A dna molecular tile or nucleic acid nanostructure thereof and applications thereof

Abstract

The application discloses a DNA tile or nucleic acid nanostructure and application thereof. The DNA tile comprises a small ring single-stranded DNA molecule and a linear single-stranded DNA molecule, and the two are integrated into a stable individual existing or individual non-existing molecular primitive structure for constructing a nucleic acid nanoarray through base pairing rules. The small ring single-stranded DNA molecule is a scaffold chain, and the linear single-stranded DNA molecule is an auxiliary chain. The molecular primitive structure comprises at least one Holliday junction. The nucleic acid nanostructure comprises at least one molecular tile, each of which is composed of at least two adjacent parallel-antiparallel double helix segments. The head and tail of each double helix segment are blunt ends or each has one sticky end. Adjacent molecular tiles are connected through geometry, complementary pairing of the sticky ends or Holliday junctions. The DNA tile or nucleic acid nanostructure is applied to the fields of biological medicine, mathematics, computer, chemical engineering, physics, electronics or nanotechnology.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of DNA nanoself-assembly technology, and particularly relates to a DNA molecular tile or nucleic acid nanostructure thereof and application thereof. BACKGROUND

[0002] Since Watson and Crick discovered the principle of DNA base pairing (A pairs with T, and G pairs with C) and double helix structure in 1953, molecular biology has developed rapidly in the past 60 years. DNA is one of the most accurate and programmable controllable self-assembling molecular systems in nature. The double helix structure formed by highly faithful base complementary pairing has stable rigidity and flexibility, and the arrangement and combination of the four bases constituting DNA on the high molecular single strand has infinite diversity. DNA is an ideal "molecular building module". The molecular building technique of constructing nano and micro structures by using DNA molecular modules was first proposed by Professor Nadrian C. Seeman of New York University in the 1980s. He broke the shackles of DNA being limited to the field of biology, invented DNA "double crossover" molecules (Double Crossover, or simply DX) and "triple crossover" molecules (Triple Crossover, or simply TX), and used the characteristics of base-specific pairing and programmable ordering to accurately assemble zero-dimensional, one-dimensional, two-dimensional, and three-dimensional (0D, 1D, 2D, 3D) array structures, devices, and 3D single crystal materials with a certain geometric configuration on the nanoscale in a "bottom-up" manner. After nearly three decades of development, the size of DNA self-assembly objects has ranged from nanoscale to three-dimensional millimeter scale, the self-assembly molecules or components have developed from single DNA molecules to DNA-nanoparticles, DNA-proteins, DNA-functional molecules, and other multi-components, and the functions of self-assembly objects have become increasingly rich, from simple and beautiful patterns to molecular assembly factories, nanometer assembly lines, and even DNA nanomachines with various operations and controls, the manipulation objects have expanded from simple nanoclusters and small crystals of a few hundred microns to more complex and dynamic materials that can respond to stimuli and macroscopic materials, in addition, the specific combination of materials has also produced novel physical properties. For example, the application of DNA nanoscale assembly technology to the assembly of optically active nanogold and nanoscale semiconductor particles can produce photonic crystal materials with controllable plasmon resonance.

[0003] DNA nanotechnology is an interdisciplinary field that breaks the traditional boundaries of disciplines and combines the knowledge of chemistry, biology, computer science, and physics to solve some of the most challenging problems in the field of biomedical and human health. The driving force behind this field is to manipulate matter at the smallest possible scale (molecular and atomic level) to enhance the ability to manipulate DNA by better understanding the properties of DNA knotting, strand threading, stability and rigidity of DNA motifs, and to synthesize a wide variety of complex and functional nanoscale materials. These artificially synthesized molecules or nanomachines also bring new technologies and manipulation tools to synthetic biology. From the earliest DX catenanes to the most complex DNA-protein composite assemblies developed recently, this field has also expanded to some of the most recent and hottest application areas, including material self-assembly, structural biology, biocatalysts, DNA computing, nanomachines, disease detection, and drug delivery. Some of the latest applications of DNA nanotechnology benefit from the ability to precisely assemble DNA molecules at the nanoscale while maintaining their complex structure and function. DNA nanoscale self-assembly technology has been recognized as the most dynamic and widely applicable scientific research field in the field of "bottom-up" molecular devices and nanofabrication. Although DNA nanotechnology has the potential to play an important role in many fields such as nanophotonic devices and DNA computers, we believe that the application prospects of DNA nanotechnology should mainly focus on the field of biomedicine, because they are composed of biopolymer materials-nucleic acids. These application areas include controlling gene expression, drug delivery, gene silencing, detecting disease markers, etc.

[0004] Backtracking the development of DNA nanotechnology in time, in the early 1980s, Seeman's group first committed to construct the natural motifs or similar motifs in biological systems, such as Holliday Junction (HJ) and its analogues, cubes, parallelograms and "Prolin-triple-ring" structures, using several synthetic single-stranded DNA. In the late 1990s, Seeman and computer youth scholar Eric Winfree cooperated to construct 2D arrays of DAO-E (Double crossover, Antiparallel, Odd half-turns tile with Even half-turns connection) and DAE-O (Double crossover, Antiparallel, Even half-turns tile with Odd half-turns connection) using the cross-connection of double crossover molecular tile (DXtile). In 1998, they first reported that 2D arrays of DNA at the scale of 0.1-10 microns could be observed by atomic force microscope, which directly triggered the wave of DNA and RNA nanoscale self-assembly technology. In the following nearly two decades, many visually stunning DNA and RNA nanoscale patterns and DNA and RNA nanoscale self-assembly works with profound scientific significance were published in Nature and Science, such as the two-dimensional DNA array and limited structure array with holes constructed by three-arm and four-arm DNA, etc. In 2006, Paul Rothemund reported the use of a long-chain viral DNA with known sequence as a template (scaffold chain), and a large number of "staple DNA chains" as auxiliary chains to fold the long template chain into any shape of planar "DNA origami" (DNA origami) technique. Seeman and Mao's group cooperated to synthesize 3D DNA crystal using triangular motif structure. William Shih et al. invented the three-dimensional folding technology of DNA origami. Hao Yan et al. used DNA array as a scaffold to construct precisely positioned protein and nanogold arrays, and also used the assembly technique of short-chain DNA to expand the pattern construction of DNA origami, such as constructing various DNA art in the field of micro-nano, such as Mobius strip and vase, etc. Peng Yin and Yonggang Ke et al. used single-stranded DNA to construct various two-dimensional and three-dimensional DNA nanostructures. Inspired by DNA nanotechnology, similar RNA nanoscale self-assembly technology also developed vigorously.

[0005] Cyclic DNA is ubiquitous in biological cells, such as the plasmid in many bacteria, yeast and other organisms is a kind of extranuclear self-replicating circular DNA molecule, the liver, brain, white blood cells, mouse thymus cells, Hela embryonic carcinoma cells of human also extract this kind of circular DNA molecule. In addition, the existence of circular DNA molecules is also found in the nucleus, chloroplast and mitochondria of higher plants such as wheat, soybean and sorghum. Circular DNA molecules can be gene drift through the membrane system of subcellular organelles, and information exchange between different parts of the cell, especially in the nuclear and mitochondrial genetic system: affect the aging of life system, cell mutation and other molecular lesions.

[0006] The biological function of biological macromolecules is closely related to the secondary and tertiary structure of biological macromolecules. Compared with the knowledge of the strength, nature and connection of chemical bonds forming the primary structure of molecules, human beings know little about the rules of the secondary and tertiary structure of biological macromolecules. This is the reason for the prosperity of current structural biology. DNA nanotechnology is a method of artificially constructing ordered structure according to the existing knowledge and rules of the primary, secondary and tertiary structure of DNA, but not limited to this. The small ring DNA nanotechnology we invented can creatively construct some reasonable artificial DNA secondary and tertiary structures that have not been proven, such as a special form or special structure of HJ, B-Z SJX (B-Z Switching Junction of X-stacking), and molecular tiles and nanostructures coexisting with B-DNA and Z-DNA. Generally speaking, B-type (right-handed helix) DNA molecules exist widely in animal and plant life systems, and there are also a large number of B-type DNA molecules in the food of various animals. B-type DNA molecules are non-immunogenic; but scientists have increasingly deep understanding of other types of DNA such as Z-type DNA molecules with left-handed helix. Since A. Rich discovered Z-DNA molecules with left-handed helix in 1979, in vivo experimental studies have shown that Z-type DNA molecules are immunogenic; Z-DNA is a high-energy DNA, and existing reports show that the conditions for the stable existence of Z-DNA are relatively harsh, such as 1) high salt state (several molar concentration) of monovalent or divalent cations, such as Na + , Mg 2+ , Ca 2+ and Ba 2+1) The arrangement of high-energy negative ions that can effectively neutralize and shield Z-DNA, 2) such as polyamines, chemical modifiers, rare earth elements, etc. (in the order of tens to hundreds of millimolar concentration) are conducive to the formation and stability of Z-DNA, 3) the torsional force and tensile force generated by the negative supercoiling in cells or the binding of proteins with specific domains are also the reasons for stimulating the formation of Z-DNA, 4) specific sequences such as d(GC)n (n≥3) and the like. Z-DNA is easy to change back to B-DNA under physiological conditions. The biological functions of Z-DNA intermediates in living organisms include: replication, activation or inhibition of transcription, induction of genetic instability, promotion of gene recombination, and cause human diseases related to Z-DNA such as Alzheimer's disease (Aβ multimers may promote the B-Z transition of DNA and stabilize the structure of Z-DNA), blood diseases, tumors, autoimmune diseases such as rheumatoid arthritis, etc. However, the scientific community has limited understanding of the formation, stability, and biological functions of Z-DNA, and more attention and research are needed. The X-shaped stacked B-Z transition four-arm cross junction (B-Z SJX) found in the invention, the molecular tile coexisting with B-DNA and Z-DNA, and the nanostructure thereof make it easy to obtain Z-DNA which is difficult for the scientific community to obtain. By modification, the Z-DNA nanostructure that stably exists under physiological conditions will change the situation that Z-DNA is difficult for the scientific community to obtain, and the biological functions of Z-DNA can be easily studied at the level of cells and living small animals. The research on DNA minicircle nanotechnology will broaden the human vision of the secondary and tertiary structure and function of DNA, and it is hoped that this technology will further deepen the research on the biological functions of Z-DNA and the human diseases caused by Z-DNA. SUMMARY

[0007] The present application aims to provide a DNA tile or nucleic acid nanostructure and its application. The present application constructs a rigid and flexible combined DNA nanostructure, which is controllable in size, high in assembly yield, compatible with biological systems, and can be subjected to mild biochemical reactions and chemical modifications such as enzyme ligation and enzyme cleavage. The DNA molecules can be modified with single (or multiple) fluorescent dyes, target molecules, nanoparticles, etc. in non-aqueous solution, and then introduced into and assembled into DNA nanostructures in aqueous solution to introduce single or multiple markers into a nanostructure. The present application constructs many stable DNA nanostructures that have not been discovered or invented by humans so far, and can construct some artificial DNA secondary and tertiary structures that have not been discovered and confirmed in life systems but are scientifically reasonable, such as B-Z SJX and B-DNA and Z-DNA coexisting nanostructures. These 10-10000 nm scale DNA ordered structures can be easily detected by modern microscopic techniques in static and dynamic state, and their biological functions can be easily studied at the level of cells and living small animals. Scientists can explore whether these artificial DNA structures exist in life systems and their biological functions by using this technology. The answers to these questions will broaden the human understanding of the secondary and tertiary structures and functions of DNA. The present application uses the torsional force and tensile force generated by the binding of negative supercoils or specific domains of proteins in cells to stabilize Z-DNA to construct B- and Z-type coexisting small ring DNA tile and its nanostructure, which changes the past extreme conditions for stabilizing Z-DNA, such as high salt environment and specific sequence such as d(GC)n, so that Z-DNA of any sequence can be easily prepared. The B- and Z-DNA coexisting nanostructure in the present application can be stable under in vitro physiological conditions after modification, and this easily obtained nanostructure containing Z-DNA will greatly facilitate the study of the biological function of Z-DNA.

[0008] A molecular tile comprising a small ring single-stranded DNA molecule and a linear single-stranded DNA molecule, which are combined into a stable individual existing or individual non-existing molecular building block for nucleic acid nanoarray by base pairing rules, the small ring single-stranded DNA molecule is a scaffold chain, the linear single-stranded DNA molecule is an auxiliary chain, and the molecular building block comprises at least one Holliday junction (HJ).

[0009] As an improvement, the length of the small ring single-stranded DNA (c64nt) is 64nt, when the small ring single-stranded DNA molecule is compressed into two 32nt long centrosymmetric linear structures side by side and antiparallel, two curves are introduced at the geometric center of c64nt and constitute HJ with two half-complementary linear single-stranded, that is, HJ@c64nt molecular tile.

[0010] As an improvement, the two ends of the HJ@c64nt molecular tile each form a Holliday junction, and the two ends of the two parallel antiparallel double helix chains are suspended ibp outside c64nt and attached to a jnt sticky end, where 2

[0011] As an improvement, the length of the small ring single-stranded DNA (c64nt) is 64nt, when the small ring single-stranded DNA molecule is compressed into two 32nt long centrosymmetric linear structures side by side and antiparallel, two curves are introduced at the geometric center of c64nt and constitute HJ with two half-complementary linear single-stranded, that is, HJ@c64nt molecular tile.

[0012] As an improvement, the length of the small circular single-stranded DNA is 128nt. The small circular single-stranded DNA molecule is stretched into a square with four sides of 32nt each. One pair of sides is parallel to the x-axis of the two-dimensional Cartesian xy rectangular coordinate system, and the other pair of sides is parallel to the y-axis. The midpoints of the pair of sides parallel to the y-axis are pulled towards the center of the square, while the other pair of sides parallel to the x-axis remain parallel and move towards the center, eventually forming a four-row "I" structure. Four single strands are introduced to complement the above four rows and extend outwards beyond the c128nt loop. Four more single strands are introduced to complement the two upper and two lower extended single strands on the left and right sides, forming four Holliday knots. The ends of the four antiparallel double strands are respectively suspended by ibp and attached with a jnt sticky end, where 2 < i < 10, 2 < j < 21, and 2i + j = 21 or 26, thus obtaining the pDAE@c128nt molecule.

[0013] As a further improvement, the two auxiliary single chains parallel to the x-axis in the middle of the pDAE@c128nt molecular tile extend c128nt in a three-arm knot at the geometric centroid and insert complementary 10bp connections, thus obtaining the pDAE-10bp@c128nt molecular tile.

[0014] As an improvement, the length of the small ring single-stranded DNA is 64 nt, the small ring single-stranded DNA molecule is compressed into two parallel but antiparallel 32 nt linear structures parallel to the x-axis direction in the xy plane of the three-dimensional Cartesian rectangular coordinate system xyz; Holliday junctions are introduced at the four-equal-division base numbers of the two parallel 32 nt chains of c64 nt parallel to the x-axis, a total of 6 "half Holliday junctions", "half Holliday junctions" need to be connected with "half Holliday junctions" at corresponding sites to form a whole Holliday junction, such as a pair of "half Holliday junctions" at the geometric center of c64 nt form a whole Holliday junction inside the molecule tile itself and located in the xy plane, the other two pairs of "half Holliday junctions" are located at the other four four-equal-division base number sites, and the two sites of each pair are symmetric to the geometric center. The "half Holliday junctions" at the four different sites must be connected with the "half Holliday junctions" at the corresponding sites of the other molecule tile to form a whole HJ, and the two "half Holliday junctions" of each pair point to the same direction of the z-axis and the vertical projection site in the xy plane is symmetric to the geometric center of the molecule tile, but the two pairs of "half Holliday junctions" point to different directions of the z-axis. According to the concept of constructing a total of 5 independent HJs, it is named as 5HJ@c64 nt chiral molecule tile, 5HJ@c64 nt has left-handed Z-5HJ@c64 nt and right-handed B-5HJ@c64 nt as enantiomers, and the individual of the 5HJ@c64 nt chiral molecule tile unit does not exist independently. The molecule tiles of left-handed Z-5HJ@c64 nt and right-handed B-5HJ@c64 nt can be produced in adjacent corresponding DNA double helix plane layers due to interlayer connection after forming stable existing molecule tiles or nanometer arrays.

[0015] As a further improvement, a pair of HJs symmetric to the four-equal-division sites of the geometric center is cancelled and changed to linear double-stranded, then "half HJ" is obtained and changed to linear double-stranded, then 3HJ@c64 nt chiral molecule tile is obtained, 3HJ@c64 nt has left-handed Z-3HJ@c64 nt and right-handed B-3HJ@c64 nt as enantiomers, and the individual of the 3HJ@c64 nt chiral molecule tile unit does not exist independently. The molecule tiles of left-handed Z-3HJ@c64 nt and right-handed B-3HJ@c64 nt can be produced in adjacent corresponding DNA double helix plane layers due to interlayer connection after forming stable existing molecule tiles or nanometer arrays.

[0016] The above-mentioned DNA molecule tile has applications in the fields of biomedicine, mathematics, computer, chemistry, chemical industry, physics, electronics or nanotechnology.

[0017] A DNA tile periodic arrangement one-dimensional or two-dimensional nucleic acid nanostructure, comprising at least one DNA tile, each tile consisting of at least two adjacent parallel double helix segments, each double helix segment having a sticky end at each end, adjacent tiles are connected by the complementary pairing of the sticky ends and are connected smoothly in approximately coplanar or similar curvature, when adjacent tiles are linearly connected, the periodic repetition of the tiles constitutes a one-dimensional nucleic acid nanostructure, when adjacent tiles are cross-connected, the periodic repetition of the tiles constitutes a two-dimensional nucleic acid nanostructure.

[0018] As a further improvement, the nucleic acid nanostructure is a one-dimensional structure, which is acDAO@c64nt-E one-dimensional nanoring or one-dimensional nanohelix formed by the linear connection of the exocyclic sticky ends of the acDAO@c64nt tiles; the nucleic acid nanostructure is a two-dimensional structure, which is cDAO@c64nt-E, cDAO@c64nt-O, tHJ@c84nt-O, pDAE@c128nt-E, pDAE@c128nt-O, pDAE-10bp@c128nt-E, pDAE-10bp@c128nt-O two-dimensional planar nanostructure and tHJ@c84nt-E nanotube formed by the cross-connection of the exocyclic sticky ends of the cDAO@c64nt, tHJ@c84nt, pDAE@c128nt and pDAE-10bp@c128nt tiles, i.e. the two-dimensional array curl of the tiles.

[0019] A DNA tile periodic arrangement three-dimensional nucleic acid nanostructure, the three-dimensional nucleic acid nanostructure is described in a Cartesian rectangular coordinate system xyz, each DNA double helix plane parallel to the xy plane in the same layer is stacked by geometric matching of the double helix axis of the tile and base π-π interaction (blunt end) or 1-8 base sticky end insertion pairing connection, the adjacent upper and lower DNA double helix layers in the z-axis direction are left-handed and right-handed helix layers alternately and are connected by B-ZSJX between adjacent layer tiles, the number of layers of DNA double helix planes in the z-axis direction is limited to 2-4 layers, when the number of layers is 2, the three-dimensional nucleic acid nanostructure is composed of at least two DNA tiles of different sequences, when the number of layers is 3 or 4, the three-dimensional nucleic acid nanostructure is composed of at least three or four DNA tiles of different sequences.

[0020] As an improvement, at least two different sequences of 3HJ@c64nt molecular tiles build two layers of 3D nucleic acid nanostructure in z direction, each layer is the same sequence or different sequence but with translational symmetry of the same layer, 3HJ@c64nt through the geometric matching of double helix axis direction and base π-π interaction accumulation (blunt end) or sticky end pairing connection composition; the conformation and connection mode of adjacent DNA double helix layers in z axis direction: 1) one layer is right-handed helix and the other layer is left-handed helix, the left and right-handed helix layers are alternately built into two layers of three-dimensional nucleic acid nanostructure, and two B-Z SJX are connected by one 3HJ@c64nt molecular tile in each layer through a pair (two) of "half Holliday junction" nodes in z direction corresponding to the "half Holliday junction" nodes of two 3HJ@c64nt molecular tiles in the adjacent layer. The sufficient and necessary condition for B-Z SJX is that the two adjacent layers are B-3HJ@c64nt and Z-3HJ@c64nt molecular tiles respectively, and only direct four-arm connection between the loops and no extra base pairing between the outside of the loops can produce B-Z SJX, and only one B-Z SJX 1 is used to connect two layers of three-dimensional nucleic acid nanostructure. The two-layer nanostructure can be infinitely extended in x and y axis direction in theory, or the width in x or y axis direction is limited but the other axis is infinitely extended, or the length in x and y axis is limited to become a finite size structure. 2) A special case is that both layers are right-handed helix and connected as cross Holliday junction. The two-layer nanostructure can be infinitely extended in x and y axis direction in theory, or the width in x or y axis direction is limited but the other axis is infinitely extended, or the length in x and y axis is limited to become a finite size structure.

[0021] As an improvement, the three-dimensional nucleic acid nanostructure is a three-layer structure, at least two 3HJ@c64nt molecules with different sequences and one 5HJ@c64nt molecule with a different sequence tile the three-layer 3D nucleic acid nanostructure, the 3HJ@c64nt in the upper layer and the 3HJ@c64nt in the lower layer are the same sequence or different sequences but have the same layer translational symmetry, the 3HJ@c64nt in the same layer is stacked by geometric matching along the double helix axis and base π-π interaction (blunt end) or cohesive end pairing connection group, the middle layer is a 5HJ@c64nt tile with the same sequence or different sequences but with the same layer translational symmetry, which is stacked by geometric matching along the double helix axis and base π-π interaction (blunt end) or cohesive end pairing connection group, the adjacent upper and lower DNA double helix layers in the z-axis direction are alternately constructed by left-handed or right-handed helix layers, and one pair of B-Z SJX 1 and another pair of B-Z SJX 2 of the 5HJ@c64nt in the middle layer are connected to each of the two 3HJ@ tiles in the upper and lower layers, respectively, to obtain a stable three-layer 3D nucleic acid nanostructure. The sufficient and necessary condition for B-Z SJX 1 and B-Z SJX 2 is that the upper and lower layers are B-3HJ@c64nt tile, and the middle layer is Z-5HJ@c64nt tile. Only direct four-arm connection between the rings (no extra base pairing between the outside of the rings) can produce B-Z SJX, and three-layer 3D nucleic acid nanostructure requires the use of two kinds of B-Z SJX 1 and B-Z SJX 2 connections. The three-layer nanostructure can be infinitely extended in the x and y axis directions in theory, or the width in the x or y axis direction is limited but infinitely extended in the other axis direction, or the length in the x and y axis directions is limited to a finite size structure.

[0022] As an improvement, the three-dimensional nucleic acid nanostructure is a four-layer structure, and the four-layer 3D nucleic acid nanostructure is constructed by 3HJ@c64nt of at least two different sequences and 5HJ@c64nt of two different sequences. The 3HJ@c64nt of the upper layer and the 3HJ@c64nt of the lower layer are 3HJ@c64nt of the same sequence or 3HJ@c64nt of different sequences but have the same layer translation symmetry, which are stacked by geometric matching and base π-π interaction along the double helix axis (blunt end) or connected by sticky end pairing, the middle two layers are respectively 5HJ@c64nt of the same sequence or 5HJ@c64nt of different sequences but have the same layer translation symmetry, which are stacked by geometric matching and base π-π interaction along the double helix axis (blunt end) or connected by sticky end pairing, the adjacent upper and lower DNA double helix layers in the z-axis direction are alternately constructed by left-handed or right-handed helix layers, the connection mode of the adjacent two layers of molecular tiles is B-Z SJX 1 or B-Z SJX 2, and the interlayer connection of the four-layer 3D nucleic acid nanostructure must alternately use B-Z SJX 1 and B-Z SJX 2, that is, the first and second layers are connected by B-Z SJX 1, the second and third layers are connected by B-Z SJX 2, the third and fourth layers are connected by B-Z SJX 1, or vice versa, that is, a stable three-layer 3D nucleic acid nanostructure is obtained. The sufficient and necessary condition for B-Z SJX 1 and B-Z SJX 2 is that the adjacent two layers above and below are respectively B- and Z-DNA layers of different conformations, such as the first layer B-3HJ@c64nt / the second layer Z-5HJ@c64nt / the third layer B-5HJ@c64nt / the fourth layer Z-3HJ@c64nt. Only direct four-arm connection between the rings (no extra base pairing between the outside of the rings) can produce B-Z SJX. The four-layer nanostructure can be infinitely extended in the x and y axial directions in theory, or the width in the x or y axial direction is limited but infinitely extended in the other axial direction, or the length in the x and y axial directions is limited to become a finite size structure.

[0023] The above nucleic acid nanostructure is applied in the fields of biomedicine, mathematics, computer, chemistry, chemical industry, physics, electronics or nanotechnology.

[0024] Beneficial effects:

[0025] Compared with the prior art, the application uses small ring single-stranded DNA molecules as a scaffold chain to construct a novel DNA molecular tile and a novel nucleic acid nanostructure built therefrom. The application constructs a nucleic acid nanostructure combining rigidity and flexibility, which is controllable in size, has a high assembly yield, is compatible with a biological system, can perform mild biochemical reactions and chemical modifications such as enzyme ligation and enzyme cleavage, and can introduce single (or multiple) fluorescent dyes, target molecules, nanoparticles and the like into DNA molecules, and then introduce the modified DNA into the nucleic acid nanostructure to introduce single markers or multiple combined markers in a nanostructure. The application constructs many stable nucleic acid nanostructures that have not been discovered or invented by human beings so far, and can creatively construct some artificially created DNA secondary and tertiary structures that have not been discovered and verified in a life system but are scientifically reasonable, such as B-Z SJX knots and B-DNA / Z-DNA coexisting molecular tiles and nanostructures. The biological functions of Z-DNA intermediates in a life system include replication, activation or inhibition of transcription, induction of genetic instability, promotion of gene recombination, and causing human diseases related to Z-DNA such as Alzheimer's disease (Aβ multimers can promote the B-Z transition of DNA and stabilize the structure of Z-DNA), blood diseases, tumors, autoimmune diseases such as rheumatoid arthritis, and the like, but the scientific community has limited understanding of the formation, stability and biological functions of Z-DNA, and needs more attention and research. These larger 1-10000 nanometer scale DNA ordered structures can be easily detected by modern microscopic techniques in static and dynamic states, and their biological functions can be easily studied at the level of cells and living small animals. The application uses the torsional force and tensile force generated by the binding of intracellular negative supercoils or specific domains of proteins to stabilize Z-DNA of any sequence to construct B- and Z-type coexisting small ring DNA molecular tiles and nanostructures, and so far the scientific community needs to use specific sequences such as d(GC)n and extreme conditions such as high salt environment to stabilize Z-DNA, and our application will change the current situation that it is difficult to prepare Z-DNA of any sequence under physiological conditions, so that it can be easily prepared. This B- and Z-DNA coexisting nanostructure modified under physiological conditions can be stably present, and this easily obtained B- and Z-DNA coexisting nanostructure will greatly facilitate the research on B-Z SJX knots and the biological functions of Z-DNA. DNA nanotechnology will open up the field of human understanding of DNA secondary and tertiary structures and functions, deepen the understanding of the biological functions of Z-DNA and the mechanisms of various human diseases caused by Z-DNA, and further guide the treatment of these diseases, and contribute to human health and the exploration of the mystery of life. BRIEF DESCRIPTION OF DRAWINGS

[0026] Figure 1 Figure 1 is a structural schematic diagram of an HJ@c64nt molecular tile.

[0027] Figure 2 Structure schematic of cDAO@c64nt molecular tile;

[0028] Figure 3 2D array of 21 bp junctions made of cDAO@c64nt-E (-E = 4), where (a) is structure schematic, (b) is AFM image;

[0029] Figure 4 2D array of 26 bp junctions made of cDAO@c64nt-O (-O = 5), where (a) is structure schematic, (b) is AFM image;

[0030] Figure 5 Linear array of 21 bp junctions made of acDAO@c64nt-E (-E = 4), where (a) is structure schematic of asymmetric aHJ@c64nt molecular tile, (b) is acDAO@c64nt molecular tile and its linear array structure schematic, (c) is AFM image;

[0031] Figure 6 Structure schematic of tHJ@c84nt;

[0032] Figure 7 Non-denaturing polyacrylamide gel electrophoresis image of different structure molecular tiles, where 1- control c64bp, 2-HJ@c64nt, 3-aHJ@c64nt, 4-high molecular nanowire formed by moving the cleavage point of the end of HJ@c64nt to the 8bp away from the HJ junction and the center-symmetric site, 5-control c84bp, 6-HJ@c84nt (similar to the structure of HJ@c64nt but the loop is c84nt), 7-tHJ@c84nt, 8-high molecular nanowire formed by moving the cleavage point of the end of HJ@c84nt to the 8bp away from the HJ junction and the center-symmetric site, 9-DNA Marker;

[0033] Figure 8 2D array of 21 bp junctions made of tHJ@c84nt-E (-E = 4), where (a) is structure schematic, (b) is AFM image;

[0034] Figure 9 2D array of 26 bp junctions made of tHJ@c84nt-O (-O = 5), where (a) is structure schematic, (b) is AFM image;

[0035] Figure 10 Structure schematic of pDAE@c128nt molecular tile;

[0036] Figure 11Structure of pDAE-10bp@c128nt molecular tile;

[0037] Figure 12 2D array of 21 bp junctions made of pDAE@c128nt-E(-E=4), where (a) is the structure schematic, (b) is the AFM image;

[0038] Figure 13 2D array of 26 bp junctions made of pDAE@c128nt-O(-O=5), where (a) is the structure schematic, (b) is the AFM image;

[0039] Figure 14 2D array of 21 bp junctions made of pDAE-10bp@c128nt-E(-E=4), where (a) is the structure schematic, (b) is the AFM image;

[0040] Figure 15 2D array of 26 bp junctions made of pDAE-10bp@c128nt-O(-O=5), where (a) is the structure schematic, (b) is the AFM image;

[0041] Figure 16 Structure of 5HJ@c64nt molecular tile and B-Z SJX, where (a) from left to right are the sequence, structure schematic of right-handed B-5HJ@c64nt molecular tile, and left-handed Z-5HJ@c64nt molecular tile, B-5HJ@c64nt and Z-5HJ@c64nt are enantiomers, (b) are structure schematics of ideal B-Z SJX 1 and B-Z SJX 2;

[0042] Figure 17 Two-layer 3D DNA array infinite nanostructure constructed by right-handed B-3HJ@c64nt and left-handed Z-3HJ@c64nt, where (a) from left to right are structure schematics of B-3HJ@c64nt and Z-3HJ@c64nt molecular tile, sequence and connection, assembly schematic, and AFM image, (b) is the CD spectrum of the nanostructure;

[0043] Figure 18 Three-layer 3D DNA array infinite nanostructure constructed by B-3HJ@c64nt, Z-5HJ@c64nt, and B-3HJ@c64nt, where (a) from left to right are structure schematics of B-3HJ@c64nt, Z-5HJ@c64nt, and B-3HJ@c64nt molecular tile, sequence and connection, and AFM image, (b) is the CD spectrum of the nanostructure;

[0044] Figure 19The four-layer 3D DNA array nanostructure of B-3HJ@c64nt, Z-5HJ@c64nt, B-5HJ@c64nt and Z-3HJ@c64nt from left to right are the structural schematic diagram, sequence and connection and AFM diagram of B-3HJ@c64nt, Z-5HJ@c64nt, B-5HJ@c64nt and Z-3HJ@c64nt molecular tile respectively;

[0045] Figure 20 The two-layer B-3HJ@c64nt right-handed helix 3D DNA array nanostructure of B-3HJ@c64nt in x-axis direction and infinite growth in y-axis direction, wherein (a) is the sequence arrangement, pairing and connection diagram drawn by using CADNANO program, (b) is the AFM diagram, and (c) is the CD spectrum diagram of the nanostructure;

[0046] Figure 21 The two-layer 3D DNA array nanostructure of B-3HJ@c64nt and Z-3HJ@c64nt in x-axis direction and infinite growth in y-axis direction, wherein (a) is the sequence arrangement, pairing and connection diagram drawn by using CADNANO program, (b) is the AFM diagram, and (c) is the CD spectrum diagram of the nanostructure;

[0047] Figure 22 The three-layer B-3HJ@c64nt / Z-5HJ@c64nt / B-3HJ@c64nt 3D DNA array nanostructure of B-3HJ@c64nt in x-axis direction and infinite growth in y-axis direction, wherein (a) is the sequence arrangement, pairing and connection diagram drawn by using CADNANO program, (b) is the AFM diagram. DETAILED DESCRIPTION

[0048] The application will be further described in detail below through specific embodiments.

[0049] HJ (Holliday Crossover Junction), also known as four-arm Holliday crossover junction. DAO (Double crossover, Antiparallel, Odd half-turns).

[0050] We use the enzyme to cyclize 5' or 3' to synthesize DNA small rings. In the preparation of DNA nanostructure, the DNA sequence is divided into two parts, the DNA molecular tile of the basic unit and the auxiliary chain of the connecting molecular tile.

[0051] The method for preparing DNA tile is as follows: according to the aforementioned rules for constructing DNA tile, a DNA tile is designed, the 5' phosphorylated linear sequence ordered from a company is circularized and purified, and the required loops and auxiliary short chains of the DNA tile are mixed in accordance with the Watson-Crick base complementary pairing mode and proportion, and annealed from a temperature interval (about 70-100°C) above the denaturation temperature or melting point temperature of double-stranded DNA to a certain temperature between 4°C and room temperature at a suitable annealing rate.

[0052] The method for synthesizing DNA nanotechnology can be divided into two methods: step-by-step method and one-pot method.

[0053] Step-by-step method: first, according to the aforementioned rules for constructing DNA sequence, a DNA nanostructure is designed. For each basic unit of DNA tile used, the DNA tile is prepared according to the method described above, and all the tiles and auxiliary connecting chains of the DNA nanostructure are mixed at a temperature lower than the melting temperature of all the DNA tiles (determined by the melting curve of the DNA tile) but higher than the temperature at which the cohesive ends are fully complementary (about 37-60°C), and then cooled to a certain temperature between 4°C and room temperature at a suitable rate (such as 0.1°C / 10min to 4°C). For example, a step-by-step cooling annealing method for preparing a 2D DNA array is as follows: 1) quickly anneal each tile mixture solution: from 95°C to 20°C in 2.5h, with a cooling rate of 1°C / 2min, to obtain a stable tile solution; 2) mix the required DNA array tile solutions at room temperature, and anneal from 50°C, slowly cooling from 50°C to 20°C in 24h, with a cooling rate of 0.1°C / 5min, to obtain a 2D DNA array.

[0054] One-pot method includes the following steps: mix all the linear single-stranded and small circular single-stranded DNA molecules of the nucleic acid nanostructure together, and anneal from a temperature interval (about 70-100°C) above the denaturation temperature or melting point temperature of double-stranded DNA to a certain temperature between 4°C and room temperature at a suitable annealing rate. For example, a cooling annealing method for preparing 2D and 3D DNA arrays is as follows: 95°C annealing, slowly cooling from 95°C to 20°C in 70h, with a cooling rate of 1°C / 5min from 95°C to 60°C, and a cooling rate of 0.1°C / 10min from 60°C to 20°C, for a total of about 70h.

[0055] All DNA was purchased from commercial company, without further purification, the stock solution was prepared in TE (pH=8.0) buffer (10 mmol / L Tris-HCl, 1 mmol / L EDTA) with a concentration of 10 μM. The 5' phosphorylated DNA was purified by HPLC from the manufacturer. The TE buffer, TAE premixed powder, Mg(Ac)2, T4 ligase, exonuclease I used in the experiment were purchased from commercial company.

[0056] Example 1 Synthesis of c64nt, c84nt, c128nt

[0057] The 64nt, 84nt, 128nt mini-circle DNA used in the experiment was obtained by intramolecular circularization of T4 ligase. The total volume of 80 μL liquid contains 20 nt clamp DNA (4.5 μM) and 5' phosphorylated DNA (3.5 μM), annealing from 95 °C to room temperature within 2 h, the clamp strand connects the 5' phosphorylated DNA end to end, after annealing, 10 μL of 10 x T4 ligase buffer (660 mM Tris-HCl, 66 mM MgCl2, 100 mM DTT, 1 mM ATP), 10 μL of T4 ligase (300 U / μL), the total volume of 100 μL is reacted in 16 °C water bath for 16 h. 95 °C heating for 5 min, ice water bath cooling, then add 10 μL of 10 x exonuclease I buffer, 10 μL of exonuclease I (5 U / μL), incubate at 37 °C water bath for 30 min, remove the remaining linear DNA. Then use 8-12% denatured polyacrylamide gel electrophoresis (PAGE) separation. Cut the target band, crush and add twice the mass of deionized water, mix and shake overnight. Use 0.22 μm filter membrane to remove PAGE gel, use ethanol precipitation method to concentrate the solution containing mini-circle DNA to about 100 μL, use the concentrator to dry to obtain DNA dry powder. Dissolve in TE buffer to 10 μM of mini-circle DNA stock solution.

[0058] Example 2 HJ@c64nt, cDAO@c64nt molecular tile and application

[0059] The molecular tile structure of HJ@c64nt is shown in Figure 1 The black rectangular line in the middle of the seamless connection represents the covalently linked 64 nt DNA mini-circle (c64nt), and the arrow direction represents the 5' to 3' direction of the DNA (hereinafter the description of the arrow represents the direction of the DNA, unless otherwise specified); the two dark gray linear DNA strands form an HJ cross in the middle of the c64nt mini-circle, which divides the c64nt into two equal parts, and the two single strands are evenly complementary to the sequences on both sides of the HJ, here the straight line and arrow are used to represent the DNA strand and its direction.

[0060] The cDAO@c64nt molecular tile structure is shown in Figure 2 As shown in FIG. 1, the four protruding ends of the two dark gray linear single strands of c64nt and the two short light gray strands outside the loop form two HJs, respectively, and then pair 8 nt or 10 nt to leave 5 nt or 6 nt single-stranded sticky ends, respectively, to form four overhanging arms. By borrowing the definition of the DAO molecular tile of Professor Seeman, this structure is a coupled two DAO structures, which we define as a cDAO molecular tile.

[0061] We assume that each molecular tile has a certain geometric configuration, such as a curved surface facing the same direction. When all the same direction rotations in the array, the curved surface of the DNA array carries the same direction curvature of the molecular tile, and the growth kinetics of the DNA array is easier and faster in the axial direction of the double-stranded, and the DNA array is easy to close in the transverse direction of the molecular tile, and quickly grows in the longitudinal direction of the molecular tile to form a nanotube; the above-mentioned curved surface bending in the same direction can be eliminated by constructing a corrugated surface, that is, by connecting the adjacent molecular tiles in the axial direction of the double-stranded DNA to have different rotation directions or surface orientations, a corrugated surface is constructed to offset the deflection of the DNA array in one direction, thereby forming a larger plane, effectively improving the success rate and yield of the experiment. In the experiment, we used two different sequences of c64nt loop A and B to construct two molecular tiles, and used two molecular tiles as an example to construct DNA nanostructures. In order to ensure that the structure is in a plane, the length of the connecting chain connecting the two loops can only be an even number of half helical turns or an odd number of half helical turns. When using an even number of half helical turns, the helical directions of the A and B loops are consistent; when using an odd number of half helical turns, the helical directions of the A and B loops are opposite.

[0062] The preparation method of the above-mentioned molecular tile is to mix the purified small loop DNA molecules required by the designed molecular tile with auxiliary single strands, and the final concentration of each DNA chain is 0.5 μM in 1 × TAE (40 mM Tris, 40 mM Hac, 1 mM EDTA, pH = 8.0) solution containing 12.5 mM Mg(Ac)2, and the total volume is 20 μL. The mixed molecular tile containing A loop and B loop is annealed in a PCR (polymerase chain reaction) instrument, and the stable molecular tile basic unit is obtained.

[0063] Example 3 21 bp connected 2D array of cDAO@c64nt-E (-E = 4 half helical turns) and its AFM image

[0064] As shown in Figure 3(a) The cDAO@c64nt connecting two different sequences of A and B loops, the helix direction of A and B loops are the same, the 21 bp (-E=4 half-helical turns) ligation is used, i.e. the four overhang 8 bp and 5 nt sticky end cDAO@c64nt tile is used to assemble the 2D array structure.

[0065] The experimental procedure is as follows: the A loop and B loop are mixed with the four straight chains that constitute the stable tile in 1 x TAE (40 mM Tris, 40 mM Hac, 1 mM EDTA, pH=8.0) solution containing 12.5 mM Mg(Ac)2, the final concentration of each DNA chain is 0.5 μM, and the total volume is 20 μL. Then the 2D array of cDAO@c64nt-E is prepared by the step-by-step method or one-pot method in the detailed description.

[0066] Figure 3 The AFM image of (b) shows a single layer of DNA array assembled: about 1.2 nm high, about 2.5 μm wide, about 9 μm long, and with parallel lines nearly perpendicular to the long axis of the single layer of DNA array with a spacing of 18.6 nm (equal to the length of one HJ@c64nt tile plus the 21 bp ligation, i.e. (32+21) bp x 0.34=18.0 nm), the parallel lines are derived from the AFM probe sensing the region of sticky end hybridization (the width of the parallel lines is about 5 bp x 0.34=1.7 nm, and the length is the width of the DNA array). The angle between the parallel lines and the DNA double helix axis is 83 0 . The scale is 1 μm, and there are parallel line segments with a spacing of 18.2 nm in the direction of 83 0 degrees to the long axis of the DNA array (DNA double helix axis direction), and the dark line segments represent the region of 5 nt sticky end hybridization. Figure 3 (a) The schematic diagram in which A and B are two different sequence of c64nt loops, 1 to 4 represent linear single strands paired with the A loop, and 5 to 8 represent linear single strands paired with the B loop, the pairing of DNA sequences and sticky ends correspond to Figure 3 (a) The schematic diagram. The sequences (the writing of the sequence is from left to right, 5' to 3', and "x loop" represents the 5' and 3' head-tail covalently coupled DNA loop) are as follows:

[0067] A loop: TAAGATGAAGATAGCGCACAATGGTCGGATTCCGTCTCTGTCAACTCGTCTATGCCAAGCCCTG

[0068] B loop: CTCAGCTGTGATCATACTATGCTAGTCCTGTAGGTCGCACGACCTGGCGTTCGCATGGCCTAT

[0069] 1 : GACTGCGTGTCAATGCTCACCGATCA

[0070] 2 : GTAGCGCCGTTAGTGGATGTCACCAG

[0071] 3 : GGTGAGCACAGGGCTTGGCATAGACGCTATCTTCATCTTATTGACACG

[0072] 4 : GACATCCAGAATCCGACCATTGTGCGAGTTGACAGAGACGCTAACGGC

[0073] 5 : GCTACATCATGGTCGGATGGCCTGGT

[0074] 6 : CAGTCGTGCGCACGCCTGACGTGATC

[0075] 7 : GCCATCCGGATAGGCCATGCGAACTATGATCACAGCTGAGACCATGAT

[0076] 8 : CGTCAGGCTACAGGACTAGCATAGGCCAGGTCGTGCGACCGTGCGCAC

[0077] Example 4 2D array of 26 bp junctions of cDAO@c64nt-O(-O=5 half helical turns) and its AFM image

[0078] As shown in Figure 4 , the 2D structure was formed by connecting the cDAO@c64nt tiles with 26 bp (-O=5 half helical turns), using four different sequences of A and B loops with 10 bp overhang and 6 nt sticky ends. The helical directions of A and B loops were opposite. When the same type of tiles but adjacent loops were designed with different rotation directions (i.e. corrugation design), the positive and negative surface curvatures of adjacent tiles neutralized, and they could form larger planes, effectively improving the success rate and yield of the experiment.

[0079] The experimental steps were the same as in Example 3.

[0080] The length of the connecting strand between two molecular tiles is 26 bp (2.5 pitches), and the cross-hybridization combination of two terminal 6-base sticky ends constructs a two-dimensional planar structure. The corresponding AFM image shows a nearly vertical parallel line segment with a length of about 1.2 nm, a width of about 700 nm, a length of about 5 μm, and a pitch of 19.7 nm (equal to one HJ@c64nt molecular tile plus the length of the connecting 26 bp, i.e. (32+26) bp x 0.34 = 19.7 nm), which is nearly perpendicular to the long axis of the single-layer DNA array. The parallel line segment is derived from the fact that the AFM probe senses the hybridization region of the sticky end, and the width of the parallel line is about 6 bp x 0.34 = 2.1 nm, and the length is the width of the DNA array. The parallel line segment is perpendicular to the DNA double helix axis. The sequences of the A and B loops are the same as those in Figure 3 (a), and only the numbers in one of the A and B loops are marked, and the unmarked A and B unit structures can be translated and superimposed to obtain (the subsequent schematic diagrams follow the description here), and the pairing of other sequences corresponds to Figure 4 (a). The sequence is as follows:

[0081] A loop: TAAGATGAAGATAGCGCACAATGGTCGGATTCCGTCTCTGTCAACTCGTCTATGCCAAGCCCTG

[0082] B loop: CTCAGCTGTGATCATACTATGCTAGTCCTGTAGGTCGCACGACCTGGCGTTCGCATGGCCTAT

[0083] 1: GACTGCGTGTCAATGCTCACCGATCA

[0084] 2: GTAGCGCCGTTAGTGGATGTCACCAG

[0085] 9: CTGACGTGATCGGTGACAGGGCTTGGCATAGACGCTATCTTCATCTTAGCATTGACAC

[0086] 10: GATGGCCTGGTGACATGAATCCGACCATTGTGCGAGTTGACAGAGACGCCACTAACGG

[0087] 11: GCCATCCGTCGATACGGCACCATGAT

[0088] 12: CGTCAGGCTGCTGTGGTCGTGCGCAC

[0089] 13: CGCTACATCATGGTGCGATAGGCCATGCGAACTATGATCACAGCTGAGCGTATCGACG

[0090] 14:GCAGTCGTGCGCACGATACAGGACTAGCATAGGCCAGGTCGTGCGACCCCACAGCAGC

[0091] Example 5: 21bp linearly connected nanorings and helices composed of asymmetric cDAO@c64nt-E (-E=4) and their AFM diagrams.

[0092] like Figure 5 As shown, the asymmetric aHJ@c64nt structure (a) is formed by adding two base pairs above c64nt (one extra base pair at one end) and subtracting two base pairs below c64nt (one less base pair at one end). Asymmetric acDAO@c64nt molecular structure ( Figure 5 (b) Left) is obtained by constructing an HJ at each end of the asymmetric aHJ@c64nt molecular tile. The cross-linking between the symmetric cDAO@c64nt molecular tiles forms a regular 2D DNA nanostructure. The asymmetric acDAO@c64nt molecular tiles can only be linearly linked to form DNA nanocircles and curved structures with a certain curvature. Figure 5 (b) Right), one side of acDAO@c64nt is 17×2=34bp and the other side is 15×2=30bp. Using 21bp (-E=4 half-helical turns) linear connections (i.e., long side to long side, short side to short side), nanospheres and nanocoils with a width of 5.0nm (two parallel DNA double helices) were obtained. Figure 5 As shown in the AFM plot in (c), the radius of the monolayer DNA nanoloop with a height of 1 nm is between 50 and 100 nm. The minimum radius of curvature of the helix is ​​36 nm (approximately twice the radius of curvature if cDAO@c64nt were considered a completely rigid structure), and the average radius of curvature of the helix is ​​approximately 50 nm. Most helices are interrupted within one turn, and a small number of helices have a radius of curvature greater than 200 nm. The presence of positive and negative curvature within the same helix is ​​due to a 180° change in the double helix at the junction. 0 The reversal.

[0093] The experimental procedure is the same as in Example 3.

[0094] The sequence of ring A and Figure 3 The A sequences are the same, and the pairings of other sequences correspond. Figure 5 (b) The diagram on the left shows that the pairing of the sticky ends is performed by the corresponding 5' and 3' ends of sequences 2 and 3, respectively, with the following sequences:

[0095] A ring: TAAGATGAAGATAGCGCACAATGGTCGGATTCCGTCTCTGTCAACTCGTCTATGCCAAGCCCTG

[0096] 15:TCACCGACTGCGTGTCAATGCGATCA

[0097] 16: GTAGCGCCGTTAGTGG

[0098] 17:GCATTGACCAGGGCTTGGCATAGGCGCTATCTTCATCTTAACGCAGTC

[0099] 18: GGTGACCACTAACCGGAATCCGACCATTGTACGAGTTGACAGAGAGGCGCTACTGATC

[0100] Example 6: tHJ@c84nt molecular tiles without suspended chains

[0101] like Figure 6 As shown, the black polygonal lines of the two isosceles triangles connected head-to-head without any gaps in the middle represent covalently linked c84nt DNA loops. Two dark gray linear DNA strands form an HJ in the middle of the c84nt loop and pair with each side of the c84nt for 16 bp. Two light gray short strands pair with the extra 10 bp single strands at each end of the c84nt to form a stable, dangling chain tHJ@c84nt molecule. In other words, tHJ@c84nt transforms the c84nt loop into two isosceles triangles sharing a single vertex, with a base of 10 bp and a leg of 16 bp. Figure 6 Straight lines and arrows are used to represent DNA strands and their orientation. Simple triangles and connecting line segments facilitate understanding of the tHJ@c84nt structure in subsequent diagrams. Figure 8 Assembly that forms a 2D structure.

[0102] The experimental procedure is the same as in Example 2.

[0103] Example 7: Non-denaturing polyacrylamide gel electrophoresis (PAGE) image of the molecular tile constructed.

[0104] like Figure 7The non-denaturing gel electrophoresis figure shows that the numbers above represent samples 1 to 9, 9 is a DNA Marker (standard DNA molecular chain length band), 1-8 columns correspond to the white band marks several single-stranded DNA hybridization to form a stable complex monomolecular or macromolecular after non-denaturing gel electrophoresis position, the white band below the corresponding DNA hybridization form, from left to right, the sample is: 1) 64 base small ring and its complementary straight chain hybridization to form a double-stranded, which is used for control band; 2) stable molecular tile HJ@c64nt; 3) asymmetric stable molecular tile aHJ@c64nt; 4) HJ@c64nt end head two cut notches are located at the center of symmetry and 8 base pairs away from HJ, two straight chains hybridize with c64nt to form a high molecular nanowire, the band is at the electrophoresis inlet, indicating that the molecular weight is extremely large, which is used for control band; 5) 84nt ring and its complementary straight chain hybridization to form a double-stranded, which is used for control band; 6) HJ@c84nt molecular tile similar to HJ@c64nt structure, two straight chains divide c84nt into two after forming HJ at the geometric center of c84nt, and two cut notches are located at the two ends of c84nt, the band at the electrophoresis inlet and some fuzzy bands near the HJ@c84nt band indicate that there are other hybrid impurities, which is used for control band; 7) stable molecular tile tHJ@c84nt; 8) HJ@c84nt two straight chains hybridized with 84nt ring cut notches are located at the center of symmetry and 10 base pairs away from HJ, two straight chains hybridize with c84nt to form a high molecular nanowire, the band is at the electrophoresis inlet, indicating that the molecular weight is extremely large, which is used for control band; 9) DNA Marker is 500, 400, 300, 200, 150, 100, 75, 50, 25bp.

[0105] Example 8 2D array of 21bp connected tHJ@c84nt-E(-E=4) and its AFM image

[0106] As shown in Figure 8 (a), Figure 6 The dark gray and light gray linear single strands in the tHJ@c84nt molecular tile without hanging chains form a three-arm knot at the four vertices of the two triangle bottom edges, and the corresponding single strands are paired with 8nt or 10nt to leave 5nt or 6nt single-stranded sticky ends, respectively. Two tHJ@c84nt are connected by 21bp to form a 2D array, and its corresponding AFM image ( Figure 8 (b)) shows several nanotubes, about 2 nanometers high, about 150 to 250 nanometers wide, and 5 to 10 micrometers long, and the lattice of the open nanotube is a parallelogram with a side length of 17.5 nanometers, which is close to the theoretical value (32+21)×0.34=18.0 nanometers, and the acute angle is 73 0The connecting arm of tHJ@C84nt molecular tile is composed of 21 bp (-E=4 half-helices) single double strand. The rotation direction of each tHJ@C84nt molecular tile is consistent. The curved surface configuration of tHJ@C84nt molecular tile determines that the array is easy to form nanotube. Since the connecting arm is single double strand, the nanotube is easy to be broken when scanned by AFM probe.

[0107] The experimental procedure is the same as that of Example 3.

[0108] Figure 8 (a) In the schematic diagram, C and D are two different sequences of c84nt ring, respectively. The pairing of other sequences corresponds to Figure 8 (a) Schematic diagram, sequence is:

[0109] C ring: TAAGATGAAGATAGCGCACAATGGTCGGATTCTCAACTCGTATTCTCAACTCGTCTCTGCCCTGACTTCTA

[0110] D ring: AGGTAGCCTGGAGCATAGAGGCATTGGCTGGCCCAGCCCTTGAAGATGAAGATCGTTTGATGTTCCTAACGTACCAAGCACGG

[0111] 19: GACTGCGTGTCAATAGAAGTCAGTGCGATCA

[0112] 20: GTAGCGCCGTTAGTACGAGTTGATGCACCAG

[0113] 21: TGACGTGATCGCAGGCAGAGACGAGTTGACGCTATCTTCATCTTATTGACACG

[0114] 22: ATGGCCTGGTGCAGAATCCGACCATTGTGGAATACGAGTTGAGAACTAACGGC

[0115] 23: GCTACATCATGGTCCGTGCGTTGATCGACGG

[0116] 24: CAGTCGTGCGCCACAAGGGCTGGCAGCAGCC

[0117] 25: GCCATCCGTCGATGTACGTTAGGAACATCATGCTCCAGGCTACCTACCATGAT

[0118] 26: CGTCAGGCTGCTGGCCAGCCAATGCCTCTAAACGATCTTCATCTTTGGCGCAC. Example 9 2D array of 26 bp junctions made of tHJ@c84nt-O(-O=5) and its AFM image

[0119] As shown in Figure 9 , two tHJ@c84nt were connected with 26 bp (-O=5 half-helical turns), and its corresponding AFM image showed a large planar single layer and two layers of structures stacked on top of each other, as well as two-layer nanotube structures, with a single layer thickness of 1 nanometer and a double layer thickness of 2 nanometers; the length of the rhombus in the structure was measured to be 19 nanometers, close to the theoretical value (32+26) x 0.34 = 19.7 nanometers, and the included angle was about 83 0 .

[0120] The experimental procedure was the same as in Example 3.

[0121] Figure 9 (a) The sequences of C and D loops in the schematic diagram are the same as Figure 8 , and the pairing of other sequences and sticky ends corresponds to Figure 9 the schematic diagram of (a), the sequence is:

[0122] C loop: TAAGATGAAGATAGCGCACAATGGTCGGATTCTCAACTCGTATTCTCAACTCGTCTCTGCCCTGACTTCTA

[0123] D loop: AGGTAGCCTGGAGCATAGAGGCATTGGCTGGCCCAGCCCTTGAAGATGAAGATCGTTTGATGTTCCTAACGTACCAAGCACGG

[0124] 27: GACTGCGTGTCAATGCTAGAAGTCAGTCACCGATCA

[0125] 28: GTAGCGCCGTTAGTGGTACGAGTTGAATGTCACCAG

[0126] 29: CTGACGTGATCGGTGAGGCAGAGACGAGTTGACGCTATCTTCATCTTAGCATTGACAC

[0127] 30: GATGGCCTGGTGACATGAATCCGACCATTGTGGAATACGAGTTGAGAACCACTAACGG

[0128] 31: GCCATCCGTCGATACGCCGTGCGTTGGCACCATGAT

[0129] 32: CGTCAGGCTGCTGTGGCAAGGGCTGGTCGTGCGCAC

[0130] 33: CGCTACATCATGGTGCGTACGTTAGGAACATCATGCTCCAGGCTACCTCGTATCGACG

[0131] 34: GCAGTCGTGCGCACGAGCCAGCCAATGCCTCTAAACGATCTTCATCTTCCACAGCAGC。

[0132] Example 10 pDAE@c128nt and pDAE-10bp@c128nt molecular tiles

[0133] As Figure 10 shown, c128nt is folded into a "work" structure with four rows side by side and adjacent rows anti-parallel, similar to two covalently coupled DAE (E = 6) structures side by side, so it is named pDAE@c128nt (p represents parallel). During the experiment, it was found that the yield of the nanostructure produced by the connection of pDAE@c128nt according to 21 and 26 bp was relatively low. We added a 10-bp connection of two auxiliary straight chains in the geometric center of it to obtain the pDAE-10bp@c128nt molecular tile, which is beneficial to the relaxation of this type of molecular tile and the adjustment of the structure. The schematic diagram of the pDAE-10bp@c128nt molecular tile structure is as Figure 11 shown.

[0134] Example 11 2D array of pDAE@c128nt-E (-E = 4) connected by 21 bp and its AFM image

[0135] As Figure 12 shown, there are two pairs of DAE sticky ends on each side of a pDAE@c128nt molecular tile, which is twice the number of cDAO@c64nt sticky ends mentioned above. By analogy with the connection of cDAO@c64nt-E, the two pairs of DAE sticky ends on the left and right sides of pDAE@c128nt are cross-connected, and the connection distance is 21 bp (-E = 4 half helical turns), obtaining a single-layer 2D DNA array with the same rotation direction of all small rings: 1 nm high, 200 to 400 nm wide, 0.5 to 1 μm long, and there are parallel line segments with a spacing period of 18.0 nm in the direction perpendicular to the long axis of the DNA array. E is a DNA small ring of 128 bases, and the pairing of other sequences and sticky ends corresponds Figure 12 to the schematic diagram, and the sequence is:

[0136] E loop: TAAGATGAAGATAGCGCACAATGGTCGGATTCCGTCTCTGTCAACTCGTCTATGCCAAGCCCTGCTCAGCTGT GATCATACTATGCTAGTCCTGTAGGTCGCACGACCTGGCGTTCGCATGGCCTATC

[0137] 35: CCATCCCACGAGAATGCGTTCGTAGC

[0138] 36: GGCTACAGTCTCAAAC

[0139] 37: GAACGCATCGCTATCTTCATCTTAGATAGGCCATGCGAACCTGTAGCCTGACG

[0140] 38: GCAGTGTTTGAGAGCCAGGTCGTGCGACCGAATCCGACCATTGTGTCTCGTGG

[0141] 39: ACTGCAGTGTGAAAGCTCTTACGTCA

[0142] 40: CTAGTAGTGTAATGGT

[0143] 41: TAAGAGCTCGAGTTGACAGAGACGTACAGGACTAGCATAGACTACTAGGCTAC

[0144] 42: GATGGACCATTACTATGATCACAGCTGAGCAGGGCTTGGCATAGATTCACACT.

[0145] Example 12 pDAE@c128nt-O(-O=5) molecular tile 26 bp connected 2D array and its AFM image

[0146] As shown in Figure 13 , each of the left and right sides of a pDAE@c128nt molecular tile has two pairs of DAE cohesive ends, using 26 bp (-O=5 half helical turns) connection, the rotation direction of the left and right adjacent pDAE@c128nt molecular tiles is opposite, and the two pairs of DAE cohesive ends are cross-connected to obtain a single-layer 2D DNA array: 1 nanometer high, 300 to 600 nanometers wide, 0.8 to 1.5 microns long, and parallel line segments with a pitch period of 19.5 nanometers in the direction perpendicular to the long diameter of the DNA array. The sequence of E is the same as Figure 12 , and the pairing of other sequences and cohesive ends correspondsFigure 13 schematic diagram, sequence is:

[0147] E loop: TAAGATGAAGATAGCGCACAATGGTCGGATTCCGTCTCTGTCAACTCGTCTATGCCAAGCCCTGCTCAGCTGT GATCATACTATGCTAGTCCTGTAGGTCGCACGACCTGGCGTTCGCATGGCCTATC

[0148] 43: TGCGCCACGAGATCAACTATGCGTTCTCCG

[0149] 44: GGCTACAGACTAATTCTCAAAC

[0150] 45: GAACGCATAGTCGCTATCTTCATCTTAGATAGGCCATGCGAACAGTCTGTAGCCGTGA

[0151] 46: GGCTGTTTGAGAATTGCCAGGTCGTGCGACCGAATCCGACCATTGTGTGATCTCGTGG

[0152] 47: TAAGAGCTGAACGAGTTGACAGAGACGTACAGGACTAGCATAGAGGACTACTAGTCAC

[0153] 48: AGCCACCATTACCAATATGATCACAGCTGAGCAGGGCTTGGCATAGAGGTTTCACACT

[0154] 49: CGCAAGTGTGAAACCTTCAGCTCTTACGGA

[0155] 50: CTAGTAGTCCTTTGGTAATGGT.

[0156] Example 13 pDAE-10 bp @ C128 nt-E (-E = 4) 2D array of 21 bp connected tiles and AFM image thereof

[0157] As Figure 14As shown, each of the left and right sides of a pDAE-10bp@C128nt tile has two pairs of cohesive ends similar to pDAE@C128nt. When using 21 bp ligation (-E = 4 half-helical turns), all pDAE-10bp@C128nt tiles rotate in the same direction, and the two pairs of cohesive ends on the left and right sides of pDAE-10bp@C128nt-E cross-link to obtain a single-layer 2D DNA array: 1 nm high, 200-400 nm wide, 0.6-1.6 μm long, with rhombic lattice units, 21.5 nm in length, and an acute angle of about 60 degrees. The sequence of E is the same as Figure 12 the schematic diagram of the pairing of other sequences and cohesive ends Figure 14 The sequence is:

[0158] E loop: TAAGATGAAGATAGCGCACAATGGTCGGATTCCGTCTCTGTCAACTCGTCTATGCCAAGCCCTGCTCAGCTGTGATCATACTATGCTAGTCCTGTAGGTCGCACGACCTGGCGTTCGCATGGCCTATC

[0159] 51: CCATCCCACGAGAATGCGTTCGTAGC

[0160] 52: GGCTACAGTCTCAAAC

[0161] 53: GAACGCATCGCTATCTTCATCTTAGATAGGCCATGCGAACCTGTAGCCTGACG

[0162] 54: GCAGTGTTTGAGAGCCAGGTCGTGCGACCGTCATACGACGAATCCGACCATTGTGTCTCGTGG

[0163] 55: ACTGCAGTGTGAAAGCTCTTACGTCA

[0164] 56: CTAGTAGTGTAATGGT

[0165] 57: TAAGAGCTCGAGTTGACAGAGACGGTCGTATGACTACAGGACTAGCATAGACTACTAGGCTAC

[0166] 58: GATGGACCATTACTATGATCACAGCTGAGCAGGGCTTGGCATAGATTCACACT. Example 14 pDAE-10bp@c128nt-O(-O=5) molecular tile 26bp connected 2D array and its AFM image

[0167] As shown in Figure 15 , one pDAE-10bp@c128nt molecular tile has two pairs of sticky ends on its left and right sides, using 26bp connection (-O=5 half helical turns), the rotation direction of the left and right adjacent tDAE-10bp@c128nt molecular tiles is opposite, and the two pairs of sticky ends are cross-connected, obtaining a single-layer 2D DNA array: 1 nanometer high, 200 to 800 nanometers wide, 0.6 to 3 micrometers long, the lattice unit is a rhombus with a side length of 23.0 nanometers and an acute angle of 60 degrees. The sequence of E is the same as Figure 12 , and the pairing of other sequences and sticky ends corresponds to the schematic diagram of Figure 15 , the sequence is:

[0168] E loop: TAAGATGAAGATAGCGCACAATGGTCGGATTCCGTCTCTGTCAACTCGTCTATGCCAAGCCCTGCTCAGCTGT GATCATACTATGCTAGTCCTGTAGGTCGCACGACCTGGCGTTCGCATGGCCTATC

[0169] 59: TGCGCCACGAGATCAACTATGCGTTCTCCG

[0170] 60: GGCTACAGACTAATTCTCAAAC

[0171] 61: GAACGCATAGTCGCTATCTTCATCTTAGATAGGCCATGCGAACAGTCTGTAGCCGTGA

[0172] 62: GGCTGTTTGAGAATTGCCAGGTCGTGCGACCGTCATACGACGAATCCGACCATTGTGTGATCTCGTGG

[0173] 63: TAAGAGCTGAACGAGTTGACAGAGACGGTCGTATGACTACAGGACTAGCATAGAGGACTACTAGTCAC

[0174] 64: AGCCACCATTACCAATATGATCACAGCTGAGCAGGGCTTGGCATAGAGGTTTCACACT

[0175] 65:CGCAAGTGTGAAACCTTCAGCTCTACGGA

[0176] 66: CTAGTAGTCCTTTGGTAATGGT.

[0177] Example 15 5HJ@c64nt molecular tile

[0178] like Figure 16 As shown, in order to construct a 3D structure, we will Figure 16 (a) At the four equal divisions on both sides of the left c64nt sequence, "half-HJs" are constructed, each segment being 8 bp. The two middle "half-HJs" connect within the molecular tile to form a single HJ. The other four "half-HJs" connect with the corresponding "half-HJs" of the external molecular tiles to form single HJs. This can be understood as a molecular tile constructing a total of 5 different HJs, resulting in a 5HJ@c64nt chiral molecular tile (the 5HJ@c64nt molecular tile is not actually an independent stable molecular complex; it is merely a DNA array). The basic structural unit in the column structure includes the sequence and number of DNA molecules, and the structural units arranged in a certain spatial manner (similar to the concept of structural motifs in crystallography). One HJ at the geometric centroid is located in the xy plane, and the other four HJs are classified into two pairs of HJs symmetrically divided into four equal base pairs around the geometric centroid. In the 3D nucleic acid nanostructure constructed in this invention, these two pairs of HJs directly connect two adjacent molecular layers in the z-direction because the thermodynamically stable form of these two pairs of HJs is a BZ transformation of X-shaped cross-packing (BZ). The HJ (switching junction of X-stacking) is specifically named BZ SJX. Each pair of junctions belongs to the same type of BZ SJX, pointing in the same direction along the z-axis, but the two pairs point in different directions along the z-axis. In the actual construction of 3D nanostructures, a pair of BZ SJX symmetrical about the geometric centroid can be removed, and this site can be linked into a linear double strand, thus transforming 5HJ@c64nt into 3HJ@c64nt molecular tiles. 3HJ@c64nt molecular tiles can only be found in the outermost layer along the z-axis, i.e., the top and bottom layers of the 3D array. This controls the number of layers in the DNA nanostructure constructed by this type of molecular tile. Figure 16(a) The sequence on the left can be represented by the two conformations of B-5HJ@c64nt or Z-5HJ@c64nt on the right, with the inner solid cylinder and the outer hollow cylinder representing the DNA double helix, the inner solid cylinder representing the single-stranded loop of c64nt, and the outer hollow cylinder representing the helper straight strand, plotted according to the generally accepted diameter of 2.6 nm of the DNA double helix in aqueous solution as a cylinder, with the inner solid cylinder having a diameter of 1.3 nm and the outer hollow cylinder having a shell thickness of 0.65 nm. Due to the assembly symmetry and periodicity of the DNA array, it can be assumed that the pair of enantiomers B-5HJ@c64nt and Z-5HJ@c64nt have the same geometric size and mirror image shape. The size of the molecular tile model is in aqueous solution, in nanometers, and the position of the molecular tile node and the position of each pair of bases can be perturbed within the sub-nanometer scale range. In the 3D nanostructure constructed by 3HJ@c64nt and 5HJ@c64nt molecular tiles designed in this invention, the ideal structure of B-Z SJX has only B-Z SJX 1 as shown Figure 16 (b) and B-Z SJX 2 Figure 16 (c) The two modes, with the thick cylinder line in the figure representing the double helix structure, B-DNA and Z-DNA representing right-handed and left-handed double helix structures, and the solid arrow representing the direction of the loop DNA scaffold strand, and the dotted curved arrow representing the direction of the helper DNA straight strand.

[0179] Figure 16 Sequence (- represents that it must be connected to another DNA)

[0180] F loop: CCGTATCTGCTCAACTGTCTCTGCCTTAGGCTGGTAACACGCGATAGAAGTAGAATGTCCCGAA

[0181] 67: TTCGGGAC-

[0182] 68: -ATTCTACTAGTTGAGC-

[0183] 69: -GCAGAGACTCTATCGC-

[0184] 70: -GTGTTACC

[0185] 71: AGCCTAAG-

[0186] 72: -AGATACGG

[0187] Example 16 Two-layer molecular tile to form a 60 0 Arrangement of 3D DNA array infinite structure

[0188] AsFigure 17 (a) shown, from left to right, the naming of 1 and 2 layer molecular tiles (1 layer B-3HJ@c64nt, 2 layer Z-3HJ@c64nt), the schematic diagram of two molecular tiles and their arrangement, the sequence and their connection (the two close vertical parallel lines in the middle of each molecular tile represent one HJ, the sequence of molecular tiles in each layer is the same and has the same layer translational symmetry, there are two close parallel lines representing one B-Z SJX 1 junction between B-3HJ@c64nt and Z-3HJ@c64nt at the right side 8 bp away from the middle HJ respectively, there are two close but disconnected parallel lines pointing up and down at the left side 8 bp away from the middle HJ respectively for two molecular tiles, the two close disconnected parallel lines represent "half HJ" or "half B-Z SJX 1", each of which will be connected to the other "half HJ" of the other molecular tile not drawn in the adjacent layer according to the square and upright triangle connection respectively to form one B-Z SJX 1), two layers of molecular tiles are arranged at an angle of about 60 0 arrangement of infinite structure, and the measured AFM image, the B-3HJ@c64nt molecular tiles of the 1st layer (upper layer) and the Z-3HJ@c64nt molecular tiles of the 2nd layer (lower layer) are arranged at an angle of about 60 0 The two-layer 3D DNA array is assembled by arranging the molecular tiles at an angle of about 60 degrees. Figure 17 The connection of the sequences represents that each B-3HJ@c64nt molecular tile of the upper layer uses a pair of two B-Z SJX 1 to connect two Z-3HJ@c64nt molecular tiles of the lower layer respectively, and each Z-3HJ@c64nt molecular tile of the lower layer uses B-Z SJX 1 to connect two B-3HJ@c64nt molecular tiles of the upper layer respectively, one of the B-Z SJX 1 is shown by the direct connection (75 and 76 sequences) on the right side in the sequence, and the other B-Z SJX 1 is represented by the disconnected 73 and 74 sequences in the sequence diagram. Since it is a 3D structure, the Δ and ■ symbols in the disconnected 73 and 74 sequences represent that the B-3HJ@c64nt and Z-3HJ@c64nt where they are located are connected to the corresponding 73 and 74 of the other adjacent but not drawn Z-3HJ@c64nt and B-3HJ@c64nt, because it is an infinite structure, all B-3HJ@c64nt sequences are the same, and all Z-3HJ@c64nt sequences are the same, so the sequences of 73 and 74 in the figure can be directly read out by the sequence connection at the same symbols of Δ and ■. The AFM image of the assembled 3D DNA array is consistent with the size obtained by the theoretical model arrangement, and the adjacent two layers are arranged at an angle of about 60 0The two layers of 3HJ@C64nt are cross-linked, and the bright lines are parallel to the long axis of the B-3HJ@C64nt, with a distance of 9.0 nm and a height of 4.0 nm. In solution, the two layers of 3HJ@C64nt are rolled into nanotubes with a yield of 90%, with a diameter of 20-50 nm and a length of 1-50 μm.

[0189] The two layers of infinite structure are composed of six DNA strands, two C64nt loops, two long helper strands, and two short helper strands:

[0190] G loop: AAGCCCTGTAAGATGAAGATAGCGCACAATGGTCGGATTCCGTCTCTGTCAACTCGTCTATGCC

[0191] H loop: GGCCTATCCTCAGCTGTGATCATACTATGCTAGTCCTGTAGGTCGCACGACCTGGCGTTCGCAT

[0192] 73: GATAGGCCCAGGGCTT

[0193] 74: GGCATAGACGAGTTGATCATCTTAATGCGAACCAGCTGAGGATAGGCC

[0194] 75: CCATTGTGCGCTATCTCAGAGACGTATGATCAGCCAGGTCGTGCGACC

[0195] 76: TAGCATAGGAATCCGA

[0196] Figure 17 (b) The CD spectra of the three-dimensional two-layer DNA array solution as a function of temperature, with the concentration of DNA in the solution normalized to the concentration of a single molecular wafer of 1.0 μM. The CD spectrum at room temperature shows the characteristics of a strange racemic and right-handed helical DNA (a low-intensity negative peak at 260 nm and a low-intensity positive peak at 290 nm), and the CD spectra at 40°C and 50°C show the characteristics of a typical left-handed helical DNA (a positive peak at 250-260 nm and a negative peak at 275-295 nm are typical characteristics of a left-handed helical DNA), and at 60°C it changes to the characteristics of a large number of free single strands and a small amount of right-handed helical DNA (the CD spectrum at 220-320 nm shows a straight line close to an intensity of 0).

[0197] The experimental steps for preparing the 3D DNA array are as follows: All sequences of B-3HJ@c64nt and Z-3HJ@c64nt constituting the infinite structure of the two-layer 3D DNA array are mixed in a 1×TAE (40mM Tris, 40mM Hac, 1mM EDTA, pH=8.0) solution of 40mM Mg(Ac)2. The final concentration of each DNA strand in equimolar proportions can be any value in the range of 50 to 500 nM, and the total volume can be any value in the range of 20 to 200 μL. The cooling process is carried out using the one-pot method described above to obtain the infinite structure of the two-layer 3D DNA array.

[0198] Example 17 Three-layer molecular tiles were respectively used at 60 0 Infinite structure of arranged 3D DNA array

[0199] like Figure 18 As shown in (a), from left to right, the names of the 1st, 2nd, and 3rd molecular tiles (1st layer B-3HJ@c64nt, 2nd layer Z-5HJ@c64nt, 3rd layer B-3HJ@c64nt), a schematic diagram of the three molecular tiles and their arrangement, the sequences and their connections, and the measured AFM diagram are shown. It should be noted that in the connection diagram of the sequences, there is an HJ in the middle of each molecular tile. The direct connection between the first and second layers B-Z SJX-1 (sequences 80 and 81) and the second and third layers B-Z SJX-2 (sequences 80 and 82) is expressed by two adjacent parallel lines. The connection between the molecular tile on the left and the neighboring molecular tiles not shown is represented by solid symbols upright triangles, inverted triangles, squares, and circles to represent the connection of the corresponding sites. In the figure, sequence 77 is directly read through the connection of the same symbol upright triangle, sequence 78 is directly read as a whole sequence through the connection of the same symbol square and circle, and sequence 79 is directly read through the connection of the same symbol inverted triangle. Three-layer molecular tiles at 60 0 The infinitely arranged structure is characterized by: the B-3HJ@c64nt molecular tiles in the first layer (upper layer) and the Z-5HJ@c64nt molecular tiles in the second layer (middle layer) at a ratio of 60... 0 The molecular tiles are arranged at an angle, with the second layer (Z-5HJ@c64nt) and the third (lower) layer (B-3HJ@c64nt) at a 60° angle. 0The angle arrangement, the third layer and the first layer overlap in xy plane projection, B-Z SJX-1 connects the first and second layers, B-Z SJX-2 connects the second and third layers. The connection of the sequence represents that each first layer B-3HJ@c64nt molecular tile uses two B-Z SJX-1 to connect two Z-5HJ@c64nt molecular tiles adjacent to the second layer; similarly, each second layer Z-5HJ@c64nt uses another pair of two B-Z SJX-2 to connect two B-3HJ@c64nt molecular tiles adjacent to the third layer. The AFM image shows the array of the three-layer 3D DNA, which is consistent with the size obtained from the theoretical model arrangement, and the adjacent two layers can be clearly seen at about 60 0 Intersect with each other, the unit cell is rhombus, the unit cell parameters are: side length 10.6 nanometers, acute angle 60 0 , high 6.0 nanometers.

[0200] The three-layer infinite structure is composed of nine DNA chains, three c64nt rings, two long auxiliary chains, and four short auxiliary chains:

[0201] G loop: AAGCCCTGTAAGATGAAGATAGCGCACAATGGTCGGATTCCGTCTCTGTCAACTCGTCTATGCC

[0202] I loop: CTCAGCTGTGATCATACTATGCTAGTCCTGTAGGTCGCACGACCTGGCGTTCGCATGGCCTATC

[0203] J loop: CTGTTGGATTCTAATCCGGATCTCTGTATGGCAAGTCAATTTAGTGGATTGCGAACCACATAGA

[0204] 77: GATAGGCCCAGGGCT

[0205] 78: GGCATAGACGAGTTGATCATCTTAATGCGAACTACAGGACGTTCGCAAGATTAGAATCCAACAG

[0206] 79: TCTATGTGTAGCATAG

[0207] 80: CCATTGTGCGCTATCTCAGAGACGCAGCTGAGGCCAGGTCGAGATCCGTCCACTAAATTGACTT

[0208] 81: TATGATCAGAATCCGA

[0209] 82: GCCATACAGTGCGACC

[0210] Figure 18 (b) is the CD spectrum of the 3D three-layer DNA array solution at room temperature, with the DNA concentration normalized to 1.5 μM of single molecular tile concentration. The CD spectrum at room temperature shows weak features of right-handed helical DNA (the weaker negative peak at 250 nm and the weaker positive peak at 280 nm are characteristic of right-handed helical DNA), due to the two layers of B-DNA and one layer of Z-DNA in the three-layer structure, with the overall effect equivalent to the CD spectrum of a single layer of B-DNA (i.e. equivalent to the CD spectrum of 0.5 μM of single right-handed helical molecular tile concentration).

[0211] The experimental procedure was the same as in Example 16.

[0212] Example 18 Four-layer molecular tiles were arranged in a 60 0 Arrangement of 3D DNA array infinite structure

[0213] As shown in Figure 19 (a), from left to right, are the designations of 1, 2, 3, 4-layer molecular tiles (1-layer B-3HJ@64 nt, 2-layer Z-5HJ@64 nt, 3-layer B-5HJ@64 nt, 4-layer Z-3HJ@64 nt), the schematic diagram of the four molecular tiles and their arrangement, the sequences and their connections, and the AFM image actually measured. To make the individual HJ connections clearer, in the "sequences and their connections", the half of the auxiliary strand of the HJ cross-linking is emphasized, and the other half of the auxiliary strand is omitted. Figure 17 and 18 The two-layer and three-layer 60 0 Arrangement of 3D DNA array infinite structure in the different expression method of the illustration, the adjacent two molecular tiles of the same structure but different individuals of the first layer, the second layer and the fourth layer are drawn, and only the half of the auxiliary strand of the HJ cross-linking is emphasized, and the other half of the auxiliary strand is omitted. The four-layer molecular tiles are arranged in a 60 0 The characteristics of the infinite structure arranged in a 60 0 The characteristics of the infinite structure arranged in a 60 0 The characteristics of the infinite structure arranged in a 60 0The angle between the layers, the first and third layers in the xy plane projection of the substantially overlap, the second and fourth layers in the xy plane projection also substantially overlap, but the connection between the layers are alternately B-Z SJX-1 and B-Z SJX-2, the first and second layers and the third and fourth layers are B-Z SJX-1 junction, the second and third layers are B-Z SJX-2. The sequence of the connection diagram represents each first layer of B-3HJ@c64nt molecular tile using a pair of two B-Z SJX-1 connecting the second layer of two adjacent Z-5HJ@c64nt molecular tile; similarly, each second layer of Z-5HJ@c64nt also with another pair of two B-Z SJX-2 connecting the third layer of two adjacent B-5HJ@c64nt molecular tile; each third layer of B-5HJ@c64nt also with another pair of two B-Z SJX-1 connecting the fourth layer of two adjacent Z-3HJ@c64nt molecular tile. AFM image shows the array of four layers of 3D DNA, which is in line with the size of the theoretical model arrangement, can be clearly seen that the adjacent two layers with about 60 0 Intersect each other, the unit cell is rhombus, the unit cell parameters are: side length 10.6 nanometers, acute angle 60 0 , high 8.0 nanometers.

[0214] Three-layer infinite structure consists of twelve DNA strands, four c64nt rings, two long auxiliary chains, six short auxiliary chains:

[0215] G ring: AAGCCCTGTAAGATGAAGATAGCGCACAATGGTCGGATTCCGTCTCTGTCAACTCGTCTATGCC

[0216] K ring: GGCCTATCCTCAGCTGTGATCATACTATGCTAGTCCTGTAGGTCGCACGACCTGGCGTTCGCAT

[0217] L ring: TTGATGTTAGGTAGCCTGGAGCATAGAGGCATTGGCTGGCCCAGCCCTGTAAGATGAAGATCGT

[0218] M ring: CGTATTCTCCTAACGTACCAACGCACGGCGAAGCTTTCCGTATTCTACTTCTATGACCAGACTT

[0219] 83: GGCATAGAGATAGGC

[0220] 84: ATGCGAACAACATCA

[0221] 85: ACGATCTTAGAATACG

[0222] 86: AAGTCTGGTCATAGAAACGTTAGCATCTTACGGCTACCGCCAGGTCCAGCTGAGCGAGTTGTCATCTTACAGGGCTT

[0223] 87: CCATTGTGTACAGGA

[0224] 88: TAGCATAGGCCAGCCA

[0225] 89: ATGCCTCTCGGAAAGC

[0226] 90: TTCGCCGTGCGTTGGTGTAGAATAATGCTCCAAGGGCTGGTATGATCAGTGCGACCCGCTATCTCAGAGACGGAATCCGA

[0227] Figure 19 (b) is the CD spectrum of the solution of this three-dimensional four-layer DNA array at room temperature, the DNA concentration in the solution is normalized to 2.0 μΜ of the concentration of a single molecular tile, the CD spectrum at room temperature shows more weak features of right-handed helical DNA (a weak negative peak at a wavelength of 250 nanometers and a weak positive peak at 280 nanometers (more than half of the intensity) are characteristic of right-handed helical DNA), this is due to the fact that there are two layers of B-DNA and two layers of Z-DNA in the four-layer structure, the overall effect is racemization, but the self-assembly of DNA cannot reach a yield of 100%, there is always a residual right-handed helical DNA that does not participate in the assembly, and the proportion of racemic DNA is about 60-80% of the total DNA according to the CD spectrum. Figure 18 (b) is the CD spectrum of the solution of this three-dimensional four-layer DNA array at room temperature, the DNA concentration in the solution is normalized to 2.0 μΜ of the concentration of a single molecular tile, the CD spectrum at room temperature shows more weak features of right-handed helical DNA (a weak negative peak at a wavelength of 250 nanometers and a weak positive peak at 280 nanometers (more than half of the intensity) are characteristic of right-handed helical DNA), this is due to the fact that there are two layers of B-DNA and two layers of Z-DNA in the four-layer structure, the overall effect is racemization, but the self-assembly of DNA cannot reach a yield of 100%, there is always a residual right-handed helical DNA that does not participate in the assembly, and the proportion of racemic DNA is about 60-80% of the total DNA according to the CD spectrum.

[0228] The experimental steps are the same as in Example 16.

[0229] Example 19 x-direction defines the width of the three-molecular tile long diameter, two-layer parallel arrangement 3D DNA array structure

[0230] As shown in Figure 20 , the x-direction defines the width of the three-molecular tile long diameter, the z-direction two-layer B-3HJ@c64nt molecular tile, and the y-direction infinite growth parallel structure, here the parallel structure specifically refers to all B-3HJ@c64nt molecular tiles being parallel to the x-axis, the linearly arranged molecular tiles between the same layer are connected by 1 to 4 base sticky ends, and the adjacent two layers in the z-direction are cross-connected by the opened HJ junction. The arrangement and pairing of sequences use the CADNANO program (http: / / cadnano.org / ), as shown in Figure 20(a) Gray scale representation. Values in the left circle represent the number of double helices from 0 to 9 in the horizontal direction. Values 5, 8, 37, 41, 69, 73, 103, and 106 in the upper circle represent the base coordinates of the vertical columns (the first vertical column is numbered 0). 64A1 through 64A6 represent six different sequences of the c64nt loop. The other backfolding lines with square black dots as starting points and arrows as ending points represent helper single strands. The helper single strands are named from the coordinates of the square black dots as starting points to the coordinates of the arrows as ending points. The corresponding sequences are listed below.

[0231] 64A1 Loop CTGTTGGATTCTAATCCGGATCTCTGTATGGCAAGTCAATTTAGTGGATTGCGAACCACATAGA

[0232] 64A2 Loop TAGTCGTGATCTATGCTAGACTAACTAGAATCAGGCGATGTGGAATGAATTTGAGTCTGGTACG

[0233] 64A3 Loop TTGGTACACCTAATTAGTATCTTAGCTAGACTGATATTCGTGTAGCGTCCAACGAGGATGGATT

[0234] 64A4 Loop TGTACTAATCGGATGGCGGCTGGCCCGTGTCCTAGCGTCCCACGATCGTCTGGTAGGGCCGGCC

[0235] 64A5 Loop AATAGGGCCTTGCAGACCTCTGGTGTAATCTACGATCGCATCGGAGACGGTATTGAGTCATGAA

[0236] 64A6 Loop AGATCGTTCAATTTACTACTCGTCTAGTTCTGCGAGGCAATGTGGAGCCCATCCAAGCCTCATC

[0237] 3[5]-4[5]: TTTTCCACTAAACTCAAATTTT

[0238] 5[5]-2[5]: TTTTCATTCCACATCGCCTCGTACCAGATTGACTTTCTATGTGGTTCGCAATTT

[0239] 2

[41] -1

[37] : TTAGAATTAGTCTACG

[0240] 0

[41] -3

[37] : ATAGATCACGACTAGATTCTAGTCCAACAGGCCATACAGAGATCCGAC

[0241] 3

[38] -4

[42] : GCTACACTACCAGAGC

[0242] 5

[38] -2

[42] : ATCGTGGGACGCTAGGCCGGCCCGAATATCAATCCATCCTCGTTGGGA

[0243] 2

[73] -1

[69] : ATTAGGGCCAGCCGGC

[0244] 0

[73] -3

[69] : ATCCGATTAGTACAGGACACGGTGTACCAAAGTCTAGCTAAGATACGT

[0245] 3

[70] -4

[74] : CTCCGATTGGATGGCC

[0246] 5

[70] -2

[74] : TCCACATTGCCTCGGATGAGGCTGCGATCGTTCATGACTCAATACCTA

[0247] 2

[106] -1

[106] : TTTTCTGCAAGGACGAGTATTT

[0248] 0

[106] -3

[106] : TTTGTAAATTGAACGATCTCAGAACTAGCCCTATTTAGATTACACCAGAGGTTT

[0249] Figure 20 The AFM image of (b) shows the nanobelt of B-DNA type, with a width of about 10 nm, a parallel line spacing of 8.0 nm, a height of 2 nm, and a length of 60-160 nm. The angle between the parallel lines of the long axis of 3HJ@64nt and the length of the nanobelt is 62 0 , and the length of the nanobelt is in the range of 40 to 120 nm.

[0250] Figure 20 (c) is the CD spectrum of the two-layer parallel arrangement DNA array solution at room temperature, and the concentration of the DNA in the solution is normalized to the concentration of 0.2 μM per single molecule wafer. The CD spectrum shows the characteristics of right-handed helical DNA (the negative peak at a wavelength of 250 nm and the positive peak at 280 nm are characteristics of right-handed helical DNA), because the two-layer parallel structure is a B-DNA layer, and the overall effect is equivalent to the CD spectrum of two layers of B-DNA.

[0251] Experimental procedure as in Example 16.

[0252] Example 20 Two layers of 60 0 Arrangement of 3D DNA array structures

[0253] Figure 21 Shown is a 3HJ@64 nt tile (in B- and Z-DNA conformations, respectively) with the x- direction defining the width of the three tile long dimensions, two layers in the z-direction, and infinite growth in the y-direction. 0 Crossed arrangement of infinite structures. The HJ connecting the two layers of tiles is a B-Z SJX 1. Figure 21 (a) The grayscale image is explained as in Example 19 Figure 20 (a), and the corresponding sequences are listed below.

[0254] 64A1 loop CTGTTGGATTCTAATCCGGATCTCTGTATGGCAAGTCAATTTAGTGGATTGCGAACCACATAGA

[0255] 64A2 loop TAGTCGTGATCTATGCTAGACTAACTAGAATCAGGCGATGTGGAATGAATTTGAGTCTGGTACG

[0256] 64A3 loop TTGGTACACCTAATTAGTATCTTAGCTAGACTGATATTCGTGTAGCGTCCAACGAGGATGGATT

[0257] 64A4 loop TGTACTAATCGGATGGCGGCTGGCCCGTGTCCTAGCGTCCCACGATCGTCTGGTAGGGCCGGCC

[0258] 64A5 loop AATAGGGCCTTGCAGACCTCTGGTGTAATCTACGATCGCATCGGAGACGGTATTGAGTCATGAA

[0259] 64A6 loop AGATCGTTCAATTTACTACTCGTCTAGTTCTGCGAGGCAATGTGGAGCCCATCCAAGCCTCATC

[0260] 6

[42] -1

[68] : ACCTCTGCAAGTTAGT

[0261] 6

[10] -1

[36] : AGACCATCCGAGAGAT

[0262] 6

[10] -1

[36] : AGACCATCCGAGAGAT

[0263] 3

[101] -8

[75] : GTAGCTCCACACTCGT

[0264] 3

[69] -8

[43] : AGGGTCTCCGAACTCA

[0265] 6

[74] -1

[107] : TGGGTAAATTGTAAGATACTTTT

[0266] 3

[37] -8[4]: CCGCGATCGTGGTTCGCAATTTT

[0267] 0

[74] -3

[68] : TGGGCATAGATCACGACTAGATTCTAGGCCCTATTTAGATTACACCAG 5

[37] -2

[43] : CCGTCATTCCACATCGCCTCGTACCAGTGCGATCGTTCATGACTCAAT

[0268] 4

[42] -7

[36] : AATGATTAGAATCCAACAGGCCATACATTAGTACAGGACACGGGCCAG

[0269] 5

[69] -2

[75] : CTAACGCTACACGAATATCAATCCATCTTGCCTCGGATGAGGCTTGGA

[0270] 0

[107] -3

[100] : TTTTTAATTAGGTGTACCAAAGTCTAGCAACGATCTCAGAACTAGACGA

[0271] 5[4]-2

[11] : TTTTTCCACTAAATTGACTTTCTATGTGGGACGCTAGGCCGGCCCTACC

[0272] Figure 21 The AFM image of (b) shows a nanowire with a width of about 10.4 nm and a height of 4 nm, which is in agreement with the design. The long axes of the adjacent tiles of B- and Z-strands DNA are crossed at 54 0 with the upper layer being a B-3HJ@c64 nt tile, and the angle between the parallel lines of the long axes of the tile and the long diameter of the nanowire is 54 0The parallel lines of the long axis of the B-3HJ@c64nt molecular tile below are parallel to the long axis direction of the nanoribbon. The length of the nanoribbon is in the range of 200 to 800 nanometers, and the spacing with the long axis of 3HJ@c64nt as the parallel line is 8.4 nanometers.

[0273] Figure 21 (c) refers to the two 60-meter layers. 0 The CD spectrum of the arranged 3D DNA array at room temperature, with the DNA concentration in the solution normalized to a single molecule concentration of 2.0 μM. The CD spectrum shows a weak negative peak at 250 nm and a weak positive peak at 280 nm (below). Figure 20 (b) More than half the intensity indicates the characteristics of the remaining unassembled right-handed helical DNA; however, the weak negative peak at 300 nm indicates the characteristics of the left-handed helical DNA solution, due to the 60 0 The two layers arranged are B-DNA and Z-DNA layers, and the overall effect is equivalent to the CD spectrum of a racemic DNA solution.

[0274] The experimental procedure is the same as in Example 16.

[0275] Example 21: Three layers of 60m² with the width of the major axis of three molecular tiles defined in the x-direction. 0 Arranged 3D DNA array structure

[0276] like Figure 22 As shown, the x-direction defines the width of the three molecular tile major axes, the z-direction defines the height of the three DNA double strands, and the y-direction defines the infinitely growing 60 0 An infinite structure with intersecting arrangements. Figure 22 (a) The description of the grayscale image is the same as in Example 19. Figure 20 (a), the corresponding sequence is listed below.

[0277] 64A1 ringCTGTTGGATTCTAATCCGGATCTCTGTATGGCAAGTCAATTTAGTGGATTGCGAACCACATAGA

[0278] 64A2 ringTAGTCGTGATTCTATGCTAGACTAACTAGAATCAGGCGATGTGGAATGAATTTGAGTCTGGTACG

[0279] 64A3 ringTTGGTACACCTAATTAGTATCTTAGCTAGACTGATATTCGTGTAGCGTCCAACGAGGATGGATT

[0280] 64A5 loop AATAGGGCCTTGCAGACCTCTGGTGTAATCTACGATCGCATCGGAGACGGTATTGAGTCATGAA

[0281] 64A6 loop AGATCGTTCAATTTACTACTCGTCTAGTTCTGCGAGGCAATGTGGAGCCCATCCAAGCCTCATC

[0282] 64A7 loop CGGACGCTAACTTCAATGACTCCGACCAGGTCACCTACGGGAAGCCACCAGTGAAACACAGTTA

[0283] 64A8 loop TTTAGATACTCAACAAGACGCTATACGCCCTCAGGCTAAGATGAAGTCTGACCAGTCGCAAGTG

[0284] 64A9 loop TTCTACATCCTAAACAACATCTTTCGAGCACTGATGTCTCGACAGCACTCCCAGAAGAGAGGAC

[0285] 64A10 loop GTGGCTCTTCTATGTGACTCTGGAAGCTGTCTTAGCAGGGTACGACTACCACCCAGTCGTAAGT

[0286] 6

[65] -4

[34] : TCATAGCGTCTAACTG

[0287] 4

[65] -1

[93] : GCGACGAGTAGATTCT

[0288] 7

[94] -3

[125] : CGCTGGGTGGTAGATT

[0289] 3

[94] -0

[66] : TATTGGATGGCGTACC

[0290] 3

[126] -0

[98] : ACTCAATACCAATCCA

[0291] 4

[33] -1

[61] : TGCGGAGTCAGCCATA

[0292] 7

[62] -3

[93] : GTTTCTGGGACAGAAC

[0293] 6

[97] -4

[66] : GAAAAGATGTGATGAG

[0294] 7

[29] -3

[61] : TTTACTGGTCAGACCTG

[0295] 6

[130] -4

[98] : TTTTCCAGAGTTTCATG

[0296] 3

[62] -0

[29] : GTTTTCACTGTCTATGTGTTT

[0297] 4

[97] -1

[130] : ACACCAGAGGAGTCTAGCTTT

[0298] 0

[97] -6

[66] : TCTTAGTCTAGCATAGATCATCGCCTGTAAATTGTTGCCTCGGTGCTGTACTGTAGAAGTCCTC

[0299] 1

[62] -7

[93] : CAACTCAAATTCATTCCACACGACTAGCTCCACAAACGATCTTGTTTAGGGAGACATCAGTGCT

[0300] 1

[29] -7

[61] : TTTGTTCGCAATCCACTAATCCAACAGGTGGCTTCAGCGTCCGTTGTTGAGCTTAGCCTGAGGGC

[0301] 0

[130] -6

[98] : TTTTAAGATACTAATTAGGCGAATATCTCTGCAAGTGCGATCGTAGTCGTAAGAGCCACACTTAC

[0302] 0

[65] -6

[29] : AGGAGATCCGGATTAGAAATTGACTTTTGAAGTTCCGTAGGTGACTTCATTAATCTAAACACTTGCGTTT

[0303] 1

[94] -7

[130] : AGCTCGTTGGACGCTACATGTACCAAGTCTCCGAGCCCTATTCACATAGACCCTGCTAAGACAGCTTTT

[0304] Figure 22 (b) AFM image shows a nanowire with a width of about 10.4 nm and a height of 6 nm, which is consistent with the design. The long axes of the adjacent tiles (B- and Z- layer DNA) are at an angle of 60 0 to each other. The upper layer in the image is a B-3HJ@c64 nt tile, and the angle between the parallel lines of the long axis of the tile and the long axis of the nanowire is 60​​​​​​​​​​0 ; the middle layer is Z-5HJ@C64nt, the parallel line of the long axis of which is parallel to the long diameter of the nanobelt, the molecular tiles of the lower layer B-3HJ@C64nt are in the same plane as the molecular tiles of the upper layer, and the angle between the parallel line of the long axis of the molecular tile and the long diameter of the nanobelt is 60 0 , the length of the nanobelt is in the range of 200 to 600 nanometers, and the interval of the parallel line of the long axis of the 3HJ@C64nt is 9.0 nanometers. The B-Z SJX 1 is and the B-Z SJX 2 are connected to the upper, middle and lower layers of the molecular tiles, respectively.

[0305] The experimental steps are the same as those in Example 16.

[0306] The applications of the molecular tiles or the nucleic acid nanostructures described in the above examples are as follows:

[0307] 1. Preparation and application of B-Z SJX and Z-DNA of any sequence: The prior art makes it very difficult to prepare B-Z SJX and Z-DNA of any sequence under physiological conditions. The above application makes it easy to prepare B-Z SJX and Z-DNA of any sequence. The above-mentioned molecular and nanostructures coexisting with B-Z SJX and B-, Z-DNA or the above-mentioned structures after modification have various applications in vitro and in vivo, including but not limited to the applications of the molecular and nanostructures coexisting with B-Z SJX and B-, Z-DNA in the diagnosis, prevention, and treatment of plant and animal diseases, pests, and human diseases.

[0308] 2. Drug delivery: The fine spatial structure constructed by the above-mentioned DNA molecules has the advantages of high stability, good biocompatibility, and small cytotoxicity. The fine spatial structure itself or the biological macromolecules and various drug molecules contained and carried by the fine spatial structure can be used as drugs, including but not limited to the applications in targeted drug delivery and treatment.

[0309] 3. Sensing and substance detection: The fine spatial structure constructed by the above-mentioned DNA molecules can be used to detect metal ions, various organic and inorganic small molecules, biological macromolecules (such as enzymes, nucleic acids, and proteins), microorganisms (such as viruses, bacteria, and cells), and target molecules of various diseases. Based on the addressability and microscopic visualization of the DNA nanostructure, aptamers and other functional molecules can be embedded or modified on the surface of the DNA nanostructure to form a visualized nano chip, including but not limited to the applications in substance detection and signal transmission.

[0310] 4. Precise positioning modification and placement of molecules and nanoparticles: The fine spatial arrangement structure of the above DNA molecule construction can be used as a scaffold to precisely position the position and coordinates of each base, and various chemical bonds, biological specific binding, physical adsorption, etc. Modification means such as functional molecules, biological macromolecules, nanoclusters or nanoparticles are accurately controlled to the determined base position, and various molecular or nano structures and devices generated thereby and their potential applications.

[0311] 5. Nanodiagnosis and treatment machine: According to the above DNA nanotechnology construction and development of intelligent nanodiagnosis and treatment machine, walking, diagnosis, targeting, and treatment integration in extremely complex human body are realized.

[0312] 6. Information storage and calculation: Because DNA calculation has high parallelism, mobility, high density and low energy consumption, it is suitable for large amount of information storage and parallel processing. Various information storage and calculation developed according to the above DNA nanotechnology, including the security problems of DNA storage information such as key search, information encryption, information hiding and authentication, etc.

[0313] In addition, the present application is not limited to the above-mentioned embodiments, and can be implemented in various ways as long as it does not exceed the scope of the present application. SEQUENCE LISTING <110> Nanjing University <120> A DNA molecular tile or nucleic acid nanostructure thereof and applications thereof <160> 156 <170> SIPOSequenceListing 1.0 <210> 1 <211> 64 <212> DNA <213> Artificial Sequence <400> 1 taagatgaag atagcgcaca atggtcggat tccgtctctg tcaactcgtc tatgccaagc 60 cctg 64 <210> 2 <211> 63 <212> DNA <213> Artificial Sequence <400> 2 ctcagctgtg atcatactat gctagtcctg taggtcgcac gacctggcgt tcgcatggcc 60 tat 63 <210> 3 <211> 26 <212> DNA <213> Artificial Sequence <400> 3 gactgcgtgt caatgctcac cgatca 26 <210> 4 <211> 26 <212> DNA <213> Artificial Sequence <400> 4 gtagcgccgt tagtggatgt caccag 26 <210> 5 <211> 48 <212> DNA <213> Artificial Sequence <400> 5 ggtgagcaca gggcttggca tagacgctat cttcatctta ttgacacg 48 <210> 6 <211> 48 <212> DNA <213> Artificial Sequence <400> 6 gacatccaga atccgaccat tgtgcgagtt gacagagacg ctaacggc 48 <210> 7 <211> 26 <212> DNA <213> Artificial Sequence <400> 7 gctacatcat ggtcggatgg cctggt 26 <210> 8 <211> 26 <212> DNA <213> Artificial Sequence <400> 8 cagtcgtgcg cacgcctgac gtgatc 26 <210> 9 <211> 48 <212> DNA <213> Artificial Sequence <400> 9 gccatccgga taggccatgc gaactatgat cacagctgag accatgat 48 <210> 10 <211> 48 <212> DNA <213> Artificial Sequence <400> 10 cgtcaggcta caggactagc ataggccagg tcgtgcgacc gtgcgcac 48 <210> 11 <211> 58 <212> DNA <213> Artificial Sequence <400> 11 ctgacgtgat cggtgacagg gcttggcata gacgctatct tcatcttagc attgacac 58 <210> 12 <211> 58 <212> DNA <213> Artificial Sequence <400> 12 gatggcctgg tgacatgaat ccgaccattg tgcgagttga cagagacgcc actaacgg 58 <210> 13 <211> 26 <212> DNA <213> Artificial Sequence <400> 13 gccatccgtc gatacggcac catgat 26 <210> 14 <211> 26 <212> DNA <213> Artificial Sequence <400> 14 cgtcaggctg ctgtggtcgt gcgcac 26 <210> 15 <211> 58 <212> DNA <213> Artificial Sequence <400> 15 cgctacatca tggtgcgata ggccatgcga actatgatca cagctgagcg tatcgacg 58 <210> 16 <211> 58 <212> DNA <213> Artificial Sequence <400> 16 gcagtcgtgc gcacgataca ggactagcat aggccaggtc gtgcgacccc acagcagc 58 <210> 17 <211> 26 <212> DNA <213> Artificial Sequence <400> 17 tcaccgactg cgtgtcaatg cgatca 26 <210> 18 <211> 16 <212> DNA <213> Artificial Sequence <400> 18 gtagcgccgt tagtgg 16 <210> 19 <211> 48 <212> DNA <213> Artificial Sequence <400> 19 gcattgacca gggcttggca taggcgctat cttcatctta acgcagtc 48 <210> 20 <211> 58 <212> DNA <213> Artificial Sequence <400> 20 ggtgaccact aaccggaatc cgaccattgt acgagttgac agagaggcgc tactgatc 58 <210> 21 <211> 84 <212> DNA <213> Artificial Sequence <400> 21 taagatgaag atagcgcaca atggtcggat tctcaactcg tattctcaac tcgtattctc 60 aactcgtctc tgccctgact tcta 84 <210> 22 <211> 83 <212> DNA <213> Artificial Sequence <400> 22 aggtagcctg gagcatagag gcattggctg gcccagccct tgaagatgaa gatcgtttga 60 tgttcctaac gtaccaagca cgg 83 <210> 23 <211> 31 <212> DNA <213> Artificial Sequence <400> 23 gactgcgtgt caatagaagt cagtgcgatc a 31 <210> 24 <211> 31 <212> DNA <213> Artificial Sequence <400> 24 gtagcgccgt tagtacgagt tgatgcacca g 31 <210> 25 <211> 53 <212> DNA <213> Artificial Sequence <400> 25 tgacgtgatc gcaggcagag acgagttgac gctatcttca tcttattgac acg 53 <210> 26 <211> 53 <212> DNA <213> Artificial Sequence <400> 26 atggcctggt gcagaatccg accattgtgg aatacgagtt gagaactaac ggc 53 <210> 27 <211> 31 <212> DNA <213> Artificial Sequence <400> 27 gctacatcat ggtccgtgcg ttgatcgacg g 31 <210> 28 <211> 31 <212> DNA <213> Artificial Sequence <400> 28 cagtcgtgcg ccacaagggc tggcagcagc c 31 <210> 29 <211> 53 <212> DNA <213> Artificial Sequence <400> 29 gccatccgtc gatgtacgtt aggaacatca tgctccaggc tacctaccat gat 53 <210> 30 <211> 53 <212> DNA <213> Artificial Sequence <400> 30 cgtcaggctg ctggccagcc aatgcctcta aacgatcttc atctttggcg cac 53 <210> 31 <211> 36 <212> DNA <213> Artificial Sequence <400> 31 gactgcgtgt caatgctaga agtcagtcac cgatca 36 <210> 32 <211> 36 <212> DNA <213> Artificial Sequence <400> 32 gtagcgccgt tagtggtacg agttgaatgt caccag 36 <210> 33 <211> 58 <212> DNA <213> Artificial Sequence <400> 33 ctgacgtgat cggtgaggca gagacgagtt gacgctatct tcatcttagc attgacac 58 <210> 34 <211> 58 <212> DNA <213> Artificial Sequence <400> 34 gatggcctgg tgacatgaat ccgaccattg tggaatacga gttgagaacc actaacgg 58 <210> 35 <211> 36 <212> DNA <213> Artificial Sequence <400> 35 gccatccgtc gatacgccgt gcgttggcac catgat 36 <210> 36 <211> 36 <212> DNA <213> Artificial Sequence <400> 36 cgtcaggctg ctgtggcaag ggctggtcgt gcgcac 36 <210> 37 <211> 58 <212> DNA <213> Artificial Sequence <400> 37 cgctacatca tggtgcgtac gttaggaaca tcatgctcca ggctacctcg tatcgacg 58 <210> 38 <211> 58 <212> DNA <213> Artificial Sequence <400> 38 gcagtcgtgc gcacgagcca gccaatgcct ctaaacgatc ttcatcttcc acagcagc 58 <210> 39 <211> 128 <212> DNA <213> Artificial Sequence <400> 39 taagatgaag atagcgcaca atggtcggat tccgtctctg tcaactcgtc tatgccaagc 60 cctgctcagc tgtgatcata ctatgctagt cctgtaggtc gcacgacctg gcgttcgcat 120 ggcctatc 128 <210> 40 <211> 26 <212> DNA <213> Artificial Sequence <400> 40 ccatcccacg agaatgcgtt cgtagc 26 <210> 41 <211> 16 <212> DNA <213> Artificial Sequence <400> 41 ggctacagtc tcaaac 16 <210> 42 <211> 53 <212> DNA <213> Artificial Sequence <400> 42 gaacgcatcg ctatcttcat cttagatagg ccatgcgaac ctgtagcctg acg 53 <210> 43 <211> 53 <212> DNA <213> Artificial Sequence <400> 43 gcagtgtttg agagccaggt cgtgcgaccg aatccgacca ttgtgtctcg tgg 53 <210> 44 <211> 26 <212> DNA <213> Artificial Sequence <400> 44 actgcagtgt gaaagctctt acgtca 26 <210> 45 <211> 16 <212> DNA <213> Artificial Sequence <400> 45 ctagtagtgt aatggt 16 <210> 46 <211> 53 <212> DNA <213> Artificial Sequence <400> 46 taagagctcg agttgacaga gacgtacagg actagcatag actactaggc tac 53 <210> 47 <211> 53 <212> DNA <213> Artificial Sequence <400> 47 gatggaccat tactatgatc acagctgagc agggcttggc atagattcac act 53 <210> 48 <211> 30 <212> DNA <213> Artificial Sequence <400> 48 tgcgccacga gatcaactat gcgttctccg 30 <210> 49 <211> 22 <212> DNA <213> Artificial Sequence <400> 49 ggctacagac taattctcaa ac 22 <210> 50 <211> 58 <212> DNA <213> Artificial Sequence <400> 50 gaacgcatag tcgctatctt catcttagat aggccatgcg aacagtctgt agccgtga 58 <210> 51 <211> 58 <212> DNA <213> Artificial Sequence <400> 51 ggctgtttga gaattgccag gtcgtgcgac cgaatccgac cattgtgtga tctcgtgg 58 <210> 52 <211> 58 <212> DNA <213> Artificial Sequence <400> 52 taagagctga acgagttgac agagacgtac aggactagca tagaggacta ctagtcac 58 <210> 53 <211> 58 <212> DNA <213> Artificial Sequence <400> 53 agccaccatt accaatatga tcacagctga gcagggcttg gcatagaggt ttcacact 58 <210> 54 <211> 30 <212> DNA <213> Artificial Sequence <400> 54 cgcaagtgtg aaaccttcag ctcttacgga 30 <210> 55 <211> 22 <212> DNA <213> Artificial Sequence <400> 55 ctagtagtcc tttggtaatg gt 22 <210> 56 <211> 26 <212> DNA <213> Artificial Sequence <400> 56 ccatcccacg agaatgcgtt cgtagc 26 <210> 57 <211> 16 <212> DNA <213> Artificial Sequence <400> 57 ggctacagtc tcaaac 16 <210> 58 <211> 53 <212> DNA <213> Artificial Sequence <400> 58 gaacgcatcg ctatcttcat cttagatagg ccatgcgaac ctgtagcctg acg 53 <210> 59 <211> 63 <212> DNA <213> Artificial Sequence <400> 59 gcagtgtttg agagccaggt cgtgcgaccg tcatacgacg aatccgacca ttgtgtctcg 60 tgg 63 <210> 60 <211> 26 <212> DNA <213> Artificial Sequence <400> 60 actgcagtgt gaaagctctt acgtca 26 <210> 61 <211> 16 <212> DNA <213> Artificial Sequence <400> 61 ctagtagtgt aatggt 16 <210> 62 <211> 63 <212> DNA <213> Artificial Sequence <400> 62 taagagctcg agttgacaga gacggtcgta tgactacagg actagcatag actactaggc 60 tac 63 <210> 63 <211> 53 <212> DNA <213> Artificial Sequence <400> 63 gatggaccat tactatgatc acagctgagc agggcttggc atagattcac act 53 <210> 64 <211> 30 <212> DNA <213> Artificial Sequence <400> 64 tgcgccacgagatcaactatgcgttctccg 30 <210> 65 <211> twenty two <212> DNA <213> Artificial Sequence <400> 65 ggctacagac taattctcaa ac 22 <210> 66 <211> 58 <212> DNA <213> Artificial Sequence <400> 66 gaacgcatag tcgctatctt catcttagat aggccatgcg aacagtctgt agccgtga 58 <210> 67 <211> 68 <212> DNA <213> Artificial Sequence <400> 67 ggctgtttga gaattgccag gtcgtgcgac cgtcatacga cgaatccgac cattgtgtga 60 tctcgtgg 68 <210> 68 <211> 68 <212> DNA <213> Artificial Sequence <400> 68 taagagctga acgagttgac agagacggtc gtatgactac aggactagca tagaggacta 60 ctagtcac 68 <210> 69 <211> 58 <212> DNA <213> Artificial Sequence <400> 69 agccaccatt accaatatga tcacagctga gcagggcttg gcatagaggt ttcacact 58 <210> 70 <211> 30 <212> DNA <213> Artificial Sequence <400> 70 cgcaagtgtg aaaccttcag ctcttacgga 30 <210> 71 <211> 22 <212> DNA <213> Artificial Sequence <400> 71 ctagtagtcc tttggtaatg gt 22 <210> 72 <211> 64 <212> DNA <213> Artificial Sequence <400> 72 ccgtatctgc tcaactgtct ctgccttagg ctggtaacac gcgatagaag tagaatgtcc 60 cgaa 64 <210> 73 <211> 8 <212> DNA <213> Artificial Sequence <400> 73 ttcgggac 8 <210> 74 <211> 16 <212> DNA <213> Artificial Sequence <400> 74 attctactag ttgagc 16 <210> 75 <211> 16 <212> DNA <213> Artificial Sequence <400> 75 gcagagactc tatcgc 16 <210> 76 <211> 8 <212> DNA <213> Artificial Sequence <400> 76 gtgttacc 8 <210> 77 <211> 8 <212> DNA <213> Artificial Sequence <400> 77 agcctaag 8 <210> 78 <211> 8 <212> DNA <213> Artificial Sequence <400> 78 agatacgg 8 <210> 79 <211> 64 <212> DNA <213> Artificial Sequence <400> 79 aagccctgta agatgaagat agcgcacaat ggtcggattc cgtctctgtc aactcgtcta 60 tgcc 64 <210> 80 <211> 64 <212> DNA <213> Artificial Sequence <400> 80 ggcctatcct cagctgtgat catactatgc tagtcctgta ggtcgcacga cctggcgttc 60 gcat 64 <210> 81 <211> 16 <212> DNA <213> Artificial Sequence <400> 81 gataggccca gggctt 16 <210> 82 <211> 48 <212> DNA <213> Artificial Sequence <400> 82 ggcatagacg agttgatcat cttaatgcga accagctgag gataggcc 48 <210> 83 <211> 48 <212> DNA <213> Artificial Sequence <400> 83 ccattgtgcg ctatctcaga gacgtatgat cagccaggtc gtgcgacc 48 <210> 84 <211> 16 <212> DNA <213> Artificial Sequence <400> 84 tagcatagga atccga 16 <210> 85 <211> 64 <212> DNA <213> Artificial Sequence <400> 85 ctcagctgtg atcatactat gctagtcctg taggtcgcac gacctggcgt tcgcatggcc 60 tatc 64 <210> 86 <211> 64 <212> DNA <213> Artificial Sequence <400> 86 ctgttggatt ctaatccgga tctctgtatg gcaagtcaat ttagtggatt gcgaaccaca 60 taga 64 <210> 87 <211> 15 <212> DNA <213> Artificial Sequence <400> 87 gataggccca gggct 15 <210> 88 <211> 64 <212> DNA <213> Artificial Sequence <400> 88 ggcatagacg agttgatcat cttaatgcga actacaggac gttcgcaaga ttagaatcca 60 acag 64 <210> 89 <211> 16 <212> DNA <213> Artificial Sequence <400> 89 tctatgtgta gcatag 16 <210> 90 <211> 64 <212> DNA <213> Artificial Sequence <400> 90 ccattgtgcg ctatctcaga gacgcagctg aggccaggtc gagatccgtc cactaaattg 60 actt 64 <210> 91 <211> 16 <212> DNA <213> Artificial Sequence <400> 91 tatgatcaga atccga 16 <210> 92 <211> 16 <212> DNA <213> Artificial Sequence <400> 92 gccatacagt gcgacc 16 <210> 93 <211> 64 <212> DNA <213> Artificial Sequence <400> 93 ggcctatcct cagctgtgat catactatgc tagtcctgta ggtcgcacga cctggcgttc 60 gcat 64 <210> 94 <211> 64 <212> DNA <213> Artificial Sequence <400> 94 ttgatgttag gtagcctgga gcatagaggc attggctggc ccagccctgt aagatgaaga 60 tcgt 64 <210> 95 <211> 64 <212> DNA <213> Artificial Sequence <400> 95 cgtattctcc taacgtacca acgcacggcg aagctttccg tattctactt ctatgaccag 60 actt 64 <210> 96 <211> 15 <212> DNA <213> Artificial Sequence <400> 96 ggcatagaga taggc 15 <210> 97 <211> 15 <212> DNA <213> Artificial Sequence <400> 97 atgcgaacaa catca 15 <210> 98 <211> 16 <212> DNA <213> Artificial Sequence <400> 98 acgatcttag aatacg 16 <210> 99 <211> 77 <212> DNA <213> Artificial Sequence <400> 99 aagtctggtc atagaaacgt tagcatctta cggctaccgc caggtccagc tgagcgagtt 60 gtcatcttac agggctt 77 <210> 100 <211> 15 <212> DNA <213> Artificial Sequence <400> 100 ccattgtgta cagga 15 <210> 101 <211> 16 <212> DNA <213> Artificial Sequence <400> 101 tagcataggc cagcca 16 <210> 102 <211> 16 <212> DNA <213> Artificial Sequence <400> 102 atgcctctcg gaaagc 16 <210> 103 <211> 80 <212> DNA <213> Artificial Sequence <400> 103 ttcgccgtgc gttggtgtag aataatgctc caagggctgg tatgatcagt gcgacccgct 60 atctcagaga cggaatccga 80 <210> 104 <211> 64 <212> DNA <213> Artificial Sequence <400> 104 ctgttggatt ctaatccgga tctctgtatg gcaagtcaat ttagtggatt gcgaaccaca 60 taga 64 <210> 105 <211> 64 <212> DNA <213> Artificial Sequence <400> 105 tagtcgtgat ctatgctaga ctaactagaa tcaggcgatg tggaatgaat ttgagtctgg 60 tacg 64 <210> 106 <211> 64 <212> DNA <213> Artificial Sequence <400> 106 ttggtacacc taattagtat cttagctaga ctgatattcg tgtagcgtcc aacgaggatg 60 gatt 64 <210> 107 <211> 64 <212> DNA <213> Artificial Sequence <400> 107 tgtactaatc ggatggcggc tggcccgtgt cctagcgtcc cacgatcgtc tggtagggcc 60 ggcc 64 <210> 108 <211> 64 <212> DNA <213> Artificial Sequence <400> 108 aatagggcct tgcagacctc tggtgtaatc tacgatcgca tcggagacgg tattgagtca 60 tgaa 64 <210> 109 <211> 64 <212> DNA <213> Artificial Sequence <400> 109 agatcgttca atttactact cgtctagttc tgcgaggcaa tgtggagccc atccaagcct 60 catc 64 <210> 110 <211> 22 <212> DNA <213> Artificial Sequence <400> 110 ttttccacta aactcaaatt tt 22 <210> 111 <211> 54 <212> DNA <213> Artificial Sequence <400> 111 ttttcattcc acatcgcctc gtaccagatt gactttctat gtggttcgca attt 54 <210> 112 <211> 16 <212> DNA <213> Artificial Sequence <400> 112 ttagaattag tctacg 16 <210> 113 <211> 48 <212> DNA <213> Artificial Sequence <400> 113 atagatcacg actagattct agtccaacag gccatacaga gatccgac 48 <210> 114 <211> 16 <212> DNA <213> Artificial Sequence <400> 114 gctacactac cagagc 16 <210> 115 <211> 48 <212> DNA <213> Artificial Sequence <400> 115 atcgtgggac gctaggccgg cccgaatatc aatccatcct cgttggga 48 <210> 116 <211> 16 <212> DNA <213> Artificial Sequence <400> 116 attagggcca gccggc 16 <210> 117 <211> 48 <212> DNA <213> Artificial Sequence <400> 117 atccgattag tacaggacac ggtgtaccaa agtctagcta agatacgt 48 <210> 118 <211> 16 <212> DNA <213> Artificial Sequence <400> 118 ctccgattgg atggcc 16 <210> 119 <211> 48 <212> DNA <213> Artificial Sequence <400> 119 tccacattgc ctcggatgag gctgcgatcg ttcatgactc aataccta 48 <210> 120 <211> 22 <212> DNA <213> Artificial Sequence <400> 120 ttttctgcaa ggacgagtat tt 22 <210> 121 <211> 54 <212> DNA <213> Artificial Sequence <400> 121 tttgtaaatt gaacgatctc agaactagcc ctatttagat tacaccagag gttt 54 <210> 122 <211> 16 <212> DNA <213> Artificial Sequence <400> 122 acctctgcaa gttagt 16 <210> 123 <211> 16 <212> DNA <213> Artificial Sequence <400> 123 agaccatccg agagat 16 <210> 124 <211> 16 <212> DNA <213> Artificial Sequence <400> 124 agaccatccg agagat 16 <210> 125 <211> 16 <212> DNA <213> Artificial Sequence <400> 125 gtagctccac actcgt 16 <210> 126 <211> 16 <212> DNA <213> Artificial Sequence <400> 126 agggtctccg aactca 16 <210> 127 <211> 23 <212> DNA <213> Artificial Sequence <400> 127 tgggtaaatt gtaagatact ttt 23 <210> 128 <211> 23 <212> DNA <213> Artificial Sequence <400> 128 ccgcgatcgt ggttcgcaat ttt 23 <210> 129 <211> 48 <212> DNA <213> Artificial Sequence <400> 129 tgggcataga tcacgactag attctaggcc ctatttagat tacaccag 48 <210> 130 <211> 48 <212> DNA <213> Artificial Sequence <400> 130 ccgtcattcc acatcgcctc gtaccagtgc gatcgttcat gactcaat 48 <210> 131 <211> 48 <212> DNA <213> Artificial Sequence <400> 131 aatgattaga atccaacagg ccatacatta gtacaggaca cgggccag 48 <210> 132 <211> 48 <212> DNA <213> Artificial Sequence <400> 132 ctaacgctac acgaatatca atccatcttg cctcggatga ggcttgga 48 <210> 133 <211> 49 <212> DNA <213> Artificial Sequence <400> 133 tttttaatta ggtgtaccaa agtctagcaa cgatctcaga actagacga 49 <210> 134 <211> 49 <212> DNA <213> Artificial Sequence <400> 134 tttttccact aaattgactt tctatgtggg acgctaggcc ggccctacc 49 <210> 135 <211> 64 <212> DNA <213> Artificial Sequence <400> 135 cggacgctaa cttcaatgac tccgaccagg tcacctacgg gaagccacca gtgaaacaca 60 gtta 64 <210> 136 <211> 64 <212> DNA <213> Artificial Sequence <400> 136 tttagatact caacaagacg ctatacgccc tcaggctaag atgaagtctg accagtcgca 60 agtg 64 <210> 137 <211> 64 <212> DNA <213> Artificial Sequence <400> 137 ttctacatcc taaacaacat ctttcgagca ctgatgtctc gacagcactc ccagaagaga 60 ggac 64 <210> 138 <211> 64 <212> DNA <213> Artificial Sequence <400> 138 gtggctcttc tatgtgactc tggaagctgt cttagcaggg tacgactacc acccagtcgt 60 aagt 64 <210> 139 <211> 16 <212> DNA <213> Artificial Sequence <400> 139 tcatagcgtc taactg 16 <210> 140 <211> 16 <212> DNA <213> Artificial Sequence <400> 140 gcgacgagta gattct 16 <210> 141 <211> 16 <212> DNA <213> Artificial Sequence <400> 141 cgctgggtgg tagatt 16 <210> 142 <211> 16 <212> DNA <213> Artificial Sequence <400> 142 tattggatgg cgtacc 16 <210> 143 <211> 16 <212> DNA <213> Artificial Sequence <400> 143 actcaatacc aatcca 16 <210> 144 <211> 16 <212> DNA <213> Artificial Sequence <400> 144 tgcggagtca gccata 16 <210> 145 <211> 16 <212> DNA <213> Artificial Sequence <400> 145 gtttctggga cagaac 16 <210> 146 <211> 16 <212> DNA <213> Artificial Sequence <400> 146 gaaaagatgt gatgag 16 <210> 147 <211> 17 <212> DNA <213> Artificial Sequence <400> 147 tttactggtc agacctg 17 <210> 148 <211> 17 <212> DNA <213> Artificial Sequence <400> 148 ttttccagag tttcatg 17 <210> 149 <211> 21 <212> DNA <213> Artificial Sequence <400> 149 gttttcactg tctatgtgtt t 21 <210> 150 <211> 21 <212> DNA <213> Artificial Sequence <400> 150 acaccagagg agtctagctt t 21 <210> 151 <211> 64 <212> DNA <213> Artificial Sequence <400> 151 tcttagtcta gcatagatca tcgcctgtaa attgttgcct cggtgctgta ctgtagaagt 60 cctc 64 <210> 152 <211> 64 <212> DNA <213> Artificial Sequence <400> 152 caactcaaat tcattccaca cgactagctc cacaaacgat cttgtttagg gagacatcag 60 tgct 64 <210> 153 <211> 65 <212> DNA <213> Artificial Sequence <400> 153 tttgttcgca atccactaat ccaacaggtg gcttcagcgt ccgttgttga gcttagcctg 60 agggc 65 <210> 154 <211> 65 <212> DNA <213> Artificial Sequence <400> 154 ttttaagata ctaattaggc gaatatctct gcaagtgcga tcgtagtcgt aagagccaca 60 cttac 65 <210> 155 <211> 70 <212> DNA <213> Artificial Sequence <400> 155 aggagatccg gattagaaat tgacttttga agttccgtag gtgacttcat taatctaaac 60 acttgcgttt 70 <210> 156 <211> 69 <212> DNA <213> Artificial Sequence <400> 156 agctcgttgg acgctacatg taccaagtct ccgagcccta ttcacataga ccctgctaag 60 acagctttt 69

Claims

1. A DNA tile, characterized in that, The application relates to a nucleic acid nanoarray construction molecule element structure comprising a small ring single-stranded DNA molecule and a linear single-stranded DNA molecule, the small ring single-stranded DNA molecule is a support chain, the linear single-stranded DNA molecule is an auxiliary chain, the molecule element structure comprises at least one Holliday junction, the length of the small ring single-stranded DNA molecule is 64 nt, when the small ring single-stranded DNA molecule is compressed into a 32 nt length center-symmetrical linear structure in two parallel and anti-parallel modes, two Holliday junctions are introduced at the c64 nt geometric center and are respectively formed by two half-complementary linear single-stranded DNA, and a HJ@c64 nt molecular tile is obtained; when the small ring single-stranded DNA molecule is compressed into a linear structure in an anti-parallel and two-side unequal mode with one side being 34 nt and the other side being 30 nt, two Holliday junctions are introduced at the c64 nt geometric center and are respectively formed by two half-complementary linear single-stranded DNA, and an asymmetric aHJ@c64 nt molecular tile is obtained.

2. The DNA tile of claim 1, wherein, The HJ@c64nt molecular tile has a Holliday knot at each end, and the two ends of the two parallel antiparallel double helical chains are suspended outside the c64nt. i bp and an accompanying j The viscous ends of nt, where 2 < i Integers less than 10, 2 < j Integers less than 21, and 2 i+j =21 or 26, thus obtaining cDAO@c64nt molecular tiles; each end of the aHJ@c64nt molecular tile forms a Holliday knot, and the ends of the two parallel antiparallel double helix chains are suspended outside c64nt. i bp and an accompanying j The viscous ends of nt, where 2 < i Integers less than 10, 2 < j Integers less than 21, and 2 i+j =21 or 26, which gives the asymmetric acDAO@c64nt molecular tile.

3. A DNA tile, characterized in that, The application relates to a nucleic acid nanoarray construction molecule which comprises a small ring single-stranded DNA molecule and linear single-stranded DNA molecules, both of which are combined into an integral structure by base pairing rules, the small ring single-stranded DNA molecule is a support chain, the linear single-stranded DNA molecule is an auxiliary chain, the molecule elementary structure comprises at least one Holliday junction, the length of the small ring single-stranded DNA molecule is 84 nt, when the small ring single-stranded DNA molecule and two linear single-stranded DNA molecules form a Holliday junction at the c84nt geometric center, the two linear single-stranded DNA molecules are bent and respectively complementary to 16 nt on two sides of each half of the c84nt, two other linear single-stranded DNA molecules are introduced, and are complementary to 10 nt on two ends of the c84nt, so as to form two isosceles triangles with a common vertex, four single-stranded DNA molecules continue to extend outward, and the corresponding single-stranded DNA molecules in the same half region are paired and complementary outside the ring, four three-arm junctions are formed at four vertices of two triangle bottom edges, and each overhanging end of the four three-arm junctions is 2-10 bp long and is provided with a sticky end of 2-21 nt, wherein 2 i bp and a sticky end of 2 j nt are attached, 2 i is an integer less than 10, 2 j is an integer less than 21, and 2 i+j =21 or 26, so as to obtain a tHJ@c84nt molecular tile.

4. A DNA tile, characterized in that, This invention comprises small circular single-stranded DNA molecules and linear single-stranded DNA molecules, which are combined according to base pairing rules to form a molecular primitive structure for constructing a nucleic acid nanoarray. The small circular single-stranded DNA molecule serves as the scaffold strand, and the linear single-stranded DNA molecule serves as the auxiliary strand. The molecular primitive structure includes at least one Holliday knot. The small circular single-stranded DNA molecule is 128 nt in length and is stretched into a square with four sides of 32 nt each, with one pair of opposite sides parallel to a two-dimensional Cartesian xy-axis coordinate system. The x-axis is perpendicular to the x-axis, and the other pair of opposite sides is parallel to the y-axis. The midpoints of the pair of opposite sides parallel to the y-axis are pulled towards the center of the square, while the other pair of opposite sides parallel to the x-axis remain parallel and move towards the center, resulting in a four-row "I"-shaped structure. Four single chains are introduced to complement the four rows of opposite sides and extend outwards beyond the c128nt ring. Four more single chains are introduced to complement the two upper and two lower extended single chains on the left and right sides, forming four Holliday knots. The ends of the four anti-parallel double chains are suspended outwards. i bp and an accompanying j The viscous ends of nt, where 2 < i Integers less than 10, 2 < j Integers less than 21, and 2 i+j =21 or 26, which gives pDAE@c128nt molecular tile.

5. A DNA tile according to claim 4, wherein, The two parallel x-axis auxiliary single strands in the middle of the pDAE@c128 nt molecular tile respectively extend out of the c128 nt in a three-arm knot mode at the geometric center and are inserted into a complementary 10 bp connection, and a pDAE-10 bp@c128 nt molecular tile is obtained.

6. A product based on a one- or two-dimensional nucleic acid nanostructure of a periodic arrangement of DNA molecules according to any one of claims 1 to 5, characterized in that, The nucleic acid nanostructure is a one-dimensional structure, and the acDAO@c64 nt-E one-dimensional nano circle or one-dimensional nano helix line is formed by linear connection of the out-of-loop sticky ends of the acDAO@c64 nt molecular tile; the nucleic acid nanostructure is a two-dimensional structure, and the cDAO@c64 nt-E, cDAO@c64 nt-O, tHJ@c84 nt-O, pDAE@c128 nt-E, pDAE@c128 nt-O, pDAE-10 bp@c128 nt-E, pDAE-10 bp@c128 nt-O two-dimensional nano plane or tHJ@c84 nt-E nanotube is formed by cross connection of the out-of-loop sticky ends of the cDAO@c64 nt, tHJ@c84 nt, pDAE@c128 nt or pDAE-10 bp@c128 nt molecular tile.

Images