Small molecule polypeptides for preventing and treating inflammation and their applications
By developing the small molecule peptide H-RN, the penetration and safety of drugs in the existing treatment of uveitis have been solved, and the effective and safe eye anti-inflammatory effects have been achieved, which is suitable for the treatment of a variety of eye inflammatory diseases.
Patent Information
- Application Number
- CN201310357596.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2013-08-15
- Publication Date
- 2025-09-02
- Estimated Expiration
- 2033-08-15
AI Technical Summary
The existing treatment methods for uveitis have problems such as great toxic side effects, difficulty in penetrating the eye tissue barrier, and low bioavailability, especially when large molecular drugs are used in the eyes, they are prone to tissue damage and complications.
A small molecule polypeptide H-RN was developed, which was prepared by solid phase synthesis or recombination technology. It has the function of inhibiting inflammation, has a small molecular weight, good water solubility, and can penetrate the eye tissue barrier. It is suitable for ocular drug administration.
It achieves anti-inflammatory effects with high bioavailability in the eyes, reduces systemic side effects, is highly safe, and is suitable for the treatment of various inflammatory diseases in the eyes.
Smart Images

Figure SMS_1 
Figure SMS_2 
Figure SMS_6
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biomedicine, and more specifically, to a novel small molecule polypeptide, referred to as H-RN, for preventing and treating inflammatory diseases. The present invention also relates to methods for preparing and using the polypeptide and pharmaceutical compositions containing the polypeptide. Background Art
[0002] Uveitis is a common, clinically challenging immunogenic disease that can disrupt the blood-ocular barrier and cause proliferation of adjacent intraocular tissues, leading to cataracts, macular edema, secondary glaucoma, and ultimately intraocular tissue damage. It has a high rate of blindness, severely impacting patients' visual quality and quality of life. In Europe and the United States, approximately 35% of patients with uveitis experience varying degrees of visual impairment; the blindness rate from uveitis in China is 18.76%.
[0003] Currently, the primary treatment for uveitis involves topical or systemic use of nonsteroidal anti-inflammatory drugs (NSAIDs), hormones, and immunosuppressants. However, hormones and immunosuppressants inevitably carry serious side effects, such as cataracts, increased intraocular pressure, infection, and nephrotoxicity. NSAIDs are highly irritating locally, and their large molecular weight limits the effective concentration of the drug in ocular tissues due to the low permeability of the ocular barrier. Furthermore, drug screening or symptomatic treatment targeting the various pathological consequences of uveitis, such as angiogenesis and tissue hyperplasia, often only provides relative symptom relief without effectively suppressing the underlying pathology of uveitis, the hyperinflammatory response.
[0004] In recent years, an increasing number of biologics have been shown, through laboratory or clinical studies, to inhibit ocular inflammation. These include antioxidants (such as benfotiamine and N-acetylcysteine), plant extracts, and anti-cytokine monoclonal antibodies (such as daclizumab, a monoclonal antibody to the α subunit of the IL-2 receptor, and infliximab, an anti-TNF-α monoclonal antibody). However, these biologics have large molecular weights and complex in vitro synthesis methods. These include drawbacks such as cumbersome recombinant expression and purification processes and residual endotoxins during preparation. Furthermore, they are susceptible to loss of biological activity due to changes in protein conformation and modification. Due to their large molecular weight, they have difficulty crossing the blood-ocular barrier and require repeated intravitreal injections or genetic modification to exert their anti-inflammatory effects, which carries the risk of serious complications such as tissue damage.
[0005] When developing effective inhibitors of ocular inflammation, the particularity of ophthalmic drugs should be fully considered.
[0006] First, the eye has multiple anatomical and functional barriers. Systemic drug delivery often fails to achieve sufficient drug concentrations locally in ocular tissues due to the blood-aqueous humor barrier and the blood-retinal barrier. Furthermore, with local administration, such as intravitreal injection, large molecules larger than 76.5 kDa theoretically have difficulty penetrating the retina and acting on retinal and choroidal blood vessels.
[0007] Second, the degree of drug solubility in hydrophilic tears, aqueous humor, and vitreous humor is positively correlated with its effectiveness.
[0008] Third, due to the aforementioned reasons, the bioavailability of ophthalmic drugs is very low; to improve it, the drug concentration must be increased. However, high-concentration drugs have significant toxic side effects, making high-dose administration impractical for both systemic and local administration.
[0009] Fourth, although a series of relatively safe endogenous inflammatory inhibitors have been confirmed, due to their large molecular weight and complex spatial conformation, there are shortcomings in the preparation process, such as cumbersome recombinant expression and purification processes and endotoxin residues.
[0010] Compared with the widely studied protein inflammatory inhibitors, peptide inflammatory inhibitors have outstanding advantages such as simple synthesis method, easy chemical modification, low immunogenicity, good solubility, high bioavailability, strong tissue penetration, diverse administration routes and low price.
[0011] Therefore, there is an urgent need in the art to develop a safe and effective small molecule inflammation inhibitor suitable for ocular tissue. Summary of the Invention
[0012] The purpose of the present invention is to provide a small molecule polypeptide suitable for eyeball tissue that is safe and effective in inhibiting eye inflammation, namely H-RN polypeptide, as well as fragments, analogs and derivatives thereof.
[0013] Another object of the present invention is to provide a preparation method and application of the polypeptide.
[0014] In the first aspect of the present invention, a polypeptide represented by the following formula I or a pharmaceutically acceptable salt thereof is provided.
[0015] [Xaa0]-[Xaa1]-[Xaa2]-[Xaa3]-[Xaa4]-[Xaa5]-[Xaa6]-[Xaa7]-[Xaa8]-[Xaa9]-[Xaa10]-[Xaa11]-[Xaa12] (I)
[0016] Where,
[0017] Xaa0 is none, or 1-3 amino acids constitute the peptide segment;
[0018] Xaa1 is an amino acid selected from the group consisting of Arg, Lys, or Gln;
[0019] Xaa2 is an amino acid selected from the group consisting of Asn or Gln;
[0020] Xaa3 is an amino acid selected from the group consisting of Pro or Ala;
[0021] Xaa4 is an amino acid selected from the group consisting of Arg or Lys;
[0022] Xaa5 is an amino acid selected from the group consisting of Gly or Ala;
[0023] Xaa6 is an amino acid selected from the group consisting of Glu or Asp;
[0024] Xaa7 is an amino acid selected from the group consisting of Glu or Asp;
[0025] Xaa8 is an amino acid selected from the group consisting of Gly or Ala;
[0026] Xaa9 is an amino acid selected from the group consisting of Gly or Ala;
[0027] Xaa10 is an amino acid selected from the group consisting of Pro or Ala;
[0028] Xaa11 is an amino acid selected from the group consisting of Trp, Tyr, or Phe;
[0029] Xaa12 is absent, or consists of 1-3 amino acids constituting a peptide segment;
[0030] Furthermore, the polypeptide has the activity of inhibiting inflammation.
[0031] In another preferred embodiment, Xaa0 and Xaa12 are absent.
[0032] In another preferred embodiment, Xaa1 is Arg, Xaa4 is Arg, Xaa10 is Pro and Xaa11 is Trp.
[0033] In another preferred embodiment, the polypeptide is selected from the following group:
[0034] (a) a polypeptide having an amino acid sequence of RNPRGEEGGPW (SEQ ID NO: 2), wherein the polypeptide is 11-15 amino acids in length;
[0035] (b) A polypeptide derived from (a) having the function of inhibiting inflammation, which is formed by replacing, deleting or adding 1-2 amino acid residues in the amino acid sequence shown in SEQ ID NO: 2.
[0036] The present invention also provides dimers and multimers of the compound of formula I that inhibit inflammation.
[0037] In the second aspect of the present invention, an isolated nucleic acid molecule is provided, which encodes the above-mentioned polypeptide of the present invention.
[0038] In a third aspect of the present invention, there is provided a pharmaceutical composition comprising:
[0039] (a) the above-mentioned polypeptide of the present invention or a pharmaceutically acceptable salt thereof; and
[0040] (b) a pharmaceutically acceptable carrier or excipient.
[0041] In another preferred embodiment, the composition is in the form of eye drops, injections (such as periocular and intraocular injections), eye gels or eye ointments.
[0042] In another preferred embodiment, the composition is a sustained-release dosage form.
[0043] In a fourth aspect of the present invention, there is provided a use of the polypeptide or pharmaceutically acceptable salt of the present invention for preparing a medicament for inhibiting inflammation or treating inflammation-related diseases.
[0044] In another preferred embodiment, the inflammation-related disease is selected from the following group: ocular inflammatory diseases, pancreatitis, inflammatory bowel disease, lung inflammation, skin inflammation, rheumatoid arthritis, ankylosing spondylitis, etc.
[0045] In another preferred embodiment, the ocular inflammatory disease includes diseases involving the choroid, retina, conjunctiva, cornea or iris, including blepharitis, conjunctivitis, keratitis, scleritis, uveitis, retinal peripheral phlebitis, optic neuritis, etc.
[0046] In a fifth aspect of the present invention, a method for inhibiting inflammation in a mammal is provided, comprising the steps of administering the polypeptide of the present invention or a pharmaceutically acceptable salt thereof to a subject in need thereof.
[0047] In another preferred embodiment, the subject is a human.
[0048] In another preferred embodiment, the inflammation is inflammation associated with ocular inflammatory diseases. BRIEF DESCRIPTION OF THE DRAWINGS
[0049] The following drawings are used to illustrate specific embodiments of the present invention and are not used to limit the scope of the present invention defined by the claims.
[0050] Figure 1The effects of H-RN peptide on inflammatory cell infiltration in a rat endotoxin-induced uveitis (EIU) model are shown. A. Clinical manifestations of a normal Wistar rat control group treated with intravitreal PBS injection. B. Clinical manifestations of a LPS-induced intravitreal PBS injection group. C. Clinical manifestations of a LPS-induced intravitreal H-RN injection group (10 μg / μl). D. EIU clinical scores in the control, LPS, DXM, and H-RN intervention groups (1, 5, and 10 μg / μl). E. Aqueous humor inflammatory cell counts in the control, LPS, DXM, and H-RN intervention groups (1, 5, and 10 μg / μl). n = 9-15, **p < 0.01 vs. LPS group.
[0051] Figure 2 The effects of H-RN peptide on LPS-induced proinflammatory cytokine expression in RAW264.7 cells are shown. A. TNF-α concentration in the supernatant of RAW264.7 cells from the normal control group, LPS group, and H-RN treatment group (1, 10, and 100 μM). B. IL-6 concentration in the supernatant of RAW264.7 cells from the normal control group, LPS group, and H-RN treatment group (1, 10, and 100 μM). n = 10, *p < 0.05, **p < 0.01 vs. LPS group.
[0052] Figure 3 The relative proliferation rate of RAW264.7 cells treated with different concentrations of H-RN (0.1, 1, 10, 100 μM, 1 mM) is shown. n=6. DETAILED DESCRIPTION
[0053] After extensive and in-depth research, the inventors have, for the first time, developed a small molecule polypeptide with a molecular weight of only 1.254 kDa that has the ability to inhibit inflammation. Specifically, the inventors applied bioinformatics methods, based on homology analysis and biological properties, to select several candidate sequences. These sequences were synthesized using a solid-phase method and then screened in an endotoxin-induced rat uveitis model. This yielded a novel class of small molecule polypeptides, namely H-RN, that can prevent and treat ocular inflammation.
[0054] The present invention has a small molecular weight and can penetrate various ocular tissue barriers. It also has good water solubility and can maintain high concentrations in neutral tears, aqueous humor, and vitreous humor. It is highly safe and has minimal toxic side effects on biological tissues. It also has high bioavailability when applied topically to the eye, allowing for reduced dosage and thus minimizing systemic side effects. This invention was completed based on these findings.
[0055] Hepatocyte growth factor (HGF)
[0056] Hepatocyte growth factor (HGF) is a dimer composed of a 69 kDa heavy chain and a 34 kDa light chain, formed through disulfide bonds. The heavy chain has a hairpin structure at its N-terminus and four consecutive Kringle loops near its C-terminus. HGF's Genbank ID is AAA64239.1.
[0057] HGF is a cytokine with a wide range of effects. Besides its effects on hepatocytes, it also regulates a variety of tissues and cells. Its primary biological and physiological activities include initiating liver regeneration, promoting cell division and motility, and inhibiting tumor necrosis. The inventors screened a large number of fragments and identified an anti-inflammatory fragment derived from HGF. This fragment, consisting of only 11 amino acids in length and a low molecular weight, easily penetrates the blood-ocular barrier, suggesting promising applications in topical ocular anti-inflammatory treatments.
[0058] LPS-induced mouse inflammation model
[0059] Lipopolysaccharide (LPS) is a polyclonal stimulator of lymphocytes. In vitro experiments show that it can directly activate B lymphocytes, causing them to undergo a series of changes such as activation and proliferation. After entering the blood circulation, LPS binds to monocytes and endothelial cells through multiple receptors (such as CD14, CD11 / 18, and lipoprotein scavenger receptors), stimulating the body's nonspecific immune function and inducing the expression of cytokines and inflammatory mediators, such as pro-inflammatory cytokines TNF-α, IL-1, IL-6, IL-8, and IFNγ. Among them, TNF-α is the main rapid-response proinflammatory mediator and the most upstream mediator that initiates the proinflammatory cascade reaction. To a certain extent, it can reflect changes in the disease state.
[0060] Currently, the LPS-induced mouse inflammation model can be widely used in the screening and testing of anti-inflammatory drugs, and is stable and representative.
[0061] Active peptides
[0062] In the present invention, the terms "polypeptide of the present invention," "H-RN polypeptide," "H-RN small peptide," or "peptide H-RN" are used interchangeably and all refer to proteins or polypeptides having the peptide H-RN amino acid sequence (SEQ ID NO: 2) with inflammation-suppressing activity. In addition, the terms also include variants of the sequence of SEQ ID NO: 2 that have inflammation-suppressing function. These variants include (but are not limited to): deletion, insertion, and / or substitution of 1-5 (usually 1-4, preferably 1-3, more preferably 1-2, and most preferably 1) amino acids, and addition of one or more (usually within 5, preferably within 3, and more preferably within 2) amino acids to the C-terminus and / or N-terminus. For example, in the art, substitution with amino acids having similar or similar properties generally does not alter the function of the protein. For another example, addition of one or more amino acids to the C-terminus and / or N-terminus generally does not alter the structure and function of the protein.
[0063] The present invention also includes active fragments, derivatives and analogs of H-RN proteins. As used herein, the terms "fragment," "derivative," and "analog" refer to polypeptides that substantially maintain the function or activity of inhibiting inflammation. The polypeptide fragments, derivatives, or analogs of the present invention may be (i) polypeptides in which one or more conservative or non-conservative amino acid residues (preferably conservative amino acid residues) are substituted, or (ii) polypeptides having a substituent group in one or more amino acid residues, or (iii) polypeptides formed by fusion of an H-RN polypeptide with another compound (such as a compound that extends the half-life of the polypeptide, such as polyethylene glycol), or (iv) polypeptides formed by fusion of an additional amino acid sequence to this polypeptide sequence (and then proteins formed by fusion with tag sequences such as a leader sequence, a secretory sequence, or 6His). According to the teachings herein, these fragments, derivatives, and analogs are within the scope known to those skilled in the art.
[0064] A preferred class of active derivatives refers to polypeptides in which no more than 5, preferably no more than 3, more preferably no more than 2, and most preferably 1 amino acid is replaced by an amino acid with similar or similar properties compared to the amino acid sequence of Formula I. These conservative variant polypeptides are preferably generated by making amino acid substitutions according to Table 1.
[0065] Table I
[0066]
[0067]
[0068] The present invention also provides analogs of H-RN proteins or polypeptides. These analogs may differ from the native H-RN polypeptide in amino acid sequence, in modifications that do not affect the sequence, or in a combination of these. Analogs also include those with residues other than naturally occurring L-amino acids (e.g., D-amino acids), as well as those with non-naturally occurring or synthetic amino acids (e.g., β- and γ-amino acids). It should be understood that the polypeptides of the present invention are not limited to the representative polypeptides listed above.
[0069] Modifications (generally without altering the primary structure) include chemical derivatization of polypeptides in vivo or in vitro, such as acetylation or carboxylation. Modifications also include glycosylation, such as those resulting from polypeptide synthesis and processing or further processing steps. Such modifications can be accomplished by exposing the polypeptide to glycosylation enzymes (e.g., mammalian glycosylases or deglycosylases). Modifications also include sequences containing phosphorylated amino acid residues (e.g., phosphotyrosine, phosphoserine, and phosphothreonine). Also included are polypeptides modified to increase their resistance to proteolysis or optimize their solubility.
[0070] The polypeptides of the present invention can also be used in the form of salts derived from pharmaceutically or physiologically acceptable acids or bases. These salts include, but are not limited to, salts formed with the following acids: hydrochloric acid, hydrobromic acid, sulfuric acid, citric acid, tartaric acid, phosphoric acid, lactic acid, pyruvic acid, acetic acid, succinic acid, oxalic acid, fumaric acid, maleic acid, oxaloacetic acid, methanesulfonic acid, ethanesulfonic acid, benzenesulfonic acid, or isethionic acid. Other salts include salts formed with alkali metals or alkaline earth metals (such as sodium, potassium, calcium, or magnesium), as well as in the form of esters, carbamates, or other conventional "prodrugs."
[0071] Coding sequence
[0072] The present invention also relates to a polynucleotide encoding an H-RN polypeptide. A preferred coding sequence is CGAAATCCTCGAGGGGAAGAAGGGGGACCCTGG (SEQ ID NO: 1).
[0073] The polynucleotides of the present invention may be in the form of DNA or RNA. The DNA may be a coding strand or a non-coding strand. The coding region sequence encoding the mature polypeptide may be identical to the coding region sequence set forth in SEQ ID NO:1 or a degenerate variant. As used herein, "degenerate variant" refers to a nucleic acid sequence that encodes a protein having the sequence of SEQ ID NO:2 but differs from the corresponding coding region sequence in SEQ ID NO:1.
[0074] The full-length H-RN nucleotide sequence of the present invention or its fragments can generally be obtained by PCR amplification, recombinant methods, or synthetic methods. Currently, DNA sequences encoding the polypeptides of the present invention (or their fragments, or derivatives thereof) can be obtained entirely by chemical synthesis. This DNA sequence can then be introduced into various existing DNA molecules (or vectors) and cells known in the art.
[0075] The present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector or H-RN protein coding sequence of the present invention.
[0076] On the other hand, the present invention also includes polyclonal antibodies and monoclonal antibodies specific to the polypeptides encoded by H-RN DNA or fragments thereof, especially monoclonal antibodies.
[0077] Preparation method
[0078] The polypeptides of the present invention may be recombinant polypeptides or synthetic polypeptides. The polypeptides of the present invention may be chemically synthesized or recombinant. Accordingly, the polypeptides of the present invention may be synthesized artificially using conventional methods or produced using recombinant methods.
[0079] A preferred method involves liquid-phase or solid-phase synthesis, such as the Boc solid-phase method, the Fmoc solid-phase method, or a combination of the two. Solid-phase synthesis allows for rapid sample acquisition, and the appropriate resin support and synthesis system can be selected based on the sequence characteristics of the target peptide. For example, a preferred solid-phase support in the Fmoc system is Wang resin, which is linked to the C-terminal amino acid of the peptide. Wang resin is a polystyrene resin with a 4-alkoxybenzyl alcohol arm between the amino acids. Treatment with 25% hexahydropyridine / dimethylformamide at room temperature for 20 minutes removes the Fmoc protecting group, and the amino acids are subsequently extended from the C-terminus to the N-terminus according to the given amino acid sequence. After synthesis, the synthesized proinsulin-related peptide is cleaved from the resin using trifluoroacetic acid containing 4% p-methylphenol to remove the protecting groups. The crude peptide can be isolated by filtration and ether precipitation after removal of the resin. The resulting product solution is lyophilized, and the desired peptide is purified by gel filtration and reverse-phase high-performance liquid chromatography. When using the Boc system for solid-phase synthesis, the preferred resin is a PAM resin linked to the C-terminal amino acid of the peptide. The PAM resin structure is polystyrene, with a 4-hydroxymethylphenylacetamide arm between the amino acid and the peptide. In the Boc synthesis system, during the deprotection, neutralization, and coupling cycles, the Boc protecting group is removed with TFA / dichloromethane (DCM) and neutralized with diisopropylethylamine (DIEA) / dichloromethane. After peptide chain condensation is complete, the peptide is treated with hydrogen fluoride (HF) containing 5-10% p-cresol at 0°C for 1 hour to cleave the peptide from the resin and remove the protecting group. The peptide is extracted with 50-80% acetic acid (containing a small amount of mercaptoethanol). The solution is lyophilized and further purified using Sephadex G10 or Tsk-40f molecular sieves. High-pressure liquid chromatography is then used to obtain the desired peptide. The amino acid residues can be coupled using various coupling agents and coupling methods known in the field of peptide chemistry, such as dicyclohexylcarbodiimide (DCC), hydroxybenzotriazole (HOBt), or 1,1,3,3-tetrauronium hexafluorophosphate (HBTU) for direct coupling. The purity and structure of the synthesized short peptide can be confirmed by reversed-phase high performance liquid chromatography and mass spectrometry.
[0080] In a preferred embodiment, the polypeptide H-RN of the present invention is prepared according to its sequence by solid phase synthesis, purified by high performance liquid chromatography, and obtained as a high purity lyophilized powder of the target peptide, which is stored at -20°C.
[0081] Another method is to use recombinant technology to produce the polypeptide of the present invention. The polynucleotides of the present invention can be used to express or produce recombinant H-RN polypeptides using conventional recombinant DNA technology. Generally speaking, the following steps are involved:
[0082] (1) Transforming or transducing a suitable host cell with a polynucleotide encoding an H-RN polypeptide (or variant) of the present invention, or a recombinant expression vector containing the polynucleotide;
[0083] (2) Host cells cultured in a suitable culture medium;
[0084] (3) Isolate and purify proteins from culture medium or cells.
[0085] The recombinant polypeptide can be expressed intracellularly, on the cell membrane, or secreted extracellularly. If desired, the recombinant protein can be isolated and purified by various separation methods utilizing its physical, chemical, and other properties. These methods are well known to those skilled in the art. Examples of these methods include, but are not limited to, conventional renaturation treatment, treatment with a protein precipitant (salting out method), centrifugation, osmotic sterilization, ultrafiltration, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC), and various other liquid chromatography techniques and combinations of these methods.
[0086] Since the polypeptide of the present invention is relatively short, it is possible to concatenate multiple polypeptides together, obtain expression products after recombinant expression, and then form the desired small peptides through methods such as enzyme cleavage.
[0087] Pharmaceutical compositions and methods of administration
[0088] In another aspect, the present invention also provides a pharmaceutical composition comprising (a) a safe and effective amount of a polypeptide of the present invention or a pharmaceutically acceptable salt thereof; and (b) a pharmaceutically acceptable carrier or excipient. The amount of the polypeptide of the present invention is generally 10 μg to 100 mg per dose, preferably 100 to 1000 μg per dose.
[0089] For the purposes of the present invention, an effective dose is about 0.01 mg / kg to 50 mg / kg, preferably 0.05 mg / kg to 10 mg / kg, of the polypeptide of the present invention administered to an individual. Furthermore, the polypeptide of the present invention may be used alone or in combination with other therapeutic agents (e.g., formulated in pharmaceutical compositions such as glucocorticoids, immunosuppressants, or nonsteroidal anti-inflammatory drugs).
[0090] The pharmaceutical composition may also contain a pharmaceutically acceptable carrier. The term "pharmaceutically acceptable carrier" refers to a carrier used to administer a therapeutic agent. The term refers to pharmaceutical carriers that do not themselves induce the production of antibodies harmful to the individual receiving the composition and that are not unduly toxic upon administration. Such carriers are well known to those of ordinary skill in the art. A comprehensive discussion of pharmaceutically acceptable excipients can be found in Remington's Pharmaceutical Sciences (Mack Pub. Co., NJ 1991). Such carriers include, but are not limited to, saline, buffer, dextrose, water, glycerol, ethanol, adjuvants, and combinations thereof.
[0091] Pharmaceutically acceptable carriers in therapeutic compositions may contain liquids such as water, saline, glycerol and ethanol. Additionally, auxiliary substances such as wetting agents or emulsifiers, pH buffering substances, etc. may also be present in these carriers.
[0092] Typically, therapeutic compositions are prepared as injectables, either as liquid solutions or suspensions; solid forms suitable for solution or suspension in liquid vehicles prior to injection can also be prepared.
[0093] Once formulated, the composition of the present invention can be administered by conventional routes, including but not limited to: intraocular, intramuscular, intravenous, subcutaneous, intradermal, or topical administration. The subject to be prevented or treated can be an animal; in particular, a human.
[0094] When the pharmaceutical composition of the present invention is used for actual treatment, various dosage forms of the pharmaceutical composition can be adopted according to the usage conditions. Preferably, eye drops, injections, eye gels and eye ointments can be cited.
[0095] These pharmaceutical compositions can be formulated according to conventional methods by mixing, diluting or dissolving, and occasionally suitable pharmaceutical additives such as excipients, disintegrants, binders, lubricants, diluents, buffers, isotonicities, preservatives, wetting agents, emulsifiers, dispersants, stabilizers and solubilizers are added, and the formulation process can be carried out in a conventional manner according to the dosage form.
[0096] For example, eye drops can be prepared as follows: the polypeptide H-RN or a pharmaceutically acceptable salt thereof is dissolved in sterile water (surfactant dissolved in sterile water) together with the basic substance by heating, polyvinylpyrrolidone is added, and suitable pharmaceutical additives such as preservatives, stabilizers, buffers and isotonic agents, antioxidants and viscosity increasing agents can be optionally added, and then completely dissolved.
[0097] The pharmaceutical composition of the present invention can also be administered in the form of a sustained-release agent. For example, polypeptide H-RN or its salt can be incorporated into a pill or microcapsule with a sustained-release polymer as a carrier, and then the pill or microcapsule is surgically implanted into the tissue to be treated. In addition, polypeptide H-RN or its salt can also be used by inserting an intraocular lens pre-coated with the drug. Examples of sustained-release polymers include ethylene-vinyl acetate copolymer, polyhydroxymethylacrylate (polyhydrometaacrylate), polyacrylamide, polyvinylpyrrolidone, methylcellulose, lactic acid polymers, lactic acid-glycolic acid copolymers, and the like. Preferably, biodegradable polymers such as lactic acid polymers and lactic acid-glycolic acid copolymers can be exemplified.
[0098] When the pharmaceutical composition of the present invention is used for actual treatment, the dosage of the polypeptide H-RN or a pharmaceutically acceptable salt thereof as the active ingredient can be reasonably determined based on the weight, age, sex, and severity of symptoms of each patient to be treated. For example, when administered topically, the concentration is generally about 0.1-10 wt %, preferably 1-5 wt %, and can be administered 2-6 times daily, with 1-5 drops each time.
[0099] Indications
[0100] The polypeptide of the present invention and its derivative polypeptides can be used to prepare drugs for inhibiting inflammation or treating diseases related to inflammation.
[0101] As used herein, inflammation encompasses both infectious and non-infectious inflammation. During the inflammatory response, pro-inflammatory cytokines participate in the development and progression of inflammation. Among them, TNF-α is the earliest and most important inflammatory mediator to appear during the inflammatory response. It activates neutrophils and lymphocytes, increases the permeability of vascular endothelial cells, regulates the metabolic activity of other tissues, and promotes the synthesis and release of other cytokines.
[0102] Inflammation-related diseases
[0103] Inflammation-related diseases that can be used in the present invention include ocular inflammatory diseases, pancreatitis, inflammatory bowel disease, lung inflammation, skin inflammation, rheumatoid arthritis, and ankylosing spondylitis.
[0104] Inflammatory eye diseases
[0105] Ocular inflammatory diseases that can be used in the present invention include various ocular inflammatory diseases involving the choroid, retina, conjunctiva, cornea or iris, including blepharitis, conjunctivitis, keratitis, scleritis, uveitis, retinal periphlebitis, optic neuritis, etc.
[0106] In the present invention, inflammation-related diseases, especially ocular inflammatory diseases, all have an increase in TNF-α as a common feature. Therefore, as long as the polypeptide of the present invention can effectively inhibit the proinflammatory cytokine TNF-α, the polypeptide has the effect of inhibiting inflammation or treating the inflammation-related disease.
[0107] Industrial Applicability
[0108] Pharmaceutical compositions containing the peptide of the present invention or a pharmaceutically acceptable salt thereof as an active ingredient exhibit significant inhibitory activity against inflammation. In vivo and in vitro tests have demonstrated that the peptide not only inhibits endotoxin-induced uveitis in rats but also suppresses LPS-induced expression of pro-inflammatory cytokines in RAW264.7 cells, without significant toxic side effects on RAW264.7 cells.
[0109] The main advantages of the present invention include:
[0110] (a) The polypeptide of the present invention has a small molecular weight and can penetrate various ocular tissue barriers;
[0111] (b) It has good water solubility and can maintain high concentrations in neutral tears, aqueous humor, and vitreous humor;
[0112] (c) High safety and minimal toxicity to biological tissues;
[0113] (d) It can be prepared by solid-phase synthesis with high purity, high yield and low cost.
[0114] Therefore, the polypeptide of the present invention is expected to be developed into a drug for the treatment of inflammatory eye diseases and related inflammatory diseases, such as inflammatory bowel disease, skin inflammation, etc.
[0115] The present invention will be further described below with reference to specific examples. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the present invention. Experimental procedures in the following examples, where specific conditions are not specified, were generally performed under conventional conditions such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer.
[0116] Example 1
[0117] Peptide synthesis
[0118] The H-RN polypeptide of SEQ ID NO: 2 was synthesized using a commercially available SYMPHONY peptide synthesizer. The steps are as follows:
[0119] 1. Prepare the required protective amino acid solution, condensation reagent, and cutting reagent according to the software calculation, and add sufficient DMF and DCM to the corresponding bottles of the instrument.
[0120] 2. Add 100 μmol FMOC-Ala-Wang-Resin into the reactor.
[0121] 3. Place a 15mg centrifuge tube on the tube that collects the cutting fluid.
[0122] 4. Edit the program. Generally, the swelling time of the resin is 30 minutes, the deprotection time is 5 minutes and 15 minutes twice, the condensation time is 30 minutes, and the cutting program is 2 hours.
[0123] 5. Turn on the machine and synthesize according to the program.
[0124] 6. Finally, the cutting solution was precipitated with ether, centrifuged, blown dry, and purified by HPLC.
[0125] 120 mg of polypeptide H-RN was obtained as a white powder (good water solubility) with a purity of >95%. The product was sealed and stored at -20°C until use.
[0126] Example 2
[0127] Effects of H-RN on inflammatory cell infiltration in EIU model
[0128] 1. Materials and Methods
[0129] 1.1 Experimental animals and materials: Healthy male Wistar rats, 140-180 g, 8-10 weeks old, were purchased from the Animal Center of the Chinese Academy of Medical Sciences; lipopolysaccharides (LPS), derived from Escherichia coli, were purchased from SIGMA-Aldrich, USA.
[0130] 1.2 Model Establishment and Intervention Experiment: Wistar rats were randomly divided into six groups, with 9-15 rats per group, namely, LPS group, LPS + 1 μg / μl H-RN intervention group, LPS + 5 μg / μl H-RN group, LPS + 10 μg / μl H-RN group, LPS + 10 μg / μl DXM group, and a normal control group (PBS). The EIU model was induced by subcutaneous injection of 200 μg LPS (2 mg / ml, 100 μl, dissolved in sterile saline) into the right footpad of each rat. The normal control group received a subcutaneous injection of 100 μl of sterile saline into the right footpad of each rat. Each rat in the LPS group, LPS+H-RN (1, 5, 10 μg / μl) intervention group, and LPS+10 μg / μl DXM group was subcutaneously injected with 200 μg of LPS into the right footpad, and 10 μl of PBS, 10 μl of H-RN PBS solution (1, 5, and 10 μg / μl), and 10 μl of DXM PBS solution (10 μg / μl) were injected into the vitreous cavity, respectively.
[0131] 1.3 Qualitative Observation of Clinical Manifestations of EIU in Rats: Rats were observed under a biomicroscope 24 hours after LPS and drug intervention. Clinical manifestations were assessed and scored by an independent observer according to the method of Behar-Cohen et al. The severity of EIU is indicated on a scale of 0 to 4: 0: no inflammatory response; 1: mild dilation of conjunctival and iris vessels; 2: moderate dilation of conjunctival and iris vessels with anterior chamber flare; 3: severe iris congestion with severe anterior chamber flare; and 4: a score of 3: fibrinous anterior chamber exudate, posterior synechiae, miosis, and hypopyon.
[0132] 1.4 Quantification of Inflammatory Cell Infiltration in Rat Aqueous Humor: 24 hours after LPS and drug treatment, rats were sacrificed by overdose of anesthesia. Under a surgical microscope, aqueous humor (30-40 μl / eye) was collected by puncturing the anterior chamber 1 mm intraperitoneally with a No. 30 microinjector. The aqueous humor samples were diluted 1 / 2 with an equal volume of trypan blue dye, and aqueous humor cell counts were performed using a hemocytometer under a light microscope. Two independent technicians counted cells in each area (equivalent to 0.1 μl). The average of the cell counts in four areas was used to determine the number of cells per μl of aqueous humor.
[0133] 1.5 Statistical analysis: Experimental data The changes of inflammatory cell infiltration in rats of each group were compared by one-way ANOVA. P < 0.05 was considered statistically significant.
[0134] 2. Results
[0135] 2.1 Qualitative observation of clinical manifestations of EIU in rats: Rats in the normal control group showed no obvious inflammatory manifestations, and the EIU clinical score was 0.50±0.54. Rats in the LPS group showed inflammatory manifestations such as tortuosity and dilation of iris vessels, anterior chamber flare, membranous matter in the pupil area, and pupillary occlusion 24 hours after LPS injection, and the EIU clinical score was 3.56±0.51. Compared with the LPS group, the inflammatory manifestations in the H-RN (1, 5, and 10 μg / μl) intervention groups were significantly alleviated, with only mild to moderate congestion of iris vessels and no exudation. The EIU clinical scores were 2.42±0.53, 2.12±0.64, and 1.92±0.27, respectively (all P<0.01) ( Figure 1 A, 1B, 1C, 1D).
[0136] 2.2 Quantitative count of inflammatory cell infiltration in aqueous humor of rats: There was no obvious inflammatory cell infiltration in aqueous humor of rats in the normal control group; the inflammatory cell count in aqueous humor of rats in the LPS group was 164.20±142.7×10 5 cells / ml, which was significantly increased compared with the control group (P < 0.01); the inflammatory cells in the 1, 5, and 10 μg / μl H-RN intervention groups were significantly reduced compared with the LPS group, which were 49.14±40.84×10 5 , 40.40±31.34×10 5 and 37.35±21.44×10 5 cells / ml (all P<0.01) ( Figure 1 E).
[0137] 3. Summary
[0138] By establishing an endotoxin-induced uveitis model in rats, and observing and scoring clinical manifestations, and counting inflammatory cells in aqueous humor, it was confirmed that H-RN has the effect of inhibiting inflammatory cell infiltration, thereby reducing inflammatory response and alleviating clinical symptoms.
[0139] Example 3
[0140] Effects of H-RN on LPS-induced pro-inflammatory cytokines in RAW264.7 cells
[0141] 1. Materials and Methods
[0142] 1.1 Experimental cell lines and materials: Mouse peritoneal macrophage cell line RAW264.7 was purchased from the Cell Resource Center of Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences; DMEM high-glucose medium was purchased from GIBCO, USA; mouse tumor necrosis factor-α (TNF-α) and interleukin-6 (IL-6) enzyme-linked immunosorbent assay (ELISA) kits were purchased from R&D Company, USA.
[0143] 1.2 Model preparation and intervention experiment: RAW264.7 cells were cultured in high-glucose DMEM medium containing 10% fetal bovine serum (FBS), 100 U / ml penicillin and streptomycin, and placed in a 37°C, 5% CO2 incubator for expansion. Cells in the logarithmic growth phase were taken and the density was adjusted to 2.5×10 5 / ml was seeded in a 24-well plate. When the cells were well attached and grew to 80-90% fusion, the DMEM medium without 10% fetal bovine serum was replaced for serum starvation culture for 24 hours. RAW264.7 cells were randomly divided into a blank control group, an LPS group, and an LPS+H-RN group, with six replicate wells in each group. Different concentrations of H-RN (1, 10, 100 μM) and LPS (100 ng / ml) 500 μl were added to the LPS group and the LPS+H-RN group, and an equal volume of DMEM medium was added to the blank control group, and the cells were placed in a 37°C, 5% CO2 incubator for routine culture. The cell supernatant was collected after 24 hours.
[0144] 1.3 Statistical analysis: Experimental data were Statistical analysis was performed using SPSS 11.0 statistical software package. One-way ANOVA was used to compare the concentrations of TNF-α and IL-6 in the cell supernatants of each group. P < 0.05 was considered statistically significant.
[0145] 2. Results
[0146] 2.1 TNF-α concentration determination: The TNF-α concentration in the cell supernatant of the LPS group (1333.00±476.59 pg / ml) was significantly higher than that in the blank control group (561.00±25.65 pg / ml). H-RN intervention (10 and 100 μM) inhibited the expression level of TNF-α in the cell supernatant, which was 737.00±155.56 pg / ml and 718.00±79.19 pg / ml, respectively, which was statistically significant compared with LPS (P < 0.05). However, there was no statistically significant difference between the 1 μM H-RN intervention group and the LPS group (P > 0.05). Figure 2 A).
[0147] 2.2 IL-6 concentration determination: The IL-6 concentration in the cell supernatant of the LPS group (2650.00±106.07pg / ml) was significantly higher than that of the blank control group (213.00±15.56pg / ml). H-RN intervention (10 and 100μM) significantly inhibited the expression level of IL-6 in the cell supernatant, which was 1385.00±101.54pg / ml and 1355.00±134.35pg / ml, respectively, which was statistically significant compared with LPS (P < 0.01). However, there was no statistically significant difference between the 1μM H-RN intervention group and the LPS group (P > 0.05). Figure 2 B).
[0148] 3. Summary
[0149] Macrophages play an important role in the body's immune system. In this experiment, an inflammatory cell model was established by stimulating the mouse peritoneal macrophage cell line RAW264.7 with LPS. Different concentrations of H-RN peptide were used for intervention. By analyzing the concentrations of inflammatory cytokines TNF-α and IL-6 in the cell supernatant, it was confirmed that H-RN could inhibit the expression of inflammatory cytokines.
[0150] Example 4
[0151] H-RN cell safety test
[0152] 1. Experimental Methods
[0153] 1.1 Experimental cell lines and materials: Mouse peritoneal macrophage cell line RAW264.7 was purchased from the Cell Resource Center of Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences; DMEM high-glucose medium was purchased from GIBCO, USA; MTS was purchased from Promega, diluted to 300 mmol / L in PBS (pH 6.0), and stored at -20°C in the dark.
[0154] 1.2 Model preparation and intervention experiment: RAW264.7 cells were cultured in high-glucose DMEM medium containing 10% fetal bovine serum (FBS), 100 U / ml penicillin and streptomycin, and placed in a 37°C, 5% CO2 incubator for expansion. Cells in the logarithmic growth phase were taken and the density was adjusted to 1×10 5 When the cells were well attached and grew to 80-90% confluence, the culture medium was replaced with DMEM without 10% fetal bovine serum and serum starvation culture was performed for 24 hours.
[0155] 1.3 Cytotoxicity Assay (MTS Colorimetric Assay): After serum starvation for 24 hours, 100 μl of H-RN at various concentrations (0.1, 1, 10 μM, 100 μM, and 1 mM) was added to each well. Six wells were replicated for each concentration. An equal volume of DMEM medium was added to the blank control group and the cells were incubated in a 37°C, 5% CO2 incubator for 24 hours. 20 μl of MTS solution was then added to each well and the cells were incubated for another 4 hours. The absorbance of each well was measured at 490 nm using an enzyme-linked immunosorbent assay (ELISA) and the relative growth rate (RGR) was calculated. Formula: RGR = A value of the experimental group / A value of the blank control group × 100%.
[0156] 1.5 Statistical analysis: Experimental data were Statistical analysis was performed using SPSS 11.0 statistical software package. One-way ANOVA was used to compare the relative proliferation rates of cells in each group. P < 0.05 was considered statistically significant.
[0157] 2. Results: The relative cell proliferation rates of the blank, LPS and various concentration groups were 100.05±3.95%, 99.79±1.28%, 96.87±3.64%, 100.06±2.67%, 98.29±3.91%, 100.80±4.00% and 95.83±4.92%, respectively. Compared with the blank group, there was no statistically significant difference in the relative cell proliferation rates of the H-RN treatment groups (0.1, 1, 10 μM, 100 μM, 1 mM) (P>0.05). Figure 3 ).
[0158] 3. Summary: By testing the effects of different concentrations of H-RN on the relative proliferation rate of cells, it can be seen that H-RN has no obvious toxic effect on cells in the concentration range of 0.1μM-1mM. The drug concentration used in the experiment (1-100μM) is within the safe concentration range.
[0159] Example 5
[0160] Preparation of derivative peptides and testing of their inhibitory effects on inflammatory responses
[0161] The following several derivative polypeptides were prepared according to the method of Example 1, and the inhibitory effects of each H-RN derivative polypeptide (1 μM, 10 μM, 100 μM) on the inflammatory factors TNF-α and IL-6 were determined according to the method of Example 3. When the concentration of the derivative polypeptide was 10 μM, the results are shown in Table 2:
[0162] Table 2
[0163]
[0164] The results showed that the H-RN derivative peptide had a significant inhibitory effect on TNF-α and IL-6 when the concentration reached 10 μM. This shows that the polypeptide of the present invention and its derivative peptides have a good inhibitory effect on inflammatory response.
[0165] Example 6
[0166] Effects of heteropeptide molecules on H-GP on inflammatory cell infiltration in EIU model and LPS-induced pro-inflammatory cytokines in RAW264.7 cells
[0167] The sequence of H-GP heteropeptide molecule is shown in SEQ ID NO.: 9: GPERWRGPNGE
[0168] 6.1 Using the EIU model in Example 2, the effect of H-GP on inflammatory cell infiltration was tested
[0169] 6.1.1 Qualitative Observation of Clinical Manifestations of EIU in Rats:
[0170] The EIU score of the LPS+10μg / μl H-GP group was 3.32±0.61, P>0.05 compared with the LPS group.
[0171] 6.1.2 Quantitative Count of Inflammatory Cell Infiltration in Rat Aqueous Humor:
[0172] The inflammatory cell count in aqueous humor of rats in LPS+10μg / μl H-GP group was 134.66±98.23×10 5 cells / ml, compared with the LPS group, P>0.05.
[0173] 6.2 Using the method in Example 3, the effect of H-GP on LPS-induced pro-inflammatory cytokines in RAW264.7 cells was tested.
[0174] There was no statistically significant difference in the concentrations of TNF-α and IL-6 in the cell supernatant between the 100 μM H-GP group and the LPS group (p>0.05).
[0175] Therefore, the heteropeptide H-GP had no inhibitory effect on cell infiltration or pro-inflammatory cytokines.
[0176] Example 7 Preparation of Eye Drops
[0177] The eye drops were prepared by mixing the following ingredients using conventional techniques. The formula is as follows:
[0178]
[0179] The drug was tested on 3 volunteers with moderate acute uveitis for one week, with 2 drops per eye 4 times a day (or once every 2 hours).
[0180] The grading criteria for acute uveitis are as follows:
[0181] ① Mild: Ciliary congestion, KP+-++, anterior chamber inflammatory cells 0-++, anterior chamber flare 0-++. ② Moderate: Ciliary congestion, KP++-+++, anterior chamber inflammatory cells ++-+++, anterior chamber flare ++-+++. ③ Severe: Mixed congestion, KP+++-++++, anterior chamber inflammatory cells +++-++++, anterior chamber flare +++-++++, fibrinous exudate in the anterior chamber, and hypopyon.
[0182] The criteria for judging efficacy are as follows:
[0183] The main evaluation indicators were visual acuity, subjective ocular symptoms, anterior chamber inflammatory cells, and aqueous humor flare. Treatment outcomes were divided into four levels: cured, markedly effective, effective, and ineffective, and each level was scored accordingly.
[0184] Recovery: ① Visual acuity restored to above 1.0; ② Disappearance of subjective ocular symptoms; ③ Inflammatory cells in the anterior chamber (-), aqueous humor flare (-).
[0185] Markedly effective: ① Visual acuity improved by more than 4 lines; ② Subjective eye symptoms alleviated; ③ Inflammatory cells in the anterior chamber decreased, ++++→++ / +++→+, and aqueous humor flare weakened, ++++→++ / +++→+.
[0186] Effective: ① Visual acuity improved by more than 2 lines; ② Subjective eye symptoms alleviated; ③ Inflammatory cells in the anterior chamber decreased, ++++→+++ / +++→++, and aqueous humor flare weakened, ++++→+++ / +++→++.
[0187] Ineffective: ① No improvement in visual acuity; ② No improvement in subjective eye symptoms; ③ No decrease or increase in anterior chamber inflammatory cells, and no change in aqueous humor flare.
[0188] Results: After one week of treatment, two drops per eye twice daily, all three patients experienced visual acuity improvement of two lines or more. Their ocular symptoms improved, with reduced corneal posterior deposition, and fewer anterior chamber flares and cells. These results suggest that the eye drops can suppress ocular inflammation.
[0189] discuss
[0190] The polypeptide H-RN of the present invention has a significant anti-inflammatory effect, as demonstrated by: H-RN inhibiting the infiltration of inflammatory cells in a rat endotoxin-induced uveitis model; H-RN inhibiting the expression of pro-inflammatory cytokines in LPS-induced RAW264.7 cells; and H-RN having no significant cytotoxic effects within a certain concentration range (0.1 μM-1 mM). In summary, the polypeptide H-RN has broad application prospects in inhibiting inflammation.
[0191] All documents mentioned in this application are incorporated herein by reference, just as if each document were incorporated herein by reference individually. It should also be understood that after reading the above teachings of the present invention, those skilled in the art may make various changes or modifications to the present invention, and that such equivalents also fall within the scope of the claims appended hereto.
Claims
1. A use of a polypeptide or a pharmaceutically acceptable salt thereof, characterized in that: For preparing a drug for treating ocular inflammatory diseases, and the polypeptide is selected from the following group: (a) a polypeptide having the amino acid sequence shown as RNPRGEEGGPW (SEQ ID NO: 2); (b) polypeptides having amino acid sequences shown in SEQ ID NOs: 3-8 derived from the amino acid sequence shown in SEQ ID NO: 2; Wherein, the ocular inflammatory disease is selected from the group consisting of blepharitis, conjunctivitis, and scleritis.
Citation Information
Patent Citations
Micro-molecule polypeptide for preventing and / or curing inflammatory reaction and application thereof
CN103897034A
Cited By
Low molecular polypeptide for preventing and treating inflammation and use thereof
EP3040343B1