Enveloped viruses resistant to complement inactivation for the treatment of cancer

Abstract

A recombinant fusion protein is disclosed. The fusion protein comprises: (a) a CD55 peptide sequence, (b) a linker sequence located C-terminal to the CD55 sequence, (c) a transmembrane domain located C-terminal to the linker sequence, and (d) an intracellular domain located C-terminal to the transmembrane domain. The fusion protein does not contain a GPI anchor. The fusion protein can be expressed with an N-terminal secretion signal peptide that is cleaved to produce the mature protein on the surface of a cell line or enveloped virus. An oncolytic virus expressing the fusion protein is resistant to complement inactivation and is useful for treating cancer.

Description

[0001] Table of Contents

[0002] The sequence listing in file number 21003-PCT submitted electronically in C / ST.25 text file is part of the disclosure. BACKGROUND

[0003] Oncolytic viruses have been tested as cancer therapeutics by infecting and destroying tumor cells. These include Newcastle Disease Virus, Adenovirus, Sindbis virus, Vaccinia virus, and Herpes virus, among others. Newcastle Disease Virus (NDV) shows great potential in shrinking tumors in cancer patients due to its unique property of preferential replication in tumor cells and lysis of tumor cells, presumably due to the factor that most tumor cells have a defective interferon pathway (Pecora et al., 2002; Laurie et al., 2006; Lorence et al., 2007). Despite promising preliminary clinical results, a drawback of NDV as a cancer therapeutic is that once the virus enters the patient, most NDV particles will inevitably be destroyed by the patient's innate immune system, the alternative complement pathway.

[0004] The complement system is part of the innate and adaptive immune system (reviewed in Volanakis, J. E., 1998. Chapter 2. In The Human Complement System in Health and Disease. Editors: J. E. Volanakis and M. M. Frank. Marcel Dekker, Inc., New York pp 9-32). Complement plays an important role in microbial killing as well as in the transport and clearance of immune complexes. Many of the activation products of the complement system are also associated with proinflammatory or immunoregulatory functions. The complement system is composed of plasma proteins and membrane-associated proteins that are organized in three enzymatic activation cascades: the classical, the lectin, and the alternative pathways. All three pathways can lead to the formation of the terminal complement complex / membrane attack complex (TCC / MAC) and a number of biologically active products.

[0005] Human cells and organs have a family of membrane-bound complement regulatory proteins to protect them from complement-mediated lysis. These complement regulatory proteins include CD55 (decay- accelerating factor, DAF), CD46 (membrane cofactor protein, MCP), CD35 (complement receptor 1, CR1), and CD59 (membrane inhibitor of reactive lysis) (Carroll et al., 1988; Rey-Campos et al., 1988; Lublin et al., 1989; Morgan et al., 1994; Kim and Song, 2006).

[0006] CD55 is a glycosylphosphatidylinositol (GPI)-anchored protein and is attached to the cytoplasmic membrane via a glycolipid moiety (GPI anchor) at its C-terminus. GPI-anchored proteins, such as CD55, can be endocytosed and degraded, or cleaved and released from the cytoplasmic membrane (Censullo and Davitz, 1994a, 1994b; Turner, 1994). For example, GPI-anchored proteins, including CD55, can be released from the cell surface by the action of GPI-specific phospholipases C and D (Turner 1994). These enzymatic activities can control the catabolism of GPI-anchored proteins and regulate their cell surface expression (Censullo and Davitz, 1994b). SUMMARY

[0007] The present invention provides a recombinant fusion protein comprising: (a) a CD55 peptide sequence, (b) a linker sequence located at the C-terminus of the CD55 sequence, (c) a transmembrane domain located at the C-terminus of the linker sequence, and (d) an intracellular domain located at the C-terminus of the transmembrane domain, wherein the fusion protein does not contain a GPI anchor. The present invention also provides nucleic acids and expression vectors encoding the protein, cells expressing the protein, enveloped viruses incorporating the protein on the viral membrane, pharmaceutical compositions comprising the viruses of the present invention incorporating the protein, and methods of treatment and uses of the viruses.

[0008] The present invention is based, in part, on the discovery that viruses expressing the fusion protein of the present invention are resistant to inactivation by normal human serum, as evidenced by higher recovery rates compared to viruses not expressing the fusion protein. Oncolytic enveloped viruses produced by the engineered cells of the present invention incorporate a complement inhibitor in the form of a recombinant fusion protein on the viral membrane, and are better cancer therapeutics compared to the corresponding viruses lacking complement on the viral membrane, and provide better clinical outcomes for cancer patients because of its ability to survive in human serum circulation before entering the tumor. The benefits are three-fold: 1) the oncolytic viruses can be produced in cell culture systems in bioreactors; 2) fewer viral particles are needed to achieve the same therapeutic effect compared to the parental oncolytic viruses produced in chicken eggs; and 3) infusion of fewer viral particles to cancer patients can reduce side effects associated with large numbers of viral particles, such as cytokine storm or impurity-related effects.

[0009] Others (Biswas et al., 2012; Rangaswamy et al., 2016) used native, unmodified CD55, which includes a glycosylphosphatidylinositol (GPI) anchor, in their studies of the protective effects of the complement regulatory protein CD55 against Newcastle Disease Virus (NDV). In contrast, the fusion proteins of the present invention omit the GPI anchor. Without wishing to be bound by theory, it is believed that omitting the GPI anchor alters the catabolic kinetics of CD55 on the cell surface. The fusion proteins of the present invention are able to withstand inactivation conditions that are more stringent than those used by Biswas and Rangaswamy. In their inactivation assays, Biswas used 5 to 10% normal human serum, and Rangaswamy used 0.3 to 5% normal human serum. The following example uses 40% normal human serum for inactivation assays of NDV that have been incorporated with the recombinant fusion proteins. BRIEF DESCRIPTION OF DRAWINGS

[0010] Figure 1 . Mammalian cell expression construct map sequence encoding a complement inhibitory recombinant fusion protein consisting of a secretion signal peptide, four short consensus repeat sequences (SCRs) of CD55, a flexible linker, a CD8 transmembrane domain, and a truncated CD8 intracellular domain, followed by an IRES-neo selectable marker and a synthetic polyadenylation signal (polyA).

[0011] Figure 2 . Diagram showing orientation of the mature complement inhibitory fusion protein on the membrane of engineered DF1 cells or on the modified NDV membrane.

[0012] Figure 3 . Cell surface expression of the complement inhibitory recombinant fusion protein. Flow cytometry analysis for fusion protein expression with a CD55-specific antibody. The left bar graph represents naive DF1 cells as a negative control. The right bar graph represents DF1 cells stably expressing SEQ ID NO: 2 (cell clone No. 8).

[0013] Figure 4 . Cytotoxicity assay of NDV incorporating the complement inhibitory fusion protein produced by engineered DF1 cells (clone No. 8) in tumor cell lines.

[0014] Figure 5 . Amino acid sequence of the complement inhibitory recombinant fusion protein consisting of a secretion signal peptide, four short consensus repeat sequences (SCRs) of CD55, a flexible linker, a CD8 transmembrane domain, and a truncated CD8 intracellular domain. (SEQ ID NO: 2)

[0015] . Indicating a secretion signal peptide

[0016] Conventional format representing SCR of CD55

[0017] with single underline (G4S1)3 linker

[0018] Bold represents CD8 transmembrane domain

[0019] Italics represent truncated CD8 intracellular domain DETAILED DESCRIPTION

[0020] According to the fusion protein of the present application, any CD55 peptide sequence can be used for sequence (a). In one embodiment, the CD55 peptide sequence is a human CD55 peptide sequence. The CD55 peptide sequence preferably comprises the four short consensus repeat sequences (SCRs) of CD55. Any flexible linker can be used for sequence (b), such as a conventional flexible linker known in the art. In one embodiment, a G4S1 linker is used, preferably a (G4S1)3 linker. Any transmembrane domain can be used for sequence (c), such as a conventional transmembrane domain known in the art. In one embodiment, the transmembrane domain is a CD8 transmembrane domain. Any intracellular domain can be used for sequence (d), such as a conventional intracellular domain. In one embodiment, the transmembrane domain is a CD8 transmembrane domain, preferably a truncated CD8 transmembrane domain.

[0021] The fusion protein of the present application can further comprise a secretion signal peptide located N-terminal to sequence (a). According to a preferred method of the present application, the fusion protein is initially expressed with a signal peptide. The signal peptide directs the newly synthesized fusion protein to the endoplasmic reticulum (ER), where the signal peptide is cleaved off by a signal peptidase. SEQ ID NO: 2 is an exemplary fusion protein of the present application with an N-terminal signal peptide. SEQ ID NO: 3 is an exemplary fusion protein of the present application without an N-terminal signal peptide.

[0022] According to the fusion protein of the present application, one or more amino acid spacers can optionally be present between the N-terminal signal peptide and sequence (a), between sequence (a) and sequence (b), between sequence (b) and sequence (c), between sequence (c) and sequence (d), between any two of them, between any three of them, or between all four. In one embodiment of the present application, there is no spacer between the N-terminal signal peptide and sequence (a), in other words, the N-terminal signal peptide is covalently bonded to sequence (a) by a single peptide bond. In another embodiment, there is a spacer between the N-terminal signal peptide and sequence (a).

[0023] In one embodiment of the application, there is no spacer between sequence (a) and sequence (b), in other words, sequence (a) is covalently bonded to sequence (b) through a single peptide bond. In another embodiment, there is a spacer between sequence (a) and sequence (b). In one embodiment of the application, there is no spacer between sequence (b) and sequence (c), in other words, sequence (b) is covalently bonded to sequence (c) through a single peptide bond. In another embodiment, there is a spacer between sequence (b) and sequence (c). In one embodiment of the application, there is no spacer between sequence (c) and sequence (d), in other words, sequence (c) is covalently bonded to sequence (d) through a single peptide bond. In another embodiment, there is a spacer between sequence (c) and sequence (d). In principle, there is no limitation on the size of the spacer.

[0024] CD55 contains four extracellular short consensus repeats (SCR), a Ser / Thr / Pro (STP)-rich region, and a GPI anchoring domain. The fusion protein according to the present application omits the GPI anchoring domain. The STP-rich region can or can not be present. One embodiment of the coding sequence of the fusion protein of the present application further comprises a polyadenylation signal at the C-terminus of the coding sequence of the third peptide sequence. The polyadenylation signal (Poly A) can be any Poly A.

[0025] The present application provides a nucleic acid encoding the above-mentioned protein. In one embodiment, the nucleic acid is DNA. It can optionally comprise one or more introns between the coding sequence of the signal peptide and sequence (a), between sequence (a) and sequence (b), between sequence (b) and sequence (c), between sequence (c) and sequence (d), or at other locations. In one embodiment of the present application, the nucleic acid encodes a protein having the sequence of SEQ ID NO: 2 or SEQ ID NO: 3. SEQ ID NO: 1 is one example of a nucleic acid encoding a protein having the sequence of SEQ ID NO: 2. Because different nucleic acid triplets code for the same amino acid, a relationship known as the degeneracy of the genetic code, many other nucleic acid sequences encoding a protein having the sequence of SEQ ID NO: 2 are readily foreseeable and encompassed in the present application.

[0026] One embodiment of the present application is an expression vector comprising the above-mentioned nucleic acid operably linked to a control sequence, such as a promoter. The promoter driving the fusion protein can be any promoter, and is not limited to a CMV promoter. When an intron is present between the promoter and the fusion protein coding sequence, any suitable conventional intron can be used. For example, a beta-globin intron is suitable.

[0027] The present invention provides a cell line that stably expresses the fusion protein of the present invention on its cell surface. According to the present invention, any conventional cell line for protein expression can be used. In one embodiment, the cell line is a mammalian cell line. In another embodiment, the cell line is a non-mammalian cell line, for example, the DF-1 chicken embryonic fibroblast cell line.

[0028] The present invention provides an enveloped virus that incorporates the fusion protein described above on the viral membrane. According to the present invention, any enveloped virus can be used. In one embodiment, the virus is an oncolytic virus, for example, a paramyxovirus, for example, a Newcastle disease virus (NDV). In an example, a complement inhibitor in the form of a recombinant fusion protein is incorporated on the envelope of NDV particles. The recombinant fusion protein of the present invention can be used for oncolytic viruses other than NDV, resulting in oncolytic virus particles that are more resistant to host complement inactivation. The novel recombinant complement inhibitor in the form of a fusion protein can be used to modify any other mammalian cell, for example, HeLa cells, to produce oncolytic viruses. Oncolytic viruses are described in International Patent Application Publication WO 2000 / 062735, the contents of which are incorporated herein by reference. In the experiments whose results are presented below, the NDV used was PPMK107, described in WO 2000 / 062735.

[0029] The virus can be added to a pharmaceutical composition comprising the virus and a pharmaceutically acceptable carrier. The present invention provides a method of treating a neoplastic condition in a mammalian subject, comprising administering to the subject an amount of the virus described above effective to treat the neoplastic condition. For cancer treatment, the virus can be administered to the patient by any conventional route, for example, by one or more intratumoral or intravenous injections. For intratumoral administration, the dose range can be 1 x 10 7 to 5 x 10 12 pfu / tumor. For intravenous administration, the dose range can be 1 x 10 7 to 1 x 10 13 pfu / m 2 .(Pfu is an abbreviation for “plaque forming units”.)

[0030] The oncolytic virus of the present invention can also be engineered to incorporate other molecules, for example, GMCSF, to enhance the efficacy of the oncolytic virus. In addition, the oncolytic virus can be part of a combination cancer therapy with a checkpoint inhibitor, for example, an anti-PD1 or anti-PDL1 molecule. In addition, the oncolytic virus can be part of a combination cancer therapy with other chemotherapeutic agents. The chemotherapeutic agents can be, but are not limited to, camptothecin compounds, for example, irinotecan or topotecan.

[0031] All publications, patents, and patent applications mentioned in this specification are incorporated by reference in their entirety into this specification to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference herein. Any supplementary information disclosed in conjunction with any of the above-mentioned publications, patents, and patent applications is also incorporated by reference. For example, some journal articles are published with supplementary information that is often available online.

[0032] The present invention will be better understood by reference to the following examples, which illustrate but do not limit the invention described herein.

[0033] Example

[0034] Example 1

[0035] A modified version of recombinant CD55 was generated, which has the four short consensus repeats (SCRs) of CD55 located downstream of the secretion signal peptide, followed by a flexible linker (3×G4S1) and the CD8 transmembrane domain and a truncated CD8 intracellular domain ( Figure 1 ). The coding sequence was cloned into a mammalian expression construct with a CMV promoter (a synthetic intron that drives recombinant protein expression). The expression cassette also contains a drug selectivity marker: neomycin phosphotransferase located downstream of the IRES. The end of the gene expression cassette is a synthetic polyadenylation signal. SEQ ID NO: 1 is the nucleotide sequence of the mammalian cell expression construct. SEQ ID NO: 2 is the amino acid sequence of the expressed protein. When expressed on the surface of chicken embryonic fibroblasts DF1 cells or incorporated into the viral membrane, the signal peptide is cleaved to produce a mature recombinant fusion protein (SEQ ID NO: 3), whose structure / orientation allows the CD55 SCR to be located outside the cell or viral membrane. The flexible linker adjacent to the cell or viral membrane should provide maximum flexibility for the CD55 SCR to perform its biological function, i.e., to inactivate the C3 convertase, a central regulator of the complement pathway. The flexible linker is followed by the CD8 transmembrane domain and a truncated CD8 intracellular domain.

[0036] Example 2

[0037] Mammalian expression constructs were transfected into chicken embryonic fibroblast DF1 cells by PEI 25K (polyethyleneimine, linear 25 kDa, Polysciences, catalog number 23966). 72 hours after transfection, the cells were cultured in the presence of 300 μg / mL G418 ( Transfected cells were selected in the presence of G418 (Geneticin, a neomycin analogue, an aminoglycoside antibiotic) to generate a stable cell line constitutively expressing SEQ ID NO: 2. This stable cell line constitutively expresses SEQ ID NO: 3 on its cell surface as detected with a monoclonal antibody specific for mature human CD55 (R&D Systems, Cat. No. MAB20091). As shown in Figure 2, the recombinant fusion protein is expressed on DF1 cells stably transfected with a construct encoding the recombinant fusion protein as analyzed by flow cytometry (right-hand histogram). The original DF1 cells serve as a negative control (left-hand histogram). Figure 3 Figure 3 Figure 3

[0038] Example 3

[0039] ​​​A stable cell line expressing SEQ ID NO: 3 on the cell surface was infected with wild type NDV produced from chicken embryonated eggs. Virus was then titrated on human tumor cell line HT1080. Equal amounts of virus (measured by PFU) were incubated with 40% normal human serum (NHS) and 40% heat inactivated normal human serum (iNHS), respectively. Virus that survived after incubation with human serum was then scored by plaque assay on HT1080 cells. The ratio of virus recovered after incubation with NHS and with iNHS was calculated. As shown in Table 1, the recovery of virus produced from chicken embryonated eggs was 0.5%, indicating that the vast majority of NDV particles produced from chicken eggs were inactivated, most likely by the human alternative complement pathway. Likewise, the recovery of virus produced from parental chicken embryonic fibroblast DF1 cells was 0.5%. Surprisingly, the recovery of virus produced from bulk non-clonal DF1 cells stably expressing SEQ ID NO: 3 on the cell surface was 5.8%, more than 10-fold higher than wild type virus. When 11 clonal populations of DF1 cells expressing SEQ ID NO: 3 were examined, the recovery was between 0.8% and 20%, with 5 clones scoring lower than the bulk non-clonal cell line and 6 clones scoring higher than the bulk non-clonal cell line (Table 1). Virus produced from clone #8 had a recovery of 10%, 20-fold higher than virus produced from chicken embryonated eggs or parental DF1 cells. Virus produced from clone #40 had a recovery of 20%, 40-fold higher than virus produced from chicken embryonated eggs or parental DF1 cells. These data strongly suggest that complement activity present in normal human serum rapidly destroys NDV particles produced from chicken embryonated eggs or parental chicken embryonic fibroblast DF1 cells. However, under the same experimental conditions, new NDV particles produced from DF-1 cells stably expressing recombinant complement inhibitors on the cell surface showed a significantly highest 40-fold recovery compared to virus produced from chicken embryonated eggs or parental DF1 cells after incubation with 40% normal human serum.

[0040] Table 1. Virus recovery measured as the ratio of virus recovered after incubation with 40% normal human serum (NHS) and after incubation with 40% heat inactivated human serum (iNHS)

[0041]

[0042]

[0043] Example 4

[0044] Using AQueous single solution was used to evaluate the broad-spectrum oncolytic activity of NDV produced by DF1 cells (clone 8) stably expressing complement inhibitory fusion proteins on their cell surface. The solution functions similarly to MTT (i.e., 3-(4,5- dimethylthiazole -2-yl)-2,5-di phenyl The assay uses a tetrazolium bromide (TBB) assay in which metabolically active cells are able to bioreduced the MTS tetrazolium (i.e., 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) in the reagent to a soluble chromogenic formazan. (chromogenic formazan). Briefly, three different tumor cell lines, HT1080 (fibrosarcoma), PANC-1 (pancreatic epithelial carcinoma), and OV-CAR3 (ovarian adenocarcinoma), were grown in separate 96-well plates. The next day, serial dilutions of NDV virus were added to each well, and the plates were incubated in a 37°C incubator with 5% CO2 for 6 days. On day 6, the absorbance of all wells on each plate was measured at 490 nm using a spectrophotometer. For each cell line, IC was calculated using a 4-parameter logistic nonlinear regression analysis. 50 This resulted in the final IC for HT1080, OV-CAR-3, and PANC-1 cell lines. 50 The values ​​were 255, 120 and 47 pfu / well ( Figure 4 ). These results indicate that NDV particles produced by DF-1 cells stably expressing a recombinant complement inhibitor on their cell surface retain the ability to lyse various tumor cell lines in a dose-dependent manner.

[0045] References

[0046] Carroll, MC, EMAlicot, PJ Katzman, LB Klickstein, JA Smith, and DTFearon. 1988. Organization of the genes encoding complement receptors type1 and 2, decay-accelerating factor, and C4-binding protein in the RCA locus on human chromosome 1. J. Exp. Med. 167:1271.

[0047] Rey-Campos, J., P. Rubinstein, and S. Rodriguez de Cordoba. 1988. A physical map of the human regulator of complement activation gene cluster linking the complement genes CRl, CR2, DAF, and C4BP. J. Exp. Med. 167:664.

[0048] Lublin, D. M., and J. P. Atkinson. 1989. Decay-accelerating factor: biochemistry, molecular biology, and function. Annu. Rev. Immunol. 7:35.5.

[0049] Nakano, Y., K. Sumida, N. Kikuta, N. H. Miura, T. Tobe, and M. Tomita. 1992. Complete determination of disulfide bonds localized within the short consensus repeat units of decay accelerating factor (CD55 antigen). Biochim. Biophys. Acta 1116:235.

[0050] Censullo, P., and M. A. Davitz. 1994a. How GPI-anchored proteins turnover: or where do they go after arrival at the plasma membrane. Semin Immunol. 6:81.

[0051] Censullo, P., and M. A. Davitz. 1994b. The fate of GPI-anchored molecules. Braz J. Med. Biol. Res. 27:289

[0052] Morgan, B. P., and S. Meri. 1994. Membrane proteins that protect against complement lysis. Springer Semin. Immunopathol. 15:369.

[0053] Turner A. J. 1994. PIG-tailed membrane proteins. Essays Biochem. 28: 113.

[0054] Kim D. D., and W. C. Song. 2006. Membrane complement regulatory proteins. Clin. Immunol. 118: 127.

[0055] Pecora, A. L., Rizvi, N., Cohen, G. I., Meropol, N. J., Sterman, D., Marshall, J. L., Goldberg, S., Gross, P., O'Neil, J. D., Groene, W. S., Roberts, M. S., Rabin, H., Bamat, M. K., and R. M. Lorence. 2002. Phase I trial of intravenous administration of PV701, an oncolytic virus, in patients with advanced solid cancers. J. Clin. Oncol. 20:2251.

[0056] Laurie, S. A., Bell, J. C, Atkins, H. L, Roach, J., Bamat, M. K., O’Neil, J. D., Roberts, M. S., Groene, W. S., and R. M. Lorence. 2006. A phase 1 clinical study of intravenous administration of PV701, an oncolytic virus, using two-step desensitization. Clin. Cancer Res. 12:2555. Lorence, R. M., Roberts, M. S., O’Neil, J. D., Groene, W. S., Miller, J. A., Mueller, S. N., and M. K. Bamat. 2007. Phase 1 clinical experience using intravenous administration of PV701, an oncolytic Newcastle disease virus. 7:157.

[0057] Biswas, M., Johnson, J. B., Kumar, S. R. P. Parks, G. D., and E. Subbiah. 2012. Incorporation of host complement regulatory proteins into Newcastle disease virus enhances complement evasion. J. Virol. 86:12708.

[0058] Rangaswamy, U. S., Cotter, C. R., Chang, X., Jin, H., and Z. Chen. 2016. CD55 is a key complement regulatory protein that counteracts complement-mediated inactivation of Newcastle disease virus. J. Gen. Virol. 97:1765. SEQUENCE LISTING <110> PHARMACEUTICAL FIVE CO., LTD. <120> Enveloped viruses resistant to complement inactivation for the treatment of cancer <130> 21003-PCT <150> US 62 / 504,120 <151> 2017‑05‑10 <160> 3 <170> PatentIn version 3.5 <210> 1 <211> 6606 <212> DNA <213> Artificial Sequence <220> <223> Mammalian cell expression construct <220> <221> misc_feature <222> (1064)..(1165) <223> Code for secretory signal peptide <220> <221> misc_feature <222> (1166)..(2119) <223> Code for SCR of CD55 <220> <221> misc_feature <222> (2120)..(2164) <223> Code for (G4S1)3 linker <220> <221> misc_feature <222> (2165)..(2227) <223> Code for CD8 transmembrane domain <220> <221> misc_feature <222> (2228)..(2260) <223> Code for truncated CD8 intracellular domain <400> 1 tcaatattgg ccattagcca tattattcat tggttatata gcataaatca atattggcta 60 ttggccattg catacgttgt atctatatca taatatgtac atttatattg gctcatgtcc 120 aatatgaccg ccatgttggc attgattatt gactagttat taatagtaat caattacggg 180 gtcattagtt catagcccat atatggagtt ccgcgttaca taacttacgg taaatggccc 240 gcctggctga ccgcccaacg acccccgccc attgacgtca ataatgacgt atgttcccat 300 agtaacgcca atagggactt tccattgacg tcaatgggtg gagtatttac ggtaaactgc 360 ccacttggca gtacatcaag tgtatcatat gccaagtccg ccccctattg acgtcaatga 420 cggtaaatgg cccgcctggc attatgccca gtacatgacc ttacgggact ttcctacttg 480 gcagtacatc tacgtattag tcatcgctat taccatggtg atgcggtttt ggcagtacac 540 caatgggcgt ggatagcggt ttgactcacg gggatttcca agtctccacc ccattgacgt 600 caatgggagt ttgttttggc accaaaatca acgggacttt ccaaaatgtc gtaataaccc 660 cgccccgttg acgcaaatgg gcggtaggcg tgtacggtgg gaggtctata taagcagagc 720 tcgtttagtg aaccgtcaga tcactagaag ctttattgcg gtagtttatc acagttaaat 780 TGCTAACGCAGTCAGTGCTTCTGACACAACAGTCTCGAACTTAAGCTGCAGAAGTTGGTC 840 GTGAGGCAC TGGGCAGGTAAGTATCAAGGTTACAAGACAGGTTTAAGGA GACCAATAGAA 900 ACTGGGCTTGT CGAGACAGAGAAGACTCTT GC GTTTCTGAT AGGCACCTAT TG GTCTTAC 960 TGACATCCACTTTGCCTTTCTCTCCACAGGTGTCCACTCCCAGTTCAATTACAGCTCTTA 1020 AGGCTAGAGTACTTAATACGACTC ACTATAGGCTAGCGCCACCATGACAGTGGCCAGACC 1080 TTCTGTGCCTGCCGCCCTGCCTCTGCTGGGAGA ACTGCCTAGACTGCTGCTGCTGGTGCT 1140 GCTGTGTCTGCCTGCCGTGTGGGGCGATTGTGGCCTGCCTCCCCATGTGCCTAATGCCCA 1200 GCCTGCCCTGGAAGGCAGAAC CAGCTTCCC CGAGGACACC GTGATCACCTACAAGTGC GA 1260 GGAATCCTTCGTGAAGATCCCCGGCGAGAAGGATAGCGTGATCTGCCTGAAGGGCAGCCA 1320 GTGGAGCGACATCGAAGAGTTCTGCAACAGATCCTGCGAGGTGCCCACC C GGCTGAA TAG 1380 C GCCTCTCTGAAGCAGCCCT ACATCACCCAGA ACTACTTCCCTGTGGGCA CC GTGGTGGA 1440 ATACGAGTGCAGACCCGGCTACAGAAGAGAGCCCTCCCTGAGCCCTAAGCTGACCTGCCT 1500 gcagaacctg aagtggtcca ccgccgtgga gttctgtaaa aagaagtcct gccccaaccc 1560 tggcgagatc cggaacggcc agattgatgt gcctggcggc atcctgttcg gcgccacaat 1620 cagcttcagc tgcaacaccg gctacaagct gttcggcagc acctccagct tttgcctgat 1680 cagcggcagc agcgtgcagt ggagtgaccc tctgcctgag tgcagagaga tctactgccc 1740 tgccccccct cagatcgaca acggcatcat tcagggcgag cgggaccact acggctacag 1800 gcagagcgtg acctacgcct gcaacaaggg cttcaccatg atcggcgagc acagcatcta 1860 ctgcaccgtg aacaacgacg agggcgagtg gagcggccca ccccctgagt gtagaggcaa 1920 gagcctgacc agcaaggtgc cccccaccgt gcagaaaccc accaccgtga atgtgcctac 1980 caccgaggtg tccccaacca gccagaaaac aaccaccaag accaccaccc ccaacgccca 2040 ggccaccaga tctacccctg tgtccaggac caccaagcac ttccacgaga caacccctaa 2100 caagggcagc ggcacaaccg gtggcggagg atctggcggc ggaggaagcg gagggggagg 2160 atccatctat atctgggccc ctctggccgg cacctgtggc gtgctgctgc tgtctctcgt 2220 GATCACCCTG TACTGCAACC ACCGGAACCG GC GGAGAGTGT GATGAGAAT TC ACGC GTGG 2280 TACCCCTAGA GTCGACCCTC TAGGGCGGCC AATTCCGC CCCTCTCCCT CCCCCCCCTA 2340 ACGTA CTGGCCGAAGCCGCTTGGAATAAGGCCGGTGTGCGTTTGTCTATATGTTATTTT 2400 CCACCATATT GCCGTCTTTT GGCAATGTGA GGGCCC GGAAACCTGGCCCT GTCTTCTTGA 2460 CGAGCATTCC TAGGGGTCTT TCCCCTCTCG CCAAAGGAAT GCAAGGTCTG TTGAATGTCG 2520 TGAAGGAAGC AGTT CCTCTGGAAGCTTCTT GAAGACAAACAACGTCTG TAGCGAC CCTTT 2580 GCAGGCAGCG GAACCCCCCA CCTGGCGACA GGTGCCTCTG CGGCCAAAAG CCACGTGTAT 2640 AAGATACACC TGCAAAGGCG GCACAACCCC AGTGCCACGT GTGTAGTTGG ATAGTTGTGG 2700 AAAGAGTCAA ATGGCTCTCC TCAAGCGTAT TCAACAAGGG GCTGAAGGAT GCCCAGAAGG 2760 TACCCCATTG TATGGGATCT GATCTGGGGC CTCG GTGCACATGCTTTACATGTGTTTAGT 2820 CGAGGT TAAA AAAACGTCTAGCCCCCGAACCACGGGACGTGGTTTTCCTTTGAAAAA 2880 CACGATGATA AGCTTGCCAC AACCCGGGAT AATT CCTG CAGCCCATATGGGATCGGCCAT 2940 tgaacaagat ggattgcacg caggttctcc ggccgcttgg gtggagaggc tattcggcta 3060. tgactgggca caacagacaa tcggctgctc tgatgccgcc gtgttccggc tgtcagcgca ggggcgcccg gttctttttg tcaagaccga cctgtccggt gccctgaatg aactgcagga 3120 cgaggcagcg cggctatcgt ggctggccac gacggcgtt ccttgcgcag ctgtgctcga cgttgtcact gagcggga gggactggct gctattgggc gagtgccgg ggcaggatct 3240 cctgtcatct caccttgctc ctgccgagaa agtatccatc atggctgatg caatgcggcg gctgcatacg cttgatccgg ctacctgccc attcgaccac caagcgaaac atcgcatcga gcgagcacgt actcggatgg aagccggtct tgtcgatcag gatgatctgg acgaagagca 3420 tcaggggctc gcgccagccg aactgttcgc caggctcaag gcgcgcatgc ccgacggcga 3480 tgatctcgtc gtgacccatg gcgatgcctg cttgccgat atcatggtgg aaaatggccg 3540 cttttctgga ttcatcgact gtggccggct gggtgtggcg gaccgctatc aggacatagc 3600. gttggctacc cgtgatattg ctgaagagct tggcggcgaa tgggctgacc gcttcctcgt 3660 gctttacggt atcgccgctc ccgattcgca gcgcatcgcc ttctatcgcc ttcttgacga 3720 gttcttctga ggggatcaat tctgggcggc ctcgagaata aacaatcatt attttcattg 3780 gatctgtgtg ttggtttttt gtgtgggctt gggggagggg gaggccagaa tgactccaag 3840 agctacagga aggcaggtca gagaccccac tggacaaaca gtggctggac tctgcaccat 3900 aacacacaat caacagggga gtgagctgga tcgagctgct cgagatccgg gctggcgtaa 3960 tagcgaagag gcccgcaccg atcgcccttc ccaacagttg cgcagcctga atggcgaatg 4020 gacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg tggttacgcg cagcgtgacc 4080 gctacactlg ccagcgccct agcgcccgct cctttcgctt tcttcccttc ctttctcgcc 4140 acgttcgccg gctttccccg tcaagctcta aatcgggggc tccctttagg gttccgattt 4200 agtgctttac ggcacctcga ccccaaaaaa cttgattagg gtgatggttc acgtagtggg 4260 ccatcgccct gatagacggt ttttcgccct ttgacgttgg agtccacgtt ctttaatagt 4320 ggactcttgt tccaaactgg aacaacactc aaccctatct cggtctattc ttttgattta 4380 taagggattt tgccgatttc ggcctattgg ttaaaaaatg agctgattta acaaaaattt 4440 aacgcgaatt ttaacaaaat attaacgctt acaatttcct gatgcggtat tttctcctta 4500 cgcatctgtg cggtatttca caccgcatat ggtgcactct cagtacaatc tgctctgatg 4560 ccgcatagtt aagccagccc cgacacccgc caacacccgc tgacgcgccc tgacgggctt 4620 gtctgctccc ggcatccgct tacagacaag ctgtgaccgt ctccgggagc tgcatgtgtc 4680 agaggttttc accgtcatca ccgaaacgcg cgagacgaaa gggcctcgtg atacgcctat 4740 ttttataggt taatgtcatg ataataatgg tttcttagac gtcaggtggc acttttcggg 4800 gaaatgtgcg cggaacccct atttgtttat ttttctaaat acattcaaat atgtatccgc 4860 tcatgagaca ataaccctga taaatgcttc aataatattg aaaaaggaag agtatgagta 4920 ttcaacattt ccgtgtcgcc cttattccct tttttgcggc attttgcctt cctgtttttg 4980 ctcacccaga aacgctggtg aaagtaaaag atgctgaaga tcagttgggt gcacgagtgg 5040 gttacatcga actggatctc aacagcggta agatccttga gagttttcgc cccgaagaac 5100 tttctcctca tcctttctcc tctcctcctt tctcctcctt tctcctcctt tctcctcctt 60 tttctcctca tcctttctcc tctcctcctt tctcctcctt tctcctcctt 60 tttctcctca tcctttctcc tctcctcctt tctcctcctt tctcctcctt 60 tttctcctca tcctttctcc tctcctcctt tctcctcctt tctcctcctt 60 tttctcctca tcctttctcc tctcctcctt tctcctcctt tctcctcctt 60 tttctcctca tcctttctcc tctcctcctt tctcctcctt tctcctcctt 60 tttctcctca tcctttctcc tctcctcctt tctcctcctt tctcctcctt 60 tttctcctca tcctttctcc tctcctcctt tctcctcctt tctcctcctt 60 tttctcctca tcctttctcc tctcctcctt tctcctcctt tctcctcctt 60 tttctcctca tcctttctcc tctcctcctt tctcctcctt tctcctcctt 60 tttctcctca tcctttctcc tctcctcctt tctcctcctt tctcctcctt 60 tttctcctca tcctttctcc tctcctcctt tctcctcctt tctcctcctt 60 ttcattttta atttaaaagg atctaggtga agatcctttt tgataatctc atgaccaaaa 5880 tcccttaacg tgagttttcg ttccactgag cgtcagaccc cgtagaaaag atcaaaggat 5940 cttcttgaga tccttttttt ctgcgcgtaa tctgctgctt gcaaacaaaa aaaccaccgc 6000 taccagcggt ggtttgtttg ccggatcaag agctaccaac tctttttccg aaggtaactg 6060 gcttcagcag agcgcagata ccaaatactg ttcttctagt gtagccgtag ttaggccacc 6120 acttcaagaa ctctgtagca ccgcctacat acctcgctct gctaatcctg ttaccagtgg 6180 ctgctgccag tggcgataag tcgtgtctla ccgggttgga ctcaagacga tagttaccgg 6240 ataaggcgca gcggtcgggc tgaacggggg gttcgtgcac acagcccagc ttggagcgaa 6300 cgacctacac cgaactgaga tacctacagc gtgagctatg agaaagcgcc acgcttcccg 6360 aagggagaaa ggcggacagg tatccggtaa gcggcagggt cggaacagga gagcgcacga 6420 gggagcttcc agggggaaac gcctggtatc tttatagtcc tgtcgggttt cgccacctct 6480 gacttgagcg tcgatttttg tgatgctcgt caggggggcg gagcctatgg aaaaacgcca 6540 GCAACGC GGC CTTTTTACGG TTCCTGGCCT TTTGCTGGCC TTTTGCTCAC ATGGCTCGAC 6600 AGATCT 6606 <210> 2 <211> 399 <212> PRT <213> Artificial Sequence <220> <223> Fusion Protein <220> <221> SIGNAL <222> (1)..(34) <223> Secretion Signal Peptide <220> <221> PEPTIDE <222> (35)..(352) <223> SCR of CD55 <220> <221> MISC_FEATURE <222> (353)..(367) <223> (G4S1)3 linker <220> <221> TRANSMEMBRANE <222> (368)..(388) <223> CD8 Transmembrane Domain <220> <221> DOMAIN <222> (389)..(399) <223> Truncated CD8 Intracellular Domain <400> 2 Met Thr Val Ala Arg Pro Ser Val Pro Ala Ala Leu Pro Leu Leu Gly 1 5 10 15 Glu Leu Pro Arg Leu Leu Leu Leu Val Leu Leu Cys Leu Pro Ala Val 20 25 30 Trp Gly Asp Cys Gly Leu Pro Pro Asp Val Pro Asn Ala Gin Pro Ala 35 40 45 Leu Glu Gly Arg Thr Ser Phe Pro Glu Asp Thr Val He Thr Tyr Lys 50 55 60 Cys Glu Glu Ser Phe Val Lys He Pro Gly Glu Lys Asp Ser Val He 65 70 75 80 Cys Leu Lys Gly Ser Gin Trp Ser Asp He Glu Glu Phe Cys Asn Arg 85 90 95 Ser Cys Glu Val Pro Thr Arg Leu Asn Ser Ala Ser Leu Lys Gin Pro 100 105 110 Tyr He Thr Gin Asn Tyr Phe Pro Val Gly Thr Val Val Glu Tyr Glu 115 120 125 Cys Arg Pro Gly Tyr Arg Arg Glu Pro Ser Leu Ser Pro Lys Leu Thr 130 135 140 Cys Leu Gin Asn Leu Lys Trp Ser Thr Ala Val Glu Phe Cys Lys Lys 145 150 155 160 Lys Ser Cys Pro Asn Pro Gly Glu He Arg Asn Gly Gin He Asp Val 165 170 175 Pro Gly Gly He Leu Phe Gly Ala Thr He Ser Phe Ser Cys Asn Thr 180 185 190 Gly Tyr Lys Leu Phe Gly Ser Thr Ser Ser Phe Cys Leu Ile Ser Gly 195 200 205 Ser Ser Val Gln Trp Ser Asp Pro Leu Pro Glu Cys Arg Glu Ile Tyr 210 215 220 Cys Pro Ala Pro Pro Gln Ile Asp Asn Gly Ile Ile Gln Gly Glu Arg 225 230 235 240 Asp His Tyr Gly Tyr Arg Gln Ser Val Thr Tyr Ala Cys Asn Lys Gly 245 250 255 Phe Thr Met Ile Gly Glu His Ser Ile Tyr Cys Thr Val Asn Asn Asp 260 265 270 Glu Gly Glu Trp Ser Gly Pro Pro Pro Glu Cys Arg Gly Lys Ser Leu 275 280 285 Thr Ser Lys Val Pro Pro Thr Val Gln Lys Pro Thr Thr Val Asn Val 290 295 300 Pro Thr Thr Glu Val Ser Pro Thr Ser Gln Lys Thr Thr Thr Lys Thr 305 310 315 320 Thr Thr Pro Asn Ala Gln Ala Thr Arg Ser Thr Pro Val Ser Arg Thr 325 330 335 Thr Lys His Phe His Glu Thr Thr Pro Asn Lys Gly Ser Gly Thr Thr 340 345 350 Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Ile 355 360 365 Tyr Ile Trp Ala Pro Leu Ala Gly Thr Cys Gly Val Leu Leu Leu Ser 370 375 380 Leu Val Ile Thr Leu Tyr Cys Asn His Arg Asn Arg Arg Arg Val 385 390 395 <210> 3 <211> 365 <212> PRT <213> Artificial Sequence <220> <223> Mature fusion protein (after removal of the signal peptide) <220> <221> peptides <222> (1)..(318) <223> SCR of CD55 <220> <221> MISC_FEATURE <222> (319)..(333) <223> (G4S1)3 linker <220> <221> transmembrane <222> (334)..(354) <223> CD8 transmembrane domain <220> <221> DOMAIN <222> (355)..(365) <223> Truncated CD8 intracellular domain <400> 3 Asp Cys Gly Leu Pro Pro Asp Val Pro Asn Ala Gln Pro Ala Leu Glu 1 5 10 15 Gly Arg Thr Ser Phe Pro Glu Asp Thr Val Ile Thr Tyr Lys Cys Glu 20 25 30 Glu Ser Phe Val Lys Ile Pro Gly Glu Lys Asp Ser Val Ile Cys Leu 35 40 45 Lys Gly Ser Gln Trp Ser Asp Ile Glu Glu Phe Cys Asn Arg Ser Cys 50 55 60 Glu Val Pro Thr Arg Leu Asn Ser Ala Ser Leu Lys Gln Pro Tyr Ile 65 70 75 80 Thr Gln Asn Tyr Phe Pro Val Gly Thr Val Val Glu Tyr Glu Cys Arg 85 90 95 Pro Gly Tyr Arg Arg Glu Pro Ser Leu Ser Pro Lys Leu Thr Cys Leu 100 105 110 Gln Asn Leu Lys Trp Ser Thr Ala Val Glu Phe Cys Lys Lys Lys Ser 115 120 125 Cys Pro Asn Pro Gly Glu Ile Arg Asn Gly Gln Ile Asp Val Pro Gly 130 135 140 Gly Ile Leu Phe Gly Ala Thr Ile Ser Phe Ser Cys Asn Thr Gly Tyr 145 150 155 160 Lys Leu Phe Gly Ser Thr Ser Ser Phe Cys Leu Ile Ser Gly Ser Ser 165 170 175 Val Gin Trp Ser Asp Pro Leu Pro Glu Cys Arg Glu lie Tyr Cys Pro 180 185 190 Ala Pro Pro Gin lie Asp Asn Gly lie lie Gin Gly Glu Arg Asp His 195 200 205 Tyr Gly Tyr Arg Gin Ser Val Thr Tyr Ala Cys Asn Lys Gly Phe Thr 210 215 220 Met lie Gly Glu His Ser lie Tyr Cys Thr Val Asn Asn Asp Glu Gly 225 230 235 240 Glu Trp Ser Gly Pro Pro Pro Glu Cys Arg Gly Lys Ser Leu Thr Ser 245 250 255 Lys Val Pro Pro Thr Val Gin Lys Pro Thr Thr Val Asn Val Pro Thr 260 265 270 Thr Glu Val Ser Pro Thr Ser Gin Lys Thr Thr Thr Lys Thr Thr Thr 275 280 285 Pro Asn Ala Gin Ala Thr Arg Ser Thr Pro Val Ser Arg Thr Thr Lys 290 295 300 His Phe His Glu Thr Thr Pro Asn Lys Gly Ser Gly Thr Thr Gly Gly 305 310 315 320 Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser lie Tyr lie 325 330 335 Trp Ala Pro Leu Ala Gly Thr Cys Gly Val Leu Leu Leu Ser Leu Val 340 345 350 Ile Thr Leu Tyr Cys Asn His Arg Asn Arg Arg Arg Val 355 360 365

Claims

1. A fusion protein consisting of SEQ ID NO: 2 or SEQ ID NO: 3, wherein, The fusion protein does not contain a GPI anchor and the fusion protein improves resistance to complement inactivation.

2. The fusion protein of claim 1, consisting of SEQ ID NO:

2.

3. The fusion protein of claim 1, consisting of SEQ ID NO:

3.

4. A nucleic acid encoding the fusion protein of any one of claims 1 to 3.

5. The nucleic acid of claim 4, wherein, The nucleic acid is DNA.

6. The nucleic acid of claim 5, further comprising one or more introns.

7. An expression vector comprising the nucleic acid of any one of claims 4 to 6 operably linked to a control sequence.

8. A cell line stably expressing the protein of any one of claims 1 to 3 on the cell surface, wherein the cell line is not a reproductive cell or a fertilized egg of an animal or human.

9. The cell line of claim 8, wherein, The cell line is a mammalian cell line.

10. The cell line of claim 8, wherein, The cell line is a DF-1 chicken embryonic fibroblast cell line.

11. An enveloped virus incorporating the protein of any one of claims 1 to 3 on the viral membrane.

12. The virus of claim 11, wherein, The virus is an oncolytic virus.

13. The virus of claim 12, wherein, The oncolytic virus is a Newcastle disease virus.

14. A pharmaceutical composition comprising the virus of claim 12 or 13 and a pharmaceutically acceptable carrier.

15. Use of the virus of claim 11 in the manufacture of a medicament for reducing a tumor in a mammalian subject.

16. The use of claim 15, wherein, The virus is administered intratumorally.

17. The use of claim 15, wherein, The virus is administered intravenously.

18. The use of claim 15, wherein, The tumor is selected from a tumor selected from fibrosarcoma, pancreatic epithelial carcinoma, or ovarian adenocarcinoma.

Images