TÔNICO PÓS-BARBA SUSTENTÁVEL E BIOTECNOLÓGICO A BASE DE RAMNOLIPÍDIOS PRODUZIDOS COM A BIOMASSA RESIDUAL DE ANDIROBA PARA O CONTROLE DE INFECÇÕES CUTÂNEAS
Patent Information
- Authority / Receiving Office
- BR · BR
- Patent Type
- Applications
- Current Assignee / Owner
- UNIVE ESTADUAL DE LONDRINA
- Filing Date
- 2025-01-27
- Publication Date
- 2026-08-04
Smart Images

Figure 00000000_0000_ABST
Description
1 / 12 DESCRIPTIVE REPORT Sustainable and biotechnological aftershave tonic based on rhamnolipids produced with residual biomass of andiroba for the control of skin infections. FIELD OF THE INVENTION
[01] Approximately 60% of the world's population carries the herpes simplex virus type-1. For immunocompromised individuals, herpetic disease can progress to severe forms causing blindness, encephalitis, and severe disseminated infection. Contagion occurs through oral and genital contact, and is characterized by periods of reactivation throughout life. Once affected, the body is unable to eliminate the infection, which establishes latency in the nerve ganglia, contributing to the high global prevalence.
[02] Although available treatments for the herpes simplex virus do not offer a cure, the use of appropriate medications can help prevent symptomatic outbreaks. However, prolonged and continuous use of these drugs, especially in cases of chronic infections or in immunocompromised individuals, can lead to the development of resistance, reducing the effectiveness of the treatment over time.
[03] Staphylococcus aureus, Cutibacterium acnes, and Staphylococcus epidermidis are involved in common skin conditions such as acne and folliculitis, each contributing in a distinct way. Cutibacterium acnes is the bacterium most associated with the onset of acne. It is part of the normal skin microbiota, living in the sebaceous follicles. When there is an imbalance, such as excessive sebum production, C. acnes proliferates excessively, causing inflammation in the follicles and resulting in the appearance of blackheads and pimples. The formation of biofilm by this bacterium aggravates the inflammatory process, contributing to the formation of acne lesions.
[04] Staphylococcus epidermidis is another commensal skin bacterium that generally plays a protective role against pathogens. However, in Petition 870250006380, dated 01 / 27 / 2025, page 19 / 73 2 / 12 In situations of microbiota imbalance or compromised skin barrier, this bacterium can contribute to inflammation and infections, exacerbating conditions such as acne and folliculitis. Staphylococcus aureus, unlike the previous two, is considered more pathogenic. It can cause skin infections, such as folliculitis, which occurs when hair follicles become inflamed due to the presence of bacteria. BACKGROUND OF THE INVENTION
[05] WO2022008088A1 - COMPOSITIONS WITH VIRUCIDAL AND / OR ANTIVIRAL ACTIVITY. The invention described relates to sanitizing chemical compositions for living and inanimate surfaces with environmental and cosmetic applications. With virucidal action against enveloped viruses, the compositions include ingredients such as 1,2-alkanediols, terpenic alcohols, phenolic compounds, ether alcohols, and aryl alkyl alcohols. The invention presented in this document differs because the bioactive ingredient used in the formulation was produced by a new strain of Pseudomonas aeruginosa BM02, called Raminolipid, cultivated in organic waste from andiroba trees. It is applied in a cosmetic formulation with anti-HSV-1 and anti-acne action.
[06] KR20230048515A NATURAL SKIN CARE COMPOSITION. The present invention relates to the application of biosurfactants of microbiological origin in natural cosmetics. The invention differs because the bioactive used in the formulation was produced by a new strain of Pseudomonas aeruginosa BM02, called Rhamnolipid, cultivated in organic waste. It is applied in a cosmetic formulation with anti-HSV-1 and anti-acne action.
[07] WO2018129603A1 Process for obtaining rhamnolipids produced by Pseudomonas or Enterobacter using andiroba or murumuru seed residue. The present invention obtained rhamnolipids produced by Pseudomonas or Enterobacter using andiroba or murumuru seed residue. The invention differs from the invention disclosed due to the strain. Petition 870250006380, dated 01 / 27 / 2025, p. 20 / 73 3 / 12 production and application of the bioactive ingredient in an aftershave formulation with proven anti-acne and anti-HSV-1 action.
[08] KR20120005569 20120118 - COSMETICS INGREDIENTS ORIGIN OF NATURAL PRODUCTS FOR CURE AND IMPROVEMENT OF ACNES. The present invention is a cosmetic formulation derived from natural products to alleviate and treat acne, which contains a mixture of a microbial surfactant and a natural plant material. The microbial surfactant contains rhamnolipid, prepared by inoculating Pseudomonas aeruginosa. The invention differs from the invention disclosed due to the producing strain and application of the bioactive in an aftershave formulation with proven anti-acne and anti-HSV-1 action.
[09] CN202310565692 20230519 - Plant extract compound for hair care cosmetics as well as preparation method and application of plant extract compound. The invention relates to a plant extract compound for hair care cosmetics, as well as a method for preparing and applying said compound. The compound includes a compound plant extract, an oily component, a compound accelerator, ethylene glycol, and water. The compound plant extract is obtained by the joint extraction of Radix paeoniae rubra, Equisetum hiemale, Platycladus orientalis, Herba ecliptae, Herba portulacae, Urtica variabilis, and Melia azedarach with an extraction solvent. The compound accelerator is prepared from rhamnolipid and methyl glycoside sesquistearate. The compound described in the invention has effects on dandruff removal, itch relief, darkening, and hair growth.The invention presented in this application differs because the rhamnolipid used in the formulation was produced by a new strain of Pseudomonas aeruginosa BM02, cultivated in organic waste from andiroba trees. It is applied in a cosmetic formulation with anti-HSV-1 and anti-acne action. SUMMARY OF THE INVENTION
[010] The invention in question relates to the development of an aftershave. Petition 870250006380, dated 01 / 27 / 2025, page 21 / 73 4 / 12 containing the rhamnolipid biosurfactant produced by Pseudomonas aeruginosa BM02, cultivated in a medium containing residual andiroba biomass as a nutrient source, is an alternative to increase the chances of effective treatment of skin infections. DETAILED DESCRIPTION OF THE INVENTION
[011] The invention was developed in 5 stages: Stage 1: Production of rhamnolipid biosurfactant by Pseudomonas aeruginosa BM02; Stage 2: Development and pharmaceutical characterization of the formulations; Stage 3: Proof of antiviral efficacy of the formulations; Stage 4: Proof of antiviral efficacy of the formulations by qPCR; Stage 5: Proof of antimicrobial efficacy of the formulations.
[012] Stage 1 - Production of rhamnolipid biosurfactant by Pseudomonas aeruginosa BM02 using residual biomass of andiroba (Carapa guianensis Aubl.) as a nutrient source.
[013] The rhamnolipid biosurfactant-producing strain of Pseudomonas aeruginosa BM02 was isolated from a soil sample from a mining operation in the state of Pará, in the Amazon region of Brazil. The genetic sequence of the bacterial strain was deposited in the NCBI, under the GenBank registry: OP410927.1. The use of the bacterium was registered in the National System for the Management of Genetic Heritage and Associated Traditional Knowledge (SisGen, No. A4DA401). The bacterium is preserved in a glycerol solution at -20 °C in the Bioassays and Bioprocesses Laboratory (L@eio) of the Federal University of Southern and Southeastern Pará (Unifesspa), Marabá-PA, Brazil.
[014] Residual biomass from andiroba was chosen as raw material for the production of rhamnolipid biosurfactant due to its oily composition, high safety, low cost, high availability and because it is the result of the commercial processing of a fruit that is part of the scope of traditional uses by Amazonian communities, enabling avenues for the commercial competitiveness of the present invention. Petition 870250006380, dated 01 / 27 / 2025, page 22 / 73 5 / 12
[015] The activation of the bacterial strain was performed by transferring 100 μL of the preserved culture to Petri dishes containing Luria Bertani (LB) medium with 1.5% agar, previously sterilized at 121 °C for 20 minutes, and incubated in an oven at 35 °C for 18 to 24 hours.
[016] The reactivated bacteria were moved to the pre-inoculum stage, transferring 3 to 5 bacterial colonies, using a bacteriological loop, to 125 mL Erlenmeyer flasks containing 25 mL of LB broth previously sterilized at 121 °C for 20 minutes, and incubated in a Shaker-type orbital shaker at 36 °C, 200 rpm, for a period ranging from 12 to 16 hours.
[017] The bacterial inoculum was obtained by transferring 2% of the preinoculum to 125 mL Erlenmeyer flasks containing 25 mL of previously sterilized LB broth (121 °C for 20 minutes), and incubated in a shaker at 36 °C, 200 rpm, for 1 to 2 hours, or until reaching an optical density (600 nm) between 0.6-0.8.
[018] The rhamnolipid biosurfactant was produced in 250 mL Erlenmeyer flasks containing 50 mL of vegetable saline medium (VSM), with the following composition in g / L: 0.15 g MgSO4.7H2O; 0.35 g (NH4)2SO4; and 2.5% residual andiroba biomass. Then, 4% of the bacterial inoculum was transferred to the flasks, which were incubated at 36 °C, 180 rpm, for 10 days. After the incubation period, the fermented culture medium was transferred to Falcon tubes, centrifuged at 4500 rpm for 15 minutes at 25 °C and sterilized by filtration (gram weight 85 g / m2). The supernatant was added to a mixture of chloroform and methanol (3:1, v / v) in a 500 mL separatory funnel. The solution was stirred and left to stand for 24 hours. The hydroalcoholic phase was discarded and the organic phase was collected. This procedure was repeated twice. After this step, the organic phase was evaporated in a rotary evaporator and dried in a circulating air oven until constant weight (mg).
[019] The concentration of rhamnose, an integral part of the rhamnolipid molecule, was determined by the orcinol method. The standard curve was calculated using L-rhamnose solutions at different concentrations (1 to 200 μg / mL). Petition 870250006380, dated 01 / 27 / 2025, page 23 / 73 6 / 12
[020] The rhamnolipid biosurfactant was characterized using Fourier transform infrared spectroscopy (FT-IR), with a Platinum ATR reflectance attachment, in the 4000 - 400 cm-1 region and processed in the OriginPro 8.0 program; and by ultra-high resolution and precision electrospray ionization mass spectrometry (ESI-MS). Results:
[021] The results showed that the maximum rhamnose value was 0.37 g / L, which represents 1.18 g / L of rhamnolipid, using a correction factor of 3.2. By FT-IR, the absorption bands located at 3355, 2921, 2852, 1710 and 1024 cm-1 are consistent with the functional groups of rhamnolipids. The prevalent ion observed at 479 m / z in the ESI-MS analysis indicates that the probable composition of the biosurfactant is formed by a di-rhamnolipid (two rhamnose units) linked to a C10 fatty acid chain.
[022] Step 2 - Formulation Development. The formulation was prepared according to Table 1. The preparation of the Test Formulation (TF) was carried out as follows: Phase 1
[023] Add the required amount of distilled water to a beaker.
[024] Dissolve the allantoin and disodium EDTA in distilled water, stirring until completely dissolved. Heat gently to facilitate dissolution (do not exceed 40 °C). Phase 2
[025] After the components of Phase 1 have completely dissolved, add the chamomile glycolic extract to the beaker.
[026] Mix slowly until the extract is completely dissolved. Phase 3
[027] In a second beaker, combine the propylene glycol and the active Biosurfactant rhamnolipid (BS- andiroba), mixing well until the mixture is homogeneous. Petition 870250006380, dated 01 / 27 / 2025, page 24 / 73 7 / 12
[028] Transfer this mixture to the Phase 2 beaker, incorporating it gradually until completely dissolved. Phase 4
[029] Add the essence directly to the main beaker and mix well to ensure complete incorporation of the component. Phase 5
[030] Add the Phenoxyethanol last, mixing well until completely incorporated.
[031] After production, the formulation was subjected to pharmaceutical evaluations, including analysis of color, appearance, odor, pH and density, performed 24 hours after production. Subsequently, stability tests were carried out, in which the formulations were alternately stored every 24 hours at temperatures of 4 °C and 40 °C, for a period of 15 days. At the end of this period, the organoleptic (appearance, color and odor) and physicochemical (pH and density) parameters were re-evaluated, following the tests described in the Brazilian Pharmacopoeia (Brazil, 2010).
[032] Table 1. Formulation Phase INCI Name Concentration Formulation containing BS rhamnolipid (BS-andiroba) (g / %) Ingredients (Chemical Name) Concentration Base Formulation (g / %) 1 Distilled water Aqua QSP for 100 mL □SP for 100 mL 1 Allantoin Allantoin 0.10-0.50 0.10-0.50 1 Disodium EDTA Disodium EDTA 0.01-0.05 0.01-0.05 2 Chamomile Flower Glycolic Extract Chamomilla recutita Flower Extract 1.00-5.00 1.00-5.00 3 Propylene Glycol Propylene Glycol 1.00-5.00 1.00-5.00 3 Active (BS rhamnolipid or BS-Andiroba) BS rhamnolipid or BS-Andiroba — 0.10-0.50 4 Perfume Essence 0.10-0.50 0.10-0.50 5 Phenoxyethanol 0.10-0.50 0.10-0.50 Petition 870250006380, dated 01 / 27 / 2025, page 25 / 73 8 / 12 Result:
[033] At the end of the pre-stability tests (15 consecutive days), the organoleptic parameters (appearance, color and odor) did not undergo significant changes. After centrifugation, the formulation was stable, without the formation of precipitates or phases.
[034] Table 2: Stability assessment. Parameters Appearance Odor pH Initial Formulation Translucent Essence 4.5-5.0 Final Base Translucent Essence 4.5-5.0 Initial Formulation Slight distortion and light ochre color Essence 4.5-5.0 BS rhamnolrpido or BS-Andiroba Final Slight distortion and light ochre color Essence 4.5 - 5.0
[035] Step 3 - Verification of the antiviral efficacy of the formulations. Initially, the cytotoxic concentrations of the formulations (Rhamnolipid BS or Andiroba BS and base) were determined. The product and base were tested separately in five dilutions (50%, 25%, 12.5%, 6.25% and 3.12%) to obtain the non-cytotoxic values used in the virucidal activity test. VERO cells, cultured in 96-well plates, were treated with the respective dilutions and incubated for 72 h. The reading was performed by MTT, determining the % of cell viability.
[036] Antiviral efficacy was performed using a virucidal assay, but using the ISO methodology (O'Connor 2000): 20 µl of pure virus (stock) was incubated in 20 µl of DMEM + 160 μI of the active and base, separately, for 1 min. Followed by five serial dilutions 1:102; 1:103; 1:104; 1:105 and 1:106 and inoculation in VERO cells cultured in 96-well plates and incubated for 72h. The test was revealed by MTT. Results:
[037] The formulation containing the rhamnolipid biosurfactant (BS-andiroba) showed greater cytotoxicity at higher dilutions (50% to 12.5%), reaching approximately 67% cell viability from the fourth dilution (6.25%) and 83% cell viability at the lowest dilution (3.25%) (Figure 1). This cytotoxicity may be related to the presence of the biosurfactant. Petition 870250006380, dated 01 / 27 / 2025, page 26 / 73 9 / 12 rhamnolipid in the formulation, since the base formulation demonstrated cell viability greater than 50% from a 25% dilution, confirming the presence of the active ingredient. Therefore, for the evaluation of antiviral efficacy, the formulation was initially tested at 100% against the virus, and dilutions up to 6.25% were used for inoculation of the virus into the cells.
[038] Statistical analyses were determined by two-way ANOVA with Tukey's test for multiple comparisons. Actual triplicates represented by mean ± SD. Different letters (a,b) represent significant differences between groups.
[039] The virucidal activity of the formulations was evaluated using the TCID50 method (Figure 2A) and the percentage of viral inhibition was calculated (Figure 2B). In Figure 2A, it can be observed that the viral control presented the highest virus concentration, approximately 1.64 χ 106TCID50. The base formulation demonstrated a significant reduction of approximately 1 log in viral concentration compared to the control (1.39 χ 105TCID50), with a p-value = 0.034, as indicated by an asterisk (*). The formulation containing the active ingredient (BSAndiroba), in turn, showed complete viral inhibition, with a statistically significant difference compared to the viral control, indicated by two asterisks (**) and a p-value = 0.0054. Figure 2B illustrates the percentage of viral inhibition for the base and Andiroba formulations.The base formulation showed an average viral inhibition of approximately 91%, while the rhamnolipid biosurfactant formulation demonstrated 100% inhibition, with a significant difference compared to the base formulation (p = 0.0026), indicated by two asterisks (**). These results indicate that the formulation containing the active ingredient produced by fermentation from residual andiroba biomass has superior virucidal efficacy, being able to significantly reduce the viral concentration compared to the base formulation without the active ingredient, highlighting its antiviral potential.
[040] For the statistical analyses of Figure 2A, one-way ANOVA followed by Dunnett's multiple comparisons test was used. The standard deviation is Petition 870250006380, dated 01 / 27 / 2025, page 27 / 73 10 / 12 indicated by the error bars. The presence of asterisks (*) indicates statistical significance with a p-value > 0.0332 and (**) p-value > 0.0021. For the statistical analyses of Figure 2B, a paired t-test was used where the presence of asterisks (**) indicates statistical significance with a p-value > 0.0021.
[041] Step 4 - Verification of the antiviral efficacy of the formulations by qPCR. To confirm the anti-HSV activity of the rhamnolipid biosurfactant-based formulation, real-time PCR of the previously described ISO Virucidal assays was performed (Figure 3). For nucleic acid purification, 40 ng of total DNA, 1 μM of primer pairs (ICP4F: 5' GCGGGGAAGTTGTGGACTGG - 3'; ICP4R: 5' CAGGTTGTTGCCGTTTATTGCG - 3') and 20 μL of the reaction were analyzed using the Quantinova SYBR Green PCR Kit (Qiagen, Germany), according to the manufacturer's recommendations. The assays were performed on a LightCycler® Nano Real-Time PCR (Roche), in the following steps: initial denaturation at 95 °C for 120 seconds, followed by 35 cycles at 95 °C for 10 seconds and 60 °C for 30 seconds (Wouk et al., 2022). Result:
[042] As observed in Figure 3, the BS rhamnolipid formulation demonstrated a 100% inhibitory effect on viral replication, with no detection of DNA copies at the highest viral dilution (10-2). This indicates that the bioactive ingredient present in the formulation is highly effective in neutralizing the virus. In contrast, the base formulation, which does not contain the active ingredient, showed results similar to those of the viral control, suggesting that there is no significant antiviral activity in this formulation.
[043] Step 5: Verification of the antimicrobial efficacy of the formulations. The minimum inhibitory concentration (MIC) for the bacterial strains Staphylococcus aureus ATCC 25923 and Staphylococcus epidermidis ATCC 12228 was determined using the same methodology and following the same protocol, making the necessary adaptations. Cultures on MH (Mueller Hinton) agar were used. Petition 870250006380, dated 01 / 27 / 2025, page 28 / 73 11 / 12 for adjustment to the McFarland scale 0.5 (1.5χ10Λ8 CFU / mL) in saline solution (0.85% NaCl), subsequently diluted in a 1:100 ratio. Then, 50 μL of this bacterial suspension were added to each test well and to the positive control, aiming to obtain a final concentration of 5χ10Λ5 CFU / mL. Sterility controls were performed by adding the formulation to wells containing only MH broth (negative control of the formulation) and wells containing only the culture medium. After the addition of the formulation and the bacterial inoculum, the plates were incubated at 37°C for 72 hours, thus allowing bacterial growth and MIC evaluation. Result:
[044] Table 3 reveals significant results in the MIC evaluation of the formulations against bacterial strains. For Cutibacterium acnes, the BS rhamnolipid formulation showed an MIC of 3.12%, indicating greater efficacy compared to the 25% of the base formulation. This suggests that the rhamnolipid biosurfactant (BS-Andiroba) present in the formulation inhibits the growth of this bacterium. Regarding Staphylococcus aureus, both formulations showed an MIC of 50%, but the formulation containing BS rhamnolipid was bactericidal, while the base was only bacteriostatic, which provides a therapeutic advantage. For Staphylococcus epidermidis, both formulations also showed an MIC of 50% and a bacteriostatic effect. Thus, the results highlight that the formulation containing BS rhamnolipid is not only more effective against C. acnes, but also offers a potentially superior treatment against S.aureus, demonstrating the effectiveness of the biosurfactant in developing effective alternatives for bacterial skin infections.
[045] Table 3: Minimum inhibitory concentration of the formulations against the strains Staphylococcus aureus ATCC 25923, Staphylococcus epidermidis ATCC and Cutibacterium acnes. Petition 870250006380, dated 01 / 27 / 2025, page 29 / 73 12 / 12 Bacterial Strains MIC Value of Base Formulation MIC Value of Formulation containing BS Rhamnolipid (BS-andiroba) C. acnes 25% 3.12% S. aureus 50% (bacteriostatic) 50% (bactericidal) S. epidermidis 50% (bacteriostatic) 50% (bacteriostatic) BRIEF DESCRIPTION OF THE FIGURES:
[046] Figure 1: Percentage of cell viability of the formulation with rhamnolipid biosurfactant (BS-Andiroba) and base formulation (without BS-Andiroba) in Vero CCL-81 cells.
[047] Figure 2: Virucidal activity of the formulations evaluated by the TCID50 Log10 method (A) and percentage of viral inhibition (B).
[048] Figure 3: Real-time PCR of virucidal assays (ISO) of formulations containing active ingredient BS rhamnolipid (BS-Andiroba) (A) and base formulation (B). Petition 870250006380, dated 01 / 27 / 2025, page 30 / 73
Claims
1 / 2 CLAIMS 1. Sustainable and biotechnological aftershave tonic formulation, characterized by having antiviral and antimicrobial properties; physicochemical and organoleptic stability, maintaining color, odor, pH (between 4.5 and 6.0) and density parameters during stability tests under alternating conditions of 4 °C and 40 °C for 15 days; comprising: a) Distilled water as a vehicle, in sufficient quantity to complete the volume; b) Allantoin (0.1 to 0.5 g / 100 mL); c) Disodium EDTA (0.01 to 0.05 g / 100 mL); d) Chamomilla recutita Flower Extract (1.0 to 5.0 g / 100 mL); e) Propylene Glycol (1.0 to 5.0 g / 100 mL); f) Rhamnolipid biosurfactant (BS - Andiroba), produced by Pseudomonas aeruginosa BM02, using residual biomass of andiroba (Carapa guianensis Aubl) as a nutrient source, at a concentration of (0.1 to 0.5 g / 100 mL); g) Parfum (0.1 to 0.5 g / 100 mL); h) Phenoxyethanol (0.1 to 0.5 g / 100 mL); 2. Formulation, according to claim 1, characterized in that the rhamnolipid biosurfactant is produced by fermentation using residual andiroba biomass, in a saline vegetable medium (VVM), containing: a) MgSO4*7H2O (0.15 g / L); b) (NH4)2SO4 (0.35 g / L); c) Residual andiroba biomass (2.5% w / v); 3. Process, characterized by comprising the incubation of Pseudomonas aeruginosa BM02 at 36°C, 180 rpm, for 10 days, followed by extraction of the rhamnolipid by mixing chloroform and methanol (3:1 v / v), and purification in a rotary evaporator; 4. Process, according to claim 1, characterized by comprising the following steps: a) Add distilled water to a beaker and dissolve the allantoin and disodium EDTA, mixing until completely dissolved; heat Petition 870250006380, dated 01 / 27 / 2025, p.31 / 73 2 / 2 gently, without exceeding 40 °C, to facilitate the dissolution process; b) After the components are completely dissolved, add the chamomile glycolic extract to the beaker, mixing slowly until the extract is fully dissolved; c) In a second beaker, combine the propylene glycol and the active ingredient BSandiroban (rhamnolipid biosurfactant), mixing well until a homogeneous solution is obtained; gradually transfer this mixture to the first beaker, incorporating while homogenizing until complete dissolution is achieved; d) Add the fragrance to the beaker and mix well, ensuring complete incorporation of the component; e) Finally, add the phenoxyethanol and carefully homogenize until completely incorporated; f) If necessary, adjust the pH of the formulation to the range of 4.5 to 5.5 using citric acid or sodium hydroxide. Petition 870250006380, dated 01 / 27 / 2025, pp. 32 / 73.