Protein SSIIIa related to rice resistant starch and its encoding gene and application

Abstract

The invention relates to a protein SSIIIa related to the content of plant resistant starch, a coding gene and an application thereof. The coding gene of the protein can control the content of resistant starch in rice. SSIIIa The gene can be used as a molecular marker to assist breeding and use genetic engineering methods to cultivate new rice varieties with high resistant starch content. The present invention provides the amino acid sequence of a protein related to plant resistant starch synthesis and the nucleotide sequence of its encoding gene, and also provides an expression cassette containing the encoding gene, a recombinant expression vector, a recombinant bacterium, a transgenic cell line, and a primer pair for amplifying the encoding gene. It also provides the use of the encoding gene of the protein related to plant resistant starch synthesis in the preparation of transgenic plants related to resistant starch synthesis and related transgenic methods. The present invention provides a powerful means for improving the quality and health function of rice, and has important theoretical significance and huge application potential.

Description

Technical Field

[0001] The present invention relates to a protein function, a coding gene and an application thereof, and specifically to a protein related to rice resistant starch, a coding gene and an application thereof Background Art

[0002] Resistant starch, also known as resistant starch, is a type of starch structure that cannot be hydrolyzed by enzymes in the human small intestine, but can undergo fermentation reactions with volatile fatty acids in the human gastrointestinal colon. It is still starch, and its chemical structure is different from that of fiber, but its properties are similar to soluble fiber. This type of starch is more difficult to degrade than other starches, is digested more slowly in the body, and is absorbed and enters the blood more slowly.

[0003] The largest component in our food is carbohydrates, which are also called polysaccharides. After people eat carbohydrates, they must be digested by gastric acid and enzymes in the body and broken down into monosaccharides - glucose before they can be absorbed and enter the blood. Foods containing resistant starch are digested and absorbed slowly, so blood sugar will not rise too quickly after consumption, that is, they can regulate blood sugar levels. Therefore, they become a functional starch, which is especially suitable for diabetic patients to eat. It helps diabetic patients maintain normal blood sugar concentrations. After eating resistant starch, patients are less likely to feel hungry and have a reduced sense of hunger.

[0004] Resistant starch exists in certain natural foods, such as potatoes, bananas, rice, etc. Resistant starch is contained in them. About 20 grams of resistant starch per person per day can produce significant health functions, and the usual diet intake is less than 10 grams. More than half of the world's population relies on rice as their staple food. The resistant starch content in ordinary cooked rice is less than 3%. Through artificial mutagenesis, cultivated rice has obtained rice strains with a resistant starch content of more than 10%. If staple rice contains enough resistant starch, it is very easy to achieve daily health defense by consuming functional foods through staple foods. Therefore, the elucidation and application of the molecular genetic mechanism of rice resistant starch synthesis, and the creation and production application of high-quality resistant starch rice, have great social significance and commercial value potential. The molecular genetic mechanism for controlling the synthesis of resistant starch in the prior art is still unclear, and the coding genes for the related proteins that control the synthesis of resistant starch have seriously restricted the creation and production application of resistant starch in high-quality resistant starch rice. Summary of the invention

[0005] The present invention provides a protein related to plant resistant starch synthesis, wherein the protein related to plant resistant starch synthesis is a protein having the following amino acid sequence a) or b):

[0006] a) a protein consisting of the amino acid sequence shown in Seq ID NO: 1 in the sequence listing;

[0007] b) The amino acid sequence of Seq ID NO: 1 in the sequence list is substituted and / or deleted and / or added with one or more amino acids, and the protein derived from a) is related to the content of plant resistant starch.

[0008] The present invention also provides a gene encoding a protein related to the synthesis of plant resistant starch, wherein the gene encodes the protein related to the synthesis of plant resistant starch.

[0009] In the above scheme, it is preferred that the coding gene is the following gene a) or b) or c):

[0010] a) a DNA molecule whose nucleotide sequence is as shown in positions 1 to 14463 from the 5′ end of Seq ID NO: 2 in the sequence listing;

[0011] b) a DNA molecule that hybridizes with the nucleotide sequence described in a) under stringent conditions and encodes the protein related to plant resistant starch synthesis;

[0012] c) A gene that has more than 90% homology with the nucleotide sequence described in a) and encodes the protein related to the synthesis of plant resistant starch.

[0013] In any of the above schemes, it is preferred that the coding gene is the following gene a) or b) or c):

[0014] a) Its nucleotide sequence is the DNA molecule shown in Seq ID NO:3 in the sequence listing;

[0015] b) a DNA molecule that hybridizes with the nucleotide sequence described in a) under stringent conditions and encodes the protein related to plant resistant starch synthesis;

[0016] c) A gene that has more than 90% homology with the nucleotide sequence described in a) and encodes the protein related to the synthesis of plant resistant starch.

[0017] The present invention also provides an expression box for expressing a protein related to plant resistant starch synthesis, which contains any gene encoding the protein related to plant resistant starch synthesis described above.

[0018] Preferably in any of the above schemes, the 5' and / or 3' end of the coding gene in the expression cassette has a coding gene with at least one tag selected from poly-Arg, Poly-His, FLAG, Strep-tag II and c-myc.

[0019] Preferably in any of the above schemes, one or more of enhancing, constitutive, tissue-specific or inducible promoters are added before the transcription start nucleotide of the encoding gene in the expression cassette.

[0020] Preferably, in any of the above schemes, the promoter in the expression cassette is a cauliflower mosaic virus (CAMV) 35S promoter or an ubiquitin gene promoter (pUbi).

[0021] Preferably in any of the above schemes, the expression cassette further contains an enhancer, and the enhancer is a translation enhancer or a transcription enhancer, and the reading frame of the enhancer is the same as that of the coding sequence.

[0022] In any of the above schemes, preferably, the enhancer region is the ATG start codon or the adjacent region start codon.

[0023] In any of the above schemes, preferably, the translation initiation region of the expression cassette is derived from the transcription initiation region or the structural gene.

[0024] In any of the above schemes, preferably, the expression cassette further comprises an identification and / or screening gene, and the identification and / or screening gene comprises one or more of the following genes:

[0025] genes that produce color-changing enzymes and / or luminescent compounds;

[0026] Antibiotic marker genes that confer resistance;

[0027] Chemical resistance marker genes.

[0028] Preferably, in any of the above schemes, the gene of the enzyme and / or luminescent compound capable of producing color change is one or more of the GUS gene, the GFP gene and the luciferase gene.

[0029] Preferably, in any of the above schemes, the antibiotic-resistant marker gene is a gentamicin marker gene or a kanamycin marker gene.

[0030] Preferably, in any of the above schemes, the chemical resistance marker gene is a herbicide resistance gene.

[0031] The present invention also provides a primer pair for amplifying a gene encoding a protein related to plant resistant starch synthesis, wherein the primer pair can be used to amplify the full length or any fragment of any of the above-mentioned genes encoding proteins related to plant resistant starch synthesis.

[0032] The present invention also provides a recombinant expression vector for expressing a protein related to plant resistant starch synthesis, which contains any one of the coding genes for the above-mentioned protein related to plant resistant starch synthesis.

[0033] The present invention also provides a recombinant expression vector for expressing a protein related to plant resistant starch synthesis, comprising a gene of any of the above-mentioned expression boxes for expressing a protein related to plant resistant starch synthesis.

[0034] Preferably, in any of the above schemes, the recombinant expression vector is a recombinant expression vector obtained by inserting any of the above coding genes for proteins related to plant resistant starch synthesis into the multiple cloning sites of pCAMBIA1300.

[0035] Preferably in any of the above schemes, the recombinant expression vector is a recombinant expression vector obtained by inserting any of the above-mentioned genes encoding proteins related to plant resistant starch synthesis into the multiple cloning site of one of the vectors among pCAMBIA3301, pCAMBIA1300, pBI121, pBin19, pCAMBIA2301, pCAMBIA1301-UbiN or other derived plant expression vectors.

[0036] The present invention also provides the use of a gene encoding a protein related to plant resistant starch synthesis in the preparation of a transgenic plant related to resistant starch synthesis, wherein the transgenic plant related to resistant starch synthesis contains any of the above-mentioned genes encoding a protein related to plant resistant starch synthesis.

[0037] Preferably in any of the above embodiments, the plant is a dicotyledonous plant or a monocotyledonous plant.

[0038] Preferably in any of the above embodiments, the monocotyledonous plant is rice.

[0039] Preferably in any of the above embodiments, the plant is a highly resistant rice line b10.

[0040] The present invention provides a method for cultivating a transgenic plant containing any of the above-mentioned coding genes for proteins related to plant resistant starch synthesis, comprising the step of transferring any of the above-mentioned coding genes for proteins related to plant resistant starch synthesis into a target plant to obtain a transgenic plant.

[0041] Preferably, in any of the above schemes, any of the above coding genes for proteins related to plant resistant starch synthesis is transferred into the target plant via any of the above recombinant expression vectors.

[0042] Preferably, in any of the above schemes, the recombinant expression vector is transformed into plant cells or tissues by conventional biological methods.

[0043] Preferably, in any of the above schemes, the biological method completes the transformation by one of the following methods: Ti plasmid-mediated transformation, Ri plasmid-mediated transformation, plant virus vector-mediated transformation, direct DNA transformation, microinjection transformation, electroporation transformation or Agrobacterium-mediated transformation.

[0044] Preferably in any of the above embodiments, the plant is a dicotyledonous plant or a monocotyledonous plant.

[0045] Preferably in any of the above embodiments, the monocotyledonous plant is rice.

[0046] Preferably in any of the above embodiments, the plant is a high resistant starch rice line b10.

[0047] The present invention also provides a method for cultivating transgenic plants, comprising the step of introducing an interference vector into a target plant to obtain a transgenic plant, wherein the interference vector is a recombinant vector in which the nucleotide sequence shown in Seq ID NO:4 and the nucleotide sequence shown in Seq ID NO:5 in the sequence list are sequentially inserted into the recombinant vector.

[0048] Preferably, in any of the above schemes, the interference vector is a recombinant vector obtained by sequentially inserting the nucleotide sequence shown in Seq ID NO:4 in the sequence listing and the nucleotide sequence shown in Seq ID NO:5 in the sequence listing into the BamHI and KpnI sites and between the SpeⅠ and SacI sites of the pTCK303 vector.

[0049] Preferably in any of the above schemes, the target plant is a dicotyledonous plant or a monocotyledonous plant.

[0050] Preferably, in any of the above schemes, the target plant is rice.

[0051] Preferably, in any of the above schemes, the target plant is a conventional indica rice variety R7954.

[0052] Preferably, in any of the above schemes, the nucleotide sequences shown in Seq ID NO:4 and Seq ID NO:5 are confirmed to have no other homologous sequences in the rice genome by whole genome comparison analysis.

[0053] The present invention also provides a recombinant bacterium containing a gene encoding a protein related to plant resistant starch synthesis, wherein the recombinant bacterium contains any one of the above-mentioned genes encoding a protein related to plant resistant starch synthesis.

[0054] The present invention also provides a transgenic cell line containing a gene encoding a protein related to plant resistant starch synthesis, wherein the transgenic cell line contains any one of the above-mentioned genes encoding a protein related to plant resistant starch synthesis.

[0055] The purpose of the present invention is to provide a protein related to the synthesis of plant resistant starch and a coding gene thereof.

[0056] The protein related to resistant starch synthesis provided by the present invention is named SSIIIa (Soluble starch synthase), which is derived from rice (Oryza sativa L.) and is the protein of 1) or 2) as follows:

[0057] 1) A protein consisting of the amino acid sequence shown in Seq ID NO: 1 in the sequence listing;

[0058] 2) The amino acid sequence of Seq ID NO: 1 in the sequence list is substituted and / or deleted by one or more amino acids and / or a protein derived from 1) and related to the synthesis of resistant starch is added.

[0059] In order to facilitate the purification of RSⅠ in 1), a tag as shown in Table 1 can be connected to the amino terminal or carboxyl terminal of the protein consisting of the amino acid sequence shown in Seq NO: 1 in the sequence listing.

[0060] Table 1 Tag sequences

[0061]

[0062]

[0063] The SSIIIa in the above 2) can be synthesized artificially, or its coding gene can be synthesized first and then expressed biologically. The coding gene of SSIIIa in the above 2) can be obtained by deleting or adding one or more codons of amino acid residues from the DNA sequence shown in Seq ID NO: 2 from the 1972nd to the 12795th base at the 5′ end, and / or performing missense mutation of one or more base pairs, and / or connecting the coding sequence of the tag shown in Table 1 to its 5′ end and / or 3′ end.

[0064] The present invention also provides a gene encoding the above-mentioned protein related to plant resistant starch (named as SSIIIa gene).

[0065] In one embodiment of the present invention, the following genes encoding genes a) or b) or c) are provided:

[0066] a) a DNA molecule whose nucleotide sequence is shown in positions 1 to 14463 from the 5′ end of Seq ID NO.2 in the sequence listing;

[0067] b) a DNA molecule that hybridizes with the nucleotide sequence described in a) under stringent conditions and encodes the protein related to plant resistant starch synthesis;

[0068] c) A gene that has more than 90% homology with the nucleotide sequence described in a) and encodes the protein related to the synthesis of plant resistant starch.

[0069] The stringent conditions mentioned above may be using a solution of 0.1×SSPE (or 0.1×SSC), 0.1% SDS, hybridizing at 65° C. and washing the membrane in a DNA or RNA hybridization experiment.

[0070] In another embodiment of the present invention, the following coding genes of a) or b) or c) are provided:

[0071] a) Its nucleotide sequence is the DNA molecule shown in Seq ID NO:3 in the sequence listing;

[0072] b) a DNA molecule that hybridizes with the nucleotide sequence described in a) under stringent conditions and encodes the protein related to plant resistant starch synthesis;

[0073] c) A gene that has more than 90% homology with the nucleotide sequence described in a) and encodes the protein related to the synthesis of plant resistant starch.

[0074] Seq ID NO: 3 in the sequence listing consists of 5626 bases, and its open reading frame (ORF) is from the 1st base to the 5367th base from the 5′ end, encoding the SSIIIa protein having the amino acid sequence of Seq ID NO: 1 in the sequence listing.

[0075] The stringent conditions mentioned above may be using a solution of 0.1×SSPE (or 0.1×SSC), 0.1% SDS, hybridizing at 65° C. and washing the membrane in a DNA or RNA hybridization experiment.

[0076] The present invention provides a primer pair for amplifying the full length of the SSIIIa gene or any fragment thereof.

[0077] The present invention also provides an expression box, a recombinant vector, a transgenic cell line and a recombinant bacterium containing the coding gene of the protein related to plant resistant starch.

[0078] The existing plant expression vector can be used to construct a recombinant expression vector containing the SSIIIa gene. The plant expression vector is a binary Agrobacterium vector or a vector that can be used for plant microprojectile bombardment, including pCAMBIA3301, pCAMBIA1300, pBI121, pBin19, pCAMBIA2301, pCAMBIA1301-UbiN or one of other derived plant expression vectors.

[0079] When using the SSIIIa gene to construct a recombinant expression vector, any enhanced, constitutive, tissue-specific or inducible promoter can be added before its transcription initiation nucleotide, such as the cauliflower mosaic virus (CAMV) 35S promoter, the ubiquitin gene promoter (pUbi), etc., which can be used alone or in combination with other plant promoters; in addition, when using the gene of the present invention to construct a plant expression vector, an enhancer can also be used, including a translation enhancer or a transcription enhancer, and these enhancer regions can be ATG start codons or adjacent region start codons, etc., but must be the same as the reading frame of the coding sequence to ensure the correct translation of the entire sequence. The sources of the translation control signal and the start codon are extensive and can be natural or synthetic. The translation initiation region can come from the transcription initiation region or the structural gene.

[0080] In order to facilitate the identification and screening of transgenic plant cells or plants, the plant expression vector used can be processed, such as adding genes that express enzymes or luminescent compounds that can produce color changes in plants (GUS gene, GFP gene, luciferase gene, etc.), antibiotic resistance markers (gentamicin marker, kanamycin marker, etc.) or chemical resistance marker genes (such as herbicide resistance genes), etc.

[0081] The recombinant expression vector may specifically be a recombinant expression vector obtained by inserting the coding gene of the above-mentioned protein related to resistant starch content into the multiple cloning site of the plant expression vector pCAMBIA1300.

[0082] Another object of the present invention is to provide a method for cultivating transgenic plants.

[0083] The method for cultivating transgenic plants provided by the present invention is to introduce the above-mentioned gene SSIIIa or genomic DNA encoding the protein related to resistant starch into a high-resistant starch plant to obtain a transgenic plant; compared with the target plant, the transgenic plant has a reduced resistant starch content.

[0084] The gene SSIIIa encoding the protein related to plant resistant starch content is introduced into the target plant through the above-mentioned recombinant expression vector.

[0085] The plant expression vector carrying the plant resistant starch-related protein encoding gene SSIIIa of the present invention can be transformed into plant cells or tissues by conventional biological methods such as Ti plasmid, Ri plasmid, plant virus vector, direct DNA transformation, microinjection, electroporation, Agrobacterium-mediated, etc. The transformed plant host (target plant) is a dicotyledonous plant or a monocotyledonous plant, preferably rice, more preferably a high-resistant starch rice strain b10.

[0086] Another object of the present invention is to provide a method for cultivating transgenic plants. The method is to introduce an interference vector into a target plant to obtain a transgenic plant; the transgenic plant has an increased resistant starch content compared to the target plant; the interference vector is a recombinant vector obtained by sequentially inserting the nucleotide sequence shown in Seq ID NO:4 in the sequence list and the nucleotide sequence shown in Seq ID NO:5 in the sequence list into the BamHI and KpnI sites and the SpeI and SacI sites of the pTCK303 vector. The target plant can be a dicotyledonous plant or a monocotyledonous plant, preferably rice, and the rice is preferably R7954.

[0087] Seq ID NO: 4 is the 2325 to 2836 bp fragment of Seq ID NO: 3. Seq ID NO: 5 is the reverse complementary sequence of Seq ID NO: 4. Whole genome comparison analysis confirmed that Seq ID NO: 4 and Seq ID NO: 5 have no other homologous sequences in the rice genome.

[0088] Seq ID NO:6 is a protein derived from a protein composed of the amino acid sequence shown in Seq ID NO:1, which is related to the plant resistant starch content, and in which one or several amino acids are substituted and / or deleted and / or added. It is the second transcript of the protein sequence Nipponbare related to the synthesis of plant resistant starch.

[0089] Seq ID NO:7 is a gene that has more than 90% homology with the nucleotide sequence of the DNA molecule shown in the 1st to 14463rd positions from the 5′ end of Seq ID NO:2 in the sequence list and encodes a protein related to plant resistant starch synthesis, and is RPBio-226gDNA. The DNA molecule that hybridizes with the nucleotide sequence of the DNA molecule shown in the 1st to 14463rd positions from the 5′ end of Seq ID NO:2 in the sequence list under stringent conditions and encodes a protein related to plant resistant starch synthesis is the complementary chain of the nucleotide sequence of the DNA molecule shown in the 1st to 14463rd positions from the 5′ end of Seq ID NO:2 in the sequence list.

[0090] Seq ID NO: 8 is a gene that has more than 90% homology with the nucleotide sequence of the DNA molecule shown in Seq ID NO: 3 in the sequence table and encodes a protein related to plant resistant starch synthesis, and is the second transcript (R7954) of the protein sequence NP. The DNA molecule that hybridizes with the nucleotide sequence of the DNA molecule shown in Seq ID NO: 3 in the sequence table under stringent conditions and encodes a protein related to plant resistant starch synthesis is the complementary chain of the nucleotide sequence of Seq ID NO: 3 in the sequence table.

[0091] According to the QTL positioning results, the present invention predicts candidate genes in the nearby area and performs sequencing comparison between wild type R7954 (which is available to the public from Zhejiang University and disclosed in the document J Agric Food Chem 2006, 54 (2) 523-528. Starch Properties of Mutant Rice High in Resistant Starch) and high resistant starch material b10. The results show that in the high resistant starch material, the gene SSIIIa (LOC_Os08g09230) mutates from AG to AA at the 3' splicing site of the 5th intron, and the mutation may affect the splicing of SSIIIa gene mRNA. In-depth analysis found that after the mutation, the original 3' splicing site of the 5th intron shifted to the next nearest AG to form a new splicing site. This splicing mode causes the deletion of 4 bases, forming a frameshift mutation, which leads to premature termination of translation. The ZH11 gene is available from the National Center of Plant Gene Research Huazhong Agricultural University and is available in the RiceMutant Database (RMD) ( http: / / signal.salk.edu / cgi-bin / RiceGE?JOB=TEXT&TYPE=TDNA&QUERY=RMD_04Z11IX53 ) and Dongjin (information disclosed in T-DNA insertional mutagenesis for functional genomics in rice, The plant journal 2000 22(6):516-570) showed that the SSIIIa T-DNA insertion mutant in the T-DNA insertion mutant library significantly increased the resistant starch content. Based on the above information, the gene was determined to be a candidate gene. The candidate gene has a corresponding full-length cDNA sequence in the Rice Genome Annotation Project database. The gene that controls the resistant starch content of the endosperm has been isolated and cloned, and the function of the gene has been verified by transgenic functional complementation experiments.

[0092] Experiments have shown that the present invention has beneficial technical effects: after the gene protected by the present invention is overexpressed in rice, the resistant starch content decreases; and after the gene protected by the present invention is inactivated or the activity is reduced in rice, the resistant starch content increases, indicating that the gene can control the resistant starch content of rice endosperm. Therefore, the SSIIIa gene provides a powerful means for molecular marker-assisted breeding and the use of genetic engineering methods to cultivate rice varieties with high resistant starch content, which has important theoretical significance and huge application potential. BRIEF DESCRIPTION OF THE DRAWINGS

[0093] Figure 1 Phenotypes of rice high resistant starch line b10 and conventional indica rice variety R7954, Figure 1 A is the comparison of resistant starch content between R7954 and b10, T test, double stars represent extremely significant differences; Figure 1 B is the appearance of brown rice of R7954 and b10; Figure 1 C is a scanning electron microscopy observation of endosperm starch granules.

[0094] Figure 2 Map-based cloning of the SSIIIa gene, Figure 2 A is to use BC 2 F 2 QTL analysis and localization map were performed; the numbers below the markers represent recombinant individuals; Figure 2 B is a schematic diagram of the structure of the cloned SSIIIa gene of the present invention, the black boxes represent exons, and the horizontal line in the middle represents introns. The base changes above the boxes represent the base mutations that occurred in the b10 material. The numbers in brackets represent the positions of the changed bases, and the numbers below the black boxes represent the exon numbers. aa represents the amino acid residue. Figure 2 C is a schematic diagram of the SSIIIa cDNA mutation sequence, where aa represents the amino acid residue.

[0095] Figure 3 SSIIIa CAPS markers show the genotype and resistant starch content of individual plants carrying different SSIIIa alleles. Figure 3 A is a graphical representation of the genotypes of different SSIIIa alleles; Figure 3 B is R7954 / b10F 2 Comparison of resistant starch content in individual plants carrying different SSIIIa alleles in the segregating population, Tukey test, different letters in the figure indicate significant differences; Figure 3 C is medium flower 11 / b10F 2 Resistant starch content in individual plants carrying the ssIIIassIIIa genotype in the segregating population, Tukey test, different letters in the figure indicate significant differences.

[0096] Figure 4 The genotypes of SSIIIa T-DNA insertion mutants in Zhonghua 11 and Dongjin T-DNA insertion mutant libraries are shown in Figure 1. Figure 4 A is a diagram of the T-DNA insertion position in the SSIIIa T-DNA insertion mutant. The black boxes represent exons, and the horizontal lines in the middle represent introns. Arrows represent primer binding positions and amplification directions, and aa represents amino acid residues. Figure 4 B is a schematic diagram of the genotype analysis of the SSIIIa T-DNA insertion mutant from Zhonghua 11; Figure 4 C is a schematic diagram of the genotype analysis of the Dongjin-derived SSIIIa T-DNA insertion mutant.

[0097] Figure 5 Schematic diagram of phenotypic analysis of SSIIIa T-DNA insertion mutants. Figure 5 A Comparison of resistant starch content of SSIIIaT-DNA insertion mutants from Zhonghua 11 background, Tukey test, different letters in the figure indicate significant differences; Figure 5 B Comparison of resistant starch content of SSIIIa T-DNA insertion mutants from Dongjin background, Tukey test, different letters in the figure indicate significant differences; Figure 5 C SSIIIa T-DNA insertion mutant brown rice appearance and starch grain electron scanning image.

[0098] Figure 6 SSIIIa:gSSIIIa vector map and analysis of transgenic rice phenotypes and protein expression levels with different vectors. Figure 6 A gSSIII gene map; Figure 6 B. Detection of SSIIIa expression by RT-PCR; Figure 6 C The expression level of SSIIIa was detected by Western-blot; Figure 6 D. Resistant starch content in endosperm of transgenic seedlings. Tukey test, different letters on the graph indicate significant differences.

[0099] Figure 7 Electronic scanning images of the appearance and starch grains of genetically modified brown rice. DETAILED DESCRIPTION

[0100] The present invention will be further described below in conjunction with specific examples, but the present invention is not limited to the following examples.

[0101] In the following embodiments, unless otherwise specified, all of them are conventional methods.

[0102] The rice in the following examples was cultivated according to the following method: (1) Field cultivation of rice materials: After the rice seeds were soaked in water at room temperature for 2 days, they were moved into a 37°C culture room for germination for 48 hours, and then the white seeds were sown on the seedbed for seedling cultivation. When the rice seedlings reached the 4-leaf stage, they were transplanted into the paddy field.

[0103] Example 1. Determination of genes and their functions

[0104] The seeds of the high-resistance rice line b10 of Oryza sativa L. and the seeds of the conventional indica rice variety R7954 were cultivated according to the above-mentioned field cultivation method, and the plant morphology was as follows: Figure 6 As shown in D. Leaves were taken for DNA extraction.

[0105] Extraction of rice genomic DNA:

[0106] The genomic DNA was extracted from rice leaves using the improved CTAB method (Mou Z, He Y, Dai Y, et al. Deficiency in fatty acid synthase leads to premature cell death and dramatic alterations in plant morphology. The Plant Cell. 2000, 12, 405-418.). 20 mg of rice leaves were placed in a 2 ml PVC centrifuge tube, and a 6 mm steel ball was added. The leaves were frozen with liquid nitrogen, and then quickly taken out and placed in an oscillating grinder. The leaves were shaken at 11,000 rpm for 60 seconds, and then buffer was added to extract DNA. The obtained DNA precipitate was dissolved in 100 μl MQ H 2 In O.

[0107] Follow the steps below to clone:

[0108] 1. Preliminary localization of the SSIIIa gene.

[0109] Construction of F using b10 and conventional japonica rice variety Zhonghua 11 2 The population was separated, and 182 plants were randomly selected to analyze the genotype and resistant starch content of the plants. The resistant starch gene was initially located within the 0.8Mb interval on the short arm of chromosome 8. The population was further expanded to 412 plants, and the resistant starch gene was finally located within the 456kb interval, which contained 76 protein-coding genes. The soluble starch synthase gene SSIIIa (LOC_Os08g09230) was located within this interval. We used the starch synthase gene SSIIIa as a candidate gene for resistant starch.

[0110] 2. Identification and sequence analysis of candidate genes

[0111] The sequencing results showed that compared with the wild type R7954, there was a single base change in SSIIIa in mutant b10. SSIIIa in mutant b10 mutated from the wild type G to A at 6223 bp ( Figure 2 A). Analysis of the wild-type whole gene sequence showed that SSIIIa consists of 16 exons and 15 introns ( Figure 2 A). Compared with wild type R7954, the G in the 3′ splice site AG of SSIIIa in the fifth intron of mutant b10 was converted to A. The mutation of this splice site may affect the splicing of mRNA.

[0112] In order to determine whether the mutation of this splicing site would affect the splicing of mRNA, we extracted RNA from the young panicles of R7954 and b10 10 days after flowering, reverse transcribed them into cDNA, and sequenced them after PCR amplification. The results of cDNA sequence analysis showed that the mRNA splicing of the SSIIIa gene in the mutant b10 changed, and the original 3′ splicing site of the fifth intron moved back to the next nearest AG to form a new splicing site. This splicing method caused the deletion of 4 bases ( Figure 2 B), resulting in a frameshift mutation and premature termination of translation, forming a truncated polypeptide of 1302 amino acids (AA), while the normal polypeptide should be a polypeptide of 1788 amino acids (AA) ( Figure 2 B). Design of SSIIIa CAPs markers based on the mutation sites between wild-type R7954 and mutant b10, and identification of R7954 (SSIIIaSSIIIa) / b10 (ssIIIassIIIa), Zhonghua11 (SSIIIaSSIIIa) / b10 (ssIIIassIIIa)F 2 The genotypes of the isolated populations showed that the resistant starch content of the individual plants carrying the b10 (ssIIIassIIIa) allele at the SSIIIa locus was significantly increased. At the same time, the resistant starch content of the SSIIIa T-DNA insertion mutants from the Zhonghua 11 and Dongjin T-DNA insertion mutant libraries was significantly increased. Based on the above information, the gene was identified as a candidate gene.

[0113] Example 2: Acquisition and detection of transgenic plants

[0114] 1. Obtaining transgenic plants

[0115] 1. Construction of recombinant expression vector

[0116] 1) Gene cloning

[0117] A DNA preparatory fragment containing the SSIIIa gene was amplified from the Nipponbare BAC library using the gSSIIIa-1F / gSSIIIa-1R primer combination and the gSSIIIa-2F / gSSIIIa-2R primer combination in Table 2. The preparatory fragment was digested with SalI, recovered and ligated, and then digested with KpnI and SbfI and recovered to obtain a final genomic DNA fragment containing the full-length SSIIIa. Sequencing showed that the nucleotide sequence was as shown in Seq ID NO: 2 from the 5' end in the sequence table.

[0118] In the genomic DNA shown in Seq ID NO:2, positions 1972 to 2073 are the first exon, positions 3019 to 3082 are the second exon, positions 3169 to 6402 are the third exon, positions 6586 to 6802 are the fourth exon, positions 7336 to 7604 are the fifth exon, positions 8197 to 8374 are the sixth exon, positions 8400 to 8607 are the seventh exon, positions 9034 to 9142 are the eighth exon, and positions 105 Positions 03 to 10604 are the 9th exon, positions 10869 to 11041 are the 10th exon, positions 11165 to 11291 are the 11th exon, positions 11533 to 11717 are the 12th exon, positions 11825 to 11954 are the 13th exon, positions 12034 to 12146 are the 14th exon, positions 12312 to 12434 are the 15th exon, and positions 12663 to 12795 are the 16th exon.

[0119] The nucleotide sequence of the cDNA corresponding to the genomic DNA shown in Seq ID NO: 2 from 1972 bp to 12795 bp is shown in Seq ID NO: 3 in the sequence list. Seq ID NO: 3 consists of 5626 bases, and its open reading frame (ORF) is from the 1st to the 5367th base from the 5′ end, encoding the SSIIIa protein having the amino acid sequence of Seq ID NO: 1 in the sequence list.

[0120] Table 2 Primer sequences

[0121] Primer name Primer sequence (5'-3') gSSIIIa-1F AAAGGTACCCGCATGCTTCACCGCCGCTCGTCT gSSIIIa-1R GCTTCCTCCCGTTCTCTGATCTCGTGGA gSSIIIa-2F CTGGGTTTTTGCTGACGGGCCACCT gSSIIIa-2R AAACCTGCAGGTCACGGCTCAGATCGACGAGTAGACCCA

[0122] A KpnI restriction site was added to the 5' end of the gSSIIIa1F primer, and a SbfI restriction site was added to the 5' end of the gSSIIIa2R primer.

[0123] 2) Construction of expression vector

[0124] The final genomic DNA fragment containing the full-length SSIIIa gene obtained in step 1) was inserted between the KpnI and SbfI restriction sites of the vector pCAMBIA1300 (purchased from Cambia) to obtain the recombinant expression vector SSIIIa:gSSIIIa ( Figure 6 A), The vector was verified to be constructed correctly.

[0125] 2. Obtaining transgenic plants

[0126] The plasmid SSIIIa:gSSIIIa was transferred into the Agrobacterium tumefaciens strain EHA105 (available to the public from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences; the non-patent literature recording this material is Lin H, Wang R, Qian Q, et al. DWARF27, an iron-containing protein required for the biosynthesis of strigolactones, regulates rice tillerbud outgrowth. Plant Cell 2009, 21, 1512-1525.) by electroporation, and a recombinant Agrobacterium strain containing the recombinant plasmid SSIIIa:gSSIIIa was screened.

[0127] The mature seeds of material b10 containing the point mutation gene ssIIIa were shelled and sterilized, and inoculated into a callus induction medium. After 2 weeks of dark culture, callus tissue grew from the scutellum. The embryonic callus tissue with vigorous growth, light yellow color and relatively compactness was selected and used as the receptor for transformation.

[0128] The b10 callus tissue was infected with the recombinant Agrobacterium strain containing the recombinant plasmid SSIIIa:gSSIIIa, and after culturing in the dark at 25°C for 2 days, resistant calli and transgenic plants were selected on a selection medium containing 40 mg / L hygromycin. The hygromycin-resistant plants were hardened in a cool place and then transplanted into paddy fields. The transgenic plants obtained were T 0 Generation. Harvest T 0 The seeds of the first generation plants were cultivated according to the above field cultivation method and the SSIIIa:gSSIIIa transgenic T cells were obtained by conventional molecular detection. 1 Generation of transgenic plants.

[0129] 2. Detection of resistant starch content in transgenic plants

[0130] 1. Determination of resistant starch content in transgenic plants

[0131] T for SSIIIa:gSSIIIa 1The resistant starch content of the transgenic plants, b10 and R7954 control plants and false positive individual plants in the same line was counted, and 5 homozygous positive individual plants were counted for each material. Figure 6 ( Figure 6 The false positive single plant control has the same phenotype as the b10 control (omitted in the figure), as shown in the T 1 The resistant starch content of the transgenic plants was reduced (from 5.69% to 1.76% on average) compared with the b10 control plants and the false positive individual control plants.

[0132] 2. Detection of SSIIIa gene protein expression by Western-blot

[0133] His-SSIIIa (SSIIIa gene fragment amplification primers are shown in Table 3, and the nucleotide sequence is shown in Seq ID NO: 3 in the sequence list from 1294 to 2016 from the 5' end) was recombinantly expressed in the protein expression strain RosettaDE3 (purchased from Beijing Quanshijin Company) and then affinity purified by Ni-NTA Spin Kits (purchased from Qiagen Company) and then immunized with rabbits to prepare polyclonal antibodies. The antigen corresponds to amino acids 432-672 of Seq ID NO: 1 in the sequence list, and whole genome alignment analysis confirmed that there are no other protein homologous sequences in the rice genome. The prepared polyclonal antibodies were used after affinity purification using ProteinA / G (purchased from Thermoscientific Company) column material.

[0134] The total protein of transgenic plants and control R7954 and b10 plants was extracted using a strongly denatured protein extract (the non-patent literature that recorded this formula is Crofts N, Abe B, Aihara S, et al. Lack of starch synthase IIIa and high expression of granule-bound starch synthase I synergistically increase the apparent amylose content in rice endosperm. Plant Science 2012, 193-194, 62-69.). The total protein was diluted 40 times and then hybridized with anti-SSIIIa 1:2000 for detection. The actin gene (act11, purchased from Abmart) was used as an internal reference, and the results showed that the expression of SSIIIa protein in transgenic plants increased ( Figure 6 B).

[0135] Table 3 Primer sequences

[0136] Primer name Primer sequence (5'-3') SSIIIa antiF GAATTCGAGGTTGATTTGTTTTGGAAATGCTTCA SSIIIa antiR AAGCTTCATGTTTTGCTCAGGTAAAACCAGC

[0137] Example 3: Acquisition and detection of transgenic plants

[0138] 1. Obtaining transgenic plants

[0139] 1. Obtaining the full-length CDS

[0140] Using the cDNA library of seeds of R7954 15 days after flowering as a template, PCR amplification was performed using the primer pair SSIIIa OE-1F / SSIIIa OE-1R and the primer pair SSIIIa OE-2F / SSIIIa OE-2R in Table 4, respectively. The amplified fragments were digested with SalI, and the fragments obtained after recovery and ligation were sequenced. The sequence is shown in Seq ID NO: 3 in the sequence table.

[0141] Table 4 Primer sequences

[0142] Primer name Primer sequence (5'-3') SSIIIa OE-1F AAAGGTACCATGGAGATGGCTCTCCGGCCTCAAA SSIIIa OE-1R GCATGAAAATCTTGTCGACCATTGTTGT SSIIIa OE-2F ACAACAATGGTCGACAAGATTTTCATGC SSIIIa OE-2R AAACCTAGGCTAAATCAAGTATTCATAATTAAAACTG

[0143] A KpnI restriction site was added to the 5' end of the SSIIIa OE-1F primer, and an AvrII restriction site was added to the 5' end of the SSIIIa OE-2R primer.

[0144] 2. Construction of overexpression vector

[0145] The full-length SSIIIa CDS fragment obtained in step 1) was cloned through the intermediate vector T-Vector and then inserted into the vector pTCK303 with Ubiquitin promoter (available to the public from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, and the non-patent literature recording this material is Wang Z, Chen C, Xu Y, et al. A practical vector for efficient knockdown of gene expression in rice (Oryza sativa L.). Plant Mol. Biol. Rep. 2004, 22, 409-417.) between the KpnI and SacI restriction sites to obtain the overexpression vector pUbi:cSSIIIa. The vector construction was verified to be correct.

[0146] 3. Obtaining transgenic plants

[0147] The plasmid pUbi:cSSIIIa was transformed into the Agrobacterium tumefaciens strain EHA105 by electroporation, and the recombinant Agrobacterium strain containing the recombinant plasmid pUbi:cSSIIIa was screened.

[0148] The mature seeds of material b10 containing the point mutation gene ssIIIa were shelled and sterilized, and inoculated into a callus induction medium. After 2 weeks of dark culture, callus tissue grew from the scutellum. The embryonic callus tissue with vigorous growth, light yellow color and relatively compactness was selected and used as the receptor for transformation.

[0149] The b10 callus tissue was infected with the recombinant Agrobacterium strain containing the recombinant plasmid pUbi:cSSIIIa. After culturing in the dark at 25°C for 2 days, resistant calli and transgenic plants were selected on a selection medium containing 40 mg / L hygromycin. The hygromycin-resistant plants were hardened in the shade and then transplanted into paddy fields. The transgenic plants obtained were T 0 Generation. Harvest T 0 The seeds of the first generation plants were cultivated according to the above field cultivation method and the T cells transfected with pUbi:cSSIIIa were obtained by conventional molecular detection. 1 Generation of transgenic plants.

[0150] 2. Detection of genetically modified plants

[0151] 1. Determination of resistant starch content in transgenic plants

[0152] For the T 1 The resistant starch content of the transgenic plants, b10 and R7954 control plants and false positive individual plants in the same line was counted, and 5 homozygous positive individual plants were counted for each material. Figure 6 ( Figure 6 The false positive single plant control has the same phenotype as the b10 control (omitted in the figure), as shown in the figure, the T 1 The resistant starch content of the transgenic plants was reduced (from 5.69% to 1.56% on average) compared with the b10 control plants and the false positive individual control plants.

[0153] 2. Detection of SSIIIa gene protein expression by Western-blot

[0154] The total protein of transgenic plants and control R7954 and b10 plants was extracted using a strong denaturing protein extract. The total protein was diluted 40 times and then hybridized with anti-SSIIIa 1:2000. The actin gene (act11, purchased from Abmart) was used as an internal reference. The results showed that the expression of SSIIIa protein in transgenic plants increased ( Figure 6 B).

[0155] Example 4. Acquisition and detection of transgenic plants

[0156] 1. Obtaining transgenic plants

[0157] 1. Obtaining interference fragments

[0158] Using the cDNA library of seeds 15 days after Nipponbare flowering as a template, SSIIIa RNAiF / SSIIIa RNAiR was PCR amplified using the primers in Table 5, and the obtained products were sequenced. The nucleotide sequences of the amplified gene fragments are shown in Seq ID NO: 4 and Seq ID NO: 5 in the sequence table.

[0159] Table 5 Primer sequences

[0160]

[0161] The 5' end of the SSIIIa RNAiF primer was added with a SacI and BamHI linker, and the 5' end of the SSIIIa RNAiR primer was added with a SpeⅠ and KpnI linker.

[0162] Seq ID NO: 4 is the 2325 bp to 2836 bp fragment of Seq ID NO: 3, and Seq ID NO: 5 is the reverse complementary sequence of Seq ID NO: 4. Whole genome comparison analysis confirmed that Seq ID NO: 4 and Seq ID NO: 5 have no other homologous sequences in the rice genome.

[0163] 2. Construction of interference vector

[0164] The partial product obtained by amplification of the primer pair SSIIIa RNAiF / SSIIIa RNAiR was digested with BamHI and KpnI, and inserted into the BamHI and KpnI sites of the vector pTCK303 with the Ubiquitin promoter to obtain vector 1; the remaining amplified product was then digested with SpeI and SacI, and inserted into the SpeⅠ and SacI sites of vector 1 to obtain the recombinant expression vector SSIIIa RNAi (i.e., the interference vector SSIIIa RNAi), and the inserted fragment formed a hairpin structure after expression.

[0165] 3. Obtaining transgenic plants

[0166] The interference vector SSIIIa RNAi was transferred into the Agrobacterium tumefaciens strain EHA105 by electroporation, and the recombinant Agrobacterium strain containing the interference vector SSIIIa RNAi was screened.

[0167] The mature seeds of wild type R7954 were dehulled and sterilized, and inoculated into callus induction medium. After culturing for 2 weeks, callus tissue grew from the scutellum. The embryonic callus tissue with vigorous growth, light yellow color and relatively compactness was selected and used as the receptor for transformation.

[0168] The recombinant Agrobacterium strain containing the interference vector SSIIIa RNAi was used to infect R7954 rice callus. After culturing at 25°C in the dark for 2 days, resistant callus and transgenic plants were selected on a selection medium containing 40 mg / L hygromycin. Hygromycin-resistant plants were hardened in the shade and then transplanted into paddy fields. The transgenic plants obtained were T 0 Generation, T 0 The collected transgenic seeds were planted to obtain T cells transfected with SSIIIa RNAi. 1 Generation of transgenic plants.

[0169] 2. Detection of genetically modified plants

[0170] 1. Determination of resistant starch content in transgenic plants

[0171] T cells transfected with SSIIIa RNAi 1 The resistant starch content of the transgenic plants, b10 and R7954 control plants and false positive individual plants in the same line was counted, and 5 homozygous positive individual plants were counted for each material. Figure 6 ( Figure 6 The false positive single plant control has the same phenotype as the R7954 control (omitted in the figure), as shown in the figure, the T cells transfected with SSIIIa RNAi 1 Compared with the R7954 control plants and the false positive individual plant controls, the resistant starch content of the transgenic plants increased (from 1.74% to 5.29% on average).

[0172] 2. Detection of SSIIIa gene protein expression by Western-blot

[0173] The total protein of transgenic plants and control R7954 and b10 plants was extracted using a strong denatured protein extract. The total protein was diluted 40 times and then hybridized with anti-SSIIIa 1:2000. The actin gene (act11, purchased from Abmart) was used as an internal reference. The results showed that the expression of SSIIIa in transgenic plants was decreased ( Figure 6 B).

Claims

1. A method for cultivating a transgenic plant containing a gene encoding a protein related to plant resistant starch synthesis, comprising the step of transferring the gene encoding a protein related to plant resistant starch synthesis into a target plant to obtain a transgenic plant with reduced resistant starch content, wherein the gene encoding the protein related to plant resistant starch synthesis is: a gene encoding an amino acid sequence as shown in Seq ID NO: 1; or a DNA molecule as shown in positions 1 to 14463 from the 5' end of Seq ID NO: 2 in the sequence listing; or a DNA molecule having a nucleotide sequence as shown in Seq ID NO: 3 in the sequence listing; and the target plant is rice.

2. A method for cultivating transgenic plants, comprising the steps of introducing an interference vector into a target plant to obtain a transgenic plant with an increased resistant starch content, Features: The interference vector is obtained by sequentially inserting the nucleotide sequence shown in Seq ID NO: 4 in the sequence list and the nucleotide sequence shown in Seq ID NO: 5 in the sequence list into a recombinant vector; and the target plant is rice.

3. The method for cultivating transgenic plants according to claim 2, Features: The interference vector is a recombinant vector obtained by sequentially inserting the nucleotide sequence shown in Seq ID NO: 4 in the sequence list and the nucleotide sequence shown in Seq ID NO: 5 in the sequence list into the BamHI and KpnI sites and between the Spe I and SacI sites of the pTCK303 vector.

4. The method for cultivating transgenic plants according to claim 3, Features: The target plant is the conventional indica rice variety R7954.

5. The method for cultivating transgenic plants according to claim 2 or 3, wherein the nucleotide sequences shown in Seq ID NO: 4 and Seq ID NO: 5 are confirmed to have no other homologous sequences in the rice genome through whole genome comparison analysis.

Images