Chemogenetic gene therapy method for treating autism spectrum disorder disease
Patent Information
- Application Number
- PCT/CN2026/091169
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2025-02-19
- Filing Date
- 2026-04-16
- Publication Date
- 2026-08-27
Smart Images

Figure PCTCN2026091169-FTAPPB-I100001 
Figure PCTCN2026091169-FTAPPB-I100002 
Figure 00000021_0000
Abstract
Description
Chemogenetic gene therapy for the treatment of autism spectrum disorder Technical Field
[0001] This application relates to the field of biomedicine, and in particular to a chemical genetic therapy for treating autism spectrum disorder. Background Technology
[0002] 1. Autism spectrum disorder and its aggressive behavior symptoms
[0003] Autism Spectrum Disorder (ASD) is a neurodevelopmental disorder characterized by social impairments, repetitive and stereotyped behaviors, and intellectual developmental abnormalities or imbalances. Most individuals with ASD experience intellectual disability, which significantly impacts their social functioning and quality of life. ASD typically begins in infancy or early childhood, with symptoms usually appearing before school age. It involves impairments in attention, memory, perception, language, problem-solving, and social interaction, leading to long-term effects on an individual's social, academic, and career development. Epidemiological data indicates that the prevalence of ASD in 8-year-old children is approximately 2.7%.
[0004] Although the etiology of most cases of ASD remains unclear, research suggests that its occurrence is related to multiple factors. Some cases can be associated with specific congenital conditions, such as congenital rubella syndrome, giant cell inclusion body disease, phenylketonuria, tuberous sclerosis, fragile X syndrome, and preterm birth. Furthermore, genetic factors are believed to play a significant role: if there is a family history of ASD and one child already has the condition, the risk of subsequent offspring developing the disease can increase to approximately 5% to 10%. At the pathophysiological level, ASD may be related to abnormalities in brain structure and function, with changes in brain regions such as the cerebellum, amygdala, hippocampus, frontal cortex, and brainstem receiving considerable attention.
[0005] It is important to clarify that aggressive behavior is not a core diagnostic symptom of ASD, but because patients generally experience communication and comprehension difficulties, they may exhibit such behavior in specific situations. The mechanisms underlying this behavior are complex, primarily including the following: communication barriers make it difficult for patients to effectively express their needs and emotions, and accumulated frustration may be released through aggressive behavior; sensory overload makes them hypersensitive to stimuli such as sound and light, easily triggering anxiety and agitation, which in turn induces aggression; difficulties in emotion regulation make it difficult for patients to smoothly manage emotional fluctuations, sometimes leading to catharsis through aggression towards others or self-harm. Furthermore, fear of social situations, aversion to specific sensory stimuli, and underlying physical discomfort (such as headaches, toothaches, or other ailments causing emotional instability) may also be triggers. Simultaneously, individuals with high-functioning ASD or Asperger's syndrome may also exhibit aggressive behavior when facing stress. If other mental disorders (such as obsessive-compulsive disorder) are present, the difficulty of behavioral management is further increased, as their reduced tolerance to disturbances may exacerbate behavioral conflicts.
[0006] 2. Current treatment methods for ASD
[0007] Currently, clinical treatment of ASD adopts a multidimensional and comprehensive intervention model. Its core objectives are to improve core symptoms, enhance adaptive functioning and quality of life, and actively manage comorbidities. While there is no cure in this field, a systematic approach has been developed based on research and practice in 2025-2026. Behavioral and psychosocial interventions are the cornerstone of evidence-based treatment. These include applying behavioral analysis and its derivative models (such as the Early Denver Model for infants and young children) to shape adaptive behavior through reinforcement and decomposition techniques; structured teaching utilizing visual and environmental support to enhance independence; and social skills training, cognitive behavioral therapy, and developmental models (such as Floor Time) focusing on directly teaching social skills, addressing comorbid emotional issues, and building emotional connections through interaction, respectively. Pharmacological treatment is primarily used as an adjunct to control comorbid symptoms that severely impair functioning. For example, FDA-approved atypical antipsychotics (risperidone, aripiprazole) are used to treat irritability and aggressive behavior, while other medications are used to manage comorbidities such as attention deficit, anxiety, or epilepsy. In addition, related therapies such as speech-language therapy, occupational therapy, and sensory integration therapy work together to improve patients' communication, self-care, and sensory regulation abilities.
[0008] 3. Chemogenetic gene therapy
[0009] Chemogenetics, also known as pharmacogenetics, is an interdisciplinary technique that integrates genetics and pharmacology. Its core lies in the engineering of specific biomolecules (such as receptors and enzymes) to selectively recognize and respond to specific small-molecule drugs, thereby achieving high spatiotemporal precision regulation of cellular or neuronal function. Due to its precise, reversible, and controllable characteristics, this technology is widely used in neuroscience, pharmacology, and disease treatment research. One of the most commonly used chemogenetic techniques is DREADDs (designed receptors specifically activated by designed drugs) based on G protein-coupled receptors. Modified DREADD receptors can be specifically activated by their corresponding small-molecule agonists, thereby precisely regulating the activity of specific neuronal populations and enabling timed and localized interventions in the function of the brain or other organs.
[0010] The receptors used in DREADDs technology are derived from modifications of human muscarinic acetylcholine receptors. Muscarinic receptors belong to the G protein-coupled receptor family. In their natural state, they bind to acetylcholine, triggering a conformational change that activates downstream G protein signaling pathways and regulates neuronal activity. After chemogenetic modification, these receptors lose their responsiveness to the natural ligand acetylcholine and instead bind specifically to artificially designed small-molecule agonists (such as CNO or DCZ), thereby achieving precise activation or inhibition of neuronal activity. Commonly used Gq-DREADD and Gi-DREADD can achieve non-invasive and cell-type-specific neuronal regulation in this way. Gi-DREADD (usually referring to hM4Di) is an engineered inhibitory receptor obtained by modifying the M4 subtype of the human muscarinic acetylcholine receptor. After the natural hM4 receptor binds to acetylcholine, it reduces intracellular cAMP levels through the Gi protein signaling pathway, thereby inhibiting neuronal excitability. The modified hM4Di responds only to specific small molecule agonists, achieving precise and reversible inhibition of target neuronal activity.
[0011] Compared to traditional clinical interventions, chemogenetic gene therapy exhibits several significant advantages. First, its safety has been supported by numerous preclinical and clinical studies: the AAV vectors used for gene delivery demonstrate good biocompatibility and delivery efficiency; the modified receptors are derived from endogenous G protein-coupled receptors, exhibiting low immunogenicity and minimizing the likelihood of significant rejection; and the small molecule agonists used are mostly approved or well-studied compounds, demonstrating high safety at therapeutic doses. Second, this therapy is reversible: once the small molecule agonists are metabolized in the body, their activation of the receptors ceases, and neuronal function can return to baseline levels, meaning treatment can be stopped at any time. Third, it features rapid onset of action: post-operative administration allows for precise and rapid modulation of target neuronal function within minutes to hours. Finally, its dose adjustability supports personalized treatment, allowing for flexible adjustments to drug dosage based on the patient's actual response and changes in their condition, achieving individualized optimization of the treatment plan. These characteristics collectively demonstrate that chemogenetic gene therapy possesses greater potential than traditional methods in terms of precision, safety, controllability, and personalization.
[0012] In conclusion, precise intervention for core symptoms of autism spectrum disorder, such as aggressive behavior, is of significant and far-reaching strategic importance for patients, their families, society, and the healthcare system. However, existing conventional treatments generally suffer from limitations such as insufficient targeting and significant side effects. Therefore, developing a novel treatment approach that is safe, effective, and has long-term beneficial effects is of paramount importance and value for improving patient prognosis, advancing medical progress, and even reducing the overall burden on society. Summary of the Invention
[0013] To address the aforementioned technical problems, this application provides the use of hM4Di, recombinant adeno-associated virus AAV-hSyn-hM4Di, or pharmaceutical compositions thereof in the preparation of products having one or more of the following functions:
[0014] 1) Reduces the excitability of the posterior innocenced brain region in individuals with autism spectrum disorder;
[0015] 2) Reduce the number of aggressive behaviors in individuals with autism spectrum disorder;
[0016] 3) Shorten the duration of aggressive behavior in individuals with autism spectrum disorder;
[0017] 4) Prolonging the latency period of aggressive behavior in individuals with autism spectrum disorder;
[0018] 5) Prevention and / or treatment of autism spectrum disorders.
[0019] This application also provides a pharmaceutical composition comprising a first drug, the first drug comprising recombinant adeno-associated virus AAV-hSyn-hM4Di.
[0020] This application also provides a method for treating autism spectrum disorder, the method comprising administering to an individual with autism spectrum disorder a therapeutically effective amount of hM4Di, recombinant adeno-associated virus, pharmaceutical composition or product, or the pharmaceutical composition described above, as used in the above-described uses.
[0021] The beneficial effects of this application include, but are not limited to: chemical genetic inhibition of the posterior unnamed brain region can: (1) reduce the excitability of the posterior unnamed brain region in individuals with autism spectrum disorder; (2) reduce aggressive behavior in individuals with autism spectrum disorder; (3) provide immediate intervention, with effects taking effect within ten minutes via intraperitoneal injection or oral administration of CLZ or CNO; (4) enable personalized and precise treatment; (5) avoid the development of drug resistance similar to drug treatment; and (6) not affect basic life activities and emotional states such as basic social exploration behavior, prosocial behavior, stereotyped repetitive behavior, or anxiety and fear. Attached Figure Description
[0022] This application will be further described by way of exemplary embodiments, which will be described in detail with reference to the accompanying drawings. These embodiments are not limiting, wherein:
[0023] Figure 1 shows the map of the adeno-associated virus vector AAV-hSyn-hM4Di used for chemogenetic regulation. This vector mainly includes the hSyn promoter, hM4Di, mCherry, and WPRE elements. The numerical scale on the vector indicates the base positions of each element.
[0024] Figure 2 illustrates the experimental procedure and virus injection. The timeline at the top shows the key steps of the experiment: First, AAV-hSyn-hM4Di virus was injected into the pSI brain region of Neuroligin3 R451C knock-in mice; three weeks later, the mice were intraperitoneally injected with saline or clozapine; 30 minutes after injection, a 15-minute behavioral test was performed. The brain region diagram at the bottom (based on mouse brain atlases) shows the target location of the virus injection—the pSI brain region, with its anterior fontanelle coordinates at AP: -1.06 mm. The pink area represents the expected expression range of the virus.
[0025] Figure 3 is a schematic diagram of an aggressive behavior testing paradigm. The diagram shows a behavior testing box (mouse cage) used to assess social behavior between two mice.
[0026] Figure 4 validates the specific expression of the virus in the pSI region of the brain. Coronal brain tissue sections are shown by fluorescence microscopy, revealing the specific expression (red fluorescence) of AAV-hSyn-hM4Di virus in the pSI brain region. The pSI and surrounding related brain regions are marked in the figure, including the globus pallidus (GP), lateral hypothalamus (LH), central amygdala (CeA), and medial amygdala (MeA). Scale bar: 500 μm.
[0027] Figure 5 shows the effect of chemogenetic inhibition of pSI neurons on aggressive behavior. (A) Latency of attack initiation; (B) Total duration of attack; (C) Number of aggressive events. Gray represents the saline control group, pink represents the clozapine (CLZ) experimental group, and the lines connecting the groups indicate the data changes for the same animal under the two treatments.
[0028] Figure 6 shows the effect of chemogenetic inhibition of pSI neurons on snigging behavior. (A) Latency of snigging behavior initiation; (B) Total duration; (C) Number of events.
[0029] Figure 7 shows the effect of chemogenetic inhibition of pSI neurons on peer grooming behavior. (A) Latency of peer grooming behavior; (B) Total duration; (C) Number of events.
[0030] Figure 8 shows the effect of chemogenetic inhibition of pSI neurons on self-grooming behavior. (A) Latency of self-grooming behavior; (B) Total duration; (C) Number of events.
[0031] Figure 9 shows the effect of chemogenetic inhibition of pSI neurons on freeze behavior. (A) Latency of freeze behavior; (B) Total duration; (C) Number of events. Detailed Implementation
[0032] To more clearly illustrate the technical solutions of the embodiments in this specification, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the drawings described below are merely some examples or embodiments of this specification. For those skilled in the art, these drawings can be applied to other similar scenarios without creative effort. Unless obvious from the context or otherwise specified, the same reference numerals in the drawings represent the same structures or operations.
[0033] As indicated in this specification and claims, unless the context clearly indicates otherwise, the words "a," "an," "an," and / or "the" do not specifically refer to the singular and may also include the plural. Generally speaking, the terms "comprising" and "including" only indicate the inclusion of expressly identified steps and elements, which do not constitute an exclusive list, and the method or apparatus may also include other steps or elements.
[0034] Flowcharts are used in this specification to illustrate the operations performed by the system according to embodiments of this specification. It should be understood that the preceding or following operations are not necessarily performed in exact order. Instead, the steps can be processed in reverse order or simultaneously. Furthermore, other operations can be added to these processes, or one or more steps can be removed from them.
[0035] This application provides the use of hM4Di, recombinant adeno-associated virus AAV-hSyn-hM4Di, or pharmaceutical compositions thereof in the preparation of products having one or more of the following functions:
[0036] 1) Reduces the excitability of the posterior innocenced brain region in individuals with autism spectrum disorder;
[0037] 2) Reduce the number of aggressive behaviors in individuals with autism spectrum disorder;
[0038] 3) Shorten the duration of aggressive behavior in individuals with autism spectrum disorder;
[0039] 4) Prolonging the latency period of aggressive behavior in individuals with autism spectrum disorder;
[0040] 5) Prevention and / or treatment of autism spectrum disorders.
[0041] The term "prevention and / or treatment" (and its grammatical variations) refers to an attempt to alter the natural course of disease in an individual being treated, and can be a clinical intervention performed for prevention or during the course of clinicopathological processes. The desired effects of treatment include, but are not limited to, preventing the onset or recurrence of disease, relieving symptoms, reducing any direct or indirect pathological consequences of the disease, preventing metastasis, slowing the rate of disease progression, improving or alleviating the disease state, and eliminating or improving prognosis.
[0042] The term "AAV" is an abbreviation for adeno-associated virus and can be used to refer to the virus itself or its derivatives.
[0043] In some embodiments, the pharmaceutical composition may include a first drug, which may include the recombinant adeno-associated virus AAV-hSyn-hM4Di.
[0044] In some embodiments, the recombinant adeno-associated virus may contain a promoter. In some embodiments, preferably, the promoter may be selected from the neuron-specific promoter hSyn.
[0045] In some embodiments, the serotype of the recombinant adeno-associated virus may be selected from AAV1, AAV2, AAV5, AAV6, AAV8, AAV9, or AAV13.
[0046] In some embodiments, the nucleotide sequence of the hM4Di gene may be as shown in SEQ ID NO.2.
[0047] In some embodiments, the aggressive behavior may include physical aggression. In some embodiments, preferably, the physical aggression may include any one or more of chasing, punching, kicking, biting, pushing, self-harm, or suicidal behavior.
[0048] In some embodiments, the hM4Di, recombinant adeno-associated virus AAV-hSyn-hM4Di, or pharmaceutical compositions thereof have no effect on basic social exploration behavior, prosocial behavior, stereotyped repetitive behavior, or anxiety or fear-related behavior in individuals with autism spectrum disorder.
[0049] In some embodiments, the promoter may be located upstream of the hM4Di gene. In some embodiments, preferably, the nucleotide sequence of the promoter hSyn may be as shown in SEQ ID NO.1.
[0050] In some embodiments, the first drug may further include a pharmaceutically acceptable carrier or excipient.
[0051] "Pharmaceutically acceptable carriers" refer to one or more compatible solid or liquid fillers or gelling substances that are suitable for human use and must have sufficient purity and sufficiently low toxicity. "Compatibility" here means that the components in the composition can be mixed with and with the compounds of the present invention without significantly reducing the efficacy of the compounds. Examples of pharmaceutically acceptable carriers include cellulose and its derivatives (such as sodium carboxymethyl cellulose, sodium ethyl cellulose, cellulose acetate, etc.), gelatin, talc, solid lubricants (such as stearic acid, magnesium stearate), calcium sulfate, vegetable oils (such as soybean oil, sesame oil, peanut oil, olive oil, etc.), polyols (such as propylene glycol, glycerin, mannitol, sorbitol, etc.), emulsifiers (such as... Wetting agents (such as sodium dodecyl sulfate), colorants, flavoring agents, stabilizers, antioxidants, preservatives, pyrogen-free water, etc.
[0052] The excipients include various excipients and diluents, which are not essential active ingredients and do not cause excessive toxicity after application. The excipients contain sterile water or physiological saline, stabilizers, excipients, antioxidants (ascorbic acid, etc.), buffers (phosphate, citric acid, other organic acids, etc.), preservatives, surfactants (PEG, Tween, etc.), chelating agents (EDTA, etc.), or binders. The excipients also contain other low molecular weight peptides, serum albumin, glycine, glutamine, asparagine, arginine, polysaccharides, monosaccharides, mannitol, or sorbitol. When used in an aqueous solution for injection, the excipients are selected from physiological saline, isotonic glucose solution, D-sorbitol isotonic solution, D-mannose isotonic solution, D-mannitol or sugar alcohol isotonic solution. The aqueous solution for injection contains a solubilizer. The solubilizer is selected from alcohols (ethanol), polyols (propylene glycol or PEG), and / or nonionic surfactants (Tween 80 or HCO-50).
[0053] There are no particular restrictions on the administration method of the pharmaceutical composition in this application. Representative administration methods include (but are not limited to): oral administration, parenteral administration (intravenous, intramuscular, or subcutaneous).
[0054] Solid dosage forms for oral administration include capsules, tablets, pills, powders, and granules. In these solid dosage forms, the active compound is mixed with at least one conventional inert excipient (or carrier), such as sodium citrate or dicalcium phosphate, or with the following components: (a) fillers or compatibilizers, such as starch, lactose, sucrose, glucose, mannitol, and silica; (b) binders, such as hydroxymethyl cellulose, alginate, gelatin, polyvinylpyrrolidone, sucrose, and gum arabic; (c) humectants, such as glycerin; (d) disintegrants, such as agar, calcium carbonate, potato starch or cassava starch, alginate, certain complex silicates, and sodium carbonate; (e) slowing agents, such as paraffin; (f) absorption accelerators, such as quaternary ammonium compounds; (g) wetting agents, such as cetyl alcohol and glyceryl monostearate; (h) adsorbents, such as kaolin; and (i) lubricants, such as talc, calcium stearate, magnesium stearate, solid polyethylene glycol, sodium dodecyl sulfate, or mixtures thereof. Buffers may also be included in capsules, tablets, and pills.
[0055] Solid dosage forms such as tablets, sugar pills, capsules, pellets, and granules can be prepared using coatings and shells, such as casings and other materials known in the art. They may contain opacifying agents, and the release of the active compound or compound from such compositions can be delayed in a portion of the digestive tract. Examples of encapsulating components that can be used are polymeric substances and waxes. If necessary, the active compound may also be formed into microcapsules with one or more of the excipients described above.
[0056] Liquid dosage forms for oral administration include pharmaceutically acceptable emulsions, solutions, suspensions, syrups, or tinctures. In addition to the active compound, liquid dosage forms may contain inert diluents conventionally used in the art, such as water or other solvents, solubilizers and emulsifiers, e.g., ethanol, isopropanol, ethyl carbonate, ethyl acetate, propylene glycol, 1,3-butanediol, dimethylformamide, and oils, particularly cottonseed oil, peanut oil, corn germ oil, olive oil, castor oil, and sesame oil, or mixtures of these substances.
[0057] In addition to these inert diluents, the composition may also contain auxiliaries such as wetting agents, emulsifiers and suspending agents, sweeteners, flavoring agents and fragrances.
[0058] In addition to the active compound, the suspension may contain suspending agents such as ethoxylated isooctadecyl alcohol, polyoxyethylene sorbitol and dehydrated sorbitol esters, microcrystalline cellulose, aluminum methoxide and agar, or mixtures of these substances.
[0059] Compositions for parenteral injection may comprise physiologically acceptable sterile aqueous or anhydrous solutions, dispersions, suspensions, or emulsions, and sterile powders for reconstitution into sterile injectable solutions or dispersions. Suitable aqueous and non-aqueous carriers, diluents, solvents, or excipients include water, ethanol, polyols, and suitable mixtures thereof.
[0060] When using the pharmaceutical composition, a safe and effective amount of the compound of this application is applied to the mammal (such as a human) requiring treatment, wherein the dose administered is the pharmaceutically considered effective dose. Of course, the specific dose should also take into account factors such as the route of administration and the patient's health condition, which are all within the scope of the skill of a skilled physician.
[0061] In the pharmaceutical composition provided in this application, the recombinant adeno-associated virus can be a single active ingredient, or it can be combined with one or more other active ingredients that are useful for the treatment of diseases to form a combined formulation.
[0062] The content of the active ingredient in the pharmaceutical composition is a safe and effective amount, which should be adjustable by those skilled in the art. For example, the dosage of the recombinant adeno-associated virus and the active ingredient in the pharmaceutical composition depends on the patient's weight, the type of application, the condition and severity of the disease.
[0063] In some embodiments, the first drug may be an injectable drug that targets a specific brain region. Preferably, in some embodiments, the first drug may be an injectable drug that targets the posterior unintelligible medulla. More preferably, in some embodiments, the first drug may be an injectable drug that targets inhibitory neurons in the posterior unintelligible medulla. Further preferably, in some embodiments, the injection method may be bilateral posterior unintelligible medulla injection.
[0064] In some embodiments, the pharmaceutical composition may further include a second drug, which may include a chemogenetic receptor agonist.
[0065] In some embodiments, the chemogenetic receptor agonist may include any one or more of quetiapine, clozapine, clozapine-N-oxide, desclozapine, or derivatives thereof.
[0066] In some embodiments, the second drug can be administered via any one of oral, intramuscular, subcutaneous, intravenous, or implantation methods. Preferably, in some embodiments, the second drug can be an oral drug or an injectable drug administered intraperitoneally.
[0067] This application also provides a pharmaceutical composition comprising a first drug, the first drug comprising recombinant adeno-associated virus AAV-hSyn-hM4Di.
[0068] In some embodiments, the recombinant adeno-associated virus may contain a promoter, and in some embodiments, preferably, the promoter may be selected from the neuron-specific promoter hSyn.
[0069] In some embodiments, the serotype of the recombinant adeno-associated virus may be selected from AAV1, AAV2, AAV5, AAV6, AAV8, AAV9, or AAV13.
[0070] In some embodiments, the nucleotide sequence of the hM4Di gene may be as shown in SEQ ID NO.2.
[0071] In some embodiments, the promoter may be located upstream of the hM4Di gene. Preferably, in some embodiments, the nucleotide sequence of the promoter hSyn may be as shown in SEQ ID NO.1;
[0072] In some embodiments, the first drug may further include a pharmaceutically acceptable carrier or excipient;
[0073] In some embodiments, the first drug may be an injectable drug that targets a specific brain region. Preferably, in some embodiments, the first drug may be an injectable drug that targets the posterior unintelligible medulla. More preferably, in some embodiments, the first drug may be an injectable drug that targets inhibitory neurons in the posterior unintelligible medulla. Further preferably, in some embodiments, the injection method may be bilateral posterior unintelligible medulla injection.
[0074] In some embodiments, the pharmaceutical composition may further comprise a second drug, which may include a chemogenetic receptor agonist. Preferably, in some embodiments, the chemogenetic receptor agonist may include one or more of quetiapine, clozapine, clozapine-N-oxide, desclozapine, or derivatives thereof.
[0075] In some embodiments, the second drug can be administered via any one of oral, intramuscular, subcutaneous, intravenous, or implantation methods. Preferably, in some embodiments, the second drug can be an oral drug or an injectable drug administered intraperitoneally.
[0076] This application also provides a method for treating autism spectrum disorder, the method comprising administering to an individual with autism spectrum disorder a therapeutically effective amount of hM4Di, recombinant adeno-associated virus, pharmaceutical composition or product, or the pharmaceutical composition described above, as used in the above-described uses.
[0077] The term "effective amount" refers to the quantity or dose of the formulation of this application that, when administered to a patient in a single or multiple doses, produces the intended effect in the treated patient. The effective amount can be readily determined by a physician skilled in the art by considering a variety of factors, such as: the species of the mammal; its size, age, and general health; the specific disease involved; the degree or severity of the disease; the individual patient's response; the specific formulation administered; the mode of administration; the bioavailability characteristics of the administered formulation; the chosen dosing regimen; and the use of any concomitant therapies.
[0078] In some embodiments, the method may administer a first drug of the pharmaceutical composition to an individual with autism spectrum disorder. Preferably, in some embodiments, the method may use an intracranial injection device to administer the first drug of the pharmaceutical composition to the individual with autism spectrum disorder. More preferably, in some embodiments, the method may use a microinjector to administer the first drug of the pharmaceutical composition to the individual with autism spectrum disorder.
[0079] In some embodiments, the method may induce hM4Di expression in brain regions of individuals with autism spectrum disorder. Preferably, in some embodiments, the method may induce hM4Di expression in the posterior unnamed tract region of the individual with autism spectrum disorder.
[0080] In some embodiments, the method may involve injecting a second drug in the drug composition three weeks after injecting a first drug in the drug composition.
[0081] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the experimental materials used in the following examples were all purchased from conventional biochemical reagent companies. All quantitative experiments in the following examples were performed in triplicate, and the results were averaged.
[0082] In this application, the mice used in the experiments were 8-12 weeks old and weighed 20-25g. C57 mice were obtained from Beijing Vital River Laboratory Animal Technology Co., Ltd., while VGAT-Cre (Strain#016962) and VGLUT2-Cre (Strain#:028863) mice were obtained from The Jackson Laboratory. All experimental mice were housed at an ambient temperature of 22±1℃, humidity of 55±5%, and a 12-hour light / dark cycle, with free access to food and water. All experimental animals were housed in an animal facility, and environmental conditions were regularly monitored to ensure they met experimental requirements.
[0083] All animal experiments were conducted in accordance with the Zhejiang University Laboratory Animal Management Regulations and approved by the Zhejiang University Ethics Committee. During the experiments, we strictly adhered to animal welfare regulations to ensure the comfort and health of the mice throughout the experiments, minimizing their pain and stress. All experimental procedures, including anesthesia, surgery, and sampling, were performed by laboratory personnel in a standardized operating environment. All animal experiments involved in this invention were conducted in accordance with the relevant laboratory animal operation management regulations of Zhejiang University, and all experimental procedures were approved by Zhejiang University.
[0084] Stereoscopic surgery
[0085] To precisely target brain regions, this study employed a stereotactic approach for micro-injection. In the preparation phase, mice were first anesthetized with 1% sodium pentobarbital (100 mg / kg) to ensure complete painlessness. After the righting reflex completely disappeared, the surgical area was cleaned and shaved to prevent infection. Subsequently, the mouse's head was secured to an adapter, disinfected with povidone-iodine, and its sutures, anterior fontanelle, and posterior fontanelle were fully exposed. Special attention was paid to maintaining a sterile environment during this procedure to avoid any bacterial contamination.
[0086] During virus injection, the position of the anterior fontanelle was adjusted using the tip of a microsyringe to ensure injection accuracy. Similarly, when embedding the optical fiber, the position of the anterior fontanelle was adjusted using the fiber tip to ensure the height difference between the anterior and posterior fontanelles was less than 0.05 mm, thereby maximizing operational precision. The anterior fontanelle was set as the reference zero point (coordinates: 0mm anterior / posterior, 0mm lateral, 0mm depth). This standardized positioning method ensured the repeatability of the experiment and provided a precise reference for subsequent operations.
[0087] Based on this, subsequent experiments used mouse brain atlases to determine the locations of brain regions for intracranial micro-injection. During the injection process, micro-injection techniques were employed to ensure precise dosage for each injection, thus avoiding unnecessary damage to the mouse brain tissue. Furthermore, physiological parameters such as body temperature, respiration, and heart rate of the mice were regularly assessed throughout the experiment to ensure the animals' health and safety.
[0088] hSyn sequence
[0089] CTGCAGAGGGCCCTGCGTATGAGTGCAAGTGGGTTTTAGGACCAGGATGAGGCGGGGTGGGGGTGCCTACCTGACGACCGACCCCGACCCACTGGACAAGCACCCAACCCCCATTCCCCAAATTGCGCATCCCCTATCAGAGAGGGGGAGGGGAAACAGGATGCGGCGAGGCGCGTGCGCACTGCCAGCTTCAGCACCGCGGACAGTGCCTTCGCCCCCGCCTGGCGGCGCGCGCCA CCGCCGCCTCAGCACTGAAGGCGCGCTGACGTCACTCGCCGGTCCCCCGCAAACTCCCTTCCGGCCACCTTGGTCGCGTCCGCGCCGCCGCCGCCGGCCCAGCCGGACGCACCACGCGAGGCGCGAGATAGGGGGGCACGGGCGCGACCATCTGCGCTGCGGCGCCGGCGACTCAGCGCTGCCTCAGTCTGCGGTGGGCAGCGGAGGAGTCGTGTCGTGCCTGAGAGCGCAG (SEQ ID NO.1)
[0090] hM4Di sequence
[0091]
[0092] Intracerebral microinjection
[0093] To achieve precise AAV expression in the pSI brain region, this study employed stereotactic techniques and a microinjection method to precisely inject AAV-hSyn-hM4Di virus into the pSI region (coordinates: anterior-posterior ±0.9 mm, lateral ±2.1 mm, depth -4.7 mm). This injection site was determined based on previous anatomical and functional studies to ensure accurate localization and minimize errors. In preliminary experiments, we explored the expression range, intensity, and transfection efficiency of AAV in the pSI brain region with different titers and volumes, and optimized the parameters according to experimental requirements. Ultimately, the AAV titer used in the formal experiments was determined to be ~1.0E+12 VG / mL, with an injection volume of 60 nL. This titer and volume ensure sufficient AAV expression within the target region and avoid local toxicity caused by overdose.
[0094] During injection, to ensure precise viral diffusion to the designated area, the injection rate was strictly controlled at 40 nL / min. Simultaneously, the injection fluid level was monitored in real-time to ensure a stable injection process. After injection, the needle was held in the target area for 10 minutes to promote full viral diffusion. The syringe was then slowly withdrawn to prevent AAV from spilling out along the needle path due to rapid withdrawal. Once the surgical window was established, the wound was immediately sutured to ensure proper closure and reduce the risk of infection.
[0095] Post-surgery, especially during the recovery period after anesthesia, we used heating pads to keep the mice warm and prevent hypothermia. We monitored the mice's body temperature, respiration, and heart rate to ensure no abnormalities occurred during recovery. Once the mice regained their righting reflex and demonstrated normal mobility, we ensured they had recovered sufficient motor function before returning them to their cages for further observation. We regularly checked their health and recorded relevant data.
[0096] Chemogenetic inhibition of pSI neurons
[0097] To intervene in the aggression of ASD mice, this application constructs and packages AAV-hSyn-hM4Di according to existing technology. AAV-hSyn-hM4Di is injected bilaterally into the pSI brain region of ASD mice to chemogenetically inhibit all neurons in the pSI brain region. Three weeks later, mice are administered saline or the chemogenetic agonists CNO and CLZ via intraperitoneal injection or gavage. Thirty minutes after administration, the aggressive behavior of the mice is tested for 15 minutes.
[0098] Attack behavior test
[0099] In the behavioral experiments, this application tested the aggressive behavior of mice. Prior to behavioral testing, sufficient viral expression and complete surgical recovery were required. Depending on the experimental objectives, test mice were individually housed or socially housed for at least 3 weeks to maintain a stable level of aggression. Before the behavioral tests, mice underwent appropriate adaptation training based on the human interventions and environment required for the formal experiments. For the human intervention training, each session lasted 3-10 minutes, with an adaptation period of 3-5 days. The standard for completion of adaptation training was the absence of stress responses such as defecation and urination during the adaptation process. For environmental adaptation, mice were placed in the test room for 1 hour per day for 1-5 days. Formal behavioral experiments were then conducted after the adaptation training was completed.
[0100] In formal testing, the virus must be expressed in the experimental mice for at least 3 weeks. On the day of the test, the mice were placed in the behavioral room 1 hour in advance. The first video recording began by introducing a male intruder mouse of similar weight to the experimental mice into the cage, recording 15 minutes of spontaneous aggressive behavior, after which the behavioral recording ended. At the same time the next day, the mice were given saline or the chemogenetic agonists CNO and CLZ via intraperitoneal injection or gavage. After 30 minutes, a different male intruder mouse was introduced for a second video recording of aggressive behavior, recording for 15 minutes.
[0101] Behavioral videos were recorded at 30 frames per second to fully preserve all behavioral processes and details. Subsequently, MATLAB was used to monitor and manually annotate each frame of the video, maximizing and standardizing the temporal accuracy of the behavioral annotations. After annotation, the behaviors were visualized (bar charts) and quantitatively described (hierarchical charts).
[0102] To determine aggressive behavior, it is necessary to combine the combined behavioral performance of both the experimental mouse and the intruding mouse. The judgment can be made by observing the sudden increase in the speed of the experimental mouse, i.e., actively chasing the intruder, and then showing obvious biting or punching behaviors, combined with the intruding mouse's escape or cries.
[0103] For the statistical analysis of aggressive behavior, this application uses a barrier diagram to visualize the behavioral test results and employs three parameters—aggression latency, duration of aggressive behavior, and number of aggressive behaviors—as parameters for quantifying aggressive behavior. The probability of aggressive behavior refers to the proportion of mice that attack during a 15-minute test; the attack latency refers to the time from the intruder mouse entering the cage to the first aggressive behavior of the experimental mouse; the duration and number of aggressive behaviors refer to the total duration and total number of aggressive behaviors during the 15-minute test.
[0104] Statistical analysis
[0105] All data were plotted using the original data. Error bars represent standard deviation. P < 0.05 indicates statistical significance. All statistical analyses were performed using Prism 8.3 software. Independent samples t-tests were used to analyze comparisons between two groups. One-way ANOVA was used to analyze comparisons among multiple groups: RM one-way ANOVA was used if the data were a self-control and normally distributed; Friedman's test was used if the data were a self-control and not normally distributed; Ordinary one-way ANOVA was used if the data were not a self-control and normally distributed; and Kruskal-Wallis test was used if the data were not a self-control and not normally distributed. In the figures, *p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001.
[0106] Example 1: Studying an animal model of ASD
[0107] The Neuroligin3 R451C knock-in (R451C) mouse is a landmark animal model in the field of autism spectrum disorder research. This model exhibits a high degree of etiological and phenotypic mimicry. In 2007, Nobel laureate Thomas C. Südhof's research team successfully constructed this model by homologously introducing the R451C point mutation of the NLGN3 gene, discovered in ASD patients, into the mouse genome. This was the first time in scientific history that genetic engineering methods had been used to reproduce behavioral and neurobiological abnormalities highly similar to human ASD in animals, providing an irreplaceable tool for systematically studying the pathogenesis, neural circuit basis, and screening potential treatment strategies for ASD in living animals.
[0108] R451C mice exhibit two core behavioral characteristics of ASD: social impairment and repetitive, stereotyped behaviors. Specifically, they show reluctance to engage in normal interaction with peer mice and exhibit social memory impairments such as abnormal social novelty deficits in social tests; simultaneously, they also display repetitive, stereotyped movements. R451C mice can effectively mimic the neurodevelopmental mechanisms of ASD. The R451C mutation leads to an abnormally enhanced number and function of inhibitory synapses in the brain, disrupting the balance between excitation and inhibition in neural networks. This "excitation / inhibition imbalance" is considered one of the fundamental cellular mechanisms leading to many behavioral abnormalities in ASD. Studies have also found abnormalities in synaptic plasticity (long-term potentiation) and myelin development in specific brain regions. Therefore, R451C mice are one of the core models for advancing basic research and translational medicine in ASD.
[0109] Example 2: A method for treating ASD aggressive behavior by inhibiting neuronal activity in the pSI brain region through chemogenetics.
[0110] The pSI brain region is involved in the regulation of various instinctive behaviors, but its specific role in ASD-related aggressive behavior remains unclear. Therefore, could specifically inhibiting neuronal activity in this brain region alleviate the core comorbid symptom of ASD models—pathological aggression? To verify this hypothesis, this application stereotactically injected AAV-hSyn-hM4Di virus into the bilateral pSI brain regions of Neuroligin3 R451C knock-in (KI) mice with a stable aggressive phenotype, causing neurons in this region to express inhibitory receptors that can be specifically activated by artificial ligands, such as CLZ (Figures 1, 2, 4). Three weeks after viral expression, the same batch of mice were treated with intraperitoneal injection of saline (control group) or CLZ (experimental group), and the level of their aggressive behavior was systematically assessed 30 minutes after administration (Figures 2, 3). This application found that, compared with the saline control group, injection of CLZ to specifically inhibit pSI neurons resulted in a comprehensive and significant improvement in the aggressive behavior of ASD model mice, which were originally highly aggressive (Figure 5). This was manifested in a significant reduction in their motivation to attack, as evidenced by a highly significant prolongation of the attack latency (P<0.0001); the intensity and frequency of attacks also decreased significantly, as evidenced by a significant reduction in both the total duration of attacks and the number of attack events (P<0.01). This embodiment demonstrates that inhibiting the activity of pSI brain region neurons through chemogenetic methods can effectively treat pathological aggressive behavior in ASD model animals.
[0111] Example 3: An example demonstrating that chemogenetic inhibition of the pSI brain region has no effect on basic social exploration (sniffing) behavior in ASD.
[0112] To rule out the possibility that the treatment method might indirectly reduce aggressive behavior by weakening basic social interest or perceptual abilities, this application analyzed the active "sniffing" behavior of experimental mice towards unfamiliar mice during testing, a key indicator for measuring social approach and exploration motivation. The results showed no significant differences between the CLZ treatment group and the control group in latency, duration, and number of sniffing events (Figure 6). This embodiment demonstrates that inhibiting pSI neuronal activity does not reduce the social exploration motivation and interest of mice, and its effect on improving aggressive behavior is quite specific. The reduction in aggressive behavior is a result of chemogenetic treatment, rather than stemming from a loss of attention or interest in the social object.
[0113] Example 4: Chemogenetic suppression of the pSI brain region has virtually no effect on prosocial behavior (heterologous grooming) in ASD.
[0114] To assess whether this intervention would affect normal positive social interaction and to comprehensively describe social behavior, this application simultaneously analyzed the "parasitic grooming" behavior of mice—a key prosocial behavior—in the behavioral test of Example 2. The results showed that, compared with the CLZ treatment group and the saline control group, there were no statistically significant differences in the latency, duration, and number of parasitic grooming events in mice (Figure 7). This example demonstrates that the treatment method of inhibiting pSI neuron activity effectively alleviates aggressive behavior without impairing an individual's normal prosocial interaction ability, and together with Example 3, excludes the side effect of widespread social dysfunction caused by chemogenetic treatment.
[0115] Example 5: Chemogenetic inhibition of the pSI brain region has virtually no effect on stereotyped repetitive behaviors (self-grooming) in ASD.
[0116] To assess whether the treatment method would induce or alter stereotyped repetitive behaviors associated with ASD, this application quantitatively analyzed the "self-grooming" behavior in the behavioral test of Example 2. Self-grooming is a common repetitive behavior in rodents, and its abnormal increase is considered one of the manifestations of stereotyped behavior. The results showed that after chemogenetic treatment to inhibit pSI neuronal activity, there were no significant changes in the latency, duration, and number of events of self-grooming behavior in mice (Figure 8). This example demonstrates that chemogenetic treatment targeting the pSI brain region does not induce or exacerbate stereotyped repetitive behaviors in model mice, indicating that its therapeutic effect is selective for aggressive behavior and does not aggravate the core behavioral symptoms of ASD.
[0117] Example 5: Chemogenetic inhibition of the pSI brain region has virtually no effect on anxiety / fear-related behaviors in ASD (freezing).
[0118] To assess whether the treatment method could induce anxiety or fear-like emotional states, thereby nonspecifically inhibiting all behaviors (including aggression), this application analyzed the "freezing" behavior in the test, i.e., the animal's complete immobility except for breathing, a classic indicator of fear / anxiety. The results showed that after inhibiting pSI neuronal activity, the parameters of the mouse freezing behavior were not significantly different from those of the control group (Figure 9). This embodiment demonstrates that the chemogenetic treatment method targeting the pSI brain region does not induce anxiety or fear-like emotional side effects, and its effect in reducing aggressive behavior is specific, rather than stemming from generalized motor inhibition or changes in emotional state.
[0119] Example 6: A method for treating social memory disorders in ASD through chemogenetics
[0120] The aforementioned studies confirmed that the NL3-R451C mutation leads to an imbalance in the excitation / inhibition of the medial prefrontal cortex (mPFC) in mice, particularly impairing NMDA receptor-dependent synaptic plasticity. This results in impaired formation of "trace cells" encoding social information, a key mechanism underlying social memory deficits in ASD. Therefore, can specifically modulating the activity of neurons in this functional brain region using chemogenetic methods repair social memory function in ASD?
[0121] We injected AAV-hSyn-hM4Di virus into the mPFC brain region of NL3-R451C KI mice. Three weeks after viral expression, we manipulated social memory tests (such as social recognition tests) by intraperitoneal injection of CLZ. Moderately enhancing the excitability of specific neuronal circuits in the mPFC may restore the synaptic plasticity and network oscillations necessary for the formation of social memory, thereby significantly improving the mice's ability to distinguish between familiar and unfamiliar companions.
[0122] Example 7: A method for alleviating social avoidance and anxiety-like behaviors in ASD through chemogenetics
[0123] The amygdala, particularly the central amygdala (CeA), is a core node for processing fear and anxiety. It often exhibits functional and connectivity abnormalities in ASD, potentially related to social avoidance and high anxiety. Could modulating the overactive "fear output" neurons in the CeA alleviate the social avoidance and anxiety associated with ASD?
[0124] We injected AAV-hSyn-hM4Di virus into the CeA brain region of NL3-R451C KI mice. Three weeks after viral expression, we specifically inhibited this neuronal population by intraperitoneal injection of CLZ and then performed social approach / avoidance tests or elevated cruciate maze tests. Inhibition of this specific circuit reduced non-specific fear and avoidance responses in social scenarios, increased the time mice spent on proactive social exploration, and alleviated anxiety-like behaviors in open environments.
[0125] Example 8: A method for improving hypersensitivity symptoms of ASD through chemogenetics
[0126] Previous studies have found that NL3-R451C KI mice exhibit insufficient myelination and reduced excitability of PV interneurons in the barrel cortex, leading to an imbalance in sensory processing circuits. This may be the basis for sensory abnormalities such as tactile hypersensitivity in ASD. Therefore, can enhancing the activity of inhibited PV interneurons in the somatosensory cortex restore the normalization of sensory processing gain, thereby improving sensory hypersensitivity in ASD?
[0127] We will inject a chemogenetic virus into the primary somatosensory cortex (e.g., barrel cortex) of mice. Three weeks after viral expression, CLZ will be injected intraperitoneally, followed by fine tactile discrimination tasks (e.g., texture recognition) or auditory startle reflex tests. Chemogenetic methods can enhance the "filtering" function of sensory information in animals by modulating the excitability of functional neurons, restoring the normal excitation / inhibition balance of the cortical network, thereby potentially reducing overreaction to mild tactile or auditory stimuli and improving sensory processing abnormalities.
[0128] Example 9: A method for mitigating stereotyped repetitive behaviors in ASD through chemogenetics
[0129] Dysfunction of basal ganglia (particularly striatal) circuits is closely associated with repetitive and stereotyped behaviors. Imbalance in the activity of the "indirect pathway" formed by dopamine receptor D2-positive medium-sized polyspinous neurons in the striatum may lead to reduced behavioral flexibility and the solidification of repetitive behaviors. Could specific modulation of the activity of striatal indirect pathway neurons reduce spontaneous stereotyped behaviors in ASD (such as excessive self-grooming and repetitive jumping)?
[0130] We injected a chemogenetic virus into the dorsolateral striatum of NL3-R451C KI mice. Three weeks after viral expression, CLZ was injected intraperitoneally, and long-term behavioral monitoring was conducted in their free-roaming environment. Moderate inhibition of overactive indirect pathways can restore the dynamic balance with direct pathways, increase behavioral flexibility, and thus significantly reduce the frequency and duration of meaningless stereotyped repetitive behaviors.
[0131] The basic concepts have been described above. Obviously, for those skilled in the art, the detailed disclosure above is merely illustrative and does not constitute a limitation of this specification. Although not explicitly stated herein, those skilled in the art may make various modifications, improvements, and corrections to this specification. Such modifications, improvements, and corrections are suggested in this specification and therefore remain within the spirit and scope of the exemplary embodiments described herein.
[0132] Furthermore, this specification uses specific terms to describe embodiments thereof. For example, "an embodiment," "one embodiment," and / or "some embodiments" refer to a particular feature, structure, or characteristic associated with at least one embodiment of this specification. Therefore, it should be emphasized and noted that references to "an embodiment," "one embodiment," or "an alternative embodiment" in different locations throughout this specification do not necessarily refer to the same embodiment. Moreover, certain features, structures, or characteristics in one or more embodiments of this specification can be appropriately combined.
[0133] In some embodiments, numbers describing the quantity of components and attributes are used. It should be understood that such numbers used in the description of embodiments are modified in some examples with the terms "approximately," "approximately," or "generally." Unless otherwise stated, "approximately," "approximately," or "generally" indicates that the numbers are allowed to vary by ±20%. Accordingly, in some embodiments, the numerical parameters used in the specification and claims are approximate values, which may be changed depending on the characteristics required by individual embodiments. In some embodiments, numerical parameters should take into account specified significant digits and employ a general method of digit reservation. Although the numerical ranges and parameters used to confirm their breadth of range in some embodiments of this specification are approximate values, in specific embodiments, such values are set as precisely as feasible.
[0134] Finally, it should be understood that the embodiments described in this specification are merely illustrative of the principles of the embodiments described herein. Other variations may also fall within the scope of this specification. Therefore, alternative configurations of the embodiments described herein are intended to be illustrative rather than limiting, and should be considered consistent with the teachings of this specification. Accordingly, the embodiments described herein are not limited to those explicitly introduced and described herein.
Claims
1. Use of hM4Di, recombinant adeno-associated virus AAV-hSyn-hM4Di, or pharmaceutical compositions thereof in the preparation of products having one or more of the following functions: 1) Reduces the excitability of the posterior innocenced brain region in individuals with autism spectrum disorder; 2) Reduce the number of aggressive behaviors in individuals with autism spectrum disorder; 3) Shorten the duration of aggressive behavior in individuals with autism spectrum disorder; 4) Prolonging the latency period of aggressive behavior in individuals with autism spectrum disorder; 5) Prevention and / or treatment of autism spectrum disorders.
2. Use according to claim 1, characterized in that, The pharmaceutical composition includes a first drug, the first drug including the recombinant adeno-associated virus AAV-hSyn-hM4Di; And / or, the recombinant adeno-associated virus contains a promoter, preferably selected from the neuron-specific promoter hSyn; And / or, the serotype of the recombinant adeno-associated virus is selected from AAV1, AAV2, AAV5, AAV6, AAV8, AAV9 or AAV13; And / or, the nucleotide sequence of the hM4Di gene is shown in SEQ ID NO.2; And / or, the aggressive behavior includes physical aggressive behavior, preferably, the physical aggressive behavior includes any one or more of chasing, punching, kicking, biting, pushing, self-harm or suicidal behavior; And / or, the hM4Di, recombinant adeno-associated virus AAV-hSyn-hM4Di, or pharmaceutical compositions thereof have no effect on basic social exploration behavior, prosocial behavior, stereotyped repetitive behavior, or anxiety or fear-related behavior in individuals with autism spectrum disorder.
3. Use according to claim 2, characterized in that, The promoter is located upstream of the hM4Di gene, and preferably, the nucleotide sequence of the promoter hSyn is shown in SEQ ID NO.1; And / or, the first drug may further include a pharmaceutically acceptable carrier or excipient; And / or, the first drug is an injectable drug that targets a brain region for administration; preferably, the first drug is an injectable drug that targets the posterior unintelligible brain region; more preferably, the first drug is an injectable drug that targets inhibitory neurons in the posterior unintelligible brain region; and even more preferably, the injection method is bilateral posterior unintelligible brain region injection.
4. The use as described in claim 1, characterized in that, The pharmaceutical composition further includes a second drug, which includes a chemogenetic receptor agonist.
5. Use according to claim 4, characterized in that, The chemogenetic receptor agonists include any one or more of quetiapine, clozapine, clozapine-N-oxide, desclozapine, or their derivatives.
6. The use as described in claim 4, characterized in that, The second drug is administered via any one of oral, intramuscular, subcutaneous, intravenous, or implantation methods. Preferably, the second drug is an oral drug or an injectable drug administered via the peritoneum.
7. A pharmaceutical composition comprising a first drug, the first drug comprising recombinant adeno-associated virus AAV-hSyn-hM4Di.
8. The pharmaceutical composition of claim 7, wherein The recombinant adeno-associated virus contains a promoter, preferably selected from the neuron-specific promoter hSyn; And / or, the serotype of the recombinant adeno-associated virus is selected from AAV1, AAV2, AAV5, AAV6, AAV8, AAV9 or AAV13; And / or, the nucleotide sequence of the hM4Di gene is shown in SEQ ID NO.
2.
9. The pharmaceutical composition of claim 7, wherein The promoter is located upstream of the hM4Di gene. Preferably, the nucleotide sequence of the promoter hSyn is shown in SEQ ID NO.1; And / or, the first drug may further include a pharmaceutically acceptable carrier or excipient; And / or, the first drug is an injectable drug that targets a brain region for administration; preferably, the first drug is an injectable drug that targets the posterior unintelligible brain region; more preferably, the first drug is an injectable drug that targets inhibitory neurons in the posterior unintelligible brain region; and even more preferably, the injection method is bilateral posterior unintelligible brain region injection.
10. The pharmaceutical composition of claim 7, wherein The pharmaceutical composition further includes a second drug comprising a chemogenetic receptor agonist, preferably one or more of quetiapine, clozapine, clozapine-N-oxide, desclozapine, or derivatives thereof.
11. The pharmaceutical composition of claim 10, wherein The second drug is administered via any one of oral, intramuscular, subcutaneous, intravenous, or implantation methods. Preferably, the second drug is an oral drug or an injectable drug administered via the peritoneum.
12. A method for treating autism spectrum disorder, the method comprising administering to an individual with autism spectrum disorder a therapeutically effective amount of hM4Di, recombinant adeno-associated virus, pharmaceutical composition or product, or pharmaceutical composition as described in any one of claims 1 to 6.
13. The method of claim 12, wherein, The method administers the first drug in the pharmaceutical composition to an individual with autism spectrum disorder. Preferably, the method uses an intracranial injection device to administer the first drug in the pharmaceutical composition to the individual with autism spectrum disorder. More preferably, the method uses a microsyringe to administer the first drug in the pharmaceutical composition to the individual with autism spectrum disorder. And / or, the method causes the expression of hM4Di in the brain regions of the individual with autism spectrum disorder, preferably, the method causes the expression of hM4Di in the posterior innocenced brain region of the individual with autism spectrum disorder; And / or, the method involves injecting a second drug in the drug composition 3 weeks after injecting the first drug in the drug composition.