Extract derived from hyssopus officinalis cell cultures, and method for the preparation thereof, cosmetic compositions containing said extract, and use of said extract and of said compositions for skin care
A hydroalcoholic extract from Hyssopus officinalis cell cultures, enriched with ceramide precursors, addresses the variability and contamination issues of plant extracts, effectively strengthening the skin barrier and treating aging and environmental stress-related skin imperfections.
Patent Information
- Application Number
- PCT/EP2025/086691
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-12-23
- Filing Date
- 2025-12-11
- Publication Date
- 2026-07-02
AI Technical Summary
Existing plant-derived Hyssopus officinalis extracts for skincare are contaminated with toxic substances and vary in quality due to environmental factors, compromising their effectiveness in strengthening the skin barrier and addressing skin imperfections.
A hydroalcoholic extract derived from Hyssopus officinalis cell cultures, which stimulates ceramide synthesis and includes ceramide precursors, is used in cosmetic compositions to enhance skin barrier function and treat aging and environmental stress-related imperfections.
The extract promotes ceramide production, enhances skin barrier integrity, reduces oxidative stress, and minimizes skin imperfections by stabilizing the skin barrier, offering consistent quality and safety without allergenic contaminants.
Smart Images

Figure EP2025086691_02072026_PF_FP_ABST
Abstract
Description
[0001] Title: Extract derived from Hyssopus officinalis cell cultures, and method for the preparation thereof, cosmetic compositions containing said extract, and use of said extract and of said compositions for skin care DESCRIPTION
[0002] Technical Field
[0003] In its most general aspect, the present invention relates to the cosmetic industry.
[0004] More particularly, the invention concerns a plant-derived extract and cosmetic compositions comprising said extract for use in the cosmetic field, in particular for skin care (dermocosmetics).
[0005] Specifically, the invention relates to a hydroalcoholic extract obtained from cell cultures belonging to the species Hyssopus officinalis, to compositions comprising said extract and to the cosmetic uses thereof for skin care, particularly for the treatment and strengthening of the skin barrier.
[0006] The invention further relates to methods for the preparation of said extract and of cosmetic compositions containing said extract.
[0007] Background Art
[0008] The skin barrier represents the body’s first line of defense against the external environment. Its primary function is to protect the body from pathogens, irritating chemicals, allergens, excessive water loss and UV-induced damage, thereby maintaining the integrity and hydration of the skin.
[0009] The skin barrier consists of the stratum corneum, the outermost layer of the epidermis, composed of corneocytes (dead keratin-rich cells) embedded in a lipid matrix. This matrix, primarily composed of ceramides, cholesterol and fatty acids, is organized into a lamellarstructure in which the corneocytes act as the main structural elements, while the intercellular lipids form the cohesive component that ensures the integrity of the barrier (Bouwstra, 2023).
[0010] With aging, the skin’s ability to maintain its protective function gradually declines. This process is characterized by a decrease in the synthesis of key lipids, particularly ceramides, which represent approximately 50% of the total lipids in the stratum corneum. As the years go by, the reduction in both the amount and quality of ceramides, which are fundamental for maintaining cell cohesion and preventing trans-epidermal water loss (TEWL), leads to a weakened skin barrier, thereby making the skin drier, more fragile and prone to inflammation, irritation, and infection (Choi, 2019).
[0011] Exposure to UV radiation and other environmental stressors, such as pollution and harsh chemicals, further accelerates barrier damage. UV radiation, in particular, promotes the formation of free radicals that harm cellular components and structural lipids such as ceramides. This results in chronic inflammation (“inflammaging”) and degradation of the extracellular matrix, leading to loss of elasticity, wrinkle formation, and structural alteration of the skin (Pilkington, 2021).
[0012] Ceramides are a family of complex lipids composed of sphingosine and fatty acids synthesized within epidermal cells (keratinocytes) and accumulated in lamellar bodies, specialized secretory organelles located in the granular layer of the epidermis. As keratinocytes mature and migrate toward the stratum corneum, lamellar bodies release their lipid contents into the extracellular space, contributing to the formation of the lipid matrix (Cha, 2016).
[0013] Ceramide synthesis is regulated by key enzymes, including sphingomyelinase (ASM), which catalyzes the conversion of lipid precursors such as sphingomyelin into mature ceramides, and [3-glucocerebrosidase (GBA), which is required for the extracellular conversion of glucosylceramides into ceramides (Rabionet, 2017). Areduction in the activity of the enzymes involved in ceramide synthesis or a decrease in the number of lamellar bodies, compromises ceramide production, thereby weakening the skin barrier function. This may lead to pathological skin conditions, such as atopic dermatitis, psoriasis, and eczema, as well as to an increased sensitivity and reactivity of the skin to external stressors.
[0014] Maintaining adequate barrier functionality is therefore crucial for preventing premature aging and dermatological disorders.
[0015] Hyssopus officinalis (commonly known as hyssop) is an aromatic plant belonging to the Lamiaceae family.
[0016] Hyssop, in the form of extracts obtained from the plant, offers a wide range of uses due to its multiple properties, both in the medical and cosmetic fields. In the medical field, it is used for its anti-inflammatory, antiseptic, and antiviral properties, whereas in the cosmetic field it is used as an antioxidant and anti-aging agent.
[0017] However, the production of such plant extracts has several drawbacks. Indeed, since such extracts are obtained from cultivated plants, they may be contaminated with toxic substances, such as, for example, pesticides and / or fertilizers to which the plants are exposed during their growth. Furthermore, the extracts may contain pathogens that reside within the plant, which can reduce the quality of the final extract, making additional purification steps necessary in order to obtain a final product suitable for application to the skin.
[0018] Another drawback lies in that the plants are subjected to variable environmental and seasonal conditions which can compromise plant growth and secondary metabolites production, thereby reducing both the yield and the quality of the resulting extract. Such environmental variations may also alter the production yield of secondary metabolites over time; in this way, there is a risk of obtaining plant extracts with a variable content of secondary metabolites.The publication, Babich et al. titled “Evaluations of the conditions for the cultivation of callus cultures of Hyssopus officinalis regarding the yield of polyphenolic compounds”, Plants, 2021, vol. 10, no. 5, p. 915 describes conditions for cultivating callus cell cultures of Hyssopus officinalis. Callus cultures are obtained from young tissues of Hyssopus officinalis plants and cultivated in MS (Murashige and Skoog) culture medium. The biomass of the callus cell culture is dried by lyophilization, and an extract is obtained by homogenizing the lyophilized biomass in a 60% methanol in-water solution under stirring on a thermo-shaker at 20 °C, three times for 40 minutes each. At each interval, the extract is centrifuged and the supernatant is subjected to qualitative phytochemical analysis by HPLC. FR 2751878 describes an extract from cell cultures of at least one plant of the Lamiaceae family, cultivated in vitro, and the use of such an extract in a cosmetic composition or for the preparation of a pharmaceutical composition for combating disorders involving an inflammatory process or an allergic process.
[0019] JP2004262862 describes a hydroethanolic extract of the Hyssopus officinalis plant and the use of such an extract as a topical preparation for the skin, exhibiting anti-aging activity, moisture-retention activity, anti-inflammatory activity, whitening activity, anti-acne activity, activity for improving dark circles, and activity for improving dull skin.
[0020] FR 3144163 describes a method for obtaining a plant-derived extract by in vitro culture from a line of undifferentiated or de-differentiated plant cells, comprising the addition of at least one flavonoid aglycone to the culture medium. The extract obtained may be used for the non-therapeutic cosmetic treatment of the skin.
[0021] The technical problem underlying the present invention is therefore that of providing an extract derived from plant cell cultures, rich in secondary metabolites, capable of strengthening the skin barrier and being substantially free from the disadvantages of the plant-derived extracts of the prior art described above.SUMMARY OF THE INVENTION
[0022] The inventors of the present invention have now identified a hydroalcoholic extract derived from plant cell cultures of Hyssopus officinalis capable of stimulating the synthesis of ceramides, which are essential components for the formation and maintenance of an intact and functional skin barrier. The extract therefore prevents and slows down skin aging by promoting the synthesis of key barrier constituents, resulting in skin that is less fragile and less susceptible to inflammation, irritation, and infection.
[0023] The inventors of the present invention have also identified a cosmetic formulation or composition for skin care or functional make-up comprising the above extract and at least one ceramide precursor, which is capable of enhancing the effect of the extract by inducing a ceramide production that is higher than that observed in compositions or formulations containing said extract but lacking the ceramide precursor(s).
[0024] In one aspect, the present invention therefore relates to a hydroalcoholic extract derived from plant cell cultures of Hyssopus officinalis as defined in Claim 1.
[0025] The extract from said plant cell cultures of Hyssopus officinalis is a hydroalcoholic extract, that is, an extract obtained using a hydroalcoholic solution as the extraction solvent, preferably a hydroethanolic extract (water + ethanol).
[0026] In another aspect, the invention relates to the cosmetic use of a hydroalcoholic extract derived from plant cell cultures of Hyssopus officinalis for skin care, in particular for strengthening the skin barrier and / or for preventing and / or treating skin imperfections caused by aging and / or environmental stress.
[0027] As used herein, the expression “skin imperfections caused by skin aging” refers to the common alterations of the various skin layers that typicallyarise during the aging process. Non-limiting examples of such imperfections include fine lines and wrinkles, rough or thickened stratum corneum, age spots, decreased hyaluronic acid, elastin, and collagen levels due to oxidative stress induced by free radicals, loss of skin tone, excessive sebum secretion, and wrinkles caused by prolonged exposure to sunlight.
[0028] The hydroalcoholic extract from Hyssopus officinalis cell cultures according to the present invention can be obtained by a process comprising the following steps:
[0029] a) homogenizing plant cell cultures of Hyssopus officinalis in a hydroalcoholic extraction solvent to obtain a homogenate; b) separating the solid portion of said homogenate from the liquid portion; c) drying the liquid portion to obtain the extract,
[0030] wherein said Hyssopus officinalis cell cultures are obtained by collecting plant tissue from Hyssopus officinalis plants, inducing callus formation from said tissue on a solid substrate, harvesting said calluses, and establishing liquid cultures therefrom.
[0031] Preferably, in the homogenization step (a), the hydroalcoholic solvent is an ethanol-water solution with an ethanol concentration ranging from 10% to 99% (v / v), more preferably about 90%.
[0032] The ratio between the volume of the extraction hydroalcoholic solvent and the weight of Hyssopus officinalis cell culture is preferably between 6: 1 and 2:1, and most advantageously about 4:1.
[0033] Preferably, the step b) for separating the solid portion of said homogenate from the liquid portion is carried out by centrifugation, sedimentation, or filtration.
[0034] In a preferred embodiment, the liquid phase obtained in step (c) is dried by evaporation or lyophilization.In another preferred embodiment, in said step c) the liquid phase is concentrated and the resulting concentrated extract is supplemented with water or a saline solution, preferably a phosphate-buffered saline (PBS) solution, and then dried, preferably by lyophilization.
[0035] In a further aspect, the present invention relates to the cosmetic use as defined above of an extract derived from plant cell cultures of Hyssopus officinalis, preferably a hydroalcoholic extract, wherein said extract is an extract obtained by the preparation process described above.
[0036] In another aspect, the invention relates to a cosmetic composition or formulation for skin treatment comprising a hydroalcoholic extract derived from Hyssopus officinalis cell cultures obtainable by the above process and, optionally, at least one cosmetically acceptable vehicle and / or excipient.
[0037] The vehicles and / or excipients may generally comprise one or more solvents (water, hydrophilic and / or organic solvents), diluents, buffers (such as, for example, neutral buffered saline, phosphate-buffered saline (PBS) or Tris-HCl, acetate or phosphate buffers), solubilizing agents (such as, for example, Tween® 80, polysorbate 80), colloids, dispersion media, fillers (for example diamido phosphate, tapioca starch and mixtures thereof), chelating agents (such as, for example, EDTA or glutathione), amino acids (such as, for example, glycine), proteins, lubricants, humectants, emulsifiers, perfumes, antioxidants (such as, for example, ascorbic acid, sodium metabisulfite), absorption-delaying agents, adjuvants, bulking agents (such as, for example, lactose, mannitol), moisturizers, exfoliants, humectants, emollients (for example vegetable oils, in particular caprylic / capric triglyceride, squalane, squalene, ethyl olivate, triheptanoin, jojoba seed oil, safflower seed oil, sesame oil, coconut oil, olive oil, almond oil, macadamia nut oil, cottonseed oil or peanut oil, silicone oils such as dimethylpolysiloxane and cyclomethicone, fatty acids and fatty alcohol ethers and combinations thereof), colorants (or pigments), preservatives, rheology modifiers (for example xanthan gum, stearic acid, cellulose ethers, acrylic polymersand carbomer) and / or surfactants and the like.
[0038] The composition or formulation according to the invention may further comprise one or more pH regulators to maintain a pH substantially neutral or slightly acidic, for example between 4.0 and 7.0, preferably between 5.0 and 6.0, so as to be compatible with the skin’s natural acidic environment. The pH-regulating agents may be selected from organic acids such as formic acid, lactic acid, acetic acid, butyric acid, valeric acid, caproic acid, enanthic acid, or caprylic acid; buffers such as a citric acid / citrate buffer and bases such as sodium hydroxide.
[0039] Preferably, the composition comprises at least one hydrophilic solvent selected from water, aqueous saline solutions, hydrophilic organic solvents, more preferably oils, alcohols, glycerol, organic acids, amides, amines, aldehydes, and ketones.
[0040] The cosmetic composition or formulation according to the invention can be formulated in any suitable form for topical application, including creams, gels, lotions, ointments, emulsions for use in lipsticks, foundations, and other make-up products, or in anhydrous forms.
[0041] In one embodiment, the cosmetic composition or formulation according to the invention may be in the form of an aqueous preparation, particularly an aqueous dispersion, such as a toner or gel, or in the form of an emulsion, for example a cream. The emulsion may be of the oil-in-water or water-in-oil type. In such a case, the oily phase of the emulsion may contain one or more oils and / or waxes selected from those commonly used in cosmetics, such as almond oil, sunflower oil, isononyl isononanoate, caprylic / capric triglyceride, beeswax, carnauba wax, squalane, squalene, ethyl olivate, triheptanoin, jojoba seed oil, safflower seed oil, and the like.
[0042] In another embodiment, the cosmetic formulation or composition according to the invention may be a liquid preparation of low, medium, or high viscosity, such as a lotion or ointment.The cosmetic composition or formulation according to the invention may also include substances that are insoluble in the dispersion medium, through the use of suitable suspending or dispersing agents, or liquid substances immiscible with the vehicle, typically dispersed using appropriate emulsifying or stabilizing agents.
[0043] In a preferred embodiment, the cosmetic composition or formulation according to the invention further comprises at least one ceramide precursor.
[0044] As used herein, the term “ceramide precursor” refers to a substance involved in the biosynthesis of ceramides in the skin barrier.
[0045] The at least one precursor of the ceramides may be selected from phytosphingosine, one or more sphingolipids (e.g., sphingosine, dihydrosphingosine) or related lipids such as glycosphingolipids (e.g., glucosylceramide), and combinations thereof. Preferably, the at least one ceramide precursor is phytosphingosine.
[0046] In the formulation or composition according to the invention, the content of the extract derived from plant cell cultures of Hyssopus officinalis may range from 0.0001% to 1% (w / v), preferably from 0.0001% to 0.06% (w / v), and more preferably from 0.0012% to 0.004% (w / v), wherein the percentages are expressed by weight on the total volume of the composition or formulation.
[0047] The content of each ceramide precursor, when present, in the formulation or composition according to the invention may range from 0.001% to 5%, preferably from 0.005% to 0.05%, wherein the percentages are expressed by weight on the total weight of the composition or formulation.
[0048] In a further aspect, the invention relates to the cosmetic use of the composition or formulation as defined above for strengthening the skin barrier and / or for preventing and treating skin imperfections caused by aging and / or environmental stress.The extract derived from Hyssopus officinalis plant cell cultures according to the present invention exhibits surprising and unexpected properties in strengthening the skin barrier and in preventing and treating skin imperfections. For these reasons, it is of particular interest in the cosmetic field.
[0049] Advantageously, the extract of the present invention is obtained from plant cell cultures.
[0050] Unlike extracts obtained from whole plants, extracts derived from plant cell cultures exhibit numerous advantages, as they are free from toxic contaminants (such as, for example, pesticides and fertilizers) and potential environmental pathogens, since the cultures are grown under controlled laboratory conditions.
[0051] Moreover, they originate from standardized production processes, and therefore their composition and activity do not depend on seasonal or environmental variations, ensuring that the qualitative characteristics of the final product remain constant.
[0052] Advantageously, the extract from Hyssopus officinalis cell cultures of the present invention has been shown to stimulate the activity of enzymes involved in ceramide synthesis, thereby promoting ceramide production both in human keratinocytes and in human skin explants.
[0053] In addition, the extract increases the synthesis of structural proteins such as involucrin and filaggrin, which are essential components of the skin barrier. Together with ceramides, these proteins play a key role in maintaining the architecture and integrity of a functional epidermal barrier.
[0054] Such effects of stimulation of the ceramide production and epidermal protein synthesis leads to stabilization of the skin barrier, thereby counteracting aging processes caused by physiological factors and environmental stress.Furthermore, advantageously, the extract according to the invention has been found to reduce oxidative stress in human keratinocytes, counteracting the cellular damage caused by reactive oxygen species (ROS).
[0055] Furthermore, the extract obtained from Hyssopus officinalis cell cultures according to the present invention is capable of reducing melanin production in melanocytes, thereby counteracting the formation of skin spots caused by its overproduction. This confirms that the extract is suitable for the prevention and treatment of skin imperfections resulting from skin aging and / or environmental stress.
[0056] Finally, the extracts obtained from the cells according to the present invention are free from allergenic or irritating substances (such as, for example, alkaloids, which are present in the leaves and seeds of many plants) and exhibit a very low potential risk of allergic reaction in individuals.
[0057] Brief description of the figures
[0058] Figure 1A shows a bar chart illustrating the results of the cytotoxicity assay (MTT) of the extract, according to the present invention, on human keratinocytes. In particular, the hydroethanolic extract obtained from Hyssopus officinalis cells (grown in darkness) was tested at concentrations equal to or lower than 0.04% (0.4 mg / mL). The ordinate axis reports the number of viable cells, expressed as a percentage value relative to the control, which was set at 100%.
[0059] Figure IB shows a bar chart illustrating the results of the cytotoxicity assay (MTT) of the extract obtained from the Hyssopus officinalis plant on human keratinocytes. In particular, the hydroethanolic extract of the Hyssopus officinalis plant was tested at concentrations equal to or lower than 0.04% (0.4 mg / mL). The ordinate axis reports the number of viable cells, expressed as a percentage value relative to the control, which was set at 100%.Figure 2 shows a bar chart illustrating the effect of the hydroalcoholic extract obtained from cell cultures of Hyssopus officinalis, according to the present invention, and from the Hyssopus plant, on the expression of the filaggrin (FLG) gene, which encodes a structural protein essential for the skin barrier. Retinoic acid was used as a positive control. The bars represent the standard deviations, and asterisks indicate statistically significant variations.
[0060] Figure 3 shows a bar chart illustrating the effect of the hydroalcoholic extract obtained from cell cultures of Hyssopus officinalis, according to the present invention, on the expression of the involucrin (INV) gene, which encodes a protein essential for the formation of the skin barrier. Retinoic acid was used as a positive control. The bars represent the standard deviations, and asterisks indicate statistically significant variations.
[0061] Figure 4A shows a bar chart illustrating the effect of the hydroalcoholic extract obtained from cell cultures of Hyssopus officinalis, according to the present invention, on the expression of the p-glucocerebrosidase (GBA) gene, which encodes an enzyme involved in ceramide biosynthesis. Retinoic acid was used as a positive control. The bars represent the standard deviations, and asterisks indicate statistically significant variations.
[0062] Figure 4B shows a bar chart illustrating the effect of the hydroalcoholic extract obtained from cell cultures of Hyssopus officinalis, according to the present invention, on the expression of the serine palmitoyltransferase (SPT) gene, which encodes an enzyme involved in the synthesis of a major class of lipids, sphingolipids, which in turn participate in the biosynthetic pathway of ceramides. Retinoic acid was used as a positive control. The bars represent the standard deviations, and asterisks indicate statistically significant variations.
[0063] Figure 5A shows a bar chart illustrating the effect of the hydroalcoholic extract obtained from cell cultures of Hyssopus officinalis, according tothe present invention, on the activity of the enzyme P-glucocerebrosidase (GBA) in human keratinocytes. Retinoic acid was used as a positive control. The measurement was performed by a fluorescence assay using a modified enzyme substrate. The bars represent the standard deviations, and asterisks indicate statistically significant variations.
[0064] Figure 5B shows a bar chart illustrating the effect of the hydroalcoholic extract obtained from cell cultures of Hyssopus officinalis, according to the present invention, on the activity of the enzyme P-glucocerebrosidase (GBA) in human skin explants. Retinoic acid was used as a positive control. The measurement was performed by a fluorescence assay using a modified enzyme substrate. The bars represent the standard deviations, and asterisks indicate statistically significant variations.
[0065] Figure 6 shows a bar chart illustrating the effect of two different cosmetic formulations containing the hydroalcoholic extract obtained from Hyssopus officinalis cell cultures, according to the present invention, on the amount of ceramides in human skin explants. The two formulations, indicated respectively as “placebo” and “biomimicking,” differ by the presence of a ceramide precursor, phytosphingosine, which is present only in the biomimicking formulation. The measurement was performed by immunohistochemical staining using an anti-ceramide primary antibody. Retinoic acid was used as a positive control, applied directly to the culture medium of the explants. The bars represent the standard deviations, and asterisks indicate statistically significant variations. Figure 7 shows a bar chart illustrating the effect of two different foundation formulations containing the hydroalcoholic extract obtained from Hyssopus officinalis cell cultures, according to the present invention, on the amount of ceramides in human skin explants. The two formulations differ by the presence of the ceramide precursor, phytosphingosine. The measurement was performed by immunohistochemical staining using an anti-ceramide primary antibody. Retinoic acid was used as a positive control, applied directly to the culture medium of the explants. The bars represent the standard deviations, andasterisks indicate statistically significant variations.
[0066] Figure 8 shows a graph illustrating the measurement of reactive oxygen species (ROS) in the cytoplasm of human keratinocytes, in cells treated with 450 pM H2O2in the presence of the H. officinalis extract according to the invention. The ordinate axis reports ROS production expressed as a percentage relative to the stressed control (arbitrarily set at 100%). Values were calculated from fluorescence measurements recorded at 535 nm. Ascorbic acid (500 pM), known for its ability to inhibit oxidative stress, was used as a positive control.
[0067] Figure 9 shows a graph illustrating the measurement of melanin content in murine melanocytes treated with NDP-MSH (a synthetic analogue of a-MSH hormone, 1 nM) in the presence of the H. officinalis extract according to the invention. The ordinate axis reports melanin production expressed as a percentage relative to the stimulated control (arbitrarily set at 100%). Values were calculated from absorbance readings measured at 490 nm. Kojic acid (1 mM), known for its ability to inhibit melanin production, was used as a positive control.
[0068] Detailed Description
[0069] The Applicant has found that hydroalcoholic extracts obtained from plant cell cultures of the species Hyssopus officinalis, particularly the hydroethanolic extract, are of particular interest in the cosmetic field, as they have been shown to be surprisingly active in promoting the production of the components of the skin barrier and in stimulating its formation, thereby resulting in a potential strengthening of its protective function.
[0070] In particular, when tested on skin cells, the H. officinalis extract according to the present invention induced an increase in the expression of both filaggrin and involucrin, which are proteins essential for the formation and stabilization of the skin barrier (Figures 2-3); the effect produced on filaggrin expression was surprisingly more pronounced thanthat produced by the extract obtained from the Hyssopus officinalis plant (Figure 2).
[0071] Furthermore, the extract of the present invention showed, in skin cells, an increase in both the gene expression and the enzymatic activity of |3-glucocerebrosidase (GBA), an enzyme involved in the synthesis of ceramides, which are the main constituents of the lipid matrix of the skin barrier (Figures 4A and 5A); the increase in enzymatic activity was also confirmed in human skin explants treated with the same extract (Figure 5B).
[0072] In addition, the extract according to the present invention surprisingly exhibited a promoting effect on ceramide production in human skin explants, when incorporated into two different cosmetic formulations, with and without ceramide precursors, respectively. In particular, the promoting effect on ceramide production was greater for the formulation containing both the extract and the ceramide precursors (Figure 6). The effect of the extract in promoting ceramide production in human skin explants was also demonstrated when incorporated into a foundation formulation; in this case, as well, the effect on ceramide production was greater for the formulation containing the extract and the ceramide precursors (Figure 7).
[0073] Moreover, the extract of the invention was found to be capable of reducing oxidative stress and melanin production in skin cells, thereby helping to counteract damage caused by physiological skin aging or by environmental stress, such as UV radiation, and to prevent the formation of dark spots (Figures 8-9) .
[0074] Based on the above findings, the Hyssopus officinalis extract of the present invention exerts a stimulating action on the synthesis of the components of the skin barrier (particularly the lipid matrix), which makes it advantageously suitable for dermocosmetic applications, especially for the prevention and treatment of skin imperfections associated with a loss of barrier functionality, which may occur duringaging or as a result of environmental stress such as photoaging.
[0075] As indicated previously, the Hyssopus officinalis extract derived from cell cultures according to the present invention can be obtained by a process comprising the steps of:
[0076] a) homogenizing plant cell cultures of Hyssopus officinalis in a hydroalcoholic extraction solvent to obtain a homogenate;
[0077] b) separating the solid part of said homogenate from the liquid part; c) drying the liquid part to obtain said extract.
[0078] The Hyssopus officinalis plant cell cultures are obtained by collecting plant tissue from Hyssopus officinalis plants, inducing callus formation from said tissue on a solid substrate, harvesting said calluses, and establishing liquid cultures therefrom, which are then processed to obtain the extract, preferably the hydroalcoholic extract.
[0079] Advantageously, the cell cultures of the invention, obtained through the plant tissue culture technique discussed below, possess a high biosynthetic capacity for classes of secondary metabolites with strong antioxidant and skin-beneficial activity.
[0080] The cell cultures are obtained from leaf discs of Hyssopus officinalis by inducing callus formation on a solid substrate.
[0081] The undifferentiated cells thus obtained are then transferred and grown in liquid cultures, which may be subjected to chemical treatments (for example, with salts, sugars, vitamins, oxidizing agents, phytohormones) and / or physical factors (for example, UV irradiation, heat, cold, osmotic stress) to stimulate the production of secondary metabolites of interest and to enhance the cosmetic efficacy of the derived extracts.
[0082] The cells of the resulting cultures are then subjected to mechanical disruption by homogenization in a hydroalcoholic extraction solvent, such as an aqueous-alcoholic solution, thereby obtaining a homogenate.The term “homogenization” refers to a fragmentation treatment of the plant material, which may be carried out in a suitable container such as a ceramic mortar with a ceramic pestle, both pre-cooled, or, for larger volumes, in larger vessels, optionally metallic, where the material may be homogenized using metal blades, either with laboratory or industrial blenders or presses.
[0083] The homogenate is then separated into a liquid phase and a solid residue by centrifugation to precipitate the insoluble components. Alternatively, the separation can be performed by sedimentation or filtration.
[0084] The supernatant obtained after centrifugation is collected: this supernatant constitutes the hydroalcoholic extract of the invention. The extract is then dried, for example by distillation through low-pressure evaporation using a rotary evaporator, in order to remove the solvent. The resulting powder or semi-solid paste may be re-suspended in water or in cosmetically acceptable organic solvents at the desired extract concentration.
[0085] The invention also encompasses cosmetic compositions comprising the hydroalcoholic extract of the present invention, and optionally at least one cosmetically acceptable vehicle and / or excipient, such as those indicated above.
[0086] Preferably, the cosmetic composition of the invention includes among its components at least one ceramide precursor, particularly phytosphingosine.
[0087] Such compositions may be in the form of gels, creams, lotions, ointments, or emulsions for use in lipsticks, foundations, and other make-up products, or in the form of anhydrous products.
[0088] Preferably, the composition of the invention comprises, as a cosmetically acceptable vehicle or excipient, a solvent, particularly a hydrophilic solvent. The hydrophilic solvent is preferably selected from water andaqueous saline solutions, or from one or more hydrophilic organic solvents compatible with cosmetic formulations, more preferably selected from alcohols, glycerol, organic acids, amides, amines, aldehydes, or ketones, or from a combination of both types of solvent, if they are mutually miscible.
[0089] The present invention also relates to the cosmetic use of the above composition for treating skin imperfections caused by aging and for producing a rejuvenating effect on skin tissues.
[0090] These compositions can be used as such for topical application, or they may serve as a raw material to be incorporated into further formulations, optionally containing one or more additional active ingredients besides the extract of the invention, for the manufacture of ready-to-use cosmetic or dermatological products.
[0091] By way of illustration and without limitation, the following examples describe the preparation of plant cell cultures of the species Hyssopus officinalis, the preparation of an extract according to the present invention, and biological assays demonstrating the cosmetic activity of the extract.
[0092] In addition, two examples are provided for the preparation of cosmetic formulations and for experiments showing that, in such formulations, the extract of the invention effectively induces ceramide production in human skin explants, ceramides being fundamental components for the formation and functionality of the skin barrier.
[0093] Finally, an example is also provided for the preparation of a make-up formulation (foundation) and for an experiment demonstrating that, in this formulation, the extract of the invention effectively induces ceramide production in human skin explants.
[0094] EXAMPLES EXAMPLE 1 — Method for the preparation of the extract derived fromplant cell cultures of the species Hyssopus officinalis according to the present invention.
[0095] The following stages describe a preferred embodiment of the method for preparing a hydroethanolic extract derived from plant cell cultures of the species Hyssopus officinalis according to a preferred embodiment of the present invention.
[0096] Establishment of cell cultures
[0097] Starting from leaf pieces of young plants belonging to the species Hyssopus officinalis, plant callus cultures were established on solid medium.
[0098] In particular, whole leaves of Hyssopus officinalis were surface sterilized with 70% (v / v) ethanol in water for 15 minutes and then with 1% (v / v) sodium hypochlorite in water for a further 15 minutes. After three washes in water to remove ethanol and hypochlorite, the leaves were cut into 5 mm x 5 mm pieces and placed on solid B5 Gamborg medium containing plant agar (7.5 mg / L), myo-inositol (500 mg / L) and sucrose (30 g / L), adjusted to pH 5.7 using 0.1 N KOH. The culture medium, sterilized by autoclaving, was then supplemented with 2,4-dichlorophenoxyacetic acid (2,4-D, 1 mg / L), adenine (1 mg / L) and kinetin (0.01 mg / L). After approximately 5 weeks of incubation at 20 °C in the dark, calluses were obtained and subsequently transferred to liquid medium to establish cell cultures.
[0099] Growth of liquid cultures
[0100] Calluses with a diameter of about 1 cm and a mass of about 50 mg each were collected and dispersed into flasks containing 50 mL of the same medium as above but without agar and with kinetin at 0.1 mg / L.
[0101] The flasks were kept in the dark on an orbital shaker at 120 rpm and, after about 10 days, the calluses began to disaggregate and form homogeneous cell suspension cultures, i.e., comprising single cells orsmall aggregates.
[0102] Cell harvest
[0103] Upon reaching a culture cell density of approximately 150 g / L
[0104] in a 2 L flask, the cells were separated from the culture medium by filtration (filters with 80-100 pm pore size), washed with distilled water, subjected to thermal inactivation, and frozen at -80 °C.
[0105] Preparation of the hydroalcoholic extract from Hi / ssopus officinalis cells
[0106] Hyssopus officinalis cells (500 g) were homogenized at 1500
[0107] rpm for 3 minutes and subsequently suspended in 90:10 (v / v) ethanol / water at a 1:4 (w / v) ratio (approximately 2000 mL of solvent per 500 g of fresh cells). The suspension was further homogenized twice at 3800 rpm for 3 minutes using a blade homogenizer. The resulting lysate was left under stirring in a beaker for 2 hours at room temperature and then centrifuged at 6300 rpm for 10 minutes at 4 °C. The supernatant was recovered and subjected sequentially to filtration on qualitative filter paper followed by microfiltration (0.22 pm pore size) to remove residual solids and eliminate any microorganisms. The microfiltered extract (approximately 2 L) was concentrated by low-pressure evaporation using a rotary evaporator to about 20% of the initial volume. To the concentrated extract, 3x PBS was added at a 1:2 ratio (2 volumes of 3* PBS per 1 volume of concentrated extract). The mixture was further concentrated and then lyophilized. After solvent removal, approximately 41 g of concentrated extract were obtained. For biological assays, the extract thus obtained was initially dissolved in water at concentrations between 10% and 0.1%, and then further diluted in cell culture medium to obtain the final concentrations tested in the biological assays.
[0108] For the preparation of extract to be used in cosmetic formulations, 8 g of the extract thus obtained were dissolved under stirring in 18 mL of water, followed by the addition of 1237.32 g of glycerol (density 1.26 g / mL). Theresulting glyceric extract corresponds to 8 g / L in water and glycerin.
[0109] The extract was tested on human keratinocytes (HaCaT) to determine usable dose ranges and cytotoxicity. The extracts were subsequently used in different cell-based assays to evaluate their properties on skin cells and on human skin explants.
[0110] EXAMPLE IB (Comparative) — Method for the preparation of
[0111] the extract derived from the Hi / ssopus officinalis plant
[0112] A hydroalcoholic extract was prepared from Hyssopus
[0113] officinalis plants as follows.
[0114] Four plants of Hyssopus officinalis were removed from the soil
[0115] and washed with running water. The plant material was then homogenized at 1500 rpm for 3 minutes and subsequently suspended in 90:10 (v / v) ethanol / water at a 1:4 (w / v) ratio (350 g plant material in 1.4 L of 90% ethanol). The suspension was further homogenized twice at 3800 rpm for 3 minutes using a blade homogenizer, then left under stirring in a beaker for 2 hours at room temperature, and centrifuged at 6300 rpm for 10 minutes at 4 °C. The supernatant was recovered and subjected sequentially to filtration on qualitative filter paper followed by microfiltration (0.22 pm) to remove residual solids and any microorganisms. The microfiltered extract (approximately 1.3 L) was concentrated by low-pressure evaporation using a rotary evaporator to about 20% of the initial volume. To the concentrated extract, 3x PBS was added at a 1:2 ratio (2 volumes of 3* PBS per 1 volume of concentrated extract). The mixture was further concentrated and lyophilized; after solvent removal, approximately 12 g of concentrated extract were obtained. For biological assays, the extract thus obtained was initially dissolved in water at concentrations between 10% and 0.1%, and then further diluted in cell culture medium to obtain the final concentrations tested.The extract was tested on HaCaT keratinocytes to determine usable dose ranges and cytotoxicity and was subsequently used in a cell-based assay to assess its ability to increase the expression of skin barrier components in skin cells.
[0116] EXAMPLE 2 — Cytotoxicity assay
[0117] To determine the concentrations of the hydroethanolic extract
[0118] of the present invention and of the comparative plant-derived extract to be used in subsequent assays, cytotoxicity assays were conducted to define the concentration ranges that are non-damaging to cells in active growth.
[0119] This cytotoxicity assay is based on the use of MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide], first described by Mosmann in 1983. The assay relies on the capacity of mitochondrial dehydrogenases of viable cells to reduce the tetrazolium ring of MTT (light yellow) to formazan crystals (dark blue). These crystals are impermeable to cell membranes and accumulate in the cytoplasm of metabolically active cells. The number of viable, healthy cells is therefore directly proportional to the amount of formazan produced.
[0120] HaCaT cells (human keratinocytes), at an initial number of 1.5 x 104per well, were seeded in 96-well plates in DMEM (Dulbecco’s Modified Eagle Medium; Lonza) supplemented with 10% fetal bovine serum (FBS) for about 8 hours. Cells were treated with increasing concentrations of Hyssopus extracts between 0.002% and 0.04% (20-400 pg / mL) for approximately 48 hours, washed with PBS, and incubated with 100 pL / well of reaction buffer containing 10 mM HEPES, 1.3 mM CaCl2, 1 mM MgSO4, 5 mM glucose, and 0.5 mg / mL MTT in PBS buffer at pH 7.4. After 3 hours of incubation at 37 °C, 5% CO2, 100 pL of solubilization solution (10% Triton X-100, 0.1 N HC1 in absolute isopropanol) was added to each well. After a 16-hour incubation, absorbance at 595 nm was measured using a Victor 3 plate reader.The MTT results, reported in Figure 1A, indicated that the extract according to the present invention did not cause cytotoxicity at the concentrations tested; conversely, the MTT results, reported in Figure IB, indicated that the plant extract tested at 0.04% caused approximately 40% cytotoxicity, proving more cytotoxic than the extract obtained from cultured cells of the same species.
[0121] EXAMPLE 3 — Analysis of GBA, FLG, INV and SPT gene
[0122] expression in human keratinocytes
[0123] HaCaT cells, at an initial number of 1.5 x 105per well, were cultured in 6-well plates in DMEM (Gibco) supplemented with 10% FBS for 20 hours. On the following day, treatments were added with different concentrations of the cell-culture-derived Hyssopus extract according to the present invention, and with 1 pM retinoic acid as the positive control, for 6 hours. For the filaggrin gene, in addition to the above extract, the effect of the comparative Hyssopus plant extract was also tested.
[0124] For RNA extraction from the cell samples, a Sigma kit was used. After the indicated treatments, cells were washed with PBS, detached in lysis buffer and processed according to the kit protocol. RNA samples were treated with DNase I (Ambion) to remove contaminating genomic DNA. 2 pL of each sample were loaded onto a 1% agarose gel in the presence of denaturing loading dye and quantified using a specific RNA marker (Thermo Scientific). 300 ng of total RNA were reverse transcribed using Reverse Transcriptase (Thermo Scientific). Semi-quantitative RT-PCR reactions were conducted using 18S primer / competimer universal pair (Ambion) as internal standard. PCR products were separated on 1.5% agarose gels, visualized using the iBright instrument (Thermo Fisher), and analyzed densitometrically with iBright analysis software. Values shown in the graphs represent the ratio between the intensity of the band of the gene under analysis and that of the 18S reference band, to yield a value related to the actual expression of that gene, independent of RNAamount or PCR reagent variations. Values were then converted to percentages (%), setting the value obtained from the untreated control as 100%. Primer sequences used for amplification were:
[0125] Hs GBA for: AGTTGCACAACTTCAGC
[0126] Hs GBA rev: GTCCAGGTACCAATGTAC
[0127] Hs FLG for: AGAGCTGAAGGAACTTCTGG
[0128] Hs FLG rev: GTGTCATAGGCTTCATCC
[0129] Hs INV for: ATGTCCCAGCAACACACA
[0130] Hs INV rev: TCTGGGAGCTCCAACAGT
[0131] Hs SPT for: TTGGGTGTCTGGACTAGGGA
[0132] Hs SPT rev: AAGACCTGCCACAGCAGAAA
[0133] The results, shown in Figure 2, indicate that treatment of keratinocytes with the cell-culture-derived Hyssopus officinalis extract of the present invention produced an increase of about 60% in FLG gene expression, whereas the plant-derived extract produced an increase of about 35%; these increases are equal to or higher than those produced by the positive control, retinoic acid.
[0134] With regard to involucrin expression, the results, shown in Figure 3, indicate that the cell-culture-derived extract increased INV gene expression by about 20%, whereas the positive control, retinoic acid, increased it by about 35%.
[0135] Concerning [3-glucocerebrosidase (GBA) expression, the results, shown in Figure 4A, indicate that treatment with the extract of the present invention induces a significant increase in expression, specifically, an increase of about 45% at 0.0012% and about 55% at 0.004%; this effect is comparable to that induced by retinoic acid (positive control) .About serine palmitoyltransferase (SPT) expression, the results, shown in Figure 4B, indicate that treatment with the extract of the present invention induces a significant increase of about 35% when tested at 0.004%; this effect is slightly higher than that induced by retinoic acid (positive control).
[0136] EXAMPLE 4 — Assay of 3-glucocerebrosidase (GBA) enzymatic activity in keratinocytes
[0137] For the analysis of GBA enzymatic activity, HaCaT cells at an initial number of 1x105per well were seeded in 6-well plates in DMEM supplemented with 10% FBS and incubated for 16 hours at 37 °C, 5% CO2. Cells were treated for 24 hours with the Hyssopus extract of the present invention or with 1 pM retinoic acid as the positive control. After treatment, cells were washed in PBS and lysed in 50 pL / well of lysis buffer consisting of 0.1 M citrate / 0.2 M phosphate, pH 5.2, 0.25% sodium taurocholate, and 0.1% Triton X-100. 25 pg of proteins, quantified by Bradford assay, were incubated with 6 mM of the fluorescent substrate 4-methylumbelliferyl p-D-glucopyranoside. After 3 hours, fluorescence (excitation 365 nm, emission 448 nm) was measured using a VictorNivo plate reader. Data were expressed relative to the untreated control set at 100%.
[0138] The results, shown in Figure 5A, indicate that treatment of keratinocytes with the extract derived from cell-culture of Hyssopus officinalis, according to the present invention, produced an increase of about 25% in GBA activity at both doses used; retinoic acid (positive control) induced an increase of about 60%.
[0139] EXAMPLE 5 — Assay of Q-glucocerebrosidase (GBA) enzymatic activity in human skin explants
[0140] For the analysis of GBA enzymatic activity in skin explants obtained fromcosmetic surgery procedures, 8-mm punches were used to obtain biopsies that were identical to one another in shape and structure. The biopsies were placed in 24-well plates in DMEM supplemented with 10% FBS and treated with the Hyssopus extract or with retinoic acid (positive control). After 48 hours of treatment, biopsies were washed in PBS and treated with a DISPASE-based solution to allow dermis / epidermis separation. After 3 hours at 37 °C, the epidermis was detached and lysed in lysis buffer consisting of 0.1 M citrate / 0.2 M phosphate, pH 5.2, 0.25% sodium taurocholate, and 0.1% Triton X-100. The isolated epidermis was collected in a centrifuge tube and mechanically disrupted with a pestle on ice for 30 minutes, then sonicated for 5 minutes at 10 °C and centrifuged at 10,000 x g for 20 minutes at 4 °C. The supernatant was collected and quantified by Bradford. 20 pg of proteins were incubated in 96-well plates, with 6 mM 4-methylumbelliferyl p-D-glucopyranoside. After 2 hours, fluorescence (excitation 365 nm, emission 448 nm) was measured using a VictorNivo reader. Data were expressed relative to the untreated control set at 100%.
[0141] The results, shown in Figure 5B, indicate that treatment of human skin explants with the cell-culture-derived H. officinalis extract produced an increase of about 25% in GBA activity at the 0.004% dose tested; retinoic acid (positive control) induced an increase of about 40%.
[0142] EXAMPLE 6 — Method for the preparation of the base cream
[0143] To prepare 1 kg of cosmetic base cream (placebo), two separate phases were produced: an aqueous phase and a lipid phase, which were subsequently emulsified to obtain a stable and homogeneous cream. The same procedure was followed to prepare 1 kg of base cream containing the Hyssopus officinalis extract of the present invention.
[0144] Phase 1 : Preparation of the aqueous phase
[0145] For the aqueous phase, 839.44 g of sterile demineralized water were heated to 70-75 °C using a magnetic stirrer set at 300 rpm. For theversion containing the extract, 835.44 g of water were heated. Upon reaching the desired temperature, 1 g of EDTA (chelating agent) was added and the solution was maintained at 70-75 °C, preferably 75 °C, until the EDTA was fully dissolved.
[0146] Subsequently, 2.6 g of carbomer (gelling agent) were added under continuous stirring until complete dispersion, initiating gel formation. Finally, 0.96 g of a 50% (w / w) aqueous sodium hydroxide solution was added to further promote gel formation. At the end of the procedure, 845 g of aqueous phase were obtained for the placebo and 840 g for the cream containing the Hyssopus extract.
[0147] Phase 2: Preparation of the lipid phase
[0148] In a separate vessel, 46 g of caprylic / capric triglyceride, 33 g of stearic acid, 24 g of glyceryl stearate, 17 g of PEG- 100 stearate, 10.5 g of cetearyl alcohol, 10 g of cetyl alcohol, and 3.5 g of PEG-20 stearate were mixed on a magnetic stirrer at 300 rpm at 70-75 °C until a homogeneous melt was obtained. At the end, 144 g of lipid phase were obtained.
[0149] Phase 3: Emulsification of the two phases
[0150] To obtain the emulsion, an ULTRA-TURRAX homogenizer was inserted into the vessel containing the aqueous phase (845 g for the placebo, 840 g for the extract-containing batch, previously prepared in Phase 1), and the speed was gradually increased from 2000 to 15,000 rpm, while the lipid phase (144 g, previously prepared in Phase 2) was slowly poured into the aqueous phase.
[0151] After complete mixing of the two components, homogenization was continued for an additional 10 minutes at 15,000 rpm, maintaining the temperature at 75 °C.
[0152] At the end, 989 g of emulsion for placebo base cream and 984 g of emulsion for the base cream that will contain the Hyssopus extract were obtained.Phase 4: Addition of the Hyssopus extract according to the present invention, and of the preservative system, to the emulsion.
[0153] The emulsion from Phase 3 was gradually cooled to 40 °C under ULTRA-TURRAX stirring to add the Hyssopus extract.
[0154] Then 5 g of the glyceric Hyssopus officinalis extract dissolved in glycerin and water and prepared in Example 1 were added; in the placebo cream, 5 g of additional demineralized water had already been included in Phase 1. Finally, 8 g of phenoxyethanol and 3 g of ethylhexylglycerin were incorporated as the preservative system into both preparations (with and without the Hyssopus extract) .
[0155] The mixture was homogenized for 7 minutes at 15,000 rpm. Once cooled to room temperature, viscosity and pH were measured and found to be 20,800 cPs and 5.97, respectively.
[0156] At the end, 1 kg of base cream (placebo) and 1 kg of cream containing 0.004% of Hyssopus officinalis extract were obtained.
[0157] EXAMPLE 6B — Method for the preparation of the
[0158] “Biomimicking” cream
[0159] To prepare 1 kg of Biomimicking cosmetic cream (placebo), two separate phases were produced: an aqueous phase and a lipid phase (composed of two sub-phases), which were subsequently emulsified to obtain a stable, homogeneous cream. The same procedure was followed to prepare 1 kg of Biomimicking cream containing the Hyssopus officinalis extract of the present invention.
[0160] Phase 1: Preparation of the aqueous phase
[0161] For the aqueous phase, 765.8 g of sterile demineralized water (760.8 g for the extract-containing version) was heated to 55-60 °C using aRayneri bench homogenizer set at 2000 rpm.
[0162] Upon reaching the desired temperature, 54.8 g of glycols were added to reduce free water loss and thus microbial contamination risk.
[0163] The solution was then heated and maintained at 58-60 °C (preferably 60 °C). Under continuous stirring at 2000 rpm, 13.25 g of gelling agents and 3.75 g of emulsifier were added until complete dispersion, forming the gel base. The phase was then heated to 78-82 °C, and at the end of the procedure, 837.6 g of aqueous phase were obtained for the Biomimicking cosmetic cream (placebo) and 832.6 g of aqueous phase for the cream that will contain the Hyssopus extract.
[0164] Phase 2: Preparation of the two parts of the lipid phase
[0165] For the first part of the lipid phase, 24.92 g of emulsifiers, 0.98 g of a lipid-phase antioxidant, and 96.05 g of oils and waxes (in proportions mimicking typical skin lipid composition) were combined. Finally, 10 g of an amino-acid derivative were added to improve spreadability. The phase was heated to 78-82 °C and mixed on a magnetic stirrer at 300 rpm until a homogeneous melt was obtained.
[0166] For the second part of the lipid phase, 20 g of caprylic / capric triglyceride and 0.5 g of phytosphingosine were combined and heated to 100-110 °C until the phytosphingosine was completely solubilized.
[0167] At the end, 131.95 g of lipid part 1 and 20.5 g of lipid part 2 were obtained.
[0168] Phase 3: Emulsification of the two phases
[0169] To obtain an emulsion, a Rayneri homogenizer was inserted into the vessel containing the aqueous phase (837.6 g of the Biomimicking cosmetic cream and 832.6 g of the cream that will contain the extract), previously prepared in Phase 1, and its speed was gradually increased from 2000 to 2500 rpm, while the two parts of the lipid phase (131.95 gof part 1 and 20.5 g of part 2, previously prepared in Phase 2) were slowly poured into the aqueous phase in sequence (first the first part and then the second part) until fully added. After complete mixing, homogenization was continued for an additional 20 minutes at 5000 rpm, maintaining the temperature at 80 °C. The emulsion was then cooled progressively to 30 °C.
[0170] At the end, 990.05 g of emulsion for the Biomimicking placebo cream and 985.05 g for the Biomimicking cream that will contain the extract were obtained.
[0171] Phase 4: Addition of the water-soluble mixture mimicking the skin Natural Moisturizing Factor (NMF) and of the Hgssopus extract of the present invention
[0172] To the emulsions obtained in Phase 3 (990.05 g placebo and 985.05 g for the emulsion that will contain the Hyssopus extract), 9.94 g of a mixture of glycols and amino acids, mimicking the typical composition of the skin NMF, were added under Rayneri stirring at 500 rpm. For the formulation with the active component, 5 g of Hyssopus officinalis extract dissolved in glycerine and water as prepared in Example 1 was additionally added under stirring.
[0173] Stirring was continued for 10 minutes at 500 rpm. After cooling to room temperature, viscosity and pH were measured and found to be 23,200 cPs and 5.65, respectively.
[0174] At the end, 1 kg of Biomimicking cream (placebo) and 1 kg of Biomimicking cream containing 0.004% of Hyssopus officinalis extract were obtained.
[0175] EXAMPLE 7 — Method for the preparation of the foundation
[0176] The laboratory process for 1 kg of emulsion foundation (placebo) comprises preparation of two phases (a pigmented aqueous phase and a lipid phase), which are subsequently emulsified. The formulation isfinalized by adding a stabilizer and preservatives to obtain a stable, homogeneous foundation.
[0177] The same procedure was followed to produce 1 kg of emulsion foundation containing the Hyssopus officinalis extract of the present invention and phytosphingosine.
[0178] Phase 1: Preparation of the pigmented aqueous phase
[0179] For the pigmented aqueous phase, 533.1 g of deionized water with 55 g of humectants was heated to 50-55 °C. Mixing was carried out in a beaker using a mechanical stirrer at 300 rpm.
[0180] Under continuous stirring, 3 g of gelling agent and 20 g of emulsifier were added in succession.
[0181] Into the gel thus formed, 130 g of powder phase were dispersed (containing 10 g of filler and 120 g of pigments: titanium dioxide and iron oxides) .
[0182] The powder phase was incorporated into the gel under continuous stirring at 50-55 °C for 15 minutes. To optimize pigment dispersion, the gel was homogenized with an ULTRA-TURRAX at 10,000 rpm for 3 minutes.
[0183] After verifying complete dispersion of the color phase, the pigmented gel was heated to 85 °C under continuous stirring.
[0184] Phase 2: Preparation of the lipid phase
[0185] The lipid phase was weighed into a second beaker and solubilized at 83-85 °C using a magnetic stirrer.
[0186] For the placebo formula, the lipid phase consisted of 160 g of skinconditioning agents, 25 g of emulsifier, 10 g of viscosity agent, and 2 g of antioxidant. In formulas containing phytosphingosine, its amount was offset by an equal amount of skin-conditioning agent.Specifically, phytosphingosine (0.5 g) was solubilized in a third beaker at 85 °C with magnetic stirring and added to the lipid phase prior to emulsification.
[0187] Phase 3: Emulsification of aqueous and lipid phases
[0188] Emulsification was carried out by slowly pouring the lipid phase into the pigmented gel under mechanical stirring at 800 rpm.
[0189] After complete addition of the lipid phase, the process was completed using ULTRA-TURRAX at 10,000 rpm for 5 minutes.
[0190] The emulsion was then cooled slowly to 50 °C under stirring, and an aqueous pH-regulating solution followed by a thickener (to further stabilize viscosity) were added in succession.
[0191] The pH regulator serves to neutralize the gelling agent and complete gel formation in the aqueous phase.
[0192] Phase 4: Addition of the Hi / ssopus officinalis extract and
[0193] preservative solution
[0194] The emulsion was further cooled slowly to 40 °C under stirring, and the preservative system was added to the bulk. The mixture of antimicrobial substances had been pre-solubilized at 50 °C before addition.
[0195] The emulsion was then cooled to 25 °C under continuous stirring and, when present, the active Hyssopus officinalis extract (5 g) prepared in Example 1 was added: its amount was offset by an equal amount of deionized water in the aqueous phase.
[0196] After the addition of the active ingredient, the product was mixed for 5 minutes at 800 rpm. Physico-chemical characteristics of the product were measured to ensure quality and cosmetic performance.
[0197] EXAMPLE 8 — Assay of ceramides in human skin explantsSkin explants obtained from cosmetic surgery were used to prepare 8 mm “punches” with a biopsy curette. The punches were cultured in DMEM, 10% FBS, penicillin / streptomycin (100 U / mL and 100 pg / mL, respectively), and gentamicin / amphotericin B (25 pg / mL and 250 ng / mL, respectively) in plates with inserts under air-liquid interface conditions. Punches were treated for 72 hours with the Hyssopus extract previously formulated in a placebo (Example 6), in a “biomimicking” formula (Example 6B), and in a foundation formula (Example 7). Retinoic acid was used as the positive control.
[0198] After incubation, punches were washed in PBS and fixed in 4% PEA for 5-6 hours, then incubated in 15% sucrose and finally in 30% sucrose. Punches were frozen in O.C.T. on dry ice and stored at -80 °C until sectioning. 5 pm cryosections were obtained using a Leica CM 1520 cryostat. Slides with sections were hydrated for 30 minutes in PBS and processed for immunohistochemical staining according to the VECTASTAIN Universal Quick kit (Vector Laboratories) guidelines. Sections were incubated with anti-ceramide primary antibody (Enzo Life Sciences) at a 1:20 dilution for 18 hours at 4 °C. On the following morning, sections were washed in PBS and the stain was developed according to Vector VIP kit guidelines (Vector Laboratories).
[0199] The results, shown in Figure 6, indicate that treatment of human skin explants with the cell-culture-derived Hyssopus officinalis extract of the present invention produced an increase in ceramide levels of about 35% at 0.004% when tested in the placebo formulation (placebo + extract), and of about 140% when tested in the biomimicking formulation containing phytosphingosine (biomimicking + extract); these effects are greater than those induced by retinoic acid (positive control) .
[0200] As shown in Figure 7, treatment with the same extract produced an increase in ceramide levels of about 16% at 0.004% when tested in the placebo foundation formulation (placebo + extract) and of about 34% when tested in the formulation containing phytosphingosine (placebo + phytosphingosine + extract); this effect is comparable to that induced byretinoic acid (positive control).
[0201] EXAMPLE 9 — Assay of reactive oxygen species (ROS) in human keratinocytes
[0202] To determine the antioxidant potential of the plant cell culture extract according to the invention, a quantitative assay of intracellular ROS concentration was carried out in epidermal cells under oxidative stress conditions.
[0203] This assay measures cytoplasmic ROS using a specific fluorescent dye and provides information on the protective effect of a given product based on its ability to maintain a reduced ROS level within the cell.
[0204] 1.8 x 104HaCaT cells were seeded in 96-well plates and maintained in culture for 20 hours. Cells were treated for 2 hours with two different concentrations of the H. officinalis extract according to the invention or with ascorbic acid (known for high antioxidant activity) as the positive control.
[0205] After treatment, cells were washed with PBS and incubated at 37 °C for 30 minutes with the dye CM-DCFDA (5-(and-6)-chloromethyl-2',7'-dichlorodihydrofluorescein diacetate; Invitrogen). After washing again with PBS, cells were exposed to 450 pM hydrogen peroxide (H2O2) and incubated for a further 1 hour.
[0206] Fluorescence emitted by the cells was measured before H2O2addition and after exposure to the oxidant; fluorescence was read at 535 nm using a VictorNivo (PerkinElmer) plate reader.
[0207] The results, shown in Figure 8, indicate that treatment of keratinocytes with the cell-culture-derived H. officinalis extract produced a reduction of ROS of about 20% at the 0.004% dose tested; ascorbic acid (positive control) produced a reduction of about 25%.
[0208] EXAMPLE 10 — Assay of melanin contentFor melanin content analysis, a murine melanoma cell line (B16F1) was used.
[0209] B16F1 cells, at an initial number of 3x103per well, were grown in 96-well plates in DMEM (Gibco) supplemented with 10% FBS, 2 mM glutamine, and 1 mM sodium pyruvate for 16 hours in an incubator at 37 °C, 5% CO2.
[0210] The B16 cells were treated for 72 hours with the Hyssopus extract in the presence of 1 nM NDP-MSH (a synthetic analogue of a-MSH capable of stimulating melanogenesis) .
[0211] After treatment, cells were washed in PBS and lysed in 50 pL / well of 1 N NaOH at 70 °C for 20 minutes. Absorbance at 490 nm, corresponding to melanin content, was measured with a VictorNivo plate reader and normalized to the total protein content of each sample by Bradford assay. The results, shown in Figure 9, indicate that treatment of melanocytes with the cell-culture-derived H. officinalis extract produced a reduction in melanin content of about 20% at 0.004%; kojic acid (positive control) produced a reduction of about 30%.BIBLIOGRAFY
[0212] Bouwstra JA, Nadaban A, Bras W, McCabe C, Bunge A, Gooris GS. The skin barrier: An extraordinary interface with an exceptional lipid organization. Prog Lipid Res. 2023;92: 101252. doi: 10.1016 / j.plipres.2O23.101252;
[0213] Choi EH. Aging of the skin barrier. Clin Dermatol. 2019;37(4):336-345. doi: 10.1016 / j.clindermatol.2019.04.009;
[0214] Pilkington SM, Bulfone-Paus S, Griffiths CEM, Watson REB. Inflammaging and the Skin. J Invest Dermatol. 2021; 141(4S): 1087- 1095. doi: 10.1016 / j.jid.2020.11.006;
[0215] Cha HJ, He C, Zhao H, Dong Y, An IS, An S. Intercellular and intracellular functions of ceramides and their metabolites in skin (Review). Int J Mol Med. 2016;38(l): 16-22. doi: 10.3892 / ijmm.2016.2600;
[0216] Rabionet M, Gorgas K, Sandhoff R. Ceramide synthesis in the epidermis. Biochim Biophys Acta. 2014;1841(3):422-434. doi: 10.1016 / j.bbalip.2013.08.011.
Claims
CLAIMS1. An extract derived from plant cell cultures of Hyssopus officinalis, wherein said extract is obtainable by a preparation process comprising the steps of:a) homogenizing plant cell cultures of Hyssopus officinalis in a hydroalcoholic extraction solvent to obtain a homogenate;b) separating the solid part of said homogenate from the liquid part; c) drying the liquid part to obtain said extract,wherein said plant cell cultures of Hyssopus officinalis areobtained by collecting plant tissue from Hyssopus officinalis plants, inducing the formation of calluses from said tissue on a solid substrate, harvesting said calluses, and establishing liquid cultures therefrom.
2. The extract according to claim 1, wherein in step (a) of homogenization, the hydroalcoholic solvent is an ethanol-water solution having an ethanol concentration ranging from 10% to 99% (v / v), preferably 90% (v / v).
3. The extract according to any one of claims 1 and 2, wherein the ratio between the volume of the hydroalcoholic extraction solvent and the weight of the Hyssopus officinalis cell culture ranges from 6:1 to 2:1, preferably said ratio is 4: 1.
4. The extract according to any one of the preceding claims, wherein step (b) of separating the solid part of said homogenate from the liquid part is carried out by centrifugation, sedimentation, or filtration.
5. The extract according to any one of the preceding claims, wherein in step (c):- the liquid part is dried by evaporation or lyophilization,- 37 -Or- the liquid part is concentrated and the resulting concentrated extract is supplemented with water or a saline solution, preferably a phosphate-buffered saline (PBS) solution, and then dried, preferably by lyophilization.
6. Use of an extract derived from plant cell cultures of Hyssopus officinalis, according to any one of the preceding claims, for skin care.
7. Use of an extract derived from plant cell cultures of Hyssopus officinalis according to any one of claims 1 to 5 for strengthening the skin barrier and / or for preventing and / or treating skin imperfections caused by skin aging and / or environmental stress.
8. A cosmetic composition or formulation for skin treatment, comprising an extract derived from plant cell cultures of Hyssopus officinalis according to any one of claims 1 to 5 and, optionally, at least one cosmetically acceptable vehicle and / or excipient.
9. The cosmetic composition or formulation according to claim 8, wherein the content of said extract derived from plant cell cultures of Hyssopus officinalis ranges from 0.0001% to 1% (w / v), preferably from 0.0001% to 0.06% (w / v), and more preferably from 0.0012% to 0.004% (w / v), wherein the percentages are expressed by weight on the total volume of the composition or formulation.
10. The cosmetic composition or formulation according to claim 8 or 9, further comprising at least one ceramide precursor selected from phytosphingosine, one or more sphingolipids, and combinations thereof, said at least one ceramide precursor being preferably phytosphingosine.
11. The cosmetic composition or formulation according to claim 10, wherein the content of each ceramide precursor ranges from 0.001% to 5% (w / w), preferably from 0.005% to 0.05% (w / w), wherein the percentages are expressed by weight on total weight of the composition- 38 -or formulation.
12. The cosmetic composition or formulation according to any one of claims 8 to 11, wherein said composition or formulation is in the form of a cream, gel, lotion, ointment, or emulsion for use in lipsticks, foundations, and / or other make-up products, including anhydrous forms.
13. Use of a cosmetic composition or formulation according to any one of claims 8 to 12 for skin care, preferably for strengthening the skin barrier and / or for preventing and / or treating skin imperfections caused by aging and / or environmental stress.