Tomato plant with high vitamin e content and production method therefor
By overexpressing the MPBQMT gene in tomatoes, the transgenic plants achieve a substantial increase in α-tocopherol content, addressing the limitations of traditional breeding and synthetic methods, and provide a valuable source for vitamin E-fortified foods and cosmetics.
Patent Information
- Application Number
- PCT/KR2025/023060
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2025-12-24
- Filing Date
- 2025-12-29
- Publication Date
- 2026-07-02
AI Technical Summary
Existing methods to increase vitamin E content in plants, particularly α-tocopherol in tomatoes, are time-consuming and face challenges such as low bioavailability and high costs of synthetic vitamins, while traditional breeding methods are limited by genetic complexity.
A transgenic tomato plant is developed by overexpressing the tomato-derived MPBQMT gene, which is operably linked to a constitutive or fruit-specific promoter and inserted into the tomato genome, using methods like Agrobacterium-mediated transformation, to enhance α-tocopherol content in the fruit.
The transgenic tomato plants exhibit significantly increased α-tocopherol levels, up to 3.4 times higher than wild-type tomatoes, maintaining normal growth and fruiting characteristics, and can be used to produce vitamin E-fortified foods and cosmetic ingredients.
Smart Images

Figure KR2025023060_02072026_PF_FP_ABST
Abstract
Description
Vitamin E high-content tomato plant and method of preparing the same
[0001] The present invention relates to a tomato plant with a high vitamin E content and a method for producing the same.
[0002]
[0003] As a fat-soluble antioxidant, Vitamin E plays an important role in the human body by eliminating free radicals and protecting cell membranes. Vitamin E is classified into two groups, tocopherols and tocotrienols, each of which exists in four isomers: α, β, γ, and δ. Among these, α-tocopherol exhibits the highest biological activity in the human body and demonstrates various health-promoting effects through its powerful antioxidant action, such as preventing lipid peroxidation of cell membranes, enhancing immune function, and preventing cardiovascular diseases.
[0004] Vitamin E deficiency is becoming a problem in the modern diet, and the generally recommended daily intake of vitamin E for adults is approximately 15 mg of α-tocopherol equivalent. Vitamin E is primarily obtained through vegetable oils, nuts, seeds, and green vegetables, but it is difficult to achieve sufficient intake in the modern diet centered on processed foods. Accordingly, interest in methods for fortifying vitamin E using natural food materials is increasing.
[0005] Tomato (Solanum lycopersicum) is one of the most widely cultivated and consumed vegetable crops worldwide, containing various nutrients such as lycopene, beta-carotene, and vitamin C. Tomatoes are a daily food consumed not only raw but also as an ingredient in various processed foods such as juice, sauces, ketchup, and paste. Therefore, enhancing the nutritional content of tomatoes can directly contribute to the improvement of public health.
[0006] Tocopherol biosynthesis in plants occurs through complex metabolic pathways. Phytyl-diphosphate, synthesized via the mevalonate pathway, and homogentisate, synthesized via the shikimate pathway, are condensed by HPT (homogentisate phytyltransferase) to form MPBQ (2-methyl-6-phytyl-1,4-benzoquinol). Subsequently, MPBQ is methylated by MPBQMT (methyl-phytylbenzoquinol methyltransferase) to convert it into DMPBQ (2,3-dimethyl-6-phytyl-1,4-benzoquinol), which is then cyclized by tocopherol cyclase to form δ-tocopherol. Finally, it is converted to α-tocopherol by γ-tocopherol methyltransferase.
[0007] MPBQMT, also named VTE3 (Vitamin E 3), is a methyltransferase that transfers a methyl group to the carbon at the 3rd position of MPBQ using S-adenosylmethionine (SAM) as a methyl donor. This enzyme acts in the early stages of tocopherol biosynthesis and is known as one of the key regulatory points determining tocopherol content. MPBQMT genes have been identified in various plants, including Arabidopsis, rice (Oryza sativa), and soybean (Glycine max), and their importance in tocopherol biosynthesis has been elucidated through functional studies of these genes.
[0008] Various approaches have been attempted to increase the vitamin E content in plants. Research has been conducted to select varieties with high tocopherol content using traditional breeding methods; however, this approach is time-consuming and has limitations, such as the difficulty of improving target traits due to the complexity of genetic backgrounds. Additionally, while methods to fortify foods by adding vitamin E externally are used, they face issues such as the low bioavailability of synthetic vitamins and high costs.
[0009] The present invention aims to provide a transgenic tomato plant in which the content of vitamin E, particularly α-tocopherol, is significantly increased by overexpressing the tomato-derived MPBQMT gene.
[0010] In addition, the present invention aims to provide a method for producing the above-mentioned transgenic tomato plant and the seeds thereof.
[0011] In addition, the present invention aims to provide a vitamin E-fortified food composition containing the above-mentioned transgenic tomato fruit.
[0012] To achieve the above technical objectives, the present invention provides a transgenic tomato plant in which a gene encoding methyl-phytylbenzoquinol methyltransferase (MPBQMT) is introduced, and the alpha-tocopherol (α-tocopherol) content in the fruit is increased compared to wild-type tomatoes.
[0013] According to one embodiment of the present invention, the gene may code for the amino acid sequence of SEQ ID NO. 2.
[0014] According to one embodiment of the present invention, the gene may be operably linked under the control of a constitutive promoter or a fruit-specific promoter. In this case, the constitutive promoter may be any one selected from the group consisting of a CaMV 35S promoter (Cauliflower Mosaic Virus 35S promoter), a nophalin synthase (NOS) promoter, a ubiquitin promoter, and an actin promoter. In addition, the fruit-specific promoter may be any one selected from the group consisting of the E8 promoter, polygalacturonase (PG-2A) promoter, acid beta-fructofuranosidase promoter, acyltransferase 2 promoter, histidine decarboxylase promoter, and lipoxygenase promoter.
[0015] According to one embodiment of the present invention, the gene may be inserted into chromosome 4 of the tomato genome.
[0016] In addition, the present invention provides seeds of the transgenic tomato plant.
[0017] In addition, the present invention provides a method for producing a tomato plant with increased alpha-tocopherol content, comprising the steps of: (a) transforming a tomato plant cell or tissue with a recombinant vector containing a gene encoding methyl-phytylbenzoquinol methyltransferase (MPBQMT); and (b) redifferentiating the transformed plant cell or tissue to obtain a plant.
[0018] According to one embodiment of the present invention, the transformation may be performed using any one selected from the group consisting of Agrobacterium-mediated transformation, a gene gun method, electroporation, and liposome-mediated delivery methods.
[0019] In addition, the present invention provides a vitamin E-fortified food composition containing the fruit of the genetically modified tomato plant.
[0020] The transgenic tomato plant of the present invention has a significantly increased α-tocopherol content in the fruit compared to the wild type through the overexpression of the MPBQMT gene, and can be utilized as an excellent source of vitamin E.
[0021] The transgenic tomato of the present invention maintains normal growth and fruiting characteristics while having enhanced functionality, and can be usefully utilized in the development of high-value functional tomato varieties.
[0022] The tomato fruit of the present invention can be applied in various fields, such as vitamin E-fortified foods, health functional foods, and cosmetic ingredients.
[0023] Figure 1 is a schematic diagram showing the presumed role of SlMPBQMT in the tocopherol (vitamin E) biosynthetic pathway of the tomato (Solanum lycopersicum cv. Micro-Tom). This schematic diagram illustrates the biosynthetic pathway leading to tocopherol formation within the chloroplast. Methyl-phytylbenzoquinol methyltransferase (MPBQMT; coded as SlMPBQMT, Solyc09g065730; red box) catalyzes the methylation of MPBQ to produce 2,3-dimethyl-6-phytyl-1,4-benzoquinol (DMPBQ), which is cyclized by tocopherol cyclase (TC) and methylated by γ-tocopherol methyltransferase (γ-TMT) to produce four tocopherol isomers (α, β, γ, δ-tocopherol). These reactions occur mainly in chloroplasts and highlight the role of SlMPBQMT in enhancing α-tocopherol biosynthesis.
[0024] Figure 2 shows the coding sequence and inferred amino acid sequence of the MPBQMT gene. The complete coding sequence (CDS) of the MPBQMT gene is shown along with the corresponding inferred amino acid sequence aligned under each codon. The translation start codon (ATG) and the translation stop codon (TGA) are highlighted in yellow. The open reading frame (ORF) spans 1,020 bp.
[0025] Figure 3 shows the identification and schematic diagram of the MPBQMT gene construct. (A) As a result of PCR amplification of the MPBQMT gene from tomato (Solanum lycopersicum cv. Micro-Tom) cDNA, a single band of approximately 1,020 bp corresponding to the expected coding sequence of MPBQMT was observed. (B) Schematic diagram of the plant expression vector pBI121-35S::MPBQMT. Restriction enzyme sites BamHI, SalI, and SacI were used for cloning.
[0026] Figure 4 shows the generation and molecular confirmation of MPBQMT overexpressing transgenic tomato plants. (A) The regeneration process of transgenic tomato (Solanum lycopersicum cv. Micro-Tom) plants overexpressing MPBQMT. Cotyledon explants were co-cultured with Agrobacterium tumefaciens possessing the 35S::MPBQMT construct and selected in kanamycin-containing medium. Shoots regenerated from resistant calluses were transplanted into root induction medium for acclimatization. Representative mature transgenic plants are indicated. (B) PCR confirmation results regarding the introduction of MPBQMT in the presumed transgenic lines. DNA fragments of the expected size (approx. 1,020 bp) were amplified from the genomic DNA of independent transgenic lines (OE1-OE9). P, positive control (plasmid DNA); N, negative control (wild-type plant). The arrow indicates the amplified MPBQMT product.
[0027] Figure 5 shows the relative expression levels of the MPBQMT (VTE3) gene in transgenic tomato lines. (A) Relative transcript levels of MPBQMT in the leaves of overexpression (OE) lines (OE1-OE8) compared to the wild type (N). (B) Relative transcript levels of MPBQMT in the fruits of the same transgenic lines. Gene expression was analyzed by quantitative real-time PCR (qRT-PCR) using Actin as an internal reference gene. Data represent the mean ± standard deviation (SD) of three biological replicates.
[0028] Figure 6 shows the tomato fruit morphology and vitamin E content of transgenic tomato lines. (A) Representative fruit images of independent MPBQMT overexpressing tomato lines (OE1, OE4, OE5, and OE8) and a negative control (N). Scale bar = 1 cm. (B) Vitamin E content (µg / g fresh weight) in the fruits of independent MPBQMT overexpressing lines (OE1, OE4, OE5, and OE8) and a negative control (N). Error bars represent the standard deviation (SD) of three biological replicates.
[0029] Figure 7 shows the results of HPLC analysis of α-tocopherol content in transgenic tomato fruits. (A) Representative HPLC chromatogram showing the α-tocopherol peak (retention time = 10.497 min) in MPBQMT overexpressing tomato lines (OE1, OE4, OE5, and OE8) independent of the wild type (N). (B) The table on the right shows the peak area values and calculated α-tocopherol content (µg / g fresh weight) for each sample.
[0030] Figure 8 shows the α-tocopherol content and growth rate in transgenic tomato lines. (A) α-tocopherol content (µg / g fresh weight) in fruits of independent MPBQMT overexpressing tomato lines (OE1, OE4, OE5, and OE8) and wild type (N). (B) Growth rate (%) of α-tocopherol accumulation in independent MPBQMT overexpressing lines compared to wild type.
[0031] Figure 9 shows the identification of the T-DNA insertion site in MPBQMT overexpressing tomato lines (VTE3-8). (A) PCR amplification results from the genomic DNA of the VTE3-8 transgenic tomato line. Primary PCR and nested secondary PCR amplification were performed to isolate the lateral genomic sequence adjacent to the T-DNA insertion site. Red arrows indicate specific PCR products obtained from the secondary reaction. (B) Sequencing results of the secondary PCR products. The green sequences represent the tomato genomic DNA adjacent to the insertion region, and the red sequences correspond to the right boundary (RB) region of the inserted T-DNA. The results confirm the accurate integration of the MPBQMT transgenic gene within the tomato genome.
[0032] Figure 10 shows the genomic location of the T-DNA insertion site in a SlMPBQMT overexpressing tomato line (VTE3-8). (A) Genome browser visualization result showing the exact T-DNA insertion site on chromosome 4 (chr04) of the tomato genome (SL3.0 build). The insertion site was mapped between 6,564,001 and 6,565,200 bp, indicated by a red arrow and a yellow label ("Insertion site"). (B) A diagram showing the insertion site mapped on chromosome 4 (blue label: "VTE3-8 insertion site") and a representative image of a VTE3-8 transgenic tomato plant.
[0033] Figure 11 shows the genotyping analysis of a SlMPBQMT overexpressing tomato line (VTE3-8) via PCR analysis. (A) Schematic diagram of the primer design for genotyping the T-DNA insertion site. Three primers were used: LP (left primer) and RP (right primer) are located in the genomic DNA (gDNA) region adjacent to the insertion site, and RBP (right boundary primer) is located within the right boundary region of the T-DNA. (B) PCR amplification results showing the genotypes of wild-type and heterozygous plants. Wild-type plants produced a 550 bp band (LP + RP), whereas heterozygous plants produced both 550 bp (wild-type allele) and 190 bp (T-DNA insertion allele; LP + RBP) fragments, confirming the presence of a single T-DNA insertion.
[0034] Figure 12 shows the identification of homozygous SlMPBQMT overexpressing tomato lines (T2 generation). (A) PCR genotyping results of T2 plants derived from the SlMPBQMT overexpressing line VTE3-8. Two sets of primers were used: LP + RP (wild-type allele amplification, 550 bp) and LP + RBP (T-DNA insertion allele amplification, 269 bp). Homozygous plants (lanes 9 and 12) produced only the 269 bp band, while wild-type controls (WT) showed only the 550 bp fragment. (B) Representative phenotypes of homozygous SlMPBQMT overexpressing tomato plants (VTE3-8 T2-9 and VTE3-8 T2-12).
[0035] The present invention will be described below.
[0036]
[0037] The present invention relates to a transgenic tomato plant in which a gene encoding methyl-phytylbenzoquinol methyltransferase (MPBQMT) is introduced, and the alpha-tocopherol (α-tocopherol) content in the fruit is increased compared to wild-type tomatoes.
[0038] As a fat-soluble antioxidant, Vitamin E plays an important role in the human body by eliminating free radicals and protecting cell membranes. Vitamin E is classified into two groups, tocopherols and tocotrienols, each of which exists in four isomers: α, β, γ, and δ. Among these, α-tocopherol exhibits the highest biological activity in the human body.
[0039] As shown in Figure 1, tocopherol biosynthesis in plants occurs through two precursor pathways. Phytyl-diphosphate synthesized via the mevalonate pathway and homogentisate synthesized via the shikimate pathway are condensed to form MPBQ (2-methyl-6-phytyl-1,4-benzoquinol). Subsequently, MPBQ is methylated by MPBQMT to be converted into DMPBQ (2,3-dimethyl-6-phytyl-1,4-benzoquinol), which is cyclized by tocopherol cyclase to form δ-tocopherol, and finally converted into α-tocopherol by γ-tocopherol methyltransferase.
[0040] In the present invention, "MPBQMT" refers to an enzyme that catalyzes the reaction of methylating MPBQ to DMPBQ in the tocopherol biosynthesis pathway. This enzyme is also named VTE3 (Vitamin E3) and transfers a methyl group to the carbon at the 3rd position of MPBQ using S-adenosylmethionine (SAM) as a methyl donor. MPBQMT acts in the early stages of tocopherol biosynthesis, and the activity of this enzyme has a direct effect on the final tocopherol content.
[0041] The gene encoding MPBQMT of the present invention may be derived from tomato (Solanum lycopersicum), preferably from Solanum lycopersicum cv. Micro-Tom. The gene may include, for example, a nucleotide sequence represented by SEQ ID NO. 1 or code for an amino acid sequence represented by SEQ ID NO. 2.
[0042] SEQ ID NO. 1 is a coding sequence (CDS) of the tomato MPBQMT gene having an open reading frame (ORF) of 1,020 bp and encoding a protein (SEQ ID NO. 2) composed of 339 amino acids as shown in FIG. 2. The gene of the present invention includes variants that are substantially identical to SEQ ID NO. 1 or have high homology thereto. Specifically, it includes variants that exhibit MPBQMT enzyme activity while having sequence identity of 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 98% or more with SEQ ID NO. 1. Additionally, it includes a gene encoding an amino acid sequence that has sequence identity of 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or 98% or more with SEQ ID NO. 2. Here, “substantially identical” means that compared to SEQ ID NO. 1 or SEQ ID NO. 2, one or more nucleotides or amino acids are different by deletion, insertion, non-conservative or conservative substitution, or a combination thereof, but the enzymatic activity of methylating MPBQ to DMPBQ is maintained.
[0043] The transgenic tomato plant of the present invention can be produced through a recombinant vector in which the MPBQMT gene is operably linked under the control of an appropriate promoter. The promoter may be a constitutive promoter or a fruit-specific promoter.
[0044] Constitutive promoters are promoters that induce sustained gene expression in all plant tissues; examples include the CaMV 35S promoter (Cauliflower Mosaic Virus 35S promoter), nopaline synthase (NOS) promoter, ubiquitin promoter, and actin promoter. Among these, the CaMV 35S promoter is known to exhibit potent expression levels in dicotyledonous plants and can induce the expression of introduced genes in all tissues, including leaves, stems, roots, and fruits. The nopaline synthase promoter provides stable expression, although weaker than the CaMV 35S promoter. Ubiquitin and actin promoters exhibit high expression levels in both monocots and dicotyledonous plants.
[0045] Fruit-specific promoters are promoters that induce gene expression only in specific tissues or organs, and can specifically increase the expression of the MPBQMT gene in fruit. Examples of fruit-specific promoters include the E8 promoter, polygalacturonase (PG-2A) promoter, acid beta-fructofuranosidase promoter, acyltransferase 2 promoter, histidine decarboxylase promoter, and lipoxygenase promoter. The E8 promoter exhibits particularly high expression during the ripening process of tomato fruit, and the polygalacturonase promoter is activated during fruit ripening. Using a fruit-specific promoter can suppress unnecessary expression in other tissues and efficiently increase α-tocopherol content only in the target tissue, the fruit.
[0046] As shown in FIG. 3, the recombinant vector of the present invention can be constructed based on the plant expression vector pBI121. The pBI121 vector is a binary vector widely used for Agrobacterium-mediated plant transformation and contains a CaMV 35S promoter and a NOS terminator within a T-DNA region. The recombinant vector pBI121-35S::MPBQMT of the present invention has a structure in which the coding sequence of the MPBQMT gene is operably linked downstream of the CaMV 35S promoter and upstream of the NOS terminator. The MPBQMT gene can be inserted into the vector at its 5' end through the BamHI restriction enzyme site and at its 3' end through the SalI and SacI restriction enzyme sites.
[0047] In addition, the recombinant vector of the present invention may include a selection marker gene. The selection marker is used to select transformed cells, and may include the neomycin phosphotransferase II (NPT II) gene, the hygromycin phosphotransferase (HPT) gene, the phosphinothricin acetyltransferase (PAT) gene, etc. Preferably, the NPT II gene, which confers kanamycin resistance, may be used. The recombinant vector of the present invention may be a binary vector capable of replication in both Escherichia coli and Agrobacterium. To this end, it may include both an origin of replication for Escherichia coli and an origin of replication for Agrobacterium.
[0048] The transgenic tomato plant of the present invention can be produced by a method comprising the steps of: transforming a tomato plant cell or tissue with a recombinant vector containing a gene encoding MPBQMT; and redifferentiating the transformed plant cell or tissue to obtain a plant.
[0049] The transformation of the present invention can be performed using Agrobacterium-mediated transformation, a gene gun method, electroporation, liposome-mediated delivery methods, etc.
[0050] Agrobacterium-mediated transformation is the most widely used method in plant transformation, which involves stably introducing T-DNA into the plant genome using the Ti plasmid of Agrobacterium tumefaciens. Recombinant vectors can be introduced into strains such as Agrobacterium LBA4404, GV3101, EHA105, and C58, and then co-cultured with tomato plant tissues to allow T-DNA to be inserted into the plant genome. Agrobacterium-mediated transformation allows for the insertion of single or small number of T-DNA copies and has the advantage that the inserted gene is stably inherited.
[0051] The gene gun method is a method of delivering DNA into cells by coating DNA onto gold or tungsten microparticles and firing them directly into plant tissues under high pressure. This method has the advantage of being applicable to various plant species without being limited by the host range of Agrobacterium, but there is a possibility of multiple duplication insertion.
[0052] Electroporation is a method that applies a high-voltage pulse for a short period to create temporary holes in the cell membrane, allowing DNA to enter the cell. It is primarily performed on protoplasts, and transformation is carried out with the plant cell wall removed.
[0053] Liposome-based delivery methods utilize the principle in which liposomes composed of cationic lipids form a complex with DNA to pass through the cell membrane. They can be applied to protoplast or suspension cell cultures.
[0054] In a preferred embodiment of the present invention, Agrobacterium-mediated transformation is used. As shown in FIG. 4, the plant tissue used for transformation may be a cotyledon, leaf explant, stem explant, hypocotyl, etc., and preferably, a cotyledon explant may be used. Tomato seeds are germinated to obtain cotyledons at 7-10 days of age, and these are cut into an appropriate size (e.g., 5 mm x 5 mm) for use in transformation.
[0055] Agrobacterium containing the recombinant vector is cultured in YEP medium (yeast extract 10 g / L, peptone 10 g / L, NaCl 5 g / L) or LB medium (tryptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L), and selective culture is performed by adding an appropriate antibiotic (e.g., rifampicin 50 mg / L, kanamycin 50 mg / L). The cultures are proliferated until an OD600 value of 0.6-1.0 is reached. The cultured Agrobacterium is recovered by centrifugation and resuspended in a co-culture medium or a liquid medium containing MS salts. The virulence gene of the Ti plasmid can be activated by adding acetosyringone at a concentration of 100-200 μM. After immersing or inoculating tomato slices in an Agrobacterium suspension, place them on a co-culture medium (MS salts 2.2 g / L, sucrose 15 g / L, plant agar 8 g / L) and co-culture them for 2-3 days under dark conditions at 22-25℃.
[0056] After co-culture, the plant tissue is washed with sterile water to remove excess Agrobacterium and transferred to a selection medium. The selection medium contains an antibiotic corresponding to the selection marker (e.g., kanamycin 50-100 mg / L) and an antibiotic that inhibits the growth of Agrobacterium (e.g., cefotaxime 250-500 mg / L or carbenicillin 250-500 mg / L). To induce shoot regeneration, cytokinins (e.g., zeatin 1-3 mg / L, BAP 1-3 mg / L) and small amounts of auxins (e.g., IAA 0.05-0.2 mg / L, NAA 0.05-0.2 mg / L) are added to the selection medium. Shoots are redifferentiated from calluses exhibiting antibiotic resistance, and these are subcultured at intervals of 2-4 weeks in fresh selection medium (MS salt including MS vitamin 4.4 g / L, Sucrose 30 g / L, Plant agar 8 g / L, IAA 0.1 mg / L, Zeatin 2 mg / L, kanamycin 50 mg / L, Cefotaxime 250-350 mg / L, pH 6.0).
[0057] When the redifferentiated shoots grow to a size of 1-2 cm, they are excised and transferred to a root induction medium. The root induction medium contains MS salts, sucrose, and auxin (e.g., IBA 1-3 mg / L, NAA 1-3 mg / L), and kanamycin and cefotaxime are added to maintain selection (MS salt including MS vitamin 4.4 g / L, sucrose 15 g / L, plant agar 8 g / L, IBA 2 mg / L, kanamycin 50 mg / L, cefotaxime 250-350 mg / L, pH 6.0). Transgenic plants with sufficiently formed roots are transplanted into sterilized potting soil or artificial soil and acclimatized for 1-2 weeks under high humidity conditions (relative humidity 80-90%). Afterwards, gradually lower the humidity and increase the light intensity to adapt to general cultivation conditions (temperature 22-24℃, 16-hour light-to-8-hour dark cycle).
[0058] Genomic DNA of the transgenic plant is extracted, and the introduction of the MPBQMT gene is confirmed through PCR analysis. As shown in Figure 4B, successful introduction of T-DNA can be confirmed if an amplification product of approximately 1,020 bp is detected in PCR analysis using MPBQMT gene-specific primers. In addition, the copy number, expression level, and protein expression of the introduced gene can be confirmed through Southern blot analysis, quantitative real-time PCR (qRT-PCR) analysis, and Western blot analysis.
[0059] As shown in Fig. 5, the transgenic tomato plants of the present invention show significantly increased expression of the MPBQMT gene compared to the wild type. Quantitative real-time PCR analysis results show that both leaves and fruits in independent transgenic lines exhibit MPBQMT transcript levels tens of times higher than the wild type. Overexpression of the MPBQMT gene activates the tocopherol biosynthetic pathway, ultimately increasing the α-tocopherol content.
[0060] As shown in Figures 6, 7, and 8, the fruits of the transgenic tomatoes maintain a shape similar to the wild type, while the content of vitamin E, particularly α-tocopherol, is significantly increased. As a result of measuring the total vitamin E content using a colorimetric assay, the transgenic lines show a vitamin E content approximately 1.8 to 2.2 times higher than that of the wild type. More specifically, as a result of quantitative analysis of α-tocopherol using HPLC, the transgenic lines show a significantly higher α-tocopherol content compared to the wild type (approx. 133 μg / g). The superior transgenic lines contain 450 μg / g of α-tocopherol, showing an increase of approximately 238% (approx. 3.4 times) compared to the wild type. According to a preferred embodiment of the present invention, the transgenic tomato plant may have an α-tocopherol content in the fruit increased by 20% or more, 30% or more, 50% or more, 100% or more, 150% or more, or 200% or more compared to the wild type. More preferably, it may have an increase of 2 times or more, 2.5 times or more, 3 times or more, or 3.5 times or more compared to the wild type.
[0061] As shown in FIGS. 9 and 10, the insertion site of T-DNA in the transgenic tomato plant of the present invention can be identified through the genome walking technique. Genome walking is a method for determining the sequence of an unknown genomic region and is performed by combining primers specific to the T-DNA boundary sequence with degenerate primers. In one embodiment of the present invention, it was confirmed that T-DNA is inserted in the region of 6,564,001 to 6,565,200 bp on chromosome 4 of the tomato genome. This was verified through comparative analysis with the tomato genome database (Sol Genomics Network, SL3.0 build). This region is an intergenic region without predicted genes, suggesting that the T-DNA insertion does not interfere with the function of endogenous genes.
[0062] As shown in Fig. 11, for the genotyping of transgenic lines, a left primer (LP) complementary to the left region of the genomic DNA insertion site, a right primer (RP) complementary to the right region, and a right boundary primer (RBP) complementary to the right boundary region of the T-DNA can be designed. The combination of LP and RP amplifies the wild-type allele (approx. 550 bp), and the combination of LP and RBP amplifies the T-DNA insertion allele (approx. 269 bp). Wild-type plants show a band only in the LP + RP combination, heterozygous transgenic plants show a band in both combinations, and homozygous transgenic plants show a band only in the LP + RBP combination. Through this genotyping analysis, single-copy T-DNA insertion can be confirmed, and homozygous lines can be selected.
[0063] As shown in Fig. 12, homozygous transgenic lines can be selected from the T2 generation or later. Homozygous plants do not have wild-type alleles and T-DNA is present in all cells. Since homozygous lines do not undergo segregation during self-pollination and all progeny exhibit the transgenic trait, they are genetically stable and suitable for commercial use. The homozygous transgenic tomato of the present invention exhibits normal growth and morphology, confirming that the overexpression of the MPBQMT gene does not have a negative effect on the growth, development, or reproductive capacity of the tomato.
[0064] The present invention also includes seeds of the transgenic tomato plant. The seeds of the present invention are obtained from a transgenic tomato plant and contain the MPBQMT gene; the plant grown after germination exhibits a trait in which the α-tocopherol content in the fruit is increased compared to the wild type. The seeds of the present invention may be obtained from a heterozygous or homozygous transgenic plant, and preferably from a homozygous plant. Since all individuals of the seeds from a homozygous plant exhibit the transgenic trait after germination, the seeds are advantageous for producing high-vitamin E tomatoes of uniform quality. The seeds of the present invention can be stored using conventional seed storage methods and can be stored for a long period in a dry state at 4°C or -20°C. The seeds can be cultivated using conventional sowing methods, and high-vitamin E tomato fruits can be produced through the processes of seedling cultivation, transplanting, cultivation, and harvesting after germination.
[0065] The present invention also includes a vitamin E-fortified food composition containing the fruit of the genetically modified tomato plant. The food composition of the present invention may be prepared by using the genetically modified tomato fruit as is or by processing it. The processed form of the fruit may be various forms, such as fresh fruit, juice, puree, paste, sauce, ketchup, powder, concentrate, or dried product. The food composition of the present invention includes tomato fruit or a processed product thereof as an active ingredient and may additionally include food-grade acceptable additives as needed. Examples of additives include sweeteners, acidifiers, flavorings, colorings, preservatives, thickeners, emulsifiers, etc.
[0066] The food composition of the present invention may be provided in the form of general food, health functional food, food additive, or special nutritional food. The type of food is not particularly limited and may be mixed, for example, into beverages, dairy products, confectionery, bakery products, snacks, seasonings, nutritional supplements, etc. Since the food composition of the present invention has a significantly higher α-tocopherol content compared to wild-type tomatoes, it can be utilized as an excellent source of Vitamin E. As a powerful antioxidant, Vitamin E exhibits various health-promoting effects, such as eliminating free radicals, preventing lipid peroxidation of cell membranes, enhancing immune function, and preventing cardiovascular diseases.
[0067] Generally, the recommended daily intake of vitamin E for adults is about 15 mg of α-tocopherol equivalent. Since the genetically modified tomato of the present invention can contain about 45 mg of α-tocopherol per 100 g of fruit, sufficient vitamin E can be supplied with only a small amount of intake. In addition, the food composition of the present invention, in addition to its efficacy as a vitamin E-fortified food, can exhibit comprehensive health-promoting effects by providing the unique nutritional components of tomatoes, such as lycopene, β-carotene, vitamin C, and dietary fiber.
[0068]
[0069] The present invention will be explained in more detail with reference to the following examples.
[0070]
[0071] Materials and Methods
[0072] 1. Plant materials and culture conditions
[0073] In the present invention, the tomato variety 'Micro-Tom' (Solanum lycopersicum cv. Micro-Tom) was used as the material. Seeds were sown in a solid medium composed of 4.4 g / L MS salts, 30 g / L sucrose, and 8 g / L plant agar, and germination and growth were induced under culture conditions set at a temperature of 22-24℃ and a light (16 h) to dark (8 h) cycle.
[0074] 2. Analysis of MPBQMT gene expression patterns
[0075] To confirm the expression pattern of the tomato MPBQMT gene, leaves and fruits from wild-type and overexpressing transformants were collected, rapidly frozen with liquid nitrogen, and ground. Leaf and ripe fruit samples obtained from transformants were used for analysis. Subsequently, APure TM Total RNA was extracted using the Plant RNA Kit (AP BIOTECH, Korea). cDNA was synthesized from 200 ng of RNA using the SuperScript II Reverse Transcriptase cDNA Synthesis Kit (INVITROGEN, USA), and then Realtime PCR analysis was performed.
[0076] For real-time PCR analysis, 4 μL of 1 / 10 diluted cDNA, 3 μL of sterile distilled water, 2 μL of forward primer, 2 μL of reverse primer, and 10 μL of SYBR Green (Qiagen, Germany) were added, and 30 cycles were performed at 95°C for 15 minutes, followed by 95°C for 20 seconds, 55°C for 30 seconds, and 72°C for 30 seconds, and a fluorescence signal was detected at each cycle. The primers used for gene expression analysis were VTE3 RT_F (5'-TTGAATACTGGCCGGACCC-3', SEQ No. 3) and VTE3 RT_R (5'-GTGAATCCCCTGGTGTAGAC-3', SEQ No. 4).
[0077] 3. Creation of recombination vectors
[0078] To construct a transgenic plant overexpressing the tomato MPBQMT gene, RNA was first extracted from tomato leaves and fruits, and cDNA was synthesized. Subsequently, the SlMPBQMT gene was amplified via PCR and cloned, and finally, the gene was inserted into the plant binary vector pBI121-Km.
[0079] Gene amplification was performed by extracting RNA from wild-type tomato leaves and fruits, synthesizing cDNA, and then performing PCR. Restriction enzyme sequences, specifically BamHI for the forward primer and SalI + SacI for the reverse primer, were added to the PCR primers for use, followed by enzyme treatment and ligation for cloning. Amplification was performed under 35 cycles consisting of 95°C for 5 minutes, 95°C for 30 seconds, 57°C for 30 seconds, and 72°C for 20 seconds, followed by stabilization at 72°C for 5 minutes. The PCR products were then loaded onto an agarose gel to verify the results.
[0080] The confirmed band was eluted to 20 μL using a PCR purification kit (NANOHELIX, Korea) to prepare the insert product. For pBI121, 5 μL of E. coli stock was inoculated into LB liquid medium (LB broth High Salt 25 g / L) containing 50 mg / L kanamycin and incubated at 37°C for one day, after which FavorPrep TM Plasmids were extracted using the Plasmid Extraction Kit (FAVORGEN, Taiwan).
[0081] The extracted plasmid and PCR-amplified DNA were cleaved by treating with BamHI and SacI, respectively, and reacting at 37°C for one hour. The recombinant vector pBI121-MPBQMT was constructed by ligation using 4 μL of restriction enzyme-cleaved pBI121 vector, 4 μL of insert, 1 μL of T4 ligase (TAKARA), 10X buffer (TAKARA), and 2 μL of sterile distilled water, followed by incubation at 16°C for one hour and on ice for 10 minutes. The constructed recombinant vector was inserted into Agrobacterium tumefaciens LBA4404. The presence of the gene was confirmed through PCR and DNA sequencing.
[0082] The primers used for insert synthesis and PCR analysis are listed in Table 1.
[0083] PrimerNucleic Sequence (5' → 3')Sequence numberGenome walking primersGSP1_R primerCGTTGCGGTTCTGTCAGTTCC9GSPII_R primerTAAAACGGCTTGTCCCGCGTCATCGG10API_F primerGTAATACGACTCACTATAGGC11APII_R primerACTATAGGGCACGCGTGGT12LP_F primerGCATGATAATCTCTCATCCTCTTC7T-DNA insertion site identification primersRBP_R primerCGTTGCGGTTCTGTCAGTTCC9RP_R primerGAAGGCCAACAGATAAAAGAGATATG8SlMPBQMT gene isolation primersMPBQMT(VTE3) Fwd (BamHI)TGGATCCATGGCAAATTCAATATTCATCT5MPBQMT(VTE3) Rvs (SalI+SacI)TGAGCTCGTCGACTCACAGAGGTTCGCCTTCA6Real-Time PCR primersVTE3 RT_FTTGAATACTGGCCGGACCC3VTE3 RT_RGTGAATCCCCTGGTGTAGAC4
[0084] 4. Tomato Transformation
[0085] Agrobacterium tumefaciens (A. tumefaciens) LBA4404 containing a recombinant vector was cultured for one day in YEP liquid medium (yeast extract 10 g / L, peptone 10 g / L, NaCl 5 g / L, pH 7.2) containing 50 mg / L rifampicin and 50 mg / L kanamycin. 5 mL of YEP liquid medium containing 50 mg / L rifampicin and 50 mg / L kanamycin was added to 0.5 mL of the cultured bacterial suspension, cultured until the O.D600 value reached 0.8, and the strain was collected by centrifugation.
[0086] Afterward, 10 mM MgCl2 was added to the medium in which the strain was subcultured at a 1:1 ratio and resuspended, and the OD600 was adjusted to 1.0 by adding MgCl2. After adding 200 μM acetosyringone and 10 mM MES, the culture was incubated in the dark at room temperature for 4 hours.
[0087] Afterward, tomato cotyledons were infected with the fungus and placed on a co-culture medium. The composition of the co-culture medium was as follows. After being placed on a solid medium composed of 2.2 g / L MS salt, 15 g / L sucrose, and 8 g / L plant agar, the plants were subcultured at 2-week intervals on Shoot Regeneration medium (MS salt including MS vitamin 4.4 g / L, Sucrose 30 g / L, Plant agar 0.8%, IAA 0.1 mg / L, Zeatin 2 mg / L, kanamycin 50 mg / L, Cefotaxime 250-350 mg / L, pH 6.0).
[0088] Afterward, when new shoots were produced, they were transferred to a root induction medium (MS salt including MS vitamin 4.4 g / L, Sucrose 15 g / L, Plant agar 0.8%, IBA 2 mg / L, kanamycin 50 mg / L, Cefotaxime 250-350 mg / L, pH 6.0). Transformed plants with roots formed were transplanted into potting soil and cultivated after undergoing an acclimatization process.
[0089] 5. Measurement of Vitamin E content
[0090] Vitamin E content in the fruit was measured using the Vitamin E (VE) Colorimetric Assay Kit from Elabscience. Leaves and orange stage fruits were harvested from wild-type and overexpression transgenic plants for the experiment. 50 mg of fruit tissue was washed with PBS solution, placed in a tube with 400 μL of sterile distilled water, and homogenized using a homogenizer. The samples were then centrifuged at 12,000 rpm for 5 minutes at 4°C, and the supernatant was collected. The Vitamin E content of each sample was measured at OD533 using a spectrophotometer (microplate reader) according to the manufacturer's analytical method.
[0091] 6. Quantitative Analysis of α-Tocopherol
[0092] Red stage fruits from each overexpression transgenic line were harvested and used in the experiment. The sample preparation and extraction procedures were as follows. For sample preparation, 5 g of tomato fruit was freeze-dried and powdered. Using n-Hexane:Acetone:Et-OH (2:1:1) as the extraction solvent, ultrasonic extraction was performed at room temperature (30–60 minutes), followed by centrifugation (10,000 rpm, 10 minutes) to recover the supernatant. The solution was concentrated using a rotary evaporator and filtered through a 0.45 μm PTFE filter.
[0093] The standard substance α-Tocopherol was used at a concentration of 430.7 g / mol, and 10 mg was dissolved in 10 mL of organic solvent (n-Hexane) to prepare a 1000 μg / mL stock solution, placed in a brown vial, and stored in a -20℃ freezer for use.
[0094] For HPLC analysis, a C18 column (250 x 4.6 mm, 5 μm) was used, and methanol was used as the mobile phase. The flow rate was set to 1.0 mL / min, and the injection volume was 10-20 μL. Detection was performed at 292 nm, the absorption wavelength of tocopherol, and the column temperature was maintained within the range of 25-30℃.
[0095] 7. Identification of T-DNA insertion sites
[0096] T-DNA insertion sites were identified using the genome walking technique. The primers used are shown in Table 1.
[0097] Primary PCR and secondary nested PCR were performed to amplify adjacent T-DNA genomic sequences, and the nucleotide sequences were analyzed. The results of the nucleotide sequence analysis were compared with the tomato genome database (Sol Genomics Network, SL3.0 build) and BLAST analysis were performed to identify the insertion sites.
[0098] 8. Genotype analysis of transgenic lines
[0099] Primers for genotyping analysis were designed based on the results of identifying the T-DNA insertion site. The primers used are shown in Table 1. The combination of LP and RP amplifies the wild-type allele (550 bp), and the combination of LP and RBP amplifies the T-DNA insertion allele (269 bp).
[0100]
[0101] result
[0102] 1. MPBQMT Gene Structure and Recombinant Vector Construction
[0103] As shown in Figure 2, the coding sequence (CDS) of the tomato MPBQMT gene has an open reading frame (ORF) of 1,020 bp and codes for a protein composed of 339 amino acids.
[0104] As shown in Fig. 3, a gene fragment of approximately 1,020 bp MPBQMT was obtained through PCR amplification (Fig. 3A), and the recombinant vector pBI121-35S::MPBQMT was constructed by cloning it between the CaMV 35S promoter and NOS terminator of the pBI121 vector using BamHI and SalI / SacI restriction enzyme sites (Fig. 3B).
[0105] 2. Generation of transgenic tomato plants and molecular verification
[0106] As shown in Fig. 4A, tomato cotyledon explants were transformed using Agrobacterium tumefaciens containing a recombinant vector. Shoots were redifferentiated from resistant calluses in kanamycin selection medium, and complete transformed plants were obtained through root induction.
[0107] As shown in Figure 4B, PCR analysis was performed using the genomic DNA of independent transgenic lines (OE1-OE9) as a template, and the MPBQMT gene-specific band of approximately 1,020 bp was amplified in all lines, confirming the successful introduction of T-DNA.
[0108] 3. MPBQMT Gene Expression Analysis
[0109] As shown in Figure 5, quantitative real-time PCR analysis revealed that the expression of the MPBQMT gene in the transgenic lines was significantly increased compared to the wild type. In leaf tissue, the OE3 line showed an increase in expression of more than 150-fold, while in fruit tissue, the OE5 line showed an increase in expression of more than 50-fold. Significant increases in expression were observed in both leaves and fruits in most transgenic lines.
[0110] 4. Analysis of Vitamin E and α-tocopherol Content
[0111] As shown in Fig. 6A, the fruits of the transgenic tomatoes (OE1, OE4, OE5, OE8) exhibited a shape similar to the wild type. As shown in Fig. 6B, the results of measuring total vitamin E content using a colorimetric method showed that the transgenic lines had a vitamin E content (approx. 2.5-3.2 μg / g) that was approximately 1.8 to 2.2 times higher than that of the wild type (approx. 1.4 μg / g).
[0112] As shown in Figure 7, the results of the α-tocopherol quantitative analysis via HPLC showed that the transgenic line exhibited an α-tocopherol peak at a retention time of 10.497 minutes. While the wild type showed a peak area of 96,696 and an α-tocopherol content of 133 μg / g, the transgenic line showed significantly higher values. In particular, the OE5 line showed a peak area of 214,453 and an α-tocopherol content of 450 μg / g, representing an increase of approximately 3.4 times compared to the wild type.
[0113] As shown in Figure 8, the α-tocopherol content and growth rate relative to the wild type of each transgenic line were summarized, and the OE5 line showed a growth rate of approximately 238%, the OE1 line about 36%, the OE8 line about 44%, and the OE4 line about 24%.
[0114] 5. Identification of T-DNA insertion site and genotyping analysis
[0115] As shown in Fig. 9, the T-DNA insertion site of the transgenic line VTE3-8 was identified using a genome walking technique. As a result of performing primary PCR and secondary nested PCR, a specific product of approximately 250 bp was amplified (Fig. 9A), and sequencing confirmed that the tomato genomic DNA and the right boundary (RB) region of the T-DNA were connected (Fig. 9B).
[0116] As shown in Figure 10, through comparative analysis with the tomato genome database (SL3.0 build), it was confirmed that T-DNA is inserted in the 6,564,001-6,565,200 bp region of chromosome 4 (chr04).
[0117] As shown in Figure 11, primers specific to the lateral genomic region of the insertion site and T-DNA were designed and genotyped. The wild type showed only the 550 bp band in the LP+RP combination, while the heterozygous transformant showed both the 550 bp and 269 bp bands, confirming the insertion of a single copy of T-DNA.
[0118] As shown in Fig. 12, homozygous lines (VTE3-8 T2-9, VTE3-8 T2-12) were selected in the T2 generation. Homozygous plants exhibited a 269 bp band only in the LP+RBP combination (Fig. 12A) and showed normal growth and morphology (Fig. 12B).
Claims
1. Transgenic tomato plants in which a gene encoding methyl-phytylbenzoquinol methyltransferase (MPBQMT) has been introduced, resulting in increased alpha-tocopherol (α-tocopherol) content in the fruit compared to wild-type tomatoes.
2. A transgenic tomato plant according to claim 1, wherein the gene codes for the amino acid sequence of SEQ ID NO.
2.
3. A transgenic tomato plant according to claim 1, wherein the gene is operably linked under the control of a constitutive promoter or a fruit-specific promoter.
4. A transgenic tomato plant according to claim 3, wherein the constitutive promoter is any one selected from the group consisting of a CaMV 35S promoter (Cauliflower Mosaic Virus 35S promoter), a nophalin synthase (NOS) promoter, a ubiquitin promoter, and an actin promoter, and the fruit-specific promoter is any one selected from the group consisting of an E8 promoter, a polygalacturonase (PG-2A) promoter, an acid beta-fructofuranosidase promoter, an acyltransferase 2 promoter, a histidine decarboxylase promoter, and a lipoxygenase promoter.
5. A transgenic tomato plant according to claim 1, wherein the gene is inserted into chromosome 4 of the tomato genome.
6. Seeds of the transgenic tomato plant of Claim 1.
7. A method for producing a tomato plant with increased alpha-tocopherol content, comprising: (a) transforming a tomato plant cell or tissue with a recombinant vector containing a gene encoding methyl-phytylbenzoquinol methyltransferase (MPBQMT); and (b) redifferentiating the transformed plant cell or tissue to obtain a plant.
8. A method for producing a tomato plant with increased alpha-tocopherol content according to claim 7, wherein the transformation is performed using any one selected from the group consisting of Agrobacterium-mediated transformation, a gene gun method, electroporation, and liposome-mediated delivery method.
9. A vitamin E-fortified food composition containing the fruit of the genetically modified tomato plant of Claim 1.