miRNA biomarkers for the auxiliary diagnosis of tuberculosis and their applications

Abstract

This invention discloses miRNA biomarkers for the auxiliary diagnosis of tuberculosis and their applications. This invention claims protection for the use of substances for detecting miRNAs in serum exosomes in the preparation of products; the purpose of said products is for the diagnosis or auxiliary diagnosis of tuberculosis patients or for the diagnosis or auxiliary diagnosis of active pulmonary tuberculosis patients. The miRNAs are any one or any combination of the following five miRNAs: miR-28-3p, miR-193b-5p, miR-370-3p, miR-1246, and miR-2110. This invention also claims protection for the use of substances for detecting serum exosome miRNAs in the preparation of products; the purpose of said products is for the diagnosis or auxiliary diagnosis of latent tuberculosis infection. The miRNAs are any one or any combination of the following three miRNAs: let-7e-5p, let-7d-5p, and miR-140-5p. This invention lays the foundation for further development of rapid early diagnosis techniques and methods for tuberculosis.

Description

Technical Field

[0001] This invention relates to miRNA biomarkers for the auxiliary diagnosis of tuberculosis and their applications, specifically to miRNA biomarkers in serum exosomes for the auxiliary diagnosis of tuberculosis and their applications. Background Technology

[0002] Currently, the gold standard for tuberculosis diagnosis is bacteriological sputum smear microscopy and sputum culture. However, bacteriological testing has low sensitivity and is time-consuming, hindering the diagnosis and treatment of tuberculosis at all stages. Tuberculosis-susceptible populations (such as children) often face difficulties in sputum collection due to their inability to cooperate with expectoration, further exacerbating the limitations of bacteriological testing. Therefore, finding other diagnostic specimens besides sputum is essential, such as easily collected blood. However, serum and plasma have complex compositions, and true specific molecular markers may be present in trace amounts, making the screening of tuberculosis-specific molecular markers from serum or plasma less than ideal.

[0003] Exosomes are small, double-membrane vesicles, 30-120 nm in size, actively secreted by cells. They can selectively encapsulate proteins, nucleic acids, and lipids, participating in intercellular transport and signal transduction. They are widely present in various bodily fluids, including blood, urine, ascites, amniotic fluid, breast milk, cerebrospinal fluid, and bronchoalveolar lavage fluid. Summary of the Invention

[0004] The purpose of this invention is to provide miRNA biomarkers for the auxiliary diagnosis of tuberculosis and their applications.

[0005] This invention claims protection for the use of a substance for detecting miRNAs in serum exosomes in the preparation of a product; said product is intended for the diagnosis or auxiliary diagnosis of tuberculosis patients. The miRNA is any one or any combination of the following five miRNAs: miR-28-3p, miR-193b-5p, miR-370-3p, miR-1246, and miR-2110.

[0006] This invention also claims the use of a substance for detecting miRNAs in serum exosomes in the preparation of a product; said product is intended for the diagnosis or auxiliary diagnosis of patients with active pulmonary tuberculosis. The miRNA is any one or any combination of the following five miRNAs: miR-28-3p, miR-193b-5p, miR-370-3p, miR-1246, and miR-2110.

[0007] This invention also claims protection for the use of a substance for detecting serum exosomal miRNAs in the preparation of a product; said product is intended for the diagnosis or auxiliary diagnosis of latent tuberculosis infection. The miRNA is any one or any combination of the following three miRNAs: let-7e-5p, let-7d-5p, and miR-140-5p.

[0008] This invention also protects the application of specific miRNAs or combinations of specific miRNAs as diagnostic biomarkers; the specific miRNA is any one of the following five miRNAs: miR-28-3p, miR-193b-5p, miR-370-3p, miR-1246, and miR-2110; the specific miRNA combination is any combination of the following five miRNAs: miR-28-3p, miR-193b-5p, miR-370-3p, miR-1246, and miR-2110; the diagnostic biomarker is a diagnostic biomarker for patients with tuberculosis or patients with active pulmonary tuberculosis. The specific miRNA is a specific miRNA found in serum exosomes. The specific miRNA combination is a combination of specific miRNAs found in serum exosomes.

[0009] This invention also protects the application of specific miRNAs or combinations of specific miRNAs as diagnostic markers; the specific miRNA is any one of the following three miRNAs: let-7e-5p, let-7d-5p, and miR-140-5p; the specific miRNA combination is any combination of the following three miRNAs: let-7e-5p, let-7d-5p, and miR-140-5p; the diagnostic marker is a diagnostic marker for latent tuberculosis infection. The specific miRNA is a specific miRNA found in serum exosomes. The specific miRNA combination is a combination of specific miRNAs found in serum exosomes.

[0010] This invention also protects a kit comprising a substance for detecting specific miRNAs in serum exosomes or a substance for detecting combinations of specific miRNAs in serum exosomes; wherein the specific miRNA is any one of the following five miRNAs: miR-28-3p, miR-193b-5p, miR-370-3p, miR-1246, and miR-2110; wherein the specific miRNA combination is any combination of the following five miRNAs: miR-28-3p, miR-193b-5p, miR-370-3p, miR-1246, and miR-2110; and wherein the kit is intended for the diagnosis or auxiliary diagnosis of tuberculosis patients or for the diagnosis or auxiliary diagnosis of active pulmonary tuberculosis patients.

[0011] This invention also protects a kit comprising a substance for detecting specific miRNAs in serum exosomes or a substance for detecting combinations of specific miRNAs in serum exosomes; wherein the specific miRNA is any one of the following three miRNAs: let-7e-5p, let-7d-5p, and miR-140-5p; and the specific miRNA combination is any combination of the following three miRNAs: let-7e-5p, let-7d-5p, and miR-140-5p; and the kit is intended for the diagnosis or auxiliary diagnosis of latent tuberculosis infection.

[0012] The substance used to detect miRNAs in serum exosomes is specifically a substance that detects the relative expression level of miRNA genes in serum exosomes. The relative expression level is the relative expression level with the U6 gene as an internal reference gene.

[0013] let-7e-5p is shown as sequence 1 in the sequence list.

[0014] let-7d-5p is shown as sequence 2 in the sequence list.

[0015] miR-140-5p is shown as sequence 3 in the sequence listing.

[0016] miR-1246 is shown as sequence 4 in the sequence listing.

[0017] miR-2110 is shown as sequence 5 in the sequence listing.

[0018] miR-370-3p is shown as sequence 6 in the sequence listing.

[0019] miR-28-3p is shown as sequence 7 in the sequence listing.

[0020] miR-193b-5p is shown as sequence 8 in the sequence listing.

[0021] Judgment Criterion I: The threshold for diagnosing latent tuberculosis infection with let-7e-5p is set at 1.25. Individuals with latent tuberculosis infection are judged to have a relative expression level of this miRNA gene in serum exosomes that is greater than or equal to the threshold.

[0022] Judgment Criterion II: The threshold for diagnosing latent tuberculosis infection with let-7d-5p is set at 8.73. Individuals with latent tuberculosis infection are defined as having a relative expression level of this miRNA gene in serum exosomes that is greater than or equal to the threshold.

[0023] Judgment Criterion III: The threshold for diagnosing latent tuberculosis infection with miR-140-5p is set at 1.02. Individuals with latent tuberculosis infection are judged to have a relative expression level of this miRNA gene in serum exosomes that is greater than or equal to the threshold.

[0024] Criterion IV: The threshold for diagnosing active pulmonary tuberculosis with miR-28-3p is set at 1.40. Patients with active pulmonary tuberculosis are defined as those whose relative expression level of this miRNA gene in serum exosomes is greater than or equal to the threshold.

[0025] Criterion V: The threshold for diagnosing active pulmonary tuberculosis with miR-193b-5p is set at 2.30. Patients with active pulmonary tuberculosis are defined as those whose relative expression level of this miRNA gene in serum exosomes is greater than or equal to the threshold.

[0026] Criterion VI: The threshold for diagnosing active pulmonary tuberculosis with miR-370-3p is set at 1.14. Patients with active pulmonary tuberculosis are defined as those whose relative expression level of this miRNA gene in serum exosomes is greater than or equal to the threshold.

[0027] Criterion VII: The threshold for diagnosing active pulmonary tuberculosis with miR-1246 is set at 1.40. Patients with active pulmonary tuberculosis are defined as those whose relative expression level of this miRNA gene in serum exosomes is greater than or equal to the threshold.

[0028] Criterion VIII: The threshold for diagnosing active pulmonary tuberculosis with miR-2110 is set at 1.02. Patients with active pulmonary tuberculosis are defined as those whose relative expression level of this miRNA gene in serum exosomes is greater than or equal to the threshold.

[0029] The reagent kits described above also include a carrier containing any of the above-described judgment criteria.

[0030] The kits described above also include a carrier containing the above judgment criteria I, judgment criteria II and judgment criteria III.

[0031] The kits described above also include a carrier containing the above judgment criteria IV, V, VI, VII and VIII.

[0032] The materials used for detecting the let-7e-5p gene include upstream primers, 5×miScript HiSpecBuffer, 10×miScript Nucleics Mix, miScript Reverse Transcriptase Mix, 2×QuantiTect SYBR Green PCR Master Mix, and 10×miScript Universal Primer. The materials also include upstream primers for the U6 gene. The upstream primers for the let-7e-5p gene are shown in Sequence 9 of the sequence listing. The upstream primers for the U6 gene are shown in Sequence 17 of the sequence listing.

[0033] The materials used for detecting the let-7d-5p gene include upstream primers, 5×miScript HiSpecBuffer, 10×miScript Nucleics Mix, miScript Reverse Transcriptase Mix, 2×QuantiTect SYBR Green PCR Master Mix, and 10×miScript Universal Primer. The materials used for detecting the let-7e-5p gene also include upstream primers for the U6 gene. The upstream primers for the gene are shown in Sequence 10 of the sequence listing. The upstream primers for the U6 gene are shown in Sequence 17 of the sequence listing.

[0034] The materials used for detecting the miR-140-5p gene include upstream primers, 5× miScript HiSpecBuffer, 10× miScript Nucleics Mix, miScript Reverse Transcriptase Mix, 2× QuantiTect SYBR Green PCR Master Mix, and 10× miScript Universal Primer. The materials used for detecting the let-7e-5p gene also include upstream primers for the U6 gene. The upstream primers for the gene are shown in Sequence 11 of the sequence listing. The upstream primers for the U6 gene are shown in Sequence 17 of the sequence listing.

[0035] The materials used for detecting the miR-1246 gene include upstream primers, 5× miScript HiSpec Buffer, 10× miScript Nucleics Mix, miScript Reverse Transcriptase Mix, 2× QuantiTectSYBR Green PCR Master Mix, and 10× miScript Universal Primer. The materials used for detecting the let-7e-5p gene also include upstream primers for the U6 gene. The upstream primers for the gene are shown in Sequence 12 of the sequence listing. The upstream primers for the U6 gene are shown in Sequence 17 of the sequence listing.

[0036] The materials used for detecting the miR-2110 gene include upstream primers, 5× miScript HiSpec Buffer, 10× miScript Nucleics Mix, miScript Reverse Transcriptase Mix, 2× QuantiTectSYBR Green PCR Master Mix, and 10× miScript Universal Primer. The materials used for detecting the let-7e-5p gene also include upstream primers for the U6 gene. The upstream primers for the gene are shown in Sequence 13 of the sequence listing. The upstream primers for the U6 gene are shown in Sequence 17 of the sequence listing.

[0037] The materials used for detecting the miR-370-3p gene include upstream primers, 5× miScript HiSpecBuffer, 10× miScript Nucleics Mix, miScript Reverse Transcriptase Mix, 2× QuantiTect SYBR Green PCR Master Mix, and 10× miScript Universal Primer. The materials used for detecting the let-7e-5p gene also include upstream primers for the U6 gene. The upstream primers for the gene are shown in Sequence 14 of the sequence listing. The upstream primers for the U6 gene are shown in Sequence 17 of the sequence listing.

[0038] The materials used for detecting the miR-28-3p gene include upstream primers, 5× miScript HiSpecBuffer, 10× miScript Nucleics Mix, miScript Reverse Transcriptase Mix, 2× QuantiTect SYBR Green PCR Master Mix, and 10× miScript Universal Primer. The materials used for detecting the let-7e-5p gene also include upstream primers for the U6 gene. The upstream primers for the gene are shown in Sequence 15 of the sequence listing. The upstream primers for the U6 gene are shown in Sequence 17 of the sequence listing.

[0039] The materials used for detecting the miR-193b-5p gene include upstream primers, 5× miScript HiSpecBuffer, 10× miScript Nucleics Mix, miScript Reverse Transcriptase Mix, 2× QuantiTect SYBR Green PCR Master Mix, and 10× miScript Universal Primer. The materials used for detecting the let-7e-5p gene also include upstream primers for the U6 gene. The upstream primers for the gene are shown in Sequence 16 of the sequence listing. The upstream primers for the U6 gene are shown in Sequence 17 of the sequence listing.

[0040] Exosomes are simple in composition, carry specific information about the cell's physiological conditions at that time, and protect nucleic acids from degradation, making them ideal molecular marker carriers. The inventors of this invention used high-throughput RNA-seq technology to characterize the serum exosomal miRNA expression profiles of healthy individuals, those with latent tuberculosis infection, and patients with active tuberculosis. They found significant differences in the serum exosomal miRNA expression profiles among these three groups, exhibiting distinguishable differences. Furthermore, the inventors analyzed the differentially expressed miRNAs among the three groups and screened for serum exosomal miRNAs specifically expressed by individuals with latent tuberculosis infection (LTBI) and patients with active tuberculosis (TB). This invention lays the foundation for further establishing technologies and methods for the early rapid diagnosis of tuberculosis. Attached Figure Description

[0041] Figure 1 This is a photograph of exosomes under a transmission electron microscope.

[0042] Figure 2 This is an immunoelectron micrograph of colloidal gold, an exosome marker.

[0043] Figure 3 The results of pairwise comparison analysis (fold difference ≥ 2, q value < 0.05) of serum exosome miRNA data from three groups of samples and subsequent heatmap plotting.

[0044] Figure 4 The results show the analysis of specifically expressed miRNAs.

[0045] Figure 5 This is the result of let-7e-5p.

[0046] Figure 6 This is the result of let-7d-5p.

[0047] Figure 7 The result is for miR-140-5p.

[0048] Figure 8 The result is for miR-28-3p.

[0049] Figure 9 The result is for miR-193b-5p.

[0050] Figure 10 The result is for miR-370-3p.

[0051] Figure 11 The result is for miR-1246.

[0052] Figure 12 The results are for miR-2110.

[0053] Figure 13 The result is for miR-450a-5p.

[0054] Figure 14 The result is for miR-30c-2-3p.

[0055] Figure 15 The result is for miR-30a-3p.

[0056] Figure 16 The result is for miR-31-3p.

[0057] Figure 17 The result is for miR-143-5p.

[0058] Figure 18 The result is for miR-3928-3p.

[0059] Figure 19 The result is for miR-3150a-5p.

[0060] Figure 20 The result is for miR-3150b-3p. Detailed Implementation

[0061] The following examples are provided to better understand the present invention, but do not limit the invention. Unless otherwise specified, the experimental methods in the following examples are conventional methods. Unless otherwise specified, the experimental materials used in the following examples were purchased from conventional biochemical reagent stores. All quantitative experiments in the following examples were performed in triplicate, and the results were averaged.

[0062] Following the ethical standards of the Declaration of Helsinki and complying with medical ethics norms, the study was reviewed by the Ethics Committee of Beijing Chest Hospital, Capital Medical University, and all participants signed informed consent forms. Healthy individuals met all four of the following criteria: ① Tuberculin skin test (TST) induration diameter <5mm; ② Negative interferon-gamma release assay (IGRA); ③ No history of active tuberculosis or other diseases; ④ Normal chest X-ray. Individuals with latent tuberculosis infection met all four of the following criteria: ① Tuberculin skin test (TST) induration diameter >10mm; ② Positive interferon-gamma release assay (IGRA); ③ No history of active tuberculosis or other diseases; ④ Normal chest X-ray. Patients with active pulmonary tuberculosis met all three of the following criteria: ① Clinical symptoms of pulmonary tuberculosis; ② Tuberculous lesions on chest X-ray; ③ At least two consecutive positive sputum cultures and a positive sputum culture for Mycobacterium tuberculosis.

[0063] Example 1: Discovery of miRNAs that can serve as diagnostic biomarkers

[0064] The healthy population (HC) consisted of 60 healthy individuals. The latent tuberculosis infection population (LTBI) consisted of 60 individuals with latent tuberculosis infection. The active pulmonary tuberculosis population (ATB) consisted of 60 individuals with active pulmonary tuberculosis.

[0065] I. Preparation of the sample cell

[0066] Serum was collected from 60 healthy individuals in the healthy population group, and the serum was mixed (1 ml / sample per individual) to obtain the sample pool for the healthy population. Serum was also collected from 60 individuals with latent tuberculosis infection group, and the serum was mixed (1 ml / sample per individual) to obtain the sample pool for the latent tuberculosis infection group. Serum was further collected from 60 individuals with active pulmonary tuberculosis group, and the serum was mixed (1 ml / sample per individual) to obtain the sample pool for the active pulmonary tuberculosis group.

[0067] II. Extraction of exosomes

[0068] Exosomes were extracted from each sample cell.

[0069] 1. Take the sample cell, centrifuge at 1000g for 15 minutes, and collect the supernatant.

[0070] 2. Take the supernatant obtained in step 1, centrifuge at 4℃ and 16500g for 30 minutes, and collect the supernatant.

[0071] 3. Take the supernatant obtained in step 2, filter it through a filter membrane with a pore size of 0.22 μm, and collect the filtrate.

[0072] 4. Take the filtrate obtained in step 3, centrifuge at 120000g for 3 hours at 4℃, discard the supernatant, invert the centrifuge tube on absorbent paper to drain the liquid on the tube wall, and the precipitate attached to the bottom of the centrifuge tube is the exosome precipitate.

[0073] Morphological observation of exosomes was performed using transmission electron microscopy. The morphology and particle size distribution of exosomes were analyzed using a NanoSight NS300 particle tracking analyzer. Images from the transmission electron microscope are shown below. Figure 1 The exosomes are spherical vesicles with uniform size, about 100 nm in diameter. The peak particle sizes of the exosomes of HC, LTBI and ATB are 95 nm, 105 nm and 117 nm, respectively.

[0074] Exosome markers were detected using colloidal gold-labeled antibodies (all commercially available). See photos. Figure 2 .

[0075] III. RNA Extraction

[0076] Take the exosome precipitate obtained in step two and extract RNA.

[0077] RNA purity and integrity were analyzed by 1% agarose gel electrophoresis, and RNA length distribution was accurately quantified and detected using an Agilent 2100 analyzer. RNA meeting quality control requirements satisfied the following criteria: insert size was acceptable, peak shape was uniform, no extraneous peaks were observed, no adapters or primer dimers were present, and the qPCR detection concentration was ≥2 nM.

[0078] IV. RNA Sequencing and Data Analysis

[0079] 1. RNA that meets quality control requirements is used to construct cDNA libraries for next-generation sequencing using an RNA library construction kit.

[0080] RNA Library Construction Kit: Library Preparation - NEBNext Multiplex Small RNA Sample Prep Set for Illumina, NEB, Catalog No. E7580. Website: https: / / international.neb.com / protocols / 2013 / 06 / 04 / library-preparation-e7580.

[0081] 2. RNA-seq sequencing was performed using an Illumina Hiseq™ 2500-SE50 sequencer to obtain raw data.

[0082] 3. Data Analysis

[0083] The raw data was processed as follows: low-quality reads (reads with a quality value sQ ≤ 5 accounting for more than 50% of the total reads); reads with an N (N indicates undetermined base information) ratio greater than 10% were removed; reads with 5' adapter contamination were removed; reads without 3' adapter sequences and insert fragments were removed; 3' adapter sequences were trimmed; and polyA / T / G / C reads were removed (most of these were consecutive polyA / T / G / C reads, which may have originated from sequencing errors and had low information entropy, so they did not require analysis). The final result was clean reads.

[0084] The software Bowtie (Langmead et al., 2009) was used to locate clean reads from different samples onto the hg38 genome. Matched small RNA tags were searched for miRNAs in the miRBase20.0 database (including miRNAs in existing databases and self-discovered miRNAs) for prediction and secondary structure analysis. RepeatMasker software was used to further remove non-coding sequences (repeat sequences, rRNA, tRNA, snRNA, and snoRNA) from the small RNA tags. Sequencing data were aligned to the human reference genome (hg38). Small RNA expression profiles of serum exosomes from three population groups were obtained: 9,584,942 in healthy individuals, 778,169 in latent tuberculosis infection, and 10,581,000 in active tuberculosis patients. Among these, 688, 612, and 1,198 were miRNA sequences, respectively.

[0085] miRNA expression levels were measured using TPM (transcripts per million). TPM = (number of matched reads / total number of reads) * 1,000,000. Differentially expressed miRNAs among different samples were compared using the DEGseq (2010)R software package, with q-value < 0.05 and |log2(fold change)| > 1 used as screening criteria for significantly differentially expressed genes. Pairwise alignment analysis (fold change ≥ 2, q-value < 0.05) was performed on serum exosomal miRNA data from the three groups of samples, and a heatmap was plotted. (See attached image). Figure 3 A total of 250 differentially expressed miRNAs were found in serum exosomes from healthy individuals, individuals with latent tuberculosis infection, and patients with active tuberculosis. Analysis of specifically expressed miRNAs showed (see...). Figure 4The study found 45 specifically expressed miRNAs in healthy individuals, 18 specifically expressed miRNAs in latent tuberculosis infection individuals, and 67 specifically expressed miRNAs in active tuberculosis patients.

[0086] The top ten miRNAs specifically expressed in serum exosomes from the latent tuberculosis-infected population (LTBI) are as follows: let-7e-5p, let-7d-5p, miR-450a-5p, miR-30c-2-3p, miR-140-5p, miR-378a-5p, miR-30a-3p, let-7d-3p, miR-31-3p, and miR-143-5p.

[0087] The top ten miRNAs specifically expressed in serum exosomes from patients with active tuberculosis (TB) are as follows: miR-1246, miR-2110, miR-370-3p, novel_47, novel_114, miR-3928-3p, miR-28-3p, miR-193b-5p, miR-3150a-5p, and miR-3150b-3p.

[0088] The sequences and TPM values ​​of the 20 miRNAs are shown in Table 1.

[0089] Table 1

[0090]

[0091] Example 2: Further screening of miRNAs from 20 miRNAs that can serve as diagnostic biomarkers.

[0092] Subjects: 10 healthy individuals, 10 individuals with latent tuberculosis infection, and 10 patients with active pulmonary tuberculosis.

[0093] I. Extraction of exosomes

[0094] Serum exosomes were extracted from each subject.

[0095] 1. Collect the subject's serum, centrifuge at 1000g for 15 minutes, and collect the supernatant.

[0096] 2. Take the supernatant obtained in step 1, centrifuge at 4℃ and 16500g for 30 minutes, and collect the supernatant.

[0097] 3. Take the supernatant obtained in step 2, filter it through a filter membrane with a pore size of 0.22 μm, and collect the filtrate.

[0098] 4. Take the filtrate obtained in step 3, centrifuge at 120000g for 3 hours at 4℃, discard the supernatant, invert the centrifuge tube on absorbent paper to drain the liquid on the tube wall, and the precipitate attached to the bottom of the centrifuge tube is the exosome precipitate.

[0099] II. Detection of miRNA levels in exosomes

[0100] 1. Take the exosome precipitate obtained in step one, extract RNA, and reverse transcribe it to obtain cDNA.

[0101] The reverse transcription reaction system (20 μL) contained 4 μL of 5×miScript HiSpec Buffer, 2 μL of 10×miScript Nucleics Mix, 2 μL of miScript Reverse Transcriptase Mix, and 1 μg of total RNA, with the volume made up to RNase-free water. The 5×miScript HiSpec Buffer, 10×miScript Nucleics Mix, and miScript Reverse Transcriptase Mix are all components of the miScript II RT Kit (QIAGEN, catalog number 218161). The reverse transcription system includes commercially available primers, which add a universal tag to the reverse transcription product while completing the reverse transcription.

[0102] Reverse transcription reaction conditions: 37℃ for 60 min; 95℃ for 5 min.

[0103] After the reaction is complete, add 200 μL of ddH2O to the reaction system, mix well, and the product is obtained. Store at 4℃.

[0104] 2. Using cDNA as a template, 20 miRNA genes were detected by real-time PCR.

[0105] The U6 gene was used as an internal reference gene. The upstream primer used to detect the U6 gene was T6-F. T6-F (sequence 17 in the sequence listing): 5′-CTCGCTTCGGCAGCACA-3′.

[0106] The upstream primers used for detecting miRNA genes are the DNA corresponding to each miRNA. The upstream primer used for detecting the let-7e-5p gene is TGAGGTAGGAGGTTGTATAGTT (sequence 9, replacing U with T in sequence 1). The upstream primer used for detecting the let-7d-5p gene is AGAGGTAGTAGGTTGCATAGTT (sequence 10, replacing U with T in sequence 2). The upstream primer used for detecting the miR-140-5p gene is CAGTGGTTTTACCCTATGGTAG (sequence 11, replacing U with T in sequence 3). The upstream primer used for detecting the miR-1246 gene is AATGGATTTTTGGAGCAGG (sequence 12, replacing U with T in sequence 4). The upstream primer used for detecting the miR-2110 gene is TTGGGGAAACGGCCGCTGAGTG (sequence 13, replacing U with T in sequence 5). The upstream primer used for detecting the miR-370-3p gene is GCCTGCTGGGGTGGAACCTGGT (sequence 14, where U in sequence 6 is replaced with T). The upstream primer used for detecting the miR-28-3p gene is CACTAGATTGTGAGCTCCTGGA (sequence 15, where U in sequence 7 is replaced with T). The upstream primer used for detecting the miR-193b-5p gene is CGGGGTTTTGAGGGCGAGATGA (sequence 16, where U in sequence 8 is replaced with T). The upstream primer rules for detecting other miRNA genes are the same as above.

[0107] The reaction system for quantitative real-time PCR (25 μL) consisted of: 12.5 μL 2×QuantiTect SYBR Green PCR Master Mix, 2.5 μL 10×miScript Universal Primer, 2.5 μL upstream primer solution, 2.5 μL product (template) from step 1, and 5 μL RNase-free water. Both the 2×QuantiTect SYBR Green PCR Master Mix and the 10×miScript Universal Primer are components of the miScript SYBR Green PCR Kit (QIAGEN, catalog number 218076). The upstream primer concentration was 1 μM. A negative control without template was included. The 10×miScript Universal Primer provides universal downstream primers corresponding to the universal label.

[0108] The reaction conditions for quantitative real-time PCR were as follows: 95℃ pre-denaturation for 15 min; 94℃ denaturation for 15 s, 55℃ annealing for 30 s, and 70℃ amplification for 30 s, for 40 cycles. Quantitative real-time PCR was performed using an ABI 7500 real-time PCR instrument.

[0109] The results of real-time quantitative PCR were analyzed using ABI 7500 software v2.0.6, with the U6 gene as an internal reference gene. (The remaining text appears to be incomplete and requires further context.) -△Ct The method for calculating the relative abundance of miRNAs (2) -△ct ×10 4 ).

[0110] Figures 5 to 20 The vertical axis represents the relative level of expression.

[0111] The results for let-7e-5p are shown below. Figure 5 See Table 1. The threshold for diagnosing latent tuberculosis infection with Let-7e-5p was set at 1.25 (above or equal to the threshold is considered latent tuberculosis infection). The false negative rate for diagnosing latent tuberculosis infection was 30%, and the false positive rate for diagnosing latent tuberculosis infection from healthy individuals was 30%.

[0112] The results for let-7d-5p are shown below. Figure 6 And Table 2. The threshold for diagnosing latent tuberculosis infection with let-7d-5p was set at 8.73 (greater than or equal to the threshold is considered latent tuberculosis infection). The false negative rate for diagnosing latent tuberculosis infection was 40%, and the false positive rate for diagnosing latent tuberculosis infection from healthy individuals was 10%.

[0113] The results for miR-140-5p are shown below. Figure 7 And Table 3. The threshold for diagnosing latent tuberculosis infection with miR-140-5p was set at 1.02 (greater than or equal to the threshold is considered as latent tuberculosis infection). The false negative rate for diagnosing latent tuberculosis infection was 10%, and the false positive rate for diagnosing latent tuberculosis infection from healthy individuals was 0%.

[0114] The results for miR-28-3p can be found in... Figure 8 See Table 4. The threshold for diagnosing active pulmonary tuberculosis with miR-28-3p was set at 1.40 (greater than or equal to the threshold was considered active pulmonary tuberculosis). The false negative rate for diagnosing active pulmonary tuberculosis was 0%, the false positive rate for diagnosing active pulmonary tuberculosis from healthy individuals was 0%, and the false positive rate for diagnosing active pulmonary tuberculosis from individuals with latent tuberculosis infection was 0%.

[0115] The results for miR-193b-5p are shown below. Figure 9See Table 5. The threshold for diagnosing active pulmonary tuberculosis with miR-193b-5p was set at 2.30 (greater than or equal to the threshold is considered active pulmonary tuberculosis). The false negative rate for diagnosing active pulmonary tuberculosis was 0%, the false positive rate for diagnosing active pulmonary tuberculosis from healthy individuals was 0%, and the false positive rate for diagnosing active pulmonary tuberculosis from individuals with latent tuberculosis infection was 0%.

[0116] The results for miR-370-3p can be found in... Figure 10 See Table 6. The threshold for diagnosing active pulmonary tuberculosis patients with miR-370-3p was set at 1.14 (greater than or equal to the threshold is considered an active pulmonary tuberculosis patient). The false negative rate for diagnosing active pulmonary tuberculosis patients was 0%, the false positive rate for diagnosing active pulmonary tuberculosis patients from healthy individuals was 0%, and the false positive rate for diagnosing active pulmonary tuberculosis patients from latent tuberculosis infection was 0%.

[0117] The results for miR-1246 are shown below. Figure 11 See Table 7. The threshold for diagnosing active pulmonary tuberculosis with miR-1246 was set at 1.40 (greater than or equal to the threshold is considered active pulmonary tuberculosis). The false negative rate for diagnosing active pulmonary tuberculosis was 0%, the false positive rate for diagnosing active pulmonary tuberculosis from healthy individuals was 0%, and the false positive rate for diagnosing active pulmonary tuberculosis from individuals with latent tuberculosis infection was 0%.

[0118] The results for miR-2110 are shown below. Figure 12 See Table 8. The threshold for diagnosing active pulmonary tuberculosis with miR-2110 was set to 1.02 (greater than or equal to the threshold is considered active pulmonary tuberculosis). The false negative rate for diagnosing active pulmonary tuberculosis was 10%, the false positive rate for diagnosing active pulmonary tuberculosis from healthy individuals was 0%, and the false positive rate for diagnosing active pulmonary tuberculosis from individuals with latent tuberculosis infection was 0%.

[0119] miR-450a-5p, miR-30c-2-3p, miR-378a-5p, miR-30a-3p, let-7d-3p, miR-31-3p, and miR-143-5p were all ineffective in diagnosing latent tuberculosis infection. Results for miR-450a-5p are shown below. Figure 13 The results for miR-30c-2-3p can be found in [link to results]. Figure 14 The results for miR-30a-3p can be found in [link to results]. Figure 15 The results for miR-31-3p can be found in [link to results]. Figure 16 The results for miR-143-5p can be found in [link to results]. Figure 17 .

[0120] novel_47, novel_114, miR-3928-3p, miR-3150a-5p, and miR-3150b-3p were all ineffective in diagnosing patients with active tuberculosis. Results for miR-3928-3p are shown below. Figure 18 The results for miR-3150a-5p can be found in [link to results]. Figure 19 The results for miR-3150b-3p can be found in [link to results]. Figure 20 .

[0121] Table 1. Relative abundance of let-7e-5p in serum exosomes

[0122] healthy people Latent tuberculosis infected persons Active pulmonary tuberculosis patients 0.9410619 2.105075 1.708003 0.5258543 5.687541 0.0579034 2.676468 2.901864 0.6324502 0.302305 2.903952 0.000000 0.8373953 3.457224 0.6786264 2.322879 0.6707156 0.3439453 0.8209958 1.744439 0.1001918 0.1601821 1.439664 1.247123 0.7510501 0.4203193 0.8170727 1.513278 0.7819517 0.000000

[0123] Table 2. Relative abundance of let-7d-5p in serum exosomes

[0124] healthy people Latent tuberculosis infected persons Active pulmonary tuberculosis patients 6.343293 10.107080 7.297814 1.907013 31.589830 0.4140489 15.711650 18.448960 1.935005 1.409408 27.984440 0.000000 3.028903 18.188660 2.712995 8.725217 4.635482 2.561687 8.127826 12.730670 1.014315 1.976903 3.214354 6.696028 4.038034 1.857294 4.290594 6.736473 2.946103 0.000000

[0125] Table 3. Relative abundance of miR-140-5p in serum exosomes

[0126] healthy people Latent tuberculosis infected persons Active pulmonary tuberculosis patients 0.3458147 2.162691 1.011208 0.4466698 5.746572 0.02499247 0.9442623 5.119142 0.1951876 0.08345439 6.892261 0.000000 0.3889703 5.937011 0.1127444 0.7657406 1.802819 0.3788507 0.847291 3.224266 0.007877136 0.09178424 2.223135 0.7321143 0.7192042 0.7746133 0.4343818 0.428146 1.026747 0.000000

[0127] Table 4. Relative abundance of miR-28-3p in serum exosomes

[0128] healthy people Latent tuberculosis infected persons Active pulmonary tuberculosis patients 0.7951865 0.5024081 3.981208 0.1850314 0.000000 4.479003 0.7559223 0.2520717 5.463334 0.04615394 0.000000 6.430764 0.2785765 0.4315141 6.316029 0.8658076 0.000000 1.914584 0.4877219 0.07342342 1.928942 0.6398699 0.5045367 2.398396 0.5260894 0.4300618 1.412792 0.5981809 0.000000 2.411378

[0129] Table 5. Relative abundance of miR-193b-5p in serum exosomes

[0130] healthy people Latent tuberculosis infected persons Active pulmonary tuberculosis patients 1.348128 1.221510 2.830096 0.2376548 0.08123808 10.450290 1.231885 0.5516616 7.559833 0.1809933 0.000000 9.330427 0.5341123 0.6460146 5.399077 1.059063 0.6576812 3.404531 1.191686 0.1560114 3.494621 0.1584256 1.229990 3.505606 1.001085 0.548095 3.241221 1.551629 0.000000 2.330689

[0131] Table 6. Relative abundance of miR-370-3p in serum exosomes

[0132]

[0133]

[0134] Table 7. Relative abundance of miR-1246 in serum exosomes

[0135] healthy people Latent tuberculosis infected persons Active pulmonary tuberculosis patients 0.2246684 0.594228 3.836896 0.06689401 0.05594233 2.912880 0.8979955 0.2208801 4.803646 0.06858411 0.003235086 2.460342 0.1423701 0.1298135 4.272040 0.5789711 0.1943623 2.417625 0.3459181 0.1021396 3.388250 0.147022 1.077374 6.544519 0.2516907 1.359462 3.242991 0.6479151 0.000000 3.569066

[0136] Table 8. Relative abundance of miR-2110 in serum exosomes

[0137] healthy people Latent tuberculosis infected persons Active pulmonary tuberculosis patients 0.3458147 1.011208 2.162691 0.4466698 0.02499247 5.746572 0.9442623 0.1951876 5.119142 0.08345439 0.000000 6.892261 0.3889703 0.1127444 5.937011 0.7657406 0.3788507 1.802819 0.847291 0.007877136 3.224266 0.09178424 0.7321143 2.223135 0.7192042 0.4343818 0.7746133 0.428146 0.000000 1.026747

[0138] The above verification revealed that the miRNAs that can be used as diagnostic markers for LTBI are let-7e-5p, let-7d-5p, and miR-140-5p; and the miRNAs that can be used as diagnostic markers for TB are miR-28-3p, miR-193b-5p, miR-370-3p, miR-1246, and miR-2110. SEQUENCE LISTING <110> Beijing Chest Hospital, Capital Medical University <120> miRNA biomarkers for the auxiliary diagnosis of tuberculosis and their applications <130> GNCYX190526 <160> 17 <170> PatentIn version 3.5 <210> 1 <211> twenty two <212> RNA <213> Homo sapiens <400> 1 ugagguagga gguuguauag uu 22 <210> 2 <211> twenty two <212> RNA <213> Homo sapiens <400> 2 agagguagua gguugcauag uu 22 <210> 3 <211> twenty two <212> RNA <213> Homo sapiens <400> 3 cagugguuuu acccuauggu ag 22 <210> 4 <211> 19 <212> RNA <213> Homo sapiens <400> 4 aauggauuuu uggagcagg 19 <210> 5 <211> twenty two <212> RNA <213> Homo sapiens <400> 5 uuggggaaac ggccgcugag and 22 <210> 6 <211> 22 <212> RNA <213> Homo sapiens <400> 6 gccugcuggg guggaaccug gu 22 <210> 7 <211> 22 <212> RNA <213> Homo sapiens <400> 7 cacuagauug ugagcuccug ga 22 <210> 8 <211> 22 <212> RNA <213> Homo sapiens <400> 8 cgggguuuug agggcgagau ga 22 <210> 9 <211> 22 <212> DNA <213> Artificial sequence <400> 9 tgaggtagga ggttgtatag tt 22 <210> 10 <211> 22 <212> DNA <213> Artificial sequence <400> 10 agaggtagta ggttgcatag tt 22 <210> 11 <211> 22 <212> DNA <213> Artificial sequence <400> 11 cagtggtttt accctatggt ag 22 <210> 12 <211> 19 <212> DNA <213> Artificial sequence <400> 12 aatggatttt tggagcagg 19 <210> 13 <211> 22 <212> DNA <213> Artificial sequence <400> 13 ttggggaaac ggccgctgag tg 22 <210> 14 <211> 22 <212> DNA <213> Artificial sequence <400> 14 gcctgctggg gtggaacctg gt 22 <210> 15 <211> 22 <212> DNA <213> Artificial sequence <400> 15 cactagattg tgagctcctg ga 22 <210> 16 <211> 22 <212> DNA <213> Artificial sequence <400> 16 cggggttttg agggcgagat ga 22 <210> 17 <211> 17 <212> DNA <213> Artificial sequence <400> 17 ctcgcttcgg cagcaca 17

Claims

1. Use of a substance for detecting miR-28-3p in serum exosomes in the preparation of a product; the use of the product is for diagnosing or assisting in diagnosing a patient with tuberculosis; The substance for detecting miR-28-3p in serum exosomes comprises a gene upstream primer, 5×miScriptHiSpec Buffer, 10×miScript Nucleics Mix, miScript Reverse Transcriptase Mix, 2×QuantiTect SYBR Green PCR Master Mix and 10×miScript Universal Primer; The gene upstream primer is specifically as shown in sequence 15 of the sequence table, and the 10×miScript Universal Primer provides a universal downstream primer corresponding to a universal tag.

Images