Dual Kallikrein Inhibitor Antibodies and Their Uses

Dual inhibitor antibodies targeting KLK5 and KLK7 address the dysregulation of these enzymes, improving skin barrier function and reducing inflammation in conditions like Netherton syndrome and atopic dermatitis.

BR112025019154A2Pending Publication Date: 2026-07-14TRIVENI BIO INC

Patent Information

Authority / Receiving Office
BR · BR
Patent Type
Applications
Current Assignee / Owner
TRIVENI BIO INC
Filing Date
2024-03-08
Publication Date
2026-07-14

AI Technical Summary

Technical Problem

Dysregulation of kallikrein (KLK) enzymes, particularly KLK5 and KLK7, leads to skin disorders and inflammatory diseases such as Netherton syndrome, eosinophilic esophagitis, and atopic dermatitis, due to imbalance between proteases and inhibitors, causing barrier dysfunction and inflammation.

Method used

Development of dual inhibitor antibodies that specifically bind to both KLK5 and KLK7 through a common and distinct antigen-specific binding site, inhibiting their protease activity and reducing inflammation.

Benefits of technology

The dual inhibitor antibodies effectively improve skin barrier function and reduce inflammation in conditions associated with KLK5 and KLK7 dysregulation, such as Netherton syndrome and atopic dermatitis, by specifically targeting and inhibiting the enzymes.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000000_0000_ABST
    Figure 00000000_0000_ABST
Patent Text Reader

Abstract

Aspects of the application provide dual inhibitor anti-KLK5 / KLK7 antibodies and methods of using the same for promoting barrier function and reducing inflammation, and treating conditions such as Netherton syndrome, eosinophilic esophagitis and atopic dermatitis.
Need to check novelty before this filing date? Find Prior Art

Description

1 / 129 Dual Kallikrein Inhibitor Antibodies and Their Uses RELATED ORDERS

[0001] This application claims priority pursuant to 35 U.S.C. § 119(e) of U.S.N. Provisional Application No. 63 / 489,414, filed March 9, 2023, and U.S.N. Provisional Application No. 63 / 614,102, filed December 22, 2023, the entire contents of each of which are incorporated herein by reference. REFERENCE TO AN ELECTRONIC SEQUENCE LISTING

[0002] The contents of the electronic sequence listing (A104770001WO00-SEQ-LJG.xml; Size: 36,826 bytes; and Creation Date: March 8, 2024) are incorporated herein by reference in their entirety. FUNDAMENTALS

[0003] Kallikrein (KLK) enzymes regulate desquamation and innate immunity to support skin homeostasis and wound healing. In healthy skin, the outermost layer of the epidermis is regularly desquamated via a KLK-induced proteolytic cascade, resulting in the degradation of corneodesmosomes and desquamation. KLK5 is believed to be the main activator of this proteolytic cascade. Self-activated KLK5 enzymatically converts proKLK7 and proKLK14 into active forms and stimulates a positive feedback loop that, via KLK14, leads to the production of more proKLK5. These KLK enzymes are controlled by endogenous serine protease inhibitors, such as Kazal-type lymphoepithelial inhibitors. Dysregulation of KLKs, including KLK5 and KLK7, is associated with skin disorders, inflammatory diseases, and cancer.For example, overactive kallikrein 5 and 7 causes both genetic and spontaneous epidermal barrier disorders (e.g., Netherton syndrome, eosinophilic esophagitis, atopic dermatitis). SUMMARY

[0004] Certain aspects of the disclosure relate to the recognition that the loss of balance between endogenous KLK proteases and inhibitors of Petition 870250091425, dated 07 / 10 / 2025, page 10 / 159 2 / 129 associated proteases cause barrier dysfunction and induce inflammation (see, for example, FIG. 1), which can result in inflammatory conditions such as Netherton syndrome, eosinophilic esophagitis, and atopic dermatitis. In some embodiments, related methods and compositions are provided that are useful for inhibiting KLK5 and KLK7 for the purpose of improving barrier function and reducing inflammation, thereby improving disease severity. In particular, aspects of the disclosure provide dual inhibitory antibodies targeting KLK5 and KLK7 (called anti-KLK5 / KLK7 antibodies) that have high binding affinity and specificity for KLK5 and KLK7 through a common and distinct antigen-specific binding site.Thus, in some embodiments, disclosure provides methods, antibodies for use in methods, and related antibody compositions to treat conditions associated with KLK5 and KLK7 dysregulation, such as Netherton syndrome, atopic dermatitis (with and without filaggrin mutations), eosinophilic esophagitis, prurigo nodularis, chronic pruritus of unknown origin (CPUO), asthma (e.g., KLK5-related asthma), and ichthyosis vulgaris.

[0005] In some respects, the present disclosure provides a dual inhibitor antibody that specifically binds to KLK5 and KLK7, the dual inhibitor antibody comprising a HC CDR1, HC CDR2 and HC CDR3 of a variable heavy chain domain having the amino acid sequence of SEQ ID NO: 7, and a LC CDR1, LC CDR2 and LC CDR3 of a variable light chain domain having the amino acid sequence of SEQ ID NO: 8.

[0006] In some respects, the present disclosure provides a dual inhibitor antibody that specifically binds to KLK5 and KLK7, the dual inhibitor antibody comprising a HC CDR1, HC CDR2 and HC CDR3 of a variable heavy chain domain with the amino acid sequence of SEQ ID NO: 13, and a LC CDR1, LC CDR2 and LC CDR3 of a variable light chain domain with the amino acid sequence of SEQ ID NO: 14.

[0007] In some respects, the present disclosure provides a dual inhibitor antibody that binds specifically to KLK5 and KLK7, the inhibitor antibody Petition 870250091425, dated 07 / 10 / 2025, p. 11 / 159 3 / 129 double comprises a CDR1 of HC, CDR2 of HC and CDR3 of HC of a variable heavy chain domain with the amino acid sequence of SEQ ID NO: 17, and a CDR1 of LC, CDR2 of LC and CDR3 of LC of a variable light chain domain with the amino acid sequence of SEQ ID NO: 14.

[0008] In some respects, the present disclosure provides a dual inhibitor antibody that specifically binds to KLK5 and KLK7, the dual inhibitor antibody comprising a HC CDR1, HC CDR2 and HC CDR3 of a variable heavy chain domain with the amino acid sequence of SEQ ID NO: 21, and a LC CDR1, LC CDR2 and LC CDR3 of a variable light chain domain with the amino acid sequence of SEQ ID NO: 14.

[0009] In some embodiments, the dual inhibitor antibody comprises an HC CDR1 with the amino acid sequence of SEQ ID NO: 1, an HC CDR2 with the amino acid sequence of SEQ ID NO: 2, an HC CDR3 with the amino acid sequence of SEQ ID NO: 3, an LC CDR1 with the amino acid sequence of SEQ ID NO: 4, an LC CDR2 with the amino acid sequence of SEQ ID NO: 5, and an LC CDR3 CDR1 with the amino acid sequence of SEQ ID NO: 6.

[0010] In some embodiments, the dual inhibitor antibody comprises an HC CDR1 with the amino acid sequence SEQ ID NO: 9, an HC CDR2 with the amino acid sequence SEQ ID NO: 10, an HC CDR3 with the amino acid sequence SEQ ID NO: 11, an LC CDR1 with the amino acid sequence SEQ ID NO: 4, an LC CDR2 with the amino acid sequence SEQ ID NO: 5, and an LC CDR3 with the amino acid sequence SEQ ID NO: 12.

[0011] In some embodiments, the dual inhibitor antibody comprises an HC CDR1 with the amino acid sequence SEQ ID NO: 9, an HC CDR2 with the amino acid sequence SEQ ID NO: 15, an HC CDR3 with the amino acid sequence SEQ ID NO: 16, an LC CDR1 with the amino acid sequence SEQ ID NO: 4, an LC CDR2 with the amino acid sequence SEQ ID NO: 5, and an LC CDR3 with the amino acid sequence SEQ ID NO: 6. Petition 870250091425, dated 07 / 10 / 2025, p. 12 / 159 4 / 129 amino acids of SEQ ID NO: 12.

[0012] In some embodiments, the dual inhibitor antibody comprises an HC CDR1 with the amino acid sequence SEQ ID NO: 18, an HC CDR2 with the amino acid sequence SEQ ID NO: 19, an HC CDR3 with the amino acid sequence SEQ ID NO: 20, an LC CDR1 with the amino acid sequence SEQ ID NO: 4, an LC CDR2 with the amino acid sequence SEQ ID NO: 5, and an LC CDR3 with the amino acid sequence SEQ ID NO: 12.

[0013] In some embodiments, the dual inhibitor antibody comprises a VH comprising the amino acid sequence of SEQ ID NO: 7 and a VL comprising the amino acid sequence of SEQ ID NO: 8.

[0014] In some embodiments, the dual inhibitor antibody comprises a VH comprising the amino acid sequence of SEQ ID NO: 13 and a VL comprising the amino acid sequence of SEQ ID NO: 14.

[0015] In some embodiments, the dual inhibitor antibody comprises a VH comprising the amino acid sequence of SEQ ID NO: 17 and a VL comprising the amino acid sequence of SEQ ID NO: 14.

[0016] In some embodiments, the dual inhibitor antibody comprises a VH comprising the amino acid sequence of SEQ ID NO: 21 and a VL comprising the amino acid sequence of SEQ ID NO: 14.

[0017] In some respects, the present disclosure provides a dual inhibitor antibody comprising a CDR1 of HC, CDR2 of HC, CDR3 of HC, CDR1 of LC, CDR2 of LC and / or CDR3 of LC of any of the dual inhibitor antibodies listed in Tables 1 and 2.

[0018] In some respects, the present disclosure provides a dual inhibitor antibody comprising a VH and / or VL of any of the dual inhibitor antibodies listed in Tables 1 and 2.

[0019] In some embodiments, the dual inhibitor antibody binds to the active site of KLK5 and the active site of KLK7.

[0020] In some modalities, the dual inhibitor antibody competes with Petition 870250091425, dated 07 / 10 / 2025, p. 13 / 159 5 / 129 SPINK 5 and / or leupeptin by binding to the KLK5 active site and the KLK7 active site.

[0021] In some embodiments, the dual inhibitor antibody binds to the active form of KLK5 and the active form of KLK7, but not to the inactive form of KLK5 or the inactive form of KLK7. In some embodiments, the antibody binds specifically to the active form of KLK5 and the active form of KLK7, but does not bind specifically to the inactive form of KLK5 or the inactive form of KLK7. In some embodiments, the antibody binds detectably to the active form of KLK5 and the active form of KLK7, but under the same or comparable conditions does not bind detectably to the inactive form of KLK5 or the inactive form of KLK7.

[0022] In some embodiments, the dual inhibitor antibody inhibits the protease activity of KLK5 and KLK7.

[0023] In some embodiments, the antibody is not cleaved at the heavy chain by KLK5 or KLK7 when it binds to KLK5 or KLK7.

[0024] In some embodiments, an anti-KLK5 / KLK7 antibody is not a bispecific antigen-binding molecule in which binding to KLK5 is conferred by a binding site within the antibody and binding to KLK7 is conferred by a different binding site.

[0025] In some embodiments, an anti-KLK5 / KLK7 antibody is a multispecific antigen-binding molecule that further comprises an antigen-binding domain that binds to an antigen other than KLK5 or KLK7.

[0026] In some respects, the present disclosure provides a composition comprising the dual inhibitor antibody described herein and an acceptable carrier.

[0027] In some respects, the present disclosure provides a nucleic acid that encodes the dual inhibitor antibody described herein.

[0028] In some respects, the present disclosure provides a method of treating a skin barrier defect, the method comprising administering to a subject an effective amount of a dual inhibitor antibody. Petition 870250091425, dated 07 / 10 / 2025, page 14 / 159 6 / 129 described herein, or its composition. In some forms, the skin barrier defect is associated with Netherton syndrome, atopic dermatitis, eosinophilic esophagitis, prurigo nodularis, chronic pruritus of unknown origin (CPUO), dry skin, asthma (specifically KLK5), ichthyosis vulgaris, or itching or chronic itching.

[0029] In some aspects, the present disclosure provides a dual inhibitor antibody for KLK5 and KLK7 (i.e., anti-KLK5 / KLK7 antibody) or a composition thereof for use in a treatment method for a skin barrier defect. In some embodiments, an anti-KLK5 / KLK7 antibody or a composition thereof is for use in a treatment method for a skin barrier defect associated with Netherton syndrome, atopic dermatitis, eosinophilic esophagitis, prurigo nodularis, chronic pruritus of unknown origin (CPUO), dry skin, asthma (specifically KLK5), ichthyosis vulgaris, or chronic itching or pruritus.

[0030] The aspects, implementations, acts, functionalities, characteristics and modalities above and others of the present teachings can be more fully understood from the following description together with the attached drawings. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] The attached drawings, which are incorporated into and form part of this specification, illustrate certain embodiments and, together with the written description, serve to provide non-limiting examples of certain aspects of the compositions and methods disclosed herein.

[0032] FIG. 1 is a diagram showing aberrant protease activation (e.g., aberrant activation of KLK5, KLK7, and KLK14) leading to diseases associated with skin barrier defects.

[0033] FIGS. 2A-2B show relative response curves of the binding of KLK5 / 7-Dual-Ab4 and Comparator Antibody #1 to the active form of human KLK5 (huKLK5) or to the proform of huKLK5 (FIG. 2A), or to the active form or proform of huKLK7 (FIG. 2B). Comparator antibody #1 shows binding to Petition 870250091425, dated 07 / 10 / 2025, p. 15 / 159 7 / 129 both forms, while KLK5 / 7-Dual-Ab4 specifically binds to the active huKLK5.

[0034] FIGS. 3A-3B are SDS-PAGE results showing antibodies controlling anti-KLK5-Ab1, KLK5 / 7-Dual-Ab1, KLK5 / 7-Dual-Ab2, KLK5 / 7-Dual-Ab3, KLK5 / 7-Dual-Ab4, and KLK5 / 7-Dual-Ab5 alone or after incubation with KLK5 (FIG. 3A) or KLK7 (FIG. 3B). The anti-KLK5-Ab1 control is a positive control for KLK5 cleavage activity (but is not cleaved by KLK7), as evidenced by the two bands of approximately 38 kDa and 12 kDa in weight. There is no cleavage of other antibodies by KLK5 or KLK7.

[0035] FIG. 4 shows the inhibitory activity of the dual-specificity antibodies KLK5 / 7-Dual-Ab2, KLK5 / 7-Dual-Ab3, and KLK5 / 7-Dual-Ab4 against other members of the KLK family and related proteases relative to an isotype control. The tested antibodies do not specifically inhibit non-KLK5 / 7 family members or related proteases, as the relative activity is not greater than the isotype control.

[0036] FIGS. 5A-5B show the relative response of KLK5 / 7-Dual-Ab2 and KLK5 / 7-Dual-Ab4 antibodies against huKLK5 and huKLK7 binding to huKLK5 (FIG. 5A) or huKLK7 (FIG. 5B) in the presence of serine protease inhibitors PMSF, leupeptin or SPINK5.

[0037] FIG. 6 shows the competitive binding of KLK5 (top) and KLK7 (bottom) between anti-KLK5 / 7 antibodies and SPINK5, which binds to the active site of KLK5 and KLK7. In the graphs on the left, the KLK5 / 7-Dual-Ab4 antibody is bound to a chip and KLK5 or KLK7 is added, resulting in an increase in the binding curve. The addition of a second anti-KLK5 / 7 or SPINK5 antibody (indicated by the brackets and “mAb #2”) does not increase binding. In the graphs on the right, SPINK5 is bound to the chip, and KLK5 or KLK7 is added, resulting in an increase in the binding curve. The addition of an anti-KLK5 / 7 antibody (indicated by the brackets and “mAb #2”) does not increase binding, as SPINK5 is already bound to the active site of KLK5 or KLK7. Petition 870250091425, dated 07 / 10 / 2025, page 16 / 159 8 / 129

[0038] FIGS. 7A-7B show the effects of treatment with KLK5 / 7Dual-Ab4 at 30 mg / kg (FIG. 7A) or 3 mg / kg (FIG. 7B) on stratum corneum thickness in a murine model of atopic dermatitis MC903. Treatment with KLK5 / 7-Dual-Ab4 led to a significant reduction in thickness.

[0039] FIGS. 8A-8I are graphs representing the efficacy of anti-KLK5 / 7 antibody treatment on disease presentation in a murine model of Nc / Nga atopic dermatitis, as measured by clinical score (FIG. 8A), histological score (FIG. 8D and FIG. 8G), stratum corneum thickness (ear thickness) (FIG. 8B and FIG. 8H), itching (FIG. 8C and FIG. 8I), epidermal area (FIG. 8E) and IgE antibody production (FIG. 8F).

[0040] FIGS. 9A-9E show the results of administering the anti-KLK5 / 7 antibody in the scaly tail mouse model, as measured by epidermal area (FIG. 9A), parakeratosis (a type of keratinization) (FIG. 9B), spongiosis (a histological feature of the epidermis in eczema) (FIG. 9C), and IL-4 (FIG. 9D) and TNFα (FIG. 9E) production in the ear.

[0041] FIGS. 10A-10F show representative histological images and summary measurements of hyperkeratosis in a disease-induced human epidermal equivalent air-liquid interface culture (MC903 model) after treatment with KLK5 / 7-Dual-Ab4 (FIG. 10C), Comparator Antibody #1 (FIG. 10D), Comparator Antibody #3 (FIG. 10E) compared with controls without MC903 (FIG. 10A) and MC903 + IgG Control (FIG. 10B). Quantitative summaries of stratum corneum thickness in each condition are shown in FIG. 10F.

[0042] FIG. 11 is a crystal structure of the Fab KLK5 / 7-DualAb1 antibody that binds to the active site of the StoA variant of the human KLK7 antigen. The heavy chain is shaded in light gray, the Fab light chain is shaded in dark gray, and the antigen is shaded in black.

[0043] FIG. 12 shows CDR3 loop residues of the heavy chain of KLK5 / 7-Dual-Ab1 (dark gray) occupying the binding pockets of the active site of Petition 870250091425, dated 07 / 10 / 2025, page 17 / 159 9 / 129 a human KLK7 antigen (light gray). The residues of the antigen's catalytic triad are shown in stick representation, as is the tryptophan residue marking the base of the S4 binding pocket. DETAILED DESCRIPTION

[0044] The present disclosure is based, at least in part, on the development of dual inhibitor antibodies and variants thereof, targeting KLK5 and KLK7. These dual inhibitor antibodies target KLK5 and KLK7 through a common and distinct antigen-specific binding site. These dual inhibitor antibodies have high binding affinity and specificity for KLK5 and KLK7 (anti-KLK5 / KLK7 antibodies). Methods for using anti-KLK5 / KLK7 antibodies and their variants in research, diagnostic / detection and therapeutic applications, and anti-KLK5 / KLK7 antibodies for use in such methods are also provided.

[0045] The aspects, implementations, acts, functionalities, characteristics and modalities above and others of the present teachings can be more fully understood from the following description together with the attached drawings. I. Definitions

[0046] Administration: As used herein, the terms “administration” or “administration” mean providing an antibody or a composition thereof to a subject in a manner that is physiologically and / or pharmacologically useful (e.g., to treat a condition in the subject).

[0047] Affinity-Matured Antibody: The term “Affinity-Matured Antibody” is used here to refer to an antibody with one or more alterations in one or more CDRs, resulting in an improvement in the antibody’s affinity (e.g., KD, kd, or ka) for a target antigen compared to a parental antibody that does not possess the alteration(s). Exemplary affinity-matured antibodies may have nanomolar or even picomolar affinities for the target antigen in some modalities. A variety of procedures for producing antibodies Petition 870250091425, dated 07 / 10 / 2025, page 18 / 159 10 / 129 affinity-matured antibodies are available, including screening from a combinatorial antibody library that was prepared using biodisplay. For example, Marks et al., BioTechnology, 10: 779-783 (1992) describes affinity maturation by shuffling VH and VL domains. Random mutagenesis of CDR and / or framework residues is described by Barbas et al., Proc. Schier et al., Gene, 169: 147-155 (1995); Yelton et al., J. Immunol., 155: 1994-2004 (1995); Jackson et al., J. Immunol., 154(7): 3310-3319 (1995); and Hawkins et al., J. Mol. Biol., 226: 889-896 (1992). Selective mutation at positions of selective mutagenesis and at contact or hypermutation positions with an amino acid residue that increases activity is described in US Patent No. 6,914,128 B1.

[0048] Antibody: As used herein, the term “antibody” refers to a polypeptide comprising at least one immunoglobulin variable domain, which comprises at least one distinct antigen-specific binding site, or a portion of an immunoglobulin variable domain (such as a paratope or portion thereof) comprising at least one distinct antigen-specific binding site. In some embodiments, an antibody comprises at least one distinct antigen-specific binding site that specifically binds to the active site of an enzyme. In some embodiments, an antibody is a full-length antibody. In some embodiments, an antibody is a chimeric antibody. In some embodiments, an antibody is a humanized antibody. However, in some embodiments, an antibody is a Fab fragment, an F(ab')2 fragment, an Fv fragment, or an scFv fragment.In some embodiments, an antibody is a multispecific antibody (e.g., a bispecific antibody). In some embodiments, an antibody is a nanobody derived from a camelid antibody or a nanobody derived from a shark antibody. In some embodiments, an antibody is a diabody. In some embodiments, an antibody comprises a framework with a human germline sequence. In another embodiment, an antibody comprises a constant heavy chain domain. Petition 870250091425, dated 07 / 10 / 2025, page 19 / 159 11 / 129 selected from the group consisting of constant domains IgG, IgG1, IgG2, IgG2A, IgG2B, IgG2C, IgG3, IgG4, IgA1, IgA2, IgD, IgM, and IgE. In some embodiments, an antibody comprises a variable heavy chain (H) region (abbreviated herein as VH) and / or a variable light chain (L) region (abbreviated herein as VL). In some embodiments, an antibody comprises a constant domain, for example, an Fc region. An immunoglobulin constant domain refers to a constant heavy or light chain domain. The amino acid sequences of the constant heavy chain and light chain domains of human IgG and their functional variations are known. With respect to the heavy chain, in some embodiments, the heavy chain of an antibody described herein may be an alpha (α), delta (Δ), epsilon (ε), gamma (γ), or mu (μ) heavy chain.In some embodiments, the heavy chain of an antibody described herein may comprise a human alpha (α), delta (Δ), epsilon (ε), gamma (γ), or mu (μ) heavy chain. In a specific embodiment, an antibody described herein comprises a human gamma 1 CH1, CH2, and / or CH3 domain. In some embodiments, the amino acid sequence of the vh domain comprises the amino acid sequence of a constant region of the human gamma (γ) heavy chain, such as any known in the art. Non-limiting examples of human constant region sequences have been described in the art, for example, see U.S. Patent No. 5,693,780 and Kabat EA et al., (1991) supra. In some embodiments, the vh domain comprises an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or at least 99% identical to any of the variable chain constant regions provided herein.In some embodiments, an antibody is modified, for example, modified by glycosylation, phosphorylation, sumoylation, and / or methylation. In some embodiments, an antibody is a glycosylated antibody, which is conjugated to one or more sugar or carbohydrate molecules. In some embodiments, the one or more sugar or carbohydrate molecules are conjugated to the antibody by N-glycosylation, O-glycosylation, C-glycosylation, glypiation (GPI anchor attachment), and / or phosphoglycosylation. Petition 870250091425, dated 07 / 10 / 2025, page 20 / 159 12 / 129 In some embodiments, one or more sugar or carbohydrate molecules are monosaccharides, disaccharides, oligosaccharides, or glycans. In some embodiments, the one or more sugar or carbohydrate molecules are a branched oligosaccharide or a branched glycan. In some embodiments, the one or more sugar or carbohydrate molecules include a mannose unit, a glucose unit, an N-acetylglucosamine unit, or a phospholipid unit. In some embodiments, an antibody is a construct comprising a polypeptide comprising one or more antigen-binding fragments of the dissemination linked to a linker polypeptide or to an immunoglobulin constant domain. Linker polypeptides comprise two or more amino acid residues linked by peptide bonds and are used to bind one or more antigen-binding moieties. Examples of linking polypeptides have been reported (see, for example, Holliger, P., et al. (1993) Proc. Natl. Acad.Sci. USA 90:6444-6448; Poljak, RJ, et al. (1994) Structure 2:1121-1123). Furthermore, an antibody can be part of a larger immunoadhesion molecule, formed by the covalent or non-covalent association of the antibody or portion of the antibody with one or more other proteins or peptides. Examples of such immunoadhesion molecules include the use of the central region of streptavidin to produce a tetrameric scFv molecule (Kipriyanov, SM, et al. (1995) Human Antibodies and Hybridomas 6:93-101) and the use of a cysteine ​​residue, a marker peptide, and a C-terminal polyhistidine tag to produce bivalent and biotinylated scFv molecules (Kipriyanov, SM, et al. (1994) Mol. Immunol. 31:1047-1058).

[0049] Approximately: In this document, the term “approximately” or “about” as applied to one or more values ​​of interest, refers to a value that is similar to a stated reference value. In certain embodiments, the term “approximately” or “about” refers to a range of values ​​that fall within 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in any direction (greater or less than) from the stated reference value except Petition 870250091425, dated 07 / 10 / 2025, p. 21 / 159 13 / 129 unless otherwise indicated or evident from the context (except where such a number exceeds 100% of a possible value).

[0050] Bispecific antibody: As used herein, the term “bispecific antibody” refers to an antibody comprising two distinct antigen-specific binding sites or two antibodies linked (covalently or non-covalently) which, combined, comprise two distinct antigen-specific binding sites. Non-limiting examples of bispecific antibody formats or architectures are provided in Labrijn, AF, et al., Biblical antibodies: a pipeline mechanical review, Nature Reviews Drug Discovery volume 18, pages 585-608 (2019) and Brinkmann U and Kontermann EE, The manufacture of specific antibodies, MAbs. 2017 Feb / Mar;9(2): 182-212, the entire contents of each of which are incorporated herein by reference in their entirety.

[0051] CDR: As used herein, the term “CDR” refers to the complementarity-determining region within variable antibody sequences. A typical antibody molecule comprises a variable heavy chain (VH) region and a variable light chain (VL) region, which are generally involved in antigen binding. The VH and VL regions can be subdivided into regions of hypervariability, also known as “complementarity-determining regions” (“CDRs”), interspersed with more conserved regions, known as “framework regions” (“FRs”). Each VH and VL is typically composed of three CDRs and four FRs, arranged from the amino-terminal to the carboxy-terminal in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4.The extent of the framework region and CDRs can be accurately identified using methodologies known in the art, for example, the Kabat definition, the IMGT definition, the Chothia definition, the AbM definition, and / or the contact definition, all well-known in the art. See, for example, Kabat, EA, et al. (1991) Sequences of Proteins of Immunological Interest, Fifth Edition, U.S. Department of Health and Human Services, NIH Publication No. 91-3242; IMGT®, the international. Petition 870250091425, dated 07 / 10 / 2025, page 22 / 159 14 / 129 ImMunoGeneTics information system® http: / / www.imgt.org, Lefranc, M.-P. et al., Nucleic Acids Res., 27:209-212 (1999); Ruiz, M. et al., Nucleic Acids Res., 28:219-221 (2000); Lefranc, M.-P., Nucleic Acids Res., 29:207-209 (2001); Lefranc, M.-P., Nucleic Acids Res., 31:307-310 (2003); Lefranc, M.-P. et al., In Silico Biol., 5, 0006 (2004) [[Epub]], 5:45-60 (2005); Lefranc, M.-P. et al., Nucleic Acids Res., 33:D593-597 (2005); Lefranc, M.-P. et al., Nucleic Acids Res., 37:D1006-1012 (2009); Lefranc, M.-P. et al., Nucleic Acids Res., 43:D413-422 (2015); Chothia et al., (1989) Nature 342:877; Chothia, C. et al. (1987) J. Mol. Biol. 196:901-917, Al-lazikani et al (1997) J. Molec. Biol. 273:927-948; and Almagro , J. Mol. Recognize. 17:132-143 (2004). See also hgmp.mrc.ac.uk and bioinf.org.uk / abs. As used herein, a CDR may refer to a CDR defined by any method known in the area.Two antibodies with the same CDR mean that the two antibodies have the same amino acid sequence of that CDR, as determined by the same method, for example, the IMGT definition.

[0052] There are three CDRs in each of the variable regions of the heavy chain and the light chain, which are designated CDR1, CDR2, and CDR3 for each of the variable regions. The term “CDR cluster,” as used herein, refers to a group of three CDRs that occur in a single variable region capable of binding to antigen. The exact boundaries of these CDRs have been defined differently according to the different systems. The system described by Kabat (Kabat et al., Sequences of Proteins of Immunological Interest (National Institutes of Health, Bethesda, Md. (1987) and (1991))) not only provides an unambiguous residue numbering system applicable to any variable region of an antibody, but also provides precise residue boundaries that define the three CDRs. These CDRs can be called Kabat CDRs. Subpores of CDRs can be designated as L1, L2, and L3 or H1, H2, and H3, where “L” and “H” designate the light chain and heavy chain regions, respectively.These regions can be called Chothia's CDRs, which have boundaries that overlap with Kabat's CDRs. Other boundaries that define... Petition 870250091425, dated 07 / 10 / 2025, page 23 / 159 15 / 129 CDRs overlapping with Kabat CDRs have been described by Padlan (FASEB J. 9:133-139 (1995)) and MacCallum (J Mol Biol 262(5):732-45 (1996)). Other definitions of CDR boundaries may not strictly follow one of the above systems, but will still overlap with Kabat CDRs, although they may be shortened or lengthened in light of predictions or experimental findings that specific residues or groups of residues, or even entire CDRs, do not significantly impact antigen binding. The methods used here may utilize CDRs defined according to any of these systems, although preferred modalities use CDRs defined by Kabat or Chothia.

[0053] CDR-grafted antibody: As used herein, the term “CDR-grafted antibody” refers to antibodies comprising variable heavy and light chain regions sequences of one species, but in which the sequences of one or more VH and / or VL CDR regions are replaced by CDR sequences of another species, such as antibodies having murine variable heavy and light chain regions in which one or more murine CDRs (e.g., CDR3) have been replaced by human CDR sequences.

[0054] Chimeric antibody: As used herein, the term “chimeric antibody” refers to antibodies comprising sequences of variable heavy and light chain regions from one species and sequences of constant regions from another species, such as antibodies that have murine variable heavy and light chain regions linked to human constant regions.

[0055] Complementary: As used herein, the term “complementary” refers to the ability of two nucleotides or two sets of nucleotides to pair precisely. In particular, complementary is a term that characterizes an extent of hydrogen bonding that causes linking between two nucleotides or two sets of nucleotides. For example, if a base at a position in an oligonucleotide is able to form a hydrogen bond with a base at the corresponding position in a target nucleic acid (e.g., mRNA), then the bases are considered complementary to each other at that position. Base pairs can Petition 870250091425, dated 07 / 10 / 2025, page 24 / 159 16 / 129 include canonical Watson-Crick base pairs and non-Watson-Crick base pairs (e.g., Wobble base pairs and Hoogsteen base pairs). For example, in some embodiments, for complementary base pairs, adenosine (A) type bases are complementary to thymidine (T) type bases or uracil (U) type bases, cytosine (C) type bases are complementary to guanosine (G) type bases, and universal bases such as 3-nitropyrrole or 5-nitroindole can hybridize and are considered complementary to any A, C, U, or T. Inosine (I) has also been considered in the art as a universal base and is considered complementary to any A, C, U, or T.

[0056] Conservative amino acid substitution: As used herein, a “conservative amino acid substitution” refers to an amino acid substitution that does not alter the relative charge or size characteristics of the protein in which the amino acid substitution is made. Variants may be prepared according to methods for altering the polypeptide sequence known to one with common skill in the art, such as those found in references compiling such methods, for example, Molecular Cloning: A Laboratory Manual, J. Sambrook, et al., eds., Fourth Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 2012, or Current Protocols in Molecular Biology, FM Ausubel, et al., eds., John Wiley & Sons, Inc., New York. Conservative amino acid substitutions include substitutions made between amino acids within the following groups: (a) M, I, L, V; (b) F, Y, W; (c) K, R, H; (d) A, G; (e) S, T; (f) Q, N; and (g) E, D.

[0057] Cross-reactive: As used herein, the term “cross-reactive” refers to a property of the agent that is able to bind specifically to more than one antigen of a similar type or class (e.g., multiple homologous, paralogous, or orthologous antigens) with similar affinity or avidity. For example, in some embodiments, an antibody that is cross-reactive against human and non-human primate antigens of a similar type or class (e.g., a human KLK5 and a non-human primate KLK5, a human KLK7 and a non-human primate KLK7) is able Petition 870250091425, dated 07 / 10 / 2025, p. 25 / 159 17 / 129 to bind to human antigen and non-human primate antigens with similar affinity or avidity. In some embodiments, an antibody is cross-reactive against a human antigen and a rodent antigen of a similar type or class. In some embodiments, an antibody is cross-reactive against a rodent antigen and a non-human primate antigen of a similar type or class. In some embodiments, an antibody is cross-reactive against a human antigen, a non-human primate antigen, and a rodent antigen of a similar type or class.

[0058] Dual inhibitor antibody: As used herein, the term “dual inhibitor antibody” refers to an antibody that targets at least two (e.g., two, three) different antigens through a common distinct antigen-specific binding site and inhibits the activity of those antigens. In some embodiments, a dual inhibitor antibody targets at least two different proteins (e.g., expressed from two different genes (e.g., endogenous genes, e.g., homologs, paralogs)) through a common distinct antigen-specific binding site and inhibits the activity of at least two different proteins (e.g., enzymes, such as proteases).In some embodiments, a dual inhibitor antibody targets at least two different proteases (e.g., expressed by two different endogenous genes, e.g., KLK5 and KLK7) via a common and distinct antigen-specific binding site and inhibits the activity of at least the two different proteases. In some embodiments, the common distinct antigen-specific binding site binds to a similar (e.g., homologous) domain shared between the at least two different antigens. For example, in some embodiments, the common distinct antigen-specific binding site binds to a similar (e.g., homologous) catalytic domain or substrate-binding site shared between the at least two different enzymes, e.g., proteases. In some embodiments, the common distinct antigen-specific binding site of a dual inhibitor antibody comprises amino acids from one. Petition 870250091425, dated 07 / 10 / 2025, p. 26 / 159 18 / 129 or more antibody complementarity-determining regions. In some embodiments, the common distinct antigen-specific binding site of a dual inhibitor antibody is within a variable heavy chain region and / or a variable light chain region of the antibody. In some embodiments, the common distinct antigen-specific binding site of a dual inhibitor antibody comprises one or more complementarity-determining regions of a variable heavy chain region and / or a variable light chain region of the antibody. In some embodiments, the common distinct antigen-specific binding site of a dual inhibitor antibody comprises HC CDR1, HC CDR2, HC CDR3, LC CDR1, LC CDR2, and LC CDR3 of a variable heavy chain region and a variable light chain region of the antibody.In some embodiments, a dual inhibitor antibody binds specifically to two different proteins expressed from two different genes (e.g., KLK5 and KLK7).

[0059] Effective amount: As used herein, “an effective amount” refers to the amount of each active agent (e.g., anti-KLK5 / KLK7 antibody) required to confer a desired effect (e.g., a therapeutic effect in the subject), alone or in combination with one or more other active agents. In some embodiments, the therapeutic effect is the reduction of KLK5 and / or KLK7 activity and / or relief of diseases (e.g., Netherton syndrome, eosinophilic esophagitis, and atopic dermatitis) or related symptoms, e.g., improvement of barrier function.

[0060] Framework: As used herein, the term “framework” or “framework sequence” refers to the remaining sequences of a variable region minus the CDRs. Because the exact definition of a CDR sequence can be determined by different systems, the meaning of a framework sequence is subject to correspondingly different interpretations. The six CDRs (CDR-L1, CDR-L2, and CDR-L3 of the light chain and CDR-H1, CDR-H2, and CDR-H3 of the heavy chain) also divide the framework regions in the light chain and heavy chain into four subregions (FR1, FR2, FR3, and FR4) in each Petition 870250091425, dated 07 / 10 / 2025, page 27 / 159 19 / 129 chain, in which CDR1 is positioned between FR1 and FR2, CDR2 between FR2 and FR3, and CDR3 between FR3 and FR4. Without specifying the particular subregions as FR1, FR2, FR3, or FR4, a framework region, as referred to by others, represents the combined FRs within the variable region of a single naturally occurring immunoglobulin chain. As used herein, an FR represents one of the four subregions, and FRs represent two or more of the four subregions that constitute a framework region. Acceptor sequences for human heavy and light chains are known in the art. In one embodiment, the acceptor sequences known in the art can be used in the antibodies disclosed herein.

[0061] Human antibody: The term “human antibody,” as used herein, is intended to include antibodies with variable and constant regions derived from human germline immunoglobulin sequences. The human antibodies of disclosure may include amino acid residues not encoded by human germline immunoglobulin sequences (e.g., mutations introduced by random or site-specific mutagenesis in vitro or by somatic mutation in vivo), for example in CDRs and in particular in CDR3. However, the term “human antibody,” as used herein, is not intended to include antibodies in which germline-derived CDR sequences from another mammalian species, such as a mouse, have been grafted onto human framework sequences.

[0062] Humanized antibody: As used herein, the term “humanized antibody” refers to antibodies comprising sequences of variable heavy and light chain regions from a non-human species (e.g., a mouse), but in which at least a portion of the Vh and / or Vl sequence has been altered to be more “human-like,” that is, more similar to human germline variable sequences. One type of humanized antibody is a CDR-grafted antibody, in which human CDR sequences are introduced into non-human VH and VL sequences to replace the corresponding non-human CDR sequences. In one embodiment, they are Petition 870250091425, dated 07 / 10 / 2025, p. 28 / 159 20 / 129 provided humanized antibodies. Such antibodies can be generated by obtaining murine monoclonal antibodies using traditional hybridoma technology followed by humanization using in vitro genetic engineering, such as those disclosed in publication PCT No. WO 2005 / 123126 A2 by Kasaian et al.

[0063] Humanized antibodies are human immunoglobulins (receptor antibody) in which residues of a complementary determinant region (CDR) of the receptor are replaced by residues of a CDR from a non-human species (donor antibody), such as mouse, rat, or rabbit, having the desired specificity, affinity, and capacity. In some embodiments, residues of the Fv framework region (FR) of the human immunoglobulin are replaced by corresponding non-human residues. Furthermore, the humanized antibody may comprise residues that are not found in either the receptor antibody or the imported CDR or framework sequences, but are included to further refine and optimize antibody performance.In general, a humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all CDR regions correspond to those of a non-human immunoglobulin and all or substantially all FR regions are those of a human immunoglobulin consensus sequence. Ideally, the humanized antibody will also comprise at least a portion of a constant region or immunoglobulin (Fc) domain, typically that of a human immunoglobulin. Antibodies may have modified Fc regions as described in WO 99 / 58572. Other forms of humanized antibodies have one or more CDRs (one, two, three, four, five, six) that are altered relative to the original antibody, which are also called one or more CDRs derived from one or more CDRs of the original antibody. Humanized antibodies may also involve affinity maturation.

[0064] In some modalities, humanization is achieved by grafting CDRs (for example, as shown in Tables 1 or 2) onto Petition 870250091425, dated 07 / 10 / 2025, page 29 / 159 21 / 129 human variable domains (e.g., human variable domain IGKV1NL1*01 and IGHV1-3*01). In some embodiments, an antibody of the present disclosure is a humanized variant comprising one or more amino acid substitutions (e.g., in the VH framework region) compared to any of the VHs listed in Tables 1 or 2 and / or one or more amino acid substitutions (e.g., in the VL framework region) compared to any of the VLs listed in Tables 1 or 2.

[0065] Isolated antibody: An “isolated antibody,” as used herein, refers to an antibody that is substantially free of other antibodies with different antigenic specificities (e.g., an isolated dual inhibitor antibody that specifically binds to KLK5 and KLK7 is substantially free of antibodies that specifically bind to antigens other than KLK5 and KLK7). An isolated antibody may, however, have cross-reactivity with other antigens in some embodiments. In addition, an isolated antibody may be substantially free of other cellular materials and / or chemicals.

[0066] Kabat Numbering: As used herein, the terms “Kabat numbering,” “Kabat definitions,” and “Kabat labeling” are used interchangeably herein. These terms, which are recognized in the art, refer to a numbering system of amino acid residues that are more variable (i.e., hypervariable) than other amino acid residues in the variable regions of the heavy and light chains of an antibody, or an antigen-binding portion thereof (Kabat et al. (1971) Ann. NY Acad. Sci. 190:382-391 and, Kabat, EA, et al. (1991) Sequences of Proteins of Immunological Interest, Fifth Edition, U.S. Department of Health and Human Services, NIH Publication No. 91-3242). For the variable region of the heavy chain, the hypervariable region ranges from amino acid positions 31 to 35 for CDR1, amino acid positions 50 to 65 for CDR2, and amino acid positions 95 to 102 for CDR3. For the variable region of the light chain, the hypervariable region ranges from amino acid positions Petition 870250091425, dated 07 / 10 / 2025, p. 30 / 159 22 / 129 to 34 for CDR1, amino acid positions 50 to 56 for CDR2, and amino acid positions 89 to 97 for CDR3.

[0067] Multispecific Antigen-Binding Molecule: As used herein, the term “multispecific antigen-binding molecule” refers to a molecule comprising two or more antigen-specific binding sites. In some embodiments, a multispecific antigen-binding molecule is a multispecific antibody (e.g., a bispecific antibody).

[0068] Multispecific Antibody: As used herein, the term “multispecific antibody” refers to an antibody comprising at least two distinct antigen-specific binding sites or at least two antibodies linked (covalently or non-covalently) that, combined, comprise at least two distinct antigen-specific binding sites. In some embodiments, a multispecific antibody is a bispecific antibody. Non-limiting examples of multispecific antibody formats or architectures are provided in Sawant MS, et al., Toward Drug-Like Multispecific Antibodies by Design, Int J Mol Sci. October 12, 2020;21(20):7496; Klein C, et al., The use of CrossMAb technology for the generation of bi- and multispecific antibodies, Mabs 2016 Aug-Sep;8(6):1010-20; and Brinkmann U and Kontermann EE, The manufacture of bispecific antibodies, Mabs. 2017 Feb / Mar;9(2):182-212, the entire content of each of which is incorporated here by reference in its entirety.

[0069] Recombinant antibody: As used herein, the term “recombinant antibody” is intended to include all antibodies that are prepared, expressed, created, or isolated by recombinant means, such as antibodies expressed using a recombinant expression vector transfected into a host cell (described in more detail in this disclosure), including, for example, antibodies isolated from a recombinant combinatorial human antibody library (Hoogenboom HR, (1997) TIB Tech. 15:62-70; Azzazy H. and Highsmith WE, (2002) Clin. Biochem. 35:425 Petition 870250091425, dated 07 / 10 / 2025, page 31 / 159 23 / 129 445; Gavilondo JV and Larrick JW (2002) BioTechniques 29: 128-145; Hoogenboom H. and Chames P. (2000) Immunology Today 21: 371-378), antibodies isolated from an animal (e.g., a mouse) that is transgenic for human immunoglobulin genes (see, for example, Taylor, LD, et al. (1992) Nucl. Acids Res. 20: 6287-6295; Kellermann SA, and Green LL (2002) Current Opinion in Biotechnology 13:593-597; Little M. et al (2000) Immunology Today 21:364-370) or antibodies prepared, expressed, created, or isolated by any other means involving the splicing of human immunoglobulin gene sequences to other DNA sequences. In some embodiments, recombinant human antibodies are provided here. In certain embodiments, such recombinant human antibodies have variable and constant regions derived from human germline immunoglobulin sequences.In certain embodiments, however, such recombinant human antibodies are subjected to in vitro mutagenesis (or, when a transgenic animal for human Ig sequences is used, in vivo somatic mutagenesis) and thus the amino acid sequences of the Vh and Vl regions of the recombinant antibodies are sequences that, although derived from and related to the human germline Vh and Vl sequences, may not naturally exist in the germline repertoire of human antibodies in vivo. One embodiment of the disclosure provides fully human antibodies, for example, capable of binding to human KLK5 or KLK7, which can be generated using appropriate techniques, such as, but not limited to, using human Ig phage libraries, such as those disclosed in Jermutus et al., PCT publication no. WO 2005 / 007699 A2.

[0070] Selective: As used herein, the term “selective” or “selectively” refers to the ability of a molecule to produce an effect (e.g., inhibit, antagonize, agonize, etc.) with respect to its target molecule compared to a reference molecule. For example, a molecule that selectively inhibits its target molecule means that this molecule is able to inhibit its target molecule to a degree that is distinguishable from a reference molecule. Petition 870250091425, dated 07 / 10 / 2025, p. 32 / 159 24 / 129 reference in an inhibition assay or other inhibitory context. For example, with respect to an inhibitor, the term “selectively inhibits” refers to the inhibitor’s ability to inhibit its target molecule to a degree that is distinguishable from a reference molecule that is not substantially inhibited in an inhibition assay, for example, to an extent that allows selective inhibition of the target molecule, as described herein. Once the reaction is complete, the signal produced by the inhibition of the target molecule can be measured. The maximum concentration of the inhibitor for the target molecule and the reference molecule can be calculated.

[0071] Binds specifically: As used herein, the term “binds specifically” refers to the ability of a molecule to bind to a binding partner with a degree of affinity or avidity that allows the molecule to be used to distinguish the binding partner from an appropriate control in a binding assay or other binding context. With respect to an antibody, the term “binds specifically” refers to the ability of the antibody to bind to a specific antigen with a degree of affinity or avidity, compared to one or more appropriate reference antigens, that allows the antibody to be used to distinguish the specific antigen from others, as described herein. In some embodiments, an antibody binds specifically to a target if the antibody has a target-binding Kd of at least about 10⁻⁴M, 10⁻⁵M, 10⁻⁶M, 10⁻⁷M, 10⁻⁸M, 10⁻⁹M, 10⁻¹⁰M, 10⁻¹¹M, 10⁻¹²M, 10⁻¹³M or less.In some forms, an antibody binds specifically to KLK5 or KLK7.

[0072] Subject: As used herein, the term “subject” refers to a mammal. In some modalities, a subject is a non-human primate or a rodent. In some modalities, a subject is a human. In some modalities, a subject is a patient, for example, a human patient who has or is suspected of having a disease.

[0073] Treatment: As used herein, the term “treatment” or “treatment” refers to the application or administration of a composition. Petition 870250091425, dated 07 / 10 / 2025, page 33 / 159 25 / 129 including one or more active agents (e.g., anti-KLK5 / KLK7 antibodies) to a subject who has a target disease or disorder, a symptom of the disease / disorder, or a predisposition to the disease / disorder, for the purpose of curing, healing, alleviating, altering, remedying, improving, enhancing, or affecting the disorder, the symptom of the disease, or the predisposition to the disease or disorder. Alleviating a target disease / disorder includes slowing or preventing the development or progression of the disease, or reducing the severity of the disease. It will be understood that references to treatment or treatment may also refer to antibodies, including dual inhibitor antibodies for use in such methods. II. Dual inhibitory antibodies targeting KLK5 and KLK7 (a) Anti-KLK5 / KLK7 antibodies

[0074] In some embodiments, a dual inhibitory antibody targeting KLK5 and KLK7 (referred to as an anti-KLK5 / KLK7 antibody) is an antibody specific for Kallikrein-5 (KLK5) and KLK7 through a common and specific antigen-binding site. In some aspects, antibodies are provided here that bind to KLK5 (e.g., human KLK5 or mouse KLK5) and KLK7 (e.g., human KLK7 or mouse KLK7) with high specificity and affinity through a common antigen-binding site. In some embodiments, the anti-KLK5 / KLK7 antibody described here specifically binds to a KLK5 epitope that is exposed or becomes exposed to an antibody, and to a KLK7 epitope that is exposed or becomes exposed to an antibody. In some embodiments, the anti-KLK5 / KLK7 antibodies provided here specifically bind to KLK5 from humans, non-human primates, mice, rats, etc.In some embodiments, the anti-KLK5 antibodies provided here specifically bind to human KLK5.

[0075] In some embodiments, an anti-KLK5 / KLK7 antibody is not a bispecific antibody or a bispecific antigen-binding molecule in which KLK5 binding is conferred by a binding site within the antibody and the Petition 870250091425, dated 07 / 10 / 2025, p. 34 / 159 26 / 129 KLK7 binding is conferred by another binding site within the antibody.

[0076] In some embodiments, an anti-KLK5 / KLK7 antibody described herein can be characterized by reference to certain functional properties. In some embodiments, an anti-KLK5 / KLK7 antibody described herein binds specifically to KLK5 and KLK7. In some embodiments, an anti-KLK5 / KLK7 antibody binds specifically to the active form of KLK5 and KLK7. In some embodiments, an anti-KLK5 / KLK7 antibody does not bind to the inactive form (the proform) of KLK5 and KLK7. In some embodiments, the antibody binds specifically to the active form of KLK5 and the active form of KLK7, but does not bind specifically to the inactive form of KLK5 or the inactive form of KLK7. In some embodiments, the antibody binds detectably to the active form of KLK5 and the active form of KLK7, but under the same or comparable conditions does not bind detectably to the inactive form of KLK5 or the inactive form of KLK7. In some embodiments, an anti-KLK5 / KLK7 antibody inhibits the activity of KLK5 and KLK7 proteases.In some embodiments, an anti-KLK5 / KLK7 antibody is not cleaved by KLK5 or KLK7 when bound to KLK5 or KLK7. In some embodiments, an anti-KLK5 / KLK7 antibody competes with SPINK5 and / or leupeptin for binding to the active site of KLK5 and KLK7. In some embodiments, an anti-KLK5 / KLK7 antibody reduces hyperkeratosis and scaling. In some embodiments, an anti-KLK5 / KLK7 antibody reduces stratum corneum thickness. In some embodiments, an anti-KLK5 / KLK7 antibody reduces inflammation and epidermal effects. Kallikrein-5, also known as stratum corneum tryptic enzyme (SCTE), is a serine protease expressed in the epidermis and encoded by the KLK5 gene. The KLK5 gene is one of fifteen members of the kallikrein subfamily located in a cluster on the chromosome. Its expression is positively regulated by estrogens and progestogens. KLK5 is expressed in the stratum granulosum and stratum corneum. In some modalities, KLK5 regulates epidermal desquamation.In some embodiments, KLK5 regulates epidermal desquamation in conjunction with another member of the kallikrein family of proteases (e.g., KLK7 and / or...). Petition 870250091425, dated 07 / 10 / 2025, p. 35 / 159 27 / 129 KLK14). In some embodiments, KLK5 degrades proteins that form the epidermis (e.g., stratum corneum, stratum lucidum, stratum granulosum, stratum spinosum, or stratum basale). In some embodiments, KLK5 degrades proteins that form the stratum corneum and / or stratum granulosum (e.g., corneodesmosin (CDSN), desmoglein 1 (DSG1), and desmocollin 1 (DSC1), etc.). In the epidermis (e.g., stratum granulosum and stratum corneum), KLK5 is expressed in an inactive form (sometimes called a proform or pro-form), proKLK5, and can self-activate. When activated, KLK5 can, through proteolytic cleavage, convert proKLK7 and proKLK14 into active forms. Active KLK14 is then able to activate newly produced proKLK5, thus creating a positive feedback loop (see, for example, Nauroy et al., Kallikreins: Essential epidermal messengers for regulation of the skin microenvironment during homeostasis, repair and disease, Matrix Biol Plus. 2019;6-7:100019).KLK7 and KLK14 also degrade proteins that form the stratum corneum and / or stratum granulosum (e.g., corneodesmosin (CDSN), desmoglein 1 (DSG1), and desmocollin 1 (DSC1), etc.). Structural proteins, such as CDSN, DSG1, and DSC1, are adhesive proteins of the extracellular part of corneodesmosomes, the junctional structures that mediate the cohesion of corneocytes. Degradation of these proteins on the epidermal surface leads to desquamation, which can lead to defects in the skin barrier (e.g., detachment of the stratum corneum, decreased barrier permeability, allergy, and inflammation, etc.). KLK5 and KLK7 have been implicated in this process (see, for example, Caubet et al., Degradation of corneodesmosome proteins by two serine proteases of the kallikrein family, SCTE / KLK5 / hK5 and SCCE / KLK7 / hK7, Journal of Investigative Dermatology, Volume 122, Issue 5, May 2004, Pages 1235-1244).Inhibition of KLK5 and / or KLK7 promotes improved skin barrier integrity and reduced inflammation (e.g., Chavarria-Smith et al., Dual antibody inhibition of KLK5 and KLK7 for Netherton syndrome and atopic dermatitis, SCIENCE TRANSLATIONAL MEDICINE, December 14, 2022, Vol. 14, Issue 675). Petition 870250091425, dated 07 / 10 / 2025, page 36 / 159 28 / 129

[0077] Kallikrein-7 is a serine protease that in humans is encoded by the KLK7 gene. KLK7 is characterized as a stratum corneum chemolytic enzyme (SCCE). [It is the seventh member of the human kallikrein family, which includes fifteen homologous serine proteases located on chromosome 19. KLK7 is secreted as an inactive zymogen (e.g., in the stratum granulosum layer of the epidermis), requiring proteolytic cleavage to be activated. In some embodiments, KLK5 or matriptase activates KLK7. Once activated, KLK7 is capable of cleaving proteins that form the stratum corneum and / or stratum granulosum (e.g., corneodesmosin (CDSN), desmoglein 1 (DSG1), and desmocollin 1 (DSC1), etc.) (see, for example, Caubet et al. (May 2004). Degradation of corneodesmosome proteins by two serine proteases of the kallikrein family, SCTE / KLK5 / hK5 and SCCE / KLK7 / hK7).These proteins constitute the extracellular component of corneodesmosomes, cohesive intercellular structures that link the intermediate filaments of adjacent cells in the stratum corneum. In some embodiments, proteolysis of corneodesmosomes leads to epidermal desquamation (i.e., the shedding of corneocytes from the outer layer of the epidermis). In some embodiments, the combined role of KLK5 and KLK7 suggests that the cutaneous KLK cascade is responsible for coordinating desquamation. KLK7 is a chymotrypsin-like serine protease that cleaves proteins at tyrosine, phenylalanine, or leucine residues. In some embodiments, KLK7 dysregulation has been associated with various skin disorders, including atopic dermatitis, psoriasis, and Netherton syndrome. These diseases are characterized by excessively dry, scaly, and inflamed skin due to disruption of skin homeostasis and proper barrier function.

[0078] In some embodiments, an anti-KLK5 / KLK7 antibody described herein binds specifically to an epitope on human KLK5. Exemplary amino acid sequences of human KLK5 are shown in NCBI accession numbers NP_001070959.1, NP_001070960.1 or NP_036559.1 and in UniProt accession numbers: Q8IU55, Q6S9W8, M0QXX2, Q9P0G3, Petition 870250091425, dated 07 / 10 / 2025, p. 37 / 159 29 / 129 A0A2I2MP48 or A0A2I2MP49, whose entire sequences are incorporated herein by reference.

[0079] In some embodiments, an anti-KLK5 / KLK7 antibody described herein binds specifically to an epitope on mouse KLK5. Exemplary amino acid sequences of mouse KLK5 are presented in NCBI accession numbers NP_081082.1, XP_006541213.1, XP_006541214.1, XP_006541215.1, XP_036009294.1 or XP_036009295.1 and the UniProt accession numbers P15945 or Q9D140, the entire sequences of which are incorporated herein by reference.

[0080] In some embodiments, an anti-KLK5 / KLK7 antibody described herein binds specifically to an epitope on human KLK7 via the same antigen-binding site that binds to KLK5 (e.g., human KLK5 or mouse KLK5). Exemplary amino acid sequences of human KLK7 are presented in NCBI accession numbers NP_001193982.1, NP_001230055.1, NP_005037.1, NP_644806.1 and UniProt accession numbers: M0QYU8, Q6DTY1, X2J289, X2J4X7, A0A024R4H6, P49862, A0A2H4GDB2 and A0A2H4GDB6, the complete sequences of which are incorporated herein by reference.

[0081] In some embodiments, an anti-KLK5 / KLK7 antibody described herein binds specifically to an epitope on mouse KLK7 via the same antigen-binding site that binds to KLK5 (e.g., human KLK5 or mouse KLK5). Exemplary amino acid sequences of mouse KLK7 are presented in NCBI accession numbers NP_036002.1 and UniProt accession numbers Q91VE3, the complete sequences of which are incorporated herein by reference.

[0082] In some embodiments, an anti-KLK5 / KLK7 antibody described herein binds specifically to an epitope on KLK5 (e.g., the catalytic domain / pocket of human KLK5 or mouse KLK5) and an epitope on KLK7 (e.g., the catalytic domain / pocket of human KLK7 or mouse KLK7). In some embodiments, an anti-Petition 870250091425, dated 07 / 10 / 2025, p. 38 / 159 30 / 129 The KLK5 / KLK7 antibody described herein prevents KLK5 (e.g., human or mouse KLK5) and KLK7 (e.g., human or mouse KLK7) from cleaving their substrates. In some embodiments, an anti-KLK5 antibody described herein binds to a fragment of KLK5 (e.g., human or mouse KLK5) and a fragment of KLK7 (e.g., human or mouse KLK7). The KLK5 and / or KLK7 fragment (e.g., human or mouse) can be between about 5 and about 425 amino acids, between about 10 and about 400 amino acids, between about 50 and about 350 amino acids, between about 100 and about 300 amino acids, between about 150 and about 250 amino acids, between about 200 and about 300 amino acids, between about 75 and about 150 amino acids, between about 25 and about 100 amino acids, or between about 10 and about 30 amino acids in length.Not wishing to be confined to any particular theory, and in some embodiments, a heavy chain (HC) complementarity-determining region 3 (CDR3) of any of the anti-KLK5 / KLK7 antibodies described herein inhibits KLK5 (e.g., human or mouse KLK5) and KLK7 (e.g., human or mouse KLK7) by binding to the catalytic domain / pocket of KLK5.

[0083] In some embodiments, an anti-KLK5 / KLK7 antibody described herein inhibits KLK5 protease activity, KLK7 protease activity, or both KLK5 and KLK7 protease activities. In some embodiments, the anti-KLK5 / KLK7 antibody inhibits the cleavage of KLK5 (e.g., human KLK5 or mouse KLK5) from BOC-Val-Pro-Arg-AMC with an IC50 of less than 30 nM, less than 25 nM, less than 20 nM, less than 15 nM, less than 10 nM, less than 5 nM, less than 3 nM, less than 2.5 nM, less than 2 nM or less than 1.5 nM, less than 1 nM, less than 0.5 nM, less than 0.3 nM, less than 0.25 nM, less than 0.2 nM or less than 0.1 nM. In some embodiments, the anti-KLK5 / KLK7 antibody inhibits the cleavage of KLK5 (e.g., human KLK5 or mouse KLK5) from BOC-Val-Pro-Arg-AMC with an IC50 in the range of 0.1 nM to 30 nM, 0.1 nM to 20 nM, 0.1 nM to 10 nM, 0.1 nM to 5 nM, 0.1 nM to 2.5 nM, 0.1 nM to 2 nM, 0.1 nM to 1 nM, 0.1 nM to 0.5 nM, 0.1 nM to 0.25 nM, 0.1 nM to 50 nM. Petition 870250091425, dated 07 / 10 / 2025, p. 39 / 159 31 / 129 0.1 nM to 40 nM, 0.1 nM to 30 nM, 0.1 nM to 20 nM, 0.1 nM to 10 nM, 0.1 nM to 5 nM, 0.1 nM to 2.5 nM, 0.1 nM to 2 nM, 0.1 nM to 1 nM, 0.1 nM to 0.9 nM, 0.1 nM to 0.8 nM, 0.1 nM to 0.7 nM, 0.1 nM to 0.6 nM, 0.1 nM to 0.5 nM, 0.1 nM to 0.4 nM, 0.1 nM to 0.3 nM, 0.1 nM to 0.25 nM, 0.1 nM to 0.2 nM, 0.1 nM to 0.15 nM, 0.15 nM to 0.2 nM, 0.15 nM to 0.25 nM, 0.15 nM to 0.3 nM, 0.15 nM to 0.4 nM, 0.15 nM to 0.5 nM, 0.15 nM to 1 nM, 0.2 nM to 30 nM, 0.2 nM to 20 nM, 0.2 nM to 10 nM, 0.2 nM to 5 nM, 0.2 nM to 2.5 nM, 0.2 nM to 2 nM, 0.2 nM to 1 nM, 0.2 nM to 0.5 nM, 0.2 nM to 0.2 nM, 0.2 nM to 50 nM, 0.2 nM to 40 nM, 0.2 nM to 30 nM, 0.2 nM to 20 nM, 0.2 nM to 10 nM, 0.2 nM to 5 nM, 0.2 nM to 2.5 nM, 0.2 nM to 2 nM, 0.2 nM to 1 nM, 0.2 nM to 0.9 nM, 0.2 nM to 0.8 nM, 0.2 nM to 0.7 nM, 0.2 nM to 0.6 nM, 0.2 nM to 0.5 nM, 0.2 nM to 0.4 nM, 0.2 nM to 0.3 nM, 0.2 nM to 0.25 nM, 1 nM to 30 nM, 1 nM to 20 nM, 1 nM to 10 nM, 1 nM to 5 nM, 1 nM to 2.5 nM, 1 nM to 2 nM, 1 nM to 3 nM, 1 nM to 5.5 nM, 1.5 nM to 2 nM, 1.5 nM to 3 nM, 1.5 nM to 5.5 nM, 2 nM to 5 nM,2 nM to 4 nM, 2 nM to 5.5 nM, 3 nM to 5.5 nM, 4 nM to 5.5 nM, 3 nM to 30 nM, 3 nM to 20 nM, 3 nM to 10 nM, 3 nM to 5 nM, 3 nM to 2.5 nM, 3 nM to 4 nM, 3 nM to 5.5 nM, 5 nM to 30 nM, 5 nM to 20 nM, 5 nM to 10 nM, 5 nM to 9 nM, 5 nM to 8 nM, 5 nM to 7 nM, 5 nM to 6 nM, 5 nM to 5.5 nM, 10 nM to 30 nM, 10 nM to 25 nM, 10 nM to 20 nM, 10 nM to 18 nM, 10 nM to 15 nM, 10 nM to 12 nM, 12 nM to 20 nM, 12 nM to 25 nM, 12 nM to 16 nM, 12 nM to 18 nM, 12 nM to 20 nM, 12 nM to 24 nM, 12 nM to 28 nM, 12 nM to 30 nM, 15 nM to 30 nM, 15 nM to 25 nM, 15 nM to 20 nM, 15 nM to 18 nM, 18 nM to 30 nM, 18 nM to 25 nM, 18 nM to 20 nM, 20 nM to 30 nM, 20 nM to 25 nM, 20 nM to 22 nM, 20 nM to 24 nM, 20 nM to 26 nM, 20 nM to 28 nM, 22 nM to 30 nM, 22 nM to 25 nM, 22 nM to 28 nM, 24 nM to 30 nM, 24 nM to 25 nM, 24 nM to 26 nM ou 24 nM to 28 nM. Em algumas modalities, o anticopo anti-KLK5 / KLK7 inibe a cleavagem de KLK7 de KHLF-AMC com um IC50 de menos de 6 nM, menos de 5 nM, menos de 4 nM, menos de 3 nM, menos de 2,5 nM, menos de 2 nM or menos de 1,5 nM,less than 1 nM, less than 0.5 nM, less than 0.4 nM, less than 0.3 nM, less than 0.2 nM, less than 0.16 nM, less than 0.1 nM, or less than 0.05 nM. In some embodiments, the anti-KLK5 / KLK7 antibody inhibits the cleavage of KLK7 from KHLF-AMC with an IC50 in the range, Petition 870250091425, dated 07 / 10 / 2025, p. 40 / 159 32 / 129 of 0.1 nM to 30 nM, 0.1 nM to 20 nM, 0.1 nM to 10 nM, 0.1 nM to 5 nM, 0.1 nM to 2.5 nM, 0.1 nM to 2 nM, 0.1 nM to 1 nM, 0.1 nM to 0.5 nM, 0.1 nM to 0.25 nM, 0.1 nM to 50 nM, 0.1 nM to 40 nM, 0.1 nM to 30 nM, 0.1 nM to 20 nM, 0.1 nM to 10 nM, 0.1 nM to 5 nM, 0.1 nM to 2.5 nM, 0.1 nM to 2 nM, 0.1 nM to 1 nM, 0.1 nM to 0.9 nM, 0.1 nM to 0.8 nM, 0.1 nM to 0.7 nM, 0.1 nM to 0.6 nM, 0.1 nM to 0.5 nM, 0.1 nM to 0.4 nM, 0.1 nM to 0.3 nM, 0.1 nM to 0.25 nM, 0.1 nM to 0.2 nM, 0.1 nM to 0.15 nM, 0.15 nM to 0.2 nM, 0.15 nM to 0.25 nM, 0.15 nM to 0.3 nM, 0.15 nM to 0.4 nM, 0.15 nM to 0.5 nM, 0.15 nM to 1 nM, 0.2 nM to 30 nM, 0.2 nM a 20 nM, 0.2 nM a 10 nM, 0.2 nM a 5 nM, 0.2 nM a 2.5 nM, 0.2 nM a 2 nM, 0.2 nM a 1 nM, 0.2 nM a 0.5 nM, 0.2 nM a 0.2 nM, 0.2 nM a 50 nM, 0.2 nM a 40 nM, 0.2 nM a 30 nM, 0.2 nM a 20 nM, 0.2 nM a 10 nM, 0.2 nM a 5 nM, 0.2 nM a 2.5 nM, 0.2 nM a 2 nM, 0.2 nM a 1 nM, 0.2 nM a 0.9 nM, 0.2 nM a 0.8 nM, 0.2 nM to 0.7 nM, 0.2 nM to 0.6 nM, 0.2 nM to 0.5 nM, 0.2 nM to 0.4 nM, 0.2 nM to 0.3 nM, 0.2 nM to 0.25 nM,1 nM to 30 nM, 1 nM to 20 nM, 1 nM to 10 nM, 1 nM to 5 nM, 1 nM to 2.5 nM, 1 nM to 2 nM, 1 nM to 3 nM, 1 nM to 5.5 nM, 1.5 nM to 2 nM, 1.5 nM to 3 nM, 1.5 nM to 5.5 nM, 2 nM to 5 nM, 2 nM to 4 nM, 2 nM to 5.5 nM, 3 nM to 5.5 nM, 4 nM to 5.5 nM, 3 nM to 30 nM, 3 nM to 20 nM, 3 nM to 10 nM, 3 nM to 5 nM, 3 nM to 2.5 nM, 3 nM to 4 nM, 3 nM to 5.5 nM, 5 nM to 30 nM, 5 nM to 20 nM, 5 nM to 10 nM, 5 nM to 9 nM, 5 nM to 8 nM, 5 nM to 7 nM, 5 nM to 6 nM, 5 nM to 5.5 nM, 10 nM to 30 nM, 10 nM to 25 nM, 10 nM to 20 nM, 10 nM to 18 nM, 10 nM to 15 nM, 10 nM to 12 nM, nM to 20 nM, 12 nM to 25 nM, 12 nM to 16 nM, 12 nM to 18 nM, 12 nM to 20 nM, nM to 24 nM, 12 nM to 28 nM, 12 nM to 30 nM, 15 nM to 30 nM, 15 nM to 25 nM, nM to 20 nM, 15 nM to 18 nM, 18 nM to 30 nM, 18 nM to 25 nM, 18 nM to 20 nM, nM to 30 nM, 20 nM to 25 nM, 20 nM to 22 nM, 20 nM to 24 nM, 20 nM to 26 nM, nM to 28 nM, 22 nM to 30 nM, 22 nM to 25 nM, 22 nM to 28 nM, 24 nM to 30 nM, nM to 25 nM, 24 nM to 26 nM or 24 nM to 28 n.M.,

[0084] In some embodiments, an anti-KLK5 / KLK7 antibody described herein binds specifically to the active form of KLK5, KLK7, or KLK5 and KLK7. In some embodiments, the anti-KLK5 / KLK7 antibody described herein does not bind to the inactive form of KLK5, KLK7, or KLK5 and KLK7. In some embodiments, the Petition 870250091425, dated 07 / 10 / 2025, p. 41 / 159 The anti-KLK5 / KLK7 antibody described herein binds specifically to the active form of KLK5, the active form of KLK7, or both the active form of KLK5 and the active form of KLK7, but does not bind specifically to the inactive form of KLK5, the inactive form of KLK7, or both the inactive form of KLK5 and the inactive form of KLK7. In some embodiments, the anti-KLK5 / KLK7 antibody described herein binds detectably to the active form of KLK5, the active form of KLK7, or both the active form of KLK5 and the active form of KLK7, but under the same or comparable conditions does not bind detectably to the inactive form of KLK5, the inactive form of KLK7, or both the inactive form of KLK5 and the inactive form of KLK7. In some embodiments, an anti-KLK5 / KLK7 antibody described herein binds specifically to the active site of KLK5, KLK7, or both KLK5 and KLK7. The active site of KLK5 and / or KLK7 is the site where the KLK5 and / or KLK7 substrate molecules bind to undergo cleavage.The active site may also be known as the catalytic domain or catalytic triad. In some embodiments, the active site (i.e., catalytic domain or catalytic triad) of KLK5 or KLK7 consists of the amino acids Ser195, His57, and Asp102 of KLK5 or KLK7 (see, for example, Goettig et al., Natural and synthetic inhibitors of kallikrein-related peptidases (KLKs), Biochimie. 2010 Nov; 92(11): 1546-1567).

[0085] In some embodiments, the antibodies described herein are optimized (e.g., matured affinity) versions of the parental antibody. In some embodiments, an antibody described herein binds specifically to a KLK5 (e.g., a human or mouse KLK5) and a KLK7 (e.g., a human or mouse KLK7) with binding affinity (e.g., as indicated by Kd) of less than about 10⁻⁴M, less than 10⁻⁵M, less than 10⁻⁶M, less than 10⁻⁷M, less than 10⁻⁸M, less than 10⁻⁹M, less than 10⁻¹⁰M, less than 10⁻¹¹M, less than 10⁻¹²M, less than 10⁻¹³M, or less. In some embodiments, an antibody described herein binds specifically to a KLK5 (e.g., a human or mouse KLK5) and a KLK7 (e.g., a human or mouse KLK7) with binding affinity (e.g., as Petition 870250091425, dated 07 / 10 / 2025, p. 42 / 159 34 / 129 indicated by KD) between 1x10-10M and 5x10-9M, between 1x10-10M and 1x10-9M, between 5x10-10 and 1x10-9M, between 5x10-11 and 1x10-10M, between 1x10-11 and 5x10-10M, or between 5x10'13e 1x10-12M. For example, an antibody of the present disclosure can bind to a KLK5 protein (e.g., human or mouse KLK5) and a KLK7 protein (e.g., human or mouse KLK7) with an affinity between 1 pM and 500 nM, for example, between 50 pM and 100 nM, between 500 pM and 50 nM, between 1 pM and 100 pM, between 10 pM and 100 pM, between 50 pM and 100 pM, between 100 pM and 500 pM, between 500 pM and 1 nM, between 1 nM and 5 nM, between 1 nM and 10 nM, between 5 nM and 25 nM, between 10 nM and 50 nM, between 50 nM and 100 nM, between 100 nM and 500 nM.The disclosure also includes antibodies that compete with any of the antibodies described herein for binding to a KLK5 protein (e.g., human or mouse KLK5) and a KLK7 protein (e.g., human or mouse KLK7) and that have an affinity of 100 nM or less (e.g., 80 nM or less, 50 nM or less, 20 nM or less, 10 nM or less, 1 nM or less, 500 pM or less, 50 pM or less, or 5 pM or less). The affinity and binding kinetics of an antibody can be tested using any suitable method, including but not limited to biosensor technology (e.g., OCTET or BIACORE). In some embodiments, the antibodies described herein bind to KLK5 and KLK7 with a subnanomolar range Kd.

[0086] Binding affinity (or binding specificity) can be determined by a variety of methods, including equilibrium dialysis, equilibrium binding, gel filtration, ELISA, surface plasmon resonance (SPR), fluorescence-activated cell sorting (FACS), or spectroscopy (e.g., using a fluorescence assay). Exemplary conditions for assessing binding affinity are in HBS-P buffer (10 mM HEPES pH 7.4, 150 mM NaCl, 0.005% (v / v) surfactant P20) and PBS buffer (10 mM PO4-3, 137 mM NaCl, and 2.7 mM KCl). These techniques can be used to measure the concentration of bound proteins as a function of the target protein concentration. The concentration of bound protein ([[Bound]]) is generally Petition 870250091425, dated 07 / 10 / 2025, page 43 / 159 35 / 129 related to the concentration of free target protein ([[Free]]) by the following equation: [[Limited]] = [[Free]] / (Kd+[[Free]])

[0087] But it is not always necessary to make an exact determination of Ka, since sometimes it is sufficient to obtain a quantitative measure of affinity, for example, determined using a method such as ELISA or FACS analysis, which is proportional to Ka, and thus can be used for comparisons, such as determining whether a higher affinity is, for example, 2 times higher, to obtain a qualitative measure of affinity, or to obtain an inference of affinity, for example, by activity in a functional test, for example, an in vitro test or in vivo test.

[0088] Exemplary anti-KLK5 / KLK7 antibody sequences (e.g., heavy chain (HC) and light chain (LC) sequences, variable heavy chain (VH) domain and variable light chain (VL) domain, CDR sequences) are provided in Tables 1 and 2. Table 1. Examples of anti-KLK5 / KLK7 antibodies. antibodies de LC QQSPPFPPLT 6 VH QLQLQESGPGLVKPSETLSLTCTV SGGSISSSDYYWGWIRQPPGKGL EWIGSIYYSGSTYYNPSLKSRVTIS VDTSKNQFSLKLSSVTAADTAVYY CARGRPLGYGARHYYYGMDVWG 7 Petition 870250091425, 07 / 10 / 2025, pág. 44 / 159 36 / 129 Anticorpo KLK5 / KLK7 Sequências SEQ ID NO QGTTVTVSS VL DIQMTQSPSSLSASVGDRVTITCR ASQSISSYLNWYQQKPGKAPKLLI YSASSLQSGVPSRFSGSGSGTDF TLTISSLQPEDFATYYCQQSPPFP PLTFGGGTKVEIK 8 KLK5 / K LK7- Dual- Ab2 CDR1 de HC GSISSDDYYWV 9 CDR2 de HC SIDYFASTYYNPSLKS 10 CDR3 de HC ARGRPLGYGARHDYYGMDV 11 CDR1 de LC RASQSISSYLN 4 CDR2 de LC SASSLQS 5 CDR3 de LC QQSPYFPPLT 12 VH QLQLQESGPGLVKPSETLSLTCTV SGGSISSDDYYWVWIRQPPGKGL EWIGSIDYFASTYYNPSLKSRVTIS VDTSKNQFSLKLSSVTAADTAVYY CARGRPLGYGARHDYYGMDVWG QGTTVTVSS 13 VL DIQMTQSPSSSLSASVGDRVTITCR ASQSISSYLNWYQQKPGKAPKLLI YSASSLQSGVPSRFSGSGSGTDF TLTISSLQPEDFATYYCQQSPYFP PLTFGGGTKVEIK 14 KLK5 / K LK7- Dual- Ab3 CDR1 to HC GSISSDDYYWV 9 CDR2 to HC SIDYYASTYYSPSLKS 15 CDR3 to HC ARGRPLGYGAKHYYYGMDV 16 CDR1de LC RASQSISSYLN 4 Petition 870250091425, on 10 / 07 / 2025, page. 45 / 159 37 / 129 Anticorpo KLK5 / KLK7 Sequências SEQ ID NO CDR2 de LC SASSLQS 5 CDR3 de LC QQSPYFPPLT 12 VH QLQLQESGPGLVKPSETLSLTCTV SGGSISSDDYYWVWIRQPPGKGL EWIGSIDYYASTYYSPSLKSRVTIS VDTSKNQFSLKLSSVTAADTAVYY CARGRPLGYGAKHYYYGMDVWG QGTTVTVSS 17 VL DIQMTQSPSSLSASVGDRVTITCR ASQSISSYLNWYQQKPGKAPKLLI YSASSLQSGVPSRFSGSGSGTDF TLTISSLQPEDFATYYCQQSPYFP PLTFGGGTKVEIK 14 KLK5 / K LK7- Dual- Ab4 CDR1 de HC GSISSLDYYWV 18 CDR2 from HC SIDYSGDTYYNPSLKS 19 CDR3 from HC ARGRPLGYGARHYYYAMDV 20 CDR1de LC RASQSISSYLN 4 CDR2 from LC SASSLQS 5 CDR3 from LC QQSPYFPPLT 12 VH QLQLQESGPGLVKPSETLSLTCTV SGGSISSLDYYWVWIRQPPGKGL EWIGSIDYSGDTYYNPSLKSRVTIS VDTSKNQFSLKLSSVTAADTAVYY CARGRPLGYGARHYYYAMDVWG QGTTVTVSS 21 VL DIQMTQSPSSSLSASVGDRVTITCR ASQSISSYLNWYQQKPGKAPKLLI 14 Petition 870250091425, on 10 / 07 / 2025, page. 46 / 159 38 / 129 Anticorpo KLK5 / KLK7 Sequências SEQ ID NO YSASSLQSGVPSRFSGSGSGTDF TLTISSLQPEDFATYYCQQSPYFP PLTFGGGTKVEIK

[0089] In some embodiments, certain amino acid positions in an antibody described herein (e.g., amino acids in the VH / VL regions and / or CDR regions) are substitutable, and the substitution results in an antibody with substantially similar biological and binding activities (e.g., binding affinity, binding specificity, protease inhibitory activity, anti-inflammatory activity, or a combination thereof) to the reference antibody. To identify a substitutable position of an antibody, the amino acid sequence of that antibody is compared with the sequences of other antibodies belonging to the same group as that antibody. If the identity of that amino acid varies among the different related antibodies of a group at any specific position, that position is a substitutable position of the antibody. In other words, a substitutable position is a position where the amino acid identity varies among related antibodies.Positions containing a constant amino acid are not replaceable positions.

[0090] In some embodiments, the above method can be employed to provide a consensus antibody sequence. In such a consensus sequence, a non-substitutable position is indicated by the amino acid present at that position, and a substitutable position is indicated as an “X”.

[0091] Depending on how the antibodies will be employed, X can be a) any amino acid, b) any amino acid present at that position in any of the antibodies listed in the group or a conservatively substituted variant thereof, or c) any amino acid present at that position in any of the antibodies listed in the group. Any Petition 870250091425, dated 07 / 10 / 2025, p. 47 / 159 39 / 129 An antibody that has a sequence covered by the consensus must bind to the same antigen as any of the related antibodies.

[0092] In some embodiments, the method described above can be employed in methods of designing and producing a variant of a parental antibody that at least maintains (e.g., maintains or increases) the antigen-binding activity of the parental antibody. Since antibodies containing substitutions at replaceable positions have already been produced and tested, substitutions at these positions can be made knowing that they should not significantly decrease the antibody-binding activity. In general, an antibody variant of a parental antibody has an antigen-binding affinity that is at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 100% (e.g., at least 150%, at least 200%, at least 500%, at least 1000%, generally up to at least 10,000%) of the binding affinity of the parental antibody to a specific antigen.

[0093] In some embodiments, a replaceable position of a parental antibody can be substituted by a) any of the 20 naturally occurring amino acids to produce random substitutions, b) an amino acid with biochemical properties similar to the amino acid already present at the replaceable position to produce conservative substitutions, c) an amino acid that is present at the same position in a related antibody to produce a targeted substitution, or d) an amino acid that is present at the same position in a similar human antibody to produce a humanizing substitution. A substitution can be made anywhere in a variable antibody region, including any region of structure or CDR. In certain embodiments, a single replaceable amino acid can be substituted. However, in other embodiments, a plurality of replaceable amino acids (e.g., up to about 5 or 10 or more) can be substituted.In specific game modes, the type of substitution that can be made in each position. Petition 870250091425, dated 07 / 10 / 2025, page 48 / 159 The substitutable 40 / 129 can be indicated by the types of amino acids present at that position in the related antibodies. For example, if unrelated amino acids (e.g., Ala, Gly, Cys, Glu, and Thr) are present at a given position in a group of related antibodies, any amino acid can be substituted at that position without significantly reducing the antibody's binding activity. Exemplary amino acid substitutions of an anti-KLK5 / KLK7 antibody described here are presented in Table 2: Table 2. Exemplary amino acid substitutions of anti-KLK5 / KLK7 antibodies. KLK5 / KLK7 Antibody Sequences SEQ ID NO HC CDR1 GSISSX1DYYWX2 X1 is S, D, or L X2 is G or V 28 HC CDR2 SIX3YX4X5X6TYYX7PSLKS X3 is Y or D X4 is S, F, or Y X5 is G or A X6 is S or D X7 is N or S 29 HC CDR3 ARGRPLGYGAX8HX9YYGMDV X8 is R or K X9 is Y or D 30 LC CDR1 RASQSISSYLN 4 LC CDR2 SASSLQS 5 LC CDR3 QQSPX10FPPLT X10 is P or Y 31

[0094] In some embodiments, an antibody of the present disclosure comprises an HC CDR1 comprising the amino acid sequence of Petition 870250091425, dated 07 / 10 / 2025, p. 49 / 159 41 / 129 GSISSX1DYYWX2 (SEQ ID NO: 28), where X1 is S, D, or L, X2 is G or V; a CDR2 of HC comprising the amino acid sequence SIX3YX4X5X6TYYX7PSLKS (SEQ ID NO: 29), where X3 is Y or D, X4 is S, F, or Y, X5 is G or A, X6 is S or D, or X7 is N or S; a CDR3 of HC comprising the amino acid sequence ARGRPLGYGAX8HX9YYGMDV (SEQ ID NO: 30), where X8 is R or K, or X9 is Y or D; a CDR1 of LC comprising the amino acid sequence SEQ ID NO: 4; a CDR2 of LC comprising the amino acid sequence SEQ ID NO: 5; and / or a CDR3 of LC comprising the amino acid sequence of QQSPX10FPPLT (SEQ ID NO: 31), where X10 is P or Y.

[0095] In some embodiments, an antibody of the present disclosure comprises one or more amino acid sequences of HC CDRs (e.g., HC CDR1, HC CDR2, or HC CDR3) from any of the anti-KLK5 / KLK7 antibodies selected from Tables 1 and 2. In some embodiments, an antibody of the present disclosure comprises the amino acid sequences of HC CDR3 from any of the anti-KLK5 / KLK7 antibodies selected from Tables 1 and 2. In some embodiments, an antibody of the present disclosure comprises HC CDR1, HC CDR2, and HC CDR3, as provided for any of the antibodies selected in Tables 1 and 2. In some embodiments, an antibody of the present disclosure comprises the amino acid sequences of LC CDR3 from any of the anti-KLK5 / KLK7 antibodies selected from Tables 1 and 2.In some embodiments, an antibody of the present disclosure comprises one or more amino acid sequences of LC CDRs (e.g., LC CDR1, LC CDR2, or LC CDR3) from any of the anti-KLK5 / KLK7 antibodies selected from Tables 1 and 2. In some embodiments, an antibody of the present disclosure comprises the LC CDR1, LC CDR2, and LC CDR3 provided for any of the anti-KLK5 antibodies selected from Tables 1 and 2.

[0096] In some embodiments, an antibody of the present disclosure Petition 870250091425, dated 07 / 10 / 2025, p. 50 / 159 42 / 129 comprises the HC CDR1, HC CDR2, HC CDR3, LC CDR1, LC CDR2, and LC CDR3, as provided for any of the selected anti-KLK5 / KLK7 antibodies from Tables 1 and 2. In some embodiments, the antibody heavy and / or light chain CDR3 domains may play a particularly important role in the binding specificity / affinity of an antibody for an antigen. Consequently, a disclosure antibody may include at least the heavy and / or light chain CDR3s of any of the selected anti-KLK5 / KLK7 antibodies from Tables 1 and 2.

[0097] Also within the scope of this disclosure are variants of any of the exemplary anti-KLK5 / KLK7 antibodies, as disclosed herein. A variant may contain one or more variations of amino acid residues in the VH and / or VL, or in one or more HC CDRs and / or one or more LC CDRs relative to the reference antibody, while retaining substantially similar biological and binding activities (e.g., binding affinity, binding specificity, protease inhibitory activity, anti-inflammatory activity, or a combination thereof) to the reference antibody.

[0098] In some embodiments, a disclosure antibody has one or more CDR sequences (e.g., HC CDR or LC CDR) substantially similar to any of the HC CDR1, HC CDR2, HC CDR3, LC CDR1, LC CDR2, and / or LC CDR3 sequences of one of the selected anti-KLK5 / KLK7 antibodies from Tables 1 and 2. In some embodiments, the position of one or more CDRs along the VH region (e.g., HC CDR1, HC CDR2, or HC CDR3) and / or VL region (e.g., LC CDR1, LC CDR2, or LC CDR3) of an antibody described herein may vary by one, two, three, four, five, or six amino acid positions, provided that specific binding to KLK5 (e.g., human or mouse KLK5) and KLK7 (e.g., KLK7) is achieved. human or mouse) is maintained (e.g., substantially maintained, for example, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% of the binding of the original antibody from which it is derived). Petition 870250091425, dated 07 / 10 / 2025, p. 51 / 159 43 / 129 For example, in some embodiments, the position that defines a CDR of any antibody described herein may vary by shifting the N-terminal and / or C-terminal boundary of the CDR by one, two, three, four, five, or six amino acids, relative to the CDR position of any of the antibodies described herein, provided that the specific binding to KLK5 (e.g., human or mouse KLK5) and KLK7 (e.g., human or mouse KLK7) is maintained (e.g., substantially maintained, e.g., at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% of the binding of the original antibody from which it is derived).In another embodiment, the length of one or more CDRs along the VH region (e.g., HC CDR1, HC CDR2, or HC CDR3) and / or VL region (e.g., LC CDR1, LC CDR2, or LC CDR3) of an antibody described herein may vary (e.g., be shorter or longer) by one, two, three, four, five, or more amino acids, provided that the immunospecific binding to KLK5 (e.g., human or mouse KLK5) and KLK7 (e.g., human or mouse KLK7) is maintained (e.g., substantially maintained, e.g., at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% of the binding of the original antibody from which it is derived).

[0099] Thus, in some embodiments, a HC CDR1, HC CDR2, HC CDR3, LC CDR1, LC CDR2 and / or LC CDR3 described herein may have one, two, three, four, five or more fewer amino acids than one or more of the CDRs described herein (e.g., CDRs of any of the selected anti-KLK5 / KLK7 antibodies from Tables 1 and 2), provided that specific binding to KLK5 (e.g., human or mouse KLK5) and KLK7 (e.g., human or mouse KLK7) is maintained (e.g., substantially maintained, e.g., at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% relative to the binding of the original antibody from which it is derived). In some modalities, a CDR1 of HC, CDR2 of HC, CDR3 of HC, CDR1 of LC, CDR2 of LC and / or CDR3 Petition 870250091425, dated 07 / 10 / 2025, p. 52 / 159 44 / 129 of the LC described herein may have one, two, three, four, five or more additional amino acids than one or more of the CDRs described herein (e.g., CDRs of any of the selected anti-KLK5 / KLK7 antibodies from Tables 1 and 2), provided that specific binding to KLK5 (e.g., human or mouse KLK5) and KLK7 (e.g., human or mouse KLK7) is maintained (e.g., substantially maintained, e.g., at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% relative to the binding of the original antibody from which it is derived).In some embodiments, the amino portion of a HC CDR1, HC CDR2, HC CDR3, LC CDR1, LC CDR2, and / or LC CDR3 described herein may be extended by one, two, three, four, five, or more amino acids compared to one or more of the CDRs described herein (e.g., CDRs of any of the selected anti-KLK5 / KLK7 antibodies from Tables 1 and 2), provided that specific binding to KLK5 (e.g., human or mouse KLK5) and KLK7 (e.g., human or mouse KLK7) is maintained (e.g., substantially maintained, e.g., at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% relative to the binding of the original antibody from which it is derived).In some embodiments, the carboxyl portion of a HC CDR1, HC CDR2, HC CDR3, LC CDR1, LC CDR2, and / or LC CDR3 described herein may be extended by one, two, three, four, five, or more amino acids compared to one or more of the CDRs described herein (e.g., CDRs of any of the selected anti-KLK5 / KLK7 antibodies from Tables 1 and 2), provided that specific binding to KLK5 (e.g., human or mouse KLK5) and KLK7 (e.g., human or mouse KLK7) is maintained (e.g., substantially maintained, e.g., at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% relative to the binding of the original antibody from which it is derived). In some embodiments, the amino portion of a CDR1 of HC, CDR2 of HC, CDR3 of HC, CDR1 of LC, CDR2 of LC and / or CDR3 of LC described herein may... Petition 870250091425, dated 07 / 10 / 2025, p. 53 / 159 45 / 129 may be shortened by one, two, three, four, five or more amino acids compared to one or more of the CDRs described herein (e.g., CDRs of any of the selected anti-KLK5 / KLK7 antibodies from Tables 1 and 2), provided that specific binding to KLK5 (e.g., human or mouse KLK5) and KLK7 (e.g., human or mouse KLK7) is maintained (e.g., substantially maintained, e.g., at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% relative to the binding of the original antibody from which it is derived).In some embodiments, the carboxyl portion of a HC CDR1, HC CDR2, HC CDR3, LC CDR1, LC CDR2, and / or LC CDR3 described herein may be shortened by one, two, three, four, five, or more amino acids compared to one or more of the CDRs described herein (e.g., CDRs of any of the selected anti-KLK5 / KLK7 antibodies from Tables 1 and 2), provided that specific binding to KLK5 (e.g., human or mouse KLK5) and KLK7 (e.g., human or mouse KLK7) is maintained (e.g., substantially maintained, e.g., at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% relative to the binding of the original antibody from which it is derived). Any method can be used to verify whether specific binding to KLK5 (e.g., human or mouse KLK5) and KLK7 (e.g., human or mouse KLK7) is maintained, for example, using binding assays and conditions described in the technique.

[0100] In some examples, an antibody from the disclosure has one or more CDR sequences (e.g., CDR HC or CDR LC) substantially similar to any of the selected anti-KLK5 / KLK7 antibodies from Tables 1 and 2. For example, an antibody described herein may include one or more CDR sequences from any of the selected anti-KLK5 / KLK7 antibodies from Tables 1 and 2 containing up to 5, 4, 3, 2, or 1 amino acid residue variation compared to the corresponding CDR region in any of the CDRs provided herein (e.g., CDRs from any of the Petition 870250091425, dated 07 / 10 / 2025, p. 54 / 159 46 / 129 anti-KLK5 / KLK7 antibodies selected from Tables 1 and 2), provided that specific binding to KLK5 (e.g., human or mouse KLK5) and KLK7 (e.g., human or mouse KLK7) is maintained (e.g., substantially maintained, e.g., at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% relative to the binding of the original antibody from which it is derived). In some embodiments, any of the amino acid variations in any of the CDRs provided herein may be conservative variations. Conservative variations may be introduced into the CDRs at positions where the residues are unlikely to be involved in interaction with a KLK5 (e.g., human or mouse KLK5) and / or a KLK7 (e.g., human or mouse KLK7), for example, as determined based on a crystal structure.Some aspects of the disclosure provide antibodies comprising one or more variable heavy chain (VH) and / or variable light chain (VL) domains provided herein. In some embodiments, any of the VH domains provided herein includes one or more HC CDR sequences (e.g., HC CDR1, HC CDR2, and HC CDR3) provided herein, for example, any of the HC CDR sequences provided in any of the selected anti-KLK5 / KLK7 antibodies in Tables 1 and 2. In some embodiments, any of the VL domains provided herein includes one or more LC CDR sequences (e.g., LC CDR1, LC CDR2, and LC CDR3) provided herein, for example, any of the LC CDR sequences provided in any of the selected anti-KLK5 / KLK7 antibodies from Tables 1 and 2.

[0101] In some embodiments, a disclosure antibody includes any antibody that includes a variable heavy chain domain and / or a variable light chain domain of any of the anti-KLK5 / KLK7 antibodies selected from Tables 1 and 2, and variants thereof. In some embodiments, a disclosure antibody includes any antibody that includes the variable heavy chain and variable light chain pairs of any Petition 870250091425, dated 07 / 10 / 2025, page 55 / 159 47 / 129 anti-KLK5 / KLK7 antibodies selected from Tables 1 and 2.

[0102] Aspects of the disclosure provide antibodies having a variable heavy chain (VH) and / or variable light chain (VL) domain amino acid sequence homologous to any of those described herein. In some embodiments, an antibody comprises a variable heavy chain sequence or a variable light chain sequence that is at least 75% (e.g., 80%, 85%, 90%, 95%, 98%, or 99%) identical to the variable heavy chain sequence and / or any variable light chain sequence of any of the anti-KLK5 / KLK7 antibodies selected in Tables 1 and 2. In some embodiments, the homologous variable heavy chain and / or variable light chain amino acid sequences do not vary within any of the CDR sequences provided herein.For example, in some embodiments, the degree of sequence variation (e.g., 75%, 80%, 85%, 90%, 95%, 98%, or 99%) may occur within a variable heavy chain and / or variable light chain sequence, excluding any of the CDR sequences provided herein. In some embodiments, an antibody provided herein comprises a variable heavy chain sequence and a variable light chain sequence comprising a framework sequence that is at least 75%, 80%, 85%, 90%, 95%, 98%, or 99% identical to the framework sequence of any anti-KLK5 / KLK7 antibodies selected from Tables 1 and 2.

[0103] In some embodiments, an antibody of the present disclosure is a humanized antibody (e.g., a humanized variant containing one or more CDRs from Tables 1 and 2). In some embodiments, an antibody of the present disclosure comprises an HC CDR1, an HC CDR2, an HC CDR3, an LC CDR1, an LC CDR2, and an LC CDR3 that are the same as HC CDR1, HC CDR2, HC CDR3, LC CDR1, LC CDR2, and LC CDR3 shown in Tables 1 and 2, and comprises a humanized heavy chain variable region and / or a humanized light chain variable region.

[0104] In some embodiments, an antibody of the present disclosure is Petition 870250091425, dated 07 / 10 / 2025, p. 56 / 159 48 / 129 a humanized antibody comprising a VH containing no more than 20 amino acid variations (e.g., no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 amino acid variation) compared to the VH of any of the anti-KLK5 / KLK7 antibodies listed in Tables 1 and 2. Alternatively or additionally, the antibody of the present disclosure is a humanized antibody comprising a VL containing no more than 20 amino acid variations (e.g., no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 9, 8, 7, 6, 5, 4, 3, 2 or 1 amino acid variation). compared to the VL of any of the anti-KLK5 / KLK7 antibodies listed in Tables 1 and 2.

[0105] In some embodiments, an anti-KLK5 / KLK7 antibody of the present disclosure comprises an HC CDR1, HC CDR2 and HC CDR3 of a variable heavy chain domain with the amino acid sequence of SEQ ID NO: 7. Alternatively or additionally, the anti-KLK5 / KLK7 antibody of the present disclosure comprises an LC CDR1, LC CDR2 and LC CDR3 of a variable light chain domain with the amino acid sequence of SEQ ID NO: 8.

[0106] In some embodiments, an anti-KLK5 / KLK7 antibody of the present disclosure comprises an HC CDR1 with the amino acid sequence of SEQ ID NO: 1, an HC CDR2 with the amino acid sequence of SEQ ID NO: 2, an HC CDR3 with the amino acid sequence of SEQ ID NO: 3, an LC CDR1 with the amino acid sequence of SEQ ID NO: 4, an LC CDR2 with the amino acid sequence of SEQ ID NO: 5 and an LC CDR3 with the amino acid sequence of SEQ ID NO: 6.

[0107] In some embodiments, an anti-KLK5 / KLK7 antibody of this disclosure comprises a CDR1 HC, a CDR2 HC and a CDR3 HC, which collectively contain no more than 5 amino acid variations (e.g., no more than 5, 4, 3, 2 or 1 amino acid variation) compared to CDR1 HC having the amino acid sequence of SEQ ID NO: Petition 870250091425, dated 07 / 10 / 2025, p. 57 / 159 49 / 129 1. CDR2 HC having the amino acid sequence of SEQ ID NO: 2 and CDR3 HC having the amino acid sequence of SEQ ID NO: 3. “Collectively,” as used anywhere in this disclosure, means that the total number of amino acid variations in all three heavy chain CDRs is within the defined range. Alternatively or additionally, the anti-KLK5 / KLK7 antibody of this disclosure comprises an LC CDR1, an LC CDR2, and an LC CDR3, which collectively contain no more than 5 amino acid variations (e.g., no more than 5, 4, 3, 2, or 1 amino acid variation) compared to LC CDR1 having the amino acid sequence of SEQ ID NO: 4, LC CDR2 having the amino acid sequence of SEQ ID NO: 5, and LC CDR3 having the amino acid sequence of SEQ ID NO: 6.

[0108] In some embodiments, an anti-KLK5 / KLK7 antibody of the present disclosure comprises a CDR1 HC, a CDR2 HC, and a CDR3 HC that collectively are at least 80% (for example, 80%, 85%, 90%, 95%, 98%, or 99%) identical to the CDR1 HC with the amino acid sequence of SEQ ID NO: 1, to the CDR2 HC with the amino acid sequence of SEQ ID NO: 2, and to the CDR3 HC with the amino acid sequence of SEQ ID NO: 3. Alternatively or additionally, the anti-KLK5 / KLK7 antibody of the present disclosure comprises a CDR1 LC, a CDR2 LC, and a CDR3 LC that collectively are at least 80% (for example, 80%, 85%, 90%, 95%, 98%, or 99%) identical to the CDR1 LC having the amino acid sequence of SEQ ID NO: 4, CDR2 of LC having the amino acid sequence of SEQ ID NO: 5 and CDR3 of LC having the amino acid sequence of SEQ ID NO: 6.

[0109] In some embodiments, an anti-KLK5 / KLK7 antibody of this disclosure comprises: a CDR1 HC with a maximum of 3 amino acid variations (e.g., a maximum of 3, 2 or 1 amino acid variation) compared to a CDR1 HC with the amino acid sequence of SEQ ID NO: 1; a CDR2 HC with a maximum of 3 amino acid variations (e.g., a maximum of 3, 2 or 1 amino acid variation) compared to the Petition 870250091425, dated 07 / 10 / 2025, p. 58 / 159 50 / 129 CDR2 of HC with the amino acid sequence of SEQ ID NO: 2; and / or a CDR3 of HC having a maximum of 3 amino acid variations (e.g., a maximum of 3, 2, or 1 amino acid variation) compared to CDR3 of HC having the amino acid sequence of SEQ ID NO: 3. Alternatively or additionally, the anti-KLK5 / KLK7 antibody of this disclosure comprises: a CDR1 of LC having a maximum of 3 amino acid variations (e.g., a maximum of 3, 2, or 1 amino acid variation) compared to CDR1 of LC having the amino acid sequence of SEQ ID NO: 4; a CDR2 of LC having a maximum of 3 amino acid variations (e.g., a maximum of 3, 2, or 1 amino acid variation) compared to CDR2 of LC having the amino acid sequence of SEQ ID NO: 5; and / or an LC CDR3 having a maximum of 3 amino acid variations (e.g., no more than 3, 2, or 1 amino acid variation) compared to an LC CDR3 having the amino acid sequence SEQ ID NO: 6.

[0110] In some embodiments, an anti-KLK5 / KLK7 antibody of the present disclosure comprises a VH comprising the amino acid sequence of SEQ ID NO: 7. Alternatively or additionally, the anti-KLK5 / KLK7 antibody of the present disclosure comprises a VL comprising the amino acid sequence of SEQ ID NO: 8.

[0111] In some embodiments, an anti-KLK5 / KLK7 antibody of this disclosure comprises a VH containing a maximum of 20 amino acid variations (for example, a maximum of 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 amino acid variation) compared to VH as set forth in SEQ ID NO: 7. Alternatively or additionally, the anti-KLK5 / KLK7 antibody of this disclosure comprises a VL containing a maximum of 20 amino acid variations (for example, a maximum of 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 9, 8, 7, 6, 5, 4, 3, 2 or 1 amino acid variation). compared to VL as established in SEQ ID NO: 8.

[0112] In some embodiments, an anti-KLK5 / KLK7 antibody of the present disclosure comprises a VH comprising a sequence of Petition 870250091425, dated 07 / 10 / 2025, p. 59 / 159 51 / 129 amino acids that is at least 80% (e.g., 80%, 85%, 90%, 95%, 98%, or 99%) identical to the VL as set forth in SEQ ID NO: 7. Alternatively or additionally, the anti-KLK5 / KLK7 antibody of this disclosure comprises a VL comprising an amino acid sequence that is at least 80% (e.g., 80%, 85%, 90%, 95%, 98%, or 99%) identical to the VL as set forth in SEQ ID NO: 8.

[0113] In some embodiments, an anti-KLK5 / KLK7 antibody of the present disclosure comprises an HC CDR1, HC CDR2 and HC CDR3 of a variable heavy chain domain having the amino acid sequence of SEQ ID NO: 13. Alternatively or additionally, the anti-KLK5 / KLK7 antibody of the present disclosure comprises an LC CDR1, LC CDR2 and LC CDR3 of a variable light chain domain having the amino acid sequence of SEQ ID NO: 14.

[0114] In some embodiments, an anti-KLK5 / KLK7 antibody of the present disclosure comprises an HC CDR1 with the amino acid sequence of SEQ ID NO: 9, an HC CDR2 with the amino acid sequence of SEQ ID NO: 10, an HC CDR3 with the amino acid sequence of SEQ ID NO: 11, an LC CDR1 with the amino acid sequence of SEQ ID NO: 4, an LC CDR2 with the amino acid sequence of SEQ ID NO: 5 and an LC CDR3 with the amino acid sequence of SEQ ID NO: 12.

[0115] In some embodiments, an anti-KLK5 / KLK7 antibody of this disclosure comprises a HC CDR1, an HC CDR2, and an HC CDR3, which collectively contain no more than 5 amino acid variations (e.g., no more than 5, 4, 3, 2, or 1 amino acid variation) compared with HC CDR1 having the amino acid sequence of SEQ ID NO: 9, HC CDR2 having the amino acid sequence of SEQ ID NO: 10, and HC CDR3 having the amino acid sequence of SEQ ID NO: 11. “Collectively,” as used anywhere in this disclosure, means the total number of amino acid variations in all three CDRs. Petition 870250091425, dated 07 / 10 / 2025, p. 60 / 159 The 52 / 129 heavy chain is within the defined range. Alternatively or additionally, the anti-KLK5 / KLK7 antibody of this disclosure comprises an LC CDR1, an LC CDR2, and an LC CDR3, which collectively contain no more than 5 amino acid variations (e.g., no more than 5, 4, 3, 2, or 1 amino acid variation) compared to LC CDR1 having the amino acid sequence of SEQ ID NO: 4, LC CDR2 having the amino acid sequence of SEQ ID NO: 5, and LC CDR3 having the amino acid sequence of SEQ ID NO: 12.

[0116] In some embodiments, an anti-KLK5 / KLK7 antibody of the present disclosure comprises an HC CDR1, an HC CDR2, and an HC CDR3 that collectively are at least 80% (e.g., 80%, 85%, 90%, 95%, 98%, or 99%) identical to the HC CDR1 with the amino acid sequence of SEQ ID NO: 9, the HC CDR2 with the amino acid sequence of SEQ ID NO: 10, and the HC CDR3 with the amino acid sequence of SEQ ID NO: 11. Alternatively or additionally, the anti-KLK5 / KLK7 antibody of the present disclosure comprises an LC CDR1, an LC CDR2, and an LC CDR3 that collectively are at least 80% (e.g., 80%, 85%, 90%, 95%, 98%, or 99%) identical to the HC CDR1 with the amino acid sequence of SEQ ID NO: 9, the HC CDR2 with the amino acid sequence of SEQ ID NO: 10, and the HC CDR3 with the amino acid sequence of SEQ ID NO: 11. 99%) identical to CDR1 of LC with the amino acid sequence of SEQ ID NO: 4, to CDR2 of LC with the amino acid sequence of SEQ ID NO: 5 and to CDR3 of LC with the amino acid sequence of SEQ ID NO: 12.

[0117] In some embodiments, an anti-KLK5 / KLK7 antibody of this disclosure comprises: a CDR1 HC with a maximum of 3 amino acid variations (e.g., a maximum of 3, 2, or 1 amino acid variation) compared to a CDR1 HC with the amino acid sequence of SEQ ID NO: 9; a CDR2 HC with a maximum of 3 amino acid variations (e.g., a maximum of 3, 2, or 1 amino acid variation) compared to a CDR2 HC with the amino acid sequence of SEQ ID NO: 10; and / or a CDR3 HC with a maximum of 3 amino acid variations (e.g., a maximum of 3, 2, or 1 amino acid variation) compared to a CDR3 HC with the amino acid sequence of SEQ ID NO: 11. Alternatively or Petition 870250091425, dated 07 / 10 / 2025, p. 61 / 159 53 / 129 additionally, the anti-KLK5 / KLK7 antibody of this disclosure comprises: an LC CDR1 with a maximum of 3 amino acid variations (e.g., a maximum of 3, 2 or 1 amino acid variation) compared to an LC CDR1 with the amino acid sequence of SEQ ID NO: 4; an LC CDR2 with a maximum of 3 amino acid variations (e.g., a maximum of 3, 2 or 1 amino acid variation) compared to an LC CDR2 with the amino acid sequence of SEQ ID NO: 5; and / or an LC CDR3 with a maximum of 3 amino acid variations (e.g., a maximum of 3, 2 or 1 amino acid variation) compared to an LC CDR3 with the amino acid sequence of SEQ ID NO: 12.

[0118] In some embodiments, an anti-KLK5 / KLK7 antibody of the present disclosure comprises a VH comprising the amino acid sequence of SEQ ID NO: 13. Alternatively or additionally, the anti-KLK5 / KLK7 antibody of the present disclosure comprises a VL comprising the amino acid sequence of SEQ ID NO: 14.

[0119] In some embodiments, an anti-KLK5 / KLK7 antibody of this disclosure comprises a VH containing no more than 20 amino acid variations (for example, no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 amino acid variation) compared to VH as set forth in SEQ ID NO: 13. Alternatively or additionally, the anti-KLK5 / KLK7 antibody of this disclosure comprises a VL containing no more than 20 amino acid variations (for example, no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 9, 8, 7, 6, 5, 4, 3, 2 or 1 variation of amino acid) compared to VL as established in SEQ ID NO: 14.

[0120] In some embodiments, an anti-KLK5 / KLK7 antibody of this disclosure comprises a VH comprising an amino acid sequence that is at least 80% (for example, 80%, 85%, 90%, 95%, 98% or 99%) identical to the VH as set forth in SEQ ID NO: 13. Alternatively or additionally, the anti-KLK5 / KLK7 antibody of this Petition 870250091425, dated 07 / 10 / 2025, p. 62 / 159 54 / 129 disclosure comprises a VL comprising an amino acid sequence that is at least 80% (e.g., 80%, 85%, 90%, 95%, 98%, or 99%) identical to the VL as set forth in SEQ ID NO: 14.

[0121] In some embodiments, an anti-KLK5 / KLK7 antibody of the present disclosure comprises an HC CDR1, HC CDR2 and HC CDR3 of a variable heavy chain domain having the amino acid sequence of SEQ ID NO: 17. Alternatively or additionally, the anti-KLK5 / KLK7 antibody of the present disclosure comprises an LC CDR1, LC CDR2 and LC CDR3 of a variable light chain domain having the amino acid sequence of SEQ ID NO: 14.

[0122] In some embodiments, an anti-KLK5 / KLK7 antibody of the present disclosure comprises an HC CDR1 with the amino acid sequence of SEQ ID NO: 9, an HC CDR2 with the amino acid sequence of SEQ ID NO: 15, an HC CDR3 with the amino acid sequence of SEQ ID NO: 16, an LC CDR1 with the amino acid sequence of SEQ ID NO: 4, an LC CDR2 with the amino acid sequence of SEQ ID NO: 5 and an LC CDR3 with the amino acid sequence of SEQ ID NO: 12.

[0123] In some embodiments, an anti-KLK5 / KLK7 antibody of the present disclosure comprises an HC CDR1, an HC CDR2, and an HC CDR3, which collectively contain no more than 5 amino acid variations (e.g., no more than 5, 4, 3, 2, or 1 amino acid variation) compared to the HC CDR1 having the amino acid sequence of SEQ ID NO: 9, the HC CDR2 having the amino acid sequence of SEQ ID NO: 15, and the HC CDR3 having the amino acid sequence of SEQ ID NO: 16. “Collectively,” as used anywhere in the present disclosure, means that the total number of amino acid variations in all three heavy chain CDRs is within the defined range. Alternatively or additionally, the anti-KLK5 / KLK7 antibody of the present disclosure comprises an LC CDR1, an LC CDR2, and an LC CDR3, which Petition 870250091425, dated 07 / 10 / 2025, p. 63 / 159 55 / 129 collectively contain no more than 5 amino acid variations (e.g., no more than 5, 4, 3, 2, or 1 amino acid variation) compared to CDR1 of LC having the amino acid sequence SEQ ID NO: 4, CDR2 of LC having the amino acid sequence SEQ ID NO: 5, and CDR3 of LC having the amino acid sequence SEQ ID NO: 12.

[0124] In some embodiments, an anti-KLK5 / KLK7 antibody of the present disclosure comprises an HC CDR1, an HC CDR2, and an HC CDR3 that collectively are at least 80% (for example, 80%, 85%, 90%, 95%, 98%, or 99%) identical to the HC CDR1 with the amino acid sequence of SEQ ID NO: 9, the HC CDR2 with the amino acid sequence of SEQ ID NO: 15, and the HC CDR3 with the amino acid sequence of SEQ ID NO: 16. Alternatively or additionally, the anti-KLK5 / KLK7 antibody of the present disclosure comprises an LC CDR1, an LC CDR2, and an LC CDR3 that collectively are at least 80% (for example, 80%, 85%, 90%, 95%, 98%, or 99%) identical to the HC CDR1 with the amino acid sequence of SEQ ID NO: 9, the HC CDR2 with the amino acid sequence of SEQ ID NO: 15, and the HC CDR3 with the amino acid sequence of SEQ ID NO: 16. 99%) identical to CDR1 of LC with the amino acid sequence of SEQ ID NO: 4, to CDR2 of LC with the amino acid sequence of SEQ ID NO: 5 and to CDR3 of LC with the amino acid sequence of SEQ ID NO: 12.

[0125] In some embodiments, an anti-KLK5 / KLK7 antibody of this disclosure comprises: a CDR1 HC with a maximum of 3 amino acid variations (e.g., a maximum of 3, 2 or 1 amino acid variation) compared to a CDR1 HC with the amino acid sequence of SEQ ID NO: 9; a CDR2 HC with a maximum of 3 amino acid variations (e.g., a maximum of 3, 2 or 1 amino acid variation) compared to a CDR2 HC with the amino acid sequence of SEQ ID NO: 15; and / or a CDR3 of HC with a maximum of 3 amino acid variations (e.g., a maximum of 3, 2, or 1 amino acid variation) compared to the CDR3 of HC with the amino acid sequence of SEQ ID NO: 16. Alternatively or additionally, the anti-KLK5 / KLK7 antibody of this disclosure comprises: a CDR1 of LC with a maximum of 3 amino acid variations (e.g., a maximum of 3, 2, or 1 amino acid variation) compared to the Petition 870250091425, dated 07 / 10 / 2025, p. 64 / 159 56 / 129 A CDR1 LC with amino acid sequence SEQ ID NO: 4; a CDR2 LC with a maximum of 3 amino acid variations (e.g., a maximum of 3, 2, or 1 amino acid variation) compared to a CDR2 LC with amino acid sequence SEQ ID NO: 5; and / or a CDR3 LC with a maximum of 3 amino acid variations (e.g., a maximum of 3, 2, or 1 amino acid variation) compared to a CDR3 LC with amino acid sequence SEQ ID NO: 12.

[0126] In some embodiments, an anti-KLK5 / KLK7 antibody of the present disclosure comprises a VH comprising the amino acid sequence of SEQ ID NO: 17. Alternatively or additionally, the anti-KLK5 / KLK7 antibody of the present disclosure comprises a VL comprising the amino acid sequence of SEQ ID NO: 14.

[0127] In some embodiments, an anti-KLK5 / KLK7 antibody of this disclosure comprises a VH containing no more than 20 amino acid variations (for example, no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 amino acid variation) compared to VH as set forth in SEQ ID NO: 17. Alternatively or additionally, the anti-KLK5 / KLK7 antibody of this disclosure comprises a VL containing no more than 20 amino acid variations (for example, no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 9, 8, 7, 6, 5, 4, 3, 2 or 1 variation) of amino acid) compared to VL as established in SEQ ID NO: 14.

[0128] In some embodiments, an anti-KLK5 / KLK7 antibody of the present disclosure comprises a VH comprising an amino acid sequence that is at least 80% (for example, 80%, 85%, 90%, 95%, 98% or 99%) identical to the VH as set forth in SEQ ID NO: 17. Alternatively or additionally, the anti-KLK5 / KLK7 antibody of the present disclosure comprises a VL comprising an amino acid sequence that is at least 80% (for example, 80%, 85%, 90%, 95%, 98% or 99%) identical to the VL as set forth in SEQ ID NO: 14. Petition 870250091425, dated 07 / 10 / 2025, p. 65 / 159 57 / 129

[0129] In some embodiments, an anti-KLK5 / KLK7 antibody of the present disclosure comprises an HC CDR1, HC CDR2 and HC CDR3 of a variable heavy chain domain having the amino acid sequence of SEQ ID NO: 21. Alternatively or additionally, the anti-KLK5 / KLK7 antibody of the present disclosure comprises an LC CDR1, LC CDR2 and LC CDR3 of a variable light chain domain having the amino acid sequence of SEQ ID NO: 14.

[0130] In some embodiments, an anti-KLK5 / KLK7 antibody of the present disclosure comprises an HC CDR1 with the amino acid sequence of SEQ ID NO: 18, an HC CDR2 with the amino acid sequence of SEQ ID NO: 19, an HC CDR3 with the amino acid sequence of SEQ ID NO: 20, an LC CDR1 with the amino acid sequence of SEQ ID NO: 4, an LC CDR2 with the amino acid sequence of SEQ ID NO: 5 and an LC CDR3 with the amino acid sequence of SEQ ID NO: 12.

[0131] In some embodiments, an anti-KLK5 / KLK7 antibody of this disclosure comprises a HC CDR1, a HC CDR2, and an HC CDR3, which collectively contain no more than 5 amino acid variations (e.g., no more than 5, 4, 3, 2, or 1 amino acid variation) compared to HC CDR1 having the amino acid sequence of SEQ ID NO: 18, HC CDR2 having the amino acid sequence of SEQ ID NO: 19, and HC CDR3 having the amino acid sequence of SEQ ID NO: 20. “Collectively,” as used anywhere in this disclosure, means that the total number of amino acid variations in all three heavy chain CDRs is within the defined range.Alternatively or additionally, the anti-KLK5 / KLK7 antibody of this disclosure comprises an LC CDR1, an LC CDR2, and an LC CDR3, which collectively contain no more than 5 amino acid variations (e.g., no more than 5, 4, 3, 2, or 1 amino acid variation) compared to LC CDR1 having the amino acid sequence of SEQ ID. Petition 870250091425, dated 07 / 10 / 2025, p. 66 / 159 58 / 129 NO: 4, CDR2 of LC having the amino acid sequence of SEQ ID NO: 5 and CDR3 of LC having the amino acid sequence of SEQ ID NO: 12.

[0132] In some embodiments, an anti-KLK5 / KLK7 antibody of the present disclosure comprises an HC CDR1, an HC CDR2, and an HC CDR3 that collectively are at least 80% (for example, 80%, 85%, 90%, 95%, 98%, or 99%) identical to the HC CDR1 with the amino acid sequence of SEQ ID NO: 18, the HC CDR2 with the amino acid sequence of SEQ ID NO: 19, and the HC CDR3 with the amino acid sequence of SEQ ID NO: 20. Alternatively or additionally, the anti-KLK5 / KLK7 antibody of the present disclosure comprises an LC CDR1, an LC CDR2, and an LC CDR3 that collectively are at least 80% (for example, 80%, 85%, 90%, 95%, 98%, or 99%) identical to the HC CDR1 with the amino acid sequence of SEQ ID NO: 18, the HC CDR2 with the amino acid sequence of SEQ ID NO: 19, and the HC CDR3 with the amino acid sequence of SEQ ID NO: 20. 99%) identical to CDR1 of LC with the amino acid sequence of SEQ ID NO: 4, to CDR2 of LC with the amino acid sequence of SEQ ID NO: 5 and to CDR3 of LC with the amino acid sequence of SEQ ID NO: 12.

[0133] In some embodiments, an anti-KLK5 / KLK7 antibody of this disclosure comprises: a CDR1 HC with a maximum of 3 amino acid variations (e.g., a maximum of 3, 2 or 1 amino acid variation) compared to a CDR1 HC with the amino acid sequence of SEQ ID NO: 18; a CDR2 HC with a maximum of 3 amino acid variations (e.g., a maximum of 3, 2 or 1 amino acid variation) compared to a CDR2 HC with the amino acid sequence of SEQ ID NO: 19; and / or a CDR3 HC with a maximum of 3 amino acid variations (e.g., a maximum of 3, 2 or 1 amino acid variation) compared to a CDR3 HC with the amino acid sequence of SEQ ID NO: 20.Alternatively or additionally, the anti-KLK5 / KLK7 antibody of this disclosure comprises: a CDR1 from LC with a maximum of 3 amino acid variations (e.g., a maximum of 3, 2, or 1 amino acid variation) compared to CDR1 from LC with the amino acid sequence of SEQ ID NO: 4; a CDR2 from LC with a maximum of 3 amino acid variations (e.g., a maximum of 3, 2, or 1 amino acid variation). Petition 870250091425, dated 07 / 10 / 2025, p. 67 / 159 59 / 129 or 1 amino acid variation) compared to CDR2 LC with amino acid sequence SEQ ID NO: 5; and / or a CDR3 LC with a maximum of 3 amino acid variations (e.g., a maximum of 3, 2, or 1 amino acid variation) compared to CDR3 LC with amino acid sequence SEQ ID NO: 12.

[0134] In some embodiments, an anti-KLK5 / KLK7 antibody of the present disclosure comprises a VH comprising the amino acid sequence of SEQ ID NO: 21. Alternatively or additionally, the anti-KLK5 / KLK7 antibody of the present disclosure comprises a VL comprising the amino acid sequence of SEQ ID NO: 14.

[0135] In some embodiments, an anti-KLK5 / KLK7 antibody of this disclosure comprises a VH containing no more than 20 amino acid variations (for example, no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 amino acid variation) compared to VH as set forth in SEQ ID NO: 21. Alternatively or additionally, the anti-KLK5 / KLK7 antibody of this disclosure comprises a VL containing no more than 20 amino acid variations (for example, no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 9, 8, 7, 6, 5, 4, 3, 2 or 1 variation) of amino acid) compared to VL as established in SEQ ID NO: 14.

[0136] In some embodiments, an anti-KLK5 / KLK7 antibody of the present disclosure comprises a VH comprising an amino acid sequence that is at least 80% (for example, 80%, 85%, 90%, 95%, 98% or 99%) identical to the VH as set forth in SEQ ID NO: 21. Alternatively or additionally, the anti-KLK5 / KLK7 antibody of the present disclosure comprises a VL comprising an amino acid sequence that is at least 80% (for example, 80%, 85%, 90%, 95%, 98% or 99%) identical to the VL as set forth in SEQ ID NO: 14.

[0137] The antibodies described herein may be in any antibody form, including, but not limited to, intact antibodies (i.e., of Petition 870250091425, dated 07 / 10 / 2025, p. 68 / 159 60 / 129 total length), antigen-binding fragments (such as Fab, F(ab'), F(ab')2, Fv), single-chain antibodies, bispecific antibodies, or nanobodies. In some embodiments, the anti-KLK5 / KLK7 antibody described here is an scFv. In some embodiments, the anti-KLK5 / KLK7 antibody described here is an scFv-Fab (e.g., scFv fused to a portion of a constant region).

[0138] In some embodiments, an anti-KLK5 / KLK7 antibody of the present disclosure is a chimeric antibody, which may include a heavy constant region and a light constant region of a human antibody. Chimeric antibodies refer to antibodies that possess a variable region or part of a variable region of a first species and a constant region of a second species. Typically, in these chimeric antibodies, the variable region of the light and heavy chains mimics the variable regions of antibodies derived from one mammalian species (e.g., a non-human mammal such as a mouse, rabbit, and rat), while the constant portions are homologous to sequences in antibodies derived from another mammal, such as a human. In some embodiments, amino acid modifications may be made to the variable region and / or the constant region.

[0139] In some embodiments, an antibody of the present disclosure comprises a VL domain and / or VH domain of any of the anti-KLK5 / KLK7 antibodies selected from Tables 1 and 2, and comprises a constant region comprising the amino acid sequences of the constant regions of an immunoglobulin molecule IgG, IgE, IgM, IgD, IgA or IgY, any class (e.g., IgG1, IgG2, IgG3, IgG4, IgA1 and IgA2) or any subclass (e.g., IgG2a and IgG2b) of immunoglobulin molecule. Non-limiting examples of human constant regions are described in the art, for example, see Kabat EA et al., (1991) supra.

[0140] In some embodiments, the light chain of any of the anti-KLK5 / KLK7 antibodies described herein may further comprise a constant light chain (LC) region, which may be any LC known in the art. Petition 870250091425, dated 07 / 10 / 2025, p. 69 / 159 61 / 129 In some examples, CL is a kappa light chain. In other examples, CL is a lambda light chain. In some embodiments, CL is a kappa light chain.

[0141] Other constant regions of antibody heavy and light chains are well known in the art, for example, those provided in the IMGT database (www.imgt.org) or at www.vbase2.org / vbstat.php, both incorporated by reference herein.

[0142] In some embodiments, conservative mutations can be introduced into antibody sequences (e.g., CDRs or framework sequences) at positions where residues are unlikely to be involved in interaction with a target antigen (e.g., human or mouse KLK5 and / or human or mouse KLK7), for example, as determined based on a crystal structure. In some embodiments, one, two, or more mutations (e.g., amino acid substitutions) are introduced into the Fc region of an anti-KLK5 / KLK7 antibody described herein (e.g., in a CH2 domain (human IgG1 residues 231-340) and / or CH3 domain (human IgG1 residues 341-447) and / or in the hinge region, numbered according to the Kabat numbering system (e.g., the EU index in Kabat)) to alter one or more functional properties of the antibody, such as serum half-life, complement fixation, Fc receptor binding, and / or antigen-dependent cellular cytotoxicity.

[0143] In some embodiments, one, two or more mutations (e.g., amino acid substitutions) are introduced into the hinge region of the Fc region (CH1 domain) so that the number of cysteine ​​residues in the hinge region is altered (e.g., increased or decreased), as described, for example, in U.S. Patent No. 5,677,425. The number of cysteine ​​residues in the hinge region of the CH1 domain may be altered to, for example, facilitate the assembly of the light and heavy chains, or to alter (e.g., increase or decrease) the stability of the antibody or to facilitate ligand conjugation. Petition 870250091425, dated 07 / 10 / 2025, page 70 / 159 62 / 129

[0144] In some embodiments, one, two, or more mutations (e.g., amino acid substitutions) are introduced into the Fc region of an antibody described herein (e.g., into a CH2 domain (residues 231–340 of human IgG1) and / or a CH3 domain (residues 341–447 of human IgG1) and / or into the hinge region, numbered according to the Kabat numbering system (e.g., the EU index in Kabat)) to increase or decrease the antibody's affinity for an Fc receptor (e.g., an activated Fc receptor) on the surface of an effector cell. Mutations in the Fc region of an antibody that decrease or increase the antibody's affinity for an Fc receptor and techniques for introducing such mutations into the Fc receptor or a fragment thereof are known to experts in the field. Examples of mutations in the Fc receptor of an antibody that can be induced to alter the antibody's affinity for an Fc receptor are described in, for example, Smith P et al., (2012) PNAS 109: 6181-6186, US Patent No. 6,737,056 and International Publications Nos. WO 02 / 060919; WO 98 / 23289; and WO 97 / 34631, which are incorporated herein by reference.

[0145] In some embodiments, one, two, or more amino acid mutations (i.e., substitutions, insertions, or deletions) are introduced into an IgG constant domain, or FcRn binding fragment thereof (preferably an Fc domain fragment or Fc hinge fragment) to alter (e.g., decrease or increase) the antibody half-life in vivo. See, for example, International Publications Nos. WO 02 / 060919; WO 98 / 23289; and WO 97 / 34631; and U.S. Patents Nos. 5,869,046, 6,121,022, 6,277,375, and 6,165,745 for examples of mutations that will alter (e.g., decrease or increase) the half-life of an antibody in vivo.

[0146] In some embodiments, one, two, or more amino acid mutations (i.e., substitutions, insertions, or deletions) are introduced into an IgG constant domain, or FcRn binding fragment thereof (preferably an Fc domain or Fc hinge fragment) to decrease the half-life of the anti-KLK5 / KLK7 antibody in vivo. In some embodiments, one, Petition 870250091425, dated 07 / 10 / 2025, page 71 / 159 63 / 129 Two or more amino acid mutations (i.e., substitutions, insertions, or deletions) are introduced into an IgG constant domain, or its FcRn-binding fragment (preferably an Fc domain or Fc-hinge fragment), to increase the antibody's half-life in vivo. In some embodiments, antibodies may have one or more amino acid mutations (e.g., substitutions) in the second constant domain (CH2) (residues 231-340 of human IgG1) and / or in the third constant domain (CH3) (residues 341-447 of human IgG1), numbered according to the EU index in Kabat (Kabat EA et al., (1991) supra). In some embodiments, the constant region of IgG1 of an antibody described herein comprises a methionine (M) to tyrosine (Y) substitution at position 252, a serine (S) to threonine (T) substitution at position 254, and a threonine (T) to glutamic acid (E) substitution at position 256, numbered according to the EU index as in Kabat. See US Patent.No. 7,658,921, which is incorporated herein by reference. This type of mutant IgG, termed “YTE mutant”, has been shown to have a half-life four times longer compared to wild-type versions of the same antibody (see Dall'Acqua WF et al., (2006) J Biol Chem 281: 23514-24). In some embodiments, an antibody comprises a constant IgG domain comprising one, two, three or more amino acid substitutions of amino acid residues at positions 251-257, 285-290, 308-314, 385-389 and 428-436, numbered according to the EU index as in Kabat.

[0147] In some embodiments, an antibody comprises an Fc region that has been engineered for half-life extension purposes, for example, by the introduction of M428L and / or N434A substitutions. Non-limiting examples of such Fc variants affecting half-life in circulation are provided in Saunders KO, Conceptual Approaches to Modulating Antibody Effector Functions and Circulation Half-Life, Front Immunol. 2019; 10: 1296, the contents of which are incorporated herein by reference.

[0148] In some embodiments, one, two or more amino acid substitutions are introduced into an Fc region of the IgG constant domain. Petition 870250091425, dated 07 / 10 / 2025, p. 72 / 159 64 / 129 to alter the effector function(s) of the anti-KLK5 / KLK7 antibody, for example, by introducing Leu234Ala and Leu235Ala mutations (commonly called LALA mutations). The effector ligand whose affinity is altered may be, for example, an Fc receptor or the C1 component of complement. This approach is described in more detail in U.S. Patents Nos. 5,624,821 and 5,648,260. In some embodiments, deletion or inactivation (by point mutations or other means) of a constant region domain can reduce the Fc receptor binding of the circulating antibody, thus increasing tumor localization. See, for example, U.S. Patents Nos. 5,585,097 and 8,591,886 for a description of mutations that delete or inactivate the constant domain and thus increase tumor localization.In some embodiments, one or more amino acid substitutions may be introduced into the Fc region of an antibody described herein to remove potential glycosylation sites in the Fc region, which may reduce Fc receptor binding (see, for example, Shields RL et al., (2001) J Biol Chem 276: 6591-604).

[0149] In some embodiments, one or more amino acids in the constant region of an anti-KLK5 / KLK7 antibody described herein may be replaced by a different amino acid residue, so that the antibody has altered Clq binding and / or reduced or abolished complement-dependent cytotoxicity (CDC). This approach is described in more detail in U.S. Patent No. 6,194,551 (Idusogie et al.). In some embodiments, one or more amino acid residues in the N-terminal region of the CH2 domain of an antibody described herein are altered to thereby alter the antibody's ability to fix complement. This approach is described in more detail in International Publication No. WO 94 / 29351. In some embodiments, the Fc region of an antibody described herein is modified to increase the antibody's ability to mediate antibody-dependent cellular cytotoxicity (ADCC) and / or increase the antibody's affinity for an Fcy receptor.This approach is described in more detail in International Publication No. WO 00 / 42072.

[0150] In some embodiments, an antibody comprises a variant Petition 870250091425, dated 07 / 10 / 2025, p. 73 / 159 65 / 129 Fc comprising amino acid substitutions L234A, L235E, and P329G, where the numbering is according to the EU index. In some embodiments, the antibody comprising the Fc variant exhibits reduced affinity for one or more or each of the FcyRJ, FcyRIIA, FcyRIIIA, and Clq compared to an antibody comprising the wild-type human Fc region. Examples of such Fc variants are provided in International Patent Application Publication No.: WO 2021 / 055669 entitled, FC VARIANTS WITH REDUCED EFFECTOR FUNCTION, published on March 25, 2021; and U.S. Patent Application Publication No.: US 2021-0087271 entitled, FC VARIANTS WITH REDUCED EFFECTOR FUNCTION, published on March 25, 2021, the contents of which are incorporated herein by reference.

[0151] In some embodiments, the variable domain(s) sequence(s) of the heavy and / or light chain of the antibodies provided herein may be used to generate, for example, CDR-grafted, chimeric, humanized, or compound human antibodies or antigen-binding fragments, as described elsewhere herein. As understood by a person of ordinary knowledge in the field, any variant, CDR-grafted, chimeric, humanized, or compound antibody derived from any of the antibodies provided herein may be useful in the compositions and methods described herein and will retain the ability to specifically bind to KLK5 and KLK7, such that the variant, CDR-grafted, chimeric, humanized, or compound antibody has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or more binding to KLK5 and KLK7 relative to the original antibody from which it is derived.

[0152] In some embodiments, the antibodies provided here comprise mutations that confer desirable properties to the antibodies. For example, to avoid potential complications due to Fab arm switching, which is known to occur with native IgG4 mAbs, the antibodies provided here may comprise a stabilizing 'Adair' mutation (Angal S., et al., “A single amino acid substitution abolished chimeric heterogeneity”). Petition 870250091425, dated 07 / 10 / 2025, p. 74 / 159 66 / 129 mouse / human (IgG4) antibody,” Mol Immunol 30, 105-108; 1993), where serine 228 (EU numbering; residue 241 Kabat numbering) is converted to proline, resulting in a hinge sequence similar to IgG1. Consequently, either antibody may include a stabilizing 'Adair' mutation.

[0153] In some embodiments, an antibody is modified, for example, modified by glycosylation, phosphorylation, sumoylation, and / or methylation. In some embodiments, an antibody is a glycosylated antibody, which is conjugated to one or more sugar or carbohydrate molecules. In some embodiments, the one or more sugar or carbohydrate molecules are conjugated to the antibody by N-glycosylation, O-glycosylation, C-glycosylation, glypiation (GPI anchor attachment), and / or phosphoglycosylation. In some embodiments, the one or more sugar or carbohydrate molecules are monosaccharides, disaccharides, oligosaccharides, or glycans. In some embodiments, the one or more sugar or carbohydrate molecules are a branched oligosaccharide or a branched glycan.In some embodiments, the one or more sugar or carbohydrate molecules include a mannose unit, a glucose unit, an N-acetylglucosamine unit, an N-acetylgalactosamine unit, a galactose unit, a fucose unit, or a phospholipid unit. In some embodiments, there are about 110, about 1-5, about 5-10, about 1-4, about 1-3, or about 2 sugar molecules. In some embodiments, a glycosylated antibody is totally or partially glycosylated. In some embodiments, an antibody is glycosylated by chemical reactions or by enzymatic means. In some embodiments, an antibody is glycosylated in vitro or within a cell, which may optionally be deficient in an enzyme in the N- or O-glycosylation pathway, for example, a glycosyltransferase.In some embodiments, an antibody is functionalized with sugar or carbohydrate molecules, as described in International Patent Application Publication WO2014065661, published on May 1, 2014, entitled “Modified antibody,. Petition 870250091425, dated 07 / 10 / 2025, page 75 / 159 67 / 129 antibody-conjugate and process for the preparation thereof”.

[0154] In some embodiments, any of the anti-KLK5 / KLK7 antibodies described herein may comprise a signal peptide in the heavy and / or light chain sequence (e.g., an N-terminal signal peptide). In some embodiments, the anti-KLK5 / KLK7 antibody described herein comprises any of the VH and VL sequences, any of the IgG heavy chain and light chain sequences, or any of the F(ab') heavy chain and light chain sequences described herein, and further comprises a signal peptide (e.g., an N-terminal signal peptide). (b) Multispecific Antibodies

[0155] In some embodiments, an antibody provided here is a multispecific antibody (e.g., a bispecific antibody). For example, in some embodiments, one or more anti-KLK5 / KLK7 antibodies may be combined with one or more different anti-KLK5 / KLK7 antibodies to produce a multispecific or bispecific anti-KLK5 / KLK7 antibody. For example, one or more anti-KLK5 / KLK7 antibodies, as described herein (Table 1 and Table 2), may be combined with one or more different anti-KLK5 / KLK7 antibodies described herein (Table 1 and Table 2) to produce a multispecific antibody.

[0156] In some embodiments, one or more anti-KLK5 / KLK7 antibodies may be combined with any other appropriate therapeutic antibodies to produce a multispecific or bispecific anti-KLK5 / KLK7 / additional target antibody. For example, an anti-KLK5 / KLK7 antibody, as described herein (Table 1 and Table 2), may be combined with any appropriate antibody to produce a bispecific antibody. These additional therapeutic antibodies include, but are not limited to: anti-IL4R antibodies (e.g., dupilumab), anti-IL-13 antibodies, TNF inhibitors (e.g., anti-TNF antibody), IL-12 / 23 antibodies, IL-17 antibodies, adalimumab, infliximab, golimumab, ustekinumab, secukinumab, ixekizumab, brodalumab, abatacept, tidrakizumab-asmn, risankisumab-rzaa, and guselcumab. Petition 870250091425, dated 07 / 10 / 2025, page 76 / 159 68 / 129

[0157] In some embodiments, one or more anti-KLK5 / KLK7 antibodies can be combined with any other appropriate anti-KLK7 antibody to produce a multispecific or bispecific anti-KLK5 / KLK7 antibody. For example, an anti-KLK5 / KLK7 antibody, as described herein (Table 1 and Table 2), can be combined with any other appropriate anti-KLK7 antibody to produce a bispecific antibody.Non-limiting examples of suitable anti-KLK7 antibodies are provided in U.S. Patent Application Publication No. 2021-0130492 entitled “ANTI-KLK7 ANTIBODIES, ANTI-KLK5 ANTIBODIES, MULTISPECIFIC ANTI-KLK5 / KLK7 ANTIBODIES, AND METHODS OF USE”, published on May 6, 2021; International Patent Application Publication No.: WO2021226695 entitled, “RECOMBINANT HUMAN ANTIBODIES FOR INHIBITING HUMAN TISSUE KALLIKREIN 7 (KLK7) AND USE IN DISEASES RELATED TO THE PROCESS OF SKIN DESQUAMATION”, published on November 18, 2021; and International Patent Application Publication No.: WO2005075667 entitled, “DIAGNOSTICS AND THERAPEUTICS FOR DISEASES ASSOCIATED WITH KALLIKREIN 7 (KLK7)”, published on August 18, 2005, the content of which is incorporated herein by reference.

[0158] In some embodiments, one or more anti-KLK5 / KLK7 antibodies may be combined with any appropriate anti-KLK5 antibody to produce a multispecific or bispecific anti-KLK5 / KLK7 antibody. For example, a KLK5 / KLK7 antibody, as described herein (Table 1 and Table 2), may be combined with any appropriate anti-KLK5 antibody. Non-limiting examples of anti-KLK5 antibodies are provided in U.S. Patent No. 11,292,828 entitled “KLK5 INHIBITORY PEPTIDE”, granted April 5, 2022; U.S. Patent Application Publication No. 2022-0306725 entitled “KLK5 INHIBITORY PEPTIDE”, published September 29, 2022; US Patent Application Publication No.: 2019-0078160 entitled “USE OF KLK5 ANTAGONISTS FOR TREATMENT OF A DISEASE”, published on March 14, 2019; International Patent Application Publication No.: WO2021156171 Petition 870250091425, dated 07 / 10 / 2025, page 77 / 159 Publication of International Patent Application No. 69 / 129 entitled “ANTIBODIES AGAINST KLK5”, published on August 12, 2021; Publication of US Patent Application No. 2021-0301032 entitled “ANTI-KLK5 ANTIBODIES AND METHODS OF USE”, published on September 30, 2021; and Publication of US Patent Application No. 2021-0130492 entitled “ANTI-KLK7 ANTIBODIES, ANTI-KLK5 ANTIBODIES, MULTISPECIFIC ANTI-KLK5 / KLK7 ANTIBODIES, AND METHODS OF USE”, published on May 6, 2021, the contents of which are incorporated herein by reference.

[0159] In some embodiments, a multispecific antibody comprises three, four, five, six, seven, eight, or more distinct antigen-specific binding sites. In some embodiments, each distinct antigen-specific binding site of a multispecific antibody targets a different antigen. In some embodiments, each distinct antigen-specific binding site of a multispecific antibody targets a different region of the same antigen. In some embodiments, a multispecific antibody comprises distinct antigen-specific binding sites targeting different antigens and / or distinct antigen-specific binding sites targeting different regions of the same antigen. In some embodiments, a multispecific antibody comprises at least one antigen-specific binding site targeting a first antigen and at least one antigen-specific binding site targeting a second antigen.In some embodiments, a multispecific antibody comprises two or more antigen-specific binding sites that target different regions of a first antigen and / or two or more antigen-specific binding sites that target different regions of a second antigen.

[0160] In some embodiments, a multispecific antibody targets two antigens and contains an antigen-specific binding site for each antigen (1 + 1). In some embodiments, a multispecific antibody Petition 870250091425, dated 07 / 10 / 2025, page 78 / 159 70 / 129 targets two antigens and contains two antigen-specific binding sites (2+2). In some embodiments, a multispecific antibody targets two antigens and contains one antigen-specific binding site and two antigen-specific binding sites (1+2). In some embodiments, a multispecific antibody targets two antigens and contains two antigen-specific binding sites for one antigen and three antigen-specific binding sites for the other antigen (2+3). In some embodiments, a multispecific antibody targets two antigens and contains three antigen-specific binding sites for one antigen and three antigen-specific binding sites for the other antigen (3+3).

[0161] In some embodiments, a multispecific antibody does not possess Fc-mediated effector functions, such as antibody-dependent cell-mediated cytotoxicity (ADCC), antibody-dependent cellular phagocytosis (ADCP), complement fixation, and FcRn-mediated recycling. However, in some embodiments, a multispecific antibody comprises one or more Fc regions that support Fc-mediated effector functions, such as antibody-dependent cell-mediated cytotoxicity (ADCC), antibody-dependent cellular phagocytosis (ADCP), complement fixation, and FcRn-mediated recycling.

[0162] In some embodiments, an antibody provided here is a bispecific antibody. In some embodiments, a bispecific antibody comprises at least two different Fv regions. In some embodiments, a bispecific antibody comprises two different heavy chains and two different light chains. In some embodiments, a bispecific antibody comprises one or more IgG molecules. In some embodiments, a bispecific antibody comprises one or more IgG molecules that contain additional antigen-specific binding sites, for example, IgG molecules comprising an attached or modified Ig-like structure.

[0163] In some embodiments, a bispecific antibody comprises Petition 870250091425, dated 07 / 10 / 2025, p. 79 / 159 71 / 129 two variable single-chain fragments (scFvs) connected via a linker. In some embodiments, a bispecific antibody comprises two single-domain antibodies, such as VH or VL, VHH, VNAR domains or nanobodies connected via a linker (e.g., a flexible glycine-rich linker, such as a (G4S)3- linker). In some embodiments, a bispecific antibody is in a diabody format, as described in P Holliger, T Prospero and G Winter, “Diabodies”: small bivalent and bispecific antibody fragments, Proc Natl Acad Sci US A. 1993 Jul 15; 90(14): 6444-6448, the full contents of which are incorporated herein by reference in their entirety. In some embodiments, a bispecific antibody is a Fab fusion protein, such as a Fab-Fab fusion protein, a Fab-scFv fusion protein, or a Fab-Fv fusion protein.In some embodiments, a bispecific antibody comprises an antigen-binding site, for example, an scFv, which is modified to contain a second, distinct antigen-specific binding site as an integral part of the antibody, for example, scFv.

[0164] In some embodiments, a bispecific antibody is in a fragment-based format, a symmetric format, or an asymmetric format. In some embodiments, a bispecific antibody in a fragment-based format does not comprise an Fc region. In some embodiments, a bispecific antibody is in a tandem VHHs format, a tandem scFvs format, a DART format, a diabody format, an F(ab)2 format, a scFv-Fab format, a tandem VHHs format, a (scFv)2-Fab format, or a tandem diabody format. In some embodiments, a bispecific antibody is in an asymmetric format selected from among: rat-mouse hybrid IgG, hetero H HL exchange and / or assembly IgG, hetero H forced HL IgG, cH IgG, hetero H CrossMab, scFv-Fab IgG, DART-Fc, LP-DART, CODV-Fab-TL, HLE-BiTE and F(ab)3CrossMab format.In some embodiments, a bispecific antibody is in a symmetrical format selected from: IgG-(scFv)2, Bs4Ab, DVD-Ig, tetravalent DART-Fc, (scFV)4Fc, CODV-Ig, two-in-one, mAb2, F(ab)4 CrossMab, and tandem VHH-Fc format. Petition 870250091425, dated 07 / 10 / 2025, p. 80 / 159 72 / 129

[0165] In some embodiments, a bispecific antibody is engineered to facilitate formation via the knobs-into-holes technique, for example, to facilitate heterodimerization. The knobs-into-holes technique can be used, in some embodiments, to produce bispecific IgG molecules, trivalent Ig-type antibodies, bispecific Fc and CH3 fusion proteins, and other formats, as discussed in Ridgway JB, et al., 'Knobs-into-holes' engineering of antibody CH3 domains for heavy chain heterodimerization. Protein Eng 1996; 9:617-21; Atwell S, et al., Stable heterodimers from remodeling the domain interface of a homodimer using a phage display library, J Mol Biol 1997; 270:26-35; and Merchant AM, et al., An efficient route to human bispecific IgG, Nat Biotechnol 1998; 16:677-681, the complete content of each of which is incorporated herein by reference in its entirety.

[0166] In some embodiments, a bispecific antibody does not possess Fc-mediated effector functions, such as antibody-dependent cell-mediated cytotoxicity (ADCC), antibody-dependent cellular phagocytosis (ADCP), complement fixation, and / or FcRn-mediated recycling. However, in some embodiments, a bispecific antibody comprises one or more Fc regions that support Fc-mediated effector functions, such as antibody-dependent cell-mediated cytotoxicity (ADCC), antibody-dependent cellular phagocytosis (ADCP), complement fixation, and FcRn-mediated recycling. III. Preparation of anti-KLK5 / KLK7 antibodies

[0167] The antibodies described here can be produced by any method known in the field. See, for example, Harlow and Lane, (1998) Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, New York.

[0168] In some embodiments, antibodies specific to a target antigen (e.g., KLK5 and / or KLK7) can be produced by conventional hybridoma technology. The full-length target antigen or a fragment thereof, optionally coupled to a carrier protein such as KLH, can be used to immunize a host animal to generate Petition 870250091425, dated 07 / 10 / 2025, page 81 / 159 73 / 129 antibodies that bind to this antigen. The route and timing of host animal immunization generally conform to established and conventional techniques for antibody stimulation and production, as described in more detail here. General techniques for producing mouse, humanized, and human antibodies are known in the art and are described here. Any mammalian subject, including humans, or antibody-producing cells, is considered suitable to serve as a basis for the production of mammalian hybridoma cell lines, including humans. Typically, the host animal is inoculated intraperitoneally, intramuscularly, orally, subcutaneously, intraplantarly, and / or intradermally with an amount of immunogen, including as described here.

[0169] If desired, an antibody (monoclonal or polyclonal) of interest (e.g., produced by a hybridoma) can be sequenced, and the polynucleotide sequence can then be cloned into a vector for expression or propagation. The sequence encoding the antibody of interest can be maintained in the vector in a host cell, and the host cell can then be expanded and frozen for future use. Alternatively, the polynucleotide sequence can be used for genetic manipulation to “humanize” the antibody or to improve the affinity (affinity maturation) or other characteristics of the antibody. For example, the constant region can be engineered to more closely resemble human constant regions to avoid an immune response if the antibody is used in clinical trials and treatments in humans. It may be desirable to genetically manipulate the antibody sequence to achieve higher affinity for the target antigen and greater efficacy.It will be evident to a specialist in the field that one or more polynucleotide changes can be made to the antibody and still maintain its specificity for binding to the target antigen.

[0170] In other embodiments, fully human antibodies can be obtained using commercially available mice that have been engineered to express specific human immunoglobulin proteins. Petition 870250091425, dated 07 / 10 / 2025, page 82 / 159 74 / 129 Transgenic animals engineered to produce a more desirable (e.g., fully human antibodies) or more robust immune response can also be used for the generation of humanized or human antibodies. Examples of this technology are the XenomouseRTM from Amgen, Inc. (Fremont, CA) and the HuMAb-MouseRTM and TC MouseTM from Medarex, Inc. (Princeton, NJ) or H2L2 mice from Harbour Antibodies BV (Netherlands). Alternatively, antibodies can be produced recombinantly by phage display or yeast technology. See, for example, U.S. Patents Nos. 5,565,332; 5,580,717; 5,733,743; and 6,265,150; and Winter et al., (1994) Annu. Rev. Immunol. 12:433-455. Alternatively, phage display technology (McCafferty et al., (1990) Nature 348:552-553) can be used to produce human antibodies and antibody fragments in vitro from immunoglobulin variable domain (V) gene repertoires from non-immunized donors.

[0171] Antigen-binding fragments of an intact antibody (full-length antibody) can be prepared using routine methods. For example, F(ab')2 fragments can be produced by pepsin digestion of an antibody molecule, and Fab fragments can be generated by reducing the disulfide bridges of F(ab')2 fragments. Genetically modified antibodies, such as humanized antibodies, chimeric antibodies, single-chain antibodies, and bispecific antibodies, can be produced using, for example, conventional recombinant technology. In one example, the DNA encoding monoclonal antibodies specific for a target antigen can be easily isolated and sequenced using conventional procedures (e.g., using oligonucleotide probes that are capable of specifically binding to genes encoding the heavy and light chains of monoclonal antibodies). Hybridoma cells serve as a preferred source of such DNA.Once isolated, the DNA can be placed into one or more expression vectors, which are then transfected into host cells, such as E. coli cells, simian COS cells, ovarian cells. Petition 870250091425, dated 07 / 10 / 2025, page 83 / 159 75 / 129 Chinese hamster (CHO) cells, human HEK293 cells, or myeloma cells that do not produce immunoglobulin protein, to obtain the synthesis of recombinant monoclonal antibodies in host cells. See, for example, PCT Publication No. WO 87 / 04462. The DNA can then be modified, for example, by replacing the coding sequence of the constant domains of the human heavy and light chains in place of homologous murine sequences, Morrison et al., (1984) Proc. Sci. 81:6851, or by covalently joining to the immunoglobulin coding sequence all or part of the coding sequence of a non-immunoglobulin polypeptide. In this way, genetically modified antibodies, such as “chimeric” or “hybrid” antibodies, can be prepared with the binding specificity of a target antigen.

[0172] A single-chain antibody can be prepared using recombinant technology by linking a nucleotide sequence encoding a variable region of the heavy chain and a nucleotide sequence encoding a variable region of the light chain. Preferably, a flexible linker is incorporated between the two variable regions.

[0173] Antibodies obtained following a method known in the art and described herein can be characterized using methods well known in the art. For example, one method consists of identifying the epitope to which the antigen binds, or “epitope mapping.” There are many known methods in the field for mapping and characterizing the location of epitopes on proteins, including crystal structure resolution of an antibody-antigen complex, competition assays, gene fragment expression assays, and synthetic peptide-based assays, as described, for example, in Chapter 11 of Harlow and Lane, Using Antibodies, a Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1999. In one example, epitope mapping can be performed using H / D-Ex (hydrogen and deuterium exchange) coupled with proteolysis and mass spectrometry.In a further example, epitope mapping can be used to determine the sequence to which an antibody binds. Petition 870250091425, dated 07 / 10 / 2025, p. 84 / 159 76 / 129 An epitope can be a linear epitope, i.e., contained in a single amino acid sequence, or a conformational epitope formed by a three-dimensional interaction of amino acids that may not necessarily be contained in a single sequence (linear sequence of the primary structure). Peptides of varying lengths (e.g., at least 4-6 amino acids in length) can be isolated or synthesized (e.g., recombinantly) and used for antibody binding assays. In another example, the epitope to which the antibody binds can be determined in a systematic screening using overlapping peptides derived from the target antigen sequence and determining antibody binding. According to gene fragment expression assays, the open reading frame encoding the target antigen is fragmented randomly or by specific genetic constructs, and the reactivity of the expressed antigen fragments with the antibody to be tested is determined.Gene fragments can, for example, be produced by PCR and then transcribed and translated into proteins in vitro, in the presence of radioactive amino acids. Antibody binding to radioactively labeled antigen fragments is then determined by immunoprecipitation and gel electrophoresis. Certain epitopes can also be identified using large libraries of random peptide sequences displayed on the surface of phage particles (phage libraries). Alternatively, a defined library of overlapping peptide fragments can be tested for binding to the test antibody in single binding assays. In a further example, antigen-binding domain mutagenesis, domain exchange experiments, and alanine screening mutagenesis can be performed to identify required, sufficient, and / or necessary residues for epitope binding.Alternatively, competition assays can be performed using other antibodies known to bind to the same antigen to determine if an antibody binds to the same epitope as the other antibodies. Competition assays are well known to those knowledgeable in the field. Petition 870250091425, dated 07 / 10 / 2025, page 85 / 159 77 / 129

[0174] In some examples, an antibody described herein is prepared by recombinant technology, as exemplified below. The nucleic acids encoding the heavy and light chains of an antibody, as described herein, can be cloned into an expression vector, with each nucleotide sequence operably bound to a suitable promoter. In one example, each of the nucleotide sequences encoding the heavy chain and the light chain is operably bound to a distinct promoter. Alternatively, the nucleotide sequences encoding the heavy chain and the light chain can be operably bound to a single promoter, so that both the heavy and light chains are expressed from the same promoter. When necessary, an internal ribosomal entry site (IRES) can be inserted between the heavy chain and light chain coding sequences.

[0175] In some examples, the nucleotide sequences that encode the two antibody chains are cloned into two vectors, which can be introduced into the same cell or into different cells. When the two chains are expressed in different cells, each can be isolated from the host cells that express them, and the isolated heavy and light chains can be mixed and incubated under suitable conditions, allowing antibody formation.

[0176] Generally, a nucleic acid sequence encoding one or all of the strands of an antibody can be cloned into a suitable expression vector in operable ligation with a suitable promoter using methods known in the art. For example, the nucleotide sequence and the vector can be brought into contact, under suitable conditions, with a restriction enzyme to create complementary ends on each molecule, which can pair with each other and be joined by a ligase. Alternatively, synthetic nucleic acid ligands can be ligated to the ends of a gene. These synthetic ligands contain nucleic acid sequences that correspond to a specific restriction site on the vector. The selection of expression vectors / promoters would depend on the type of host cells to be used in Petition 870250091425, dated 07 / 10 / 2025, page 86 / 159 78 / 129 antibody production.

[0177] A variety of promoters can be used for expression of the antibodies described herein, including, but not limited to, cytomegalovirus (CMV) intermediate early promoter, a viral LTR such as the Rous sarcoma virus LTR, HIV-LTR, HTLV-1 LTR, simian virus 40 (SV40) early promoter, E. coli lac UV promoter and herpes simplex virus tk promoter.

[0178] Regulated promoters can also be used. Such regulated promoters include those that use the E. coli lac repressor as a transcription modulator to regulate the transcription of mammalian cell promoters carrying the lac operator [[Brown, M. et al., Cell, 49:603-612 (1987)]], those that use the tetracycline repressor (tetR) [[Gossen, M., and Bujard, H., Proc. Natl. Sci. USA 89:5547-555115 (1992); Yao, F. et al., Human Gene Therapy, 9:1939-1950 (1998); Shockelt, P., et al., Proc. Natl. Sci. USA, 92:6522-6526 (1995)]]. Other systems include FK506, VP16, or p65 dimers using astradiol, RU486, the diphenol murislerone, or rapamycin. Inducible systems are available from Invitrogen, Clontech, and Ariad, among others.

[0179] Regulated promoters that include a repressor with the operon can be used. In one embodiment, the lac repressor of E. coli can function as a transcriptional modulator to regulate the transcription of mammalian cell promoters bearing the lac operator [[M. Brown et al., Cell, 49:603-612 (1987)]]; Gossen and Bujard (1992); [[M. Gossen et al., Natl. Acad. [Sci. USA, 89:5547-5551(1992)]] combined the tetracycline repressor (tetR) with the transcription activator (VP 16) to create a mammalian cell tetR-transcription activator fusion protein, tTa (tetR-VP 16), with the tetO-bearing minimal promoter derived from the human cytomegalovirus (hCMV) promoter to create a tetR-tet operator system to control gene expression in mammalian cells. In one embodiment, a tetracycline-inducible switch is used.Tetracycline repressor (tetR) alone, rather than fusion derivatives of mammalian cell transcription factors with tetR, can function as a potent transmodulator to regulate... Petition 870250091425, dated 07 / 10 / 2025, page 87 / 159 79 / 129 gene expression in mammalian cells when the tetracycline operator is correctly positioned downstream of the TATA element of the CMVIE promoter (Yao et al., Human Gene Therapy). A particular advantage of this tetracycline-inducible change is that it does not require the use of a tetracycline-repressor transactivating or mammalian cell fusion protein, which in some cases can be toxic to cells (Gossen et al., Natl. Acad. Sci. USA, 89:5547-5551 (1992); Shockett et al., Proc. Natl. Acad. Sci. USA, 92:6522-6526 (1995)), to achieve its regulable effects.

[0180] In addition, the vector may contain, for example, some or all of the following: a selectable marker gene, such as the neomycin gene for selection of stable or transient transfectants in mammalian cells; enhancer / promoter sequences of the human CMV immediate early gene for high transcription levels; transcription termination signals and RNA processing of SV40 for mRNA stability; SV40 and ColE1 polyome replication origins for proper episomal replication; internal ribosome binding sites (IRESes), versatile multiple cloning sites; and T7 and SP6 RNA promoters for in vitro transcription of sense and antisense RNA. Suitable vectors and methods for producing vectors containing transgenes are well known and available in the art.Examples of polyadenylation signals useful for the practice of the methods described herein include, among others, the polyadenylation signal of human collagen I, the polyadenylation signal of human collagen II, and the polyadenylation signal of SV40.

[0181] One or more vectors (e.g., expression vectors) comprising nucleic acids encoding any of the antibodies (e.g., the nucleic acid coding sequence listed in Table 3) may be introduced into suitable host cells to produce the antibodies. Non-limiting examples of host cells include Chinese hamster ovary (CHO) cells, dhfr-CHO cells, human embryonic kidney (HEK)-293 cells, verda reno (VERO) cells, non-secretory null (NS0) cells, human embryonic retinal (PER.C6) cells, Sp2 / 0 cells, cells Petition 870250091425, dated 07 / 10 / 2025, page 88 / 159 80 / 129 baby hamster kidney (BHK) cells, Madin-Darby canine kidney cells (MDCK), Madin-Darby bovine kidney cells (MDBK), and SV40-transformed monkey kidney cell line CV1 (COS). In some embodiments, the host cells expressing the antibodies described herein are CHO cells. The host cells can be cultured under suitable conditions for expression of the antibody or any of its polypeptide chains. Such antibodies or their polypeptide chains can be recovered by the cultured cells (e.g., from the cells or culture supernatant) by a conventional method, e.g., affinity purification. If necessary, the antibody polypeptide chains can be incubated under suitable conditions for an appropriate period of time, allowing antibody production. In some embodiments, the host cell comprises the nucleic acid encoding the heavy chain of the antibody described herein.In some embodiments, the host cell comprises the nucleic acid encoding the light chain of the antibody described herein. In some embodiments, the host cell comprises both the nucleic acid encoding the heavy chain and the nucleic acid encoding the light chain.

[0182] In some embodiments, the methods for preparing an antibody described herein involve a recombinant expression vector encoding both the heavy and light chains of an antibody described herein, as also described herein. The recombinant expression vector can be introduced into a suitable host cell (e.g., a dhfr-CHO cell) by a conventional method, e.g., calcium phosphate-mediated transfection. Positive transforming host cells can be selected and cultured under suitable conditions, allowing the expression of the two polypeptide chains that form the antibody, which can be recovered from the cells or the culture medium. When necessary, the two chains recovered from the host cells can be incubated under suitable conditions, allowing antibody formation.

[0183] In one example, two recombinant expression vectors are Petition 870250091425, dated 07 / 10 / 2025, page 89 / 159 81 / 129 provided, one encoding the antibody heavy chain and the other encoding the antibody light chain. Both recombinant expression vectors can be introduced into a suitable host cell (e.g., dhfr-CHO cell) by a conventional method, e.g., calcium phosphate-mediated transfection.

[0184] Alternatively, each of the expression vectors can be introduced into suitable host cells. Positive transformants can be selected and cultured under suitable conditions, allowing the expression of the antibody polypeptide chains. When the two expression vectors are introduced into the same host cells, the antibody produced can be recovered from the host cells or the culture medium. If necessary, the polypeptide chains can be recovered from the host cells or the culture medium and then incubated under suitable conditions, allowing antibody formation. When the two expression vectors are introduced into different host cells, each can be recovered from the corresponding host cells or the corresponding culture medium. The two polypeptide chains can then be incubated under suitable conditions for antibody formation.

[0185] Standard molecular biology techniques are used to prepare the recombinant expression vector, transfect the host cells, select the transformants, culture the host cells, and recover the antibodies from the culture medium. For example, some antibodies can be isolated by affinity chromatography with a Protein A or Protein G coupled to the matrix.

[0186] Any of the nucleic acids encoding the heavy chain, the light chain, or both of an antibody as described herein (e.g., as provided in Table 3), vectors (e.g., expression vectors) containing such; and host cells comprising the vectors are within the scope of this disclosure. Table 3: Nucleic acid sequences encoding VH / VL of anti-KLK5 / KLK7 antibodies listed in Table 1 Petition 870250091425, dated 07 / 10 / 2025, page 90 / 159 82 / 129 Anticorpo Sequência de Ácido Nucleico SEQ ID NO KLK5 / K LK7- Dual- Ab1 VH CAGCTGCAATTGCAAGAGTCCGGACCCGGA CTCGTCAAGCCGAGCGAAACTCTGAGCCTC ACCTGTACTGTGTCCGGAGGCTCCAI 1 1 CGT CCTCCGACTACTACTGGGGGTGGATTAGGC AGCCACCTGGAAAGGGGCTGGAATGGATCG GTTCCATCTACTATTCGGGCTCGACCTACTA CAACCCCTCACTGAAATCGCGCGTCACCAT CTCTGTGGACACCTCCAAGAACCAGTTCAG CCTTAAGCTGTCCTCAGTGACGGCCGCAGA CACTGCCGTGTACTACTGCGCGAGAGGCAG ACCGCTGGGATACGGTGCCCGGCACTATTA CTACGGGATGGATGTCTGGGGCCAGGGAAC TACCGTGACCGTGTCCAGC 22 VL GACATTCAAATGACCCAGTCCCCGTCGTCC CTGTCTGCGTCCGTGGGCGACAGAGTGACG ATCACTTGCCGGGCTTCCCAAAGCATCTCCT CCTATCTGAACTGGTACCAGCAGAAGCCCG GAAAAGCCCCCAAGCTGCTCATCTACTCCG CCTCGAGCTTGCAGTCAGGAGTGCCGTCCC GCTTCTCGGGATCAGGCTCCGGGACCGACT TCACCCTGACCATTAGCAGCCTGCAGCCGG AAGAI I I CGCCACTTACTACTGTCAGCAGTC GCCTCCC I I ICCTCCACTCACTTTCGGGGGT GGCACCAAGGTCGAGATCAAG 23 KLK5 / K LK7- Dual- VH CAGCTGCAACTGCAAGAATCGGGCCCCGGG CTCGTGAAGCCCTCCGAAACTCTGTCCCTG ACTTGCACCGTGTCCGGCGGATCTATCAGC 24 Petição 870250091425, de 07 / 10 / 2025, pág. 91 / 159 83 / 129 Anticorpo Sequência de Ácido Nucleico SEQ ID NO Ab2 AGCGACGATTACTACTGGGTCTGGATTAGAC AGCCGCCTGGAAAGGGTCTTGAGTGGATCG GGTCAATCGACTACTTCGCCTCCACCTACTA CAACCCATCACTGAAGTCCAGGGTCACCATT AGCGTGGACACCTCGAAGAACCAGTTCAGC CTGAAATTGTCGTCCGTGACCGCGGCAGAC ACCGCCGTGTACTACTGTGCTCGGGGTCGG CCGCTCGGCTACGGCGCCCGCCACGACTAT TACGGAATGGATGTCTGGGGACAGGGAACG ACCGTGACTGTGTCCTCC VL GACATTCAAATGACCCAGTCCCCATCGTCAC TCTCCGCCTCCGTGGGAGACAGAGTGACCA TCACCTGTCGCGCTAGCCAGTCCATTTCCTC CTACTTGAACTGGTACCAGCAGAAGCCCGG GAAGGCCCCGAAGCTGCTGATCTATAGCGC CAGCAGCCTTCAGTCGGGAGTGCCCTCTCG GTTCTCGGGGTCGGGTTCCGGAACTGA1 1 1 CACTCTCACCATCTCATCCCTGCAACCTGAG GACTTCGCGACTTACTACTGCCAACAGTCCC CGTACTTCCCTCCGCTGACGTTTGGCGGCG GCACCAAAGTCGAAATCAAG 25 KLK5 / K LK7- Dual- Ab3 VH CAGCTCCAACTGCAAGAATCCGGTCCGGGG CTTGTGAAGCCATCTGAAACCCTGTCCCTGA CGTGTACCGTGTCCGGGGGAAGCATCTCCA GCGACGATTACTACTGGGTCTGGATTCGCC AGCCTCCCGGAAAGGGTCTGGAGTGGATCG GCTCCATTGACTACTATGCCTCGACCTACTA 26 Petição 870250091425, de 07 / 10 / 2025, pág. 92 / 159 84 / 129 Anticorpo Sequência de Ácido Nucleico SEQ ID NO CTCACCGTCCCTGAAGTCGAGAGTGACCAT CTCCGTGGACACCTCGAAAAACCAGTTCAG CCTGAAGCTCAGCTCAGTGACTGCCGCCGA TACCGCGGTGTACTATTGCGCACGGGGCAG GCCCTTGGGATACGGCGCTAAGCACTACTA CTACGGAATGGACGTCTGGGGCCAGGGAAC TACTGTGACCGTGTCCTCC VL GACATTCAAATGACCCAGTCACCGAGCTCC CTGTCCGCCTCCGTGGGTGATCGCGTGACC ATCACTTGTCGGGCGTCGCAGAGCAI 1 1CCT CCTACCTTAACTGGTACCAGCAGAAACCCG GAAAGGCTCCTAAGCTGCTCATCTATTCGGC CTCCTCCTTGCAATCCGGGGTGCCGTCGAG ATTCAGCGGCAGCGGATCCGGGACCGACTT CACCCTCACTATCTCTTCGCTGCAACCTGAA GATTTCGCCACCTACTACTGCCAGCAGTCAC CCTACTTCCCGCCACTGACGTTTGGCGGCG GAACTAAGGTCGAGATCAAG 32 KLK5 / K LK7- Dual- Ab4 VH CAGCTGCAACTTCAAGAATCCGGCCCCGGA CTCGTGAAGCCTTCTGAGACTCTGTCCCTGA CTTGCACCGTGTCGGGTGGCAGCAI I I CCT CACTGGACTACTACTGGGTCTGGATCAGAC AGCCACCCGGAAAGGGACTGGAATGGATCG GATCCATCGACTACTCCGGGGACACCTACT ACAACCCGTCGCTGAAGTCCAGGGTCACCA TTAGCGTGGACACGTCCAAGAACCAGTTCA GCCTGAAATTGTCGTCAGTGACTGCAGCCG 27 Petition 870250091425, of 07 / 10 / 2025, p. 93 / 159 85 / 129 Antibody Nucleic Acid Sequence SEQ ID NO ATACCGCGGTGTACTACTGTGCCCGGGGCC GCCCGCTCGGATACGGTGCTCGGCACTACT ACTATGCCATGGATGTCTGGGGCCAGGGGA CCACCGTGACCGTGTCCAGGC VL GACATCCAAATGACTCA CTCTCGGCTAGCGTGGGCGACAGAGTGACC ATTACTTGCCGCGCGTCACAATCCATCTCTT CATACTTGAACTGGTACCAGCAGAAGCCTG GGAAAGCCCCGAAGCTCCTGATCTATTCCG CCTCGAGCCTGCAGTCGGGAGTGCCCTCCC GGTTCTCCGGGAGCGGTAGCTGACCTCGACCTTGACCTT AGAIIII GCCACCTACTACTGTCAGCAGTCC CCGTACTTCCCTCCACTGACCTTCGGCGGC GGAACCAAGGTCGAGATTAAG 33

[0187] In some embodiments, the present disclosure provides an isolated nucleic acid comprising a sequence at least 60% (for example, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to any of the SEQ ID NOs: 22, 24, 26 or 27. In some embodiments, the present disclosure provides an isolated nucleic acid comprising a sequence at least 60% (for example, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to any of the SEQ ID Nos: 23, 25, 32 or 33.

[0188] In some embodiments, the present disclosure provides an expression vector encoding the anti-KLK5 / KLK7 antibody described herein. In some embodiments, the expression vector comprises at least 60% of an isolated nucleic acid (e.g., 60%, 65%, 70%, 75%, 80%, 85%, 90%, Petition 870250091425, dated 07 / 10 / 2025, p. 94 / 159 86 / 129 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any of the SEQ ID NOs: 22, 24, 26, or 27. In some embodiments, the expression vector comprises a nucleic acid isolate that is at least 60% (e.g., 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identical to any of the SEQ ID NOs: 23, 25, 32, or 33.

[0189] In some embodiments, the anti-KLK5 / KLK7 antibody described herein is produced by expression in a recombinant cell: (i) a nucleic acid isolate at least 60% (e.g., 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to any of the SEQ ID NOs: 22, 24, 26 or 27, and / or (ii) a nucleic acid isolate at least 60% (e.g., 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to any of the SEQ ID Nos: 23, 25, 32 or 33.

[0190] In some embodiments, the anti-KLK5 / KLK7 antibody described herein is produced by expression in a recombinant cell of an expression vector comprising: (i) a nucleic acid isolate at least 60% (e.g., 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to any of the SEQ ID NOs: 22, 24, 26 and 27, and / or (ii) a nucleic acid isolate at least 60% (e.g., 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to any of the SEQ ID Nos: 23, 25, 32 or 33.

[0191] In some embodiments, the present disclosure provides an isolated nucleic acid comprising a sequence at least 60% (for example, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to SEQ ID NO: 22, and / or an isolated nucleic acid at least 60% (for example, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to SEQ ID NO: 23.

[0192] In some embodiments, the present disclosure provides an acid Petition 870250091425, dated 07 / 10 / 2025, p. 95 / 159 87 / 129 isolated nucleic acid comprising a sequence at least 60% (e.g., 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to SEQ ID NO: 24, and / or an isolated nucleic acid at least 60% (e.g., 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to SEQ ID NO: 25.

[0193] In some embodiments, the present disclosure provides an isolated nucleic acid comprising a sequence at least 60% (for example, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to SEQ ID NO: 26, and / or an isolated nucleic acid at least 60% (for example, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to SEQ ID NO: 32.

[0194] In some embodiments, the present disclosure provides an isolated nucleic acid comprising a sequence at least 60% (for example, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to SEQ ID NO: 27, and / or an isolated nucleic acid at least 60% (for example, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to SEQ ID NO: 33.

[0195] In some embodiments, the present disclosure provides an expression vector comprising an isolated nucleic acid comprising a sequence at least 60% (e.g., 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to SEQ ID NO: 22, and / or an isolated nucleic acid at least 60% (e.g., 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to SEQ ID NO: 23.

[0196] In some embodiments, the present disclosure provides an expression vector comprising an isolated nucleic acid comprising a sequence of at least 60% (e.g., 60%, 65%, 70%, 75%, 80%, 85%, Petition 870250091425, dated 07 / 10 / 2025, p. 96 / 159 88 / 129 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to SEQ ID NO: 24, and / or an isolated nucleic acid at least 60% (e.g., 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to SEQ ID NO: 25.

[0197] In some embodiments, the present disclosure provides an expression vector comprising an isolated nucleic acid comprising a sequence at least 60% (e.g., 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to SEQ ID NO: 26, and / or an isolated nucleic acid at least 60% (e.g., 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to SEQ ID NO: 32.

[0198] In some embodiments, the present disclosure provides an expression vector comprising an isolated nucleic acid comprising a sequence at least 60% (e.g., 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to SEQ ID NO: 27, and / or an isolated nucleic acid at least 60% (e.g., 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to SEQ ID NO: 33.

[0199] In some embodiments, the antibodies described herein are used to modulate the activity or function of at least one gene, protein, and / or nucleic acid. In some embodiments, the molecular payload is responsible for modulating a gene, protein, and / or nucleic acid. A molecular payload can be a small molecule, protein, nucleic acid, oligonucleotide, or any molecular entity capable of modulating the activity or function of a gene, protein, and / or nucleic acid in a cell.

[0200] In some embodiments, a multispecific antibody comprises the direct fusion or binding of different antigen-specific binding sites. In some embodiments, a multispecific antibody comprises immunoglobulin-derived heteromerization domains to generate multispecific antibodies. In some embodiments, an antibody Petition 870250091425, dated 07 / 10 / 2025, page 97 / 159 89 / 129 A multispecific antibody can be formed by the co-expression of different heavy chains and two different light chains. In some embodiments, a multispecific antibody can be formed by the co-expression of different heavy chains and a common light chain. In some embodiments, a multispecific antibody comprises an engineered CH1 domain (first Ig constant domain of the heavy chain) that facilitates proper heavy chain-light chain pairing, for example, in such a co-expression system, as disclosed in International Patent Application Publication Number WO2021067404, “CH1 DOMAIN VARIANTS ENGINEERED FOR PREFERENTIAL LIGHT CHAIN ​​PAIRING AND MULTISPECIFIC ANTIBODIES COMPRISING THE SAME”, published on April 8, 2021, the content of which is incorporated here by reference.

[0201] In some embodiments, a multispecific antibody comprises a variant CH1 domain that pairs (e.g., preferentially pairs) with a variant CL domain. For example, in some embodiments, a multispecific antibody comprises a heavy chain comprising a variant CH1 domain that preferentially pairs with a variant CLK or CLλ domain. Non-limiting examples of such multispecific antibody configurations are provided in International Patent Application Publication Number WO2022150787, “VARIANT CH1 DOMAINS AND VARIANT CL DOMAINS ENGINEERED FOR PREFERENTIAL CHAIN ​​PAIRING AND MULTI-SPECIFIC ANTIBODIES COMPRISING THE SAME”, published on July 14, 2022, the contents of which are incorporated herein by reference in their entirety.

[0202] In some embodiments, a multispecific antibody comprises variant CH3 domains that preferentially form CH3-CH3 heterodimers rather than CH3-CH3 homodimers. The incorporation of these variant CH3 domains facilitates heterodimerization, for example, of different antibodies to form multispecific antibodies. Non-limiting examples of such multispecific antibody configurations are provided. Petition 870250091425, dated 07 / 10 / 2025, page 98 / 159 90 / 129 in International Patent Application Publication Number WO2022150785, “VARIANT CH3 DOMAINS ENGINEERED FOR PREFERENTIAL CH3 HETERODIMERIZATION, MULTI-SPECIFIC ANTIBODIES COMPRISING THE SAME, AND METHODS OF MAKING THEREOF”; published on July 14, 2022, the contents of which are incorporated herein by reference in their entirety.

[0203] In some embodiments, a bispecific antibody comprises the direct fusion or binding of different antigen-specific binding sites. In some embodiments, a bispecific antibody comprises immunoglobulin-derived heterodimerization domains to generate bispecific antibodies. For example, in some embodiments, a bispecific antibody may be formed by the co-expression of two different heavy chains and two different light chains. In some embodiments, a bispecific antibody may be formed by the co-expression of two different heavy chains and a common light chain. In some embodiments, the fusion of two antibody-producing cell lines allows the combination of the heavy and light chains of two different antibodies, so that the resulting bispecific antibodies comprise the heavy and light chains of the first antibody and the heavy and light chains of the second antibody.In some embodiments, the constant regions of the heavy and light chains are of the same isotype. In some embodiments, the constant regions of the heavy and light chains are of different isotypes.

[0204] In some embodiments, a bispecific antibody comprises variant heavy chains and / or light chains that force correct assembly between the two heavy chains and cognate heavy and light chains, or to facilitate the purification of correctly assembled bispecific antibodies (see, for example, Figures 3 and 4 and Table 1 in Brinkmann U and Kontermann EE, The making of bispecific antibodies, MAbs. 2017 Feb / Mar;9(2):182-212). In some embodiments, a bispecific antibody is formed using the knobs-in-hole technique, for example, to facilitate heterodimerization. The knobs-in-hole technique can be used, in some embodiments, to produce molecules Petition 870250091425, dated 07 / 10 / 2025, p. 99 / 159 91 / 129 of bispecific IgG, trivalent Ig-type antibodies, bispecific Fc and CH3 fusion proteins, and other formats, as discussed in Ridgway JB, et al., 'Knobs-into-holes' engineering of antibody CH3 domains for heavy chain heterodimerization. Protein Eng 1996; 9:617-21; Atwell S, et al., Stable heterodimers from remodeling the domain interface of a homodimer using a phage display library, J Mol Biol 1997; 270:26-35; and Merchant AM, et al., An efficient route to human bispecific IgG, Nat Biotechnol 1998; 16:677-681, the complete content of each of which is incorporated herein by reference in its entirety.

[0205] In some embodiments, a bispecific antibody comprises an engineered CH1 domain (first Ig domain constant of the heavy chain) that facilitates proper heavy chain-light chain pairing, for example, in such a co-expression system, as disclosed in International Patent Application Publication No: WO2021067404, “CH1 DOMAIN VARIANTS ENGINEERED FOR PREFERENTIAL LIGHT CHAIN ​​PAIRING AND MULTISPECIFIC ANTIBODIES COMPRISING THE SAME”, published on April 8, 2021, the contents of which are incorporated herein by reference.

[0206] In some embodiments, a bispecific antibody comprises a variant CH1 domain that pairs (e.g., preferentially pairs) with a variant CL domain. For example, in some embodiments, a bispecific antibody comprises a heavy chain comprising a variant CH1 domain that preferentially pairs with a variant CLK or CLλ domain. Non-limiting examples of such bispecific antibody configurations are provided in International Patent Application Publication No. WO2022150787, “VARIANT CH1 DOMAINS AND VARIANT CL DOMAINS ENGINEERED FOR PREFERENTIAL CHAIN ​​PAIRING AND MULTI-SPECIFIC ANTIBODIES COMPRISING THE SAME”, published on July 14, 2022, the contents of which are incorporated herein by reference in their entirety.

[0207] In some embodiments, a bispecific antibody comprises variant CH3 domains that preferentially form CH3-CH3 heterodimers. Petition 870250091425, dated 07 / 10 / 2025, pp. 100 / 159 92 / 129 instead of CH3-CH3 homodimers. The incorporation of these variant CH3 domains facilitates heterodimerization, for example, of different antibodies to form bispecific antibodies. Non-limiting examples of such bispecific antibody configurations are provided in International Patent Application Publication No. WO2022150785, “VARIANT CH3 DOMAINS ENGINEERED FOR PREFERENTIAL CH3 HETERODIMERIZATION, MULTI-SPECIFIC ANTIBODIES COMPRISING THE SAME, AND METHODS OF MAKING THEREOF”; published on July 14, 2022, the contents of which are incorporated herein by reference in their entirety.

[0208] In some embodiments, a bispecific antibody can be formed using non-immunoglobulin heterodimerization modules to combine different antigen-specific binding sites in a covalent or non-covalent manner. For example, in some embodiments, a bispecific antibody is formed via a docking and locking (DNL) method using heterodimeric assembly of the cAMP-dependent protein kinase (PKA) regulatory subunit and the anchoring domains (ADs) of anchor kinase A proteins (AKAPs). In some embodiments, a bispecific antibody can be formed using non-immunoglobulin heterodimerization modules to combine different antigen-specific binding sites, such as the barnase-barstar system, adapter / docking marker modules based on mutated RNase I fragments, and SNARE modules based on the interaction of the three proteins syntaxin, synaptobrevin, and SNAP25. IV. Pharmaceutical Composition

[0209] Antibodies, as well as coding nucleic acids or sets of nucleic acids, vectors comprising them, or host cells comprising the vectors, as described herein, may be mixed with a pharmaceutically acceptable carrier (excipient) to form a pharmaceutical composition for use in the treatment of a target disease. “Acceptable” means that the carrier must be compatible with the ingredient. Petition 870250091425, dated 07 / 10 / 2025, pp. 101 / 159 93 / 129 active ingredient of the composition (and preferably capable of stabilizing the active ingredient) and not harmful to the subject to be treated. Pharmaceutically acceptable excipients (vehicles), including buffers, are well known in the field. See, for example, Remington: The Science and Practice of Pharmacy, 20th edition (2000), Lippincott Williams and Wilkins, Ed. KE Hoover.

[0210] The pharmaceutical composition containing anti-KLK5 / KLK7 antibody disclosed herein may further comprise a suitable buffering agent. A buffering agent is a weak acid or base used to maintain the pH of a solution close to a chosen value after the addition of another acid or base. In some examples, the buffering agent disclosed herein may be a buffering agent capable of maintaining physiological pH despite changes in carbon dioxide concentration (produced by cellular respiration). Exemplary buffering agents include, but are not limited to, a HEPES buffer (4-(2-hydroxyethyl)-1-piperazinoethanesulfonic acid), Dulbecco's phosphate-buffered saline buffer (DPBS), or phosphate-buffered saline buffer (PBS). These buffers may comprise disodium hydrogen phosphate and sodium chloride, or dipotassium potassium phosphate and potassium chloride.

[0211] The pharmaceutical composition described herein comprises one or more suitable salts. A salt is an ionic compound that can be formed by the neutralization reaction of an acid and a base. (Skoog, DA; West, DM; Holler, JF; Crouch, SR (2004). “Chapters 14-16”. Fundamentals of Analytical Chemistry (8th ed.)). Salts are composed of related numbers of cations (positively charged ions) and anions (negative ions), so that the product is electrically neutral (no net charge).

[0212] In some embodiments, pharmaceutical compositions may comprise pharmaceutically acceptable vehicles, excipients, or stabilizers in the form of lyophilized formulations or aqueous solutions. (Remington: The Science and Practice of Pharmacy 20th Ed. (2000) Lippincott Williams and Wilkins, Ed. KE Hoover). In some embodiments, the pharmaceutical composition may be formulated for intravenous injection. In some Petition 870250091425, dated 07 / 10 / 2025, pp. 102 / 159 In 94 / 129 modalities, the pharmaceutical composition can be formulated for subcutaneous injection.

[0213] Pharmaceutical compositions to be used for in vivo administration must be sterile. This is readily achieved, for example, by filtration through sterile filtration membranes. Therapeutic antibody compositions are generally placed in a container with a sterile access port, for example, an intravenous or subcutaneous solution bag or bottle with a stopper that can be pierced by a hypodermic injection needle. V. Methods of Use

[0214] In certain respects, the disclosure provides related methods and compositions for treating conditions associated with KLK5 and KLK7-related dysregulation, including, for example, Netherton syndrome, atopic dermatitis (with and without filaggrin mutations), eosinophilic esophagitis, nodular prurigo, chronic pruritus of unknown origin (CPUO), dry skin, asthma (e.g., asthma specifically related to KLK5), ichthyosis vulgaris, and itchy skin.

[0215] Aspects of the disclosure relate to methods and compositions (e.g., dual anti-KLK5 / KLK7 inhibitor antibodies) useful for promoting adequate barrier function (e.g., epidermal barrier function). Hyperactive kallikrein 5 / 7 causes genetic and spontaneous disruption of epidermal barrier function and is associated with related disorders such as Netherton syndrome, eosinophilic esophagitis, and atopic dermatitis. Consequently, in some embodiments, the methods provided herein comprise administering an effective amount of one or more of the anti-KLK5 / KLK7 antibodies provided herein to a subject for the purpose of restoring the epithelial barrier in a subject in need thereof. In other aspects, methods are provided for addressing one or more aspects of the altered barrier function.For example, in some embodiments, the methods provided herein comprise the administration of an effective amount of one or more anti-KLK5 / KLK7 antibodies provided herein to a subject for the purpose of reducing infiltrates. Petition 870250091425, dated 07 / 10 / 2025, pp. 103 / 159 95 / 129 dermal in a subject who needs them. In some embodiments, the methods provided herein comprise administering an effective amount of one or more anti-KLK5 / KLK7 antibodies provided herein to a subject for the purpose of reducing epithelial inflammation in a subject who needs it. In some embodiments, the methods provided herein comprise administering an effective amount of one or more anti-KLK5 / KLK7 antibodies provided herein to a subject for the purpose of reducing epithelial permeability in a subject who needs it. In some embodiments, the methods provided herein comprise administering an effective amount of anti-KLK5 / KLK7 antibodies provided herein to a subject for the purpose of reducing parakeratosis in a subject who needs it.In some embodiments, the methods provided herein comprise administering an effective amount of one or more anti-KLK5 / KLK7 antibodies provided herein to a subject for the purpose of reducing inflammatory skin cytokines in a subject in need thereof. In some embodiments, the methods provided herein comprise administering an effective amount of one or more anti-KLK5 / KLK7 antibodies provided herein to a subject for the purpose of reducing transepidermal water loss in a subject in need thereof.

[0216] Other aspects of the disclosure relate to methods and compositions (e.g., anti-KLK5 / KLK7 antibodies) useful for treating atopic dermatitis. Atopic dermatitis (AD), also known as eczema, is a common chronic, itchy inflammatory skin disease. In some embodiments, atopic dermatitis begins in a subject in infancy or early childhood (e.g., at or around 2 years of age). Thus, in some embodiments, the methods provided here are useful for treating individuals with atopic dermatitis aged 2 years or older. Atopic dermatitis may be associated with elevations in total serum IgE concentration. According to some embodiments, the methods provided here are useful for treating individuals with atopic dermatitis with elevated levels of total serum IgE concentrations (e.g., compared to normal IgE levels). Petition 870250091425, dated 07 / 10 / 2025, pp. 104 / 159 96 / 129 in individuals who do not have atopic dermatitis or related conditions). In some embodiments, atopic dermatitis is associated with a chronic, recurrent form of skin inflammation, a disturbance of epidermal barrier function (e.g., culminating in dry skin), and / or IgE-mediated sensitization to allergens, such as food and environmental allergens. Consequently, in some embodiments, methods of treating a subject with atopic dermatitis are provided here that comprise the administration of an effective amount of anti-KLK5 / KLK7 antibodies to the subject. Furthermore, in some embodiments, the individuals to be treated present with a chronic, recurrent form of skin inflammation, a disturbance of epidermal barrier function, and / or IgE-mediated sensitization to allergens.

[0217] Other aspects of the disclosure relate to methods and compositions (e.g., anti-KLK5 / KLK7 antibodies) useful for treating individuals with Netherton syndrome. In some embodiments, methods for treating a subject with Netherton syndrome are provided herein that comprise administering an effective amount of one or more anti-KLK5 / KLK7 antibodies to the subject. Netherton syndrome is a rare and severe autosomal recessive skin disease. In some embodiments, Netherton syndrome is associated with congenital erythroderma, a specific hair shaft abnormality, and / or atopic manifestations with high IgE levels (e.g., compared to normal IgE levels in individuals without Netherton syndrome or related conditions).In some forms, individuals with Netherton syndrome present with atopic manifestations, including eczema-like skin rashes, atopic dermatitis, pruritus, hay fever, angioedema, urticaria, high serum IgE levels, and / or hypereosinophilia. In some forms, Netherton syndrome is caused by mutations in the Kazal-type 5 serine protease inhibitor (SPINK5) gene, which encodes the Kazal-type lymphoepithelial protease inhibitor. In some forms, the absence of this protease inhibitor is the cause. Petition 870250091425, dated 07 / 10 / 2025, pp. 105 / 159 97 / 129 causes detachment of the stratum corneum secondary to hyperactivity of epidermal proteases. Thus, in some embodiments, the methods provided herein comprise the administration of an effective amount of one or more anti-KLK5 / KLK7 antibodies provided herein to a subject for the purpose of improving one or more aspects or symptoms (e.g., atopic manifestations, e.g., skin rash desquamation, stratum corneum detachment) associated with Netherton Syndrome.

[0218] Other aspects of the disclosure relate to methods and compositions (e.g., anti-KLK5 / KLK7 antibodies) useful for treating eosinophilic esophagitis. In some embodiments, symptoms of eosinophilic esophagitis include feeding difficulties, growth retardation, vomiting, epigastric or thoracic pain, dysphagia, and food impaction. In some embodiments, individuals with eosinophilic esophagitis are young men with a relatively high predisposition to atopic disease. In some embodiments, individuals with eosinophilic esophagitis are diagnosed by endoscopy and / or biopsy findings of isolated eosinophils in the esophagus.In some modalities, eosinophilic esophagitis is histologically defined by the presence of proliferative changes, which, in some modalities, include thickening of the basal epithelial layer and / or elongation of the papillae, a minimum of 24 eosinophils per high-power field in the distal esophagus, and / or absence of eosinophilia in any other intestinal segment evaluated. In some modalities, individuals with eosinophilic esophagitis present low levels or absence of certain serine protease inhibitors belonging to the lymphoepithelial Kazal-type inhibitory protein family, such as SPINK7, for example, in esophageal biopsies. In some modalities, eosinophilic esophagitis is differentiated from reflux esophagitis based on the magnitude of mucosal eosinophilia and the lack of response to acid suppression.In some embodiments, methods of treating a subject with eosinophilic esophagitis are provided here that comprise administering an effective amount of one or more anti-KLK5 / KLK7 antibodies to the subject. Petition 870250091425, dated 07 / 10 / 2025, pp. 106 / 159 98 / 129

[0219] Other aspects of the disclosure relate to methods and compositions (e.g., anti-KLK5 / KLK7 antibodies) useful for treating prurigo nodularis. Prurigo nodularis is a chronic inflammatory skin disease in which an extremely itchy, symmetrically distributed rash most commonly appears on the arms, legs, upper back, and / or abdomen. In some forms, prurigo nodularis appears alone. However, in some forms, prurigo nodularis is associated with other skin diseases or medical conditions such as cancer, diabetes, chronic kidney disease, or AIDS. In some forms, altered immune system and skin nerve function is believed to be associated with increased itching sensations (pruritus), leading to frequent scratching; whereby these frequent scratching and picking at the skin contribute to thickening and the formation of more lesions.Consequently, in some embodiments, methods of treating a subject with nodular pruritus are provided here that comprise the administration of an effective amount of one or more anti-KLK5 / KLK7 antibodies to the subject.

[0220] Other aspects of the disclosure relate to methods and compositions (e.g., anti-KLK5 / KLK7 antibodies) useful for treating chronic pruritus. In some embodiments, chronic pruritus is associated with itching lasting more than 6 weeks (e.g., up to 3 months, up to 6 months, up to 1 year or more). In some embodiments, chronic pruritus appears in association with potentially unrelated diseases, including chronic kidney disease, hepatobiliary disease, and neuropathic entities such as brachioradial pruritus and notalgia paresthetica. In some embodiments, chronic pruritus of unknown origin (CPUO) is established when no underlying origin for the pruritus can be determined. In some embodiments, chronic pruritus is associated with intense itching and significant scratching lesions.In some modalities, methods of treating a subject with chronic pruritus, including CPUO, are provided here, which comprise the administration of an effective amount of one or more. Petition 870250091425, dated 07 / 10 / 2025, pp. 107 / 159 99 / 129 anti-KLK5 / KLK7 antibodies in the subject.

[0221] Other aspects of the disclosure relate to methods and compositions (e.g., anti-KLK5 / KLK7 antibodies) useful for treating ichthyosis vulgaris. In some embodiments, ichthyosis vulgaris is caused by a heterozygous mutation in the filaggrin gene. In some embodiments, individuals with homozygous or compound heterozygous mutations in this gene have a more severe phenotype. In some embodiments, ichthyosis vulgaris is histologically characterized by the absence or reduction of keratohyalin granules in the epidermis and mild hyperkeratosis. Keratohyalin contains a histidine-rich protein that is the precursor form (profilaggrin) of filaggrin, a keratin filament-aggregating protein. In some embodiments, profilaggrin and filaggrin are reduced or absent in individuals with ichthyosis vulgaris. In some forms, ichthyosis vulgaris includes palmar hyperlinearity, keratosis pilaris, and a fine scale that is most prominent on the lower abdomen, arms, and legs.In some modalities, a subject may present with prominent scaling. In some modalities, a subject may present with palmar hyperlinearity, keratosis pilaris, and, in some cases, fine scaling. Consequently, in some modalities, methods of treatment for a subject with ichthyosis vulgaris or one or more symptoms or phenotypic features thereof are provided herein, which comprise the administration of an effective amount of one or more anti-KLK5 / KLK7 antibodies to the subject.

[0222] Other aspects of the disclosure relate to methods and compositions (e.g., anti-KLK5 / KLK7 antibodies) useful for treating psoriasis. Psoriasis (or psoriasis vulgaris) is a chronic inflammatory dermatosis. In some forms, psoriasis is characterized by red, scaly patches on the skin that may be found on an individual's scalp, elbows, and / or knees. In some forms, psoriasis is associated with severe arthritis in a subject. In some forms, the lesions associated with psoriasis are caused by the abnormal proliferation of keratinocytes. Petition 870250091425, dated 07 / 10 / 2025, pp. 108 / 159 100 / 129 and infiltration of inflammatory cells in the dermis and epidermis. In some forms, individuals present with the onset of psoriasis between 15 and 30 years of age. In some forms, psoriatic lesions are characterized by skin hardening, scaling, and / or erythema, which may be accompanied by histological evidence of inflammation, abnormal terminal proliferation / differentiation of keratinocytes, and / or dermal angiogenesis. In some forms, psoriatic inflammatory infiltrates, which may be pronounced at the dermoepidermal junction, comprise activated T cells and antigen-presenting cells (APCs). In some forms, the presence of activated T cells and APCs in such infiltrates precedes the development of epidermal hyperproliferation.In some embodiments, increased levels of inflammatory cytokines are detectable in the lesional psoriatic epidermis, which may result in potentiation of T-cell activation, as well as hyperproliferation and accelerated differentiation of keratinocytes. In some embodiments, methods of treating a subject with psoriasis are provided here that comprise the administration of an effective amount of one or more anti-KLK5 / KLK7 antibodies to the subject. In some embodiments, subjects are treated before the development of epidermal hyperproliferation. However, in some embodiments, subjects are treated after the development of epidermal hyperproliferation and accelerated differentiation of keratinocytes.

[0223] Other aspects of the disclosure relate to methods and compositions (e.g., anti-KLK5 / KLK7 antibodies) useful for the treatment of rosacea. Rosacea is an inflammatory disease characterized by erythema, papules, and / or telangiectasias. In some embodiments, individuals with rosacea express abnormally high levels of cathelicidin in the skin of the face. In some embodiments, proteolytically processed forms of cathelicidin peptides found in rosacea are different from those present in normal individuals. In some embodiments, methods for treating a subject with rosacea are provided herein, comprising the administration of Petition 870250091425, dated 07 / 10 / 2025, pp. 109 / 159 101 / 129 an effective quantity of one or more anti-KLK5 / KLK7 antibodies in the subject.

[0224] Other aspects of the disclosure relating to methods of treating a subject with asthma are provided herein, which comprise administering an effective amount of one or more antibodies disclosed herein (e.g., anti-KLK5 / KLK7 antibodies) to the subject. In some embodiments, methods of treating a subject with asthma are provided herein that comprise administering an effective amount of one or more anti-KLK5 / KLK7 antibodies. In some embodiments, the subject has asthma (e.g., a subject to be treated with a KLK5-targeted antibody provided herein).In some modalities, asthma is selected from among: allergic asthma, aspirin-sensitive / exacerbated asthma, asthma due to smoking, asthma uncontrolled with corticosteroids or other chronic asthma control medications, atopic asthma, asthma associated with bronchial obstruction, asthma related to pathogenesis, chronic asthma, asthma without prior corticosteroid treatment, corticosteroid-refractory asthma, corticosteroid-resistant asthma, asthma with high eosinophil count, eosinophilic asthma, asthma with low eosinophil count, exercise-induced asthma, mild asthma, moderate to severe asthma, asthma with Netherton syndrome, newly diagnosed and / or untreated asthma, non-allergic asthma, non-Th2-induced asthma, asthma with high periostin levels, asthma with low periostin levels, asthma with low Th2 levels, type 2 (T2)-induced asthma, and asthma with low inflammation type 2. 2. In some cases, the individual has atopic asthma or allergic asthma.In some modalities, the subject has aspirin-sensitive asthma or asthma exacerbated by aspirin. In some modalities, the subject has asthma associated with a nonsteroidal anti-inflammatory drug (NSAID). Thus, in some modalities, the subject has asthma that was triggered by aspirin or a similar NSAID (e.g., recently ingested aspirin or a similar NSAID). In some modalities, the subject has bronchospasm that may or may not be characterized as asthma. For example, in some modalities, the subject has exercise-induced bronchospasm. Petition 870250091425, dated 07 / 10 / 2025, p. 110 / 159 102 / 129

[0225] In some modalities, the subject has eosinophilic asthma. In some modalities, the subject has asthma with positive eosinophilic inflammation (EIP). In some modalities, the subject has asthma with negative eosinophilic inflammation (EIN). In some modalities, the subject has asthma with elevated eosinophil levels (e.g., at least about 150, 200, 250, 300, 350, or 400 eosinophil counts / mL of blood). In some modalities, the subject has asthma with low eosinophil levels (e.g., less than about 150 eosinophil counts / μL of blood or less than about 100 eosinophil counts / μL of blood). These and other examples of asthma-related conditions treatable using compositions provided here (e.g., anti-KLK5 / KLK7 antibodies) are disclosed in WO2015 / 061441, METHODS OF DIAGNOSING AND TREATING EOSINOPHILIC DISORDERS, published on April 30, 2015, the relevant contents of which are incorporated herein by reference.

[0226] In some modalities, the subject has exercise-induced asthma, intermittent or exercise-induced asthma, mild asthma, mild or untreated asthma with corticosteroids, moderate to severe asthma, asthma with Netherton Syndrome, newly diagnosed asthma, untreated asthma, or severe asthma. In some modalities, the subject has asthma that does not require or involve prior use (e.g., chronic use) of topical or systemic inhaled steroids to control or manage symptoms (e.g., symptoms such as cough, wheezing, shortness of breath / breathlessness, and chest pain).

[0227] In some modalities, the subject has asthma with low periostin levels (e.g., with a serum periostin level less than about 20 ng / mL). In some modalities, the subject has asthma with high periostin levels (e.g., having a serum periostin level of at least about 20 ng / mL, 25 ng / mL, or 50 ng / mL). In some modalities, the subject has non-allergic asthma (e.g., which may or may not be triggered by infection, for example, by a respiratory virus (e.g., influenza, coronavirus, parainfluenza, rhinovirus, human metapneumovirus, and respiratory syncytial virus)). Petition 870250091425, dated 07 / 10 / 2025, page 111 / 159 103 / 129 respiratory) or inhaled irritant (air pollutant, atmospheric pollution, combustion particles (e.g., diesel particles), volatile chemicals, indoor or outdoor gases) or by relatively cold and dry air. In some forms, the subject has asthma due to acute or chronic primary or passive exposure to smoke (cigarettes, cigars, pipes, or other combustion products) or as a result of inhalation or vaporization (nicotine, cannabis, or other similar substances). In some forms, the subject has severe persistent chronic asthma with acute events of worsening symptoms (exacerbations or attacks) that can be fatal.

[0228] In some modalities, the subject has a type 2 helper T lymphocyte (Th2) or type 2 (Th2) high asthmatic condition. In some modalities, the subject has Th2-induced asthma. For example, in some modalities, Th2 cells and / or their secreted effector molecules mediate the immune response to allergens and are triggered by exposure to specific allergens, leading to allergic asthma in a subject. In some modalities, a subject has Th2-activated cell-mediated asthma, which may be caused in part by the secretion of interleukins, for example, IL-4, IL-5, and IL-13. Thus, in some modalities, KLK5 antibodies (or other antibodies) may be combined separately or in a multispecific antibody format with one or more antibodies targeting cytokines such as IL-13, IL-17, IL-5, and IL-4, as well as allergy-associated targets such as IgE.Examples of such antibodies for the treatment of asthma include, but are not limited to, omalizumab (XOLAIR®) (targeting soluble IgE); lebrikizumab (targeting IL-13); mepolizumab (targeting IL-5); and quilizumab (targeting membrane-bound IgE).

[0229] In other embodiments, antibodies as described herein are used to treat, but are not limited to, the following: inflammatory disorders, infectious diseases, allergic diseases, and autoimmune disorders. In some embodiments, the inflammatory disorders are selected from, but not limited to, rosacea, prurigo nodularis, Crohn's disease, ankylosing spondylitis, ulcerative colitis, hidradenitis suppurativa, and uveitis, or one or more of these. Petition 870250091425, dated 07 / 10 / 2025, page 112 / 159 104 / 129 symptoms related to barrier function. In some modalities, allergic diseases are selected from, but not limited to, eczema, atopic dermatitis, asthma, sinusitis, and eosinophilic esophagitis. In some modalities, autoimmune diseases are selected from, but not limited to, rheumatoid arthritis, psoriatic arthritis, juvenile idiopathic arthritis, Behçet's disease, and plaque psoriasis, or one or more symptoms related to barrier function.

[0230] Determining whether a quantity of antibody (e.g., anti-KLK5 / KLK7 antibody) has achieved a therapeutic effect would be evident to someone skilled in the art based on the teachings provided herein. Effective quantities vary, as recognized by experts in the field, depending on the specific condition being treated, the severity of the condition, individual patient parameters including age, physical condition, size, sex, and weight, the duration of treatment, the nature of concomitant therapy (if any), the specific route of administration, and similar factors within the knowledge and experience of the healthcare professional. The specific dosage regimen, i.e., dose, timing, and repetition, used in the method described herein will depend on the specific subject and that subject's medical history, as discussed herein.

[0231] Empirical considerations, such as time to maximum effect, half-life, and / or time above a specific concentration, will generally contribute to dosage determination. For example, antibodies compatible with the human immune system, such as humanized antibodies or fully human antibodies, can be used to prolong the antibody half-life and prevent it from being attacked by the host's immune system. Other reasons for dose adjustment include differences in pharmacokinetics or pharmacodynamic response determined by sex, age, individual response, polymorphisms in the antibody target, and / or receptors involved in antibody clearance. The frequency of administration can be determined and adjusted throughout therapy and is generally, but not necessarily, based on Petition 870250091425, dated 07 / 10 / 2025, pp. 113 / 159 105 / 129 treatment and / or suppression and / or improvement and / or delay of a target disease / disorder. Alternatively, sustained-release formulations of an antibody may be appropriate. Several formulations and devices for achieving sustained release are known in the art.

[0232] Dosing frequencies may vary depending on the methods claimed. In some embodiments, a composition may be administered once. In some embodiments, a composition will be administered on multiple occasions. In some embodiments, the dosing frequency is every week, every 2 weeks, every 3 weeks, every 4 weeks, every 5 weeks, every 6 weeks, every 7 weeks, every 8 weeks, every 9 weeks, or every 10 weeks; or once a month, every 2 months, every 3 months, or more. In some embodiments, a composition will be administered daily, biweekly, weekly, bimonthly, monthly, or at any time interval that provides adequate (e.g., maximum) efficacy while minimizing safety risks to the subject. Generally, treatment efficacy and risks and safety can be monitored throughout the treatment.

[0233] In some embodiments, a subject may receive a composition provided herein (e.g., an anti-KLK5 / KLK7 antibody) at one or more intervals during a defined period of time. In some cases, time periods during which a subject receives a composition at one or more intervals may be separated by time periods during which the subject does not receive the composition. In some embodiments, the relative durations of the respective time periods may depend on the subject's response to treatment or the severity of the disease, or both, and / or may be determined based on the judgment of an attending physician.

[0234] In some embodiments, an antibody may be administered parenterally. For example, a parenterally administered composition may be administered topically, transmucosally, by subcutaneous, intracutaneous, intravenous, intraperitoneal, intratumoral techniques, Petition 870250091425, dated 07 / 10 / 2025, pp. 114 / 159 106 / 129 intramuscular, intra-articular, intra-arterial or infusion.

[0235] In some embodiments, an antibody (e.g., an anti-KLK5 / KLK7 antibody) is administered intravenously. In some embodiments, an antibody (e.g., an anti-KLK5 / KLK7 antibody) is administered subcutaneously or topically.

[0236] For intravenous injection, water-soluble antibodies may be administered by the drip method, whereby a pharmaceutical formulation containing the antibody and a physiologically acceptable excipient is infused. Physiologically acceptable excipients may include, for example, 5% dextrose, 0.9% saline solution, Ringer's solution, or other suitable excipients. Other injectable compositions may contain various vehicles such as vegetable oils, dimethyllactamide, dimethylformamide, ethyl lactate, ethyl carbonate, isopropyl myristate, ethanol, and polyols (glycerol, propylene glycol, liquid polyethylene glycol, and the like). In some cases, preparations, for example, a sterile formulation of a suitable soluble salt form of the antibody, may be dissolved and administered in a pharmaceutical excipient such as water for injection, 0.9% saline solution, or 5% glucose solution.

[0237] In one embodiment, an antibody is administered via specific or targeted local delivery techniques. Examples of specific or targeted local delivery techniques include various implantable, transdermal, or transmucosal antibody depot sources or local delivery systems.

[0238] An anti-KLK5 / KLK7 antibody and treatment methods involving it as described in this disclosure may be used in combination with other types of therapy for the target disease or disorder disclosed herein. In this context, a combination of antibodies and a therapeutic agent may be administered simultaneously or sequentially. Such therapies may be administered simultaneously or sequentially (in any order) with the treatment according to this disclosure. Petition 870250091425, dated 07 / 10 / 2025, pp. 115 / 159 107 / 129

[0239] Consequently, aspects of the disclosure relating to methods and compositions (e.g., anti-KLK5 / KLK7 antibodies). In some embodiments, the antibodies described herein may be administered as a combination therapy (concomitantly or sequentially, e.g., over time). In some embodiments, the combination therapy comprises the administration of one or more of the antibodies described herein (e.g., anti-KLK5 / KLK7 antibodies) and at least one additional therapeutic agent (e.g., one, two, three, four, five, six, or seven therapeutic agents). In some embodiments, one or more of the antibodies described herein and at least one additional therapeutic agent (e.g., one, two, three, four, five, six, or seven therapeutic agents) are administered together.In some embodiments, one or more of the antibodies described herein and at least one additional therapeutic agent (e.g., one, two, three, four, five, six, or seven therapeutic agents) are administered separately.

[0240] In some modalities, the additional therapeutic agent is an anti-inflammatory agent. In some embodiments, the anti-inflammatory agent is selected from, but not limited to, low-dose antibiotics, steroids, corticosteroids, tacrolimus, anti-IL4R antibodies (e.g., dupilumab), anti-IL-13 antibodies, TNF inhibitors (e.g., anti-TNF), IL-12 / 23 inhibitors, IL-17 inhibitors, and IL-4 receptor inhibitors, doxycycline, methotrexate, prednisone, cyclosporine, mycophenolate mofetil, dupilumab, certolizumab pegol, etanercept, adalimumab, infliximab, golimumab, ustekinumab, secukinumab, ixekizumab, brodalumab, abatacept, tidrakizumab-asmn, risankizumab-rzaa, and guselkumab. In some embodiments, the anti-inflammatory agent is administered orally. In some treatments, the anti-inflammatory agent is administered topically.In some forms, the anti-inflammatory agent is administered by injection (e.g., intravenous, subcutaneous, or intramuscular).

[0241] In some modalities, the therapeutic combination comprises one or more of the antibodies described herein (e.g., anti antibodies Petition 870250091425, dated 07 / 10 / 2025, pp. 116 / 159 108 / 129 KLK5 / KLK7) administered with one or more additional antibodies or fragments thereof (e.g., one, two, three, four, five, six, or seven antibodies). In some embodiments, the therapeutic combination comprising one or more of the antibodies described herein and one or more additional antibodies or fragments thereof (e.g., one, two, three, four, five, six, or seven antibodies) are administered separately. In some embodiments, the therapeutic combination comprising one or more of the antibodies described herein and one or more additional antibodies or fragments thereof (e.g., one, two, three, four, five, six, or seven antibodies) are administered together.

[0242] In some embodiments, the therapeutic combination comprising one or more of the antibodies described herein and one or more additional antibodies or fragments thereof (for example, one, two, three, four, five, six, or seven antibodies) is a multispecific antibody combination. In some embodiments, the multispecific antibody combination comprises a KLK5 / KLK7 antigen-binding site and one or more additional distinct antigen-binding sites of one or more additional antibodies. In some embodiments, a multispecific antibody comprises the direct fusion or binding of different antigen-specific binding sites.In some embodiments, additional antibodies or fragments thereof are selected, but not limited to, an anti-IL4R antibody, an anti-IL-13 antibody, an anti-TNF antibody, an anti-IL-12 / 23 antibody, an anti-IL-17 antibody, doxycycline, dupilumab, certolizumab pegol, etanercept, adalimumab, infliximab, golimumab, ustekinumab, secukinumab, ixekizumab, brodalumab, abatacept, tildrakizumabmn, risankizumab-rzaa and / or guselcumab.

[0243] In some modalities, in a non-limiting example, in the treatment of rosacea, additional therapies may be selected from among a topically administered steroid; oral administration of methotrexate; oral administration of cyclosporine; and / or administration of a TNF inhibitor. Petition 870250091425, dated 07 / 10 / 2025, pp. 117 / 159 109 / 129 In some modalities, including but not limited to, the treatment of atopic dermatitis, additional therapies may be selected from subcutaneous administration of dupilumab and / or topical administration of a steroid.

[0244] Any of the anti-KLK5 / KLK7 antibodies disclosed herein can also be used to detect the presence of KLK5 and / or KLK7 in vitro or in vivo. The results obtained by these detection methods can be used for diagnostic purposes (e.g., diagnosis of diseases associated with KLK5 and / or KLK7) or for scientific research purposes (e.g., identification of new types of KLK5-secreting cells, study of the bioactivity and / or regulation of secreted KLK5 and / or KLK7). For assay uses, such as diagnostics, an anti-KLK5 / KLK7 antibody, as described herein, can be conjugated with a detectable marker (e.g., an imaging agent, such as a contrast agent) to detect the presence of KLK5 and / or KLK7, in vivo or in vitro.

[0245] As used herein, “conjugated” or “attached” means that two entities are associated, preferably with sufficient affinity for the therapeutic / diagnostic benefit of the association between the two entities to be realized. The association between the two entities may be direct or via a linker, such as a polymer linker. Conjugated or attached may include covalent or non-covalent linkage, as well as other forms of association, such as trapping, for example, of one entity on or within the other, or of one or both entities on or within a third entity, such as a micelle.

[0246] In other embodiments, an anti-KLK5 / KLK7 antibody, as described herein, may be attached to a detectable marker, which is a compound capable of releasing a detectable signal, directly or indirectly, so that the aptamer can be detected, measured and / or qualified, in vitro or in vivo. Examples of such “detectable markers” include, but are not limited to, fluorescent markers, chemiluminescent markers, markers Petition 870250091425, dated 07 / 10 / 2025, pp. 118 / 159 110 / 129 colorimetric markers, enzymatic markers, radioactive isotopes, and affinity markers such as biotin. Such markers can be conjugated to the aptamer, directly or indirectly, by conventional methods.

[0247] The notification agent can also be a dye, for example, a fluorophore, which is useful in detecting a cell-mediated disease that expresses KLK5 and / or KLK7 in tissue samples, respectively.

[0248] To perform an in vitro diagnostic assay, an anti-KLK5 / KLK7 antibody can be placed in contact with a sample suspected of containing KLK5 and / or KLK7, for example, cells expressing KLK5 or soluble KLK5 in the disease microenvironment. The antibody and sample can be incubated under suitable conditions for an appropriate period to allow the antibody to bind to the KLK5 antigen. This interaction can then be detected by routine methods, for example, ELISA, histological staining, or FACS. To perform an in vivo diagnostic assay, an appropriate amount of anti-KLK5 / KLK7 antibodies, conjugated with a marker (for example, an imaging agent or a contrast agent), can be administered to a subject requiring the examination. The presence of the labeled antibody can be detected based on the signal released by the marker using routine methods.

[0249] To perform scientific research assays, an anti-KLK5 / KLK7 antibody can be used to study the bioactivity of KLK5 and / or KLK7, detect the presence of KLK5 and / or KLK7 intracellularly or extracellularly, and / or regulate the effect of KLK5. For example, an appropriate amount of anti-KLK5 / KLK7 can be placed in contact with a sample (e.g., a new cell type not previously identified as KLK5 and / or KLK7-producing cells) suspected of producing KLK5 and / or KLK7. The cells are permeabilized before contact with the anti-KLK5 / KLK7 antibody. The antibody and sample can be incubated under suitable conditions for an appropriate period to allow the antibody to bind to the KLK5 antigen. This interaction can then be detected by routine methods, e.g., ELISA, Petition 870250091425, dated 07 / 10 / 2025, pp. 119 / 159 111 / 129 histological staining or FACS. VI. Kits for therapeutic and diagnostic applications

[0250] This disclosure also provides kits for therapeutic or diagnostic applications as disclosed herein. These kits may include one or more containers containing an antibody, for example, any of those described herein.

[0251] In some embodiments, the kit may include instructions for use according to any of the methods described herein. The included instructions may include a description of administering the antibody to treat, delay the onset of, or alleviate a target disease, such as those described herein. The kit may also include a description of selecting a suitable individual for treatment based on identifying whether that individual has the target disease. In other embodiments, the instructions include a description of administering an antibody to an individual at risk of the target disease.

[0252] Instructions relating to the use of a described antibody generally include information on dosage, dosing schedule, and route of administration for the intended treatment. Containers may be unit doses, bulk packaging (e.g., multidose packs), or subdoses. Instructions provided in the kits of the invention are typically written instructions on a label or package insert (e.g., a sheet of paper included in the kit), but machine-readable instructions (e.g., instructions contained on a magnetic or optical storage disk) are also acceptable.

[0253] The label or leaflet indicates that the composition is used to treat, delay the onset of, and / or alleviate a disease or disorder. Instructions may be provided for practicing any of the methods described herein.

[0254] The kits in this order are in suitable packaging. Suitable packaging includes, but is not limited to, bottles, jars, jugs, flexible packaging (e.g., sealed Mylar or plastic bags) and Petition 870250091425, dated 07 / 10 / 2025, pp. 120 / 159 112 / 129 similar.

[0255] Packaging for use in combination with a specific device, such as an infusion device like a mini-pump, is also contemplated. A kit may have a sterile access port (e.g., the container may be an intravenous solution bag or a vial with a stopper that can be pierced by a hypodermic injection needle). The container may also have a sterile access port (e.g., the container may be an intravenous solution bag or a vial with a stopper that can be pierced by a hypodermic injection needle). At least one active agent in the composition is an antibody such as those described herein.

[0256] The kits may optionally provide additional components, such as buffers and interpretive information. Typically, the kit consists of a container and a label or leaflet(s) on or attached to the container. In some embodiments, the invention provides articles of manufacture comprising the contents of the kits described above.

[0257] Kits for use in detecting the target protein (e.g., KLK5 and / or KLK7) in a sample are also provided here. This kit may comprise any of the antibodies described herein. In some cases, the antibody may be conjugated with a detectable marker such as those described herein. As used herein, “conjugated” or “attached” means that two entities are associated, preferably with sufficient affinity so that the therapeutic / diagnostic benefit of the association between the two entities is realized. The association between the two entities may be direct or via a linker, such as a polymer linker. Conjugated or attached may include covalent or non-covalent linkage, as well as other forms of association, such as trapping, for example, of one entity on or within the other, or of one or both entities on or within a third entity, such as a micelle.

[0258] Alternatively or additionally, the kit may comprise a secondary antibody capable of binding to an antibody described herein. The kit may Petition 870250091425, dated 07 / 10 / 2025, pp. 121 / 159 113 / 129 still understand instructions for using the antibody to detect the target protein (e.g., KLK5 and / or KLK7). EXAMPLES Example 1: Generation and selection of anti-KLK5 and anti-KLK7 antibodies (i) Affinity

[0259] KLK5 and KLK7 are mediators of the pathology observed in cases of aberrant protease activation (FIG. 1). Kinetic antibody binding experiments via Biacore were performed to screen anti-KLK5 / KLK7 antibodies with high affinity to the respective targets for use in inhibiting KLK5 / 7 activity and subsequent improvement or elimination of symptoms associated with aberrant protease activation. All screening assays were performed at 25 °C. The passage buffer used was 20 mM HEPES, 300 mM NaCl, 0.01% Tween-20, pH 7.5. Antibodies (1 µg / mL) were captured on Fc2-4 of a Serial S Protein A Sensor Chip (Cytiva) flowing at 10 µL / min for 30 s. Kinetic measurements were performed in single-cycle kinetic mode with a series of 4-5 concentrations, with a maximum concentration of 25-100 nM and serial dilution of 4 times. The contact time was typically 300 s, and the dissociation time ranged from 1800 to 3600 s. The flow rate normally used was 30 µL / min.The sensor chip was regenerated with 10 mM glycine, pH 1.5, with a contact time of 30 µL and a flow rate of 50 µL / min. The results show that the dual inhibitor antibodies described in Table 1 exhibited binding specificity for both KLK5 and KLK7. A summary of the binding kinetics for the anti-KLK5 antibodies is provided below in Table 4. Table 4 Antibody Affinity and Potency against KLK5 / KLK7 Clone Target Binding / Inhibition (hKLK5) Binding / Inhibition (hKLK7) Binding / Inhibition (mKLK5) Binding / Inhibition (mKLK7) Kd (M) IC50(nM) Kd (M) IC50(nM) Kd (M) IC50(nM) Kd (M) IC50(nM) KLK5 / KL K7-Dual- Ab4 Double 2.43E -11 0.27 2.00E- 12 0.16 3.1 5E09 16.14 1.29 E-10 1.77 Petition 870250091425, dated 07 / 10 / 2025, pp. 122 / 159 114 / 129 Clone Target Binding / Inhibition (hKLK5) Binding / Inhibition (hKLK7) Binding / Inhibition (mKLK5) Binding / Inhibition (mKLK7) Kd (M) IC50(nM) Kd (M) IC50(nM) Kd (M) IC50(nM) KLK5 / KL K7-Dual- Ab3 Double 1.41E-10 0.25 1.36E-11 0.21 4.0 2E-09 24.06 1.11 E-09 5.28 KLK5 / KL K7-Dual- Ab2 Double 1.00E-11 0.25 2.18E-11 0.25 2.7 9E09 17.24 1.55 E-09 5.13 KLK5 / KL K7-Dual- Ab1 Double 1.00E -06 - 1.82E- 09 - - - 1.00 E-09 (ii) Protease inhibition assay

[0260] To evaluate the ability of the antibodies described in Table 1 to inhibit the activity of KLK5 and / or KLK7 proteases, respectively, 1.5 nM human or mouse KLK5 or 0.5 nM human or mouse KLK7 were prepared in assay buffer (0.1 M NaH2PO4 pH 7.5 for KLK5 and 50 mM Tris, 150 mM NaCl, pH 7.5 for KLK7). Antibodies diluted in PBS to test concentrations were added. The substrate was then added (50 µM BOC-Val-Pro-Arg-AMC for KLK5 and 30 µM KHLF-AMC for KLK7). The fluorescence signal was then measured every minute for 30 minutes at room temperature.

[0261] The results show that anti-KLK5 / KLK7 antibodies are able to inhibit the activity of KLK5 and KLK7 proteases, as described in Table 4. Example 2. Anti-KLK5 / KLK7 antibodies bind specifically to the active form of human KLK5.

[0262] KLK5 / 7-Dual-Ab4 or comparator antibody no. 1 (a bispecific antibody with a first arm that binds to KLK5 and a second arm that binds to KLK7) were captured on an S-series protein sensor chip (Cytiva) at a concentration of 1 µg / ml. The active form or pro-form of huKLK5 or huKLK7 was fluidized at 50 µL / min at the following concentrations (0.156 nM, 0.625 Petition 870250091425, dated 07 / 10 / 2025, pp. 123 / 159 The sensor chip was tested at concentrations of 115 / 129 nM, 2.5 nM, 10 nM, or 40 nM) with a contact time of 5 min and a dissociation time of 1 hour. The sensor chip was regenerated with 10 mM glycine, pH 1.5, with a contact time of 30 seconds flowing at 50 µL / min. KLK5 / 7-Dual-Ab4 was found to bind to active huKLK5 (FIG. 2A) and active huKLK7 (FIG. 2B), but not to the pro-form of either. Comparator antibody #1 binds to the pro-form and active form of KLK5 (FIG. 2A) and KLK7 (FIG. 2B) with similar potencies. These data indicate that KLK5 / 7-DualAb4 binds to the active site of huKLK5 and huKLK7, since the appropriate active site structure is not present in the protease pro-form. Comparator antibody #1 binds to an allosteric site that is present in both the active and pro-forms, but does not bind to the active site of the enzymes. Example 3. Anti-KLK5 / KLK7 antibodies are not cleaved when they bind to their target.

[0263] A concern in the development of antibodies that bind to proteases is that the proteolytic activity of the antibody target may result in the cleavage of the antibody after it binds, rendering the antibody activity irrelevant. To determine whether KLK5 or KLK7 were capable of cleaving anti-KLK5 / KLK7 antibodies, stoichiometric amounts of KLK and mAb were incubated for 18 h at 37 °C. 40 pmol of KLK5 or KLK7 were used per reaction and mixed with 20 pmol of each antibody tested to a final volume of 20 µL. After overnight incubation, each reaction was analyzed by reducing SDSPAGE gel.

[0264] Cleavage of the antibody heavy chain (HC) at the complementarity-determining region 3 (CDR3) produces 12 kDa and 38 kDa fragments. SDS-PAGE analysis demonstrated that while co-incubation of a control anti-KLK5 antibody that binds to the KLK5 active site and is cleaved by KLK5 (referred to in this example as the “control anti-KLK5 antibody”) and active KLK5 produced 12 kDa and 38 kDa fragments, incubation of anti-KLK5 / 7 antibodies with active KLK5 did not, indicating that they are not cleaved by KLK5 (FIG. 3A). SDS-PAGE analysis of co-incubation of active KLK7 with antibodies Petition 870250091425, dated 07 / 10 / 2025, pp. 124 / 159 116 / 129 anti-KLK5 / 7 demonstrated that none of the anti-KLK5 / 7 antibodies were cleaved by KLK7 (FIG. 3B).

[0265] Recent crystal structures of the control anti-KLK5-Ab1 Fab and the KLK5 / 7-Dual-Ab1 Fab show that the HC CDR3 of these anti-KLK5 / 7 antibodies is inserted into the respective KLK active site (FIG. 11). The control anti-KLK5-Ab1 HC CDR3 is inserted into the (N^C) register, while the KLK5 / 7-DualAb1 CDR3 is inserted against the (0>N) register (FIG. 12). This reverse register insertion is likely the reason why the anti-KLK5 / 7 antibodies are not cleaved by their targets. Example 4. Anti-KLK5 / KLK7 antibodies are specific for KLK5 and KLK7 and do not bind to other members of the KLK family.

[0266] Kallikrein family members and kallikrein-like families are remarkably similar at the genetic and protein levels. Therefore, developing antibodies that specifically bind to one or more selected members of the KLK family presents a challenge. To determine whether anti-KLK5 / 7 antibodies bound to other KLK family members or related proteases, 10 µg / mL of anti-KLK5 / 7 antibody were tested for inhibition of plasma KLK, KLK1, KLK2, KLK4, KLK6, KLK12, KLK14, trypsin, chymotrypsin, and urokinase, using substrate cleavage as a readout.

[0267] The substrates for protease assays were as follows: plasma KLK, KLK1, KLK2 (Pro-Phe-Arg-AMC); KLK4, KLK12, KLK13 and KLK14 (Boc-VPR-AMC); KLK6 (Boc-QAR-AMC); trypsin (MCA-RPKPVG-NVAL (DNP)NH2); chymotrypsin (Suc-AAPF-AMC); and urokinase (Z-Gly-Gly-Arg-AMC).

[0268] The following enzyme concentrations were prepared in assay buffer: KLK plasma (10 nM); KLK1 (10 nM); KLK2 (10 nM); KLK4 (5 nM); KLK6 (5 nM), KLK12 (2.5 nM), KLK14 (2.5 nM), Trypsin (0.25 nM), Chymotrypsin (17 nM) and Urokinase (20 nM).

[0269] The assay buffers were as follows: KLK1 and 2 (50 mM Tris, 150 mM NaCl, 10 mM CaCl2, 0.05% (w / v) Brij-35, pH 7.5); KLK3 (50 mM Tris, 1 Petition 870250091425, dated 07 / 10 / 2025, pp. 125 / 159 117 / 129 M NaCl, pH 8.0); KLK4 (50 mM Tris, 1 M NaCl, pH 8.0); KLK6 (50 mM Tris, 1 M Sodium Citrate, pH 7.5); KLK12 and 13 (100 mM Tris, 150 mM NaCl, 10 mM CaCl2, 0.05% (w / v) Brij-35, pH 7.5); KLK14 (50 mM Tris, 150 mM NaCl, 0.05% (w / v) Brij-35, pH 8.0), Trypsin (1x HBS + 1 mM CaCl2 + 0.05% Tween 20, pH 7.4); Chymotrypsin (25 mM Tris, 0.5 mM CaCl2, pH 8.0); Urokinase (50 mM Tris + 0.01% Tween 20 pH 8.5; and plasma kallikrein KLKb1 (50 mM Tris, 250 mM NaCl, pH 7.5).

[0270] The antibodies were diluted in PBS to test concentrations, after which the substrates were added. Fluorescence was then measured every minute for 30 minutes at room temperature.

[0271] The following KLK family members were screened for affinity for Biacore: hKLK3, hKLK8, hKLK9, hKLK10, hKLK11, hKLK12, hKLK13, and hKLK15. All screening assays were performed at 25°C. The buffer used was 20 mM HEPES, 300 mM NaCl, 0.01% Tween20, pH 7.5. Antibodies (1 μg / mL) were captured on Fc2-4 of an S-series protein A sensor chip (Cytiva), flowing at 10 μL / min for 30 seconds. Kinetic measurements were made in single-cycle kinetic mode with 25 and 100 nM analytes. The contact time was 120 seconds and the dissociation time was 300 seconds. A flow rate of 30 μL / min was typical. The protein A sensor chip was regenerated with 10 mM glycine, pH 1.5, with a contact time of 30 seconds, flowing at 50 uL / min.

[0272] Follow-up studies were performed on KLK6, KLK14 and KLK13, as they showed that anti-KLK5 / 7 antibodies had some binding / inhibition activity. All IC50 curves were at least 100 times greater than the activity against KLK5 or KLK7, demonstrating that anti-KLK5 / 7 antibodies are highly specific for KLK5 and KLK7 and not for other members of the KLK family or related proteases (FIG. 4). Example 5. Anti-KLK5 / KLK7 antibodies bind to the active sites of KLK5 and KLK7.

[0273] The inhibitory capacity of an antibody is related to Petition 870250091425, dated 07 / 10 / 2025, pp. 126 / 159 118 / 129 The ability of this antibody to compete for binding of the active site of its target with the substrate of its target. The binding activity of anti-KLK5 / 7 antibodies to KLK5 and KLK7 was tested in the presence of small inhibitors of molecules known to bind to the active sites of KLK5 and KLK7.

[0274] Binning was performed by immobilizing specific double KLK5 / 7 antibodies (2 ug / mL) on the surface of a protein A chip. The flow rate was 30 uL / min and the contact time was 30 seconds. Then, huKLK5 (FIG. 5A) or huKLK7 (FIG. 5B) was pre-incubated with an inhibitor before being applied to the chip. 20 nM of KLK5 or KLK7 were incubated with 0.35 mg / mL of small molecule inhibitor PMSF (final concentration of 2 mM, made from 100x stock), 1 mg / mL of peptide inhibitor leupeptin (final concentration of 1 mM) or 25 ug / mL of SPINK5. The flow rate was 30 uL / min, the contact time was 300 seconds, and the dissociation time was 120 seconds.

[0275] When KLK5 or KLK7 were pre-incubated with various inhibitors that bind to the active site, little or no binding of anti-KLK5 / 7 antibodies to KLK5 (FIG. 5A) or KLK7 (FIG. 5B) was observed, indicating that anti-KLK5 / 7 antibodies bind to the active site of KLK5 and KLK7, as they cannot bind when the active site is already bound to another molecule. Example 6. Anti-KLK5 / KLK7 antibodies bind to the same epitope in KLK5 and KLK7 as SPINK5.

[0276] The binding of anti-KLK5 / 7 antibodies to the active site of KLK5 and KLK7 was analyzed in more detail in this Example. Binning was performed in a sandwich format. In the first experiment, the anti-KLK5 / 7 antibody KLK5 / 7Dual-Ab4 was covalently coupled to the surface of a CM5 chip, after which huKLK5 or huKLK7 flowed. Then, a second anti-KLK5 / 7 antibody was applied to the chip surface at a concentration of 10 μg / mL (FIG. 6, graphs on the left). In the second experiment, recombinant human SPINK5 was covalently coupled to the surface of a CM5 chip, after which huKLK5 or huKLK7 flowed. Then, an anti-KLK5 / 7 antibody was applied to the surface (FIG. 6, graphs on the right). The passage buffer was 20 mM HEPES, Petition 870250091425, dated 07 / 10 / 2025, pp. 127 / 159 119 / 129 300 mM NaCl, 0.05% Tween-20, pH 7.5. Biacore was performed with a flow rate of 50 µL / min. The contact time for each antibody or protein was 60 seconds, and the dissociation time was 60 seconds.

[0277] The data show that the anti-KLK5 / 7 antibody KLK5 / 7-DualAb4 competes for binding to huKLK5 and huKLK7 with human SPINK5. Since SPINK5 binds to the active site of KLK5 and KLK7, this further indicates that the anti-KLK5 / 7 antibody KLK5 / 7-Dual-Ab4 also binds to the active site of KLK5 and KLK7, and that neither SPINK5 nor the inhibitory antibody can be bound to KLK5 or KLK7 at the same time (FIG. 6). Example 7. Treatment with dual anti-KLK5 / 7 antibody reduces barrier defects in the MC903 murine model of atopic dermatitis.

[0278] Murine atopic dermatitis was induced in C57 / B6 mice by topical application of 40 μL of MC903 (Sigma, calcipotriol hydrate, 2 ng / 10 μL in ethanol) to the shaved nape area once daily, from day 1 to day 8.

[0279] Mice were pre-treated 3x / week, starting on day -6, with vehicle-free control MC903, control IgG (non-specific antibody), KLK5 / 7-Dual-Ab4, or comparator antibody #2 (a mouse anti-IL4R antibody) at 30 mg / kg intraperitoneally. Alternatively, control IgG was administered subcutaneously (SC) at 30 mg / kg Q3D starting on day 6; KLK5 / 7-Dual-Ab4 was administered at 3 mg / kg SC Q3D, Q7D, or Q14D starting on day -6; and Comparator Antibody #2 was injected at 30 mg / kg IP Q3D starting on day -6.

[0280] On day 9, a piece of dorsal skin was resected from each mouse and preserved in 10% neutral buffered formalin. The skin was trimmed, embedded in paraffin, sectioned, and stained with hematoxylin and eosin (H&E). The stratum corneum thickness was measured every 800 μM according to a grid defined in Qupath and then averaged for each animal (FIGs. 7A-7B).

[0281] Treatment with KLK5 / 7-Dual-Ab4 reduced hyperkeratosis and Petition 870250091425, dated 07 / 10 / 2025, pp. 128 / 159 120 / 129 desquamation, measured by stratum corneum thickness, to a greater extent than Comparator Antibody #2. The minimum effective subcutaneous dose was 3 mg / kg every 7 days. Example 8. Treatment with dual anti-KLK5 / 7 antibodies reduces disease in a murine model of Nc / Nga atopic dermatitis.

[0282] Murine atopic dermatitis was induced in 8–10 week-old Nc / Nga mice (a strain with an intrinsic barrier defect) by topical administration of house dust mite allergen (HDM). Animals received Biostir-AD ointment (120 mg / mouse), containing HDM allergens derived from Dermatophagoides farina, on the ears and dorsal skin regions (including the neck) twice weekly for two weeks, resulting in a total of 480 mg per mouse. A 150 μL sodium dodecyl sulfate (SDS) treatment was applied 2 hours before the second Biostir-AD treatment (day 4).

[0283] Mice were pretreated with control IgG, KLK5 / 7Dual-Ab4, or comparator antibody #2 with intraperitoneal injections of 30 mg / kg 3x / week starting on day -6 for a total of 9 doses. Tacrolimus, a steroidal compound that treats atopic dermatitis but cannot be used long-term due to severe withdrawal effects, was applied topically once daily, starting on day -6 for a total of 21 days and was applied 1 hour after each Biostir-AD application.

[0284] To assess treatment efficacy, mice were evaluated for itching (FIG. 8C), macroscopic skin lesions, and ear thickness (FIG. 8B) on day 15. To assess itching, mice were housed individually and allowed to acclimate for 30 minutes before the start of the evaluation. Scratching behavior was recorded for 60 minutes on day 0 and 30 minutes after administration on day 15, by visual observation. Ear thickness was measured with a Dyer model micrometer. The severity of skin lesions was assessed using four parameters: erythema, hemorrhage, edema, excoriation / erosion, and scaling / dryness. The Petition 870250091425, dated 07 / 10 / 2025, pp. 129 / 159 121 / 129 parameters of skin lesions were evaluated on the ears, neck, and dorsal skin. The total clinical severity score of the skin was defined as the sum of the individual scores (0: None; 1: Mild; 2: Moderate; 3: Severe) (FIG. 8A).

[0285] A 1 cm² piece of dorsal skin was resected from each mouse and preserved in 10% neutral buffered formalin. The skin was trimmed, embedded in paraffin, sectioned, and stained with H&E. Epidermal area (FIG. 8E) was measured using Qupath software, and stratum corneum thickness measurements were taken every 800 µM based on a Qupath grid and then averaged to generate a value for each animal. Samples were examined microscopically by a veterinary pathologist and scored for inflammation, necrosis, hyperplasia, and hyperkeratosis (FIG. 8D). Serum was also analyzed for the presence of HDM-specific IgE antibodies (FIG. 8F).

[0286] Treatment with KLK5 / 7-Dual-Ab4 reduced ear thickness, clinical skin lesions, and itching to a similar degree as treatment with comparator antibody #2 or tacrolimus. Histological analysis shows that the reduction in hyperkeratosis and scaling, measured by stratum corneum thickness, is reduced to a greater extent after treatment with KLK5 / 7-Dual-Ab4 compared to treatment with tacrolimus or comparator antibody #2, indicating that KLK5 / 7-Dual-Ab4 is a robust inhibitor of atopic dermatitis.

[0287] The experiments described above were repeated using KLK5 / 7Dual-Ab2, which reduced itching (FIG. 8I), stratum corneum thickness (FIG. 8H) and histological scores (FIG. 8G) compared with control IgG and consistent with the effect of Competitor Antibody #2 (FIG. 8B). Example 9. Treatment with anti-KLK5 / 7 antibody reduces disease in a murine model of scaly tail atopic dermatitis.

[0288] Murine atopic dermatitis was induced in male Flaky Tail mice (Flaky Tail mice have an intrinsic barrier defect caused Petition 870250091425, dated 07 / 10 / 2025, pp. 130 / 159 122 / 129 by loss of function of filaggrin, a filament-associated protein, and the transmembrane protein mattrin) through topical application of the HDM allergen. The nape of the neck was shaved in all mice before HDM allergen administration. The non-disease control group received petrolatum applied topically to the shaved nape area and both ears 3 times / week for 6 weeks. All other treatment groups received Biostir cream topically applied to the shaved nape area and both ears 3 times / week for 6 weeks. Each Biostir application used approximately 100 mg of cream per mouse. For the control and test groups, control IgG or KLK5 / 7-Dual-Ab4 was injected at 30 mg / kg intraperitoneally 3 times / week, starting on day 0.

[0289] A 1 cm² piece of dorsal skin was resected from each mouse and preserved in 10% neutral buffered formalin. The skin was trimmed, embedded in paraffin, sectioned, and stained with H&E. The epidermal area (FIG. 9A) was measured using Qupath software analysis. Samples were examined microscopically by a veterinary pathologist and scored for parakeratosis (FIG. 9B) and spongiosis (FIG. 9C). Cytokine expression was measured from lysed auricular tissue.

[0290] Histological analysis revealed that treatment of atopic dermatitis with KLK5 / 7-Dual-Ab4 reduces epidermal thickness, parakeratosis, and spongiosis. Cytokine analysis showed a reduction in the allergy-associated cytokine interleukin (IL)-4 (FIG. 9D) and the inflammatory cytokine tumor necrosis factor alpha (TNFα) (FIG. 9E). These data demonstrate that KLK5 / 7 inhibition can reduce inflammation and epidermal effects in a murine model of atopic dermatitis. Example 10. Treatment with an anti-KLK5 / 7 antibody reduces hyperkeratosis in a disease-induced human epidermal equivalent air-liquid interface culture.

[0291] EpiDermFT cultures, which have a dermal layer seeded with fibroblasts with an overlay of primary human keratinocytes, Petition 870250091425, dated 07 / 10 / 2025, pp. 131 / 159 123 / 129 differentiated cells, designed to create an epidermis in a transwell, were incubated overnight in assay buffer. 80 μM of MC903 treatment was applied on day 0 to the top of the transwell to induce lesion and hyperkeratosis. Cultures were placed in media with control IgG (FIG. 10B, without MC903 control FIG. 10A), KLK5 / 7-Dual-Ab4 (FIG. 10C), Comparator Antibody #1 (FIG. 10D), or Comparator Antibody #3 (a monospecific anti-KLK5 antibody that does not bind to the KLK5 active site) (FIG. 10E) at 10 μg / mL added to the top and bottom of the well for a total of 20 μg / mL. Antibody treatment began on day 0 and continued for 5 days. Each condition was tested in 6 separate cell culture inserts. Histogel was added to the top of the cell inserts, and the inserts were formalin-fixed and paraffin-embedded for sectioning and H&E staining.The Qupath image analysis software was used to measure the thickness of the stratum corneum at 100 μM intervals.

[0292] Measurements of stratum corneum thickness (FIG. 10F) indicated that treatment with MC903 induces hyperkeratosis in human EpiDermFT cultures. Treatment with KLK5 / 7-Dual-Ab4 or bispecific comparator antibody #1 reduces this hyperkeratosis due to inhibition of both KLK5 and KLK7. Treatment with comparator antibody #3, which inhibits only KLK5, demonstrates some effect on hyperkeratosis, but to a lesser degree. The data suggest that inhibition of both KLK5 and KLK7 is necessary for complete rescue of epidermal dysfunction. Example 11. Crystalline structure of KLK5 / 7-Dual-Ab1.

[0293] The crystallization conditions for the complex between KLK5 / 7-DualAb1 and human KLK7 (StoA variant) were 25% (w / v) polyethylene glycol, 0.1 M PCTP buffer (pH 8), at 20 °C with a protein-to-reservoir ratio of 1:1. The structure was fully refined with autoBUSTER and validation was performed with MolProbity. KLK5 / 7-Dual-Ab1 and its derivatives are characterized by a longer-than-average heavy chain CDR3 loop (indicated by the arrow), which occupies the antigen's active site (FIG. 11). Inhibition of the catalytic activity of Petition 870250091425, dated 07 / 10 / 2025, pp. 132 / 159 124 / 129 KLK enzyme was achieved through competitive inhibition. Endogenous KLK7 substrates occupied the S4-S1 active site in the N-terminal to C-terminal direction. In contrast, Fab KLK5 / 7-Dual-Ab1 occupied the active site in the C-terminal to N-terminal direction (indicated by the arrow) (FIG. 12), thus conferring protection to Fab against proteolytic degradation through occupation in the reverse register. Tyrosine occupies the critical S1 binding site and is anchored through a polar interaction between the hydroxyl group of the Tyr residue and the side chain of an Asn residue found on the back side of the site. OTHER MODALITIES

[0294] All features disclosed in this specification may be combined in any combination. Each feature disclosed in this specification may be replaced by an alternative feature that serves the same purpose, is equivalent, or is similar. Therefore, unless expressly stated otherwise, each disclosed feature is only an example of a generic series of equivalent or similar features.

[0295] From the description above, a specialist in the field can easily determine the essential characteristics of the present invention and, without departing from its spirit and scope, can make various alterations and modifications to the invention to adapt it to various uses and conditions. Thus, other embodiments are also presented below: Equivalents and Scope

[0296] In claims, articles such as “a,” “an,” and “the” may mean one or more than one unless indicated otherwise, or otherwise evident from the context. Claims or descriptions that include “or” among one or more members of a group are considered satisfactory if one, more than one, or all members of the group are present, employed, or otherwise relevant to a given product or process, unless indicated otherwise, or otherwise evident from the context. The invention includes embodiments in which exactly one member of the group is present in, employed in, or otherwise relevant to a given product. Petition 870250091425, dated 07 / 10 / 2025, pp. 133 / 159 125 / 129 or process. The invention includes embodiments in which more than one, or all, members of the group are present in, employed in, or otherwise relevant to a particular product or process.

[0297] Furthermore, the invention encompasses all variations, combinations, and permutations in which one or more limitations, elements, clauses, and descriptive terms of one or more of the listed claims are presented in another claim. For example, any claim that is dependent on another claim may be modified to include one or more limitations found in any other claim that is dependent on the same underlying claim. Where elements are displayed as lists, for example, in Markush group format, each subgroup of the elements is also disclosed, and any element(s) may be removed from the group. It should be understood that, in general, when the invention, or aspects of the invention, are referred to as comprising particular elements and / or features, certain embodiments of the invention or aspects of the invention consist of, or essentially consist of, such elements and / or features.For the sake of simplicity, these modalities have not been specifically established in haec verba in this document.

[0298] The phrase “and / or”, as used in this document in the descriptive report and claims, should be understood as meaning “one or both” of the elements thus joined, that is, elements that are present conjuncturally in some cases and present disjuncturally in other cases. Several elements listed with “and / or” should be interpreted in the same way, that is, “one or more” of the associated elements. Other elements may optionally be present in addition to the elements specifically identified by the “and / or” clause, whether or not related to those specifically identified elements. Thus, as a non-limiting example, a reference to “A and / or B”, when used in conjunction with open language such as “understand”, may refer, in one embodiment, to only A (optionally including elements other than B); in another embodiment, to Petition 870250091425, dated 07 / 10 / 2025, pp. 134 / 159 126 / 129 only B (optionally including elements different from A); in yet another modality, both A and B (optionally including other elements); etc.

[0299] As used in this document in the descriptive report and claims, “or” should be understood as having the same meaning as “and / or” as defined above. For example, when separating items in a list, “or” or “and / or” should be interpreted as being inclusive, i.e., including at least one, but also including more than one, of a number or list of elements and, optionally, additional unlisted items. Only terms clearly indicated to the contrary, such as “only one of” or “exactly one of”, or, when used in claims, “consisting of”, will refer to the inclusion of exactly one element of a number or list of elements. In general, the term “or” in this document should only be interpreted as indicating exclusive alternatives (i.e., “one or the other but not both”) when preceded by terms of exclusivity, such as “or”, “one of”, “only”, or “exactly one of”."Essentially consisting of," when used in claims, should retain its common meaning as used in the field of patent law.

[0300] As used in this document in the descriptive report and claims, the phrase “at least one,” in reference to a list of one or more elements, shall be understood as meaning at least one element selected from any one or more of the elements in the list of elements, but not necessarily including at least one of each and every element specifically listed in the list of elements and not excluding any combinations of elements in the list of elements. This definition also allows for elements that may optionally be present, different from the elements specifically identified in the list of elements to which the phrase “at least one” refers, whether or not related to those specifically identified elements. Thus, as a non-limiting example, “at least one of A and B” (or, equivalently, “at least Petition 870250091425, dated 07 / 10 / 2025, pp. 135 / 159 127 / 129 “one of A or B”, or, equivalently, “at least one of A and / or B”) may refer, in one way, to at least one, optionally including more than one, A, without B present (and optionally including other elements different from B); in another way, to at least one, optionally including more than one, B, without A present (and optionally including other elements different from A); in yet another way, to at least one, optionally including more than one, A, and at least one, optionally including more than one, B (and optionally including other elements); etc.

[0301] It should also be understood that, unless clearly stated otherwise, in any methods claimed herein that include more than one step or act, the order of the steps or acts of the method is not necessarily limited to the order in which the steps or acts of the method are recited.

[0302] In the claims, as well as in the specification above, all transitional phrases such as “comprising,” “including,” “carrying,” “having,” “containing,” “enveloping,” “composed of,” and the like are to be understood as open-ended, that is, meaning including but not limited to. Only the transitional phrases “consist of” and “consist essentially of” should be closed or semi-closed transitional phrases, respectively, as set forth in the U.S. Patent Examination Procedures Manual, Section 2111.03. It should be understood that embodiments described herein using an open-ended transitional phrase (e.g., “comprising”) are also contemplated, in alternative embodiments, as “consisting of” and “consisting essentially of” the feature described by the open-ended transitional phrase.For example, if the application describes "a composition comprising A and B", the application also contemplates the alternative embodiments "a composition consisting of A and B" and "a composition consisting essentially of A and B".

[0303] Where ranges are given, extreme points are included. Furthermore, unless otherwise indicated, or otherwise evident, from the Petition 870250091425, dated 07 / 10 / 2025, pp. 136 / 159 128 / 129 context and understanding of someone skilled in the art, the values ​​that are expressed as ranges can assume any specific value or subrange within the ranges stated in different embodiments of the invention, to the tenth of a unit of the lower limit of the range, unless the context clearly dictates otherwise.

[0304] This application refers to various issued patents, published patent applications, journal articles, and other publications, all incorporated herein by reference. If there is a conflict between any of the incorporated references and this descriptive report, the descriptive report shall prevail. Furthermore, any particular embodiment of the present invention that falls within the prior art can be explicitly excluded from any one or more of the claims. Because such embodiments are considered to be common knowledge in the art, they can be excluded even if the exclusion is not explicitly stated in this document. Any particular embodiment of the invention can be excluded from any claim for any reason, whether or not related to the existence of the prior art.

[0305] Those skilled in the art will recognize, or be able to determine using no more than routine experimentation, many equivalents to the specific embodiments described in this document. The scope of the present embodiment described in this document is not intended to be limited to the above description, but rather to be set forth in the appended claims. Those skilled in the art will recognize that various alterations and modifications may be made to this description without departing from the spirit or scope of the present invention, as defined in the following claims.

[0306] The recitation of a listing of chemical groups in any definition of a variable herein includes definitions of that variable as any single group or combination of groups listed. The recitation of a modality for a variable herein includes that modality as any single modality or in combination with any other modalities or portions thereof. A Petition 870250091425, dated 07 / 10 / 2025, pp. 137 / 159 129 / 129 recitation of a modality in this document includes that modality as any single modality or in combination with any other modalities of the same. Petition 870250091425, dated 07 / 10 / 2025, pp. 138 / 159

Claims

1 / 4 CLAIMS 1. A dual inhibitor antibody that specifically binds to KLK5 and KLK7, the dual inhibitor antibody characterized in that it comprises: (a) an HC CDR1, HC CDR2 and HC CDR3 of a variable heavy chain domain having the amino acid sequence of SEQ ID NO: 7, and an LC CDR1, LC CDR2 and LC CDR3 of a variable light chain domain having the amino acid sequence of SEQ ID NO: 8; (b) an HC CDR1, HC CDR2 and HC CDR3 of a variable heavy chain domain having the amino acid sequence of SEQ ID NO: 13, and an LC CDR1, LC CDR2 and LC CDR3 of a variable light chain domain having the amino acid sequence of SEQ ID NO: 14; (c) an HC CDR1, HC CDR2 and HC CDR3 of a variable heavy chain domain with amino acid sequence SEQ ID NO: 17, and an LC CDR1, LC CDR2 and LC CDR3 of a variable light chain domain with amino acid sequence SEQ ID NO: 14;or (d) an HC CDR1, HC CDR2 and HC CDR3 of a variable heavy chain domain having the amino acid sequence of SEQ ID NO: 21, and an LC CDR1, LC CDR2 and LC CDR3 of a variable light chain domain having the amino acid sequence of SEQ ID NO: 14.; 2. Dual inhibitor antibody, according to claim 1, characterized in that the dual inhibitor antibody comprises: (a) an HC CDR1 having the amino acid sequence of SEQ ID NO: 1, an HC CDR2 having the amino acid sequence of SEQ ID NO: 2, an HC CDR3 having the amino acid sequence of SEQ ID NO: 3, an LC CDR1 having the amino acid sequence of SEQ ID NO: 4, an LC CDR2 having the amino acid sequence of SEQ ID NO: 5 and an LC CDR3 having the amino acid sequence of SEQ ID NO: 6; (b) an HC CDR1 having the amino acid sequence of SEQ ID NO: 9, an HC CDR2 having the amino acid sequence of SEQ ID NO: 10, an HC CDR3 having the amino acid sequence of SEQ ID NO: 11, an LC CDR1 Petition 870250080962, of 09 / 09 / 2025, p.(a) a 21 / 26 2 / 4 having the amino acid sequence SEQ ID NO: 4, an LC CDR2 having the amino acid sequence SEQ ID NO: 5 and an LC CDR3 having the amino acid sequence SEQ ID NO: 12; (b) an HC CDR1 having the amino acid sequence SEQ ID NO: 9, an HC CDR2 having the amino acid sequence SEQ ID NO: 15, an HC CDR3 having the amino acid sequence SEQ ID NO: 16, an LC CDR1 having the amino acid sequence SEQ ID NO: 4, an LC CDR2 having the amino acid sequence SEQ ID NO: 5 and an LC CDR3 having the amino acid sequence SEQ ID NO: 12; or (d) an HC CDR1 having the amino acid sequence of SEQ ID NO: 18, an HC CDR2 having the amino acid sequence of SEQ ID NO: 19, an HC CDR3 having the amino acid sequence of SEQ ID NO: 20, an LC CDR1 having the amino acid sequence of SEQ ID NO: 4, an LC CDR2 having the amino acid sequence of SEQ ID NO: 5 and an LC CDR3 having the amino acid sequence of SEQ ID NO:

12.

3. Dual inhibitor antibody, according to claim 1 or 2, characterized in that the antibody comprises: (a) a VH comprising the amino acid sequence of SEQ ID NO: 7 and a VL comprising the amino acid sequence of SEQ ID NO: 8; (b) a VH comprising the amino acid sequence of SEQ ID NO: 13, and a VL comprising the amino acid sequence of SEQ ID NO: 14; (c) a VH comprising the amino acid sequence of SEQ ID NO: 17 and a VL comprising the amino acid sequence of SEQ ID NO: 14; or (d) a VH comprising the amino acid sequence of SEQ ID NO: 21, and a VL comprising the amino acid sequence of SEQ ID NO:

14.

4. Dual inhibitor antibody, characterized in that it comprises an HC CDR1, HC CDR2, HC CDR3, LC CDR1, LC CDR2 and / or LC CDR3 of any of the dual inhibitor antibodies listed in Tables 1a and 1b. Petition 870250080962, dated 09 / 09 / 2025, p. 22 / 26 3 / 4 5. Dual inhibitor antibody, characterized in that it comprises a VH and / or VL of any of the dual inhibitor antibodies listed in Tables 1a and 1b.

6. Dual inhibitor antibody, according to any one of claims 1 to 5, characterized in that the dual inhibitor antibody binds to the active site of KLK5 and to the active site of KLK7.

7. Dual inhibitor antibody, according to any one of claims 1 to 6, characterized in that the dual inhibitor antibody competes with SPINK 5 and / or leupeptin for binding to the active site of KLK5 and the active site of KLK7.

8. Dual inhibitor antibody, according to any one of claims 1 to 7, characterized in that the dual inhibitor antibody binds to the active form of KLK5 and the active form of KLK7, but not to the inactive form of KLK5 or the inactive form of KLK7.

9. Dual inhibitor antibody, according to any one of claims 1 to 8, characterized in that the dual inhibitor antibody inhibits the protease activity of KLK5 and KLK7.

10. Dual inhibitor antibody, according to any one of claims 1 to 9, characterized in that the antibody is not cleaved at the heavy chain by KLK5 or KLK7 upon binding to KLK5 or KLK7.

11. Dual inhibitor antibody, according to any one of claims 1 to 10, characterized in that the antibody is not a bispecific antigen-binding molecule in which KLK5 binding is conferred by a binding site within the antibody and KLK7 binding is conferred by a different binding site.

12. Dual inhibitor antibody, according to any one of claims 1 to 11, characterized in that the antibody is a multispecific antigen-binding molecule that further comprises an antigen-binding domain that binds to an antigen other than KLK5 or KLK7.

13. Composition, characterized in that it comprises Petition 870250080962, dated 09 / 09 / 2025, page 23 / 26 4 / 4 a dual inhibitor antibody of any of claims 1 to 12 and an acceptable carrier.

14. Nucleic acid, characterized in that it encodes an inhibitory antibody for any one of claims 1 to 12.

15. A method for treating a skin barrier defect, characterized in that it comprises administering to a subject an effective amount of a dual inhibitor antibody of any one of claims 1 to 2, or of the composition of claim 13.

16. Method, according to claim 15, characterized in that the skin barrier defect is associated with Netherton syndrome, atopic dermatitis, eosinophilic esophagitis, nodular prurigo, chronic pruritus of unknown origin (CPUO), dry skin, asthma (specifically KLK5), ichthyosis vulgaris, or itching or chronic itching.

17. Dual inhibitor antibody, according to any one of claims 1 to 12, or composition, according to claim 13, characterized in that it is for use in a method of treating a skin barrier defect.

18. Dual inhibitor antibody for use according to claim 17, characterized in that the skin barrier defect is associated with Netherton syndrome, atopic dermatitis, eosinophilic esophagitis, nodular prurigo, chronic pruritus of unknown origin (CPUO), dry skin, asthma (specifically KLK5), ichthyosis vulgaris, or chronic itching. Petition 870250080962, dated 09 / 09 / 2025, pp. 24 / 26