A prokaryotic gene editing method based on Cas7 and Cas3 in type I Cas system

Abstract

The present invention discloses for the first time a prokaryotic gene editing method based on Cas7 and Cas3 in the type I Cas system, including a protein expression plasmid, a gene editing plasmid and a gene editing process. In prokaryotes, the two genes can be transcribed separately or simultaneously transcribed in the same operon, so this method can conveniently, flexibly and effectively perform gene editing on the prokaryotic genome; it is expected to be effectively applied to basic biological sciences and other fields such as pharmaceuticals, food, and agriculture.

Description

[0001] The present invention relates to the field of genetic engineering in biotechnology, and more specifically to a prokaryotic gene editing method based on Cas7 and Cas3 in a type I Cas system. Background Art

[0002] CRISPR / Cas system is widely present in bacteria and archaea. It is an adaptive immune system that has evolved over a long period of time and is guided by RNA to degrade invading viruses or bacteriophage DNA (Li Jun, Zhang Yi, Chen Kunling, Shan Qiwei, Wang Yanpeng, Liang Zhen, Gao Caixia. CRISPR / Cas system: a new technology for RNA-targeted genome editing [J / OL]. Heredity, 2013, 35(11): 1265-1273). According to the Cas gene sequence and protein structure, CRISPR / Cas system can be divided into two categories and six types. Currently, only two type II (Cas9) and two type V (Cpf1) Cas systems can be used for gene editing (P. Mohanraju, KS Makarova, B. Zetsche, F. Zhang, EV Koonin, J. van der Oost, Diverse evolutionary roots and mechanistic variations of the CRISPR-Cas systems. Science 353, aad5147 (2016)).

[0003] Streptomyces virginiae IBL14 is an actinomycete isolated and screened from the sludge of a pharmaceutical factory in our laboratory. The whole genome sequencing analysis found that there are three confirmed CRISPR sequences and a provisionally named IB-svi Cas system in the strain IBL14. It has been successfully applied to IBL14 self-targeting genome editing (Tong Wangyu; Yong Dexiang; Li Xue; Qiu Caihua et al. A CRISPR-Cas system in Virginia Streptomyces IBL14 and a method for gene editing using the same. CN201511002817.3; Tong Wangyu; Li Xue; Yong Dexiang A method for constructing a recombinant penicillin-producing strain of Virginia Streptomyces IBL14. CN201510999333.4) and non-self-targeting genome editing (Tong Wangyu, Xu Xin, Zhang Yan, Sun Yan, Cao Suli (20161207) A Virginia Streptomyces IBL14type IB-sv14 type CAS gene editing system, CN201611113137.3; Tong Wangyu, Qiu Caihua, Yang Xingwang, Wang Anjing A gene editing method based on the Virginia Streptomyces IBL14 gene cas7-5-3, CN201611089333.1).

[0004] The gene editing method of prokaryotes based on cas7-5-3 has been reported in our laboratory (Tong Wangyu, Qiu Caihua, Yang Xingwang, Wang Anjing, etc., A gene editing method based on the cas7-5-3 gene of Streptomyces virginica IBL14, CN201611089333.1). Given that Cas5 may be a protein involved in crRNA processing and stabilization, it only helps Cas3 to specifically cut the target DNA (G. Gasiunas, T. Sinkunas, V. Siksnys, Molecular mechanisms of CRISPR-mediated microbial immunity. Cell Mol Life Sci 71, 449-465 (2014)). Our laboratory further found that the protein expression plasmid plasmid-cas7-3 based on cas7-3, combined with gene editing plasmid (plasmid-t / g-gene abbreviation) and / or other plasmids can also achieve non-self-targeting gene editing in other prokaryotes. Summary of the invention

[0005] The technical problem to be solved by the present invention is to provide a prokaryotic gene editing method based on Cas7 and Cas3 in a type I Cas system, and to apply a gene editing tool composed of a protein expression plasmid and / or a gene editing plasmid expressing Cas7 and Cas3 to the gene editing of prokaryotes.

[0006] To achieve this purpose, the technical solution adopted by the present invention to solve the problem is: a prokaryotic gene editing method based on Cas7 and Cas3 in the type I Cas system, characterized in that: the method includes the construction of a protein expression plasmid composed of two genes, cas7 and cas3, the construction of a gene editing plasmid, and the use of the constructed protein expression plasmid and / or gene editing plasmid to form a gene editing tool to perform gene editing on prokaryotes.

[0007] The prokaryotic gene editing method based on Cas7 and Cas3 in the type I Cas system is characterized by comprising the following steps:

[0008] (1) Construction of protein expression plasmid plasmid-cas7-3

[0009] Primers for binding to cas gene were designed according to the sequence information of the vector, and linearized cloning vector was obtained by PCR amplification; primers were designed according to the cas gene and related information sequence in Streptomyces virginiana IBL14 (Appendix 2), and the extracted genome of Streptomyces virginiana IBL14 was used as a template to obtain two genes, cas7 and cas3, with 15-25bp overlapping regions at the ends and containing overlapping regions with the vector, and cas7 and cas3 genes were connected by overlapPCR, and finally the overlapPCR product was connected to the linear plasmid by a one-step method to obtain the protein expression plasmid plasmid-cas7-3;

[0010] (2) Construction of gene editing plasmid plasmid-t / g-gene abbreviation

[0011] Primers are designed according to the DNA sequence information of the targeted gene, and the extracted prokaryotic genome is used as a template. The upstream and downstream homology arm fragments of the targeted gene with restriction endonuclease cleavage sites and overlap PCR complementary sequences at the ends are amplified by PCR reaction, and the upstream and downstream homology arm fragments are combined by overlap PCR to construct the gene editing template t-DNA. At the same time, the targeted gene fragment g-DNA containing T7 promoter and RNA terminator at the head and tail are designed and chemically synthesized according to the sequence information of the biological targeted gene, and the t-DNA and g-DNA are connected to the plasmid to obtain the gene editing plasmid plasmid-t / g-gene abbreviation;

[0012] (3) Construction and testing of gene-edited recombinants

[0013] Prepare prokaryotic cell competent cells, and transform the plasmid-cas7-3 obtained in step (1) and the plasmid-t / g-gene abbreviation obtained in step (2) into the competent cells simultaneously or separately to obtain candidate gene-edited recombinants, directly perform monoclonal PCR or extract genomic PCR on the recombinants, and further perform gene sequencing to confirm the edited target recombinants.

[0014] The prokaryotic organism refers to Escherichia coli, Bacillus subtilis or other prokaryotic microorganisms.

[0015] The gene editing described herein refers to the use of gene editing tools to knock out, insert, perform traceless point mutation, or any combination thereof, chromosomal genes.

[0016] The present invention provides a prokaryotic gene editing method based on Cas7 and Cas3 in the type I Cas system, and realizes the gene editing of other prokaryotic genomes by Cas7 and Cas3 in the CRISPR-Cas type I system for the first time. In prokaryotes, the two genes can be transcribed separately or located in the same operon and transcribed simultaneously, so the method can conveniently, flexibly and effectively perform gene editing on the prokaryotic genome; it is expected to be effectively applied to other application fields such as biological sciences, pharmaceuticals, food, and agriculture. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 The protein expression plasmid pcas-cas7-3 was constructed. Ori / origin: DNA replication initiation site; pSC101ori: replication initiation site of pSC101 plasmid; Rep101: control the number of plasmid pSC101 replication copies based on gene RepA; araC / L-arabinose regulatory protein: arabinose regulatory protein; native cas9 promoter, initiates DNA transcription; KanR / Kanamycin resistance: kanamycin resistance; T7 terminator: T7 terminator, terminates DNA transcription, lacI / lactose repressor: encodes lactose repressor protein; aBAD promoter / promoter of the L-arabinose operon of E.coli: araB promoter regulated by arabinose in E. coli; exo, bet, gam genes: Red homologous recombination consists of exo, bet, gam3 genes of λ phage, encoding Exo, Beta, Gam3 proteins respectively.

[0018] Figure 2 The results of transformant screening and verification. (A) Blue-white screening results of E. coli JM109 (DE3), black indicates the original strain, white indicates the recombinant strain; (B) External PCR electrophoresis of gene lacZ, lane M: 10037bp DNA ladder, lane 1: wild bacteria control, lane 2: lacZ gene PCR products of plasmid pcas-cas7-3 and pKC1139-lacZ-t / g-DNA transformants. DETAILED DESCRIPTION

[0019] In order to more fully understand the technical content of the present invention, the technical solution of the present invention is further introduced and illustrated in conjunction with specific embodiments below, in order to better explain the content of the present invention, and the following embodiments do not limit the protection scope of the present invention. In addition, in the examples listed, the following materials are used unless otherwise specified:

[0020] 1) Strains and plasmids

[0021] Streptomyces virginiae IBL14 / SV IBL14; Escherichia coli DH5α / EC DH5α; Escherichia coli JM109 / EC JM109; Bacillus subtilis168 / BS 168, plasmids pCas, pKC1139.

[0022] 2) Culture medium

[0023] LB liquid medium

[0024] Yeast powder 5g, peptone 10g, NaCl 10g, add appropriate amount of distilled water to dissolve, make up to 1L, adjust pH to 7.0-7.2, package and sterilize at 121℃ / 20min.

[0025] LB solid medium

[0026] Yeast powder 5g, peptone 10g, NaCl 10g, agar 20g, add appropriate amount of distilled water to dissolve, make up to 1L, adjust pH to 7.0-7.2, package and sterilize at 121℃ / 20min.

[0027] Spizizen Minimal Medium

[0028] 10×Spizzen basic salt medium 100 mL / L, 50% (w / v) glucose 10 mL / L, tryptophan mother solution (5 mg / mL) 10 mL / L, agar 1.5% w / v), sterilized at 121°C / 20 min.

[0029] GM1 medium (5 mL)

[0030] 40% glucose 100 μl, 20 mg / mL acid hydrolyzed casein 100 μl, 50 mg / mL yeast extract 100 μl, 20% (w / w) MgSO4.7H2O 5 μl, 10×Spizzen basic medium 500 μl, water 3195 μl. The above substances must be sterilized at 121°C / 20 min before mixing.

[0031] GM2 medium (5 mL)

[0032] 40% glucose 100 μl, 20 mg / mL acid hydrolyzed casein 50 μl, 20% (w / w) MgSO4.7H2O 40 μl, 10×Spizzen basic medium 500 μl, water 3310 μl. The above substances must be sterilized at 121°C / 20 min before mixing.

[0033] All reagents used were commercially available.

[0034] Example 1 Knockout of EC JM109 lacZ gene by one-step co-transformation with two plasmids

[0035] (1) Construction of protein expression plasmid pCas-cas7-3

[0036] According to the SV IBL14 whole genome sequencing information and plasmid pCas sequence information, cas7, cas3 gene specific primers cas7-F and cas3-R with plasmid pCas complementary sequences and overlap PCR upper and lower primers for connecting cas7 and cas3 genes were designed. SV IBL14 genomic DNA was extracted, and TransStartFastPfu Fly DNA Polymerase produced by Quanshijin Biotechnology Co., Ltd. was used to perform PCR amplification of cas7, cas3, and linear plasmid fragments (pCas plasmid fragments). The reaction conditions were: 95°C 5min, 95°C 20s, 63°C 30s, 72°C 1min, 30 cycles, 72°C 10min (pCas plasmid fragment amplification annealing temperature was 60°C, extension time was 5min, and the other reaction conditions were the same). The PCR product was detected by 1% agarose electrophoresis, and the kit was recovered to obtain purified cas7, cas3 genes and pCas linear plasmid fragments. The cas7 and cas3 genes were connected by overlap PCR, and the reaction conditions were: 95℃5min, 95℃20s, 63℃30s, 72℃1min, 30 cycles, 72℃10min. The product was recovered by 1% agarose electrophoresis, and the cas7-3 gene sequence amplified by overlap PCR was connected with the pCas linear plasmid fragment by one-step method to obtain the pCas-cas7-3 protein expression plasmid, see Figure 1 .

[0037] (2) Construction of gene editing plasmid pKC1139-t / g-ΔlacZ

[0038] (A) Design of primers for lacZ gene and amplification of full-length lacZ gene

[0039] According to the EC JM109 genome sequencing information, the gene lacZ specific primers lacZ-F and lacZ-R were designed. The EC JM109 genomic DNA was extracted and the lacZ gene was amplified by PCR using TransStart FastPfu Fly DNA Polymerase. The reaction conditions were: 95℃5min, 95℃20s, 52℃30s, 72℃2min, 30 cycles, 72℃10min. The PCR product was detected by 1.5% agarose electrophoresis and recovered by the kit to obtain the purified lacZ full-length gene fragment for use.

[0040] (B) Preparation of upstream and downstream homology arms

[0041] According to the complete sequence of lacZ gene, the upstream homology arm primers lacZ-UF and lacZ-UR, and the downstream homology arm primers lacZ-DF and lacZ-DR of lacZ gene were designed, and the upstream primer of the upper homology arm contained the restriction endonuclease site of BamHI, and the downstream primer of the lower homology arm contained the restriction endonuclease site of HindⅢ. Using the purified lacZ gene DNA as a template, the upstream and downstream homology arms were amplified respectively, and the reaction conditions were: 95℃5min, 95℃20s, 58℃30s, 72℃45s,, 30 cycles, 72℃10min. The PCR product was detected by 1.5% agarose electrophoresis, and the kit was recovered to obtain the purified upstream and downstream homology arm DNA fragments for use.

[0042] (C) Construction of gene editing template vector pKC1139-t-ΔlacZ

[0043] Take 0.5 μl of the purified product of the upper homology arm and the purified product of the lower homology arm, mix them as templates, and use 25 μl reaction system for overlap PCR. The reaction conditions are: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 1 min, annealing at 58°C for 1 min, and extension at 72°C for 30 s. After one cycle, add 1 μl of primers UF and DR respectively, and continue PCR. The reaction conditions are: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 20 s, annealing at 58°C for 30 s, and extension at 72°C for 45 s. Perform 30 cycles, and then add 72°C for 10 min. The amplified product was detected by 1.5% agarose gel electrophoresis and purified to obtain the gene editing template t-ΔlacZ; the obtained t-ΔlacZ was cut out of the sticky ends by BamHⅠ restriction endonuclease and HindⅢ restriction endonuclease, and then ligated to the pKC1139 plasmid by T4 ligase produced by Quanshijin Biotechnology Co., Ltd. to obtain the gene editing template vector pKC1139-t-ΔlacZ.

[0044] The sequence of t-ΔlacZ is:

[0045] The wavy lines represent protected bases.

[0046] (D) Construction of gene editing plasmid pKC1139-t / g-ΔlacZ

[0047] The targeted gene fragment g-lacZ containing the lactose operon promoter was chemically synthesized by Chuzhou General Biotechnology Co., Ltd., with BamHI and EcoRI restriction sites added at the beginning and end, respectively, and the promoter, repeat sequence (repeat), spacer sequence (spacer), repeat sequence (repeat) and terminator in the middle; the synthetic targeted gene fragment g-lacZ was cut out of the sticky ends by BamHI and EcoRI restriction endonucleases, and then ligated to the gene editing template vector pKC1139-lacZ-t-DNA by T4 ligase to obtain the gene editing plasmid pKC1139-t / g-ΔlacZ.

[0048] The sequence of the targeted gene fragment g-lacZ is:

[0049] GGATCC taatacgactcactatagggaatatt GAATTC The capital letters are restriction sites, the wavy lines are protection bases, the single underline is the promoter, the italic is the spacer, the bold is the repeat, and the double underline is the terminator.

[0050] (3) Acquisition and testing of recombinants

[0051] (A) One-step preparation of EC JM109 electroporation competent cells

[0052] In the clean bench, use a sterilized toothpick to pick up the EC JM109 monoclone on the plate and place it in 30ml LB liquid medium, and culture it overnight at 37°C and 200rpm; take 100μl of the overnight cultured bacterial solution and transfer it to new LB liquid medium, and culture it at 37°C and 200rpm for about 2h until the OD600 value of the bacterial solution is 0.5-1.0; take the above bacterial solution to a 50ml EP tube and place it in an ice bath for 10-15min; centrifuge at 5000rpm×g at 4°C for 15min, and remove the supernatant; take 35ml of sterile ice water to resuspend the cells, and then centrifuge and collect the cell precipitate according to the above method, for a total of four times; take 2ml of 10% glycerol that has been pre-cooled on ice to blow and evenly beat the bacterial precipitate, and dispense 100μl / tube to obtain the electroporation competent cells of EC JM109, and store it at -80°C for later use (this process is carried out on ice throughout the process).

[0053] (B) Co-transformation of plasmid pCas-cas7-3 and pKC1139-t / g-ΔlacZ

[0054] 10 μl of plasmid pCas-cas7-3 and pKC1139-t / g-ΔlacZ were mixed thoroughly and transferred into 80 μl ECJM109 electroporation competent medium, placed on ice for about 5 min, and electroporated according to the parameters: 2.5 kv, 2 mm, 1 electric shock, and electric shock time constant> 3 ms. 200 μl LB liquid culture medium was immediately added to the electroporation cup, and the bacteria were mixed and transferred to a 1.5 ml EP tube. The cells were cultured in a shaker at 30 ° C and 200 rpm for 45 min, and then the bacterial liquid was spread on a plate containing 5 μl isopropyl-β-D-thiogalactopyranoside (IPTG200 mg / ml), 40 μl 5-bromo-4-chloro-3-indole-β-D-galactopyranoside (X-gal The cells were cultured overnight at 30°C in LB solid medium containing apramycin and ampicillin resistance (20 mg / ml) and 20 μl arabinose (10 mM / L) to obtain candidate white monoclonal transformants. Figure 2 (A).

[0055] (C) Recombinant chromosome PCR electrophoresis and gene sequencing analysis

[0056] The white monoclonal gene was extracted as a template, and then the lacZ gene verification primers lacZ-UF / lacZ-R were used for PCR amplification reaction. The reaction conditions were: 95℃5min, 95℃20s, 58℃30s, 72℃140s, 30 cycles, 72℃10min. The PCR product was detected by 1% agarose electrophoresis ( Figure 2 (B)) and DNA sequencing analysis proved that the recombinant was correct.

[0057] The primers and their sequences involved in each step are shown in Table 1, and capital letters represent restriction sites.

[0058] Table 1 Primers and their sequences

[0059]

[0060]

[0061] Example 2 Two-step transformation with two plasmids to knock out the EC JM109 lacZ gene

[0062] (1) Construction of protein expression plasmid pCas-cas7-3

[0063] Same as step (1) of Example 1.

[0064] (2) Construction of gene editing plasmid pKC1139-t / g-ΔlacZ

[0065] Same as step (2) in Example 1.

[0066] (3) Acquisition and testing of recombinants

[0067] (A) Transformation of plasmid pCas-cas7-3

[0068] The same procedures as step (3) of Example 1 were followed, except that 8 μl of plasmid pCas-cas7-3 was transformed into 92 μl EC JM109 electroporation competent cells and transformants were confirmed by kanamycin resistance screening and plasmid PCR electrophoresis.

[0069] (B) Transformation of plasmid pKC1139-t / g-ΔlacZ

[0070] The procedure was the same as steps 3 (A) and 3 (B) of Example 1, except that 8 μl of plasmid pKC1139-t / g-ΔlacZ was transformed into 92 μl EC JM109-pCas-cas7-3 electrocompetent medium and cultured overnight at 30° C. in LB solid medium containing kanamycin and apramycin coated with 5 μl IPTG, 40 μl X-gal and 20 μl arabinose to obtain candidate transformants.

[0071] (C) Recombinant chromosome PCR electrophoresis and gene sequencing analysis

[0072] Same as step 3 (C) in Example 1.

[0073] Example 3 Single plasmid transformation to knock out EC JM109 lacZ gene

[0074] (1) Construction of protein expression plasmid pCas-cas7-3

[0075] Same as step (1) of Example 1.

[0076] (2) Protein expression and construction of a single plasmid for gene editing, pCas-cas7-3-t / g-ΔlacZ

[0077] Except that the temple-DNA-ΔlacZ::cm target gene fragment contains the Cm gene, the remaining steps are the same as step (2) in Example 1.

[0078] (3) Acquisition and testing of recombinants

[0079] (A) Preparation of EC JM109 electroporation competent cells

[0080] Same as step (3A) of Example 1.

[0081] (B) Transformation of plasmid pCas-cas7-3-t / g-ΔlacZ

[0082] Except that the resistance plate contains only kanamycin, the rest is the same as step (3B) of Example 1.

[0083] (C) Recombinant chromosome PCR electrophoresis and gene sequencing analysis

[0084] Except for the primers, the remaining steps are the same as step (3C) of Example 1.

[0085] The primers and their sequences involved in each step are shown in Table 2.

[0086] Table 2 Primers and their sequences

[0087]

[0088] Example 4 Double plasmid co-transformation to knock out BS 168 gene phoP

[0089] (1) Construction of protein expression plasmid pHT304-cas7-3

[0090] Except for replacing the plasmid with pHT304, the rest of the method is the same as step (1) of Example 1.

[0091] (2) Construction of gene editing plasmid pKC1139-t / g-ΔphoP

[0092] Except for designing and synthesizing t-ΔphoP, g-phoP and primers based on the phoP gene sequence information, the rest is the same as step (2) of Example 1.

[0093] The synthetic t-ΔphoP sequence is:

[0094] The wavy lines represent protected bases.

[0095] The synthetic g-phoP sequence is:

[0096] GGATCC taatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgt tgtgtggaattgtgagcggataacaa GAATTC The capital letters are restriction sites, the wavy lines are protection bases, the single underline is the promoter, the italic is the spacer, the bold is the repeat, and the double underline is the terminator.

[0097] (3) Acquisition and testing of recombinants

[0098] (A) Preparation of BS168 competent cells

[0099] Pick a BS168 single clone and place it in 5ml GM1 medium, culture it at 37℃, 130rpm overnight. The next day, transfer 1ml to 9ml GM1 medium, culture it at 37℃, 200rpm for 3.5h. Transfer 5ml GM1 culture solution to 45ml GM2 medium, culture it at 37℃, 130rpm for 1.5h. Centrifuge at 4℃, 4000rpm for 10min. Retain an appropriate amount of supernatant to resuspend the cells, and dispense into 2ml EP tubes to obtain BS168 competent cells for use.

[0100] (B) Co-transformation of plasmid pHT304-cas7-3 and pKC1139-phoP-t / g-DNA

[0101] 8 μl of plasmid pHT304-cas7-3 and pKC1139-t / g-ΔphoP were mixed thoroughly and added to the prepared 84 μl BS168 competent medium, incubated at 37°C for 1 hour, and cultured at 37°C, 220 rpm for 3-4 hours. 10-50 μl of bacterial solution was spread on the double-resistance LB medium containing erythromycin and apramycin resistance, and cultured in a 37°C incubator.

[0102] (C) Recombinant chromosome PCR electrophoresis and gene sequencing analysis

[0103] Except for the primers, the remaining steps are the same as step (3C) of Example 1.

[0104] The primers and their sequences involved in each step are shown in Table 3, where capital letters represent restriction sites and wavy lines represent protected bases.

[0105] Table 3 Primers and their sequences

[0106]

[0107]

[0108] Example 5 Two-step transformation of two plasmids to knock out the BS 168 gene phoP

[0109] (1) Construction of protein expression plasmid pHT304-cas7-3

[0110] The method is the same as step (1) of Example 4.

[0111] (2) Construction of gene editing plasmid pKC1139-t / g-ΔphoP

[0112] The method is the same as step (2) in Example 4.

[0113] (3) Acquisition and testing of recombinants

[0114] (A) Transformation of plasmid pHT304-cas7-3

[0115] The remaining steps were the same as step (3) of Example 4, except that 8 μl of pHT304-cas7-3 plasmid was added to the prepared 92 μl BS168 competent medium and screened by erythromycin resistance.

[0116] (B) Transformation of plasmid pKC1139-t / g-ΔphoP

[0117] The same procedures as in step (3A-B) of Example 4 were followed, except that 8 μl of pKC1139-t / g-ΔphoP plasmid was added to the prepared 92 μl BS168-pHT304-cas7-3 competent medium and candidate transformants were screened by erythromycin and apramycin.

[0118] (C) Recombinant chromosome PCR electrophoresis and gene sequencing analysis

[0119] Except for the primers, the remaining steps are the same as step (3C) of Example 4.

[0120] The above description is only used to further illustrate the technical content of the present invention by examples, so as to facilitate readers to understand more easily, but it does not mean that the implementation mode of the present invention is limited to this. Any technical extension or re-creation made according to the present invention is protected by the present invention. Sequence Listing <110> Anhui University <120> A prokaryotic gene editing method based on Cas7 and Cas3 in type I Cas system <160> 2 <170> SIPOSequenceListing 1.0 <210> 1 <211> 999 <212> DNA <213> S. virginiae IBL14 <400> 1 gtggtcgccg gtgccccgaa caacggggag ggcgaggaca acacggggcg tgtgaagaag 60 ctgagggtcg ggcggggagga gttcccgtac gtgtccgcgc aggcgttccg tcggtggttg 120 cgtgactcgc tgccggcgca ggagccgcgt tcggtggtca ctcgctcggg cagcggtgcc 180 aagcagcagg cacacaccgc gggccggccg gacctgcacc tggacgatga tctgttcggc 240 tacatggtcg cggtgaaggg gaagggggga agctaccagc gggacaccgt gctggctacc 300 gggactttag tttcagtggt gccgcagcgt ccgacgttgg acttcggcac gatgagccgg 360 gacttcccgg ctggtgagca cccggtgatt cactcgcacg agctgtacag cgcgaccctg 420 gccggcgatg ttctgctgga tctgccgcgg gctggggtct tcgagacgga cggcaacggg 480 ttgcgcgtgg cgatcagccc tgccgtcgct gaggaagcgg cgaagaacgg ggcggaggtc 540 accacgctgc ggggcagtgc ggccattcgg ttgccgctta ctgagcggca ccggcggatc 600 ggcacgctgt tgcggacgct ggcgtcggtg cgtggtgggg ccaagcaggc tctgcactac 660 ggggaccggg ccccttcatt ggtcttgttg gctcctctca agggtggcgt caatccgttc 720 acccgtgttc tgggcgcccg cgacggtaag cctgtgttcc tgagcgatgt cctgcgcgag 780 gagctcgagg cgtgggcgga tgagctggac gggccggtgc tgctgggctg ggccccgggg 840 tttctcggcg atcagcgtga gcaggtccgc cgcgagctca aggatctgat tgacgagggc 900 cgtgtcgtcc tgagccatcc tcgtgtgctg ctgacccagc tggccgaccg gatcgagcag 960 ggtgatcatg acgcgtggtt cgaggactcc gcggcgtga 999 <210> 2 <211> 2316 <212> DNA <213> S. virginiae IBL14 <400> 2 gtgggccgtc tggacgcggt ggaggacgtc ttcggcggca ggttctggcc cgtcgtggaa 60 ctcgctggcc tcacccacga cgccggcaag attcccgaag gcttccagcg gatgctggcg 120 ggatacagcc gtgcctgggg tgagcgtcac gaagtcgcct cgttgggctt cctgcccgcg 180 ctcatcggcg acccggacgt gctgttgtgg gtggcgaccg cggtcgccac ccaccatcgt 240 ccgctgaccg gccagaacgg acgcgacctg cagactctct acagcggtgt caccatcacc 300 gagctcgcgc accgtttcgg gccttttgac ccacgcgctg tccccgcctt ggaggcctgg 360 cttcgtgcga gcgccatccg ggtcggcctc cccgcggccg ctgttccaga cgacggcacg 420 ctcaccgaca ccggagtggt cgctggcgcc caccagctgc tggaggagat tttggaccgt 480 tgggcagacc gtgtgaggcc tgaggtgggc ttggccgctg tactgctgca gggggcggtc 540 accctggccg accacttgtc ctccgcccat caggctctgc ccaccgtcca gccgttgggg 600 gccgggttcc ggtcccggtt ggagaaggag ttcgctgaac gcggcaggac cctgcgtgcc 660 caccagctgg aggccgccac cgttaccgga catcttctgc tgcgcgggcc gaccggcagt 720 gggaagaccg aggctgccct gctgtgggct gccagccagg tcgaggccct gaaggcggaa 780 ggccggggcg tgccgcgtgt gtttttcact ctcccctacc tggcctccat caacgccatg 840 gcaacacggc tgggtgacac tctcggcgat ggtgaggctg tcggcgttgc ccactcccgc 900 gccgcctcct accaccttgc ccaggccatc gccccgcagg acggcgacga ggaggacgaa 960 cacggagccc cctgccgtgt tgacgcggcc gccaaggcct tgtcccgggc cgctgccacc 1020 aagctgttcc gcgagagtgt ccgcgtcgcc accccctacc agcttctgcg ggccgccctg 1080 gccgggccgg cccactccgg catcctcatc gacgccgcga actcggtgtt catcctggac 1140 gaactccacg cctacgacgc ccgcaggctc ggctacatcc tggccagtgc ccggctgtgg 1200 gaacgcctcg gtggacggat cacagtcctg tccgcgaccc tgcccagggc cctggccgac 1260 ctgttcgaga gcaccctcac cgcccccatc accttcctcg acacccccga cctcgggctg 1320 ccggcgcgcc acctcctgca cacccgaggc caccatctca ccgacccggc cacactggag 1380 gagatccgtc tgcggctgtc ccgggacgag tcggtcctgg tgatcgccaa caacgtgtcc 1440 caggccatcg ccctgtacga acagctcgca cccgacgtgt gtgaacgctt cggtcaggac 1500 gccgcgctac tgctgcactc ccggtttcga cggatggacc ggtcccggat tgagcagaag 1560 atcgccgacc ggttcgccac tgtggcacct gatgcccaga acagccgtaa gccgggcctg 1620 gtcgttgcca cgcaggtggt cgaggtcagt ctcgacgtcg acttcgatgt gctgttcact 1680 ggagcggctc cgctcgaggc cctcctgcag cgcttcggcc ggaccaaccg cgtcggggcc 1740 cgcccgccgg ccgacgtcat cgtccaccat cccgcctgga ccacacgccg ccgacagccc 1800 ggcgagtacg ccgacggcat ctacccacgg gagccggtcg agtccgcgtg gcacatcctc 1860 acccgcaatc acgggcgagt catcgacgaa gcggacgcca ccgcgtggct ggacgaggtc 1920 tacgccacgg actggggcag gcaatggcac cgcgaggtgc tggagcggcg agaaagattc 1980 gaccgtgcgt tcctgcagtt ccgctacccc ttcgaagacc gcactgacct ggccgatacc 2040 ttcgacgaac tcttcgacgg ctccgaagcc atcctcgccg aagaccagga cgcctactca 2100 gccgcactgg ccgcaccaga cggcgaccac cccggagctg gccggctcct cgcagaggaa 2160 tacctcatcc ccgttcccca ctgggccagc cccctcagcc gctacgagaa gcagctcaaa 2220 gtccgcgtca tcaacggcga ctaccacccc gaccacggcc tcatggcggt ccgggggctg 2280 ccccagcccg cctaccgcgc cggggaggtc ttgtga 2316

Claims

1. A prokaryotic gene editing method based on Cas7 and Cas3 in the type I Cas system, characterized in that: The specific steps include: (1) Construction of protein expression plasmid plasmid-cas7-3 Primers for connecting cas genes were designed based on vector-related sequence information, and linearized cloning vectors were obtained by PCR amplification; Primers were designed based on the cas7 and cas3 genes and related sequence information in Streptomyces virginica IBL14, and the extracted genome of Streptomyces virginica IBL14 was used as a template. The cas7 and cas3 genes with 15-25bp overlapping regions at the ends and containing overlapping regions with the vector were amplified by PCR reaction, and the cas7 and cas3 genes were connected by overlap PCR. Finally, the overlap PCR product was connected to the linear plasmid by a one-step method to obtain the protein expression plasmid plasmid-cas7-3; (2) Construction of gene editing plasmid plasmid-t / g-DNA Primers are designed according to the DNA sequence information of the prokaryotic target gene, and the extracted prokaryotic genome is used as a template. The upstream and downstream homology arm fragments of the target gene with restriction endonuclease cleavage sites and overlap PCR complementary sequences at the ends are amplified by PCR reaction, and the upstream and downstream homology arm fragments are connected by overlap PCR to construct the gene editing template t-DNA. At the same time, the target gene fragment g-DNA containing T7 promoter and RNA terminator at the head and tail, respectively, is designed and chemically synthesized according to the sequence information of the prokaryotic target gene, and the t-DNA and g-DNA are connected to the plasmid to obtain the gene editing plasmid plasmid-t / g-DNA; (3) Construction and testing of gene-edited recombinants Prepare prokaryotic competent cells, and transform the pIasmid-cas7-3 obtained in step (1) and the pIasmid-t / g-DNA obtained in step (2) into competent cells simultaneously or separately to obtain candidate gene-edited recombinants, directly perform monoclonal PCR or extract genomic PCR on the recombinants, and further perform gene sequencing to confirm the edited target recombinants; The prokaryotic organisms mentioned herein refer to Escherichia coli or Bacillus subtilis.

2. A prokaryotic gene editing method based on Cas7 and Cas3 in a type I Cas system according to claim 1, characterized in that: The gene editing described herein refers to the use of gene editing tools to knock out, insert, or perform traceless point mutations on chromosomal genes.

Images