conducted intensive research and found that by excessively immunizing fully human antibody-producing animals with virus-derived antigens for a short period of time (within 30 days), the titer of human antibodies against those antigens can be rapidly enhanced.

[0012] Furthermore, the inventors have discovered that fully human antibody-producing animals can be immunized with virus-derived antigens, immunoglobulin G-positive B cells can be isolated, single B cell analysis can be performed to obtain the base sequence of the human antibody, and antibodies can be produced based on the base sequence of the obtained human antibody. According to the method of the present invention, human antibodies can be obtained rapidly. Moreover, according to the method of the present invention, it is also possible to produce broad-spectrum human neutralizing antibodies that can neutralize antigens that were not immunized.

[0013] The present invention is based on the above-mentioned new findings and is as follows: [1] An immunization method for rapidly inducing a human antibody having high binding ability to a desired antigen or a human antiserum having a high antibody titer, the method comprising the step of immunizing a non-human animal multiple times with a desired antigen or a nucleic acid encoding the antigen within 30 days from the first immunization, the non-human animal comprising a human antibody gene or gene locus, and the non-human animal having a mutation in which the endogenous gene or gene locus of the non-human animal corresponding to the human antibody gene or gene locus is disrupted or deleted, or has loss of expression or low expression. [2] The method according to [1], wherein the human antibody gene or gene locus is a human immunoglobulin heavy chain gene or gene locus, and a human immunoglobulin κ light chain gene or gene locus or a human immunoglobulin λ light chain gene or gene locus. [3] The non-human animals are the following (1) to (3): (1) a rodent artificial chromosome vector containing a telomere, a human antibody heavy chain gene or locus, a first DNA sequence insertion site, a human antibody light chain κ gene or locus, a second DNA sequence insertion site, and a centromere in this order; (2) a rodent artificial chromosome vector containing a telomere, a human antibody heavy chain gene or locus, a first DNA sequence insertion site, a human antibody light chain λ gene or locus, a second DNA sequence insertion site, and a centromere in this order; and (3) The method according to [1] or [2], comprising a rodent artificial chromosome vector selected from the group consisting of: (3) a first rodent artificial chromosome vector comprising a telomere, a human antibody heavy chain gene or locus, a first DNA sequence insertion site, a human antibody light chain κ gene or locus, a second DNA sequence insertion site, and a centromere in that order; and a second rodent artificial chromosome vector comprising a telomere, a human antibody heavy chain gene or locus, a first DNA sequence insertion site, a human antibody light chain λ gene or locus, a second DNA sequence insertion site, and a centromere in that order. [4] The method according to any one of [1] to [3], wherein the antigen or nucleic acid encoding the antigen is of multiple types. [5] The method according to any one of [1] to [4], wherein the multiple immunizations consist of 2 to 15 immunizations.[6] The method according to any one of [1] to [5], wherein the non-human animal is a mouse or a rat. [7] The method according to any one of [1] to [6], wherein the antigen or the nucleic acid encoding the antigen is of viral origin. [8] The method according to [7], wherein the virus is severe acute respiratory syndrome coronavirus. [9] The method according to any one of [1] to [8], which achieves an antibody titer of 1 mg / ml or more in the blood human IgG concentration and 100 μg / ml or more in antigen-specific human IgG concentration.

[0014]

[10] An immunization method for rapidly inducing a human antibody having high binding ability to a desired antigen or a human antiserum having a high antibody titer, the method comprising the step of immunizing a non-human animal multiple times with the desired antigen or a nucleic acid encoding the antigen within 30 days from the first immunization, the non-human animal comprising a mammalian artificial chromosome vector comprising human immunoglobulin heavy chain and light chain gene loci, the mammalian artificial chromosome vector characterized in that the human-derived genome sequences from D1-1 to D1-26 of the D region of the human immunoglobulin heavy chain gene locus are replaced with modified sequences of the D region consisting of the following combinations of (1) and (2), or (1) and (3), the modified sequences of the D region are (1) The human genome sequence between the open reading frames (ORFs) D1-1 to D1-26 of the human immunoglobulin heavy chain locus D region, or the human genome sequence between the ORFs excluding D3-9 and D3-10, includes a sequence in which the VDJ recombinant sequence is shortened to a length of 49 bp or more from the end of each VDJ recombinant sequence in the adjacent ORF region, and (2) The ORF sequences D1-1 to D1-26 of the human immunoglobulin heavy chain locus D region include the ORF sequences B1-1 to B9-4 of the bovine immunoglobulin heavy chain locus D region, or the ORF sequences 1S5 to 1S35 of the monkey immunoglobulin heavy chain locus D region, or the ORF sequences of the immunoglobulin heavy chain locus D region from sheep, horses, rabbits, birds or sharks, or (3) The method comprising 26 modified ORF sequences from D1-1 to D1-26 of the human immunoglobulin heavy chain locus D region, which are prepared based on human antibody heavy chain CDR3 sequences of 18 amino acids or more, instead of the ORF sequences from D1-1 to D1-26 of the human immunoglobulin heavy chain locus D region.

[11] A method for producing a human antibody against a desired antigen using a non-human animal, comprising: an immunization step of immunizing the non-human animal with the antigen or a nucleic acid encoding the antigen; an isolation step of human immunoglobulin-positive B cells

[13] The non-human animals are (1) to (3) below: (1) a rodent artificial chromosome vector containing a telomere, a human antibody heavy chain gene or locus, a first DNA sequence insertion site, a human antibody light chain κ gene or locus, a second DNA sequence insertion site, and a centromere in this order; (2) a rodent artificial chromosome vector containing a telomere, a human antibody heavy chain gene or locus, a first DNA sequence insertion site, a human antibody light chain λ gene or locus, a second DNA sequence insertion site, and a centromere in this order; and (3) The method according to

[11] or

[12] , comprising a rodent artificial chromosome vector selected from the group consisting of: (3) a first rodent artificial chromosome vector comprising a telomere, a human antibody heavy chain gene or locus, a first DNA sequence insertion site, a human antibody light chain κ gene or locus, a second DNA sequence insertion site, and a centromere in that order; and a second rodent artificial chromosome vector comprising a telomere, a human antibody heavy chain gene or locus, a first DNA sequence insertion site, a human antibody light chain λ gene or locus, a second DNA sequence insertion site, and a centromere in that order.

[14] The method according to any one of

[11] to

[13] , wherein the immunization step is carried out by the immunization method described in [1].

[15] The method according to any one of

[11] to

[14] , wherein the non-human animal is a mouse or a rat.

[16] The method according to any one of

[11] to

[15] , wherein the antigen or the nucleic acid encoding the antigen is of viral origin.

[17] The method according to

[16] , wherein the virus is severe acute respiratory syndrome coronavirus.

[18] The method according to any one of

[11] to

[17] , wherein in the isolation step, IgG-positive B cells are isolated using an anti-CD19 antibody and an anti-IgG antibody.

[19] The method according to any one of

[11] to

[18] , wherein antibodies are produced for chronotypes that are among the top 50 most frequently occurring base sequences obtained in the antibody base sequence acquisition step.

[20] The method according to any one of

[11] to

[19] , wherein antibodies are produced against antigens other than the antigen administered in the immunization step.

[21] A method for producing a human antibody against a desired antigen using a non-human animal, comprising: an immunization step of immunizing the non-human animal with the antigen or a nucleic acid encoding the antigen; an isolation step of human immunoglobulin-positive B cells (1) The human genome sequence between the open reading frames (ORFs) D1-1 to D1-26 of the human immunoglobulin heavy chain locus D region, or the human genome sequence between the ORFs excluding D3-9 and D3-10, includes a sequence in which the VDJ recombinant sequence is shortened to a length of 49 bp or more from the end of each VDJ recombinant sequence in the adjacent ORF region, and (2) The ORF sequences D1-1 to D1-26 of the human immunoglobulin heavy chain locus D region include the ORF sequences B1-1 to B9-4 of the bovine immunoglobulin heavy chain locus D region, or the ORF sequences 1S5 to 1S35 of the monkey immunoglobulin heavy chain locus D region, or the ORF sequences of the immunoglobulin heavy chain locus D region from sheep, horses, rabbits, birds or sharks, or (3) The method comprising 26 modified ORF sequences from D1-1 to D1-26 of the human immunoglobulin heavy chain locus D region, which are prepared based on a human antibody heavy chain CDR3 sequence of 18 amino acids or more, instead of the ORF sequences from D1-1 to D1-26 of the human immunoglobulin heavy chain locus D region. This specification includes the disclosures of Japanese Patent Application No. 2024-207891, which forms the basis of the priority of this application.

[0015] This invention shortens the immunization period for fully human antibody-producing mice to 30 days, and further shortens the period from B cell isolation to antibody production to 30 days. Therefore, this invention makes it possible to rapidly produce human antibodies against mutant strains of the virus, even if mutant strains arise. Furthermore, this invention makes it possible to produce broad-spectrum neutralizing antibodies against mutant strains that were not immunized as antigens.

[0016] Figure 1-1 shows the evaluation results of antibody production after 30 days of immunization. (A) Figure 1-1(A) is a diagram showing the immunization schedule of fully human antibody-producing mice. After initial immunization with RBD-Wuhan strain, a total of nine immunizations were performed over 28 days at a frequency of twice a week with spike protein alpha, beta, and delta strains, and RBD-Wuhan strain. Lymphocytes were collected from lymph nodes, spleen, and bone marrow 1 to 3 days after the final immunization. In Figure 1-1(A), the numbers written under Day indicate the number of days after immunization, the test tubes below the horizontal line indicating the number of days indicate blood collection, and the injection needles indicated as Immunization indicate immunization with antigen. The same applies to Figures 3(A), 4(A), 5(A), 11(A), and 13(A). (B) Figure 1-1(B) shows the increase in titer of antiserum against the RBD-Wuhan strain used as the antigen. Antiserum collected before immunization (pre), after the second immunization (2nd), after the fourth immunization (4th), after the sixth immunization (6th), after the eighth immunization (8th), and after the final immunization (final) was diluted to 1 / 1000, 1 / 100000, and 1 / 1000000, and the titer was measured by measuring the OD450nm using the ELISA method. (C) Figure 1-1(C) shows the increase in human IgG and human IgM. Antiserum collected before immunization, after the second immunization (2nd), fourth immunization (4th), sixth immunization (6th), eighth immunization (8th), and final immunization (final) was analyzed using ELISA to measure the concentrations of human IgG and human IgM (mg / ml) at OD450nm. Figure 1-2 shows the evaluation results of antibody production after 30 days of immunization. (D) Figure 1-2(D) shows the results of the analysis of human IgG subclasses. For human IgG1, human IgG2, human IgG3, and human IgG4, the concentrations (mg / ml) of each subtype were measured using ELISA. (E) Figure 1-2(E) shows the increase in antibody titer of anti-RBD antibody. The concentration of anti-RBD antibodies (mg / ml) was measured by measuring the OD450nm of antiserum collected pre-immunization (pre) and final-immunization (final) using the ELISA method.Figure 2 shows the titer increase of antiserum against various spike protein mutants. Antiserum titer was evaluated by diluting antiserum before immunization (pre), after the second immunization (2nd), after the fourth immunization (4th), after the sixth immunization (6th), after the eighth immunization (8th), and after the final immunization (final) to 1 / 1000, 1 / 100000, and 1 / 1000000, and measuring the OD450nm using the ELISA method. (A) Figure 2(A) shows the results of evaluating the titer increase against the spike protein alpha mutant (B.1.1.7) immunized as an antigen using the ELISA method. (B) Figure 2(B) shows the results of evaluating the titer increase against the spike protein beta mutant (B.1.351) immunized as an antigen using the ELISA method. (C) Figure 2(C) shows the results of evaluating the titer increase against the spike protein delta strain mutant (B.1.617.2) immunized as an antigen using the ELISA method. (D) Figure 2(D) shows the results of evaluating the titer increase against the spike protein omicron strain mutant (B.1.1.529) that was not immunized as an antigen using the ELISA method. Figure 3 shows the evaluation results of this immunization method in which only the RBD-Wuhan strain was used as an antigen for 30 days. (A) Figure 3(A) shows the immunization schedule. Initial immunization was performed with the RBD-Wuhan strain, followed by a total of nine immunizations with the same RBD-Wuhan strain at a frequency of twice a week for 28 days. Lymphocytes were collected from lymph nodes, spleen, and bone marrow 1 to 3 days after the final immunization. (B) Figure 3(B) shows the titer increase of antiserum against the RBD-Wuhan strain used as an antigen. Antiserum titers were evaluated by diluting antiserum pre-immunization (pre), second-immunization (2nd), fourth-immunization (4th), sixth-immunization (6th), eighth-immunization (8th), and final-immunization (final) to 1 / 1000, 1 / 100000, and 1 / 1000000, respectively, and measuring the OD450nm using ELISA. (C) Figure 3(C) shows the increase in antibody titers of human IgG and anti-RBD antibody when immunized with only the RBD-Wuhan strain as the antigen. The concentrations (mg / ml) of human IgG and anti-RBD antibody were measured pre-immunization (pre) and final-immunization (final).Figure 4 shows the evaluation results of antibody production after 60 days of immunization. (A) Figure 4(A) shows the immunization schedule. After initial immunization with the RBD-Wuhan strain, a total of nine immunizations were performed over 56 days at a frequency of once a week with spike protein alpha, beta, delta strains and the RBD-Wuhan strain. Lymphocytes were collected from lymph nodes, spleen, and bone marrow 1 to 3 days after the final immunization. (B) Figure 4(B) shows the increase in antiserum titer against the RBD-Wuhan strain used as the antigen. Antiserum was diluted to 1 / 1000, 1 / 10000, 1 / 100000, and 1 / 1000000 before immunization (pre), after the second immunization (2nd), after the fourth immunization (4th), after the sixth immunization (6th), after the eighth immunization (8th), and after the final immunization (final). The titer was measured by measuring the OD450nm using the ELISA method. (C) Figure 4(C) shows the increase in antibody titers of human IgG and anti-RBD antibody. The concentrations (mg / ml) of human IgG and anti-RBD antibody were measured before immunization (pre) and after the final immunization (final). Figure 5 shows the evaluation results of antibody production after 20 days of immunization. (A) Figure 5(A) shows the immunization schedule. After initial immunization with the RBD-Wuhan strain, a total of nine immunizations were performed over 20 days at a frequency of three times per week with the spike protein alpha, beta, and delta strains, along with the RBD-Wuhan strain. Lymphocytes were collected from lymph nodes, spleen, and bone marrow 1 to 3 days after the final immunization. (B) Figure 5(B) shows the increase in titer of antiserum against the RBD-Wuhan strain used as the antigen. Antiserum before immunization (pre), after the third immunization (3rd), after the sixth immunization (6th), and after the final immunization (final) was diluted to 1 / 1000, 1 / 100000, 1 / 1000000, and 1 / 1000000, and titer was measured by measuring OD450nm using the ELISA method. (C) Figure 5(C) shows the increase in antibody titers of human IgG and anti-RBD antibody. The concentrations (mg / ml) of human IgG and anti-RBD antibody were measured before (pre) and after (final) immunization. Figure 6 shows the process of separating IgG+ B cells by flow cytometry. (A) Figure 6(A) shows the separation of IgG+ B cells collected from lymph nodes using a cell sorter.After gating the cells recovered from the lymph nodes, doublet removal was performed, and IgG+ B cells were obtained by separating them with PerCP-Cy5.5 (CD19) and PE / Cy7 (human IgG). (B) Figure 6(B) shows the separation of IgG+ B cells recovered from the spleen using a cell sorter. After gating the cells recovered from the spleen, doublet removal was performed, and IgG+ B cells were obtained by separating them with PerCP-Cy5.5 (CD19) and PE / Cy7 (human IgG). Figure 7 shows the results of antigen-binding analysis of antibodies produced from the top 25 chronotypes that suggested the induction of antigen-specific B cells, after obtaining the sequences of the human antibody heavy chain gene and human antibody κ gene from the obtained IgG+ B cells. In Figure 7, the horizontal axis shows the chronotype number, and the vertical axis shows the antigen-binding ability to RBD-Wuhan strain (RBD), spike protein alpha strain (alpha), spike protein beta strain (beta), spike protein delta strain (delta), and spike protein omicron strain (omicron). NT-193 indicates a sample to which NT-193 antibody, an antibody against SARS-CoV-2, has been added. Figure 8 shows the results of analyzing the neutralizing activity against the Wuhan strain of antibodies produced from 25 chronotypes. The horizontal axis shows each chronotype, and the vertical axis shows the neutralizing activity expressed as OD620. Blank indicates a sample without antibody addition, hIgG indicates a sample with human IgG added, NT-193 indicates a sample with NT-193 antibody, an antibody against SARS-CoV-2, added, and Sotrovimab indicates an antibody against SARS-CoV-2. Figure 9 shows the results of analyzing the neutralizing activity of antibodies prepared from three chronotypes (chronotype 6, chronotype 11, and chronotype 37) against Omicron BA. 5 strain. The horizontal axis represents each chronotype, and the vertical axis represents the neutralizing activity expressed as OD620. "Blank" indicates a sample without antibody, "hIgG" indicates a sample with human IgG added, "NT-193" indicates a sample with NT-193 antibody (an antibody against SARS-CoV-2) added, and "Sotrovimab" indicates an antibody against SARS-CoV-2.Figure 10-1 shows the evaluation results of antibody production after 30 days of immunization with nine doses of SARS-CoV-2 spike protein mRNA-LNP. (A) Figure 10-1(A) is a diagram showing the immunization schedule of fully human antibody-producing mice. After initial immunization with SARS-CoV-2 spike protein mRNA-LNP, a total of nine immunizations were performed twice a week for 28 days. Lymphocytes were collected from lymph nodes, spleen, and bone marrow 1 to 3 days after the final immunization. In Figure 10-1(A), the numbers written under Day indicate the number of days after immunization, the test tubes below the horizontal line indicating the number of days indicate blood collection, and the injection needles indicated as Immunization indicate immunization with the antigen. Figure 10-1(B) shows the increase in antiserum titer against the RBD-Wuhan strain after immunization with SARS-CoV-2 spike protein mRNA-LNP according to the administration schedule in Figure 10-1(A). Antiserum collected before immunization (pre), after the second immunization (2nd), after the fourth immunization (4th), after the sixth immunization (6th), after the eighth immunization (8th), and after the final immunization (final) was diluted to 1 / 1000, 1 / 100000, and 1 / 1000000, and the titer was measured by measuring the OD450nm using the ELISA method. Figure 10-1(C) shows the increase in human IgG and human IgM. Antiserum collected before immunization, after the second immunization (2nd), after the fourth immunization (4th), after the sixth immunization (6th), after the eighth immunization (8th), and after the final immunization (final) was measured for human IgG and human IgM concentrations (mg / ml) by measuring OD450nm using the ELISA method. Figure 10-2 shows the evaluation results of antibody production after 30 days of immunization with nine doses of SARS-CoV-2 spike protein mRNA-LNP. (D) Figure 10-2(D) shows the results of the analysis of human IgG subclasses. For human IgG1, human IgG2, human IgG3, and human IgG4, the concentration (mg / ml) of each subtype was measured by ELISA. (E) Figure 10-2(E) shows the increase in antibody titer of anti-RBD antibody.The concentration (mg / ml) of anti-RBD antibody was measured by measuring the OD450nm of antiserum collected pre-immunization (pre) and final immunization (final) using the ELISA method. Figure 11 shows the increase in antiserum titer against various spike protein mutants. Antiserum titer was evaluated by diluting the antiserum pre-immunization (pre), second immunization (2nd), fourth immunization (4th), sixth immunization (6th), eighth immunization (8th), and final immunization (final) to 1 / 1000, 1 / 100000, and 1 / 1000000, and measuring the OD450nm using the ELISA method. (A) Figure 11(A) shows the results of evaluating the increase in titer against the spike protein alpha mutant (B.1.1.7) using the ELISA method. (B) Figure 11(B) shows the results of evaluating the titer increase against the spike protein beta mutant (B.1.351) using the ELISA method. (C) Figure 11(C) shows the results of evaluating the titer increase against the spike protein delta mutant (B.1.617.2) using the ELISA method. (D) Figure 11(D) shows the results of evaluating the titer increase against the spike protein omicron mutant (B.1.1.529) using the ELISA method. Figure 12-1 shows the binding activity of antibodies produced from frequently occurring chronotypes. Figure 12-1 shows the results of analyzing the frequency of chronotypes from which sequences of human antibody heavy chains and human antibody κ genes were obtained by performing NGS analysis on a single IgG-positive B cell using 10x Chromium. Figure 12-2 shows the binding activity of antibodies produced from frequently occurring chronotypes. Figure 12-2 shows the results of analyzing the antigen-binding ability of antibodies produced from the top 24 chronotypes. Diamonds indicate antibodies bound to the alpha strain's spike protein, the delta strain's RBD, and the omicron strain's spike protein. Squares indicate antibodies bound to the alpha strain's spike protein and the omicron strain's spike protein. Trapezoids indicate antibodies bound to the omicron strain's spike protein. Circles indicate antibodies that did not bind to any antigen.Figure 13-1 shows the evaluation results of antibody production after 30 days of immunization with 13 doses of SARS-CoV-2 spike protein mRNA-LNP. (A) Figure 13-1(A) is a diagram showing the immunization schedule of fully human antibody-producing mice. After initial immunization with SARS-CoV-2 spike protein mRNA-LNP, a total of 13 immunizations were performed over 28 days at a frequency of 3 times per week. Lymphocytes were collected from lymph nodes, spleen, and bone marrow 1 to 3 days after the final immunization. In Figure 13-1(A), the numbers written under Day indicate the number of days after immunization, the test tubes below the horizontal line indicating the number of days indicate blood collection, and the injection needles indicated as Immunization indicate immunization with the antigen. Figure 13-1(B) shows the increase in antiserum titer against the RBD-Wuhan strain after immunization according to the administration schedule in Figure 13-1(A). Antiserum collected before immunization (pre), after the 3rd immunization (3rd), after the 6th immunization (6th), after the 9th immunization (9th), after the 12th immunization (12th), and after the final immunization (final) was diluted to 1 / 1000, 1 / 100000, and 1 / 1000000, and the titer was measured by measuring the OD450nm using the ELISA method. Figure 13-1(C) shows the increase in human IgG and human IgM. Antiserum collected before immunization, after the 3rd immunization (3rd), 6th immunization (6th), 9th immunization (9th), 12th immunization (12th), and final immunization (final) was analyzed using ELISA to measure the concentrations of human IgG and human IgM (mg / ml) at OD450nm. Figure 13-2 shows the results of antibody production evaluation after 30 days of immunization with 13 doses of SARS-CoV-2 spike protein mRNA-LNP. (D) Figure 13-2 (D) shows the results of human IgG subclass analysis. For human IgG1, human IgG2, human IgG3, and human IgG4, the concentrations (mg / ml) of each subtype were measured using ELISA. (E) Figure 13-2 (E) shows the increase in antibody titer of anti-RBD antibody. The concentration of anti-RBD antibodies (mg / ml) was measured by measuring the OD450nm of antiserum collected pre-immunization (pre) and final-immunization (final) using the ELISA method.Figure 14 shows the increase in antiserum titer against various spike protein mutants. Antiserum titer was evaluated by diluting antiserum pre-immunization (pre), 3rd immunization (3rd), 6th immunization (6th), 9th immunization (9th), 12th immunization (12th), and final immunization (final) to 1 / 1000, 1 / 100000, and 1 / 1000000, respectively, and measuring the OD450nm using ELISA. (A) Figure 14(A) shows the results of evaluating the increase in titer against the spike protein alpha mutant (B.1.1.7) using ELISA. (B) Figure 14(B) shows the results of evaluating the increase in titer against the spike protein beta mutant (B.1.351) using ELISA. (C) Figure 14(C) shows the results of evaluating the titer increase against the spike protein delta mutant (B.1.617.2) using the ELISA method. (D) Figure 14(D) shows the results of evaluating the titer increase against the spike protein omicron mutant (B.1.1.529) using the ELISA method. Figure 15-1 shows the binding activity of antibodies produced from frequently occurring chronotypes. Figure 15-1 shows the results of analyzing the frequency of chronotypes from which the sequences of human antibody heavy chains and human antibody κ genes were obtained by performing NGS analysis on a single IgG-positive B cell using 10x Chromium. Figure 15-2 shows the binding activity of antibodies produced from frequently occurring chronotypes. Figure 15-2 shows the results of analyzing the antigen-binding ability of antibodies produced from the top 25 chronotypes. Diamond shapes indicate antibodies bound to the alpha strain's spike protein, the delta strain's RBD, and the omicron strain's spike protein. Hexagons indicate antibodies bound to the alpha strain's spike protein and the delta strain's RBD. Squares indicate antibodies bound to the alpha strain's spike protein and the omicron strain's spike protein. Trapezoids indicate antibodies bound to the alpha strain's spike protein. Circles indicate antibodies that did not bind to any antigen.

[0017] 1. Overview The present invention is a rapid human antibody production technology using fully human antibody-producing mice. More specifically, the present invention is a method for rapidly inducing human antibodies with high binding ability to a desired antigen or antisera with a high antibody titer. Furthermore, the present invention is a method for producing human antibodies against a desired antigen using non-human animals.

[0018] 2. Non-human animals used in the present invention The non-human animals used in the present invention will be described in detail below. In this specification, "non-human animals" refers to mammals other than humans, such as rodents (e.g., mice, rats, hamsters, etc.) and ungulates (e.g., cattle, goats, etc.), preferably rodents, and more preferably mice or rats.

[0019] One embodiment of the present invention is a "non-human animal" that includes a human antibody gene or gene locus, thereby disrupting or deleting an endogenous gene or gene locus of the non-human animal that corresponds to the human antibody gene or gene locus, or having a mutation that results in loss of expression or low expression.

[0020] Some human antibody genes or loci are human immunoglobulin heavy chain genes or loci, human immunoglobulin κ light chain genes or loci, or human immunoglobulin λ light chain genes or loci.

[0021] Preferably, the non-human animal of the present invention is a rodent artificial chromosome vector selected from the group consisting of (1) to (3) below: (1) a rodent artificial chromosome vector comprising a telomere, a human antibody heavy chain gene or locus, a first DNA sequence insertion site, a human antibody light chain κ gene or locus, a second DNA sequence insertion site, and a centromere in this order; (2) a rodent artificial chromosome vector comprising a telomere, a human antibody heavy chain gene or locus, a first DNA sequence insertion site, a human antibody light chain λ gene or locus, a second DNA sequence insertion site, and a centromere in this order; and (3) A first rodent artificial chromosome vector comprising a telomere, a human antibody heavy chain gene or locus, a first DNA sequence insertion site, a human antibody light chain κ gene or locus, a second DNA sequence insertion site, and a centromere in that order; and a second rodent artificial chromosome vector comprising a telomere, a human antibody heavy chain gene or locus, a first DNA sequence insertion site, a human antibody light chain λ gene or locus, a second DNA sequence insertion site, and a centromere in that order.

[0022] The non-human animals used in the present invention, including the rodent artificial chromosome vectors described in (1) to (3) above, have disrupted or deleted endogenous antibody genes or loci corresponding to the human antibody heavy chain gene or locus and the human antibody light chain κ gene or locus, and have disrupted or deleted endogenous antibody genes or loci corresponding to the human antibody light chain λ gene or locus, or have mutations that result in loss of expression or low expression. Such non-human animals are also referred to as "fully human antibody-producing animals" in this specification.

[0023] Specific examples of fully human antibody-producing animals used in the present invention include, but are not limited to, TC-mAb mice containing IGHK-NAC (Satofuka et al. Nature Communication, 2022, 13, 1, pp. 1841-15) and IGHL mice containing IGHL-NAC (Shimoya et al., iScience, 2024, 27, 111258, pp. 1-18).

[0024] In the embodiment described in (1) above, IGHK-NAC is an artificial chromosome containing a light chain κ gene derived from human chromosome 2 and a human antibody heavy chain gene derived from human chromosome 14. On the other hand, in the embodiment described in (2) above, IGHL-NAC is an artificial chromosome containing a light chain λ gene derived from human chromosome 22 and a human antibody heavy chain gene derived from human chromosome 14.

[0025] In another embodiment, non-human animals containing artificial chromosomes in which the D region of the human antibody heavy chain has been modified in order to expand human antibody diversity in the above-mentioned IGHL-NAC are also included in the "non-human animals" used in the present invention. Such non-human animals are disclosed in WO2023 / 090361.

[0026] Such non-human animals include a mammalian artificial chromosome vector containing human immunoglobulin heavy chain and light chain gene loci, wherein the mammalian artificial chromosome vector is characterized in that the human-derived genome sequences from D1-1 to D1-26 in the D region of the human immunoglobulin heavy chain gene locus are replaced with modified sequences of the D region consisting of the following combinations of (1) and (2), or (1) and (3), wherein the modified sequences of the D region include (1) human-derived genome sequences between the open reading frames (ORFs) from D1-1 to D1-26 in the D region of the human immunoglobulin heavy chain gene locus, or human-derived genome sequences between the ORFs excluding between D3-9 and D3-10, shortened to a length of 49 bp or more from each VDJ recombinant sequence end in the ORF inter-ORF region adjacent to the VDJ recombinant sequence, and (2) In place of the ORF sequences D1-1 to D1-26 of the human immunoglobulin heavy chain locus D region, the ORF sequences B1-1 to B9-4 of the immunoglobulin heavy chain locus D region derived from cattle, or the ORF sequences 1S5 to 1S35 of the immunoglobulin heavy chain locus D region derived from monkeys, or the ORF sequences of the immunoglobulin heavy chain locus D region derived from sheep, horses, rabbits, birds, or sharks, or (3) In place of the ORF sequences D1-1 to D1-26 of the human immunoglobulin heavy chain locus D region, the ORF sequences D1-1 to D1-26 of the human immunoglobulin heavy chain locus D region are replaced with 26 modified ORF sequences D1-1 to D1-26 of the human immunoglobulin heavy chain locus D region, which are constructed based on human antibody heavy chain CDR3 sequences of 18 amino acids or more.

[0027] In this embodiment, the human immunoglobulin (also simply referred to as "human antibody") heavy chain locus contained in the artificial chromosome vector has only the D region genome sequence modified in the V, D, J, and C regions. Here, the modification of the human-derived genome sequence in the D region includes modification of the ORF (or gene) sequence of the human D region or shortening (also referred to as "minimalization") of the ORF interregion. Furthermore, the ORF sequence in the human-derived genome sequence of the human D region, or the minimalized human D region sequence, is replaced with a D region ORF sequence derived from another animal species, or one of 26 modified ORF sequences from D1-1 to D1-26 of the human immunoglobulin heavy chain locus D region, which are constructed based on a human antibody heavy chain CDR3 sequence of 18 amino acids or more.

[0028] Here, the “human immunoglobulin heavy chain locus D region” refers to the entirety including all ORFs (also called “genes” (or polypeptide-coding regions) or “D fragments”), VDJ recombinant sequences, and all interORF regions (i.e., regions between genes).

[0029] Here, the "VDJ recombinant sequence" is a sequence adjacent to the upstream and downstream V, D, and J regions of the human immunoglobulin heavy chain and light chain loci, and includes conserved sequences consisting of 7, 23, 9, and / or 12 bases in different configurations depending on the heavy chain, light chain κ, and light chain λ loci. In the case of the D region of the human immunoglobulin heavy chain locus, the recombinant sequence contains 28 bp (i.e., 9 bp, 12 bp (spacer), 7 bp) bases.

[0030] The D region of the human immunoglobulin heavy chain gene locus (also called the "IgHD" region) is located on human chromosome 14 (14q32.33), and is arranged in the order of 5'→3', for example, D1-1 (position 23599-35048; accession number X97051), D2-2 (position 35049-37615; accession number J00232), D3-3 (position 37616-39425; accession number X13972), D4-4 (position 39426-40474; accession number X13972), D5-5 (position 40475-41880; accession number X97051) D1-7 (positions 43057-44649; accession number X13972), D2-8 (positions 44650-47262; accession number X13972), D3-9 (positions 47263-48619; accession number X13972), D3-10 (positions 48620-49158; accession number X13972), D4-11 (positions 49159-50078; accession number X13972), D5-12 (position 50079 -51316; accession number X13972), D6-13 (positions 51317-52324; accession number X13972), D1-14 (positions 52325-53909; accession number X13972), D2-15 (positions 53910-56408; accession number J00234), D3-16 (positions 5640-58143; accession number X97051), D4-17 (positions 58144-59187; accession number X97051), D5-18 (positions 59188-60591; accession number X9705 1) D6-19 (position 60592-61769; accession number X97051), IGHD1-20 (position 61770; accession number X97051), D2-21 (position 61770-65916; accession number X97051), D3-22 (position 65917-67762; accession number X93616), D4-23 (position 67763-68826; accession number X97051), D5-24 (position 68827-70492; accession number X97051), D6-25 (position 70493-71926;It includes a nucleotide sequence exceeding approximately 40 kb, with accession number X97051, and D1-26 (positions 719267-79765; accession number X97051).

[0031] The ORF sequences from D1-1 to D1-26 in the D region of the human immunoglobulin heavy chain (IgH) are, for example, the nucleotide sequences of SEQ ID NOs: 1 to 26 below. Examples of the sizes between shortened ORF sequences are also shown between each sequence.

[0032] Sequence ID 1 (IGHD1-1): ggtacaactggaacgac (size between ORFs D1-1 and D2-2 + VDJ recombinant sequence (28bp x 2): 256bp) Sequence ID 2 (IGHD2-2): aggatattgtagtagtaccagctgctatgcc (size between ORFs D2-2 and D3-3 + VDJ recombinant sequence (28bp x 2): 256bp) Sequence ID 3 (IGHD3-3): gtattacgatttttggagtggttattatacc (size between ORFs D3-3 and D4-4 + VDJ recombinant sequence (28bp x 2): 256bp) Sequence ID 4 (IGHD4-4): tgactacagtaactac (size between ORFs D4-4 and D5-5 + VDJ recombinant sequence (28bp x 2): 256bp) Sequence ID 5 (IGHD5-5): gtggatacagctatggttac (size between ORFs D5-5 and D6-6 + VDJ recombination sequence (28bp x 2): 256bp) Sequence ID 6 (IGHD6-6): gagtatagcagctcgtcc (size between ORFs D6-6 and D1-7 + VDJ recombination sequence (28bp x 2): 256bp) Sequence ID 7 (IGHD1-7): ggtataactggaactac (size between ORFs D1-7 and D2-8 + VDJ recombination sequence (28bp x 2): 256bp) Sequence ID 8 (IGHD2-8): aggatattgtactaatggtgtatgctatacc (size between ORFs D2-8 and D3-9 + VDJ recombination sequence (28bp x 2): 255bp) Sequence ID 9 (IGHD3-9): gtattacgatattttgactggttattataac (Size between ORFs D3-9 and D3-10 + VDJ recombinant sequence (28bp x 2): 153bp) Sequence ID 10 (IGHD3-10):gtattactatggttcggggagttattataac (Size between ORFs D3-10 and D4-11 + VDJ recombinant sequence (28bp x 2): 316bp) Sequence ID 11 (IGHD4-11): tgactacagtaactac (Size between ORFs D4-11 and D5-12 + VDJ recombinant sequence (28bp x 2): 256bp) Sequence ID 12 (IGHD5-12): gtggatatagtggctacgattac (Size between ORFs D5-12 and D6-13 + VDJ recombinant sequence (28bp x 2): 256bp) Sequence ID 13 (IGHD6-13): gggtatagcagcagctggtac (Size between ORFs D6-13 and D1-14 + VDJ recombinant sequence (28bp x 2): 259bp) Sequence ID 14 (IGHD1-14): ggtataaccggaaccac (size between ORFs D1-14 and D2-15 + VDJ recombination sequence (28bp x 2): 256bp) Sequence ID 15 (IGHD2-15): aggatattgtagtggtggtagctgctactcc (size between ORFs D2-15 and D3-16 + VDJ recombination sequence (28bp x 2): 256bp) Sequence ID 16 (IGHD3-16): gtattatgattacgtttgggggagttatgcttatacc (size between ORFs D3-16 and D4-17 + VDJ recombination sequence (28bp x 2): 256bp) Sequence ID 17 (IGHD4-17): tgactacggtgactac (Size between ORFs D4-17 and D5-18 + VDJ recombinant sequence (28bp x 2): 256bp) Sequence ID 18 (IGHD5-18): gtggatacagctatggttac (Size between ORFs D5-18 and D6-19 + VDJ recombinant sequence (28bp x 2): 256bp) Sequence ID 19 (IGHD6-19):gggtatagcagtggctggtac (Size between ORFs D6-19 and D1-20 + VDJ recombinant sequence (28bp x 2): 256bp) Sequence ID 20 (IGHD1-20): ggtataactggaacgac (Size between ORFs D1-20 and D2-21 + VDJ recombinant sequence (28bp x 2): 256bp) Sequence ID 21 (IGHD2-21): agcatattgtggtggtgattgctattcc (Size between ORFs D2-21 and D3-22 + VDJ recombinant sequence (28bp x 2): 256bp) Sequence ID 22 (IGHD3-22): gtattactatgatagtagtggttattactac (Size between ORFs D3-22 and D4-23 + VDJ recombinant sequence (28bp x 2): 316bp) Sequence ID 23 (IGHD4-23): tgactacggtggtaactcc (size between ORFs D4-23 and D5-24 + VDJ recombinant sequence (28bp x 2): 256bp) Sequence ID 24 (IGHD5-24): gtagagatggctacaattac (size between ORFs D5-24 and D6-25 + VDJ recombinant sequence (28bp x 2): 256bp) Sequence ID 25 (IGHD6-25): gggtatagcagcggctac (size between ORFs D6-25 and D1-26 + VDJ recombinant sequence (28bp x 2): 256bp) Sequence ID 26 (IGHD1-26): ggtatagtgggagctactac

[0033] The ORF sequences from B1-1 to B9-4 in the bovine IgHD region described above are, for example, the nucleotide sequences of sequence numbers 27 to 49 below.

[0034] Sequence ID 27 (B1-1): agaataccgtgatgatggttactgctacacc Sequence ID 28 (B1-2): agaatatcgtgatgatggttactgctacacc Sequence ID 29 (B1-3): agactatcgtgatgatggttactgctacacccacagtgactcaggccctgacataaagtctgacccgcacacaggtgtggagctggccaatgcatccccaggggcactgggctcccaag Sequence ID 30 (B1-4): agaatatcgtgatgatggttactgctacacc Sequence ID 31 (B2-1): ttactatagtgaccac Sequence ID 32 (B2-2): ttactatagtgaccac Sequence ID 33 (B2-3): ttactatagtgaccac Sequence ID 34 (B2-4): ttactatagtgaccac Sequence ID 35 (B3-1): gtattgtggtagctattgtggtagttattatggtac Sequence ID 36 (B3-3): gtattgtggtagctattgtggtagttattatggtac Sequence ID 37 (B3-4): gtattgtggtagctattgtggtagttattatggtac Sequence ID 38 (B4-1): gtagttatagtggttatggttatggttatagttatggttatac Sequence ID 39 (B5-2): atgatacgataggtgtggttgtagttattgtagtgttgctac Sequence ID 40 (B5-3): atgatacgataggtgtggttttagttattgtagtgttgctac Sequence ID 41 (B5-4): atgatacgataggtgtggttttagttattgtagtgttgctacSEQ ID NO: 42 (B6-2): gtagttgttatagtggttatggttatggttgtggttatggttatggttatgattatac SEQ ID NO: 43 (B6-3): gtagttgttatagtggttatggttatggttatggttgtggttatggttatggttatac SEQ ID NO: 44 (B6-4): gtagttgttatagtggttatggttatggttatggttgtggttatggttatggttatac SEQ ID NO: 45 (B7-3): gtagttatggtggttatggttatggtggttatggttgttatggttatggttatggttatggttatac SEQ ID NO: 46 (B7-4): gtagttatggtggttatggttatggtggttatggttgttatggttatggttatggttatggttatggttatac SEQ ID NO: 47 (B8-2): gtagttgtcctgatggttatagttatggttatggttgtggttatggttatggttgtagtggttatgattgttatggttatggttatggttatggttatggttatagtagttatagttatacttacgaatatac Sequence 48 (B9-1): ga actcggtggggc Sequence 49 (B9-4): ga actcggtggggc

[0035] The D region of the cynomolgus monkey immunoglobulin heavy chain locus (Chr7q; G.-Y.Yu et al., Immunogenetics 2016; 68:417-428) contains approximately 44 kb of nucleotide sequences in the order of 5'→3', for example, 1S5, 2S11, 3S6, 4S24, 5S8, 6S4, 1S10, 2S17, 3S18, 2S34, 5S14, 5S31, 6S3, 1S27, 2S22, 4S36, 4S30, 5S37, 6S20, 1S33, 2S28, 6S32, 3S12, 6S38, 6S26, and 1S39 of IGHD. The ORF sequences D1-1 to D1-26 of the human immunoglobulin heavy chain locus D region are replaced with ORF sequences 1S5 to 1S35 of the monkey immunoglobulin heavy chain locus D region. The ORF sequences 1S5 to 1S35 of the cynomolgus monkey D region are, for example, the nucleotide sequences of SEQ ID NOs. 50 to 75 below.

[0036] Sequence ID 50 (1S5): ggtataactggaactac Sequence ID 51 (2S11): agaatattgtagtagtacttactgctcctcc Sequence ID 52 (3S6): gtattacgaggatgattacggttactattacacccacagcgt Sequence ID 53 (4S24): tgactacggtagcagctac Sequence ID 54 (5S8): gtggatacagctacagttac Sequence ID 55 (6S4): gggtatagcagcggctggtac Sequence ID 56 (1S10): ggtatagctggaacgac Sequence ID 57 (2S17): agaatactgtactggtagtggttgctatgcc Sequence ID 58 (3S18): gtactggggtgattattatgac Sequence ID 59 (2S34): agcatattgtagtggtggtgtctgctacacc Sequence ID 60 (5S14): gtggatacagctacagttaccacagttttgccacc Sequence ID 61 (5S31): gtggatatagctacggttac Sequence ID 62 (6S9): gggtatagcagctggtcc Sequence ID 63 (1S27): ggtataactggaatgac Sequence ID 64 (2S22): agaatattgtagtggtatttactgctatgcc Sequence ID 65 (4S36): tgaatacagtaactac Sequence ID 66 (4S30): tgactacggtaactac Sequence ID 67 (5S37): ggggatacagtgggtacagttac Sequence ID 68 (6S20): gggtatagcggcagctggaacSequence ID 69 (1S33): ggaacacctggaacgac Sequence ID 70 (2S28): agcacactgtagtgatagtggctgctcctcc Sequence ID 71 (6S32): gggtatagcggtggctggtcc Sequence ID 72 (3S12): gtattactatagtggtagttattactaccacagtgt Sequence ID 73 (6S38): gggtatagcagcagcta Sequence ID 74 (6S26): gggtatagcagcggctggtcc Sequence ID 75 (1S39): ggtatagtgggaactacaac

[0037] 3. Desired Antigen in the Invention In this specification, "desired antigen" means an antigen intended to produce human antibodies against it. Examples of antigens include, but are not limited to, antigens associated with infectious diseases, cancer antigens, and antigens associated with autoimmune diseases.

[0038] Antigens associated with infectious diseases include those that cause viral diseases in humans, such as severe acute respiratory syndrome coronavirus, the betacoronavirus genus Salvecovirus subfamily, and respiratory syncytial virus (RSV), as well as malaria parasites that cause malaria. Particularly desirable antigens are severe acute respiratory syndrome coronaviruses, whose viral strains mutate frequently. Antibodies against these are thought to be potential preventive and therapeutic agents for infectious diseases.

[0039] Examples of cancer-related antigens include those that cause cancer in humans, such as vascular endothelial growth factor (VEGF), epidermal growth factor receptor (EGFR), CD38, CD20, glypican-3, and human epidermal growth factor receptor 2 (HER-2). Antibodies against these cancer antigens are thought to have anticancer effects.

[0040] Furthermore, examples of immune checkpoint molecules related to cancer immunity include programmed cell death-1 (PD-1), programmed cell death ligand-1 (PD-L1), cytotoxic T-lymphocyte antigen-4 (CTLA-4), and lymphocyte activation gene-3 (LAG-3). Antibodies against these antigens are also called immune checkpoint inhibitors and inhibit the mechanism (immune checkpoint) that inhibits T-cell attack against cancer cells. In this way, by activating immunity against cancer cells, the immune checkpoint inhibitors mentioned above are thought to have anti-cancer effects.

[0041] Antigens associated with autoimmune diseases include, for example, tumor lethal factor alpha (TNFα), interleukin (IL)-6, IL-6 receptor, integrin-a4b7, IL-12, IL-23, IL-17a, IL-17R, IL-4Rα, IL-23 p19, IL-5, OX40, MHC class I, and MHC class II. Antibodies against these antigens can be effective therapeutic agents for various autoimmune diseases.

[0042] Examples of other antigens include, in addition, sclerostin, complement C5, calcitonin gene-related peptide (CGRP), fibroblast growth factor 23 (FGF23), and RANK-L, etc. Sclerostin is a protein related to bone metabolism, and anti-sclerostin antibodies can be therapeutic agents for osteoporosis. Anti-complement C5 antibodies can be therapeutic agents for paroxysmal nocturnal hemoglobinuria (PNH) and other diseases where intravascular hemolysis caused by complement occurs. Anti-CGRP antibodies can be therapeutic agents that suppress the onset of migraine attacks by inhibiting the activity of this CGRP. Anti-FGF23 antibodies can be therapeutic agents for FGF23-related hypophosphatemic rickets / osteomalacia. Anti-RANK-L antibodies can be therapeutic agents for osteoporosis by inhibiting RANK-L and suppressing bone resorption by osteoclasts.

[0043] 4. Immunization method for rapidly inducing human antibodies The present invention is an immunization method for rapidly inducing human antibodies having a high binding ability to a desired antigen or antiserum having a high antibody titer.

[0044] The immunization induction method of the present invention includes, as an essential step, an immunization step of immunizing a non-human animal a plurality of times within 30 days from the first immunization with a desired antigen or a nucleic acid encoding the antigen. The non-human animal contains a human antibody gene or locus, and the endogenous gene or locus of the non-human animal corresponding to the human antibody gene or locus is disrupted or deficient, or has a mutation in which expression is lost or reduced.

[0045] According to the method of the present invention, a complete human antibody-producing animal containing a human antibody gene or locus and having a corresponding endogenous gene or locus deficient is hyperimmunized with a virus-derived antigen or the like in a short period of within 30 days, whereby the binding ability of a human monoclonal antibody or the titer of a human polyclonal antibody to the antigen can be rapidly enhanced.

[0046] The "non-human animal" herein is as described in 2 above, and the "desired antigen" is as described in 3 above. Examples of suitable non-human animals in the present invention include mice or rats. Further, in the present invention, it is preferable that the antigen is derived from a virus, and it is more preferable that the virus is a severe acute respiratory syndrome coronavirus.

[0047] In addition to the mode of immunizing a non-human animal with the antigen protein described in 3 above, in the present invention, a non-human animal can be immunized by administering mRNA encoding the antigen protein. Therefore, by performing immunization using a so-called mRNA vaccine, the effect of the present invention of rapidly inducing immunity can be achieved. mRNA vaccines can be developed relatively early if the genetic information of the antigen can be analyzed, and can also respond promptly when a new infectious disease prevails, and have the advantage of being able to expect high efficacy.

[0048] Most commonly, an mRNA vaccine is prepared as a formulation in which mRNA encoding an antigen protein is encapsulated in LNP, thereby stabilizing the mRNA. The method for preparing an mRNA vaccine encapsulated in LNP is a known technique generally known in the art. In addition, it is also possible to administer it in the form of an electrostatic complex of a cationic (positively charged) liposome and mRNA, a complex of various polymers and mRNA, etc., but it is not limited to the mode described above. Specific examples of various polymers include polyethyleneimine (PEI), dendrimer, poly(beta amino ester) (PBAEs), polyamino acid, polypeptide, chitosan and its derivatives, hyaluronic acid (HA) and its derivatives, etc.

[0049] Routes of administration for mRNA vaccines include intramuscular, subcutaneous, intradermal, and intravenous administration. Among these, immunization using the method of the present invention with a formulation encapsulated in LNPs is a preferred embodiment. It has been reported that immunity can be induced by intradermal administration of SARS-CoV-2 mRNA using a jet injector without encapsulating it in LNPs, etc. (Abbasi et al., Mol. Ther., 2024, 32(5), 1266-1283).

[0050] In this specification, "antibody" means "monoclonal antibody" unless otherwise specified. A "monoclonal antibody" is an antibody that recognizes only one epitope on an antigen and is composed of a single immunoglobulin G.

[0051] In this specification, "antiserum" refers to the blood of an immunized non-human animal from which coagulation proteins (red blood cells) have been removed. "Polyclonal antibodies" can be obtained by further purifying the "antiserum." "Polyclonal antibodies" refer to antibodies that recognize multiple epitopes on an antigen and are composed of a mixture of non-homologous immunoglobulins G against the entire antigen.

[0052] Furthermore, immunizing non-human animals with multiple antigen species or nucleic acids encoding those antigens is a preferred embodiment in the present invention. This makes it possible to obtain antibodies or antisera against antigens that have not been immunized, i.e., broad-spectrum neutralizing antibodies or broad-spectrum neutralizing antisera, which is a remarkable effect of the present invention. In the following examples, it is disclosed that when human antibody-producing mice were immunized with SARS-CoV-2 Wuhan strain, alpha strain, beta strain, and delta strain, antibodies and antisera against the unimmunized Omicron strain were obtained.

[0053] In the immunization step of the method of the present invention, "multiple immunizations" means administering a desired antigen or the nucleic acid encoding that antigen to a non-human animal two to fifteen times, preferably four to thirteen times, and more preferably six to nine times.

[0054] In the following examples, the spike proteins of the Wuhan strain of severe acute respiratory syndrome coronavirus and its variants, alpha, beta, and delta, were used as antigens, and immunization was administered for 20, 30, and 60 days. As a result, antisera that elicited a sufficient immune response even when diluted 100,000 times were obtained from the 30-day and 60-day immunization regimens. On the other hand, it was found that the antisera obtained from the 20-day immunization regimen elicited a weaker immune response in comparison.

[0055] Furthermore, in the following example, we have found that by administering a preparation in which the mRNA of the spike protein of the novel severe respiratory syndrome virus is encapsulated in LNPs and performing immunization for 30 days, we can obtain an antiserum that can produce a sufficient immune response even when diluted 100,000 times.

[0056] Conventionally, it took several months to immunize non-human animals to produce antibodies or antisera. However, with the present invention, this period can be drastically shortened to within 30 days, making the present invention of great significance for producing antibodies or antisera against viruses and other pathogens that mutate rapidly.

[0057] Furthermore, as mentioned above, the ability to obtain monoclonal or polyclonal antibodies against unimmunized antigens by administering multiple antigen species in a short period of time is of great significance as an effective means of dealing with viruses such as SARS-CoV-2, which are particularly prone to mutation.

[0058] 5. Method for Producing Human Antibodies Against a Desired Antigen 5-1. Overview The present invention relates to a method for producing human antibodies against a desired antigen. The method of the present invention is a method for producing human antibodies against a desired antigen using a non-human animal, and includes, as essential steps: an immunization step in which the non-human animal is immunized with the antigen or the nucleic acid encoding the antigen; an isolation step of human immunoglobulin-positive B cells in which human immunoglobulin-positive B cells are isolated from the tissue of the immunized non-human animal; an antibody base sequence acquisition step in which the base sequences of antibody heavy chain mRNA-derived cDNA and antibody light chain mRNA-derived cDNA prepared from the isolated B cells are obtained; and an antibody production step in which antibodies are produced based on the base sequences of the obtained antibodies.

[0059] The present invention provides a method for producing human antibodies, characterized by obtaining antibody sequences at the single-cell level by performing single-cell repertoire analysis based on single-B cell technology. In single-cell repertoire analysis, by attaching a different barcode to the mRNA of each individual B cell, it is possible to perform sequence analysis and expression analysis of the B cell receptor (BCR) gene at the single-cell level. Therefore, the diversity and dynamics of B cells can be analyzed at the single-cell level.

[0060] The present invention's method for producing human antibodies obtains antibody sequences at the single-cell level, eliminating the need to sort by antigen before determining the antibody sequence. Therefore, the present invention enables rapid and high-throughput production of human antibodies. In addition, as shown in the examples below, antibodies produced from single-cell clones obtained by the method of the present invention bind to antigens with high efficiency.

[0061] 5-2. Immunization Process The immunization process of the present invention involves immunizing a non-human animal with a desired antigen. Herein, "non-human animal" is as described in section 2 above, and "desired antigen" is as described in section 3 above. The desired antigen can be administered to the non-human animal as its antigen protein, or as mRNA encoding the antigen protein. In the present invention, mice or rats are suitable non-human animals. Furthermore, in the present invention, it is preferable that the antigen is of viral origin, and it is even more preferable that the virus is severe acute respiratory syndrome coronavirus. In addition, it is a preferred embodiment of the present invention to carry out this immunization process by an immunization method that rapidly increases antibody titers as described in section 4 above.

[0062] 5-3. Isolation Step In the isolation step of the present invention, human immunoglobulin-positive B cells are isolated from the tissue of a non-human animal after the immunization step. This tissue is not particularly limited, but isolating B cells from the lymph nodes or spleen of an immunized non-human animal is a preferred embodiment in the present invention.

[0063] In this process, impurities are removed from a mixture of cells containing various types of cells, and human immunoglobulin-positive B cells are isolated. The operation of separating a mixture of many types of cells and selecting the target cells is called sorting.

[0064] In this isolation process, cells contained in the tissue of immunized non-human animals are labeled with an anti-CD19 antibody, a B cell marker conjugated to a fluorescent dye, and an antibody against human IgG conjugated to a fluorescent dye. These cells are then sorted using a flow cytometer, i.e., by the FACS method, fluorescently active IgG-positive B cells can be isolated. Since the cells become single cells after sorting, cloning has already occurred.

[0065] In another embodiment, IgG-positive B cells can also be isolated by magnetic activated cell sorting (MACS), in which cells contained in the tissue of a non-human animal that has been immunized by an antigen-antibody reaction are passed through a column set in a magnetic field, and only the cells labeled with magnetic beads are obtained.

[0066] 5-4. Antibody Base Sequence Acquisition Process In the antibody base sequence acquisition process of the present invention, the base sequences of the antibody heavy chain mRNA-derived cDNA and antibody light chain mRNA-derived cDNA prepared from isolated B cells are acquired. That is, single-cell repertoire analysis is performed on the single cells obtained in the above isolation process, and the base sequences of the antibodies of each clone are acquired as pairs of heavy chain and light chain sequences.

[0067] B cells are key players in the adaptive immune response, and they express B cell receptors (BCRs), which are antigen-recognizing molecules, on their surface. These receptors enable the immune system to make antigen-specific responses, and the immune repertoire refers to the totality of these receptors. BCRs are created through V(D)J gene rearrangement, in which one gene each from the V, D, and J gene groups are selected and combined to form a single receptor gene.

[0068] Repertoire analysis is a technique for analyzing the diversity of BCR genes expressed on the surface of B cells. Single-cell repertoire analysis involves analyzing the BCR gene sequence for each individual cell. By performing high-throughput nucleotide sequence analysis on a single cell, it is possible to obtain nucleotide sequence information for each clone, and it is also possible to analyze the type of clone and its expression frequency.

[0069] The acquisition of such base sequences can be performed using various instruments for single-cell base sequence analysis, and is not particularly limited as long as it is possible to acquire and analyze the base sequence of the target single cell. Examples of instruments capable of such analysis include single-cell analyzers such as 10x Chromium (10x Genomics), fasta (basepair), and BBrowserX (Bioturning). Alternatively, single-cell nucleic acid preparation systems such as Fluidigm C1 (Fluidigm) and Beacon Optofluidic System (Berkeley Lights) can also be used.

[0070] 5-5. Antibody Production Process In the antibody production process of the present invention, an antibody against a desired antigen is produced based on the base sequences of the antibody heavy chain mRNA-derived cDNA and the antibody light chain mRNA-derived cDNA obtained in the preceding step.

[0071] As described in section 5-4 above, B cells express BCRs as cell surface molecules that specifically recognize antigens. Since a single B cell expresses only one type of antigen receptor (BCR), cells with identical antigen receptors are considered clones, and the amino acid sequence or corresponding nucleic acid sequence unique to each BCR is called a "chronotype."

[0072] Based on the base sequences of the antibody heavy chain and antibody light chain obtained in the antibody base sequence acquisition process, the expression frequency of chronotypes is analyzed as described in 5-4 above, and antibodies are produced for chronotypes with high expression frequency.

[0073] There is no limit to the number of chronotypes used in antibody production. However, from a cost and effort standpoint, antibodies can be produced based on the base sequences of the top 80, 70, 60, 50, 40, 30, 25, or 24 chronotypes that induce high levels of antigen-specific B cell proliferation.

[0074] The means of antibody production are not specified, and various methods known in the art can be used. For example, after cloning the obtained antibody base sequence into an expression vector, the vector can be introduced into cultured cells such as Chinese hamster ovary (CHO) cells or human fetal kidney 293 (HEK293) cells, and the antibody can be expressed to produce the antibody. However, the cultured cells that can be used for antibody production are not limited to these.

[0075] In the examples below, when the antigen-binding ability of 25 antibodies based on 25 chronotypes was measured, it was shown that 14 antibodies, representing 56%, bound to the antigen. Even when administered as mRNA encapsulated in LNPs, it was shown that 63% of the antibodies bound to the antigen after 9 administrations over 30 days, and 64% of the antibodies bound to the antigen after 13 administrations over 30 days.

[0076] Furthermore, to efficiently produce antibodies, it is also possible to isolate human immunoglobulin-positive B cells from immunized non-human animals and obtain antibodies by synthesizing and amplifying antibody heavy chain mRNA-derived cDNA and antibody light chain mRNA-derived cDNA without performing single-cell repertoire analysis.

[0077] The present invention will be described in more detail with reference to the following embodiments, but the technical scope of the present invention is not limited by these embodiments.

[0078] The inventors focused on SARS-CoV-2 spike protein mutants and succeeded in rapidly producing broad-spectrum human neutralizing antibodies against the spike protein mutant and unimmunized mutants by shortening the time required for antibody production from immunization of fully human antibody-producing mice into which human antibody genes have been introduced, and from B cell isolation. In the following examples, the Wuhan strain, alpha strain, beta strain, and delta strain of the novel severe respiratory syndrome virus (SARS-CoV-2) were used as antigens, and antibodies and antisera against them were obtained.

[0079] <Example 1> (1) Overview In order to deal with viruses that have a high mutation rate, a technology is needed that can rapidly produce human antibodies. Therefore, the immunization period, which conventionally took several months, was completed in a short period of less than 30 days using fully human antibody-producing mice (TC-mAb mice). In this example, immunization was performed for 30 days, and the titer of the antiserum, the concentration of human IgG and human IgM, the human IgG subclass, and the antibody titer of the anti-RBD antibody were evaluated.

[0080] (2) Materials and Methods 15 μg of RBD-Wuhan strain was prepared with 60 μl of phosphorate-buffered saline (PBS: pH 7.4) + 60 μl of AddaVax (InvivoGen) and used as the antigen for the first immunization against one fully human antibody-producing mouse. 20 μl of the preparation was administered subcutaneously to a total of six sites, targeting the lymph nodes. After the initial immunization, 5 μg spike protein alpha, beta, and delta strains (Sino Biological, Inc.) and RBD-Wuhan strain were prepared with 60 μl PBS + 60 μl incomplete Friend's adjust (IFA) and 30 μg ODN1826 (InvivoGen) or 30 μg imiquimod (InvivoGen) to serve as immunization antigens. Immunization was performed twice a week, for a total of nine immunizations (Figure 1-1A). Antiserum was also prepared by collecting blood once a week. Lymphocytes were collected from lymph nodes, spleen, and bone marrow 1 to 3 days after the final immunization. All mice were maintained under SPF conditions and used at 7 to 9 weeks of age. All animal experiments were conducted in accordance with guidelines, with the approval of the Tottori University Animal Experiment Committee.

[0081] The immunization method performed in this example was evaluated using ELISA with antiserum. The evaluation items were the titers against the RBD-Wuhan strain, spike protein alpha strain (B.1.1.7), beta strain (B1.351), and delta strain (B.1.617.2) immunized as antigens, the titer against the Omicron strain (B.1.1.529) which was not immunized as an antigen, the concentrations of human IgG and human IgM, and the antibody titers of human IgG subclasses and anti-RBD antibodies. To evaluate the titers, ELISA plates were coated with RBD-Wuhan strain, spike protein alpha strain, beta strain, delta strain, and Omicron strain (1 μg / ml). After blocking, serially diluted antiserum was added to the ELISA plate and then incubated with goat anti-human IgG-Fc antibody-HRP (Bethyl Laboratories, Inc.). HRP activity was visualized using 1-Step Ultra TMB-ELISA solution (Thermo Fisher Scientific), and the reaction was stopped by adding 0.18 M sulfuric acid. OD450 was measured using a BioTek Epoch 2 microplate spectrum meter (Agilent Technologies).

[0082] To measure the concentrations of human IgG and human IgM, ELISA plates were coated with goat anti-human IgG-Fc coated antibody (Bethyl Laboratories, Inc.) or goat anti-human IgM coated antibody (Bethyl Laboratories, Inc.). After blocking, diluted antiserum and human IgG-UNLB standard (Southern Biotech) or human IgM Lambda-UNLB standard (Southern Biotech) were added to the ELISA plates, and then incubated with goat anti-human IgG-Fc antibody-HRP (Bethyl Laboratories, Inc.) or goat anti-human IgM-Fc antibody-HRP (Bethyl Laboratories, Inc.). HRP activity was visualized using 1-Step Ultra TMB-ELISA solution (Thermo Fisher Scientific), and the reaction was stopped by adding 0.18 M sulfuric acid. OD450 was measured using a BioTek Epoch 2 microplate spectrum meter (Agilent Technologies).

[0083] Human IgG subclasses were measured using the human IgG subclass ELISA kit (Invitrogen).

[0084] To measure the antibody titer of anti-RBD antibodies, ELISA plates were coated with RBD-Wuhan strain (2.5 μg / ml). After blocking, diluted antiserum or NT-193 antibody standard was added to the ELISA plate and then incubated with goat anti-human IgG-Fc antibody-HRP (Bethyl Laboratories, Inc.). HRP activity was visualized using 1-Step Ultra TMB-ELISA solution (Thermo Fisher Scientific), and the reaction was stopped by adding 0.18 M sulfuric acid. OD450 was measured using a BioTek Epoch 2 microplate spectrum meter (Agilent Technologies).

[0085] (3) Results and Discussion The results of the immunoassay evaluation are shown in Figures 1-1, 1-2, and 2. Analysis of the antiserum titer by ELISA revealed an increase in titer against the RBD-Wuhan strain three weeks after the start of immunization, and a reaction was observed even when the antiserum was diluted 100,000 times after the final immunization (Figure 1-1B). For each spike protein mutant strain, namely spike protein alpha strain (B.1.1.7), beta strain (B1.351), delta strain (B.1.617.2), and omicron strain (B.1.1.529), an increase in titer was observed two weeks after the start of immunization, and a reaction was observed even when the antiserum was diluted 1,000,000 times after the final immunization (Figures 2A-D). While differences in reaction were observed depending on the antigenicity of the antigen protein, this immunoassay demonstrated a sufficient increase in titer against the antigen.

[0086] Serum human IgG concentrations were measured and found to have risen to 1–2 mg / ml after final immunization (Figure 1-1C). Human IgM concentrations also rose to 1–2 mg / ml after final immunization (Figure 1-1C). Compared to pre-immunization levels, human IgG increased approximately 200-fold and human IgM increased approximately 10-fold, suggesting the induction of class switching from IgM to IgG.

[0087] Analysis of IgG subclasses revealed that more than half were human IgG1 (Figure 1-2D).

[0088] Analysis of anti-RBD antibody titers in serum using ELISA revealed that they increased to 100-400 μg / ml after final immunization (Figure 1-2E). Since the human IgG concentration was 1-2 mg / ml, it was observed that 1 / 5 to 1 / 10 of the human IgG was antigen-specific antibody (anti-RBD antibody). Because human antibody-producing mice have a characteristic of easily differentiating into plasma blasts and plasma cells, it was suggested that a sufficient immune response occurs in the immunization method of the present invention, and antigen-specific antibody production is frequently induced.

[0089] <Example 2> (1) Outline Similar to conventional immunoassays, fully human antibody-producing mice were immunized with the RBD-Wuhan strain as a single antigen to evaluate antibody production against the antigen of this immunoassay. Immunization was carried out for 30 days. The immunoassay performed in this example was evaluated by the titer of the antiserum and the antibody titers of human IgG and RBD antibodies.

[0090] (2) Materials and Methods 15 μg RBD-Wuhan strain was prepared with 60 μl phosphorate-buffered saline (PBS: pH 7.4) + 60 μl AddaVax (InvivoGen) and used as the antigen for the initial immunization of one fully human antibody-producing mouse. 20 μl was subcutaneously administered to a total of six sites, targeting the lymph nodes. After the initial immunization, 5 μg RBD-Wuhan strain was prepared with 60 μl PBS + 60 μl incomplete Friend's adjust (IFA) and 30 μg ODN1826 (InvivoGen) and used as the antigen for immunization. A total of nine immunizations were performed by administering immunizations twice a week (Figure 3A). Furthermore, antiserum was prepared by collecting blood once a week. Lymphocytes were collected from lymph nodes, spleen, and bone marrow 1 to 3 days after final immunization. All mice were maintained under SPF conditions and used at 7 weeks of age. All animal experiments were conducted in accordance with the guidelines approved by the Tottori University Animal Experiment Committee.

[0091] The immunization method performed in this example was evaluated using ELISA with antiserum. The evaluation items were the titer against the RBD-Wuhan strain immunized as the antigen, and the antibody titers of human IgG and anti-RBD antibodies. To evaluate the titer, ELISA plates were coated with RBD-Wuhan strain (1 μg / ml). After blocking, serially diluted antiserum was added to the ELISA plate and then incubated with goat anti-human IgG-Fc antibody-HRP (Bethyl Laboratories, Inc.). HRP activity was visualized using 1-Step Ultra TMB-ELISA solution (Thermo Fisher Scientific), and the reaction was stopped by adding 0.18 M sulfuric acid. OD450 was measured using a BioTek Epoch 2 microplate spectrum meter (Agilent Technologies).

[0092] To measure the concentration of human IgG, ELISA plates were coated with goat anti-human IgG-Fc coated antibody (Bethyl Laboratories, Inc.). After blocking, diluted antiserum and human IgG-UNLB standard (Southern Biotech) were added to the ELISA plates, and then incubated with goat anti-human IgG-Fc antibody-HRP (Bethyl Laboratories, Inc.). HRP activity was visualized using 1-Step Ultra TMB-ELISA solution (Thermo Fisher Scientific), and the reaction was stopped by adding 0.18 M sulfuric acid. OD450 was measured using a BioTek Epoch 2 microplate spectrum meter (Agilent Technologies).

[0093] To measure the antibody titer of anti-RBD antibodies, ELISA plates were coated with RBD-Wuhan strain (2.5 μg / ml). After blocking, diluted antiserum or NT-193 antibody standard was added to the ELISA plate and then incubated with goat anti-human IgG-Fc antibody-HRP (Bethyl Laboratories, Inc.). HRP activity was visualized using 1-Step Ultra TMB-ELISA solution (Thermo Fisher Scientific), and the reaction was stopped by adding 0.18 M sulfuric acid. OD450 was measured using a BioTek Epoch 2 microplate spectrum meter (Agilent Technologies).

[0094] (3) Results and Discussion The evaluation results of this immunoassay using a single antigen are shown in Figure 3. Analysis of the antiserum titer by ELISA revealed an increase in titer against the RBD-Wuhan strain two weeks after the start of immunization, and a reaction was still observed even when the antiserum was diluted 100,000 times after the final immunization (Figure 3B). This immunoassay demonstrated a reasonable increase in titer against the antigen.

[0095] Serum human IgG concentrations were measured and found to have risen to 0.1–0.2 mg / ml after final immunization (Figure 3C).

[0096] Analysis of anti-RBD antibody titers in serum using ELISA revealed that they increased to 100–300 μg / ml after final immunization (Figure 3C). Given that human IgG concentrations were 0.1–0.2 mg / ml, this suggests that almost all of the produced human IgG was antigen-specific.

[0097] <Example 3> (1) Overview Similar to conventional immunoassays, in this example the immunization period was extended from 30 days to 60 days for further investigation. The immunization performed in this example was evaluated by the titer of the antiserum and the antibody titers of human IgG and RBD antibodies.

[0098] (2) Materials and Methods 15 μg of RBD-Wuhan strain was prepared by mixing 60 μl of phosphorate-buffered saline (PBS: pH 7.4) with 60 μl of AddaVax (InvivoGen) to create an antigen for one fully human antibody-producing mouse. 20 μl of this preparation was administered subcutaneously to a total of six locations, targeting the lymph nodes. After the initial immunization, 5 μg spike protein alpha, beta, and delta strains (Sino Biological, Inc.) and RBD-Wuhan strain were prepared with 60 μl PBS + 60 μl incomplete Friend's adjust (IFA) and 30 μg ODN1826 (InvivoGen) or 30 μg imiquimod (InvivoGen) to serve as immunization antigens. Immunization was performed once a week, for a total of nine immunizations (Figure 4A). Antiserum was also prepared by collecting blood once a week. Lymphocytes were collected from lymph nodes, spleen, and bone marrow 1 to 3 days after the final immunization. All mice were maintained under SPF conditions and used at 7 to 9 weeks of age. All animal experiments were conducted in accordance with guidelines, with the approval of the Tottori University Animal Experiment Committee.

[0099] The immunization method performed in this example was evaluated using ELISA with antiserum. The evaluation items were the titer against the RBD-Wuhan strain immunized as the antigen, and the antibody titers of human IgG and anti-RBD antibody. To evaluate the titer, ELISA plates were coated with RBD-Wuhan strain (1 μg / ml). After blocking, serially diluted antiserum was added to the ELISA plate and then incubated with goat anti-human IgG-Fc antibody-HRP (Bethyl Laboratories, Inc.). HRP activity was visualized using 1-Step Ultra TMB-ELISA solution (Thermo Fisher Scientific), and the reaction was stopped by adding 0.18 M sulfuric acid. OD450 was measured using a BioTek Epoch 2 microplate spectrum meter (Agilent Technologies).

[0100] To measure the concentration of human IgG, ELISA plates were coated with goat anti-human IgG-Fc coated antibody (Bethyl Laboratories, Inc.). After blocking, diluted antiserum and human IgG-UNLB standard (Southern Biotech) were added to the ELISA plates, and then incubated with goat anti-human IgG-Fc antibody-HRP (Bethyl Laboratories, Inc.). HRP activity was visualized using 1-Step Ultra TMB-ELISA solution (Thermo Fisher Scientific), and the reaction was stopped by adding 0.18 M sulfuric acid. OD450 was measured using a BioTek Epoch 2 microplate spectrum meter (Agilent Technologies).

[0101] For measuring the antibody titer of anti-RBD antibodies, ELISA plates were coated with RBD-Wuhan strain (2.5 μg / ml). After blocking, diluted antiserum or NT-193 antibody standard was added to the ELISA plate and then incubated with goat anti-human IgG-Fc antibody-HRP (Bethyl Laboratories, Inc.). HRP activity was visualized using 1-Step Ultra TMB-ELISA solution (Thermo Fisher Scientific), and the reaction was stopped by adding 0.18 M sulfuric acid. OD450 was measured using a BioTek Epoch 2 microplate spectrum meter (Agilent Technologies).

[0102] (3) Results and Discussion The evaluation results of long-term immunization (60 days) are shown in Figure 4. Analysis of antiserum titer by ELISA revealed an increase in titer against the RBD-Wuhan strain four weeks after the start of immunization, and a reaction was still observed even when the antiserum was diluted 100,000 times after the final immunization (Figure 4B). This immunization method demonstrated a reasonable increase in titer against the antigen.

[0103] Serum human IgG concentration was measured and found to have risen to 2 mg / ml after final immunization (Figure 4C).

[0104] Analysis of anti-RBD antibody titers in serum using ELISA revealed that they increased to 200–500 μg / ml after final immunization (Figure 4C). Since the human IgG concentration was 2 mg / ml, it was determined that 1 / 4 to 1 / 10 of the human IgG was antigen-specific antibody (anti-RBD antibody). It was observed that stable and high titers can be achieved by prolonging the immunization period.

[0105] <Example 4> (1) Overview In order to further shorten the immunization period, the immunization period of this immunization method was shortened from 30 days to 20 days and investigated. The immunization method performed in this example was evaluated by the titer of the antiserum and the antibody titers of human IgG and RBD antibodies.

[0106] (2) Materials and Methods 15 μg of RBD-Wuhan strain was prepared with 60 μl of phosphorate-buffered saline (PBS; pH 7.4) + 60 μl of AddaVax (InvivoGen) and used as the antigen for the first immunization against one fully human antibody-producing mouse. 20 μl of the preparation was administered subcutaneously to a total of six sites, targeting the lymph nodes. After the initial immunization, 5 μg spike protein alpha, beta, and delta strains (Sino Biological, Inc.) and RBD-Wuhan strain were prepared with 60 μl PBS + 60 μl incomplete Friend's adjust (IFA) and 30 μg ODN1826 (InvivoGen) or 30 μg imiquimod (InvivoGen) to serve as immunization antigens. Immunization was performed three times a week, for a total of nine immunizations (Figure 5A). Antiserum was also prepared by collecting blood once a week. Lymphocytes were collected from lymph nodes, spleen, and bone marrow 1 to 3 days after the final immunization. All mice were maintained under SPF conditions and used at 7 weeks of age. All animal experiments were conducted in accordance with guidelines after approval by the Tottori University Animal Experiment Committee.

[0107] The immunization method performed in this example was evaluated using ELISA with antiserum. The evaluation items were the titer against the RBD-Wuhan strain immunized as the antigen, and the antibody titers of human IgG and anti-RBD antibody. To evaluate the titer, the ELISA plate was coated with RBD-Wuhan strain (1 μg / ml). After blocking, serially diluted antiserum was added to the ELISA plate and then incubated with goat anti-human IgG-Fc antibody-HRP (Bethyl Laboratories, Inc.). HRP activity was visualized using 1-Step Ultra TMB-ELISA solution (Thermo Fisher Scientific), and the reaction was stopped by adding 0.18 M sulfuric acid. OD450 was measured using a BioTek Epoch 2 microplate spectrum meter (Agilent Technologies).

[0108] To measure the concentration of human IgG, ELISA plates were coated with goat anti-human IgG-Fc coated antibody (Bethyl Laboratories, Inc.). After blocking, diluted antiserum and human IgG-UNLB standard (Southern Biotech) were added to the ELISA plates, and then incubated with goat anti-human IgG-Fc antibody-HRP (Bethyl Laboratories, Inc.). HRP activity was visualized using 1-Step Ultra TMB-ELISA solution (Thermo Fisher Scientific), and the reaction was stopped by adding 0.18 M sulfuric acid. OD450 was measured using a BioTek Epoch 2 microplate spectrum meter (Agilent Technologies).

[0109] To measure the antibody titer of anti-RBD antibodies, ELISA plates were coated with RBD-Wuhan strain (2.5 μg / ml). After blocking, diluted antiserum or NT-193 antibody standard was added to the ELISA plate and then incubated with goat anti-human IgG-Fc antibody-HRP (Bethyl Laboratories, Inc.). HRP activity was visualized using 1-Step Ultra TMB-ELISA solution (Thermo Fisher Scientific), and the reaction was stopped by adding 0.18 M sulfuric acid. OD450 was measured using a BioTek Epoch 2 microplate spectrum meter (Agilent Technologies).

[0110] (3) Results and Discussion The evaluation results of short-term immunization (20 days) are shown in Figure 5. Analysis of antiserum titer by ELISA revealed an increase in titer against the RBD-Wuhan strain two weeks after the start of immunization, and even after the final immunization, a slight reaction was observed when the antiserum was diluted 100,000 times (Figure 5B).

[0111] Serum human IgG concentrations were measured and found to have risen to 0.2–1 mg / ml after final immunization (Figure 5C).

[0112] Analysis of serum anti-RBD antibody titers using ELISA revealed that they increased to 10–100 μg / ml after final immunization (Figure 5C). Shortening the immunization period resulted in a decrease in both titer and antibody titer.

[0113] <Example 5> (1) Outline IgG+ B cells were isolated from lymphocytes recovered from fully human antibody-producing mice immunized with viral antigens, and the gene sequences of human antibody heavy chains and human antibody κ chains were identified using 10x Chromium. Antibodies were produced based on the heavy chain and κ chain gene sequences of the top 25 most frequently occurring chronotypes, and the binding ability and neutralizing activity of 25 neutralizing antibody candidates were analyzed.

[0114] (2) Materials and Methods Cells derived from the lymph nodes or spleen of fully human antibody-producing mice immunized for 30 days with spike protein alpha, beta, delta strains and RBD-Wuhan strain were blocked using mouse seroblock FcR (Bio-Rad Laboratories) and then stained with anti-CD19 antibody-PerCP-Cy5.5 (Biolegend) and anti-hIgG antibody-PE / Cy7 (Biolegend). IgG+ B cells were isolated using a FACSAria Fusion flow cytometer (BD).

[0115] NGS analysis was performed on single IgG+ B cells using 10x Chromium (10x Genomics) to obtain the sequences of human antibody heavy chain and human antibody light chain genes (κ genes), and their frequencies were analyzed. Antibodies were produced based on the heavy chain and κ chain gene sequences of the top 25 most frequently occurring chronotypes (Biointron).

[0116] The binding ability of the 25 neutralizing antibody candidate clones prepared in this manner to the antigen was analyzed by ELISA. ELISA plates were coated with RBD-Wuhan strain, spike protein alpha, beta, delta, and omicron strains (0.1 μg / ml). After blocking, diluted purified antibodies, NT-193 antibody, and sotrovimab were added to the ELISA plates, and then incubated with goat anti-human IgG-Fc antibody-HRP (Bethyl Laboratories, Inc.). HRP activity was visualized using 1-Step Ultra TMB-ELISA solution (Thermo Fisher Scientific), and the reaction was stopped by adding 1 M sulfuric acid. OD450 was measured using a BioTek Epoch 2 microplate spectrum meter (Agilent Technologies).

[0117] The neutralizing activity of the 25 neutralizing antibody candidates listed above against the Wuhan strain and the Omicron BA.5 strain was analyzed using a SARS-CoV-2 spike-dependent cell fusion assay (InvivoGen). 293-hMyD88 cells expressing the spike protein of either the Wuhan strain or the Omicron BA.5 strain were seeded in 96-well plates and incubated with purified antibody, NT-193 antibody, and sotrovimab for 1 hour. A549 dual hACE2 TMPRSS2 cells were added and cultured for 1 day. SEAP activity was visualized using quanti-blue solution (InvivoGen), and OD620 was measured using a BioTek Epoch 2 microplate spectrum meter (Agilent Technologies).

[0118] (3) Results and Discussion Figure 6 shows the process of isolating IgG+ B cells from lymph node or spleen-derived cells of fully human antibody-producing mice immunized with viral antigens.

[0119] Lymphocytes were gated from the recovered cells, doublets were removed, and then the cells were separated using PerCP-Cy5.5 (CD19) and PE / Cy7 (human IgG).

[0120] NGS analysis was performed on a single IgG+ B cell using 10x Chromium to obtain the sequences of the human antibody heavy chain and the human antibody κ gene. Considering the continuous immunization schedule and the high frequency of antigen-specific antibody production, the induction of clonal proliferation (proliferation of antigen-specific B cells) was suggested. Therefore, neutralizing antibody candidates were generated from the 25 most frequently occurring chronotypes.

[0121] The analysis results of the neutralizing antibody candidates are shown in Figures 7-9. Analysis of the antigen-binding ability of antibodies produced from 25 chronotypes using ELISA revealed that 14 antibodies (56%) bound to the RBD-Wuhan strain, spike protein alpha, beta, or delta strains, which were immunized as antigens (Figure 7). Of these, 9 antibodies (36%) also bound to the Omicron strain, which was not immunized as an antigen. Based on these results, these 9 antibodies were selected as broad-spectrum neutralizing antibody candidates.

[0122] Analysis of 25 chronotypes using a SARS-CoV-2 spike-dependent cell fusion assay revealed neutralizing activity against the Wuhan strain in chronotypes 6 and 11 (Figure 8). Furthermore, chronotype 11 also showed neutralizing activity against the Omicron BA.5 strain (Figure 9). These results demonstrate that this immunoassay successfully produced broad-spectrum neutralizing antibodies against the Omicron strain, which was not immunized as an antigen.

[0123] <Example 6> (1) Overview In order to deal with viruses with a high mutation rate, a technology that can rapidly produce human antibodies is necessary. Therefore, instead of using conventional recombinant proteins as the antigen to be used for immunity, mRNA encoding the antigen was encapsulated in lipid nanoparticles (LNPs) to produce mRNA-LNPs. While recombinant proteins require processes such as molecular cloning, transfection, and protein purification, mRNA-LNPs allow for efficient antigen preparation because mRNA is produced from the gene sequence and encapsulated in LNPs. In this study, mRNA encoding SARS-CoV-2 spike protein (RBD-Wuhan strain (RBD-Wuhan)) was encapsulated in LNPs to produce SARS-CoV-2 spike protein mRNA-LNPs. (2) Materials and Methods

[0124] [A. 1] Straightening of DNA A 5 μg equivalent of pDNA was weighed out of an aqueous solution containing template pDNA in which DNA encoding SARS-CoV-2 spike protein was inserted into a pT7 vector (vector builder), and ultrapure water was added to make a total volume of 45 μL. To this diluted pDNA solution, 1 μL of restriction enzyme XhoI (New England Biolabs) was added, and 5 μL of rCut smart buffer (New England Biolabs) was added to make a total volume of 50 μL, and the solution was incubated at 37°C for 16 hours. To the incubated DNA solution, 50 μL of ultrapure water was added, followed by 100 μL of a mixture of phenol, chloroform, and isoamyl alcohol in a 25:24:1 ratio. The mixture was vortexed for 1 minute, then centrifuged (20400 × g, 10 minutes, 4°C). 90 μL of the upper aqueous phase was collected, and 10 μL of ultrapure water was added to make a total of 100 μL. 250 μL of 99.5% ethanol, 5 μL of 5M NaCl aqueous solution, and 0.5 μL of 20 mg / mL glycogen aqueous solution were added and mixed by inversion. The mixture was then cooled at -20°C for 30 minutes and centrifuged (20400 × g, 15 minutes, 4°C). The liquid portion was removed, 200 μL of 70% ethanol was added to the precipitate, and after mixing by pipetting, the mixture was centrifuged (20400 × g, 5 minutes, 4°C). The liquid portion was removed, and 15 μL of nuclease-free ultrapure water was added to dissolve the precipitate, obtaining an aqueous solution of linearized DNA.

[0125] [A. 2] In vitro transcription reaction: Weigh out 1 μg of linearized DNA aqueous solution and add ultrapure water to make 8.5 μL. Add 2 μL of 75 mM adenosine triphosphate solution, 2 μL of 75 mM cytidine triphosphate solution, 2 μL of 75 mM guanosine triphosphate solution, and 1.5 μL of 100 mM N1-methylpsuduridine triphosphate solution to a separate tube. Add 2 μL of 10×T7 Reaction Buffer included with the MEGAscript™ T7 T7 Transcription Kit (Invitrogen), then add the linearized DNA solution. After that, add 2 μL of T7 Enzyme Mix included with the same kit and react at 37°C for 1 hour. Next, 1 μL of the TURBO DNase solution included in the kit was added and mixed, and the mixture was allowed to react at 37°C for 15 minutes. To the reaction solution, 30 μL of ultrapure water and 30 μL of Lithium Chloride Precipitation Solution included in the kit were added, and the mixture was cooled at -20°C for 30 minutes. Then, the mixture was centrifuged (20400 x g, 15 minutes, 4°C). After removing the liquid portion, 200 μL of 70% ethanol was added to the precipitate and stirred by tapping, and then the mixture was centrifuged (20400 x g, 5 minutes, 4°C). After removing the liquid portion, 20 μL of nuclease-free ultrapure water was added to dissolve the precipitate and obtain the RNA solution.

[0126] [A. 3] A dsRNA removal chromatography buffer (10 mM HEPES, 0.1 mM EDTA, 125 mM NaCl, 16% ethanol, pH 7.2) was prepared. Cellulose was suspended in the chromatography buffer to a concentration of 0.2 g / mL and stirred for 10 minutes. 350 μL of this cellulose suspension was transferred to a spin column and centrifuged (14,000 × g, 1 minute, 25°C). The chromatography buffer that passed through the column was removed, and 500 μL of fresh chromatography buffer was added from the top of the column and stirred for 5 minutes, then centrifuged (14,000 × g, 1 minute, 25°C). The chromatography buffer that passed through the column was removed, and 20 μL of RNA solution and 480 μL of chromatography buffer were added from the top of the column and shaken at 37°C for 30 minutes. Next, centrifugation (14,000 g, 1 minute, 25°C) was performed and 500 μL of the solution containing the RNA that passed through the column was recovered. To the recovered mRNA solution, 50 μL of 0.1 volume (50 μL) of 3 M ammonium acetate aqueous solution (pH 5.5) was added, 500 μL of isopropanol was added, and the mixture was inverted and mixed. After spinning down, the mixture was cooled at -20°C for 20 minutes and centrifuged (20,400 × g, 10 minutes, 4°C). The liquid portion was removed, and 200 μL of 70% ethanol was added to the precipitate and mixed by pipetting, then centrifuged (20,400 × g, 5 minutes, 4°C). The liquid portion was removed, and 70 μL of nuclease-free ultrapure water was added to dissolve the precipitate and obtain the RNA solution.

[0127] [A. 4] Addition of 5' Caps: Weigh out 50 μg of RNA equivalent from the RNA solution, add ultrapure water to make 67 μL, heat at 65°C for 5 minutes, and then place on ice. To this RNA solution, 10 μL of 10×ScriptCap Capping Buffer (included with ScriptCap™ m7G Capping System (cellscript)), 10 μL of 10 mM GTP solution, 2.5 μL of 20 mM SAM solution, 2.5 μL of ScriptGuard RNAse Inhibitor, 4 μL of ScriptCap 2'-O-Methyltransferase (100 U / μL), and 4 μL of ScriptCap Capping Enzyme were mixed and reacted at 37°C for 30 minutes. 50 μL of LiCl Precipitation Solution was added to 100 μL of the reaction mixture, cooled at -20°C for 30 minutes, and then centrifuged (20400 g, 5 minutes, 4°C). The liquid portion was removed, 200 μL of 70% ethanol was added to the precipitate, and after mixing by pipetting, centrifugation was performed again (20400 g, 5 minutes, 4°C). The liquid portion was removed, and 20 μL of nuclease-free ultrapure water was added to dissolve the precipitate, obtaining an aqueous solution of Cap-mediated RNA.

[0128] [A. 5] Addition of Poly(A) tail To 20 μL of aqueous solution of Cap-modified RNA, 36 μL of ultrapure water was added. 20 μL of 5×E-PAP buffer, 10 μL of 25 mM MnCl2 solution, 10 μL of ATP solution, and 4 μL of E-PAP solution were added to the Poly(A) Tailing Kit (ThermoFisher Scientific), mixed by tapping, and reacted at 37°C for 45 minutes. 50 μL of LiCl Precipitation Solution was added to 100 μL of the reaction mixture, cooled at -20°C for 30 minutes, and centrifuged (20400×g, 5 minutes, 4°C). The liquid portion was removed, 200 μL of 70% ethanol was added to the precipitate and mixed by pipetting, then centrifuged (20400 × g, 5 minutes, 4°C). The liquid portion was removed, and 50 μL of nuclease-free ultrapure water was added to dissolve the precipitate, obtaining an aqueous solution of mRNA.

[0129] [B] Preparation of mRNA-free LNPs A 10 mM ethanol solution of COATSOME® SS-OP (NOF Co., Ltd.), a 20 mM ethanol solution of cholesterol (Sigma-Aldrich), a 10 mM ethanol solution of 1,2-diol eolu-sn-glycero-3-phosphocholine (DOPC, NOF Co., Ltd.), and a 5 mM COATSOME® SS-EC (NOF Co., Ltd.) were mixed in a molar ratio of 32.5:40:7.5:20. Further, a 2 mM ethanol solution of GM-020 (NOF Co., Ltd.) was added to an amount equivalent to 1.5 mol% of the total amount of these lipids. Finally, ethanol was added to dilute the mixture so that the total concentration of COATSOME® SS-OP, cholesterol, DOPC, and COATSOME® SS-EC was 8 mM. Using the nanoparticle manufacturing devices NanoAssemblr Ignite and Precision NanoSystem, 7 mL of 20 mM malate buffer (pH: 3.0) was mixed at a flow rate of 14 mL / min, and 1 mL of 8 mM lipid solution was mixed at a flow rate of 2 mL / min to obtain 8 mL of nucleic acid / lipid mixture. This mixture was divided into two 4.0 mL tubes, and each was mixed with 10.0 mL of 20 mM 2-morpholinoethanesulfonic acid monohydrate (MES) buffer (pH: 6.0). 14 mL of each nucleic acid / lipid mixture was centrifuged (1000 × g, 25°C) using Amicon Ultra-15 (MWCO 100 kDa) to concentrate to 1.5 mL, and then diluted with 13.5 mL of MES buffer (pH: 6.0). The solutions were again centrifuged (1000 x g, 25°C) and concentrated to 0.25 mL each. The two solutions (0.5 mL) were combined and transferred to a new Amicon Ultra-15 (MWCO 100 kDa) container and diluted with 13.5 mL of MES buffer (pH: 6.0). Then, the solution was centrifuged again (1000 x g, 25°C) to concentrate it to a volume of 0.4 mL or less and collected. MES buffer (pH: 6.0) was then added to make a total volume of 0.8 mL. 0.8 mL of 320 mg / mL sucrose aqueous solution was added to obtain 1.6 mL of mRNA-free-LNP solution. The prepared mRNA-free-LNP solution was stored under an argon atmosphere at 4°C until use.

[0130] [C. 1] Preparation of mRNA-LNPs The mRNA prepared in [A] above was diluted with MES buffer (pH: 6.0) to a concentration of 7.4 μg / mL. 35 μL of the mRNA-free-LNP solution prepared in [B] above was dispensed into 40 separate 5 mL tubes. 115 μL of mRNA solution was added to the mRNA-free-LNP solution while stirring, bringing the total volume to 150 μL. This mixture of mRNA and mRNA-free-LNPs was incubated at 37°C for 20 minutes. 981 μL of 50 mM Tris-HCl buffer (pH 7.4, containing 150 mM NaCl) was added to obtain mRNA-LNPs.

[0131] [C. 2] Concentration of mRNA-LNPs Five vials of mRNA-LNP solution obtained in [C. 1] above were added to each of eight vials of Amicon Ultra-15 (MWCO 100kDa). Each vial was centrifuged (1000×g, 25°C) to concentrate the volume to 1.5 mL or less, and diluted with 13.5 mL of Tris-HCl buffer (pH 7.4, containing 150 mM NaCl). This procedure was repeated once more. After that, each vial was centrifuged (1000×g, 25°C) to concentrate the volume to 0.25 mL or less, and the eight vials were combined into one vial of Amicon Ultra-15 (MWCO 100kDa) and diluted with 13.5 mL of Tris-HCl buffer (pH 7.4, containing 150 mM NaCl). Further centrifugation (1000 x g, 25°C) was performed to concentrate the solution to a volume of 0.7 mL or less, and it was recovered. This solution was then diluted to 1.4 mL with Tris-HCl buffer (pH 7.4, containing 150 mM NaCl). The mRNA content was measured using the Ribogreen® assay, and the mRNA was diluted with Tris-HCl buffer (pH 7.4, containing 150 mM NaCl) to obtain mRNA-LNPs at a concentration of 100 μg / mL. The mRNA-LNPs were stored at 4°C under an argon atmosphere until use. The sequence information of the mRNA encoding SARS-CoV-2 spike protein, excluding the cap and poly(A), is shown in Sequence ID No. 76.

[0132] <Example 7> (1) Overview To investigate the immune response to SARS-CoV-2 spike protein mRNA-LNP administration, fully human antibody-producing mice (TC-mAb mice) were immunized with SARS-CoV-2 spike protein mRNA-LNP as an antigen. In this example, immunization was performed for 30 days (a total of 9 doses), and the antiserum titer, human IgG and human IgM concentrations, human IgG subclass, and antibody titer of anti-RBD antibodies that bind to the receptor binding domain (RBD) of SARS-CoV-2 spike protein were evaluated.

[0133] (2) Materials and Methods SARS-CoV-2 spike protein mRNA (12 μg)-LNP was used as the antigen for the first immunization of one fully human antibody-producing mouse. 20 μl was subcutaneously administered to a total of six lymph node locations, targeting the lymph nodes. A total of nine immunizations were performed by administering immunizations twice a week (Figure 10-1A). Antiserum was also prepared by collecting blood once a week. Lymphocytes were collected from the lymph nodes, spleen, and bone marrow 1 to 3 days after the final immunization. All mice were maintained under SPF conditions and used at 7 to 9 weeks of age. All animal experiments were conducted in accordance with the guidelines after approval by the Tottori University Animal Experiment Committee.

[0134] The immunization method performed in this example was evaluated using ELISA with antiserum. The evaluation items were the titers against RBD-Wuhan strain, spike protein alpha strain (B.1.1.7), beta strain (B1.351), delta strain (B.1.617.2), and omicron strain (B.1.1.529), the concentrations of human IgG and human IgM, and the antibody titers of human IgG subclasses and anti-RBD antibodies. To evaluate the titers, ELISA plates were coated with RBD-Wuhan strain, spike protein alpha strain, beta strain, delta strain, and omicron strain (1 μg / ml). After blocking, serially diluted antiserum was added to the ELISA plate and then incubated with goat anti-human IgG-Fc antibody-HRP (Bethyl Laboratories, Inc.). HRP activity was visualized using 1-Step Ultra TMB-ELISA solution (Thermo Fisher Scientific), and the reaction was stopped by adding 0.18 M sulfuric acid. OD450 was measured using a BioTek Epoch 2 microplate spectrum meter (Agilent Technologies). To measure the concentrations of human IgG and human IgM, ELISA plates were coated with either goat anti-human IgG-Fc coated antibody (Bethyl Laboratories, Inc.) or goat anti-human IgM coated antibody (Bethyl Laboratories, Inc.). After blocking, diluted antiserum and human IgG-UNLB standard (Southern Biotech) or human IgM lambda-UNLB standard (Southern Biotech) were added to an ELISA plate, and then incubated with goat anti-human IgG-Fc antibody-HRP (Bethyl Laboratories, Inc.) or goat anti-human IgM-Fc antibody-HRP (Bethyl Laboratories, Inc.). HRP activity was visualized using 1-Step Ultra TMB-ELISA solution (Thermo Fisher Scientific), and the reaction was stopped by adding 0.18 M sulfuric acid.OD450 was measured using a BioTek Epoch 2 microplate spectrum meter (Agilent Technologies).

[0135] Human IgG subclasses were measured using the human IgG subclass ELISA kit (Invitrogen).

[0136] To measure the antibody titer of anti-RBD antibodies, ELISA plates were coated with RBD-Wuhan strain (2.5 μg / ml). After blocking, diluted antiserum or NT-193 antibody (a neutralizing antibody that binds to RBD of the Wuhan strain) standard was added to the ELISA plate, and then incubated with goat anti-human IgG-Fc antibody-HRP (Bethyl Laboratories, Inc.). HRP activity was visualized using 1-Step Ultra TMB-ELISA solution (Thermo Fisher Scientific), and the reaction was stopped by adding 0.18 M sulfuric acid. OD450 was measured using a BioTek Epoch 2 microplate spectrum meter (Agilent Technologies).

[0137] (3) Results and Discussion The results of the immunoassay evaluation are shown in Figures 10-1 and 10-2. Analysis of the antiserum titer by ELISA revealed an increase in titer against the RBD-Wuhan strain two weeks after the start of immunization, and a reaction was observed even when the antiserum was diluted 100,000 times after the final immunization (Figure 10-1B). For each spike protein mutant strain, namely spike protein alpha strain (B.1.1.7), beta strain (B1.351), delta strain (B.1.617.2), and omicron strain (B.1.1.529), an increase in titer was observed one week after the start of immunization, and a reaction was observed even when the antiserum was diluted 1,000,000 times after the final immunization (Figures 11A-D). While differences in reaction were observed depending on the antigenicity of the antigen protein, this immunoassay demonstrated a sufficient increase in titer against the antigen.

[0138] Serum human IgG concentration was measured and found to have risen to 1.75 mg / ml after final immunization (Figure 10-1C). Human IgM concentration also rose to 0.59 mg / ml after final immunization (Figure 10-1C). Compared to pre-immunization levels, human IgG increased approximately 30 times and human IgM increased approximately 2 times, suggesting the induction of class switching from IgM to IgG.

[0139] Analysis of IgG subclasses revealed that more than half were human IgG1 (Figure 10-2D). ELISA analysis of anti-RBD antibody titers in serum showed an increase to 444 μg / ml after final immunization (Figure 10-2E). Since the human IgG concentration was 1.75 mg / ml, it was confirmed that 1 / 4 of the human IgG was antigen-specific antibody (anti-RBD antibody). Because B cells from human antibody-producing mice have a characteristic of easily differentiating into plasma blasts and plasma cells, it was suggested that a sufficient immune response occurs in the immunization method of the present invention, and the production of antigen-specific antibodies is frequently induced.

[0140] <Example 8> (1) Outline IgG-positive B cells were isolated from lymphocytes recovered from fully human antibody-producing mice immunized with viral antigens, and the gene sequences of human antibody heavy chains and human antibody κ chains were identified using 10x Chromium. Antibodies were produced based on the heavy chain and κ chain gene sequences of the top 24 most frequently occurring chronotypes, and the antigen-binding ability of 24 antigen-specific antibody candidates was analyzed.

[0141] (2) Materials and Methods Lymph node-derived cells from fully human antibody-producing mice immunized with SARS-CoV-2 spike protein mRNA-LNP for 30 days were blocked using mouse seroblock FcR (Bio-Rad Laboratories). IgG-positive, IgM-negative B cells were then isolated using a FACSAria Fusion flow cytometer (BD) with anti-hIgG antibody-PE / Cyanine7 (Biolegend) and anti-hIgM antibody-PE-CF594 (Biolegend). NGS analysis was performed on single IgG-positive B cells using 10x Chromium (10x Genomics) to obtain the sequences of human antibody heavy chain and human antibody light chain genes (κ genes), and their frequencies were analyzed. Antibodies were produced based on the heavy chain and κ chain gene sequences of the chronotypes included in the top 24 most frequently occurring sequences (Biointron).

[0142] The binding ability of the 24 antigen-specific antibody candidate clones prepared in this manner to the antigens was analyzed by ELISA. ELISA plates were coated with spike protein alpha, RBD-delta, and Omicron strains (0.1 μg / ml). After blocking, diluted purified antibodies and sotrovimab (a broad-spectrum neutralizing antibody that neutralizes SARS-CoV-2 Wuhan strain and Omicron strain) were added to the ELISA plates, and then incubated with goat anti-human IgG-Fc antibody-HRP (Bethyl Laboratories, Inc.). HRP activity was visualized using 1-Step Ultra TMB-ELISA solution (Thermo Fisher Scientific), and the reaction was stopped by adding 1 M sulfuric acid. OD450 was measured using a BioTek Epoch 2 microplate spectrum meter (Agilent Technologies).

[0143] (3) Results and Discussion, etc. IgG-positive B cells were isolated from lymph node-derived cells of fully human antibody-producing mice immunized with viral antigens. Lymphocytes were gated from the recovered cells, doublets were removed, and then the cells were separated using PerCP-Cy5.5 (CD19) and PE / Cy7 (human IgG).

[0144] NGS analysis was performed on a single IgG-positive B cell using 10x Chromium to obtain the sequences of the human antibody heavy chain and the human antibody κ gene (Figure 12A). Considering the continuous immunization schedule and the high frequency of antigen-specific antibody production, the induction of clonal proliferation (proliferation of antigen-specific B cells) was suggested. Therefore, candidate antigen-specific antibodies were generated from the chronotypes included in the top 24 most frequently occurring chronotypes.

[0145] Analysis of the antigen-binding ability of antibodies produced from 24 chronotypes using the ELISA method revealed that 15 antibodies (63%) bound to the alpha strain's spike protein, the delta strain's RBD, and the omicron strain's spike protein, which were not immunized as antigens (Figure 12B). These results demonstrate the success of this immunoassay method in producing antigen-specific antibodies.

[0146] <Example 9> (1) Outline In the above example, we succeeded in obtaining antigen-specific antibodies, so we kept the immunization period of 30 days the same, but increased the number of administrations from 9 to 13 to investigate the immunization method. In this example, we performed immunization for 30 days (13 administrations in total) and evaluated the antiserum titer, the concentrations of human IgG and human IgM, the human IgG subclass, and the antibody titer of the anti-RBD antibody.

[0147] (2) Materials and Methods SARS-CoV-2 spike protein mRNA (12 μg)-LNP was used as the antigen for the first immunization of one fully human antibody-producing mouse. 20 μl was subcutaneously administered to a total of six lymph nodes, targeting them. A total of 13 immunizations were performed, three times per week (Figure 13-1A). Antiserum was also prepared by collecting blood once a week. Lymphocytes were collected from the lymph nodes, spleen, and bone marrow 1 to 3 days after the final immunization. All mice were maintained under SPF conditions and used at 7 to 9 weeks of age. All animal experiments were conducted in accordance with the guidelines after approval by the Tottori University Animal Experiment Committee.

[0148] The immunization method performed in this example was evaluated using ELISA with antiserum. The evaluation items were the titers against RBD-Wuhan strain, spike protein alpha strain (B.1.1.7), beta strain (B1.351), delta strain (B.1.617.2), and omicron strain (B.1.1.529), the concentrations of human IgG and human IgM, and the antibody titers of human IgG subclasses and anti-RBD antibodies. To evaluate the titers, ELISA plates were coated with RBD-Wuhan strain, spike protein alpha strain, beta strain, delta strain, and omicron strain (1 μg / ml). After blocking, serially diluted antiserum was added to the ELISA plate and then incubated with goat anti-human IgG-Fc antibody-HRP (Bethyl Laboratories, Inc.). HRP activity was visualized using 1-Step Ultra TMB-ELISA solution (Thermo Fisher Scientific), and the reaction was stopped by adding 0.18 M sulfuric acid. OD450 was measured using a BioTek Epoch 2 microplate spectrum meter (Agilent Technologies).

[0149] To measure the concentrations of human IgG and human IgM, ELISA plates were coated with goat anti-human IgG-Fc coated antibody (Bethyl Laboratories, Inc.) or goat anti-human IgM coated antibody (Bethyl Laboratories, Inc.). After blocking, diluted antiserum and human IgG-UNLB standard (Southern Biotech) or human IgM Lambda-UNLB standard (Southern Biotech) were added to the ELISA plates, and then incubated with goat anti-human IgG-Fc antibody-HRP (Bethyl Laboratories, Inc.) or goat anti-human IgM-Fc antibody-HRP (Bethyl Laboratories, Inc.). HRP activity was visualized using 1-Step Ultra TMB-ELISA solution (Thermo Fisher Scientific), and the reaction was stopped by adding 0.18 M sulfuric acid. OD450 was measured using a BioTek Epoch 2 microplate spectrum meter (Agilent Technologies).

[0150] Human IgG subclasses were measured using the human IgG subclass ELISA kit (Invitrogen). To measure the antibody titer of anti-RBD antibodies, ELISA plates were coated with RBD-Wuhan strain (2.5 μg / ml). After blocking, diluted antiserum or NT-193 antibody standard was added to the ELISA plate, and then incubated with goat anti-human IgG-Fc antibody-HRP (Bethyl Laboratories, Inc.). HRP activity was visualized using 1-Step Ultra TMB-ELISA solution (Thermo Fisher Scientific), and the reaction was stopped by adding 0.18 M sulfuric acid. OD450 was measured using a BioTek Epoch 2 microplate spectrum meter (Agilent Technologies).

[0151] (3) Results and Discussion The results of the immunoassay evaluation are shown in Figure 13. Analysis of the antiserum titer by ELISA revealed an increase in titer against the RBD-Wuhan strain two weeks after the start of immunization, and a reaction was confirmed even when the antiserum was diluted 100,000 times after the final immunization (Figure 13-1B). For each spike protein mutant strain, namely spike protein alpha strain (B.1.1.7), beta strain (B1.351), delta strain (B.1.617.2), and omicron strain (B.1.1.529), an increase in titer was confirmed one week after the start of immunization, and a reaction was confirmed even when the antiserum was diluted 1,000,000 times after the final immunization (Figures 14A-D). While differences in reaction were observed depending on the antigenicity of the antigen protein, this immunoassay demonstrated a sufficient increase in titer against the antigen.

[0152] Serum human IgG concentrations were measured and found to have risen to 2.84 mg / ml after final immunization (Figure 13-1C). Human IgM concentrations also rose to 2.90 mg / ml after final immunization (Figure 13-1C). Compared to pre-immunization levels, human IgG increased approximately 70 times and human IgM increased approximately 4 times, suggesting the induction of class switching from IgM to IgG.

[0153] Analysis of IgG subclasses revealed that more than half were human IgG1 (Figure 13-2D).

[0154] Analysis of anti-RBD antibody titers in serum using ELISA revealed that the titer increased to 726 μg / ml after final immunization (Figure 13-2E). Since the human IgG concentration was 2.84 mg / ml, it was confirmed that 1 / 4 of the human IgG was antigen-specific antibody (anti-RBD antibody). Because B cells from human antibody-producing mice have a characteristic of easily differentiating into plasma blasts and plasma cells, it was suggested that a sufficient immune response occurs in the immunization method of the present invention, and the production of antigen-specific antibodies is frequently induced.

[0155] <Example 10> (1) Outline IgG-positive B cells were isolated from lymphocytes recovered from fully human antibody-producing mice immunized with viral antigens, and the gene sequences of human antibody heavy chains and human antibody κ chains were identified using 10x Chromium. Antibodies were produced based on the heavy chain and κ chain gene sequences of the top 25 most frequently occurring chronotypes, and the antigen-binding ability of 25 antigen-specific antibody candidates was analyzed.

[0156] (2) Materials and Methods Lymph node-derived cells from fully human antibody-producing mice immunized with SARS-CoV-2 spike protein mRNA-LNP for 30 days were blocked using mouse seroblock FcR (Bio-Rad Laboratories), and then IgG-positive IgM-negative B cells were isolated using a FACSAria Fusion flow cytometer (BD) with anti-hIgG antibody-PE / Cyanine7 (Biolegend) and anti-hIgM antibody-PE-CF594 (Biolegend).

[0157] NGS analysis was performed on single IgG-positive B cells using 10x Chromium (10x Genomics) to obtain the sequences of human antibody heavy chain and human antibody light chain genes (κ genes), and their frequencies were analyzed. Antibodies were produced based on the heavy chain and κ chain gene sequences of the top 25 most frequently occurring chronotypes (Biointron).

[0158] The binding ability of the 25 antigen-specific antibody candidate clones prepared in this manner to the antigen was analyzed by ELISA. ELISA plates were coated with spike protein alpha, RBD-delta, and omicron strains (0.1 μg / ml). After blocking, diluted purified antibodies and sotrovimab were added to the ELISA plates, and then incubated with goat anti-human IgG-Fc antibody-HRP (Bethyl Laboratories, Inc.). HRP activity was visualized using 1-Step Ultra TMB-ELISA solution (Thermo Fisher Scientific), and the reaction was stopped by adding 1 M sulfuric acid. OD450 was measured using a BioTek Epoch 2 microplate spectrum meter (Agilent Technologies).

[0159] (3) Results and Discussion, etc. IgG-positive B cells were isolated from lymph node-derived cells of fully human antibody-producing mice immunized with viral antigens. Lymphocytes were gated from the recovered cells, doublets were removed, and then the cells were separated using PerCP-Cy5.5 (CD19) and PE / Cy7 (human IgG).

[0160] NGS analysis was performed on a single IgG-positive B cell using 10x Chromium to obtain the sequences of the human antibody heavy chain and the human antibody κ gene (Figure 15A). Considering the continuous immunization schedule and the high frequency of antigen-specific antibody production, the induction of clonal proliferation (proliferation of antigen-specific B cells) was suggested. Therefore, candidate antigen-specific antibodies were generated from the 25 most frequently occurring chronotypes.

[0161] Analysis of the antigen-binding ability of antibodies produced from 25 chronotypes using the ELISA method revealed that 16 antibodies (64%) bound to the spike protein of the Alpha strain, RBD of the Delta strain, and the spike protein of the Omicron strain, which were not immunized as antigens (Figure 15B). These results demonstrate that this immunoassay method successfully produced antigen-specific antibodies.

[0162] <Example 11> (1) Outline To improve the efficiency of antibody production, IgG-positive B cells or IgG-positive antigen probe-positive B cells were isolated from lymphocytes recovered from fully human antibody-producing mice immunized with viral antigens, and human antibody heavy chain and human antibody κ chain cDNA synthesis and amplification were performed. The promoter and poly(A) signal were linked to the antibody gene cDNA by Overlap extension polymerase chain reaction (OE-PCR), and antibodies were expressed using the synthesized DNA fragments. The antibody expression level was examined by quantifying human IgG. The binding ability of the antibody to the SARS-CoV-2 spike protein was analyzed.

[0163] (2) Materials and Methods Lymph node-derived cells from fully human antibody-producing mice were blocked with mouse seroblock FcR (Bio-Rad Laboratories), and then IgG-positive IgM-negative B cells were isolated using a FACSAria Fusion flow cytometer (BD) with anti-hIgG antibody-BV421 (Biolegend) and anti-hIgM antibody-BV650 (Biolegend). As antigen probes, spike protein alpha strain crosslinked with DyLight 594 NHS Ester (Thermo Fisher Scientific) and spike protein omicron strain crosslinked with DyLight 650 NHS Ester (Thermo Fisher Scientific) were used.

[0164] Using the QuantAccuracy RT-RamDA cDNA Synthesis Kit (Toyobo Co., Ltd.), single B cells were lysed, antibody gene cDNA was synthesized, and cDNA amplification was performed. For OE-PCR, KOD-Plus-Neo (Toyobo Co., Ltd.) was used to ligate the promoter and poly(A) signal. Antibodies were expressed by introducing DNA fragments into Expi293F cells (Thermo Fisher Scientific).

[0165] To measure the concentration of human IgG, ELISA plates were coated with goat anti-human IgG-Fc coated antibody (Bethyl Laboratories, Inc.). After blocking, cell supernatant and human IgG-UNLB standard (Southern Biotech) were added to the ELISA plates, and then incubated with goat anti-human IgG-Fc antibody-HRP (Bethyl Laboratories, Inc.). HRP activity was visualized using 1-Step Ultra TMB-ELISA solution (Thermo Fisher Scientific), and the reaction was stopped by adding 0.18 M sulfuric acid. OD450 was measured using a BioTek Epoch 2 microplate spectrum meter (Agilent Technologies).

[0166] To examine the antibody binding ability, ELISA plates were coated with spike protein (1 μg / ml). After blocking, cell supernatant and sotrovimab were added to the ELISA plates, and then incubated with goat anti-human IgG-Fc antibody-HRP (Bethyl Laboratories, Inc.). HRP activity was visualized using 1-Step Ultra TMB-ELISA solution (Thermo Fisher Scientific), and the reaction was stopped by adding 1 M sulfuric acid. OD450 was measured using a BioTek Epoch 2 microplate spectrum meter (Agilent Technologies).

[0167] (3) Results and Discussion Of the 192 IgG-positive B cells isolated as single cells, human antibody heavy chain and human antibody κ chain cDNA were amplified in 43 cells (22%). The average human IgG concentration in the cell supernatant was approximately 300 ng / ml. Next, the antigen-binding ability was analyzed, and it was found that 20 antibodies (47%) bound to spike proteins, etc.

[0168] Of the 96 IgG-positive antigen probe-positive B cells isolated as single cells, human antibody heavy chain and human antibody κ chain cDNA were amplified in 48 cells (50%). The average human IgG concentration in the cell supernatant was approximately 400 ng / ml. Further analysis of antigen-binding ability revealed that 17 antibodies (35%) bound to spike proteins, etc. Based on these results, we have successfully produced antigen-specific antibodies with high efficiency from IgG-positive B cells and IgG-positive antigen probe-positive B cells.

[0169] This invention provides a platform technology for the rapid production of human antibodies and human antisera using fully human antibody-producing mice. The method for producing human antibodies according to this invention requires shorter immunization and antibody production periods compared to conventional technologies utilizing hybridomas, thus contributing to the production of human antibodies against viruses that frequently mutate. Furthermore, the method of this invention makes it possible to obtain broad-spectrum neutralizing human antibodies and broad-spectrum neutralizing antisera capable of binding even to antigens that were not immunized, which has significant clinical implications. Moreover, the method of this invention can be used to produce human antibodies and antisera not only against viral antigens but also against cancer antigens and autoimmune diseases.

[0170] All publications, patents, and patent applications cited herein shall be incorporated herein by direct reference.

Claims

1. An immunization method for rapidly inducing a human antibody having high binding ability to a desired antigen or a human antiserum having a high antibody titer, wherein the method comprises the step of immunizing a non-human animal multiple times with the desired antigen or a nucleic acid encoding the antigen within 30 days from the first immunization, wherein the non-human animal contains a human antibody gene or gene locus, and the non-human animal has an endogenous gene or gene locus of the non-human animal that corresponds to the human antibody gene or gene locus disrupted or deleted, or has a mutation that results in loss of expression or low expression.

2. The method according to claim 1, wherein the human antibody gene or locus is a human immunoglobulin heavy chain gene or locus, and a human immunoglobulin κ light chain gene or locus, or a human immunoglobulin λ light chain gene or locus.

3. The non-human animals are the following (1) to (3): (1) a rodent artificial chromosome vector containing a telomere, a human antibody heavy chain gene or locus, a first DNA sequence insertion site, a human antibody light chain κ gene or locus, a second DNA sequence insertion site, and a centromere in this order; (2) a rodent artificial chromosome vector containing a telomere, a human antibody heavy chain gene or locus, a first DNA sequence insertion site, a human antibody light chain λ gene or locus, a second DNA sequence insertion site, and a centromere in this order; and (3) The method according to claim 1 or claim 2, comprising a rodent artificial chromosome vector selected from the group consisting of: a first rodent artificial chromosome vector comprising a telomere, a human antibody heavy chain gene or locus, a first DNA sequence insertion site, a human antibody light chain κ gene or locus, a second DNA sequence insertion site, and a centromere in that order; and a second rodent artificial chromosome vector comprising a telomere, a human antibody heavy chain gene or locus, a first DNA sequence insertion site, a human antibody light chain λ gene or locus, a second DNA sequence insertion site, and a centromere in that order.

4. The method according to any one of claims 1 to 3, wherein the antigen or the nucleic acid encoding the antigen is of multiple types.

5. The method according to any one of claims 1 to 4, wherein the multiple immunizations are 2 to 15 immunizations.

6. The method according to any one of claims 1 to 5, wherein the non-human animal is a mouse or a rat.

7. The method according to any one of claims 1 to 6, wherein the antigen or the nucleic acid encoding the antigen is derived from a virus.

8. The method according to claim 7, wherein the virus is severe acute respiratory syndrome coronavirus.

9. The method according to any one of claims 1 to 8, which achieves an antibody titer of 1 mg / ml or more in the blood human IgG concentration and 100 μg / ml or more in the antigen-specific human IgG concentration.

10. An immunization method for rapidly inducing a human antibody having high binding ability to a desired antigen or a human antiserum having a high antibody titer, the method comprising the step of immunizing a non-human animal multiple times with the desired antigen or a nucleic acid encoding the antigen within 30 days from the first immunization, the non-human animal comprising a mammalian artificial chromosome vector containing human immunoglobulin heavy chain and light chain gene loci, the mammalian artificial chromosome vector characterized in that the human-derived genome sequences from D1-1 to D1-26 of the D region of the human immunoglobulin heavy chain gene locus are replaced with modified sequences of the D region consisting of the following combinations of (1) and (2), or (1) and (3), the modified sequences of the D region are (1) The human genome sequence between the open reading frames (ORFs) D1-1 to D1-26 of the human immunoglobulin heavy chain locus D region, or the human genome sequence between the ORFs excluding D3-9 and D3-10, includes a sequence in which the VDJ recombinant sequence is shortened to a length of 49 bp or more from the end of each VDJ recombinant sequence in the adjacent ORF region, and (2) The ORF sequences D1-1 to D1-26 of the human immunoglobulin heavy chain locus D region include the ORF sequences B1-1 to B9-4 of the bovine immunoglobulin heavy chain locus D region, or the ORF sequences 1S5 to 1S35 of the monkey immunoglobulin heavy chain locus D region, or the ORF sequences of the immunoglobulin heavy chain locus D region from sheep, horses, rabbits, birds or sharks, or (3) The method comprising 26 modified ORF sequences from D1-1 to D1-26 of the human immunoglobulin heavy chain locus D region, which are prepared based on human antibody heavy chain CDR3 sequences of 18 amino acids or more, instead of the ORF sequences from D1-1 to D1-26 of the human immunoglobulin heavy chain locus D region.

11. A method for producing a human antibody against a desired antigen using a non-human animal, comprising: an immunization step of immunizing the non-human animal with the antigen or a nucleic acid encoding the antigen; a human immunoglobulin-positive B cell isolation step of isolating human immunoglobulin-positive B cells from the tissue of the immunized non-human animal; an antibody base sequence acquisition step of obtaining the base sequences of antibody heavy chain mRNA-derived cDNA and antibody light chain mRNA-derived cDNA prepared from the isolated B cells; and an antibody production step of producing an antibody based on the base sequence of the acquired antibody, wherein the non-human animal contains a human antibody gene or gene locus, and the non-human animal has an endogenous gene or gene locus of the non-human animal that corresponds to the human antibody gene or gene locus, which is disrupted or deleted, or has a mutation that results in loss of expression or low expression.

12. The method according to claim 11, wherein the human antibody gene or locus is a human immunoglobulin heavy chain gene or locus and a human immunoglobulin κ light chain gene or locus, or a human immunoglobulin λ light chain gene or locus.

13. The non-human animals are the following (1) to (3): (1) a rodent artificial chromosome vector containing a telomere, a human antibody heavy chain gene or locus, a first DNA sequence insertion site, a human antibody light chain κ gene or locus, a second DNA sequence insertion site, and a centromere in this order; (2) a rodent artificial chromosome vector containing a telomere, a human antibody heavy chain gene or locus, a first DNA sequence insertion site, a human antibody light chain λ gene or locus, a second DNA sequence insertion site, and a centromere in this order; and (3) The method according to claim 11 or claim 12, comprising a rodent artificial chromosome vector selected from the group consisting of: a first rodent artificial chromosome vector comprising a telomere, a human antibody heavy chain gene or locus, a first DNA sequence insertion site, a human antibody light chain κ gene or locus, a second DNA sequence insertion site, and a centromere in that order; and a second rodent artificial chromosome vector comprising a telomere, a human antibody heavy chain gene or locus, a first DNA sequence insertion site, a human antibody light chain λ gene or locus, a second DNA sequence insertion site, and a centromere in that order.

14. The method according to any one of claims 11 to 13, wherein the immunization step is carried out by the immunization method described in claim 1.

15. The method according to any one of claims 11 to 14, wherein the non-human animal is a mouse or a rat.

16. The method according to any one of claims 11 to 15, wherein the antigen or the nucleic acid encoding the antigen is derived from a virus.

17. The method according to claim 16, wherein the virus is severe acute respiratory syndrome coronavirus.

18. The method according to any one of claims 11 to 17, wherein in the isolation step, IgG-positive B cells are isolated using an anti-CD19 antibody and an anti-IgG antibody.

19. The method according to any one of claims 11 to 18, wherein antibodies are produced for chronotypes that are among the top 50 most frequently occurring nucleotide sequences obtained in the antibody nucleotide sequence acquisition step.

20. The method according to any one of claims 11 to 19, wherein antibodies are produced against antigens other than the antigen administered in the immunization step.

21. A method for producing a human antibody against a desired antigen using a non-human animal, comprising: an immunization step of immunizing the non-human animal with the antigen or a nucleic acid encoding the antigen; an isolation step of human immunoglobulin-positive B cells (1) The human genome sequence between the open reading frames (ORFs) D1-1 to D1-26 of the human immunoglobulin heavy chain locus D region, or the human genome sequence between the ORFs excluding D3-9 and D3-10, includes a sequence in which the VDJ recombinant sequence is shortened to a length of 49 bp or more from the end of each VDJ recombinant sequence in the adjacent ORF region, and (2) The ORF sequences D1-1 to D1-26 of the human immunoglobulin heavy chain locus D region include the ORF sequences B1-1 to B9-4 of the bovine immunoglobulin heavy chain locus D region, or the ORF sequences 1S5 to 1S35 of the monkey immunoglobulin heavy chain locus D region, or the ORF sequences of the immunoglobulin heavy chain locus D region from sheep, horses, rabbits, birds or sharks, or (3) The method comprising 26 modified ORF sequences from D1-1 to D1-26 of the human immunoglobulin heavy chain locus D region, which are prepared based on human antibody heavy chain CDR3 sequences of 18 amino acids or more, instead of the ORF sequences from D1-1 to D1-26 of the human immunoglobulin heavy chain locus D region.