Tissue Organoids

Abstract

Physiologically tailored tissue organoids for monitoring and treating disease and improving individual health are disclosed.

Description

[0001] Statement Regarding Federally Funded Research

[0002] This invention was made with government support under Grant No. R01AR063630 awarded by the National Institutes of Health. The government has certain rights in this invention. Background of the Invention Field of the Invention

[0004] The present disclosure relates to genetically engineered tissue organoids capable of non-invasively reporting biochemical signals sensed in an individual and / or providing therapeutic agents to the individual to monitor and / or treat disease or improve the health of the individual.

[0005] Description of related fields

[0006] Obesity and diabetes are examples of acute and growing global health problems, requiring careful monitoring and therapeutic intervention (see Ahima, RS Digging deeper into obesity, J Clin Invest 121, 2076-2079, 2011). Diabetes in particular usually requires daily monitoring of blood sugar levels. However, this continuous blood monitoring may be inconvenient, time-consuming and painful.

[0007] Additionally, there are many other diseases, such as phenylketonuria, substance addiction, and heart disease, that manifest themselves in elevated blood concentrations of specific disease-related markers or blood factors (e.g., amino acids, illicit chemicals, proteins, lipids, enzymes, metabolites, etc.). However, while some diseases, such as diabetes, may require continuous marker monitoring (i.e., blood glucose levels), others may only require periodic monitoring, such as weekly or monthly, or may even require only sporadic, on-demand monitoring.

[0008] Recent advances in blood factor monitoring provide improved options for individuals (e.g., diabetics who need to monitor blood sugar levels). For example, implantable glucose monitors enable diabetics to continuously monitor blood sugar levels remotely using compatible smart devices. In fact, bio-integrated sensors can solve various monitoring challenges in medicine by continuously transmitting various biological signals (including electrophysiological, physiological, and biochemical information) (see Kim et al. Flexible and stretchable electronics for biointegrated devices. Annual review of biomedical engineering 14, 113-128, 2012).

[0009] Accompanying the need for blood testing in some individuals is the need to receive therapeutic agents to counteract the potential diseases that cause the concentration of disease-related indicators to increase. For example, diabetic patients usually need insulin supplementation. Insulin supplementation is usually self-implemented by injection, which is similar to blood monitoring and may be inconvenient, difficult to remember, time-consuming and painful. Fortunately, with the advancement of blood monitoring technology, new bio-integrated devices become available, which provide greater convenience for individuals who need to regularly self-implement monitoring and therapeutic agent administration. For example, a device combining a glucose monitor and an insulin pump can be used to continuously monitor glucose levels and regularly deliver quick-acting or short-acting insulin through a catheter as needed. In addition, a "smart insulin patch" is being developed, which integrates a thin polymer platform covered with a needle with living beta cells.

[0010] There are other diseases in which a protein or metabolite is nonfunctional or expressed at insufficient levels, but does not elevate the concentration of a specific indicative disease-related marker. For example, hemophilia A and hemophilia B are genetic diseases in which individuals express insufficient amounts of coagulation factors VIII and IX, respectively. However, hemophilia patients can be treated by replacing these missing coagulation factors with those that can be obtained from human blood or recombinantly produced.

[0011] Although the use of novel nanomaterials of bio-integrated device design and manufacturing progress has greatly accelerated the development of in vivo (including brain, heart and skin) applications (see Kim et al. and Choi et al. Recent Advances in Flexible and Stretchable Bio-Electronic Devices Integrated with Nanomaterials. Advanced materials 28, 4203-4218, 2016), the biomechanical interface required for these devices is still problematic. For example, the stability, biocompatibility and potential infection from the implanted device are still technically challenging to the field. In addition, current bio-integrated devices require replacement of batteries and / or therapeutic agent reservoirs, and / or must be replaced by themselves once their service life is reached.

[0012] In view of the foregoing, there is a need for improved, stable, and permanent devices for continuously monitoring disease states and / or administering therapeutic agents that can be physiologically customized for a specific individual. Summary of the invention

[0013] This article provides physiologically tailored tissue organoids and methods for their use in monitoring and treating diseases.

[0014] In the first aspect, the present invention provides physiological customized tissue organoids, which include multiple genetically engineered cells, and the multiple genetically engineered cells include at least one recombinant gene encoding a reporter molecule. The reporter molecule produces a detectable signal when combined with and / or contacted with a predetermined blood factor. In one embodiment, the tissue organoid comprises a layered skin graft grown from cells taken from an individual. In another embodiment, the tissue organoid comprises a cultured skin graft grown from embryonic stem cells, human induced pluripotent stem cells, epidermal stem cells or keratinocytes. In one embodiment, when the tissue organoid is biologically integrated into an individual, the tissue organoid expresses a reporter molecule proportional to the concentration of blood factors in the individual's blood. In other embodiments, blood factors include cells, enzymes, proteins, polypeptides, amino acids, polynucleotides, nucleic acids, sugars, lipids, metabolites, synthetic compounds, naturally occurring compounds, minerals, metals, bacteria, viruses, prions, disease indicators or combinations thereof. In one embodiment, the physiological customized tissue organoid is biologically integrated into an individual. The individual can be an animal.

[0015] In a second aspect, the present invention provides physiologically customized tissue organoids, which include multiple genetically engineered cells, and the multiple genetically engineered cells include at least one recombinant gene encoding a therapeutic agent. When the therapeutic agent is applied to an individual in need, the therapeutic agent improves the health of the individual. In one embodiment, the therapeutic agent includes an enzyme, a protein, a coagulation factor, a vitamin, a peptide, a lipid, a toxin, or a combination thereof. In another embodiment, the expression of the therapeutic agent can be induced by an induction factor. The induction factor can be one or more of the following: heat, cold, light, protein, hormone, lipid, chemical substance, metabolic change, electric potential or electric field and a combination thereof. In one embodiment, when the expression of the therapeutic agent is induced, the therapeutic agent is released into the circulation of the individual. In another embodiment, the physiologically customized tissue organoid can be biologically integrated into the individual. The individual can be an animal. The predetermined blood factor can be glucose.

[0016] In a third aspect, the present invention provides a physiologically tailored tissue organoid comprising a plurality of genetically engineered cells comprising at least one recombinant gene encoding a reporter molecule and at least one recombinant gene encoding a therapeutic agent, wherein the therapeutic agent is expressed as a function of the expression of the reporter molecule.

[0017] In a fourth aspect, the invention provides a method for monitoring blood factors, comprising: biologically integrating a tissue organoid according to any of the foregoing aspects or embodiments into an individual, and detecting a detectable signal generated by a reporter molecule expressed by the tissue organoid in response to a blood factor. The detectable signal is proportional to the concentration of the blood factor in the individual. In one embodiment of the method, the tissue organoid is biologically integrated into the individual by transplantation or surgical implantation. In another embodiment of the method, the detectable signal is detected by one or more of a fluorometer, a colorimeter, a bioluminescent monitoring system, and an electrical system with appropriate electrodes.

[0018] In a fifth aspect, the present invention provides a method of treating a disease in an individual in need thereof. The method comprises integrating a tissue organoid according to any one of the preceding aspects or embodiments into the individual and administering a therapeutic agent to the individual. In one embodiment, the individual is a human.

[0019] In a sixth aspect, the present invention provides physiologically customized tissue organoids comprising a genetically engineered cell population comprising at least one recombinant gene encoding a therapeutic agent. The therapeutic agent comprises at least one of mGLP1 and hBChE, and when the therapeutic agent is administered to an individual in need, the therapeutic agent improves the health of the individual. In one embodiment, the therapeutic agent improves the health of the individual by reducing the individual's seeking and / or consumption of at least one of nicotine, alcohol, cocaine, and amphetamine.

[0020] In a seventh aspect, the present invention provides a method of treating cocaine addiction in an individual in need thereof, the method comprising: contacting a tissue organoid with the individual, the tissue organoid comprising a genetically engineered cell population comprising at least one recombinant gene encoding a therapeutic agent, wherein the therapeutic agent comprises hBChE. In one embodiment, the tissue organoid is transplanted into the individual. In one embodiment, the hBChE is constitutively expressed or induced to be expressed by using an inducing factor. In one embodiment, the expression of hBChE hydrolyzes cocaine in the blood of the individual. In one embodiment, the expression of hBChE results in a decrease in cocaine seeking and / or consumption in the individual.

[0021] In an eighth aspect, the present invention provides a method for treating AUD in an individual in need thereof, the method comprising: contacting a tissue organoid with the individual, the tissue organoid comprising a genetically engineered cell population, the genetically engineered cell population comprising at least one recombinant gene encoding a therapeutic agent, wherein the therapeutic agent comprises mGLP1 or an analog thereof. In one embodiment, the tissue organoid is transplanted into the individual. In one embodiment, mGLP1 or an analog thereof is constitutively expressed or expressed by inducing an induction factor. In one embodiment, the expression of mGLP1 or an analog thereof results in a decrease in alcohol seeking and / or consumption by the individual.

[0022] In a ninth aspect, the present invention provides a method for treating nicotine addiction in an individual in need thereof, the method comprising: contacting a tissue organoid with an individual, the tissue organoid comprising a genetically engineered cell population, the genetically engineered cell population comprising at least one recombinant gene encoding a therapeutic agent, wherein the therapeutic agent comprises mGLP1 or an analog thereof. In one embodiment, the tissue organoid is transplanted into the individual. In one embodiment, mGLP1 or an analog thereof is constitutively expressed or expressed by inducing expression with an inducing factor. In one embodiment, expression of mGLP1 or an analog thereof results in reduced nicotine seeking and / or consumption in the individual.

[0023] In a tenth aspect, the present invention provides a method for treating amphetamine addiction in an individual in need thereof, the method comprising: contacting a tissue organoid with an individual, the tissue organoid comprising a genetically engineered cell population, the genetically engineered cell population comprising at least one recombinant gene encoding a therapeutic agent, wherein the therapeutic agent comprises mGLP1 or its analog. In one embodiment, the tissue organoid is transplanted into the individual. In one embodiment, mGLP1 or its analog is constitutively expressed or expressed by inducing expression with an induction factor. In one embodiment, the expression of mGLP1 reduces amphetamine seeking and / or consumption in the individual.

[0024] In an eleventh aspect, the present invention provides a method for treating obesity in an individual in need thereof, the method comprising: contacting a tissue organoid with an individual, the tissue organoid comprising a genetically engineered cell population, the genetically engineered cell population comprising at least one recombinant gene encoding a therapeutic agent, wherein the therapeutic agent comprises peptide tyrosine tyrosine (PYY) or an analog thereof. In one embodiment, the tissue organoid is transplanted into the individual. In one embodiment, PYY or an analog thereof is constitutively expressed or expressed by inducing expression with an induction factor. In one embodiment, the expression of PYY results in a decrease in food seeking and / or consumption by the individual.

[0025] In a twelfth aspect, the present invention provides a method for treating the effects of aging in an individual in need thereof, the method comprising contacting a tissue organoid with the individual, the tissue organoid comprising a genetically engineered cell population, the genetically engineered cell population comprising at least one recombinant gene encoding a therapeutic agent, wherein the therapeutic agent comprises tissue inhibitor of metalloproteinases 2 (TIMP2) or an analog thereof. In one embodiment, the tissue organoid is transplanted into the individual. In one embodiment, TIMP2 or an analog thereof is constitutively expressed or expressed by inducing expression with an induction factor. In one embodiment, the expression of TIMP2 reduces the negative effects of aging in the individual. In one embodiment, the negative effects of aging include memory loss, reduced vascular response, and / or reduced immune response.

[0026] These and other features and advantages of the present invention will be more fully understood from the following detailed description taken in conjunction with the appended claims.It should be noted that the scope of the claims is defined by the recitation therein rather than by the specific discussion of the features and advantages set forth in this specification. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 . Development of a mouse-to-mouse skin gene transfer model utilizing an immunocompetent host. Figure 1 A: Diagram of the skin gene transfer strategy. Primary skin stem cells are isolated and cultured from a patient's skin biopsy. The cells are genetically modified using genome editing technology and the resulting cells are used to generate skin organoids and transplanted into the same patient for clinical application. Figure 1 B: Images of immunocompetent mice (CD1 strain or C57BL / 6J strain) transplanted with isogenic skin organoids, with (left two panels) or without (right panel, direct transplantation) the aid of a skin dome chamber for transplantation. Intravital imaging shows efficient incorporation of transplanted cells expressing luciferase (Luc) after transplantation. Ctrl: Control. Figure 1 C: CD1 skin sections with transplanted H2B-RFP expressing keratinocytes were stained with DAPI. The dotted line indicates the dermal-epidermal boundary. The arrow indicates the boundary between the transplanted skin and the host skin. Scale bar = 50 μm. Epi: epidermis, Der: dermis, HF: hair follicle. Panels DF: Sections of transplanted skin and adjacent host skin were immunostained with the different antibodies as indicated (Krt14: keratin 14, Krt10: keratin 10, Lor: loricrin, β4: β4-integrin, CD104). Scale bar = 50 μm. Figure 1G: Proliferation of epidermal cells in host or transplanted skin one or four weeks after skin transplantation was determined and quantified by immunohistological staining with an antibody against phosphor-histone H3. After skin transplantation, a significant decrease in cell proliferation was observed over time, most likely due to skin wound healing. There was no significant change in cell proliferation between transplanted skin and adjacent host skin (P>0.05). Error bars represent sd (standard deviation) unless otherwise stated. Sample size (n) = 7 (7 represents sections obtained from 3 different animals in each group).

[0028] Figure 2 .Using CRISPR to modify skin epidermal stem cells. Figure 2 A: Diagram showing the Rosa26 targeting strategy for expressing the glucose sensor GGBP. The targeting vector contains two Rosa26 homology arms flanking the GGBP expression cassette and a selectable marker (puromycin resistance gene, Puro) via the constitutive promoter UbiC (ubiquitin C promoter). GGBP and Puro are separated by the self-cleavable peptide T2A. Figure 2 B: Integration of the targeting vector into the Rosa26 locus was verified by PCR (left panel) and Southern blot (right panel). Positive clones showed an additional band of the expected size. Figure 2 C: Expression of GGBP sensor in target cells confirmed by fluorescence imaging. Scale bar = 20 μm. Figure 2 D: FRET ratio images were pseudo-colored to demonstrate glucose-dependent ratio changes in engineered cells. Red indicates high (H) FRET efficiency and blue indicates low (L) efficiency. M: Medium FRET efficiency, the integration of the ratio relative to the entire cell was used to quantify FRET ratio changes. Figure 2 E: FRET ratio changes of the GGBP reporter were measured in the presence of various monosaccharides or oligosaccharides at different concentrations. Note: only glucose and galactose resulted in significant FRET ratio changes (P<0.01). n>6 (single cells). Figure 2 F: FACS (fluorescence activated cell sorting) shows similar cell cycle profiles of WT (wild type) and GGBP expressing epidermal stem cells. PI: propidium iodide. Figure 2 G: Western blot analysis of the expression of early (Krt10) and late (loricrin) differentiation markers in WT and GGBP-expressing cells after calcium shift. Band intensities were determined by densitometry and fold induction was quantified. n=4 (4 independent tests). P>0.05. Figure 2H: WT cells or GGBP cells were tested for anchorage-independent growth in soft agar. Note: WT or GGBP cells did not grow, but tumor-initiating cells isolated from skin SCC (squamous cell carcinoma) could easily generate colonies in soft agar plates. n=3. P<0.01 (between WT and SCC or GGBP and SCC).

[0029] Figure 3 .Transfection of skin cells in vivo using electroporation. Figure 3 A: CD1 mice were intradermally electroporated with plasmid DNA encoding luciferase. Luciferase expression was determined by bioluminescence imaging two days after treatment. Figure 3 B: CD1 mice were intradermally electroporated with plasmid DNA encoding tdTomato. Red fluorescent protein expression was determined by live imaging using two-photon microscopy. Arrows indicate cells expressing tdTomato in the skin.

[0030] Figure 4 .Monitoring changes in blood glucose levels in vivo using the GGBP reporter. Figure 4 A: Skin organoids were developed from control or GGBP-producing cells and transplanted into CD1 mice. Figure 4 B: Glucose fluctuations were induced in transplanted animals using IPGTT (intraperitoneal glucose tolerance test). FRET ratio images were pseudo-colored to demonstrate glucose-dependent ratio changes in transplanted skin. Red indicates high FRET efficiency and blue indicates low efficiency. Figure 4 C and 4D: Correlation of FRET ratio with blood glucose concentration during IPGTT (intraperitoneal glucose tolerance test). n=9 (integrated FRET values ​​from 9 different fields at each time point). Figure 4 E and 4F: Insulin injection was used to induce hypoglycemia in transplanted animals. Intravital imaging with transplanted skin shows the correlation between the FRET ratio of the GGBP reporter and blood glucose concentration. n=9 (integrated FRET values ​​from 9 different fields at each time point). Figure 4 G: GLP1 secretion in the cell culture medium was determined by ELISA (enzyme-linked immunosorbent assay). n=3 (3 independent tests). P<0.01. Figure 4 H: Conditioned media were collected from different cell cultures and used to treat starved insulinoma cells. In vitro insulin secretion was determined by ELISA. n=4 (4 independent tests). P<0.01. Figure 4 I: Images of control and GLP1 animals fed with HFD (high fat diet). Figure 4J: Body weight changes of different groups of mice measured starting from ~10 weeks of age. Note that HFD induced significant obesity in control mice (P<0.01, between control mice fed with normal diet or HFD for 8-10 weeks), but expression of GLP1 inhibited body weight gain (P<0.05, between GLP1 / HFD and control / HFD groups for 8-10 weeks). n=5 (animals). Figure 4 K: Correlation of FRET ratio with blood glucose concentration over time after IPGTT in control and GLP1 mice. n=9 (integrated FRET values ​​from 9 different fields at each time point). Figure 4 L and 4M: Correlation of blood glucose concentration with GGBP FRET changes in control (L) and GLP1 (M) mice. n=9 (integrated FRET values ​​from 9 different fields at each time point).

[0031] Figure 5 .Expression of the GGBP reporter in human epidermal stem cells using CRISPR. Figure 5 A: Image of a nude mouse transplanted with an organotypic human skin culture. Intravital imaging shows efficient incorporation of transplanted cells expressing luciferase. Figure 5 B: Sections of transplanted skin and adjacent host skin were immunostained with the various antibodies indicated. Scale bar = 50 μm. Figure 5 C: Integration of the targeting vector into the AAVS1 locus was verified by Southern blot. Positive clones showed an additional band of the expected size. Figure 5 D: Glucose fluctuations were induced in transplanted animals using IPGTT (intraperitoneal glucose tolerance test). FRET ratio images were pseudo-colored to demonstrate glucose-dependent ratio changes in transplanted skin. Red indicates high FRET efficiency and blue indicates low efficiency. Figure 5 E and 5F: Correlation of FRET ratio with blood glucose concentration during IPGTT. n=9 (integrated FRET values ​​from 9 different fields of view at each time point).

[0032] Figure 6 . Development of a mouse-to-mouse skin gene transfer model utilizing an immunocompetent host. Figure 6 A: Diagram showing the procedure of in vitro skin organotypic culture. Epidermal progenitor cells are seeded on top of acellularized dermis and then exposed to air / liquid intervals to induce differentiation and stratification like the skin epidermis in vivo. Figure 6 B and 6C: H / E (hematoxylin and eosin) staining of transplanted skin and adjacent host skin one (B) or four (C) weeks after skin transplantation. Scale bar = 50 μm. Figure 6D: Immunohistological staining with antibodies against active caspase 3 was performed to determine and quantify apoptosis of epidermal cells in host or transplanted skin one or four weeks after skin transplantation. Error bars represent sd (standard deviation) unless otherwise stated. n=4 (4 independent tests). P>0.05.

[0033] Figure 7 .Skin epidermal progenitor cells modified with CRISPR to produce GGBP. Figure 7 A: Diagram showing the Rosa26 targeting strategy for expressing GGBP. Expression vectors encoding the D10A mutant of cas9 and two gRNAs targeting the Rosa26 locus are used to generate cuts in chromosomal DNA and enhance integration of the GGBP targeting vector. Figure 7 B: Cell proliferation of control (Ctrl) and GGBP expressing cells. For all cell types, the increase in cell number was quantified, n=3 (4 independent tests). For each time point between ctrl and GGBP groups, P>0.05. Figure 7 C: Control or GGBP-targeted epidermal progenitor cells can generate similar skin organoids in vitro. Scale bar = 50 μm.

[0034] Figure 8 . In vivo transplantation of cells expressing GGBP. Figure 8 A-8C: Immunostaining of transplanted skin sections with different antibodies as indicated (Krt14: keratin 14, Krt10: keratin 10, Lor: loricrin, β4: β4-integrin, CD104). Dashed line indicates dermal-epidermal boundary. Epi: epidermis; Der: dermis. Scale bar = 50 μm. Figure 8 D: Proliferation of epidermal cells in control or GGBP skin grafts was determined and quantified by immunohistological staining with an antibody against phospho-histone H3. n=7 (7 sections obtained from 2 animals per group). P>0.05. Figure 8 E: Apoptosis of epidermal cells in host or transplanted skin one or four weeks after skin transplantation was determined and quantified by immunohistological staining with an antibody against active caspase 3. n=6 (6 sections obtained from 2 animals per group). P>0.05. Figure 8 F: Diagram showing the Rosa26 targeting strategy for simultaneous expression of GGBP and GLP1. The coding sequences of GGBP and GLP1 are separated by an IRES (internal ribosome entry site).

[0035] Fig. 9 .Expression of GGBP in human epidermal progenitor cells using CRISPR. Fig. 9A: Diagram showing the AAVS1 targeting strategy for expressing GGBP. Expression vectors encoding the D10A mutant of cas9 and two gRNAs targeting the AAVS1 locus are used to generate cuts in chromosomal DNA and enhance integration of the GGBP targeting vector. Fig. 9 B: FACS (fluorescence activated cell sorting) showing similar cell cycle profiles of WT (wild type) and GGBP expressing epidermal progenitor cells before and after doxycycline treatment. PI: propidium iodide. Fig. 9 C: Western blot analysis of early (C) and late (D) differentiation marker expression in cells expressing WT and GGBP after calcium mobilization. Band intensity was determined by densitometry and fold induction was quantified. Krt10: keratin 10; Lor: loricrin. n=4 (4 independent tests). P>0.05. Fig. 9 D and Fig. 9 E: Immunostained sections of transplanted skin with different antibodies as indicated. Scale bar = 50 μm, Fig. 9 F and 9G: Proliferation and apoptosis of epidermal cells in control or GGBP skin grafts were determined and quantified by immunohistological staining with antibodies against phospho-histone H3 and active caspase 3, respectively. For proliferation, n=7 (7 sections obtained from 2 animals in each group). P>0.05. For apoptosis, n=6 (6 sections obtained from 2 animals in each group). P>0.05.

[0036] Fig.10 .Skin epidermal stem cells modified with CRISPR to produce GLP1. Fig.10 A: Diagram showing the Rosa26 targeting strategy for expressing GLP1. The targeting vector contains two Rosa26 homology arms on both sides of the GLP1 expression cassette. The tetracycline-inducible expression cassette drives the expression of Tet3G (tetracycline transactivator) protein and a selection marker (puromycin resistance gene, Puro) through the constitutive promoter UbiC (ubiquitin C promoter). Tet3G and Puro are separated by the self-cleaving peptide T2A. The expression of the GLP1 fusion protein is controlled by the TRE (tet-on) promoter. A transcription termination signal (ST) is included in front of the TRE promoter to eliminate leakage expression of GLP1. Fig.10 B: Integration of the targeting vector into the Rosa26 locus was verified by PCR (left panel) and Southern blot (right panel). Positive clones showed an additional band of the expected size. Fig.10 C: GLP1 secretion in the cell culture medium was determined by ELISA (enzyme-linked immunosorbent assay) after stimulation with different amounts of doxycycline (Doxy). Fig.10D: Conditioned media were collected from different cell cultures and used to treat starved insulinoma cells. Insulin secretion in vitro was measured by ELISA. Fig.10 E: FACS (fluorescence activated cell sorting) shows similar cell cycle profiles of WT (wild type) and GLP1 expressing epidermal stem cells after doxycycline treatment. PI: propidium iodide. Fig.10 F and 10G: Western blot analysis of early (F) and late (G) differentiation marker expression in WT and GLP1-expressing cells after calcium mobilization. Band intensity was determined by densitometry and fold induction was quantified. Krt10: keratin 10; Lor: loricrin. Fig.10 H: WT cells or GLP1 cells treated with or without doxycycline were tested for anchorage-independent growth in soft agar. Note that there was no growth of WT or GLP1 cells, but tumor-initiating cells isolated from skin SCC (squamous cell carcinoma) could easily generate colonies in soft agar plates.

[0037] Fig.11 . Stable in vivo delivery of GLP1 via mouse-to-mouse skin transplantation. Fig.11 A: Image of an immunocompetent mouse (CD1 strain) transplanted with isogenic skin organoids generated with cells expressing GLP1. Cells were infected with lentivirus encoding luciferase prior to transplantation, and intravital imaging showed efficient incorporation of transplanted cells. Fig.11 B: Histological examination of transplanted GLP1 skin and adjacent host skin as control (Ctrl). Scale bar = 50 μm. Epi: epidermis, Der: dermis, HF: hair follicle. Fig.11 C-11E: Sections of transplanted skin and adjacent host skin (ctrl) were immunostained with different antibodies as indicated (Krt14: keratin 14, Krt10: keratin 10, Lor: loricrin, β4: β4-integrin, CD104). Scale bar = 50 μm. Fig.11 F: Skin organoids were developed from control or GLP1-producing cells and transplanted into CD1 mice. GLP1 levels in blood were measured by ELISA. Food containing doxycycline can activate GLP1 secretion in vivo. Fig.11 G: CD1 mice were transplanted with control or GLP1 skin organoids and treated with or without doxycycline. The presence of GLP1 in the blood was determined by ELISA 16 weeks after transplantation.

[0038] Fig.12 . Expression of GLP1 in epidermal stem cells improves body weight and glucose homeostasis. Fig.12 A: Images of control and transplanted animals fed with regular diet or HFD (high fat diet). Fig.12B: Representative images of histological examination of white adipose tissue. Scale bar = 100 μm. Fig.12 C: Body weight changes of mice in different groups measured starting from ~10 weeks of age. Note that HFD induced significant obesity in control mice, but body weight gain was suppressed by doxycycline-stimulated GLP1 expression. Fig.12 D-12E: IPGTT (intraperitoneal glucose tolerance test) of control (D) and GLP1 transplanted (E) animals. In GLP1 expressing mice fed with a HFD, blood glucose concentration as a function of time after intraperitoneal injection of glucose showed improved glucose tolerance. Fig.12 F and 12G: ITT (insulin tolerance test). The profile of glucose concentration (percentage of initial value) as a function of time after intraperitoneal injection of insulin in mice expressing GLP1 shows a reduction in insulin resistance.

[0039] Fig.13 .Expression of GLP1 in human epidermal stem cells using CRISPR. Fig.13 A: Image of a nude mouse transplanted with an organotypic human skin culture. Intravital imaging shows efficient incorporation of transplanted cells expressing luciferase following transplantation. Fig.13 B: Sections of transplanted skin and adjacent host skin were immunostained with the various antibodies indicated. Scale bar = 50 μm. Fig.13 C: Integration of the targeting vector into the AAVS1 locus was verified by Southern blot. Positive clones showed an additional band of the expected size. Fig.13 D: After stimulation with different concentrations of doxycycline (Doxy), the secretion of GLP1 in the culture medium was measured by ELISA. Fig.13 E: Conditioned media were collected from control and GLP1 expressing cells, cultured in the presence and absence of Doxy, and used to treat starved insulinoma cells. In vitro insulin secretion was determined by ELISA. Fig.13 F: H&E staining of skin organoids developed from control or GLP1-producing human cells and transplanted into nude mice. Fig.13 G: GLP-1 levels were measured by ELISA in blood from control and transplanted nude mice fed with a standard chow or a chow containing doxycycline to activate GLP1 secretion in vivo.

[0040] Fig.14 . Skin epidermal progenitor cells modified with CRISPR to produce GLP1, Fig.14 A: Cell proliferation of control (Ctrl) and GLP1 expressing cells. For all cell types, the fold increase in cell number was quantified. Fig.14 B: Control or GLP1-targeted epidermal progenitor cells can generate similar skin organoids in vitro. Scale bar = 50 μm.

[0041] Fig.15 . Stable in vivo delivery of GLP1 via mouse-to-mouse skin transplantation. Fig.15 A: Proliferation of epidermal cells in control or GLP1 skin grafts was determined and quantified by immunohistological staining with an antibody against phospho-histone H3. Fig.15 B: Apoptosis of epidermal cells in host or transplanted skin one or four weeks after skin transplantation was determined and quantified by immunohistological staining with an antibody against active caspase H3.

[0042] Fig.16 .Expression of GLP1 in human epidermal progenitor cells using CRISPR. Fig.16 A: Diagram showing the AAVS1 targeting strategy for expressing GLP1. Expression vectors encoding the D10A mutant of cas9 and two gRNAs targeting the AAVS1 locus are used to generate cuts in chromosomal DNA and enhance integration of the GLP1 targeting vector. Fig.16 B: FACS (fluorescence activated cell sorting) showing similar cell cycle profiles of WT (wild type) and GLP1 expressing epidermal progenitor cells before and after doxycycline treatment. PI: propidium iodide. Fig.16 C and 16D: Western blot analysis of early (C) and late (D) differentiation marker expression in WT and GLP1-expressing cells after calcium mobilization. Band intensity was determined by densitometry and fold induction was quantified. Krt10: keratin 10; Lor: loricrin. Fig.16 E: Proliferation of epidermal cells in control or GLP1 skin grafts was determined and quantified by immunohistological staining with an antibody against phospho-histone H3. Fig.16 F and 16G: Immunostained explanted skin sections with the different antibodies indicated. Scale bar = 50 μm.

[0043] Fig.17 .CPP device. Fig.17A three-compartment CPP device is shown, which includes two large conditioning compartments with different colors and floor textures. As previously described (Yan et al., 2013), the CPP device (Med Associates, E.Fairfield, VT, USA) consists of two large chambers (16.8 × 12.7 × 12.7 cm) separated by a small chamber (7.2 × 12.7 × 12.7 cm). Each chamber has a unique combination of visual and tactile properties (one large chamber has black walls and a rod-shaped floor, the other large chamber has a white wall and a mesh floor, and the middle chamber has a gray wall and a solid gray floor). Each compartment has a lamp embedded in a transparent plexiglass hinged cover. The time spent in each chamber is measured and recorded by beam interruption. CPP is determined on the test day by subtracting the time spent on the saline paired side from the time spent on the drug paired side.

[0044] Fig.18 Transplantation of cells expressing hBChE attenuated cocaine-induced CPP acquisition and reinstatement. Fig.18 A: After transplantation, GhBChE (transplanted with hBChE-expressing cells) and GWT (transplanted with wild-type cells) mice were subjected to pretest (day 1), cocaine conditioning (days 2 to 5), and CPP expression test (day 6). Data represent mean ± SEM (n = 9 in each group, treatment × day interaction: F 1,16 =4.94, P<0.05). Fig.18 B: After transplantation, GhBChE mice and GWT mice were subjected to pre-test (day 1), ethanol conditioning (days 2 to 5), and CPP test (day 6). Data represent mean ± SEM (n = 8 in each group, treatment × day interaction: F 1,17 =0.07, not significant). **P<0.01 compared with the pre-test (Fisher t test). Fig.18 C: Mice acquired similar levels of cocaine CPP during pre-test, cocaine conditioning, and post-test, and underwent transplantation surgery on day 7. After 10 days of recovery, GhBChE mice and GWT mice underwent extinction until day 31. During the recurrence period on day 32, GhBChE mice and GWT mice were given cocaine injections and CPP was measured again. Data show mean ± SEM (n = 8 in each group, treatment × day interaction: F 3,42=12.34, P<0.001). 18D: Mice acquired similar levels of ethanol CPP during pretest, ethanol conditioning, and posttest on days 1 to 6, and experienced extinction until day 20. During the recurrence on day 21, ethanol injections were given and CPP was recorded (mean ± SEM) (n = 8 per group, treatment × day interaction: F 3,42 =0.05, not significant). *P<0.05 compared with the final regression (Fisher t test).

[0045] Fig.19 .Expression of engineered hBChE in skin epidermal stem cells by genome editing. Fig.19 A: Targeting strategy for expression of engineered hBChE. The targeting vector contains two Rosa26 homology arms flanking the hBChE expression cassette and a selectable marker (puromycin resistance gene, Puro) via the constitutive promoter UbiC (ubiquitin C promoter). hBChE and Puro are separated by the self-cleaving peptide T2A. gRNA: guide RNA. Fig.19 B: Integration of the targeting vector into the Rosa26 locus was verified by PCR (left panel) and Southern blot (right panel). Positive clones showed an additional band of the expected size. Fig.19 C: hBChE expression in target cells was confirmed by immunoblotting using different antibodies. Fig.19 D: Secretion of engineered hBChE into the culture medium was confirmed by ELISA. Fig.19 E: In vitro cocaine hydrolysis activity. Cell culture supernatants were collected from hBChE or mBChE targeted cells. Cocaine hydrolysis activity was examined by in vitro clearance assay. Fig.19 F: Cell cycle profile. FACS (fluorescence activated cell sorting) of control (Ctrl) and hBChE-expressing epidermal stem cells. PI: propidium iodide.

[0046] Fig. 20 Skin epidermal progenitor cells engineered with CRISPR to produce hBChE. 20A: Cell proliferation of control (Ctrl) and hBChE expressing cells. For all cell types, the fold increase in cell number was quantified. Fig. 20 B: Western blot analysis of early (Krt10: keratin 10) and late (Lor: loricrin) differentiation marker expression in WT and hBChE expressing cells after calcium mobilization. Band intensity was determined by densitometry and fold induction was quantified. 20C: WT cells or hBChE cells were tested for anchorage-independent growth in soft agar. Note that WT or hBChE cells did not grow, but tumor initiating cells isolated from skin SCC (squamous cell carcinoma) could easily generate colonies in soft agar plates.

[0047] Fig.21 . Stable in vivo delivery of engineered hBChE via mouse-to-mouse skin transplantation. Fig.21 A: Control or hBChE-targeted epidermal progenitor cells can generate similar skin organoids in vitro. Scale bar = 50 μm. Fig.21 B: Graft skin was collected from mice transplanted with control (GWT) or hBChE skin organoids (GhBChE). Cell proliferation was determined and quantified by immunohistological staining with an antibody against phospho-histone 3. 21C: Apoptosis of epidermal cells in control or hBChE skin grafts was determined and quantified by immunohistological staining with an antibody against active caspase 3.

[0048] Fig. 22 . Transplantation of cells expressing hBChE protects against cocaine overdose. Fig. 22 A: Skin organoids were developed from control or hBChE-producing cells and transplanted into host mice. Cells were infected with a lentivirus encoding firefly luciferase prior to transplantation to allow for live imaging of skin grafts. Fig. 22 B: Histological examination of transplanted skin collected from mice transplanted with control (GWT) or hBChE skin organoids (GhBChE). Scale bar = 50 μm. Fig. 22 C: Immunostaining of transplanted skin sections with the different antibodies indicated (Krt10: keratin 10, a marker of early epidermal differentiation, Lor: loricrin, a marker of early epidermal differentiation, β4: β4-integrin, CD104, a marker of the basement membrane of the skin). The dotted line indicates the base of the skin. Epi: epidermis, Der: dermis. Scale bar = 50 μm. 22D: Mice were transplanted with control or hBChE skin organoids. The presence of hBChE in the blood was determined by ELISA 10 weeks after implantation (n = 5 mice per group). Fig. 22 E: Lethality after injection of 40, 80, 120, 160 mg / kg cocaine in GhBGhE and GWT mice (n=8 per group). Fig. 22 F: Lethality after injection of 34, 68, 100, 160 mg / kg METH (methamphetamine) in GhBChE mice and GWT mice (n=8 in each group).

[0049] Fig.23 .Expression of hBChE in human epidermal stem cells using CRISPR. Fig.23A: AAVS1 targeting strategy for expression of engineered hBChE. The targeting vector contains two AAVS1 homology arms flanking the hBChE expression cassette and selection marker (puromycin resistance gene, Puro) via the constitutive promoter UbiC (ubiquitin C promoter). hBChE and Puro are separated by the self-cleaving peptide T2A. 23B: Integration of the targeting vector into the AAVS1 locus was verified by Southern blotting. Positive clones show an additional band of the expected size. 23C: Expression of hBChE was confirmed in target cells by immunoblotting with the different antibodies shown. 23D: Secretion of engineered hBChE in the culture medium was confirmed by ELISA. Fig.23 E: Images of nude mice transplanted with organotypic human skin cultures. Intravital imaging shows efficient incorporation of transplanted cells expressing luciferase (right) or control cells (left) after implantation. 23F: Immunostaining of transplanted skin sections with different antibodies as shown. Dashed line indicates base of skin. Scale bar = 50 μm. 23G: Mice transplanted with control or hBChE skin organoids. The presence of hBChE in the blood was determined by ELISA 8 weeks after implantation (n = 3 mice per group).

[0050] Fig.24 .Expression of hBChE in human epidermal progenitor cells using CRISPR. Fig.24 A: FACS (fluorescence activated cell sorting) showing similar cell cycle profiles of control (Ctrl) and / or hBChE expressing epidermal stem cells. PI: propidium iodide. Fig.24 B: Western blot analysis of the expression of early (Krt10: keratin 10) and late (loricrin) differentiation markers in WT and hBChE expressing cells after calcium mobilization. Band intensities were determined by densitometry and fold induction was quantified. Fig.24 C: Grafted skin was collected from mice transplanted with control or hBChE skin organoids. Cell proliferation was determined and quantified by immunohistological staining with an antibody against phospho-histone 3. 24D: Apoptosis of epidermal cells in control or hBChE skin grafts was determined and quantified by immunohistological staining with an antibody against active caspase 3.

[0051] Fig.25 . Skin epidermal stem cells engineered with CRISPR to produce mGLP1. CRISPR-mediated knock-in of DlmGLP1 and dox-regulated mGLP1 expression in mouse epidermal progenitor cells. Fig.25 A: The targeting vector contains two Rosa26 homology arms flanking the dox-responsive expression cassette encoding mGLP1. The expression of Tet3G (transactivator) and puromycin resistance (Puro) linked by a T2A peptide is controlled by the ubiquitin C (Ubi) promoter. ST is a signal that increases the specificity of the TRE promoter. Fig.25 B: DlmGLP1 knock-in PCR and Southern blot verification. Fig.25 C: Dox-induced mGLP1 expression in plasma of GLP1 mice. Fig.25 D: Long-term mGLP1 expression in GLP1 mice.

[0052] Fig.26 . Performance of mGLP1 on ethanol-induced CPP. GLP1 mice do not show significant ethanol-induced CPP. After 2 free explorations on day 1 (pre-test), separate groups of GLP1 and GWT mice (n=9 per group) received alternating intraperitoneal injections of ethanol (2 g / kg) and saline twice a day for the next 4 days, as previously described (Chen et al., Dopamine D1 and D3 receptors are differentially involved in cue-elicited cocaine seeking. J. Neurochem. 114, 530-541 (2010); Kong et al., Activation of dopamine D3 receptors inhibits reward-related learning induced by cocaine. Neurosci. 176, 152-161 (2011)). CPP performance was tested on day 6. Results represent the mean ± SEM time spent on the drug-paired side minus the saline-paired side. Repeated measures ANOVA with test day as within-group factor and transplant status as between-subject factor (Chen et al., 2010; Kong et al., 2011) was used. F values ​​were calculated and Newman-Keuls post hoc test was performed (Chen et al., 2010; Kong et al., 2011). GLP1 and WT mice were fed dox diet throughout the period.

[0053] Fig. 27 .Expression of spider-derived pain peptides in human epidermal progenitor cells using CRISPR. The figure shows the intended targeting vectors for treating alcoholism by skin expression of spider-derived pain peptides (toxins) DkTx (SEQ ID NO: 36) or VaTx (SEQ ID NO: 35). SP: signal peptide; F: furin cleavage site; IgG-Fc: mouse (SEQ ID NO: 34) or human IgG-Fc (SEQ ID NO: 39) fragments. The intended VatX3 and DkTx targeting vector cassettes are represented by SEQ ID NOs: 37 and 38, respectively.

[0054] Fig.28.Expression of PAL in human epidermal progenitor cells using CRISPR. The figure shows the intended targeting vector for treating PKU through skin expression of PAL; SP: signal peptide; PAL: coding sequence of PAL.

[0055] Fig.29 . Performance of mGLP1 on nicotine-induced CPP. Legend: GLP1 mice do not exhibit significant nicotine-induced CPP. As previously described (Chen et al., 2010; Kong et al., 2011), after 2 free explorations on day 1 (pre-test), separate groups of GLP1 and GWT mice (n=7 per group) received alternating intraperitoneal injections of nicotine (0.4 mg / kg) and saline twice daily for the next 4 days. CPP performance was tested on day 6. Results represent the mean ± SEM time spent on the drug-paired side minus the saline-paired side. Repeated measures ANOVA with test day as within-group factor and transplant status as between-subject factor was used (Chen et al., 2010; Kong et al., 2011). F values ​​were calculated and Newman-Keuls post hoc tests were performed (Chen et al., 2010; Kong et al., 2011). GLP1 and WT mice were fed dox diet throughout the period. DETAILED DESCRIPTION

[0056] All publications, patents, and patent applications cited herein are expressly incorporated by reference in their entirety for all purposes.

[0057] Before describing the present invention in detail, a number of terms will be defined. Unless the context clearly dictates otherwise, the singular forms "a", "an", and "the" as used herein include plural referents. For example, reference to "a metabolite" refers to one or more metabolites.

[0058] It should be noted that terms such as "preferably," "usually," and "typically" are not used herein to limit the scope of the claimed invention or to imply that certain features are critical, necessary, or even important to the structure or function of the claimed invention. Instead, these terms are merely intended to highlight alternative or additional features that may or may not be used in a particular embodiment of the invention.

[0059] For purposes of describing and defining the present invention, it is noted that the term "substantially" as used herein represents the inherent degree of uncertainty that may be attributed to any quantitative comparison, value, measurement, or other representation. The term "substantially" is also utilized herein to represent the degree by which a quantitative representation may vary from a stated reference without resulting in a change in the basic function of the subject matter at issue.

[0060] Genetic expression constructs, targeting vectors and genetically engineered cells according to the present invention can be constructed using methods well known to those skilled in the art. These methods include in vitro recombinant DNA technology, synthetic technology, in vivo recombination technology, polymerase chain reaction (PCR) technology, etc. Referring to, for example, the technology described below: Green & Sambrook, 2012, MOLECULAR CLONING: A LABORATORY MANUAL, Fourth Edition, Cold Spring Harbor Laboratory, New York; Ausubel et al., 1989, CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, Greene Publishing Associates and Wiley Interscience, New York, and PCR Protocols: A Guide to Methods and Applications (Innis et al., 1990, Academic Press, San Diego, CA).

[0061] As used herein, the terms "polynucleotide," "nucleotide," "oligonucleotide," and "nucleic acid" are used interchangeably to refer to nucleic acids comprising DNA, RNA, derivatives thereof, or combinations thereof.

[0062] As used herein, the term "genetic engineering" refers to the genetic manipulation of one or more cells, whereby the genome of one or more cells has been enhanced by at least one DNA sequence. Candidate DNA sequences include, but are not limited to, non-naturally occurring genes, DNA sequences that are not usually transcribed into RNA or translated into proteins ("expressed"), and other genes or DNA sequences that are desired to be introduced into one or more cells. It should be understood that the genome of the genetically engineered cells described herein is usually enhanced by the stable introduction of one or more recombinant genes. Typically, the introduced DNA is not initially present in the genetically engineered cells that are the recipients of the DNA, but within the scope of the present disclosure includes isolating DNA fragments from a given genetically engineered cell, and subsequently introducing one or more additional copies of the DNA into the same genetically engineered cell, for example to enhance the production of a gene product or to change the expression pattern of a gene. In some cases, the introduced DNA will be introduced by, for example, homologous recombination, site-directed mutagenesis, and / or genome editing techniques including CRISPR (clustered regularly interspaced short palindromic repeats) and / or mammalian transposon technology (e.g., piggyBac TMTransposons) are used to modify or even replace endogenous genes or DNA sequences. In some cases, the introduced DNA is introduced into the recipient via a viral vector (including vectors derived from retroviruses, lentiviruses, and adeno-associated viruses). In some cases, the introduced DNA is directly introduced into the recipient's skin via electroporation without skin stem cell isolation, culture, CRISPR editing, or transplantation.

[0063] As used herein, the term "recombinant gene" refers to a gene or DNA sequence introduced into a genetically engineered cell, whether or not the same or similar gene or DNA sequence is already present in such a host. In this case, "introducing" or "enhancing" means manually introducing or enhancing by people as known in the art. Therefore, a recombinant gene can be a DNA sequence from another species, or can be a DNA sequence derived from or present in the same species, but has been introduced into a cell by the method for forming a genetically engineered cell. It should be understood that the recombinant gene introduced into a cell can be identical to the DNA sequence normally present in the transformed cell, and is introduced to provide one or more additional copies of DNA, thereby allowing the overexpression or altered expression of the gene product of the DNA. Recombinant genes can also be introduced with different driving promoters or related sequences that can change gene expression levels or patterns. The recombinant gene is particularly encoded by cDNA. Non-coding sequences, such as short hairpin RNA, micro RNA or long non-coding RNA can also be included.

[0064] It is also expected that codon optimization can be performed on recombinant genes to maximize protein expression in genetically engineered cells by improving the translation efficiency of specific genes. For example, codon optimization can be achieved by converting the nucleotide sequence of a species into the genetic sequence of a different species. Optimized codons help to achieve faster translation rates and higher accuracy. Due to these factors, it is expected that translation selection is stronger in highly expressed genes. However, although it is contemplated herein that optimized codons are used to express disclosed proteins, all possible codons are expected to be used for nucleic acids for encoding any disclosed protein herein.

[0065] As used herein, the term "about" refers to ± 10% of any particular value.

[0066] As used herein, the terms "or" and "and / or" are used to describe multiple components that are combined with or mutually exclusive of each other. For example, "x, y, and / or z" can mean "x" alone, "y" alone, "z" alone, "x, y, and z", "(x and y) or z", "x or (y and z)", or "x or y or z".

[0067] As used herein, the term "blood factor" refers to any specific disease-related indicator or factor that can circulate in the body, such as in the blood and / or lymphatic system. For example, a blood factor can be, but is not limited to, a cell, an enzyme, a protein, a polypeptide, an amino acid, a polynucleotide, a nucleic acid, a sugar, a lipid, a metabolite, a synthetic compound, a naturally occurring compound, a mineral, a metal, a bacterium, a virus, a prion, a disease indicator, and combinations or variations thereof.

[0068] As used herein, the term "reporter molecule" refers to any compound that can be produced by biosynthesis of a genetically engineered host cell. For example, the reporter molecule can be an enzyme, a protein, a polypeptide, an amino acid, a polynucleotide, a nucleic acid, a sugar, a lipid, a metabolite, a synthetic compound, a naturally occurring compound, and combinations thereof. In a particular example, the reporter molecule can be a fluorescent protein, a transport-based biosensor, and / or a bioluminescent protein.

[0069] In one embodiment, the reporter molecule can be induced to express, for example, when the tissue organoid senses a blood factor. As described elsewhere herein, the induction of expression can also be caused by administering an inducing factor. When expressed by induction, the increase in the concentration of the reporter molecule is used to "report" the presence of the blood factor in question by generating a detectable signal. "Reporting" can be by any detectable means, such as fluorescing, generating a FRET signal, generating an electrical signal, and / or undergoing a conformational change.

[0070] Alternatively, the reporter molecule can be constitutively expressed but only "report" when the signal produced by the reporter molecule changes in response to the reporter molecule's sensing of a blood factor. In this case, a change in the signal (increase or decrease) can be proportionally correlated to an increase in the concentration of the blood factor.

[0071] In one embodiment, an external measurement device targeting a tissue organoid expressing a reporter molecule can be used to non-invasively measure the relative amount of a blood factor in a patient. In one embodiment, it is contemplated that the reporter molecule can bind or contact the blood factor directly or indirectly to produce a detectable signal that is proportional to the concentration of the blood factor in the individual.

[0072] As used herein, the term "therapeutic agent" refers to a substance that improves the health of an individual when applied to an individual in need. For example, a therapeutic agent can be, but is not limited to, an enzyme, a protein, a coagulation factor, a vitamin, a peptide, a lipid, a toxin, a hormone, a polysaccharide, and a combination thereof. In a specific example, the therapeutic agent can be insulin or an analog thereof, which, when applied to an individual in need, improves the health of the individual by regulating the blood glucose level of the individual. In another specific example, the therapeutic agent can be a hormone, such as GLP1, which, when applied to an individual in need, improves the health of the individual by inducing a satiety response in the individual (e.g., helping to regulate food intake). In another specific example, the therapeutic agent can be an enzyme, such as phenylalanine hydroxylase (PAH), which, when applied to an individual in need, improves the health of the individual by reducing the concentration of phenylalanine in the patient's blood. In addition, the therapeutic agent can be any compound that can be produced by biosynthesis of a genetically engineered host cell (e.g., an epidermal cell). The therapeutic agent can include proteins and other substances derived from one species and applied to another species in natural and / or modified form.

[0073] As used herein, the term "subject" refers to any animal. Examples of subjects include, but are not limited to, humans, domesticated animals, household pets, and other animals. Other examples of subjects include animals suffering from a disease.

[0074] As used herein, the term "physiologically tailored" refers to a state in which a tissue organoid has been generated that is physiologically and / or immunologically compatible with an individual. For example, a physiologically tailored tissue organoid can be a tissue organoid that is grown from an individual's own cells or physiologically compatible cells, and does not trigger an immune response in the individual when the individual's immune system is exposed to the tissue organoid, such as when the tissue organoid is surgically transplanted into or onto the individual or otherwise biointegrated.

[0075] As used herein, the term "tissue organoid" refers to a collection of cells that form a tissue that has been genetically modified and can be surgically transplanted or transplanted to biointegrate in vivo (e.g., on the skin of an individual). For example, a tissue organoid can be a cultured stratified skin graft grown from genetically engineered stem cells or keratinocytes taken from an individual. In addition to in vitro construction, it is contemplated that tissue organoids can be constructed in situ on an individual.

[0076] The cultured skin grafts can be engineered to express one or more proteins or other molecules of interest under predetermined conditions (e.g., in response to the presence, absence, or change in the level of one or more blood factors). The proteins or other molecules of interest can be reporter molecules, therapeutic agents, inducing factors, and / or any other molecules or compounds that can be produced biosynthetically by genetically engineered host cells.

[0077] As used herein, the term "inducing factor" refers to a physical stimulus and / or chemical stimulus that induces the expression of one or more genes within a tissue organoid and / or the activation and / or release of a reporter molecule or therapeutic agent from a tissue organoid. Non-exclusive examples of inducing factors may include heat, cold, light, proteins, peptides, hormones, lipids, chemicals, metabolic changes, metabolites, electric potentials or fields, and combinations thereof. Specific examples of inducing factors include doxycycline, reporter molecules, and ethanol, and it is also expected that inducing factors can induce the expression and / or release of reporter molecules or therapeutic agents in a dose-dependent manner.

[0078] In one embodiment, the disclosure relates to physiologically customized biologically integrable tissue organoids that can monitor the level of one or more blood factors in an individual. Tissue organoids can be transplanted or implanted into an individual to provide a permanent or temporary (e.g., one, two, three, six, twelve, or sixty months or longer) continuous monitoring and / or source of therapeutic agents for one or more blood factors. For example, tissue organoids can be fully stratified skin grafts cultivated from the individual's own epidermal stem cells, which are surgically transplanted onto the skin of the individual. Once the organism is integrated into the patient's skin, the tissue organoid forms a part of the patient's skin, thereby preventing potential infection by eliminating the need to pierce the skin to monitor blood factor concentrations. In addition, since the tissue organoids are derived from the patient's own cells, the risk of host rejection of the tissue organoids is reduced.

[0079] When biologically integrated, the tissue organoid is nourished like any other tissue of an individual and simultaneously exposed to circulating blood factors. In this case, the tissue organoid can be genetically engineered to carry one or more stable genetic modifications (e.g., genomic-integrated modifications), such as one or more genes encoding reporter molecules that are expressed when blood factors are sensed by or in contact with the tissue organoid.

[0080] In another embodiment, the reporter molecule can be constitutively expressed within the tissue organoid, but only "reports" by producing a detectable signal (e.g., fluorescing, producing a FRET signal, producing an electrical signal, bioluminescent, producing a colorimetric change, undergoing a conformational change) when bound to and / or in contact with a predetermined blood factor. It is expected that the reporter molecule can directly or indirectly bind to or contact a blood factor to produce a detectable signal. External measurement devices for tissue organoids can be used to non-invasively measure the relative amount of blood factors sensed in a patient. In another embodiment, it is expected that the reporter molecules produced by the tissue organoid are released systemically and can therefore be lacking in another part of the body.

[0081] In a specific embodiment, the expected tissue organoid is a blood glucose monitor that expresses a reporter molecule proportional to the relative blood glucose concentration of an individual. For example, a tissue organoid can express a fluorescent or bioluminescent reporter protein proportional to the glucose blood concentration. The relative amount of the reporter protein can be measured from the outside, for example, by a fluorometer or a colorimeter, and therefore the concentration of the blood factor can be determined. It is also expected that the inverse relationship between the reporter molecule and the specific blood factor is possible, so that the relative amount of the reporter molecule is reduced in response to the increase in the blood factor concentration.

[0082] It is also contemplated that tissue organoids can produce reporter molecules that can be detected by measuring the reporter molecules in sweat, tears, mucus, plasma, urine, feces, or a combination thereof.

[0083] In another embodiment, the present disclosure relates to physiologically tailored biointegrated tissue organoids that can express therapeutic agents that cross the epidermal / dermal barrier to reach the circulation and have a therapeutic effect.

[0084] In a specific embodiment, the tissue organoid can be induced to express the therapeutic agent either constitutively or by administering an induction factor to the individual. For example, the tissue organoid can express GLP1 in a dose-dependent manner when stimulated with an induction factor (e.g., doxycycline). In this way, the amount of therapeutic agent expressed by the tissue organoid can be tailored to the specific needs of the individual at a specific time.

[0085] In one embodiment, the tissue organoid expresses both a reporter molecule and a therapeutic agent.

[0086] Genetic constructs

[0087] Organoids can include genetically engineered cells that can express reporter molecules and / or therapeutic agents. The genes encoding reporter molecules and / or therapeutic agents can be stably introduced into the genome of cells using any technology (such as CRISPR) that allows genome editing. However, other methods are contemplated herein. When CRISPR is used for genetically engineered cells, any integration locus suitable for genome editing can be used. Examples of integration loci include AAVSI (adeno-associated virus integration site 1), HPRT1 (hypoxanthine phosphoribosyltransferase-1) and / or human Rosa26 loci. The use of HPRT1 locus provides the following advantages: correctly integrated cells can be selected based on their resistance to 6-TG (2-amino-6-decylpurine). In addition, CRISPR targeting vectors can introduce drug resistance genes (puromycin; "puro") for cell selection, which may trigger an immune response in vivo. If this happens, the targeting vector can be modified so that the puro coding sequence is flanked by two LoxP sites. After selecting the targeted clone, the puro sequence can be removed in vitro by transient expression of Cre recombinase.

[0088] Cell selection and tissue growth

[0089] Suitable cells that can be used for tissue organoid construction include epidermal stem cells, such as epidermal stem cells isolated from human skin. Other sources of epidermal stem cells include induced human pluripotent stem cells. Other examples of suitable cells include embryonic stem cells and human induced pluripotent stem cells.

[0090] Once isolated, stem cells can be transfected with a targeting vector carrying one or more reporter encoding genes and / or one or more therapeutic encoding genes, and selected for correct integration of the targeting vector by Southern blotting and other available methods. Correctly integrated genetically engineered epidermal stem cells can then be induced to differentiate to form stratified skin tissue when seeded on decellularized dermis and exposed to an air / liquid interface within a cell culture insert. Once the graft is ready, it can be transplanted into a donor patient using well-established protocols.

[0091] transplant

[0092] The tissue organoids can be implanted into the skin of an individual through known surgical procedures, such as skin grafts. Other suitable procedures include applying engineered skin stem cells directly to the patient's skin. Once implanted, the tissue organoids can be allowed to heal and fully biointegrate into the individual's skin.

[0093] Reporter molecule assay

[0094] Detection of reporter molecules of bio-integrated tissue organoids can be performed by any method known in the art suitable for detecting reporter molecules to be tested. For example, a fluorometer and / or a colorimeter can be used to measure changes in fluorescence, color or luminescence associated with reporter molecule expression. In addition, a bioluminescence monitoring system (e.g., Xenogen) can be used for in vivo bioluminescence imaging. Other examples of measuring devices that can be used to measure reporter molecules include electrical systems with appropriate electrodes.

[0095] Tissue Organoid Standardization

[0096] Once a tissue organoid is biointegrated into an individual, for example, a blood glucose monitoring tissue organoid, the response of the organoid to blood glucose concentration can be standardized so that a given reporter response indicates a specific blood glucose concentration. This can be achieved by measuring different blood glucose concentrations using a standard blood glucose meter and correlating the specific concentration measured with the relative reporter molecule signal for each concentration. An example of a standardized test is the intraperitoneal glucose tolerance test. Similar clinical standardization techniques can be performed on tissue organoids engineered to detect other specific blood factors. It is envisioned that once the tissue organoid "readout" is correlated with blood factor concentrations, no further direct blood testing is required.

[0097] Therapeutic platform development

[0098] The present disclosure also relates to tissue organoids for treating multiple medical problems simultaneously or as needed. For example, physiologically customized biologically integrable tissue organoids are envisioned, which can express one or more therapeutic agents designed to meet the specific medical needs of an individual, thereby forming a biologically integrable therapeutic platform. For example, the therapeutic platform can be designed to express multiple therapeutic agents, such as 2, 3, 4, 5, 6, 7, 8, 9, 10 or more therapeutic agents, simultaneously or at different times according to the needs of the individual. For example, each therapeutic agent to be expressed by the therapeutic platform can be induced individually and separately by an induction factor, so that for each therapeutic agent to be expressed, a separate induction factor must be introduced to cause the expression of the therapeutic agent. Alternatively, the therapeutic agents (e.g., 2 or more therapeutic agents) that can be advantageously expressed simultaneously can each be induced by the same induction factor.

[0099] In addition, although some embodiments described herein relate to the expression of therapeutic agents for the treatment of existing diseases, diseases and / or the lack or absence of required physiological substances (e.g., enzymes, proteins, coagulation factors, vitamins, peptides, lipids, etc.), it is also envisioned that therapeutic agents are expressed when physiological damage or stress is expected. For example, when exposure to harmful chemicals is expected, tissue organoids that express therapeutic agents to resist the effects of harmful chemicals or substances can be induced to express therapeutic agents. In this way, the therapeutic agent is expressed in the individual before the individual encounters the harmful chemical or substance. In another example, tissue organoids can be made to express therapeutic agents when blood loss, hypoxic environments, and / or other physiological damage are expected.

[0100] In another embodiment, the present disclosure relates to physiologically tailored bio-integrable tissue organoids that can express therapeutic agents with multiple therapeutic effects. For example, tissue organoids can be designed to express a single therapeutic agent, such as GLP1, which can be used to combat both alcohol abuse and nicotine abuse.

[0101] In one specific embodiment, it is contemplated that tissue organoids engineered to express GLP-1 (anti-alcohol and anti-nicotine therapeutic) and BChE (anti-cocaine therapeutic) could be biointegrated into individuals with substance abuse or at risk for relapse to simultaneously eliminate or minimize the addictive effects of alcohol, nicotine, and cocaine.

[0102] In other embodiments, GLP-1 analogs are contemplated for use herein. For example, contemplated analogs for use herein include Exendin-4 and Exendin-based therapeutics (e.g., Exenatide and Exenatide LAR), DPP-IV resistant GLP-1 analogs (e.g., albiglutide), semaglutide (NN9535), liraglutide, taspoglutide, dulaglutide (GLP-1 Fc, )(LY2189265) and its derivatives (see Gupta, V. Glucagon-like peptide-1 analogues: An overview, Indian J Endocrinol Metab, 17(3): 413-421 (2013)).

[0103] Relatedly, it is contemplated that a pharmaceutical composition comprising one or more induction factors can be administered to an individual to cause expression of one or more therapeutic agents that are inducible by the administered induction factors. For example, a pharmaceutically acceptable form of a formulation (e.g., oral, parenteral, inhaled, and / or topical) can contain two or more induction factors, each of which is specific for a separate therapeutic agent expressed by a tissue organoid. In this way, tissue organoids that express multiple therapeutic agents can be designed, and customized therapeutic agent expression can be obtained.

[0104] In a specific example, tissue organoids can be biointegrated into an individual, wherein the tissue organoids are designed to express 5 different therapeutic agents TA1, TA2, TA3, TA4, and TA5, each induced by a separate induction factor (respectively I1, I2, I3, I4, and I5). When necessary, a pharmaceutical composition including, for example, induction factors I2, I3, and I5 that cause the expression of therapeutic agents TA2, TA3, and TA5 can be administered to the individual. Alternatively, a pharmaceutical composition including, for example, induction factors I1, I2, and I4 that cause the expression of therapeutic agents TA1, TA2, and TA4 can be administered to the individual. A variety of changes in therapeutic agent induction are envisioned without limitation. In addition, a variety of variants of pharmaceutical dosage forms are contemplated, such as immediate release, delayed release, and / or extended release forms. In this way, a specific pharmaceutical composition may include, for example, induction factors I1, I2, I3, I4, and I5, wherein induction factors I1 and I5 are formulated for immediate release, induction factors I2 and I3 are formulated for delayed release, and induction factor II4 is formulated for extended release. Other dosage forms are contemplated, such as implantable depots. Combinations of any induction factors in any dosage form or formulation are contemplated herein, but are not limited thereto.

[0105] It is also contemplated that tissue organoids can be designed to express multiple therapeutic agents, wherein expression of one or more therapeutic agents is inducible and expression of one or more therapeutic agents is constitutive.

[0106] It is also contemplated that tissue organoids can be cultured that contain multiple transformed cell populations, wherein each population is engineered to express a different therapeutic agent than the other populations within the tissue organoid.Any number of separate cell populations are contemplated.

[0107] The present invention will be further described in the following examples, which do not limit the scope of the invention described in the claims.

[0108] Example

[0109] The following examples illustrate specific embodiments of the present invention and various uses thereof. They are presented for illustrative purposes only and are not to be considered as limitations of the present invention.

[0110] Example 1: Development of an intrinsic skin sensor for blood glucose levels using CRISPR-mediated genome editing in epidermal stem cells

[0111] introduction

[0112] Current integrated biosensors show limitations in terms of stability, biocompatibility and increased risk of infection. One possibility to overcome these limitations is to convert a small portion of endogenous tissue into a durable physiological and biochemical signal sensor for biological integration by genome editing technology (see Hsu et al. Development and applications of CRISPR-Cas9 for genome engineering. Cell 157, 1262-1278 (2014); Maeder et al. Genome-editing Technologies for Gene and Cell Therapy. Mol Ther 24, 430-446 (2016); and Wright et al. Biology and Applications of CRISPR Systems: Harnessing Nature's Toolbox for Genome Engineering. Cell 164, 29-44 (2016)). In this regard, human skin and skin epidermal stem cells (see Blanpain et al. Epidermal stem cells of the skin. Annu Rev Ceil Dev Biol 22, 339-373 (2006) and Watt, FM Medical skin cell biology: at the interface between laboratory and clinic. Science 346, 937-940 (2014)) have a number of unique advantages, making them particularly suitable for genetic engineering and in vivo applications ( Figure 1 A).

[0113] The procedure of separating and culturing primary epidermal stem cells has been well established. The cultured epidermal stem cells can be induced to stratify and differentiate in vitro, and the transplantation of epidermal autografts is minimally invasive, safe and stable in vivo. Autologous skin grafts have been used clinically to treat burns for decades (see Carsin, H. et al. Cultured epithelial autografts in extensive bum coverage of severely traumatized patients: a five-year single-center experience with 30 patients. Burns: journal of the International Society for Burn Injuries 26, 379-387 (2000) and Coleman et al. Culture depidermal autografts: a life-saving and skin-saving technique in children, Journal of pediatric surgery 27, 1029-1032 (1992)). In this embodiment, it is shown that the tissue organoids derived from epidermal stem cells edited by genome can be used to continuously monitor blood glucose levels in vivo.

[0114] Experimental Procedure

[0115] Reagents and plasmid DNA construction

[0116] Guinea pig anti-K5, rabbit anti-K14, rabbit anti-K10, and loricrin antibodies were generous gifts from Dr. Elaine Fuchs of Rockefeller University. Rat monoclonal β4-integrin (CD104, BD553745) was obtained from BD Biosciences. (Franklin lakes, NJ). Ser10pho-histone antibody was obtained from EMD (06-570, Billerica, MA). Cleaved caspase-3 antibody was obtained from Cell Signaling (#9661, Danvers, MA). Insulin ELISA kit was obtained from EMD Corp. (EZRMI-13K, Billerica, MA). GLP-1 ELISA kit was obtained from (RAB0201-1kt, St. Louis, MO). Unless otherwise stated, other chemicals or reagents were from

[0117] Lentiviral vectors encoding luciferase (SEQ ID NO: 1) and H2B-RFP (SEQ ID NO: 2) have been described previously (Liu et al., 2015; Yue, 2016). The plasmid encoding the hCas9-D10A mutant was a gift from George Church and obtained from Addgene (plasmid #41816). The plasmid encoding the gRNA expression cassette was constructed using gBlock as a template with the following primers: AAG GAA AAA AGC GGC CGC TGT ACA AAA AAG CAG G (SEQ ID NO: 3) and gGA ATT CTA ATGCCA ACT TTG TAC (SEQ ID NO: 4). The following primers were used to construct Rosa26 targeting gRNA: ACA CCG GCA GGC TTAAAG GCT AAC CG (SEQ ID NO: 5), AAA ACG GTT AGC CTT TAA GCC TGC CG (SEQ ID NO: 6), ACA CCG AGG ACA ACG CCC ACA CAC Cg (SEQ ID NO: 7), AAA ACG GTG TGT GGG CGT TGTCCT CG (SEQ ID NO: 8). The following primers were used to construct AAVS1 targeting gRNA: ACA CCG TCA CCA ATC CTG TCCCTA GG (SEQ ID NO: 9), AAA ACC TAG GGA CAG GAT TGG TGA CG (SEQ ID NO: 10), ACA CCGCCC CAC AGT GGG GCC ACT AG (SEQ ID NO: 11), AAA ACT AGT GGC CCC ACT GTG GGG CG (SEQ ID NO: 12).The Rosa26 targeting vector was constructed using pRosa26-GT as a template (a gift from Liqun Luo, addgene plasmid 40025) with the following primers: GAC TAG TGA ATT CGG ATC CTT AAT TAA GGC CTC CGCGCC GGG TTT TGG CG (SEQ ID NO: 13), GAC TAG TCC CGG GGG ATC CAC CGG TCA GGA ACAGGT GGT GGC GGC CC (SEQ ID NO: 14), CGG GAT CCA CCG GTG AGG GCA GAG GAA GCC TTCTAA C (SEQ ID NO: 15), TCC CCC GGG TAC AAA ATC AGA AGG ACA GGG AAG (SEQ ID NO: 16), GGA ATT CAA TAA AAT ATC TTT ATT TTC ATT ACA TC (SEQ ID NO: 17), CCT TAA TTAAGG ATC CAC GCG TGT TTA AAC ACC GGT TTT ACG AGG GTA GGA AGT GGT AC (SEQ ID NO: 18). The AAVS1 targeting vector (SEQ ID NO:40) was constructed using the AAVS1 hPGK-PuroR-pA donor (a gift from Rudolf Jaenisch, addgene plasmid 22072) as a template using the following primers: CCC AAG CTT CTC GAG TTG GGGTTG CGC CTT TTC CAA G (SEQ ID NO:19), CCC AAG CTT CCA TAG AGC CCA CCG CAT CCC C (SEQ ID NO:20), CAG GGT CTA GAC GCC GGA TCC GGT ACC CTG TGC CTT CTA GTT GC (SEQ ID NO:21), GGA TCC GGC GTC TAG ACC CTG GGG AGA GAG GTC GGT G (SEQ ID NO:22). CCGCTC GAG AAT AAA ATA TCT TTA TTT TCA TTA CAT C (SEQ ID NO:23), GCT CTA GAC CAAGTG ACG ATC ACA GCG ATC (SEQ ID NO: 24).Genotyping primers for CRISPR-mediated knock-in: GAGCTG GGA CCA CCT TAT ATT C (SEQ ID NO: 25), GGT GCA TGA CCC GCA AG (SEQ ID NO: 26), GAG AGA TGG CTC CAG GAA ATG (SEQ ID NO: 27).

[0118] Culture of mouse and human primary keratinocytes

[0119] Primary mouse keratinocytes were isolated from the epidermis of newborn mice using trypsin after the epidermis was separated from the dermis by overnight dispase treatment. Keratinocytes were seeded on 3T3 fibroblast feeder cells treated with mitomycin C until the third passage. The cells were cultured in a 1% serum supplemented with a final concentration of 0.05 mM Ca 2+ Cultured in E-medium.

[0120] From Thermo Primary human neonatal epidermal keratinocytes were obtained from (C0015C) and cultured using the manufacturer's recommended procedures. Culture medium (Thermo Fischer, M-EPICF-500) was used to culture the cells. Calcium mobilization was performed by increasing the calcium concentration in the culture medium to 1.5 mM to induce differentiation of primary keratinocytes.

[0121] Cells were routinely screened for the presence of mycoplasma using the ATCC Universal Mycoplasma Detection Kit (Cat. No. 30-1012K). Cells were screened every 6 months, and any mycoplasma contamination resulted in the cells being discarded and replaced with a previous mycoplasma-free generation.

[0122] Cell cycle analysis:

[0123] The effects on cell cycle profiles were determined using propidium iodide (PI) staining followed by flow cytometry. Mouse and human epidermal cells were cultured in two 6 cm cell culture dishes for 24 h. Cells were treated with trypsin and 1 × 10 cells were collected from each dish. 5cells, followed by one PBS wash. Cell fixation was performed using 70% (v / v) ice-cold ethanol for 1 hour. The fixed cells were then centrifuged at 500g for 10 minutes at 4°C and then washed twice with PBS. The cells were then treated with 75μg RNase A in 100μL PBS and incubated at 37°C for 1 hour. After incubation, the cells were collected by centrifugation at 500g for 10 minutes at 4°C, followed by another PBS wash. The cell pellet was resuspended in 200μL PBS with an additional PI solution at a final concentration of 25ng / μL. After staining, the flow cytometer BD FACSCanto was used immediately. TM II (BD Biosciences, San Jose, CA) with excitation at 488 nm and emission at 585 nm. FlowJo TM Histograms of DNA content and cell cycle distribution were analyzed using software version 10 (FLOWJOLLC, OR).

[0124] Protein biochemical analysis

[0125] Western blotting was performed as described previously (Blanpain et al.). Briefly, equal amounts of cell lysates were separated on SDS-polyacrylamide gel electrophoresis (PAGE) and electroblotted onto nitrocellulose membranes. Blocking buffer (Li-Cor) was incubated for 1 hour at room temperature, followed by incubation with primary antibodies overnight. The blots were washed three times with Tween 20 / Tris-buffered saline (TBST) and incubated with secondary antibodies diluted 1:10,000 for 1 hour at room temperature. The blots were washed three more times with TBST. Visualization and quantification were performed using a scanner and software (LI-COR Biosciences).

[0126] Skin organoid culture and transplantation

[0127] Acellular dermis (circles with a diameter of 1 cm) was prepared by treating newborn mouse skin with EDTA (Maeder et al.). 6 Aliquots of cultured keratinocytes were seeded onto the dermis in cell culture inserts. After overnight attachment, the skin cultures were exposed to an air / liquid interface.

[0128] For the transplantation of skin organoids, 6-8 week old CD1 (syngeneic mouse keratinocyte transplantation) males or naked (human keratinocyte transplantation) females were anesthetized. The bottom of the silicone chamber with an inner diameter of 0.8 cm and an outer diameter of 1.5 cm was implanted on the shaved midline skin of the back, which was used to hold the skin graft. The chamber cover was installed immediately after implanting a piece of graft to seal the chamber. After about a week, the chamber cover was removed to expose the graft to the air. A single dose of 0.2 mg α-CD4 (GK1.5) and 0.2 mg α-CD8 (2.43.1) antibodies were administered intraperitoneally for skin transplantation.

[0129] High-fat diet-induced obesity and glucose tolerance test

[0130] Male CD-1 mice with skin grafts were housed (5 per cage, ~8 weeks old) in a central animal facility with controlled air, humidity, and temperature. These mice were fed regular chow or HFD (60% kcal from fat, 20% from carbohydrates, and 20% from protein) purchased from Bio-Serv (Frenchtown, NJ). Body weight and food intake were measured every two weeks.

[0131] For the glucose tolerance test, an intraperitoneal glucose tolerance test (IPGTT) was performed on mice fed with HFD for 10 weeks. The mice were fasted for 6 hours before the test. The animals were injected with glucose dissolved in saline (1 g / kg glucose / body weight, intraperitoneally), and blood glucose was measured at 0, 10, 20, 30, 60, and 90 minutes using glucose test strips and a glucose meter.

[0132] To induce hypoglycemia, CD1 mice with skin grafts were fasted for 4 hours and injected with insulin (2 U / kg, intraperitoneally) purchased from Sigma (St. Louis, MO). Blood glucose levels were measured at 0, 15, 30, 45, and 60 minutes thereafter.

[0133] In vivo imaging of mice

[0134] Optical imaging was performed at the integrated small animal imaging research resource (iSAIRR) at the University of Chicago. After injection of luciferin (100 mg / kg) into the animals, the cells were visualized using an IVIS Spectrum (Caliper Life Sciences). Bioluminescent images were collected on a 3D-printed MRI machine in Alameda, CA. Living Image 4.3.1 software was used for acquisition and image analysis.

[0135] Wound healing in transplanted skin was imaged using multiphoton microscopy at the University of Chicago's Light Microscopy Center. Images were analyzed using Image J software.

[0136] Histology and immunofluorescence

[0137] Skin or wound samples were embedded in OCT, frozen, sectioned and fixed in 4% formaldehyde. For paraffin sections, samples were incubated overnight at 4°C in 4% formaldehyde, dehydrated with a series of increasing concentrations of ethanol and xylene, and then embedded in paraffin. Paraffin sections were rehydrated in decreasing concentrations of ethanol and antigen unmasked in 10 mM citrate (pH 6.0). Sections were stained with hematoxylin and eosin or immunofluorescence as described by Wright et al. Antibodies were diluted according to the manufacturer's instructions unless otherwise stated.

[0138] Statistical analysis

[0139] Statistical analysis was performed using Excel or OriginLab software. Box plots were used to describe the entire population without assuming statistical distribution. Student t tests were used to assess the statistical significance (P value) of the difference between two experimental conditions (unless otherwise stated, otherwise 2 tail distributions). Unless otherwise stated, all experiments were repeated at least three times. For all figures, statistical tests were reasonable and met the hypothesis of the test. The differences between the different test groups for statistical comparison were similar.

[0140] For all experiments, sample sizes were chosen based on our preliminary testing and previous studies. For all in vitro analyses, no samples were excluded. For in vivo experiments, animals that died before the end of the experiment were excluded. Exclusion criteria were predetermined. No randomization or blinding was used in this study.

[0141] Results and discussion

[0142] Despite potential clinical applications, research on skin epidermal stem cells has been greatly hampered by the lack of a suitable model. Although it has been shown that mouse skin or human skin can be transplanted into immunodeficient mice, the lack of a complete immune system in this model bodes poorly for the potential outcome predictions of the procedure in vivo. Immune clearance of engineered cells has always been a major complication of somatic gene therapy (see Collins, M. & Thrasher, A. Gene therapy: progress and predictions. Proceedings. Biological sciences / The Royal Society 282 (2015)). In addition, it remains technically challenging to culture skin organoids with mouse epidermal stem cells and produce mouse skin substitutes for transplantation. To address these issues, a new organotypic culture model using in vitro mouse epidermal stem cells was developed by culturing cells in the upper part of the decellularized mouse dermis ( Figure 6 A) (see Liu, H et al. Regulation of Focal Adhesion Dynamics and Cell Motility by the EB2and Hax1 Protein Complex. J Biol Chem 290, 30771-30782 (2015) and Yue, J. et al. In vivo epidermal migration requires focal adhesion targeting of ACF7. Nat Commun 7, 11692 (2016).

[0143] Tissue Organoids

[0144] Exposure to an air / liquid interface can induce stratification of cultured epidermal cells, thereby generating skin-like organoids in vitro. Transplantation of such cultured skin organoids into nude hosts resulted in effective skin transplantation (see Liu, H et al., 2015 and Yue, J et al., 2016). Using improved surgical procedures and skin graft maintenance protocols, transplantation of isogenic mouse skin substitutes into immunocompetent hosts (CD1 and C57BL / 6J strains) with or without silicone dome chambers for skin transplantation was achieved ( Figure 1 B and Figure 6 B and 6C).

[0145] Transplanted cells in immunocompetent hosts readily express exogenous genes such as luciferase and histone H2B-RFP ( Figure 1BC), the exogenous gene was transduced into the cells using lentivirus. When stained for basal epidermal stem cells (keratin 14) or early (keratin 10) and late (loricrin) skin differentiation markers, the transplanted tissue showed normal skin stratification ( Figure 1 DF). In addition, skin grafts showed similar cell proliferation and cell death compared with adjacent host skin ( Figure 1 G and Figure 6 D). Importantly, tissue organoids with exogenous gene expression (e.g., luciferase and H2B-RFP) were stable in immunocompetent hosts for more than 5 months as determined by in vivo bioluminescence imaging and tissue histology. Taken together, these results suggest that tissue organoids are a new model for epidermal stem cell engineering and transplantation, strongly suggesting that genetically modified skin epidermal cells are non-immunogenic and well tolerated in vivo.

[0146] Engineered Blood Glucose Monitor

[0147] Bio-integrated sensors for non-invasive monitoring of blood glucose levels in vivo can eliminate the need for diabetic patients to draw blood multiple times a day. In addition, continuous monitoring of glucose allows patients to better maintain blood glucose levels by changing insulin dosage or diet according to current glucose values. At present, most continuous glucose monitoring sensors are enzyme electrodes or microdialysis probes implanted subcutaneously. These sensors usually require oxygen to be active, are not stable enough in vivo and are inaccurate under low glucose conditions. The presence of interfering electroactive substances in tissues can also lead to weakened responses and signal drift in vivo, which requires frequent calibration of current sensors. Glucose sensors based on fluorescence in the skin may be more stable, have improved sensitivity, and solve the problem of electrochemical interference from tissues (see Pickup et al. Fluorescence-based glucose sensors. Biosensors & bioelectronics 20, 2555-2565 (2005)).

[0148] To engineer epidermal stem cells for glucose sensing, intracellular expression of the sugar binding protein, glucose / galactose binding protein (GGBP), was examined (Jeffery, CJ Engineering periplasmic ligand binding proteins as glucose nanosensors. Nano reviews 2, 2011). GGBP transports glucose in the periplasm of Escherichia coli, and binding to glucose can lead to large conformational changes in the protein (Jeffery, 2011). This property of GGBP has been used to develop protein sensors based on FRET (fluorescence resonance energy transfer) or bioluminescence imaging of glucose (see Fehr et al., In vivo imaging of the dynamics of glucose uptake in the cytosol of COS-7 cells by fluorescent nanosensors, J Biol Chem 278, 19127-19133, (2003); Saxl et al. A fluorescence lifetime-based fibre-optic glucose sensor using giucose / galactose-binding protein. The Analyst 136, 968-972 (2011); Teasley Hamorsky et al. A bioluminescent molecular switch for glucose. Angewandte Chemie 47, 3718-3721 (2008); Tian et al. Structure-based design of robust glucose biosensors using a Thermotoga maritima periplasmic glucose-binding protein. Protein science: a publication of the Protein Society 16, 2240-225 (2007) and Veetil et al. A glucose sensor protein for continuous glucose monitoring. Biosensors & bioelectronics 26, 1650-1655 (2010). WT (wild type) GGBP has a very high glucose binding affinity (K d=0.2 μm). To generate a probe corresponding to the physiologically relevant glucose range, a CFP / YFP FRET sensor with the A213R / L238S double mutant of GGBP (SEQ ID NO: 28) was designed by CRISPR-mediated genome editing in mouse epidermal stem cells. d =10mM) (Amiss, TJ, Sherman, DB, Nycz, CM, Andaluz, SA & Pitner, JB Engineering and rapid selection of a low-affinity glucose / galactose-binding protein for a glucose biosensor. Protein science: a publication of the Protein Society 16, 2350-2359). A DNA vector encoding the D10A mutant of Cas9 (CRISPR-associated protein 9) (Ran, FA et al. Double nicking by RNA-guided CRISPRCas9 for enhanced genome editing specificity. Cell 154, 1380-1389 (2013) (SEQ ID NO: 29), two gRNAs (guide RNAs) targeting the mouse Rosa26 locus (SEG ID NO: 30) (SEG ID NO: 31), and a Rosa26 targeting vector (SEG ID NO: 32) were developed. The targeting vector contains two homology arms of the Rosa26 locus on both sides of the expression cassette encoding the GGBP fusion protein ( Figure 2 A and Figure 7 A) (SEG ID NO:33).

[0149] Primary epidermal keratinocytes were isolated from CD1 neonatal mice and electroporated with the Rosa26 targeting vector together with plasmids encoding Cas9 and Rosa26-specific gRNA. Clones were isolated upon selection and correct integration into the Rosa26 locus was confirmed by PCR screening and Southern blot analysis ( Figure 2 B). Engineered epidermal cells show strong expression of GGBP fusion protein in the cytosol ( Figure 2 C).

[0150] To test whether intradermal electroporation is also an effective means of introducing reporters, CD1 mice were intradermally electroporated with plasmid DNA encoding luciferase and tdTomato and the expression of luciferase and tdTomato was visualized by bioluminescence imaging ( Figure 3A) and in vivo imaging using two-photon microscopy ( Figure 3 B) Analysis of both expression. Electroporation resulted in the expression of both luciferase and tdTomato.

[0151] To test glucose sensing in vitro, cells were exposed to medium containing increasing amounts of glucose. Quantification of the FRET ratio by microscopic imaging showed an excellent correlation of the FRET ratio with extracellular glucose concentrations in the range of 0-10 mM ( Figure 2 D). Further analysis showed that the GGBP reporter responded to extracellular glucose or galactose, but not to other sugars such as sucrose, fructose, or ribose ( Figure 2 E). The intracellular GGBP probe responds rapidly to changes in glucose concentration. The FRET ratio changes within 30 seconds after changing the medium and remains stable in the same medium. Together, these results indicate that epidermal stem cells expressing the GGBP reporter can faithfully sense extracellular glucose concentrations.

[0152] Expression of GGBP fusion protein in epidermal cells did not significantly alter cell proliferation in vitro ( Figure 2 F and Figure 7 B) or differentiation ( Figure 2 G). To confirm that the modified epidermal cells were not tumorigenic, the anchorage-independent growth of the cells was determined and it was confirmed that epidermal stem cells with GGBP targeting could not grow in suspension ( Figure 2 H). As a positive control, cancer initiating cells isolated from mouse SCC (squamous cell carcinoma) showed strong colony formation in soft agar medium ( Figure 2 H). Expression of the GGBP reporter does not affect the ability of epidermal stem cells to stratify. When cultured as skin organoids, the target cells readily generate stratified epithelial tissue ( Figure 7 C).

[0153] To investigate the potential in vivo applicability of the engineered glucose monitor, skin organoid cultures were prepared using engineered epidermal stem cells and transplanted into CD1 host animals ( Figure 4 A). No significant rejection of the skin grafts was observed after transplantation. The transplanted organoids showed normal epidermal stratification, proliferation, and cell death ( Figure 8 A-8E). To test the in vivo glucose sensing ability, an intraperitoneal glucose tolerance test (IPGTT) was performed in transplanted animals. Fasted animals were given a large amount of glucose intraperitoneally. Fluorescence (FRET) changes in transplanted skin were monitored by in vivo imaging ( Figure 4 B), and blood glucose levels were measured by a commercial glucose monitoring system (Bayer Contour), where blood samples were taken from the snipped tail. Figure 4C and 4D show the correlation between the measured glucose concentration and the FRET ratio over time. The FRET ratio has an approximately linear correlation with the in vivo glucose concentration ( Figure 4 D, R 2 =0,977). In contrast, conventional glucose sensors cannot accurately measure low glucose levels in the body.

[0154] To test the skin sensor for lower glucose concentrations, we induced hypoglycemia by administering insulin to fasting animals. In vivo imaging of transplanted skin again showed excellent correlation of FRET ratio changes with glucose levels ( Figure 4 E and 4F). Taken together, these results demonstrate that engineered skin organoids with a GGBP reporter can accurately sense blood glucose levels in vivo.

[0155] Engineered tissue organoids

[0156] If an engineered blood glucose monitor can be engineered to produce or regulate insulin levels in response to blood glucose levels, it could approximate an “artificial endocrine pancreas” that automatically maintains a patient’s glucose levels. Therefore, introducing an expression cassette into epidermal stem cells encoding a GGBP reporter and a therapeutic protein could enable continuous glucose monitoring and diabetes treatment through a single skin transplant. GLP1 (glucagon-like peptide 1) is released from the intestine upon food consumption, acting as a satiety signal to reduce food consumption and as an incretin hormone to stimulate insulin release and inhibit glucagon secretion. In fact, GLP1 receptor agonists have previously been used to treat type 2 diabetes. Therefore, a new Rosa26 targeting vector was developed that contains an expression cassette encoding a fusion protein of GLP1 and a mouse IgG-Fc fragment (for enhancing the stability and secretion of GLP1) as well as a GGBP reporter gene ( Figure 8 F).

[0157] Engineered epidermal cells exhibited robust GLP1 production and secretion ( Figure 4 G). The secreted GLP1 fusion protein is functional, as the conditioned medium significantly induced insulin secretion when added to cultured insulinoma cells ( Figure 4 H).

[0158] To examine the potential applicability in diet-induced obesity and diabetes, cells expressing GLP1 / GGBP and control cells (GGBP alone) were transplanted into two groups of CD1 adult male mice. The mice were fed a high-fat diet (HFD) to induce obesity in the transplanted animals. The HFD greatly accelerated the weight gain of mice transplanted with control cells compared to animals on a regular diet. In contrast, GLP1 expression resulted in a significant inhibition of weight gain ( Figure 4 I; in Figure 4quantified in J).

[0159] IPGTT was performed to examine glucose homeostasis. Expression of GLP1 significantly reduced in vivo glucose excursions as determined by direct measurement of blood glucose or in vivo imaging of the GGBP reporter ( Figure 4 K-4M). Non-invasive monitoring of the GGBP reporter showed excellent correlation with conventional glucose measurements in both diabetic and GLP1-treated animals ( Figure 4 L and 4M).

[0160] Human tissue organoids

[0161] To test the feasibility of glucose sensing using human epidermal stem cells, human skin organoids were cultured from primary epidermal keratinocytes isolated from human neonatal foreskin. Human epidermal keratinocytes readily generate organoids in vitro, which can be transplanted into nude mice. When infected with lentivirus, the transplanted human cells showed strong expression of the exogenous luciferase gene ( Figure 5 A). When stained for early or late epidermal differentiation markers, the explanted tissue showed normal skin stratification ( Figure 5 B).

[0162] For CRISPR-mediated genome editing, vectors encoding two gRNAs targeting the human AAVS1 (adeno-associated virus integration site 1) locus and an AAVS1-targeting vector encoding the GGBP reporter protein were developed. Fig. 9 A). Human epidermal keratinocytes were electroporated with the targeting vector together with plasmids encoding Cas9 and gRNA. Clones were isolated and correct integration was confirmed by Southern blot analysis ( Figure 5 C).

[0163] Expression of GGBP fusion protein did not significantly alter cell proliferation in vitro ( Fig. 9 B) or differentiation ( Fig. 9 C). The engineered cells stratified and formed skin organoids in vitro, which were successfully transplanted into a nude host. The transplanted tissue organoids showed normal epidermal stratification and proliferation in vivo ( Fig. 9 D-9G). In vivo imaging of IPGTT and GGBP reporters was performed and similar correlations of FRET ratio changes with blood glucose levels in transplanted skin were observed ( Figure 5 D-5F). These data suggest that these human tissue organoids can be used to monitor blood glucose levels in humans.

[0164] In this study, technical barriers were overcome and a unique mouse-mouse skin transplant model was established using an immunocompetent host. The results provide key evidence to support the feasibility of intradermal monitoring of blood glucose levels in vivo. The same platform can also be used to develop other biosensors and ex vivo skin gene therapy to stably deliver therapeutic proteins (such as GLP1) in vivo, providing promising treatments for many other terminal or severely disabling diseases (see Christensen, R. et al. Skingenetically engineered as a bioreactor or a'metabolic sink'. Cells, tissues, organs 172, 96-104, (2002) and Del Rio, M. et al. Current approaches and perspectives in human keratinocyte-based gene therapies. Gene therapy 11 Suppl 1, S57-63, (2004)).

[0165] Example 2: Treatment of diabetes and obesity using CRISPR-mediated genome editing in epidermal stem cells

[0166] introduction

[0167] In this report, skin grafts with controllable GLP1 (glucagon-like peptide-1) release were developed by combining CRISPR-mediated genome editing with an epidermal stem cell platform, and in vivo therapeutic effects were demonstrated by reducing blood glucose excursions in diet-induced obese and diabetic mice. GLP1 is a major physiological incretin that controls blood glucose homeostasis by stimulating glucose-dependent insulin secretion, inhibiting glucagon secretion, delaying gastric emptying, and protecting pancreatic β-cell mass (see Ross et al., 2010, Sandoval et al., 2015). However, native GLP1 must be delivered by parenteral routes to achieve its effects because it has an extremely short circulation half-life. Therefore, somatic gene transfer may provide a more effective way for long-term and stable delivery of GLP1 in vivo to treat diabetes (Prud'homme et al., 2007; Rowzee et al., 2011).

[0168] Recent developments in genome editing technologies, including the CRISPR (clustered regularly interspaced short palindromic repeats) system, have enabled precise genetic modification, providing an ideal tool for somatic gene therapy (Cox et al., 2015; Hotta et al., 2015; Wright et al., 2016). However, clinical application of CRISPR technology has been challenging due to insufficient efficacy in vivo using conventional delivery methods. Therefore, the development of an ex vivo platform that can combine precise genome editing in vitro with the efficient application of engineered cells in vivo would provide significant benefits for the treatment of many human diseases.

[0169] Skin epidermal stem cells (Blanpain and Fuchs, 2006; Watt, 2014) have several unique advantages that make them particularly suitable for ex vivo somatic cell gene therapy: i) Human skin is the largest and most accessible organ in the body, providing the availability of epidermal stem cells for collection using well-established procedures (Rasmussen et al., 2013; Rheinwald and Green, 1975, 1977). In addition, the skin is easily monitored for potential off-target effects of gene targeting and, if necessary, removed in the event of adverse consequences. ii) Cultured epidermal stem cells can be easily induced to differentiate and the resulting stratified skin tissue can be transplanted to donor patients using well-established protocols (Blanpain and Fuchs, 2006; Watt, 2014). Autologous skin grafts are relatively inexpensive compared to other somatic cell gene therapy methods, and the procedure is minimally invasive, safe, and has been used clinically for decades to treat burn wounds (Carsin et al., 2000; Coleman and Siwy, 1992). iii) Somatic gene therapy of epidermal stem cells is tissue-specific. Anatomically, the skin epidermis is not directly vascularized, but receives nutrients from blood vessels located in the underlying dermal tissue. The physical separation of the basement membrane excludes the potential spread of genetically modified cells in vivo, making it extremely tissue-specific and safe for skin gene therapy. iv) Epidermal stem cells can withstand long-term culture in vitro without losing stem cell properties (Rheinwald and Green, 1975), making it possible to perform precise genome editing with non-viral methods. Potential genotoxicity (especially from viral vectors) has become an important obstacle to somatic gene therapy (Kotterman et al., 2015; Kustikova et al., 2010). v) Epidermal stem cells have low immunogenicity. Gene therapy-derived products can be recognized as foreign antigens by the host immune system, which can produce an immune response and lead to the clearance of genetically modified cells. However, autologous skin grafts or allografts developed from cultured epidermal stem cells can achieve long-term and stable engraftment in human patients without eliciting a significant immune response (Centanni et al., 2011; Zaulyanov and Kirsner, 2007). vi) It has been well documented that proteins secreted by skin epidermal cells such as ApoE (apolipoprotein E) and the large coagulation proteins Factor VIII and Factor IX can cross the epidermal / dermal barrier and reach the circulation, thereby achieving therapeutic effects in a systemic manner (Christensen et al., 2002; Del Rio et al., 2004; Fakharzadeh et al., 2000; Fenjves et al., 1989; Gerrard et al., 1993; Morgan et al., 1987). Therefore, the potential applicability of skin stem cell therapy is broad and extends beyond skin diseases.

[0170] This example demonstrates that genome-edited epidermal stem cells can be used to robustly and controllably deliver GLP1 in vivo and effectively treat diabetes and obesity in a clinically relevant setting.

[0171] Experimental Procedure

[0172] Reagents and plasmid DNA construction

[0173] Guinea pig anti-K5, rabbit anti-K14, rabbit anti-K10, and loricrin antibodies were generous gifts from Dr. Elaine Fuchs of Rockefeller University. Rat monoclonal β4-integrin (CD104, BD553745) was obtained from BD Pharmingen (Franklin lakes, NJ). Ser10pho-histone antibody was obtained from EMD Millipore (Billerica, MA). Cleaved caspase-3 antibody was obtained from Cell Signaling Technology (Danvers, MA). Insulin ELISA kit was obtained from EMD Millipore Corp. (Billerica, MA). GLP-1 ELISA kit was obtained from Sigma (St. Louis, MO). Unless otherwise stated, other chemicals or reagents were from Sigma.

[0174] Lentiviral vectors encoding luciferase (SEQ ID NO: 1) and H2B-RFP (SEQ ID NO: 2) have been described previously (Liu et al., 2015; Yue, 2016). The plasmid encoding the hCasd-D10A mutant was a gift from George Church and obtained from Addgene (plasmid #41816). The plasmid encoding the gRNA expression cassette was constructed using gBlock as a template with the following primers: AAG GAA AAA AGC GGC CGC TGT ACA AAA AAG CAG G (SEQ ID NO: 3) and gGA ATT CTAATG CCA ACT TTG TAG (SEQ ID NO: 4). The following primers were used to construct Rosa26 targeting gRNA: ACA CCG GCA GGCTTA AAG GCT AAC CG (SEQ ID NO: 5), AAA ACG GTT AGC CTT TAA GCC TGC CG (SEQ ID NO: 6), ACA CCG AGG ACA ACG CCC ACA CAC Cg (SEQ ID NO: 7), AAA ACG GTG TGT GGG CGTTGT CCT CG (SEQ ID NO: 8). The following primers were used to construct AAVS1 targeting gRNA: ACA CCG TCA CCA ATC CTGTCC CTA GG (SEQ ID NO: 9), AAA ACC TAG GGA CAG GAT TGG TGA CG (SEQ ID NO: 10), ACACCG CCC CAC AGT GGG GCC ACT AG (SEQ ID NO: 11), AAA ACT AGT GGC CCC ACT GTG GGGCG (SEQ ID NO: 12).The Rosa26 targeting vector was constructed using pRosa26-GT as a template (a gift from Liqun Luo, addgene plasmid 40025) with the following primers: GAC TAG TGA ATT CGG ATC CTT AAT TAA GGC CTC CGCGCC GGG TTT TGG CG (SEQ ID NO: 13), GAC TAG TCC CGG GGG ATC CAC CGG TCA GGA ACAGGT GGT GGC GGC CC (SEQ ID NO: 14), CGG GAT CCA CCG GTG AGG GCA GAG GAA GCC TTCTAA C (SEQ ID NO: 15), TCC CCC GGG TAG AAA ATC AGA AGG ACA GGG AAG (SEQ ID NO: 16), GGA ATT CAA TAA AAT ATC TTT ATT TTC ATT ACA TC (SEQ ID NO: 17), CCT TAA TTAAGG ATC CAC GCG TGT TTA AAC ACC GGT TTT ACG AGG GTA GGA AGT GGT AC (SEQ ID NO: 18). The AAVS1 targeting vector (SEQ ID NO:40) was constructed using the AAVS1 hPGK-PuroR-pA donor (a gift from Rudolf Jaenisch, addgene plasmid 22072) as a template using the following primers: CCC AAG CTT CTC GAG TTG GGGTIG CGC GTT TTC GAA G (SEQ ID NO:19), CCC AAG CTT CCA TAG AGG CCA CCG CAT CCC C (SEQ ID NO:20), CAG GGT CTA GAC GCC GGA TCC GGT ACC CTG TGC CTT CTA GTT GC (SEQ ID NO:21), GGA TCC GGG GTC TAG ACC CTG GGG AGA GAG GTC GGT G (SEQ ID NO:22), CCGCTC GAG AAT AAA ATA TCT TTA TTT TCA TTA CAT C (SEQ ID NO:23), GCT CTA GAC CAAGTG ACG ATC ACA GGG ATC (SEQ ID NO: 24).Genotyping primers for CRISPR-mediated knock-in: GAGCTG GGA CCA GGT TAT ATT C (SEQ ID NO:25), GGT GCA TGA CCC GCA AG (SEQ ID NO:26), GAG AGA TGG CTC GAG GAA ATG (SEQ ID NO:27).

[0175] Skin organoid culture and transplantation

[0176] Acellular dermis (circles with a diameter of 1 cm) was prepared by treating newborn mouse skin with EDTA (Prunieras et al., 1983). 6 Aliquots of cultured keratinocytes were seeded onto the dermis in cell culture inserts. After overnight attachment, the skin cultures were exposed to an air / liquid interface.

[0177] For the transplantation of skin organoids, 6-8 week old CD1 males were anesthetized. The bottom of a silicone chamber with an inner diameter of 0.8 cm and an outer diameter of 1.5 cm was implanted on the shaved midline skin of the back, which was used to hold the skin graft. The chamber cover was installed immediately after implanting a piece of graft to seal the chamber. After about a week, the chamber cover was removed to expose the graft to air. A single dose of 0.2 mg α-CD4 (GK1.5) and 0.2 mg α-CD8 (2.43.1) antibodies were administered intraperitoneally for skin transplantation.

[0178] Histology and immunofluorescence

[0179] Skin or wound samples were embedded in OCT, frozen, sectioned and fixed in 4% formaldehyde. For paraffin sections, samples were incubated overnight at 4°C in 4% formaldehyde, dehydrated with a series of increasing concentrations of ethanol and xylene, and then embedded in paraffin. Paraffin sections were rehydrated in decreasing concentrations of ethanol and exposed to antigens in 10 mM citrate (pH 6.0). Sections were stained with hematoxylin and eosin or immunofluorescence. Antibodies were diluted according to the manufacturer's instructions unless otherwise stated.

[0180] Cell cycle analysis:

[0181] The effects on cell cycle profiles were determined using propidium iodide (PI) staining followed by flow cytometry. Mouse and human epidermal cells were cultured in two 6 cm cell culture dishes for 24 h. Cells were treated with trypsin and 1 × 10 cells were collected from each dish. 5cells, followed by one PBS wash. Cell fixation was performed using 70% (v / v) ice-cold ethanol for 1 hour. The fixed cells were then centrifuged at 500g for 10 minutes at 4°C, followed by two PBS washes. The cells were then treated with 75μg RNase A in 100μl PBS and incubated at 37°C for 1 hour. After incubation, the cells were collected by centrifugation at 500g for 10 minutes at 4°C, followed by another PBS wash. The cell pellet was resuspended in 200μl PBS with a final concentration of PI solution of 25ng / μl. After staining, the flow cytometer BD FACSCanto was used immediately. TM II (BD Biosciences, San Jose, CA) with excitation at 488 nm and emission at 585 nm. FlowJo TM Histograms of DNA content and cell cycle distribution were analyzed using FLOWJO software version 10 (FLOWJO LLC, OR).

[0182] Protein biochemical analysis

[0183] Western blotting was performed to assess protein biochemistry. Briefly, equal amounts of cell lysates were separated on SDS-polyacrylamide gel electrophoresis (PAGE) and electroblotted onto NC membranes. Immunoblots were incubated with Odyssey blocking buffer (Li-Cor) at room temperature for 1 h and then incubated with primary antibodies overnight. Blots were washed three times with Tween 20 / Tris-buffered saline (TBST) and incubated with secondary antibodies diluted 1:10,000 for 1 h at room temperature. Blots were washed three more times with TBST. Immunoblots were performed using LI-COR Visualization and quantification were performed using a scanner and software (LI-COR Biosciences).

[0184] High-fat diet-induced obesity and glucose and insulin tolerance tests

[0185] Male CD-1 mice (5 per cage, ~8 weeks old) were housed in a central animal facility with controlled air, humidity, and temperature. These mice were fed either regular chow or HFD (60% kcal from fat, 20% from carbohydrates, and 20% from protein) purchased from Bio-Serv (Frenchtown, NJ). Body weight and food intake were measured every two weeks.

[0186] For glucose tolerance test, intraperitoneal glucose tolerance test (IPGTT) was performed on mice fed with HFD for 10 weeks. Mice were fasted for 6 hours before the test. Animals were injected with glucose dissolved in saline (1 g / kg glucose / body weight, intraperitoneal), and blood glucose was measured at 0, 30, 60 and 90 minutes using glucose test strips and glucose meter. Intraperitoneal insulin tolerance test was performed 1 week after IPGTT. Mice were fasted for 4 hours and injected with insulin purchased from Sigma (St.Louis, MO) (2U / kg, intraperitoneal). Blood glucose levels were then measured at 0, 30, 60 and 90 minutes.

[0187] Statistical analysis

[0188] Statistical analysis was performed using Excel or OriginLab software. Box plots were used to describe the entire population without assuming statistical distribution. Student t-test was used to assess the statistical significance (P value) of differences between two experimental conditions.

[0189] result

[0190] Ectopic expression of GLP1 in epidermal stem cells via CRISPR-mediated genome editing

[0191] Through genetic engineering of skin epidermal stem cells, the skin can be transformed into an in vivo reactor that produces GLP1 in a controlled manner. Figure 1 A). Although skin stem cells are very sensitive to manipulation using viral vectors, viral infection can cause genotoxicity and may raise significant safety concerns for potential gene therapies (Kotterman et al., 2015; Kostikova et al., 2010). The CRISPR system presents a new approach to site-specific modification of the target genome in a non-viral manner (Cox et al., 2015; Hotta and Yamanaka, 2015; Wright et al., 2016).

[0192] To test CRISPR-mediated genome editing in mouse epidermal stem cells, a DNA vector encoding the D10A mutant of Cas9 (CRISPR-associated protein 9) was developed (Ran et al., 2013), two gRNAs (guide RNAs) targeting the mouse Rosa26 locus, and a Rosa26 targeting vector. The targeting vector contains two homology arms of the Rosa26 locus on either side of an expression cassette encoding a fusion protein of GLP-1 and mouse IgG-Fc fragment ( Fig.10 A and Figure 2A). Fusion to IgG-Fc enhances the stability and secretion of GLP-1 when ectopically expressed in epidermal cells (Kumar et al., 2007). To control the level of GLP-1 release, we further modified the targeting vector so that expression of the GLP-1 fusion protein was driven by a tetracycline-dependent promoter ( Fig.10 A).

[0193] Primary epidermal keratinocytes were isolated from CD1 neonatal mice and electroporated with the Rosa26 targeting vector together with plasmids encoding Cas9 and Rosa26-specific gRNA. Clones were isolated upon selection and correct integration into the Rosa26 locus was confirmed by PCR screening and Southern blot analysis ( Fig.10 B). Engineered epidermal cells exhibited robust GLP1 production after stimulation with doxycycline in a dose-dependent manner ( Fig.10 C). The secreted GLP1 fusion protein is functional, as the conditioned medium significantly induced insulin secretion when added to insulinoma cells cultured in vitro ( Fig.10 D). Expression of GLP1 fusion protein in epidermal cells does not significantly alter cell proliferation in vitro ( Fig.10 E and Fig.14 A) or differentiation ( Fig.10 F and 10G).

[0194] To confirm that the modified epidermal cells were not tumorigenic, the cells were examined for their potential anchorage-independent growth, and the results showed that epidermal stem cells with GLP1 targeting were unable to grow in suspension with or without doxycycline stimulation ( Fig.10 H). As a positive control, cancer-initiating cells isolated from mouse SCC (squamous cell carcinoma) (Schober and Fuchs, 2011) showed strong colony formation in soft agar medium ( Fig.10 H). GLP1 expression does not affect the ability of epidermal stem cells to stratify. When cultured as skin organoids, the target cells readily give rise to stratified epithelial tissue (14B).

[0195] Stable in vivo delivery of GLP1 via skin transplantation

[0196] To investigate the potential therapeutic effects of GLP1 in vivo, skin organoid cultures with epidermal keratinocytes targeted with a GLP1-expressing vector or a control vector were prepared and the organoids were transplanted into CD1 host animals ( Fig.11 A and 11B). No significant rejection of the skin grafts was observed after transplantation, indicating that the targeted epidermal stem cells were well tolerated immunologically in vivo. The transplanted skin showed normal epidermal stratification, proliferation, and cell death regardless of whether it was treated with doxycycline ( Fig.11 C-11E, and Fig.15 A and 15B). When fed a diet containing doxycycline, mice transplanted with cells expressing GLP1 showed significantly enhanced levels of GLP1 in the blood ( Fig.11 F). GLP1 expression in transplanted animals was stable for more than 3 months ( Fig.11 G). Consistent with previous observations (Christensen et al., 2002; Del Rio et al., 2004; Fakharzadeh et al., 2000; Fenjves et al., 1989; Gerrard et al., 1993; Morgan et al., 1987; Sebastiano et al., 2014), these results demonstrate that skin-derived therapeutic proteins can cross the basement membrane barrier and achieve systemic effects in vivo.

[0197] Skin gene transfer with GLP1 can achieve therapeutic effects in vivo

[0198] To investigate potential effects on diet-induced obesity and diabetes, cells expressing GLP1 and control cells were transplanted into two groups of CD1 adult mice, and a high-fat diet (HFD) was used to induce obesity in the transplanted animals. Doxycycline was administered to half of the animals to induce expression of GLP1. To minimize gender differences, only male animals were used. HFD greatly accelerated weight gain in mice transplanted with control cells or GLP1 cells that were not treated with doxycycline, compared to animals on a conventional diet. Induction of GLP1 expression with doxycycline resulted in a significant reduction in body weight in mice transplanted with GLP1 cells but not control cells ( Fig.12 A and Figure 1 Consistently, histological examination of white adipose tissue demonstrated that, in the control group, HFD progressively increased adipocyte size and induced a significant level of adipocyte hypertrophy by the end of the experiment ( Fig.12 In contrast, induction of GLP1 expression significantly suppressed this effect ( Fig.12 B).

[0199] To examine glucose homeostasis, IPGTT (retroperitoneal glucose tolerance test) and ITT (insulin tolerance test) were performed. HFD resulted in impaired glucose tolerance in control mice or GLP1-transplanted mice not treated with doxycycline (12D and 12E). In contrast, expression of GLP1 significantly reduced in vivo glucose excursions ( Fig.12 D and 12E). Consistent with the glucose homeostasis analysis, expression of GLP1 in skin grafts significantly reduced insulin resistance compared with control mice or GLP1 mice not treated with doxycycline ( Fig.12F and 12G ). Taken together, these data strongly suggest that cutaneous gene therapy with inducible GLP1 expression could be used to treat and prevent diet-induced obesity and pathology.

[0200] Skin delivery of GLP1 using human epidermal stem cells

[0201] To test the feasibility of using human epidermal stem cells for skin gene therapy, human skin organoids were cultured from primary epidermal keratinocytes isolated from human neonatal foreskin. When infected with lentivirus, the transplanted human cells showed strong expression of the exogenous luciferase gene ( Fig.13 A). When stained for early or late epidermal differentiation markers, the explanted tissue showed normal skin stratification ( Fig.13 B).

[0202] To examine CRISPR-mediated genome editing in human epidermal cells, vectors encoding two gRNAs targeting the human AAVS1 (adeno-associated virus integration site 1) locus and an AAVS1 targeting vector containing a tetracycline-inducible expression cassette encoding a fusion protein of GLP-1 and IgG-Fc fragment were used. Fig.16 A). Human epidermal keratinocytes were transfected with the targeting vector together with plasmids encoding Cas9 and gRNA. Clones were isolated and correct integration was confirmed by Southern blot analysis ( Fig.13 C). Like mouse cells, engineered human epidermal cells exhibited robust GLP1 production after stimulation with doxycycline in a dose-dependent manner ( Fig.13 D) GLP1 fusion protein secreted from these cells induces insulin secretion in vitro ( Fig.13 E), demonstrated the release of functional GLP1 from these cells.

[0203] Expression of GLP1 fusion protein in human cells does not significantly alter cell proliferation in vitro ( Fig.16 B) or differentiation ( Fig.16 C and 16D). The engineered cells stratified and formed skin organoids in vitro, which were transplanted into a nude host ( Fig.13 F). The transplanted skin showed normal epidermal stratification and proliferation, regardless of whether it was treated with doxycycline or not ( Fig.16 E-16G). Significant secretion of GLP1 was detected in the blood of nude mice transplanted with cells expressing GLP1 when fed a diet containing doxycycline ( Fig.13 G).

[0204] discuss

[0205] Somatic cell gene therapy provides a promising therapeutic approach for the treatment of a variety of other terminal or severely disabling diseases (Collins and Thrasher, 2015). Skin epidermal stem cells represent an ideal platform for ex vivo cell gene therapy, allowing effective genetic manipulation with minimal risk of in vivo tumorigenesis or other harmful complications (Christensen et al., 2002; Del Rio et al., 2004). In addition to expressing therapeutic agents (e.g., hormones and / or protein factors) such as GLP-1, ectopic expression of metabolic enzymes in skin epidermal cells can also convert engineered tissue organoids into potential "metabolic pools" for correcting a variety of metabolic disorders (Christensen et al., 2002). Therefore, the applicability of this skin gene therapy platform is very broad. Due to the minimally invasive and safety of skin transplantation, human clinical trials can be started relatively easily if effective preclinical models for skin gene therapy are established and encouraging results are obtained from animal models.

[0206] Diabetes is a major global health problem (Ahima, 2011; Ashcroft and Rorsman, 2012). The peptide hormone GLP1 has essential properties necessary to maintain steady-state levels of glucose for the effective treatment of diabetes. Compounds that extend the half-life of endogenous GLP1 or synthetic GLP1 receptor agonists have been clinically used to assist anti-diabetic therapy (Ross and Ekoe, 2010; Sandoval and D'Alessio, Physiology of proglucagon peptides: role of glucagon and GLP-1 in health and disease. Physio. Rev. 95, 513-548 (2015)). Somatic gene transfer that can stably deliver GLP1 to patients has been proposed as a more effective way to treat diabetes (Prud'homme et al., 2007; Rowzee et al., 2011). In this regard, the skin constitutes an attractive target organ, providing a durable, safe and economical way for GLP1 delivery. Here, controlled release of GLP1 was demonstrated in engineered tissue organoids and shown to have therapeutic effects in vivo, thus laying the essential foundation for the development of novel therapeutic approaches to combat obesity and diabetes.

[0207] Gene therapy derivatives can be recognized as foreign antigens by the host immune system, which can produce an immune response and lead to the removal of genetically modified cells (Collins and Thrasher, 2015). However, the model developed in this study provides a unique approach. In the normal skin epidermis, Langerhans cells act as the only cell type that expresses major histocompatibility complex (MHC) class II and presents antigens (Haniffa et al., 2015). Epidermal keratinocytes only express MHC class I molecules on their cell surface and are considered to be "non-professional" antigen presenting cells. Therefore, in the engineered tissue organoids described herein (produced by epidermal stem cells) without Langerhans cells or leukocytes as antigen presenting cells, potential antigenicity and immunogenicity are significantly reduced. It has been shown that skin allografts developed from cultured human keratinocytes can be used clinically to treat wounds without causing significant immune responses (Centanni et al., 2011; Zaulyanov and Kirsner, 2007). The results demonstrate for the first time that transplanted skin stem cells expressing therapeutic proteins can be effectively and stably transplanted into host mice with intact immune systems. The results further demonstrate the potential of skin gene therapy to treat a variety of human diseases in the future.

[0208] Example 3: Tissue Organoids for the Treatment of Cocaine Addiction

[0209] introduction

[0210] Drug addiction is characterized by compulsive drug seeking and taking and a high likelihood of relapse when the addicted individual is exposed to the drug or drug-related cues, even long after abstinence (Kalivas et al. Drug addiction as a pathology of staged neuroplasticity. Neuropsychopharmacology: official publication of the American College of Neuropsychopharmacology 33: 166-180 (2008); Koob et al. Neurocircuitry of addiction. Neuropsychopharmacology: official publication of the American College of Neuropsychopharmacology 35: 217-238 (2010); O'Brien et al. Conditioning factors in drug abuse: can they explain compulsion? Journal of psychopharmacology 12: 15-22 (1998)). Cocaine is a common drug of abuse that causes significant morbidity and mortality. Although multiple pharmacological targets and behavioral interventions have been explored, there is currently no FDA-approved drug for treating cocaine use or relapse in users, and there is no effective intervention for acute emergencies caused by cocaine overdose (Heard et al. Mechanisms of acute cocaine toxicity. The open pharmacology journal 2.70-78, (2008); Zimmerman, JL Cocaine intoxication. Critical care clinics 28: 517-526 (2012)). Recently we have demonstrated that epidermal progenitor cells of the skin can be easily edited in vitro using CRISPR (clustered regularly interspaced short palindromic repeats) and transplanted back into donor mice (see Liu, H et al., 2015; Yue, J et al., 2016; Yue et al., Engineered epidermal progenitor cells can correct diet-induced obesity and diabetes. Cell stem cell (2017)).This unique ex vivo platform may provide a durable, effective, and safe means for in vivo gene delivery. Here, we report that this skin stem cell-based platform for chronic in vivo delivery of cocaine hydrolase can effectively and specifically prevent cocaine seeking and acute overdose.

[0211] BChE (butyrylcholinesterase) is a natural enzyme that is present in hepatocytes and plasma and hydrolyzes its normal substrate, acetylcholine. BChE can also hydrolyze cocaine with low catalytic efficiency into benzoic acid and ecgonine methyl ester, the latter of which has low toxicity and beneficial properties, i.e., they are not addictive substances. Recent advances in protein engineering have greatly improved the catalytic potency and substrate specificity of BChE for cocaine hydrolysis and are used to protect against cocaine-induced behaviors, including the acquisition and recurrence of IVSA (intravenous self-administration). The catalytic efficiency (k cat / K M) is more than 4400-fold higher than wild-type (WT) hBChE and has significantly reduced activity towards acetylcholine (see Zheng et al. A highly efficient cocaine-detoxifying enzyme obtained by computational design. Nat Commun. 5: 3457 (2014). However, purified recombinant hBChE has a short in vivo half-life after intravenous injection, making it only useful for acute treatment of cocaine abuse. In a recent clinical trial, the hBChE-albumin fusion protein TV-1380 was ineffective in promoting cocaine abstinence in dependent individuals, most likely due to the short half-life of the protein and the inefficient intramuscular injection route (Cohen-Barak et al. Safety, pharmacokinetics, and pharmacodynamics of TV-1380, a novel mutated butyrylcholinesterase treatment for cocaine addiction, after single and multiple intramuscular injections in healthy subjects. Journal of clinical pharmacology 55:573-583 (2015); Gilgun-Sherki et al. Placebo-controlled evaluation of a bioengineered, cocaine-metabolizing fusion protein, TV-1380 (AlbuBChE), in the treatment of cocaine dependence. Drug and alcohol dependence 166:13-20 (2016)). Therefore, the ability to stably deliver engineered hBChE in vivo to allow for sustained activity could lead to cocaine withdrawal in dependent individuals and prevent the establishment of cocaine dependence in others.

[0212] Experimental Procedure

[0213] Reagents and plasmid DNA construction

[0214] Unless indicated to the contrary, reagents and experimental procedures followed those described above in Example 2. The HumanBChE quantikine ELISA kit was obtained from R&D systems (Minneapolis, MN).

[0215] Human (SEQ ID NO:41) and mouse BChE (SEQ ID NO:43) with point mutations {Zheng, 2014 #794} were codon optimized and synthesized by IDT (integrated DNA Technology, Coralville, IA), and PCR amplified with primers AD: GCT CTA GAG CCA CCA TGC AGA CTC AGC ATA CCA AGG (SEQ ID NO:47), CGG GAT CCA CCG GTT TAG AGA GCT GTA CAA GAT TCT TTC TTG (SEQ ID NO:48), CCCAAG CTT GCC ACC ATG CAT AGC AAA GTC ACA ATC (SEQ ID NO:49), ACG CGT CGA CTT AGAGAC CCA CAC AAC TTT CTT TCT TG (SEQ ID NO:50), respectively.

[0216] Skin organoid culture and transplantation

[0217] Skin organoid culture and transplantation were performed according to the procedures described in Example 2 above.

[0218] Implantation

[0219] Unless otherwise stated below, implantation was performed according to the procedures described in Example 2 above.

[0220] Cocaine-induced behavior

[0221] For all behavioral experiments, C57BL / 6J mice were used unless otherwise stated. Approximately equal numbers of adult male and female mice were group-housed until surgery. Mice were kept under controlled temperature and humidity conditions with a 12h:12h light:dark cycle (light on at 7:00). Water and food were available ad libitum. At the beginning of the experiment, mice weighed about 25-30g. All procedures followed the National Institutes of Health Laboratory Animal Care and Use Guide and were approved by the University of Chicago Institutional Animal Care and Use Committee.

[0222] Drugs: Cocaine HCl and methamphetamine HCl (Sigma-Aldrich, Saint Louis, MO) were dissolved in sterile saline and delivered intraperitoneally at a volume of 10 mL / kg at an appropriate dose. Ethanol (Sigma-Aldrich, Saint Louis, MO, 95%, density = 0.816) was prepared by dilution at 20% (v / v) in sterile saline and delivered intraperitoneally at an appropriate dose. (Sterile saline) was administered intraperitoneally at 10 mL / kg as a control.

[0223] CPP apparatus: As previously described (Yan et al., 2013), the CPP apparatus ( Fig.17 ; Med Associates, E. Fairfield, VT, USA) consists of two large chambers (16.8 × 12.7 × 12.7 cm) separated by a small chamber (7.2 × 12.7 × 12.7 cm). Each chamber has a unique combination of visual and tactile properties (one large chamber has black walls and a rod-shaped floor, the other large chamber has white walls and a mesh floor, and the middle chamber has gray walls and a solid gray floor). Each compartment has a light embedded in a transparent Plexiglas (Plexiglas) hinged lid. The time spent in each chamber is measured and recorded by beam interruption. CPP is determined on the test day by subtracting the time spent on the saline paired side from the time spent on the drug paired side.

[0224] Acquisition of CPP: A preference CPP procedure similar to that of a previous study (Yan et al., 2013) was used. CPP acquisition consists of three consecutive procedures: pre-test, conditioning, and testing. After 7-12 days of recovery from transplant surgery, mice were pre-tested on day 1, in which mice were allowed to freely explore the entire chamber for 20 minutes every day. Mice that spent more than 500 seconds in the gray chamber or more than 800 seconds in either large chamber were excluded from the study. After the pre-test day, mice were conditioned and tested on days 2-5. Starting on day 2, mice received intraperitoneal injections of drugs (10 mg / kg cocaine in cocaine CPP or 2 g / kg ethanol in ethanol CPP) and were restricted to the white chamber for 30 minutes. At least 5 hours later on the same day, mice received intraperitoneal injections of saline and were restricted to the black chamber for 30 minutes. On day 6 (test day), mice were allowed to explore the entire chamber for 20 minutes, and the time spent in each area was recorded.

[0225] Extinction and reappearance of CPP: After CPP acquisition, mice undergo extinction, where the procedure is the same as the test day. On each extinction day, mice are allowed to explore the entire chamber for 20 minutes and the time spent in each area is recorded. Extinction is performed until CPP is reduced to a level that is indistinguishable from the level of the pre-test for two consecutive days. On the second day of the last extinction, mice undergo a reappearance procedure, where mice trained in cocaine CPP receive an intraperitoneal injection of 15 mg / kg cocaine, and mice trained in ethanol CPP receive an intraperitoneal injection of 1 g / kg ethanol. Immediately after the injection, mice are allowed to explore the entire chamber for 20 minutes, and the time spent in each area is recorded.

[0226] Acute drug overdose test: Two weeks after transplantation surgery, four groups of GhBChE and four groups of GWT mice (n=8 per group) received intraperitoneal injections of cocaine at 40, 80, 120, and 160 mg / kg. As a control, four groups of GhBChE and four groups of GWT mice (n=8 per group) received intraperitoneal injections of methamphetamine (METH) at 34, 68 (LD50), 100, and 160 mg / kg. Two GhBChE mice and GWT mice using CD1 mice as hosts were also used to record acute cocaine (80 mg / kg)-induced behaviors. Mice were monitored for 2 hours after injection, and the percentage lethality induced by cocaine and METH was calculated.

[0227] Methods: After implantation, a group of GhBChE and a group of GWT mice (n = 9 per group) were trained with cocaine CPP for 7 days ( Fig.18 A). Mice were pre-tested on day 1, conditioned with cocaine for 4 days from day 2 to day 5, and tested for CPP on day 6. After implantation, one group of GhBChE and one group of GWT mice (n=8 per group) were trained with ethanol CPP for 7 days ( Fig.18 B). Mice were pre-tested on day 1, ethanol conditioned for 4 days from day 2 to day 5, and CPP tested on day 6. From day 1 to day 6, two groups of drug-naive mice (n=8 per group) were trained with cocaine CPP ( Fig.18 C). The next day, mice underwent transplantation. Starting from day 18, behavioral procedures were restarted after transplantation. Extinction was performed from day 18 to day 31. On day 32, mice underwent reinstatement induced by intraperitoneal injection of cocaine. From day 1 to day 6, one group of GhBChE and one group of GWT mice (n=8 per group) were trained with ethanol CPP. Extinction was performed from day 7 to day 20 ( Fig.18 D) On day 21, mice underwent a relapse procedure induced by intraperitoneal injection of ethanol.

[0228] Statistical analysis

[0229] Statistical analysis was performed using Excel or OriginLab software. Box plots were used to describe the entire group without assuming statistical distribution. Student t-tests were used to assess the statistical significance (P value) of differences between two experimental conditions. For cocaine behavior analysis, repeated measures ANOVA within the factor time (test days) and between the factor treatments (transplants) were used to analyze CPP results. Significant effects were further analyzed using Fisher t-tests.

[0230] Results and discussion

[0231] To perform CRISPR-mediated genome editing in mouse epidermal progenitor cells, a DNA vector encoding the D10A mutant of Cas9 (CRISPR-associated protein 9; Ran et al., 2013), two gRNAs (guide RNAs) targeting the mouse Rosa26 locus, and a Rosa26 targeting vector were developed. The targeting vector contained two homology arms of the Rosa26 locus on either side of the expression cassette encoding the modified hBChE gene ( Fig.19 A). Primary epidermal basal cells were isolated from newborn mice and electroporated with a Rosa26 targeting vector together with a plasmid encoding Cas9 and Rosa26-specific gRNA. Clones were isolated upon selection and correct integration into the Rosa26 locus was confirmed by PCR screening and Southern blot analysis ( Fig.19 B). Engineered epidermal cells showed strong hBChE expression and secretion as shown by immunoblotting and ELISA (enzyme-linked immunosorbent assay) ( Fig.19 C and 19D). The secreted hBChE protein was functional, as conditioned medium collected from cells expressing hBChE but not from control cells significantly induced cocaine degradation in vitro ( Fig.19 E). Consistent with previous reports, similar mutations in mBChE (mouse BChE) resulted in only residual activity in cocaine hydrolysis (Chen, X. et al. Kinetic characterization of acocaine hydrolase engineered from mouse butyrylcholinesterase. The Biochemical journal 466, 243-251 (2015); Fig.19 E). hBChE expression in epidermal stem cells does not significantly alter cell proliferation in vitro ( Fig.19 F and Fig. 20 A) or differentiation ( Fig. 20B). To confirm that the modified epidermal cells are not tumorigenic, the potential anchorage-independent growth of the cells was examined. The results showed that hBChE-targeted epidermal stem cells could not grow in suspension. In contrast, cancer-initiating cells isolated from mouse SCC (squamous cell carcinoma) (Schober, M, et al. Tumor-initiating stem cells of squamous cell carcinomas and their control by TGF-beta andintegrin / focal adhesion kinase (FAK) signaling. Proc Natl Acad Sci USA 108, 10544-10549 (2011)) showed strong colony formation efficiency in soft agar medium ( Fig. 20 C).

[0232] To efficiently transplant mouse epidermal progenitor cells, a new organotypic culture model utilizing mouse epidermal stem cells in vitro was developed by culturing cells in the upper part of decellularized mouse dermis. Exposure to the air / liquid interface induced stratification of cultured cells, resulting in the generation of skin-like organoids in vitro. Expression of hBChE did not alter the ability of epidermal stem cells to stratify ( Fig.21 A). To investigate the potential therapeutic effects of hBChE expression in vivo, we transplanted organoids into syngeneic host animals (CD1 and C57BL / 6) ( Fig. 22 A and 22B). No significant rejection of the skin grafts was observed for at least 5 months after transplantation, indicating that the targeted epidermal stem cells were well tolerated immunologically in vivo. The transplanted skin showed normal epidermal stratification, proliferation, and cell death ( Fig.21 B, 21C and 22C). Mice transplanted with cells expressing hBChE showed significantly elevated levels of human BChE in their blood ( Fig. 22 D). hBChE expression in transplanted animals was stable for more than 10 weeks ( Fig. 22 D). Consistent with previous observations, our results demonstrate that skin-derived therapeutic proteins can cross the basement membrane barrier and enter the in vivo circulation.

[0233] To first determine whether transplantation of hBChE-expressing cells protects mice from acute systemic toxicity of cocaine, we delivered different doses of cocaine to transplanted mice and calculated the lethality of cocaine. Cocaine at doses of 40, 80, 120, and 160 mg / kg had near-zero lethality in mice transplanted with hBChE-expressing cells (GhBChE), whereas in control mice transplanted with WT epidermal cells (GWT), 80 mg / kg of cocaine induced approximately 50% lethality and 120 and 160 mg / kg of cocaine induced 100% lethality ( Fig. 22 E). Parallel tests were performed to test the toxicity of the relevant irritant METH (methamphetamine) in GhBChE mice and GWT mice. There was no difference in the lethality induced by various doses of METH between GhBChE and GWT animals ( Fig. 22 F) These findings demonstrate that implantation of hBChE-expressing cells results in a significant release of functional hBChE in vivo and protects mice from the toxicity of acute cocaine overdose.

[0234] Next, protection from cocaine seeking was assessed using the conditioned place preference (CPP) paradigm, which is thought to simulate reward learning and seeking as animals approach and maintain contact with a cue that has been paired with a rewarding effect. After 4 days of place conditioning, GWT mice spent significantly more time in the environment previously associated with cocaine, whereas GhBChE mice showed no such preference ( Fig.18 A). As an additional control, ethanol CPP was measured after 4 days of conditioning in GhBChE mice and GWT mice. In contrast, GhBChE mice and GWT mice spent significantly more time in the ethanol-paired context ( Fig.18 B) These findings demonstrate that implantation of cells expressing hBChE effectively and specifically attenuates the rewarding effects induced by cocaine.

[0235] To determine whether transplantation of hBChE-expressing cells affects the reinstatement of cocaine-induced drug seeking, hBChE-expressing cells were transplanted into mice that had previously acquired cocaine CPP. Ten days after reinstatement, we performed extinction training and drug-induced reinstatement. Following an initial dose of cocaine, preference for the previously cocaine-associated context was reinstated in GWT mice but not in GhBChE mice ( Fig.18 C). Because hBChE expression does not prevent CPP induction by ethanol ( Fig.18 B), so these GhBChE mice and GWT mice were used for extinction training and then for reinstatement. In contrast to those induced by cocaine, ethanol CPP was similarly reinstated in GhBChE mice and GWT mice ( Fig.18 D) These results indicate that skin-derived hBChE effectively and specifically disrupts cocaine-induced reinstatement.

[0236] To test the feasibility of using human epidermal progenitor cells for skin gene therapy, we cultured human skin organoids from primary epidermal keratinocytes isolated from human neonatal foreskin. To perform CRISPR-mediated genome editing in human cells, we developed vectors encoding two gRNAs targeting the human AAVS1 (adeno-associated virus integration site 1) locus, as well as an AAVS1 targeting vector with an expression cassette encoding engineered hBChE ( Fig.23 A). Human epidermal keratinocytes were electroporated with the targeting vector together with plasmids encoding Cas9 and gRNA. Clones were isolated and correct integration was confirmed by Southern blot analysis ( Fig.23 B). Like mouse cells, engineered human epidermal cells exhibited robust hBChE production as determined by immunoblotting and ELISA ( Fig.23 C and 23D). Expression of hBChE protein in human cells does not significantly alter cell proliferation in vitro ( Fig.24 A) or differentiation ( Fig.24 B). Engineered cells stratify and form skin organoids in vitro, which are transplanted into naked hosts ( Fig.23 E). The transplanted skin showed normal epidermal stratification, proliferation and apoptosis in vivo ( Fig.23 F and Fig.24 CD). Taken together, these results suggest that CRISPR editing of human epidermal progenitor cells does not significantly alter cell dynamics and in vivo persistence. ELISA confirmed that mice transplanted with cells expressing hBChE had significant levels of human BChE in the blood, and that human BChE expression was stable in vivo for more than 8 weeks ( Fig.23 G). Our results suggest that cutaneous gene delivery has potential clinical relevance for future treatment of cocaine abuse and overdose.

[0237] This study shows for the first time that transplanted skin stem cells expressing hBChE can be highly drug-specific in addressing several key aspects of cocaine abuse, including reducing the development of cocaine seeking, preventing the recurrence of cocaine-induced drug seeking, and protecting against acute cocaine overdose. Due to the presence of high levels of hBChE, this approach is highly effective with little individual variability. Skin gene delivery with engineered epidermal stem cells could offer therapeutic opportunities for drug abuse or co-abuse in addition to cocaine.

[0238] For example, glucagon-like peptide 1 (GLP1) is the major physiological incretin that controls food intake and glucose homeostasis (Sandoval et al., 2015). Multiple GLP1 receptor agonists have been approved by the FDA for the treatment of type II diabetes. Our recent study showed that skin-derived GLP1 expression can effectively correct diet-induced obesity and diabetes in mice (Yue et al., 2017). Interestingly, GLP1 receptor agonists can also attenuate the reinforcing properties of alcohol and nicotine in rodents (Skibicka, KP, The central GLP-1: implications for food and drug reward. Front Neuroses. 7, 181 (2013); Egecioglu et al. The glucagon-like peptide 1 analogue Exendin-4 attenuates alcohol mediated behaviors in rodents. Psychoneuroendocrinol. 38, 1259-1270 (2013); Shirazi et al. Gut peptide GLP-1 and its analogue, Exendin-4, decrease alcohol intake and reward. PLoS One. 8, e61965 (2013); et al. The glucagon-like peptide 1 receptor agonist liraglutide attenuates the reinforcing properties of alcohol in rodents. Addict. Biol. 21, 422-437 (2016)). Therefore, future studies will determine whether constitutive or inducible expression of GLP1 in skin grafts can reduce alcohol and nicotine use and relapse in patients with alcohol use disorder and nicotine dependence. In addition, it will be important to investigate whether co-expression of hBChE and GLP1 in the skin can be used to treat alcohol and cocaine as well as ethanol and nicotine co-abuse, which occur at high frequencies and significantly increase the risk of drug-related morbidity and mortality.

[0239] Epidermal stem cells of the skin provide an ideal platform for ex vivo cell gene therapy, allowing effective genetic manipulation with minimal risk of in vivo tumorigenesis or other harmful complications. Cultured human epidermal progenitor cells have been used to produce CEA (cultured epidermal autografts), which have been used clinically to treat a large number of burn trauma for decades. Engineered skin stem cells and CEA have also been used to treat other skin diseases, including vitiligo and genetic diseases of the skin, such as bullous epidermolysis. Regenerated skin is stable in vivo and can persist for a long time in clinical follow-up studies. Therefore, skin gene therapy is durable, minimally invasive and safe.

[0240] Gene therapy-derived products can be recognized as foreign antigens by the host immune system, which can generate an immune response leading to neutralization of the therapeutic molecule or clearance of the genetically modified cells (Collins and Thrasher, 2015). Our skin graft model constructed with WT syngeneic animals provides a unique method to examine this process in vivo. Skin epidermal keratinocytes have low immunogenicity. Within the normal skin epidermis, Langerhans cells serve as the only cell type that expresses major histocompatibility complex (MHC) class II and presents antigens. Epidermal keratinocytes are considered "non-professional" antigen-presenting cells. Therefore, in the absence of Langerhans cells or leukocytes as antigen-presenting cells, the potential antigenicity and immunogenicity are significantly reduced in skin substitutes generated from epidermal progenitor cells. Therefore, engineered skin grafts are generally well-received and immunologically tolerated in WT syngeneic animals. In fact, skin-derived hBChE expression can be stable for more than 10 weeks in host mice with an intact immune system without significantly reducing serum levels of the engineered enzyme, strongly suggesting that the low immunogenicity of the skin environment may contribute to the reduced antigenicity and immune response to hBChE. Furthermore, the oldest GhBChE mice were 6 months old, healthy and free of tissue rejection, further supporting the long-term feasibility of cutaneous gene therapy for cocaine abuse. Altogether, these results show the promise of cutaneous gene therapy as a safe and cost-effective treatment option for cocaine abuse in the future.

[0241] Example 4: Treatment of alcohol abuse

[0242] introduction

[0243] Alcohol use disorder (AUD) is one of the most important public health problems. AUD involves problems controlling drinking, continuing to use alcohol even when it causes problems, having to drink more to get the same effect, or experiencing withdrawal symptoms when drinking is reduced or stopped (Koob et al. Neurobiology of addiction: a neurocircuitry analysis. Lancet Psychiatry 3, 760-773 (2016); Koob, GF Neurocircuitry of alcohol addiction: synthesis from animal models. Handb. Clin. Neurol. 125, 33-54 (2014). In 2012, 7.2% or 17 million adults aged 18 and older in the United States had AUD (Grant et al. Epidemiology of DSM-5 alcohol use disorder: results from the national epidemiologic survey on alcohol and related conditions III. JAMA Psychiatry 72, 757-766 (2015)). There are three FDA-approved medications and behavioral counseling for stopping or reducing drinking and preventing relapse in people (Johnson, BA Update on Neuropharmacological treatments for alcoholism: scientific basis and clinical findings. Biochem. Pharmacol. 75, 34-56 (2008)). However, only 1.3 million people receive treatment (NIAAA, 2015). In addition, not everyone responds to these drugs and treatment types, and not everyone follows the treatment regimen provided (Cohen et al. Alcohol treatment utilization: findings from the national epidemiologic survey on alcohol and related conditions. Drug Alcohol Depend. 86, 214-221 (2007)). Therefore, other methods need to be taken to combat AUD. In fact, if there is a treatment that can prevent individuals from craving to consume alcohol, then this treatment may eventually cause individuals to stop consuming alcohol.

[0244] Glucagon-like peptide 1 (GLP1) is a gastrointestinal peptide and the main physiological incretin that controls food intake and glucose homeostasis (Sandoval et al., 2015). A variety of GLP1 receptor agonists have been approved by the FDA for the treatment of type II diabetes. Interestingly, GLP1 receptor agonists can also attenuate the reinforcing properties of alcohol in rodents (Skibicka, KP, The central GLP-1: implications for food and drug reward. Front Neuroses. 7, 181 (2013); Egecioglu et al. The glucagon-like peptide 1 analogue Exendin-4 attenuates alcohol mediated behaviors in rodents. Psychoneuroendocrinol. 38, 1259-1270 (2013); Shirazi et al., Gut peptide GLP-1 and its analogue, Exendin-4, decreases alcohol intake and reward. PLoS One. 8, e61965 (2013); et al. The glucagon-like peptide 1receptor agonist liraglutide attenuates the reinforcing properties of alcohol in rodents. Addict. Biol. 21, 422-437 (2016); Effects of the GLP-1agonist Exendin-4on intravenous ethanol self-administration in mice.Alcohol Clin.Exp.Res.40,2247-2252(2016); Suchankova et al. The glucagon-like peptide-1receptor as a potential treatment target inalcohol use disorder: evidence from human genetic association studies and amouse model of alcohol dependence.Transl.Psychi.5,e583(2015)).

[0245] Although GLP1 can potentially be used to treat AUD (Suchankova et al., 2015), native GLP1 must be delivered parenterally to achieve its effects, and it has an extremely short circulation half-life (Sandoval and D'Alessio, 2015). Therefore, the somatic cell gene transfer method in Example 2 was used to determine the efficacy of GLP1 in treating AUD in mice.

[0246] Experimental Procedure

[0247] Unless indicated to the contrary, reagents and experimental procedures followed those described in Example 2 above.

[0248] Modified GLP1

[0249] The GLP1 gene (mGLP1 or DlmGLP1) was modified to produce a novel protein with a longer half-life in vivo (Kumar et al., Gene therapy of diabetes using a novel GLP-1 / IgG1-Fc fusion construct normalizes glucose levels in db / db mice. Gene therapy 14, 162-172, (2007)). In order to stably deliver mGLP1 in vivo and control its expression, we prepared a Rosa26-targeting vector (SEQ ID NO: 45) encoding a Gly8-mutant mGLP1 and a mouse IgG-Fc fragment fusion protein driven by a dox-dependent promoter. Fig.25A; Yue et al. Treatment of diabetes and obesity with CRISPR-mediated genome editing in epidermal progenitor cells. Cell Stem Cell, In press (2017); Kumar et al., 2007). Glycine mutations render peptides resistant to DPP-IV-mediated cleavage (Mentlein et al., Dipeptidyl-peptidase IV hydrolyses gastric inhibitory polypeptide, glucagon-like peptide-1(7-36)amide, peptide histidine methionine and is responsible for their degradation in human serum. Eur. J. Biochem. 214, 829-835 (1993)).

[0250] When expressed in epidermal cells, fusion with IgG-Fc further enhances mGLP1 stability and circulation half-life (Kumar et al., 2007), and it can reach the brain through the blood-brain barrier (Pardridge, WM, CSF, blood-brain barrier, and brain drug delivery. Expert Opin. Drug Deliv. 13, 963-975 (2016)). The Rosa26 allele has been widely used as a safe locus for gene targeting in mice (Soriano, P., Generalized lacZ expression with the ROSA26Cre reporter strain. Nat, Genetics 21, 70-71, (1999)). In order to use CRISPR-mediated genome editing, a vector encoding a D10A mutant of Cas9 (CRISPR-associated protein 9) was developed (Ran et al., 2013) and two gRNAs (guide RNAs) targeting the mouse Rosa26 allele. The D10A mutation and double nicking system in Cas9 minimize unwanted off-target mutagenesis in the genome (Ran et al., 2013).

[0251] Skin organoid culture and transplantation

[0252] Epidermal progenitor cells were isolated from newborn pups of CD1 or C57BL / 6J mice. Cells were transfected with targeting vectors and plasmids encoding Cas9 and Rosa26-specific gRNAs. Targeted clones were selected in medium containing puromycin, and correct introduction of the Rosa26 locus was confirmed by PCR and Southern blotting ( Fig.25 B) Mouse skin substitutes were prepared by seeding target cells into acellular neodermis and allowing differentiation upon exposure to an air / liquid interface, and the resulting tissues were transplanted into CD1 or C57BL / 6J mice (GLP1).

[0253] When fed a dox diet, GGLP1 mice began to show significantly enhanced mGLP1 levels in the blood within 3 days ( Fig.25 C; Yue et al., 2017). There was a dose-dependent release of mGLP1 into plasma (not shown). In the presence of dox, expression of mGLP1 in GLP1 mice was stable for up to 4 months ( Fig.25 D).

[0254] Results and discussion

[0255] Compared with mock transplantation (GWT), mGLP1 expression attenuated ethanol-induced CPP in GLP1 mice ( Fig.26 ).

[0256] GLP1 mice did not show significant ethanol-induced CPP. As previously described (Chen et al., Dopamine D1 and D3 receptors are differentially involved in cue-elicited cocaine seeking. J. Neurochem. 114, 530-541 (2010); Kong et al., Activation of dopamine D3 receptors inhibits reward-related learning induced by cocaine. Neurosci. 176, 152-161 (2011)), after 2 free explorations on day 1 (pre-test), separate groups of GLP1 and GWT mice (n=9 per group) received alternating intraperitoneal injections of ethanol (2 g / kg) and saline twice a day for the next 4 days. CPP performance was tested on day 6. Results are expressed as the mean ± SEM time spent on the drug-paired side minus the saline-paired side. Repeated measures ANOVA with test day as within-group factor and transplant status as between-subject factor (Chen et al., 2010; Kong et al., 2011) was used. F values ​​were calculated and Newman-Keuls post hoc test was performed (Chen et al., 2010; Kong et al., 2011). GLP1 and GWT mice were fed dox diet throughout the period.

[0257] These results indicate that mGLP1 expression attenuates ethanol-induced CPP. Therefore, tissue organoids expressing mGLP1 have the potential to treat AUD. In addition, Egecioglu et al. also reported that the GLP-1 receptor agonist Exendin-4 (Ex4) attenuated nicotine-induced motor stimulation, cumulative dopamine release, and the expression of conditioned place preference in mice (Egecioglu et al., 2013). Therefore, it is believed that tissue organoids expressing mGLP1 can also be used to treat nicotine addiction. It can be seen that tissue organoids expressing mGLP1 can also be used to treat AUD patients who are addicted to nicotine at the same time. In addition, it is believed that tissue organoids designed to express multiple therapeutic agents (such as mGLP1 and hBChE) can be used to reduce the incidents of co-abuse of cocaine and ethanol and / or nicotine, and may reduce the abuse and co-abuse of other drugs (such as amphetamine) (see Skibicka KP The central GLP-1: Implications for food and drug reward, Front Neurosci. 7: 181 (2013)). It is also contemplated herein that GLP-1 analogs (see above) may be used in a similar manner.

[0258] Example 5: Tissue Organoids for the Treatment of Alcohol Abuse

[0259] Alcoholism is a debilitating disease characterized by dependence on alcohol consumption and often associated with social and / or health problems. Drugs are available to treat alcoholism that discourage alcohol consumption by causing nausea when alcohol is consumed, by reducing the pleasure associated with drinking, or by reducing the craving for alcohol. However, as with all drugs, treatment compliance is difficult. Treatment compliance is further complicated when drugs are used to treat addiction and require self-administration. Therefore, it would be desirable to automatically administer a therapeutic agent for combating alcoholism caused when alcohol is consumed.

[0260] Thus, tissue organoids engineered to express one or more alcohol-inducible genes encoding spider-derived pain peptides, such as DkTx (S2-DkTx; SEG ID NO: 36) or VaTx (S2-VaTx3; SEG ID NO: 35), were prepared as described above (see Fig. 27 ). In addition, GLP-1 and / or GLP-1 analogs can be further added to the tissue organoids for expression simultaneously with DkTx or VaTx or on demand. It is contemplated that any of these therapeutic agents can be expressed and / or administered alone or in any combination.

[0261] After engineering alcohol-inducible therapeutic tissue organoids, the organoids were transplanted into mice before and after training the mice in a two-bottle choice paradigm. This paradigm tested how effectively the system protected mice from drinking or relapsing into drinking. In the mice's home cage, there were two liquid bottles, one containing regular drinking water and the other containing a ratio of alcohol solution. Consumption of alcohol or water was measured daily. Previous work has established that mice prioritize drinking alcohol over water over a period of time, reflecting the rewarding effects of alcohol.

[0262] Therefore, mice were not expected to develop a preference for drinking (acquisition) or reinitiate drinking (relapse) when implanted with alcohol-inducible therapeutic tissue organoids.

[0263] Similarly, according to this example, when alcohol metabolism activates expression of therapeutic agents (e.g., spider-derived toxins and GLP-1 or GLP-1 analogs), the human patient with the biointegrated tissue organoids experiences 1) pain or discomfort from the expressed toxins, and 2) lack of reward from the expressed GLP-1 / GLP-1 analogs. In this way, the therapeutic agents expressed in response to alcohol metabolites act synergistically, and the patient is reluctant to drink.

[0264] Example 6: Tissue Organoids for Monitoring Silent Heart Attack

[0265] Silent heart attacks have few or no obvious "classic" symptoms, such as chest pressure, heaviness in the chest, arm pain, neck pain, jaw pain, shortness of breath, sweating, extreme fatigue, dizziness, and nausea. However, while nearly half of heart attacks are silent, they carry a similar risk of death as "overt" heart attacks and, if successfully diagnosed, can be treated with similar medications and lifestyle changes. Therefore, the ability to monitor factors that indicate silent heart attacks, such as cardiac fatty acid binding protein (H-FABP) and cardiac myoglobin, would be beneficial.

[0266] Tissue organoids engineered to report the occurrence of silent heart attacks were prepared as described above using targeting vectors containing genes encoding reporters specific for H-FABP (SEQ ID NO: 62) and cardiac myoglobin (SEQ ID NO: 63).

[0267] Example 7: Tissue Organoids for Monitoring Stroke

[0268] A cerebrovascular accident or "stroke" is the sudden death of brain cells due to lack of oxygen when blood flow to the brain is impaired due to blockage or rupture of a blood vessel. Glial fibrillary acid protein (GFAP) (SEQ ID NO: 64) is a biomarker associated with acute stroke symptoms. S100B (SEQ ID NO: 65) is a marker associated with stroke-related astrocyte damage and increased BBB permeability. The ability to monitor this stroke marker would allow for earlier intervention when an individual experiences a stroke.

[0269] Therefore, tissue organoids engineered to report on the occurrence of stroke were prepared as described above using targeting vectors containing genes encoding reporters specific for GFAP (SEQ ID NO:64) and S100B (SEQ ID NO:65).

[0270] Example 8: Tissue steroids for the treatment of phenylketonuria (PKU)

[0271] introduction

[0272] PKU is the most common hereditary disease involving amino acid metabolism. It comes from a mutation in the gene encoding the key liver enzyme phenylalanine hydroxylase (PAH), which catalyzes the hydroxylation reaction that converts phenylalanine into tyrosine. If left untreated, PKU will lead to a sharp increase in plasma phenylalanine levels, causing profound and irreversible mental disability, epilepsy and other behavioral problems. The current treatment for PKU is a strict dietary restriction of natural protein intake and supplementation of amino acids other than phenylalanine by chemically manufactured protein substitutes, which can prevent most complications of the disease after birth. However, there is ample evidence that patients with dietary restrictions still have neuropsychological defects, and it has been proven that maintaining dietary control is difficult, particularly in adolescents, young people and pregnant women. Somatic gene therapy has the potential to develop a more effective treatment for PKU.

[0273] Although PAH is naturally a hepatic enzyme, it has been hypothesized that circulating phenylalanine can be adequately cleared by ectopic expression of PAH in tissues other than the liver, such as T cells, muscle cells, and skin epidermal cells. However, a potential problem is that the catalytic activity of PAH requires the non-protein cofactor BH4 (tetrahydrobiopterin), which is synthesized de novo from guanosine triphosphate in hepatocytes via a three-enzyme pathway involving GTP cyclohydrolase I (GTPCH), 6-pyruvoyltetrahydrobiopterin synthase (PTPS), and septopterin reductase (SR). Without adequate replenishment of BH4 or reconstitution of the BH4 synthesis pathway, ectopic expression of PAH does not function properly. Transgenic mice expressing PAH and GTPCH (the rate-limiting enzyme for BH4 synthesis) under a variety of skin-specific promoters were unable to adequately rescue the in vivo phenylalanine deficiency, suggesting that alternative approaches must be employed to convert the skin epidermis into an effective “phenylalanine sink.”

[0274] Enzyme replacement therapy has been proposed for the treatment of PKU. Phenylalanine aminolyase (PAL) is an attractive alternative for the removal of phenylalanine. PAL can perform the nonoxidative deamination of L-phenylalanine to form ammonia and cinnamic acid (cinnamate), which can be excreted in the urine as hippurate along with small amounts of cinnamic and benzoic acids. Unlike PAH, PAL is an autocatalytic enzyme that does not require cofactors, making it a simple and effective method for removing plasma phenylalanine.

[0275] Preliminary results with mouse epidermal keratinocytes showed that PAL was efficiently expressed when infected with a lentivirus encoding PAL, and degradation of phenylalanine in the culture medium was much more rapid than in cells expressing PAH. Exogenous expression of PAL in epidermal progenitor cells did not significantly alter cell proliferation or differentiation in vivo, and the cells readily generated skin organoids when cultured on top of decellularized dermis. Therefore, the possibility of treating PKU through cutaneous expression of PAL was investigated using CRISPR-mediated genome editing with epidermal progenitor cell technology.

[0276] A mouse model of PKU has been developed by ENU (N-ethyl-N-nitrosourea)-mediated mutagenesis in the BTBR strain (Jax strain 002232).

[0277] Plasma phenylalanine levels were monitored as skin transplants were established in PAH mutant mice. Three weeks after skin transplantation with PAL-expressing cells or control cells (BTBR epidermal progenitor cells treated with a control vector), blood samples were collected from the tail shear every two weeks for up to 30 weeks. Plasma was separated by centrifugation. Phenylalanine concentration was determined by an established fluorescence protocol. Reducing phenylalanine levels restored melanin biosynthesis and resulted in changes in coat color. Potential changes in skin color were recorded weekly for all transplanted animals. It has been previously demonstrated that treatment of PKU has a sex-dependent response to viral vector-mediated therapy and enzyme replacement therapy with modified PAL. Therefore, two different groups of animals (male and female) were established to test the potential sex-dependent effects of in vivo skin gene therapy.

[0278] At the end point of the experiment (30 weeks), transplanted animals were euthanized and tissue samples (transplanted skin, host skin and liver) were collected. The presence of enzyme activity in tissues was determined by PAH and PAL activity assays.

[0279] In vitro analysis demonstrated that exogenous expression of PAL in mouse epidermal cells could clear ~120 nmol of phenylalanine / hour / 10 6 cells. Therefore, it contains ~2X10 7 Two 1cm2 of metabolically active cells 2 Epidermal grafts can remove 57 μmol phenylalanine per day, which is sufficient to completely reverse hyperphenylalaninemia (PAH mutant mice normally have ~2 mM plasma phenylalanine). A complete phenotypic change from brown fur to dark black fur is also expected. For tissue enzyme analysis, detection of PAL activity in transplanted skin is expected, but not in other tissues. PAH activity is not present in the liver of mutant mice. Female mice are more resistant to PKU therapy. If this is the case for skin gene therapy, female PAH mutant mice are tested to determine if they require larger skin grafts or more grafts than male mice to correct hyperphenylalaninemia.

[0280] One potential problem is that overexpression of PAL may result in excessive removal of phenylalanine in mice and lead to hypophenylalaninemia, which has been reported for human PKU patients receiving recombinant PAL enzyme replacement therapy. If this occurs, a Tet (tetracycline)-inducible system for driving PAL expression as described above can be used. The expression level of PAL can be controlled by administering different doses of doxycycline.

[0281] Method 1: Expressing the PAL gene in transplanted cells

[0282] Although exogenous expression of PAL does not alter cell proliferation or differentiation programs in mouse epidermal keratinocytes, expression of PAL may impair human keratinocyte growth or skin regeneration. If this occurs, use a Tet-inducible system for driving PAL gene expression (see Fig.28 ).

[0283] Method 2: Immune intolerance of PAL

[0284] If exogenous expression of PAL indeed results in a severe immune response that cannot be suppressed, expression of PAH (the native phenylalanine processing enzyme) for the treatment of PKU was tested. Although PAH requires BH4 as a cofactor, co-expression of GTPCH and PTPS with PAH in muscle has been shown to result in a stable and long-term reduction in plasma phenylalanine in a mouse model. Therefore, a Rosa26 targeting vector with a triple cis expression cassette encoding PAH (SEQ ID NO: 54), GTPCH (SEQ ID NO: 55), and PTPS (SEQ ID NO: 56) was developed.

[0285] Targeted epidermal progenitor cells were examined for phenylalanine clearance and potential therapeutic effects on PKU in vitro and in vivo. If co-expression of PAH, GTPCH, and PTPS was insufficient, a Rosa26 targeting vector with a quadruple cistron expression cassette encoding PAH, GTPCH, PTPS, and SR (SEQ ID NO: 57) was developed to reconstitute the entire de novo BH4 synthesis pathway in tissue organoids.

[0286] Example 9: Tissue Organoids for Treatment of Hemophilia

[0287] introduction

[0288] Hemophilia is an inherited coagulation disorder caused by a lack of coagulation factor VIII (type A) or IX (type B) in plasma. Unstoppable bleeding itself may be life-threatening, but hemophiliacs also often suffer from repeated bleeding in soft tissues, joints, and muscles, leading to chronic synovitis, severe arthropathy, and physical disability. Hemophilia is an excellent candidate for skin gene therapy because both factor VIII and IX are secretory proteins, so their expression in epidermal cells can correct defects. In addition, particularly for hemophilia A, the coding sequence of factor VIII exceeds 7kb (kilobases), far exceeding the packaging limitations of typical viral vectors (e.g., AAV (adeno-associated virus) vectors) for gene therapy. Somatic cell gene therapy in the skin provides a more durable and affordable treatment for hemophilia A than the current standard therapy of purified factor VIII by intravenous infusion.

[0289] Previous work has demonstrated that factors VIII and IX can be expressed in human or mouse epidermal keratinocytes and that exogenously expressed coagulation factors can cross the epidermal / dermal barrier to reach the circulation. In particular, when transgenic skin expressing factor VIII under the involucrin promoter was transplanted into an immunocompromised host (factor VIII and Rag1 double knockout), epidermal expression of factor VIII significantly restored plasma factor VIII levels, strongly supporting the feasibility of a cutaneous gene therapy approach to treat hemophilia A.

[0290] A Factor VIII expression gene with a B domain deletion (SEQ ID NO: 58) is contemplated, wherein the B domain, which is a long internal domain and functionally useful for blood coagulation, is removed. It is contemplated that the transfection targeting vector further introduces a Tet-inducible system to control overexpression of Factor VIII.

[0291] The emergence of inhibitory antibodies against factor VIII is the most serious complication of current enzyme replacement therapy. If the expression of mouse factor VIII in mutant mice (factor VIII-deficient) induces antibody production, three approaches are used:

[0292] 1) Use full-length factor VIII (SEQ ID NO: 59) for skin gene therapy instead of factor VIII with a B domain deletion. Although the B domain is not essential for blood coagulation, a meta-analysis of prospective clinical results showed that the deletion of the B domain can shorten the half-life of recombinant factor VIII, increase the incidence of bleeding in patients, and significantly increase the risk of neutralizing antibodies.

[0293] 2) The Fc domain of an immunoglobulin (mouse IgG1 Fc (SEQ ID NO: 34) or human IgG1 Fc (SEQ ID NO: 39)) is conjugated to Factor VIII. The Fc domain of IgG can interact with the neonatal Fc receptor, which can protect IgG from catabolism and extend its half-life in the circulation. It has been shown that fusion of human Factor VIII to the IgG1 Fc domain can significantly increase its half-life in patients. In addition, current clinical results show that Fc conjugation of Factor VIII does not induce neutralizing antibody production in patients. Consistently, it has been shown that in a hemophilia A mouse model, the Fc-Factor VIII conjugate elicits a much lower immune response than non-conjugated Factor VIII.

[0294] 3) Factor VIII is coupled to albumin (SEQ ID NO: 60). Albumin is the most abundant plasma protein and is a natural carrier of a variety of molecules in circulation. Albumin has a very long half-life and low immunogenicity in the blood. Therefore, conjugation with albumin may enhance the effectiveness of skin gene therapy for hemophilia A. It has been shown that conjugation of albumin to factor IX (SEQ ID NO: 61) can significantly protect factor IX in the circulation and reduce its immunogenicity. Although the fusion of factor VIII to albumin has not been successfully performed before, different fusion strategies (e.g., conjugation to the amino or carboxyl terminus of factor VIII and / or fusion using different linker peptides) have been adopted and in vitro and in vitro effects have been examined.

[0295] For hemophilia B, a similar approach as described above is used using Factor IX.

[0296] Example 10: Evaluation of immune response to skin transplantation

[0297] The skin transplantation procedure developed with immunocompetent mice provides a unique opportunity to evaluate potential immune responses following skin gene therapy. To examine potential inflammatory infiltration in vivo after tissue organoid transplantation, transplanted skin tissue was collected at different time points after transplantation. Potential infiltration of immune cells was assessed by immunofluorescence staining with α-CD3, α-CD4, α-CD8 (T cells), α-B220 (B cells), α-CD11c (dendritic cells), α-Mac-1 (macrophages), α-CD335 (NK cells) and α-Gr1 (granulocytes) antibodies. The presence of Langerhans cells in skin transplants was determined by staining with α-CD1a antibodies. In addition, skin samples were stained for MHC class I and class II antigens (including HLA-ABC and HLA-DR) as indicators of potential graft rejection, tissue antigenicity, and epidermal reactivity.

[0298] As a second method, immune response is assessed by flow cytometry (fluorescence activated cell sorting), which allows immune cell populations to be analyzed more comprehensively and quantitatively. For this purpose, a specific antibody group has been developed to more carefully examine the phenotype of immune cells that change in response to transplantation. These experiments are guided by the immunofluorescence staining results of sections. For example, if the difference in the number and / or position of macrophages in the staining method is seen, a "macrophage group" is established, which allows the use of surface markers to determine whether the macrophages raised adopt proinflammatory M1 (CD38, CD274, CD319) or anti-inflammatory M2 (CD206, CD163, TFRC) phenotypes. Similarly, if staining experiments show that T cells respond, a T cell group comprising CD3 (all T cells), CD4 (helper T cells), CD8 (killer T cells), FoxP3 / CD25 (regulatory T cells) and CD44 / CD62L (activated T cells) is implemented. The exact nature of the immune response (eg, immunogenicity vs. tolerogenicity) needs to be understood to determine whether modulation of the host response to transplantation is necessary.

[0299] To determine whether implantation of modified epidermis can increase host leukocytes specific for transplanted keratinocytes, an in vitro cell proliferation assay was performed. Peripheral blood mononuclear cells (PBMCs) were isolated before and after skin transplantation and evaluated with irradiated autologous PBMCs or irradiated epidermal progenitor cells with modified expression. Phytohemagglutinin was used as a positive control.

[0300] To examine NK (natural killer) cell activity against epidermal progenitor cells, PBMCs isolated from transplanted animals were used. In vitro cytotoxicity assays were performed to determine the activity of NK cells at different effector: target ratios. NK sensitive cell lines were used as positive controls.

[0301] In order to examine the immunogenicity of the modified protein, blood samples from transplanted animals were collected at different time points (up to 6 months). Serum antibody levels were determined by ELISA (enzyme-linked immunosorbent assay). As a positive control, intravenous injections of the recombinant modified protein were injected into mice.

[0302] Example 11: Non-surgical removal of skin grafts

[0303] Biointegrated tissue organoids can be used temporarily and removed surgically. However, skin stem cell technology allows for another non-invasive and effective way to achieve removal of transplanted cells.

[0304] To test this possibility, epidermal progenitor cells were transfected with a Rosa26 targeting vector encoding phenylalanine aminolyase (PAL) (SEQ ID NO: 51) and the inducible "suicide" genes HSV-TK (herpes simplex virus thymidine kinase) (SEQ ID NO: 52) and yCD (yeast cytosine deaminase) (SEQ ID NO: 53). The results (data not shown) showed that both suicide genes were safely expressed in epidermal progenitor cells and effectively induced cell death after treatment with prodrugs (ganciclovir and 5-fluorocytosine, respectively).

[0305] A potential problem is that high levels of suicide gene expression (TK or yCD) may lead to a bystander effect, causing cell death in the surrounding tissue. To prevent this, the Tet promoter can be used to drive suicide gene expression, allowing the level of suicide gene expression to be controlled by administering doxycycline.

[0306] Therefore, tissue organoids encoding reporter molecules and / or therapeutic agents as well as inducible suicide genes are considered to allow for nonsurgical removal of biointegrated tissue organoids.

[0307] Example 12: Tissue organoids for the treatment of obesity

[0308] Recent reports indicate that nearly 40% of American adults and approximately 20% of children are obese. Peptide YY (PYY) (SEQ ID NO: 66) is associated with hunger and satiety, and is released from cells in the ileum and colon in response to eating. Increased levels of PYY are thought to be associated with satiety. According to the present disclosure, administration of PYY may allow a person suffering from obesity to reduce their food consumption, thereby enabling them to not only lose weight, but also maintain the weight loss.

[0309] Thus, tissue organoids for treating and / or preventing obesity are prepared as described herein using a targeting vector encoding PYY (SEQ ID NO: 66). It is expected that increased PYY levels will reduce cravings in individuals receiving tissue organoids expressing PYY. As a result, it is expected that individuals will experience reduced food seeking and consumption, thereby treating and / or preventing obesity.

[0310] Example 13: Tissue Organoids for Reversing Aging Effects

[0311] The global anti-aging market is estimated at $250 billion. The effects of aging include, but are not limited to, vascular and cardiac disease and a reduction in immune response. Tissue inhibitor of metalloproteinases 2 (TIMP2) (SEQ ID NO: 67) encodes a protein that is a natural inhibitor of matrix metalloproteinases (MMPs). TIMP2 was found to be present in high concentrations at a very young age, but decreases with age. Memory studies with mice showed that after injection with TIMP2, older mice performed comparable to young mice (Castellano et al., Nature, 544, 488-492 (2017)). Controlled administration of TIMP2 may have anti-aging effects, such as memory improvement.

[0312] Therefore, tissue organoids engineered to treat and / or prevent the effects of aging are prepared as described herein using a targeting vector encoding TIMP2 (SEQ ID NO: 67). It is expected that increased TIMP2 levels will exhibit anti-aging effects in individuals receiving tissue organoids expressing TIMP2. As a result, it is expected that the treated individual may experience a reduction in the negative effects of aging, which may include memory loss, reduced vascular response, and / or reduced immune response.

[0313] Example 14: Tissue Organoids for Nicotine Abuse

[0314] Similarly, tobacco use is the leading cause of death from cardiovascular disease, lung disease, and cancer (Nature, 362, 2295-2303 (2010)). The Centers for Disease Control states that nearly 480,000 people die each year from tobacco-related deaths. Nicotine has long been identified as the cause of the addictive nature of tobacco. Nicotine replacement therapy (including transdermal nicotine patches and nicotine gum) was the first FDA-approved treatment for smoking cessation. Although nicotine replacements are commonly used, other forms of treatment are available, including the antidepressant bupropion (National Institute on Drug Abuse, Tobacco / Nicotine, Research Report Series (2012). Despite the availability of multiple treatments, nicotine abuse remains widespread. Egecioglu et al. reported that the GLP-1 receptor agonist Exendin-4 (Ex4) attenuated nicotine-induced locomotor stimulation, cumulative dopamine release, and the expression of conditioned place preference in mice (Egecioglu et al., 2013). Therefore, it is believed that tissue organoids expressing mGLP1 may also be used to treat nicotine addiction.

[0315] Experimental Procedure

[0316] Unless indicated to the contrary, reagents and experimental procedures followed those described in Example 2 above.

[0317] Modified GLP1

[0318] The GLP1 gene (mGLP1) was modified to produce a novel protein with a longer in vivo half-life (Kumar et al., Gene therapy of diabetes using a novel GLP-1 / IgG1-Fc fusion construct normalizes glucose levels in db / db mice. Gene therapy 14, 162-172, (2007)). In order to stably deliver mGLP1 in vivo and control its expression, we prepared a Rosa26-targeting vector (SEQ ID NO: 45) encoding a Gly8-mutant mGLP1 and a mouse IgG-Fc fragment fusion protein driven by a dox-dependent promoter. Fig.25 A; Yue et al. Treatment of diabetes and obesity with CRISPR-mediated genomeediting in epidermal progenitor ceils. Cell Stem Cell, In press (2017); Kumar et al., 2007). Glycine mutations render peptides resistant to DPP-IV-mediated cleavage (Mentlein et al., Dipeptidyl-peptidase IV hydrolyses gastric inhibitory polypeptide, glucagon-like peptide-1(7-36)amide, peptide histidine methionine and is responsible for their degradation in human serum. Eur. J. Biochem. 214, 829-835 (1993)).

[0319] When expressed in epidermal cells, fusion with IgG-Fc further enhances mGLP1 stability and circulation half-life (Kumar et al., 2007), and it can reach the brain through the blood-brain barrier (Pardridge, WM, CSF, blood-brain barrier, and brain drug delivery. Expert Opin. Drug Deliv. 13, 963-975 (2016)). The Rosa26 allele has been widely used as a safe locus for gene targeting in mice (Soriano, P., Generalized lacZ expression with the ROSA26 Cre reporter strain. Nat, Genetics 21, 70-71, (1999)). In order to use CRISPR-mediated genome editing, a vector encoding a D10A mutant of Cas9 (CRISPR-associated protein 9) was developed (Ran et al., 2013) and two gRNAs (guide RNAs) targeting the mouse Rosa26 allele. The D10A mutation and double nicking system in Cas9 minimize unwanted off-target mutagenesis in the genome (Ran et al., 2013).

[0320] Skin organoid culture and transplantation

[0321] Epidermal progenitor cells were isolated from newborn pups of CD1 or C57BL / 6J mice. Cells were transfected with targeting vectors and plasmids encoding Cas9 and Rosa26-specific gRNAs. Targeted clones were selected in medium containing puromycin, and correct introduction of the Rosa26 locus was confirmed by PCR and Southern blotting ( Fig.25 B) Mouse skin substitutes were prepared by seeding target cells into acellular neodermis and allowing differentiation upon exposure to an air / liquid interface, and the resulting tissues were transplanted into CD1 or C57BL / 6J mice (GLP1).

[0322] When fed the dox diet, mGLP1 mice began to show significantly enhanced mGLP1 levels in the blood within 3 days ( Fig.25 C; Yue et al., 2017). There was a dose-dependent release of GLP1 in plasma (not shown). In the presence of dox, expression of mGLP1 in GLP1 mice was stable for up to 4 months ( Fig.25 D).

[0323] Results and discussion

[0324] GLP1 expression attenuated nicotine-induced CPP in GLP1 mice compared with mock transplants (GWT). Fig.29 ).

[0325] GLP1 mice did not show significant nicotine-induced GPP. As previously described (Chen et al., Dopamine D1 and D3 receptors are differentially involved in cue-elicited cocaine seeking. J. Neurochem. 114, 530-541 (2010); Kong et al., Activation of dopamine D3 receptors inhibits reward-related learning induced by cocaine. Neurosci. 176, 152-161 (2011)), after 2 free explorations on day 1 (pre-test), separate mGLP1 and GWT groups (n = 7 per group) received alternating intraperitoneal injections of nicotine (0.4 mg / kg) and saline twice a day for the next 4 days. CPP performance was tested on day 6. Results are expressed as the mean ± SEM time spent on the drug-paired side minus the saline-paired side. Repeated measures ANOVA with test day as within-group factor and transplant status as between-subject factor (Chen et al., 2010; Kong et al., 2011) was used. F values ​​were calculated and Newman-Keuls post hoc test was performed (Chen et al., 2010; Kong et al., 2011). GLP1 and GWT mice were fed dox diet throughout the period.

[0326] These results show that mGLP1 expression weakens nicotine-induced CPP. Therefore, the tissue organoid expressing mGLP1 has the potential for treating nicotine abuse. In addition, it is believed that the tissue organoid designed to express multiple therapeutic agents (such as mGLP1 and hBChE) can be used to reduce the event of cocaine and ethanol and / or nicotine co-abuse, and may reduce the abuse and co-abuse of other drugs (such as amphetamine) (see Skibicka KP The central GLP-1: implications for food and drug reward, Front Neurosci. 7: 181 (2013)). It is also expected that GLP-1 analogs (see above) can be used in a similar manner herein.

[0327] sequence

[0328]

[0329]

[0330]

[0331]

[0332]

[0333]

[0334]

[0335]

[0336]

[0337]

[0338]

[0339]

[0340]

[0341]

[0342]

[0343]

[0344]

[0345]

[0346]

[0347]

[0348]

[0349]

[0350]

[0351]

[0352]

[0353]

[0354]

[0355]

[0356]

[0357]

[0358]

[0359]

[0360] Having described the present invention in detail and with reference to specific aspects and / or embodiments of the present invention, it is apparent that modifications and variations may be made without departing from the scope of the present invention as defined by the appended claims. More specifically, although some aspects herein may be identified as particularly advantageous herein, it is contemplated that the present invention is not limited to these specific aspects of the present invention. Sequence Listing <110> The University of Chicago <120> Tissue Organoids <130> 16-1381-PRO <140> tbd <141> 2016-12-09 <160> 67 <170> PatentIn Version 3.5 <210> 1 <211> 1071 <212> DNA <213> Unknown <220> <223> Luciferase <400> 1 atgccagagc cagcgaagtc tgctcccgcc ccgaaaaagg gctccaagaa ggcggtgact 60 aaggcgcaga agaaaggcgg caagaagcgc aagcgcagcc gcaaggagag ctattccatc 120 tatgtgtaca aggttctgaa gcaggtccac cctgacaccg gcatttcgtc caaggccatg 180 ggcatcatga actcgtttgt gaacgacatt ttcgagcgca tcgcaggtga ggcttcccgc 240 ctggcgcatt acaacaagcg ctcgaccatc acctccaggg agatccagac ggccgtgcgc 300 ctgctgctgc ctggggagtt ggccaagcac gccgtgtccg agggtactaa ggccatcacc 360 aagtacacca gcgctaaagga tccaccggtc gccaccatgg cctcctccga ggacgtcatc 420 aaggagttca tgcgcttcaa ggtgcgcatg gagggctccg tgaacggcca cgagttcgag 480 atcgagggcg agggcgaggg ccgcccctac gagggcaccc agaccgccaa gctgaaggtg 540 accaagggcg gccccctgcc cttcgcctgg gacatcctgt cccctcagtt ccagtacggc 600 tccaaggcct acgtgaagca ccccgccgac atccccgact acttgaagct gtccttcccc 660 gagggcttca agtgggagcg cgtgatgaac ttcgaggacg gcggcgtggt gaccgtgacc 720 caggactcct ccctgcagga cggcgagttc atctacaagg tgaagctgcg cggcaccaac 780 ttcccctccg acggccccgt aatgcagaag aagaccatgg gctgggaggc ctccaccgag 840 cggatgtacc ccgaggacgg cgccctgaag ggcgagatca agatgaggct gaagctgaag 900 gacggcggcc actacgacgc cgaggtcaag accacctaca tggccaagaa gcccgtgcag 960 ctgcccggcg cctacagac cgacatcaag ctggacatca cctcccaca cgaggactac 1020 accatcgtgg aacagtacga gcgcccgag gccgccact cccaccggcc c 1071 <210> 2 <211> 1648 <212> DNA <213> Unknown <220> <223> H2B-RFP <400> 2 atggaagacg ccaaaacat aaagaaaggc ccggcgccat tctatccgct ggaagatgga 60 accgctggag agcactgca taaggctg aagagatacg ccctggttcc tggacaatt 120 gcttttacag atgcacatat cgaggtggac atcacttacg ctgagtactt cgaaatgtcc 180 gttcggttgg cagaagctat gaacgatat gggctgaata caatcacag aatcgtcgta 240 tgcagtgaaa actctctca attctatg ccggtgttgg gcgcgttatt tatcggagtt 300 gcagttgcgc ccgcgaacga catttataat gaacgtgaat tgctcacag tatgggcatt 360 tcgcagccta ccgtggtgtt cgtttccaa aaggggttgc aaaaaatttt gaacgtgcaa 420 aaaaagctcc catcatcca aaaaattatt catcatccatt ctaaaacgga catcaggga 480 tttcagtcga tgtacacgtt cgtcacatct catctacctc ccggttttaa tgaatacgat 540 600 tctactggtc tgcctaaagg tgtcgctctg cctcatagaa ctgcctgcgt gagattctcg 660 catgccagag atcctatttt tggcaatcaa atcattccgg atactgcgat tttaagtgtt 720 gttccattcc atcacggttt tggaatgttt actacactcg gatatttgat atgtggattt 780 cgagtcgtct taatgtatag atttgaagaa gagctgtttc tgaggagcct tcaggattac 840 aagattcaaa gtgcgctgct ggtgccaacc ctattctcct tcttcgccaa aagcactctg 900 attgacaaat acgatttatc taatttacac gaaattgctt ctggtggcgc tcccctctct 960 aaagtcg gggaagcggt tgccaagagg ttccatctgc caggtatcag ccaaggatat 1020 gggctcactg agactacatc agctattctg attacacccg aggggatga taaaccgggc 1080 gcggtcggta aagttgttcc atttttgaa gcgaaggttg tggatctgga taccgggaaa 1140 acgctgggcg ttaatcaaag aggcgaactg tgtgtgagag gtcctatgat tatgtccggt 1200 tatgtaaaca atccggaagc gaccaacgcc ttgattgaca aggatggatg gctacattct 1260 ggagacatag cttactggga cgaagacgaa cacttcttca tcgttgaccg cctgaagtct 1320 ctgattaagt acaaaggcta tcaggtggct cccgctgaat tggaatccat cttgctccaa 1380 caccccaaca tcttcgacgc aggtgtcgca ggtcttcccg acgatgacgc cggtgaactt 1440 cccgccgccg ttgttgtttt ggagcacgga aagacgatga cggaaaaaga gatcgtggat 1500 tacgtcgcca gtcaagtaac aaccgcgaaa aagttgcgcg gaggagttgt gtttgtggac 1560 gaagtaccga aaggtcttac cggaaaactc gacgcaagaa aaatcagaga gatcctcata 1620 aaggccaaga agggcggaaa gatcgccg 1648 <210> 3 <211> 34 <212> DNA <213> Unknown <220> <223> Forward primer of gRNA expression cassette <400> 3 aaggaaaaaa gcggccgctg tacaaaaaag cagg 34 <210> 4 <211> 24 <212> DNA <213> Unknown <220> <223> Reverse primer of gRNA expression cassette <400> 4 ggaattctaa tgccaacttt gtac 24 <210> 5 <211> 26 <212> DNA <213> Unknown <220> <223> Rosa26 targeting gRNA forward primer 1 <400> 5 acaccggcag gcttaaaggc taaccg 26 <210> 6 <211> 26 <212> DNA <213> Unknown <220> <223> Rosa26 targeting gRNA reverse primer 1 <400> 6 aaaacggtta gcctttaagc ctgccg 26 <210> 7 <211> 26 <212> DNA <213> Unknown <220> <223> Rosa26 targeting gRNA forward primer 2 <400> 7 acaccgagga caacgcccac acaccg 26 <210> 8 <211> 26 <212> DNA <213> Unknown <220> <223> Rosa26 targeting gRNA reverse primer 2 <400> 8 aaaacggtgt gtgggcgttg tcctcg 26 <210> 9 <211> 26 <212> DNA <213> Unknown <220> <223> AAVS1 targeting gRNA forward primer 1 <400> 9 acaccgtcac caatcctgtc cctagg 26 <210> 10 <211> 26 <212> DNA <213> Unknown <220> <223> AAVS1 targeting gRNA reverse primer 1 <400> 10 aaaacctagg gacaggattg gtgacg 26 <210> 11 <211> 26 <212> DNA <213> Unknown <220> <223> AAVS1 targeting gRNA forward primer 2 <400> 11 acaccgcccc acagtggggc cactag 26 <210> 12 <211> 26 <212> DNA <213> Unknown <220> <223> AAVS1 targeting gRNA reverse primer 2 <400> 12 aaaactagtg gccccactgt ggggcg 26 <210> 13 <211> 50 <212> DNA <213> Unknown <220> <223> Rosa26 targeting vector forward primer 1 <400> 13 gactagtgaa ttcggatcct taattaaggc ctccgcgccg ggttttggcg 50 <210> 14 <211> 47 <212> DNA <213> Unknown <220> <223> Rosa26 targeting vector reverse primer 1 <400> 14 gactagtccc gggggatcca ccggtcagga acaggtggtg gcggccc 47 <210> 15 <211> 37 <212> DNA <213> Unknown <220> <223> Rosa26 targeting vector forward primer 2 <400> 15 cgggatccac cggtgagggc agaggaagcc ttctaac 37 <210> 16 <211> 33 <212> DNA <213> Unknown <220> <223> Rosa26 targeting vector reverse primer 2 <400> 16 tcccccgggt acaaaatcag aaggacaggg aag 33 <210> 17 <211> 35 <212> DNA <213> Unknown <220> <223> Rosa26 targeting vector forward primer 3 <400> 17 ggaattcaat aaaatatctttattttcatt acatc 35 <210> 18 <211> 59 <212> DNA <213> Unknown <220> <223> Rosa26 targeting vector reverse primer 3 <400> 18 ccttaattaa ggatccacgc gtgtttaaac accggtttta cgagggtagg aagtggtac 59 <210> 19 <211> 37 <212> DNA <213> Unknown <220> <223> AAVS1 targeting vector constructed with AAVS1 hPGK-PuroR-pA donor forward primer 1 <400> 19 cccaagcttc tcgagttggg gttgcgcctt ttccaag 37 <210> 20 <211> 31 <212> DNA <213> Unknown <220> <223> AAVS1 targeting vector constructed with AAVS1 hPGK-PuroR-pA donor reverse primer 1 <400> 20 cccaagcttc catagagccc accgcatccc c 31 <210> twenty one <211> 44 <212> DNA <213> Unknown <220> <223> AAVS1 targeting vector constructed with AAVS1 hPGK-PuroR-pA donor forward primer 2 <400> twenty one cagggtctag acgccggatc cggtaccctg tgccttctag ttgc 44 <210> twenty two <211> 37 <212> DNA <213> Unknown <220> <223> AAVS1 targeting vector constructed with AAVS1 hPGK-PuroR-pA donor reverse primer 2 <400> twenty two ggatccggcg tctagaccct ggggagagag gtcggtg 37 <210> twenty three <211> 37 <212> DNA <213> Unknown <220> <223> AAVS1 targeting vector constructed with AAVS1 hPGK-PuroR-pA donor forward primer 3 <400> twenty three ccgctcgaga ataaaatatc tttattttca ttacatc 37 <210> twenty four <211> 30 <212> DNA <213> Unknown <220> <223> AAVS1 targeting vector constructed with AAVS1 hPGK-PuroR-pA donor reverse primer 3 <400> twenty four gctctagacc aagtgacgat cacagcgatc 30 <210> 25 <211> twenty two <212> DNA <213> Unknown <220> <223> Genotyping primers for CRISPR-mediated knock-in #1 <400> 25 gagctgggac caccttatat tc 22 <210> 26 <211> 17 <212> DNA <213> Unknown <220> <223> Genotyping primers for CRISPR-mediated knock-in #2 <400> 26 ggtgcatgac ccgcaag 17 <210> 27 <211> twenty one <212> DNA <213> Unknown <220> <223> Genotyping primers for CRISPR-mediated knock-in #3 <400> 27 gagagatggc tccaggaaat g 21 <210> 28 <211> 2391 <212> DNA <213> Unknown <220> <223> CFP / YFP FRET sensor with A213R / L238S double mutation of GGBP <400> 28 atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 60 ggcgacgtaa acggccacaa gttcagcgtg tccggcgagg gcgagggcga tgccacctac 120 ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc 180 ctcgtgacca ccctgacctg gggcgtgcag tgcttcagcc gctaccccga ccacatgaag 240 cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatcttc 300 ttcaaggacg acggcaacta caagacccgc gccgaggtga agttcgaggg cgacaccctg 360 gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 420 aagctggagt acaactacat cagccacaac gtctatatca ccgccgacaa gcagaagaac 540. ggcatcaagg ccaacttcaa gatccgccac aacatcgagg acggcagcgt gcagctcgcc gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac tacctgagca cccagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc ctgctggagt tcgtgaccgc cgccgggatc actctcggca tggacgagct gtacaagggt 720 ggtaccggag gcgccgctga tactcgcatt ggtgtaacaa tctataagta cgacgataac tttatgtctg tagtgcgcaa ggctattgag caagatgcga aagccgcgcc agatgttcag ctgctgatga atgattctca gaatgaccag tccaagcaga acgatcagat cgacgtattg ctggcgaaag gggtgaaggc actggcaatc aacctggttg acccggcagc tgcgggtacg gtgattgaga aagcgcgtgg gcaaaacgtg ccggtggttt tcttcaacaa agaaccgtct cgtaaggcgc tggatagcta cgacaaagcc tactacgttg gcactgactc caaagagtcc ggcattattc aaggcgattt gattgctaaa cactgggcgg cgaatcaggg ttgggatctg 1140 aacaaagacg gtcagattca gttcgtactg ctgaaaggtg aaccgggcca tccggatgca 1200 gaagcacgta ccacttacgt gattaaagaa ttgaacgata aaggcatcaa aactgaacag 1260 ttacagttag ataccgcaat gtgggacacc gctcaggcga aagataagat ggacgcctgg 1320 ctgtctggcc cgaacgccaa caaaatcgaa gtggttatcg ccaacaacga tcggatggca 1380 atgggcgcgg ttgaagcgct gaaagcacac aacaagtcca gcattccggt gtttggcgtc 1440 gatgcgtcgc cagaagcgct ggcgctggtg aaatccggtg cactggcggg caccgtactg 1500 aacgatgcta acaaccaggc gaaagcgacc tttgatctgg cgaaaaacct ggccgatggt 1560 aaaggtgcgg ctgatggcac caactggaaa atcgacaaca aagtggtccg cgtaccttat 1620 gttggcgtag ataaagacaa cctggctgaa ttcagcaaga aaggcgccgg taccggtgga 1680 atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 1740 ggcgacgtaa acggccacaa gttcagcgtg tccggcgagg gcgagggcga tgccacctac 1800 ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc 1860 ctcgtgacca ccttcggcta cggcctgcag tgcttcgccc gctaccccga ccacatgaag 1920 cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatcttc 1980 ttcaaggacg acggcaacta caagacccgc gccgaggtga agttcgaggg cgacaccctg 2040 gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 2100 aagctggagt acaactacaa cagccacaac gtctatatca tggccgacaa gcagaagaac 2160 ggcatcaagg tgaacttcaa gatccgccac aacatcgagg acggcagcgt gcagctcgcc 2220 gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac 2280 tacctgagct accagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc 2340 ctgctggagt tcgtgaccgc cgccgggatc actctcggca tggacgagct g 2391 <210> 29 <211> 4146 <212> DNA <213> Unknown <220> <223> Cas9 D10A <400> 29 gccaccatgg acaagaagta ctccattggg ctcgctatcg gcacaaacag cgtcggctgg 60 gccgtcatta cggacgagta caaggtgccg agcaaaaaat tcaaagttct gggcaatacc 120 gatcgccaca gcataaagaa gaacctcatt ggcgccctcc tgttcgactc cggggagacg 180 gccgaagcca cgcggctcaa aagaacagca cggcgcagat atacccgcag aaagaatcgg 240 atctgctacc tgcaggagat ctttagtaat gagatggcta aggtggatga ctctttcttc 300 cataggctgg aggagtcctt tttggtggag gaggataaaa agcacgagcg ccacccaatc 360 tttggcaata tcgtggacga ggtggcgtac catgaaaagt acccaaccat atatcatctg 420 aggaagaagc ttgtagacag tactgataag gctgacttgc ggttgatcta tctcgcgctg 480 gcgcatatga tcaaatttcg gggacacttc ctcatcgagg gggacctgaa cccagacaac 540 agcgatgtcg acaaactctt tatccaactg gttcagactt acaatcagct tttcgaagag 600 aacccgatca acgcatccgg agttgacgcc aaagcaatcc tgagcgctag gctgtccaaa 660 tcccggcggc tcgaaaacct catcgcacag ctccctgggg agaagaagaa cggcctgttt 720 ggtaatctta tcgccctgtc actcgggctg acccccaact ttaaatctaa cttcgacctg 780 gccgaagatg ccaagcttca actgagcaaa gacacctacg atgatgatct cgacaatctg 840 ctggcccaga tcggcgacca gtacgcagac cttttttgg cggcaaagaa cctgtcagac 900 gccattctgc tgagtgatat tctgcgagtg aacacggaga tcaccaaagc tccgctgagc 960 gctagtatga tcaagcgcta tgatgagcac caccaagact tgactttgct gaaggccctt 1020 gtcagacagc aactgcctga gaagtacaag gaaatttct tcgatcagtc taaaaatggc 1080 tacgccggat acattgacgg cggagcaagc caggaggaat tttacaaatt tattaagccc 1140 atcttggaaa aaatggacgg caccgaggag ctgctggtaa agcttaacag agaagatctg 1200 ttgcgcaaac agcgcacttt cgacaatgga agcatccccc accagattca cctgggcgaa 1260 ctgcacgcta tcctcaggcg gcaagaggat ttctacccct tttgaaaga taacagggaa 1320 aagattgaga aaatcctcac atttcggata ccctactatg taggccccct cgcccgggga 1380 aattccagat tcgcgtggat gactcgcaaa tcagaagaga ccatcactcc ctggaacttc 1440 gaggaagtcg tggataaggg ggcctctgcc cagtccttca tcgaaggat gactacttt 1500 gataaaaatc tgcctaacga aaggtgctt cctaacact ctctgctgta cgagtacttc 1560 acagtttata acgagctcac caggtcaa tacgtcacag aagggag aaagccagca 1620 ttcctgtctg gagagcagaa gaaagctatc gtggacctcc tctcagac gaaccggaaa 1680 gttaccgtga aacagctcaa agagactat ttcaaaga ttgaatgttt cgactctgtt 1740 gaatcagcg gagtggagga tcgctcaac gcatccctgg gaacgtatca cgatctcctg 1800 aaaatcatta agachagga cttcctggac agaggaga agaggacat tctgaggac 1860 attgtcctca cccttacgtt gtttgaagat agggagatga tgagaacg cttgaaaact 1920 tacgctcatc tctcgacga caagtcatg aacagctca agaggcgccg atacagga 1980 tggggcggc tgtcaagaaa actgatcaat gggatccgag acagcag tggaagaca 2040 atcctggatt ttcttaagtc cgatggattt gccaaccgga acttcatgca gttgatccat 2100 gatgactctc tcaccttatta ggaggacatc cagaagcac aagtttctgg ccagggggac 2160 agtcttcacg agcacatcgc taatcttgca ggtagcccag ctcaaaaa gggaatactg 2220 cagaccgtta agtcgtgga tgaactcgtc aaagtaatgg gaaggcataa gccgagaat 2280 atcgttatcg agatggcccg aggaaccaa actacccaga agggacagaa gaacagtagg 2340 gaaaggatga agaggattga agagggtata aagaactgg ggtcccaat ccttaaggaa 2400 cacccagttg aaaacaccca gctcagaat gagaagctct acctgtacta cctgcagaac 2460 ggcagggaca tgtacgtgga tcaggactg gatacaatc ggctctccga ctacgacgtg 2520 gatcatatcg tgccccagtc tttctcaa gatgattcta ttgataataa agtgttgaca 2580 agatccgata aaatagagg gagagtgat aacgtcccct cagagaagt tgtcaagaaa 2640 atgaaaaatt attggcggca gctgctgaac gccaactga tcacaacg gaagttcgat 2700 aatctgacta aggctgaacg aggtggctg tctgagttgg ataaagccgg cttcatcaa 2760 agcagcttg ttgagacacg ccagatcacc aagcacgtgg cccaattct cgatcacgc 2820 atgaacacca agtacgatga aaatgacaaa ctgattcgag agtgaaagt tattactctg 2880 aagtctaagc tggtctcaga ttcagaag gactttcagt tttaaggt gagagagatc 2940 aacaattacc accatgcgca tgatgcctac ctgaatgcag tggtaggcac tgcacttatc 3000 aaaaaatatc ccaagcttga atctgaattt gtttacggag actataaagt gtacgatgtt 3060 aggaaaatga tcgcaagtc tgagcaggaa atggcaag ccaccgcta gtactcttt 3120 tacagcaata ttatgaattt ttcagacc gagattacac tggccaatgg agagattcgg 3180 aagcgaccac ttatcgaac aaacggagaa acggagaaa tcgtgtggga caagggtagg 3240 gatttcgcga cagtccggaa ggtcctgtcc atgccgcagg tgaacatcgt taaaaagacc 3300 gaagtacaga cggaggtt ctccaaggaa agtatcctcc cgaaaaggaa cagcgacaag 3360 ctgatcgcac gcaaaaaga ttgggacccc aagaatacg gcggattcga ttctcctaca 3420 gtcgcttaca gtgtactggt tgtggccaaa gtggagaaag ggaagtctaa aaaactcaa 3480 agcgtcagg aactgctggg catcacaatc atggagcgat caagcttcga aaaaaacccc 3540 atcgactttc tcaggcgaa aggatataaa gaggtcaaa aagacctcat cattaagctt 3600 cccaagtact ctctctttga gcttgaaaac ggccggaaac gaatgctcgc tagtgcgggc 3660 gagctgcaga aaggtaacga gctggcactg ccctctaaat acgttaattt cttgtatctg 3720 gccagccact atgaaaagct caaagggtct cccgaagata atgagcagaa gcagctgttc 3780 gtggaacaac acaaacacta ccttgatgag atcatcgagc aaataagcga attctccaaa 3840 agagtgatcc tcgccgacgc taacctcgat aaggtgcttt ctgcttacaa taagcacagg 3900 gataagccca tcagggagca ggcagaaaac attatccact tgtttactct gaccaacttg 3960 ggcgcgcctg cagccttcaa gtacttcgac accaccatag acagaaagcg gtacacctct 4020 acaaaggagg tcctggacgc cacactgatt catcagtcaa ttacggggct ctatgaaaca 4080 agaatcgacc tctctcagct cggtggagac agcagggctg accccaagaa gaagaggaag 4140 gtgtga 4146 <210> 30 <211> 23 <212> DNA <213> Unknown <220> <223> Rosa26 gRNA1 <400> 30 ggcaggctta aaggctaacc tgg 23 <210> 31 <211> twenty three <212> DNA <213> Unknown <220> <223> Rosa26 gRNA2 <400> 31 gactggagtt gcagatcacg agg 23 <210> 32 <211> 7695 <212> DNA <213> Unknown <220> <223> Rosa26 targeting vector <220> <221> misc_feature <222> (195)..(195) <223> n is a, c, g, or t <220> <221> misc_feature <222> (230)..(230) <223> n is a, c, g, or t <220> <221> misc_feature <222> (380)..(380) <223> n is a, c, g, or t <220> <221> misc_feature <222> (3724)..(3724) <223> n is a, c, g, or t <220> <221> misc_feature <222> (4213)..(4213) <223> n is a, c, g, or t <220> <221> misc_feature <222> (4297)..(4297) <223> n is a, c, g, or t <220> <221> misc_feature <222> (4874)..(4874) <223> n is a, c, g, or t <220> <221> misc_feature <222> (4931)..(4931) <223> n is a, c, g, or t <220> <221> misc_feature <222> (4953)..(4953) <223> n is a, c, g, or t <220> <221> misc_feature <222> (4993)..(4993) <223> n is a, c, g, or t <220> <221> misc_feature <222> (5644)..(5644) <223> n is a, c, g, or t <220> <221> misc_feature <222> (6667)..(6667) <223> n is a, c, g, or t <220> <221> misc_feature <222> (6769)..(6769) <223> n is a, c, g, or t <220> <221> misc_feature <222> (7147)..(7147) <223> n is a, c, g, or t <220> <221> misc_feature <222> (7562)..(7562) <223> n is a, c, g, or t <400> 32 ccgcggcagg ccctccgagc gtggtggagc cgttctgtga gacagccggg tacgagtcgt gacgctgga ggggcaagcg ggtggtgggc aggaatgcgg tccgccctgc agcaaccgga gggggaggga gaagggagcg gaaaagtctc caccggacgc ggccatggct cgggggggg 180 ggggcagcgg aggancgctt ccggccgacg tctcgtcgct gattggcttn ttttcctccc 240 gccgtgtgtg aaaacacaaa tggcgtgttt tggttggcgt aaggcgcctg tcagttaacg gcagccggag tgcgcagccg ccggcagcct cgctctgccc actgggtggg gcgggaggta 360 ggtggggtga ggcgagctgn acgtgcggggc gcggtcggcc tctggcgggg cgggggaggg 420 gagggagggt cagcgaaagt agctcgcgcg cgagcggccg cccaccctcc ccttcctctg 480 ggggagtcgt tttacccgcc gccggccggg cctcgtcgtc tgattggctc tcggggccca 540 gaaaactggc ccttgccatt ggctcgtgtt cgtgcaagtt gagtccatcc gccggccagc 600 gggggcggcg aggaggcgct cccaggttcc ggccctcccc tcggccccgc gccgcagagt 660 ctggccgcgc gcccctgcgc aacgtggcag gaagcgcgcg ctggggggcgg ggacgggcag 720 tagggctgag cggctgcggg gcgggtgcaa gcacgtttcc gacttgagtt gcctcaagag 780 gggcgtgctg agccagacct ccatcgcgca ctccggggag tggagggaag gagcgagggc 840 tcagttgggc tgttttggag gcaggaagca cttgctctcc caaagtcgct ctgagttgtt 900 atcagtaagg gagctgcagt ggagtaggcg gggagaaggc cgcacccttc tccggagggg 960 ggaggggagt gttgcaatac ctttctggga gttctctgct gcctcctggc ttctgaggac 1020 cgccctgggc ctgggagaat cccttgcccc ctcttcccct cgtgatctgc aactccagtc 1080 tttctagtga attcggatcc ttaattaagg cctccgcgcc gggttttggc gcctcccgcg 1140 ggcgcccccc tcctcacggc gagcgctgcc acgtcagacg aagggcgcag cgagcgtcct 1200 gatccttccg cccggacgct caggacagcg gcccgctgct cataagactc ggccttagaa 1260 ccccagtatc agcagaagga cattttagga cgggacttgg gtgactctag ggcactggtt 1320 ttctttccag agagcggaac aggcgaggaa aagtagtccc ttctcggcga ttctgcggag 1380 ggatctccgt ggggcggtga acgccgatga ttatataagg acgcgccggg tgtggcacag 1440 ctagttccgt cgcagccggg atttgggtcg cggttcttgt ttgtggatcg ctgtgatcgt 1500 cacttggtct agacgccacc atggtgtcca agggcgagga ggtgatcaag gagttcatgc 1560 gcttcaaggt gcgcatggag ggctccatga acggccacga gttcgagatc gagggcgagg 1620 gcgagggccg cccctacgag ggcacccaga ccgccaagct gaaggtgacc aagggcggcc 1680 ccctgccctt cgcctgggac atcctgtccc cccagttcat gtacggctcc aaggcctacg 1740 tgaagcaccc cgccgacatc cccgactaca agaagctgtc cttccccgag ggcttcaagt 1800 gggagcgcgt gatgaacttc gaggacggcg gcctggtgac cgtgacccag gactcctccc 1860 tgcaggacgg caccctgatc tacaaggtga agatgcgcgg caccaacttc ccccccgacg 1920 gccccgtgat gcagaagaag accatgggct gggaggcctc caccgagcgc ctgtaccccc 1980 gcgacggcgt gctgaagggc gagatccacc aggccctgaa gctgaaggac ggcggccact 2040 acctggtgga gttcaagacc atctacatgg ccaagaagcc cgtgcagctg cccggctact 2100 actacgtgga caccaagctg gacatcacct cccacaacga ggactacacc atcgtggagc 2160 agtacgagcg ctccgagggc cgccaccacc tgttcctgac cggtgagggc agaggaagcc 2220 ttctaacatg cggtgacgtg gaggagaatc ccggcccttc cgggatgacc gagtacaagc 2280 ccacggtgcg cctcgccacc cgcgacgacg tccccagggc cgtacgcacc ctcgccgccg 2340 cgttcgccga ctaccccgcc acgcgccaca ccgtcgatcc ggaccgccac atcgagcggg 2400 tcaccgagct gcaagaactc ttcctcacgc gcgtcgggct cgacatcggc aaggtgtggg 2460 tcgcggacga cggcgccgcg gtggcggtct ggaccacgcc ggagagcgtc gaagcggggg 2520 cggtgttcgc cgagatcggc ccgcgcatgg ccgagttgag cggttcccgg ctggccgcgc 2580 agcaacagat ggaaggcctc ctggcgccgc accggcccaa ggagcccgcg tggttcctgg 2640 ccaccgtcgg cgtctcgccc gaccaccagg gcaagggtct gggcagcgcc gtcgtgctcc 2700 ccggagtgga ggcggccgag cgcgccgggg tgcccgcctt cctggagacc tccgcgcccc 2760 gcaacctccc cttctacgag cggctcggct tcaccgtcac cgccgacgtc gaggtgcccg 2820 aaggaccgcg cacctggtgc atgacccgca agcccggtgc ctgaatctag gtcgacctgc 2880 agaagcttgc ctcgagcagc gctgctcgag agatctacgg gtggcatccc tgtgacccct 2940 ccccagtgcc tctcctggcc ctggaagttg ccactccagt gcccaccagc cttgtcctaa 3000 taaaattaag ttgcatcatt ttgtctgact aggtgtcctt ctataatatt atggggtgga 3060 ggggggtggt atggagcaag gggcaagttg ggaagacaac ctgtagggcc tgcggggtct 3120 attgggaacc aagctggagt gcagtggcac aatcttggct cactgcaatc tccgcctcct 3180 gggttcaagc gattctcctg cctcagcctc ccgagttgtt gggattccag gcatgcatga 3240 ccaggctcag ctaatttttg tttttttggt agagacgggg tttcaccata ttggccaggc 3300 tggtctccaa ctcctaatct caggtgatct acccaccttg gcctcccaaa ttgctgggat 3360 tacaggcgtg aaccactgct cccttccctg tccttctgat tttgtacccg ggactagaag 3420 atgggcggga gtcttctggg caggcttaaa ggctaacctg gtgtgtgggc gttgtcctgc 3480 aggggaattg aacaggtgta aaattggagg gacaagactt cccacagatt ttcggttttg 3540 tcgggaagtt ttttaatagg ggcaaatagg aaaatggagg ataggagtca tctggggttt 3600 <h2 style=";text-align:left;direction:ltr">atgcagcaaa actacaggta tattgcttgt atccgcctcg gagatttcca tgaggagata 3660<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> aagacatgtc acccgagttt atactctcct gcttagatcc tactacagta tgaaatacag 3720<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> tgtngcgagg tagactatgt aagcagattt aatcatttta aagagcccag tacttcatat 3780<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> ccatttctcc cgctccttct gcagccttat caaaaggtat ttagaacact cattttagcc 3840<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> ccattttcat ttattatact ggcttatcca acccctagac agagcattgg cattttccct 3900<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> ttcctgatct tagaagtctg atgactcatg aaaccagaca gattagttac atacaccaca 3960<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> aatcgaggct gtagctgggg cctcaacact gcagttcttt tataactcct tagtacactt 4020<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> tttgttgatc ctttgccttg atccttaatt ttcagtgtct atcacctctc ccgtcaggtg 4080<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> gtgttccaca tttgggccta ttctcagtcc agggagtttt acaacaatag atgtattgag 4140<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> aatccaacct aaagcttaac tttccactcc catgaatgcc tctctccttt ttctccatta 4200<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> taactgagct atnaccatta atggtttcag gtggatgtct cctcccccaa tatacctgat 4260<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> gtatctacat attgccaggc tgatatttta agacatnaaa ggtatatttc attattgagc 4320<h2 style=";text-align:left;direction:ltr"> cacatggtat tgattactgc tactaaaatt ttgtcattgt acacatctgt aaaaggtggt 4380 tccttttgga atgcaaagtt caggtgtttg ttgtctttcc tgacctaagg tcttgtgagc 4440 ttgtattttt tctatttaag cagtgctttc tcttggactg gcttgactca tggcattcta 4500 cacgttattg ctggtctaaa tgtgattttg ccaagcttct tcaggaccta taattttgct 4560 tgacttgtag ccaaacacaa gtaaaatgat taagcaacaa atgtatttgt gaagcttggt 4620 ttttaggttg ttgtgttgtg tgtgcttgtg ctctataata atactatcca ggggctggag 4680 aggtggctcg gagttcaaga gcacagactg ctcttccaga agtcctgagt tcaattccca 4740 gcaaccacat ggtggctcac aaccatctgt aatgggatct gatgccctct tctggtgtgt 4800 ctgaagacca caagtgtatt cacattaat aaataatcct ccttcttctt ctttttttt 4860 4920 tccaatatgg nagccaataa tcaaatactc ttnagcactg gaaatgtacc aaagactat 4980 tttatttaag tgnactgtgg acaggaggc cataactgca gacttgtggg atacagaaga 5040 ccaatgcaga cttaatgtct tttctcttac actaagcaat aaagaaataa aaattgaact 5100 tctagtatcc tatttgttaa actgctagct ttactaactt ttgtgcttca tctatacaaa 5160 gctgaaagct aagtctgcag ccattactaa acatgaaagc aagtaatgat aattttggat 5220 ttcaaaaatg tagggccaga gtttagccag ccagtggtgg tgcttgcctt tatgccttaa 5280 tcccagcact ctggaggcag agacaggcag atctctgagt ttgagcccag cctggtctac 5340 acatcaagtt ctatctagga tagccaggaa tacacacaga aaccctgttg gggagggggg 5400 ctctgagatt tcataaatt ataattgaag cattccctaa tgagccacta tggatgtggc 5460 taaatccgtc tacctttctg atgagatttg ggtattattt tttctgtctc tgctgttggt 5520 tgggtctttt gacactgtgg gctttcttaa agcctcttc cctgccatgt ggtctcttgt 5580 ttgctactaa cttcccatgg cttaaatggc atggcttttt gccttctaag ggcagctgct 5640 gagntttgca gcctgatttc cagggtgggg ttgggaaatc tttcaaacac taaaattgtc 5700 ctttaatttt tttttaaaaa atgggttata taataaacct cataaaatag ttatgaggag 5760 tgaggtggac taatattaat gagtccctcc cctataaaag agctattaag gctttttgtc 5820 ttatactaac tttttttta aatgtggtat ctttagaacc aagggtctta gagttttagt 5880 atacagaaac tgttgcatcg cttaatcaga ttttctagtt tcaatccag agaatccaaa 5940 ttcttcacag ccaagtcaa attagaatt tctgacttta atgttattg ctactgtgaa 6000 tataaaatga tagctttcc tgaggcaggg tctcactatg tatctctgcc tgatctgca 6060 caagatatgt agactaagt tctgcctgct ttgtctcct gatactaag gttaaaatgt 6120 agtaatactt tggaacttg caggtcagat tctttag gggacacact aagggagtt 6180 gggtgatagt tggtaatgt gtttaagtga tgaaaacttg aattattac accgcaacct 6240 actttttaaa aaaaaaagcc aggctgtta gagcatgcta agggatccct aggacttgct 6300 gagcacacaa gagtagtact tggcaggctc ctggtgagag catatttca aaaaaaggc 6360 agacaaccaa gaaactacag taaggttacc tgtctttaac catctgcata tacacaggga 6420 tattaaaata ttccaata tattcattc aagttttccc ccatcaatt gggacatgga 6480 tttctccggt gaataggcag agttggaaac taaacaaatg ttggttttgt gatttgtgaa 6540 attgttttca agtgatagtt aaagcccatg agatacagaa caaagctgct atttcgaggt 6600 ctcttggtta tactcagaag cacttctttg ggtttccctg cactatcctg atcatgtgct 6660 aggcctncct taggctgatt gttgttcaaa taacttaagt ttcctgtcag gtgatgtcat 6720 atgatttcat atatcaaggc aaaacatgtt atatatgtta aacatttgna cttaatgtga 6780 aagttaggtc tttgtgggtt ttgattttaa tttcaaaacc tgagctaaat aagtcatttt 6840 acatgtctta catttggtga attgtatatt gtggtttgca ggcaagactc tctgacctag 6900 taaccctcct atagagcact ttgctgggtc acaagtctag gagtcaagca tttcaccttg 6960 aagttgagac gttttgttag tgtatactag ttatatgttg gaggacatgt ttatccagaa 7020 gatattcagg actatttttg actgggctaa ggaattgatt ctgattagca ctgttagtga 7080 gcattgagtg gcctttaggc ttgaattgga gtcacttgta tatctcaaat aatgctggcc 7140 ttttttnaaa agcccttgtt ctttatcacc ctgttttcta cataattttt gttcaaagaa 7200 atacttgttt ggatctcctt ttgacaacaa tagcatgttt tcaagccata ttttttttcc 7260 tttttttttt tttttttggt ttttcgagac agggtttctc tgtatagccc tggctgtcct 7320 ggaactcact ttgtagacca ggctggcctc gaactcagaa atccgcctgc ctctgcctcc 7380 tgagtgccgg gattaaaggc gtgcaccacc acgcctggct aagttggata ttttgtatat 7440 aactataacc aatactaact ccactgggtg gatttttaat tcagtcagta gtcttaagtg 7500 gtctttattg gcccttatta aaatctactg ttcactctaa cagaggctgt tggactagtg 7560 gnactaagca acttcctacg gatatactag cagataaggg tcagggatag aaactagtct 7620 agcgttttgt atacctacca gcttatacta ccttgttctg atagaaatat ttaggacatc 7680 tagcttatcg atccg 7695 <210> 33 <211> 9435 <212> DNA <213> Unknown <220> <223> Rosa26 targeting vector with GGBP <220> <221> misc_feature <222> (195)..(195) <223> n is a, c, g or t <220> <221> misc_feature <222> (230)..(230) <223> n is a, c, g, or t <220> <221> misc_feature <222> (380)..(380) <223> n is a, c, g, or t <220> <221> misc_feature <222> (5464)..(5464) <223> n is a, c, g, or t <220> <221> misc_feature <222> (5953)..(5953) <223> n is a, c, g, or t <220> <221> misc_feature <222> (6037)..(6037) <223> n is a, c, g, or t <220> <221> misc_feature <222> (6614)..(6614) <223> n is a, c, g, or t <220> <221> misc_feature <222> (6671)..(6671) <223> n is a, c, g, or t <220> <221> misc_feature <222> (6693)..(6693) <223> n is a, c, g, or t <220> <221> misc_feature <222> (6733)..(6733) <223> n is a, c, g, or t <220> <221> misc_feature <222> (7384)..(7384) <223> n is a, c, g or t <220> <221> misc_feature <222> (8407)..(8407) <223> n is a, c, g or t <220> <221> misc_feature <222> (8509)..(8509) <223> n is a, c, g or t <220> <221> misc_feature <222> (8887)..(8887) <223> n is a, c, g or t <220> <221> misc_feature <222> (9302)..(9302) <223> n is a, c, g or t <400> 33 ccgcggcagg ccctccgagc gtggtggagc cgttctgtga gacagccggg tacgagtcgt 60 gacgctggaa ggggcaagcg ggtggtgggc aggaatgcgg tccgccctgc agcaaccgga 120 gggggaggga gaagggagcg gaaaagtctc caccggacgc ggccatggct cggggggggg 180 ggggcagcgg aggancgctt ccggccgacg tctcgtcgct gattggcttn ttttcctccc 240 gccgtgtgtg aaaacacaaa tggcgtgttt tggttggcgt aaggcgcctg tcagttaacg 300 gcagccggag tgcgcagccg ccggcagcct cgctctgccc actgggtggg gcgggaggta 360 ggtggggtga ggcgagctgn acgtgcggggc gcggtcggcc tctggcgggg cgggggaggg 420 gagggagggt cagcgaaagt agctcgcgcg cgagcggccg cccaccctcc ccttcctctg 480 ggggagtcgt tttacccgcc gccggccggg cctcgtcgtc tgattggctc tcggggccca 540 gaaaactggc ccttgccatt ggctcgtgtt cgtgcaagtt gagtccatcc gccggccagc 600 gggggcggcg aggaggcgct cccaggttcc ggccctcccc tcggccccgc gccgcagagt 660 ctggccgcgc gcccctgcgc aacgtggcag gaagcgcgcg ctggggggcgg ggacgggcag 720 tagggctgag cggctgcggg gcgggtgcaa gcacgtttcc gacttgagtt gcctcaagag 780 gggcgtgctg agccagacct ccatcgcgca ctccggggag tggagggag gagcgagggc 840 tcagttgggc tgttttggag gcaggagca cttgctctcc caaagtcgct ctgagttgtt atcagtaagg gagctgcagt ggagtaggcg gggagaaggc cgcacccttc tccggagggg 960 ggaggggagt gttgcaatac ctttctgggga gttctctgct gcctcctggc ttctgaggac 1020 cgccctgggc ctggggagat cccttgcccc ctcttcccct cgtgatctgc aactccagtc 1080 tttctagtga attcggatcc ttaattaagg cctccgcgcc gggttttggc gcctcccgcg 1140 ggcgcccccc tcctcacggc gagcgctgcc acgtcagacg aagggcgcag cgagcgtcct 1200 gatccttccg cccggacgct caggacagcg gcccgctgct cataagactc ggccttagaa 1260 ccccagtatc agcagaagga cattttagga cgggacttgg gtgactctag ggcactggtt 1320 ttctttccag agagcggaac aggcgaggaa aagtagtccc ttctcggcga ttctgcggag 1380 ggatctccgt ggggcggtga acgccgatga ttatataagg acgcgccggg tgtggcacag 1440 ctagttccgt cgcagccggg atttgggtcg cggttcttgt ttgtggatcg ctgtgatcgt 1500 cacttggtct agaggatccg ggccgcatgg tgagcaaggg cgaggagctg ttcaccgggg 1560 tggtgcccat cctggtcgag ctggacggcg acgtaaacgg ccacaagttc agcgtgtccg 1620 gcgagggcga gggcgatgcc acctacggca agctgaccct gaagttcatc tgcaccaccg 1680 gcaagctgcc cgtgccctgg cccaccctcg tgaccaccct gacctggggc gtgcagtgct 1740 tcagccgcta ccccgaccac atgaagcagc acgacttctt caagtccgcc atgcccgaag 1800 gctacgtcca ggagcgcacc atcttcttca aggacgacgg caactacaag acccgcgccg 1860 aggtgaagtt cgagggcgac accctggtga accgcatcga gctgaagggc atcgacttca 1920 aggaggacgg caacatcctg gggcacaagc tggagtacaa ctacatcagc cacaacgtct 1980 atatcaccgc cgacaagcag aagaacggca tcaaggccaa cttcaagatc cgccacaaca 2040 tcgaggacgg cagcgtgcag ctcgccgacc actaccagca gaacaccccc atcggcgacg 2100 gccccgtgct gctgcccgac aaccactacc tgagcaccca gtccgccctg agcaaagacc 2160 ccaacgagaa gcgcgatcac atggtcctgc tggagttcgt gaccgccgcc gggatcactc 2220 tcggcatgga cgagctgtac aagggtggta ccggaggcgc cgctgatact cgcattggtg 2280 taacaatcta taagtacgac gataacttta tgtctgtagt gcgcaaggct attgagcaag 2340 atgcgaaagc cgcgccagat gttcagctgc tgatgaatga ttctcagaat gaccagtcca 2400 agcagaacga tcagatcgac gtattgctgg cgaaaggggt gaaggcactg gcaatcaacc 2460 tggttgaccc ggcagctgcg ggtacggtga ttgagaaagc gcgtgggcaa aacgtgccgg 2520 tggttttctt caacaaagaa ccgtctcgta aggcgctgga tagctacgac aaagcctact 2580 acgttggcac tgactccaaa gagtccggca ttattcaagg cgatttgatt gctaaacact 2640 gggcggcgaa tcagggttgg gatctgaaca aagacggtca gattcagttc gtactgctga 2700 aaggtgaacc gggccatccg gatgcagaag cacgtaccac ttacgtgatt aaagaattga 2760 acgataaagg catcaaaact gaacagttac agttagatac cgcaatgtgg gacaccgctc 2820 aggcgaaaga taagatggac gcctggctgt ctggcccgaa cgccaacaaa atcgaagtgg 2880 ttatcgccaa caacgatcgg atggcaatgg gcgcggttga agcgctgaaa gcacacaaca 2940 agtccagcat tccggtgttt ggcgtcgatg cgtcgccaga agcgctggcg ctggtgaaat 3000 ccggtgcact ggcgggcacc gtactgaacg atgctaacaa ccaggcgaaa gcgacctttg 3060 atctggcgaa aaacctggcc gatggtaaag gtgcggctga tggcaccaac tggaaaatcg 3120 acaacaaagt ggtccgcgta ccttatgttg gcgtagataa agacaacctg gctgaattca 3180 gcaagaaagg cgccggtacc ggtggaatgg tgagcaaggg cgaggagctg ttcaccgggg 3240 tggtgcccat cctggtcgag ctggacggcg acgtaaacgg ccacaagttc agcgtgtccg 3300 gcgagggcga gggcgatgcc acctacggca agctgaccct gaagttcatc tgcaccaccg 3360 gcaagctgcc cgtgccctgg cccaccctcg tgaccacctt cggctacggc ctgcagtgct 3420 tcgcccgcta ccccgaccac atgaagcagc acgacttctt caagtccgcc atgcccgaag 3480 gctacgtcca ggagcgcacc atcttcttca aggacgacgg caactacaag acccgcgccg 3540 aggtgaagtt cgagggcgac accctggtga accgcatcga gctgaagggc atcgacttca 3600 aggaggacgg caacatcctg gggcacaagc tggagtacaa ctacaacagc cacaacgtct 3660 atatcatggc cgacaagcag aagaacggca tcaaggtgaa cttcaagatc cgccacaaca 3720 tcgaggacgg cagcgtgcag ctcgccgacc actaccagca gaacaccccc atcggcgacg 3780 gccccgtgct gctgcccgac aaccactacc tgagctacca gtccgccctg agcaaagacc 3840 ccaacgagaa gcgcgatcac atggtcctgc tggagttcgt gaccgccgcc gggatcactc 3900 tcggcatgga cgagctgtac aagggaggtg gcggaagctc cggtgagggc agaggaagcc 3960 ttctaacatg cggtgacgtg gaggagaatc ccggcccttc cgggatgacc gagtacaagc 4020 ccacggtgcg cctcgccacc cgcgacgacg tccccagggc cgtacgcacc ctcgccgccg 4080 cgttcgccga ctaccccgcc acgcgccaca ccgtcgatcc ggaccgccac atcgagcggg 4140 tcaccgagct gcaagaactc ttcctcacgc gcgtcgggct cgacatcggc aaggtgtggg 4200 tcgcggacga cggcgccgcg gtggcggtct ggaccacgcc ggagagcgtc gaagcggggg 4260 cggtgttcgc cgagatcggc ccgcgcatgg ccgagttgag cggttcccgg ctggccgcgc 4320 agcaacagat ggaaggcctc ctggcgccgc accggcccaa ggagcccgcg tggttcctgg 4380 ccaccgtcgg cgtctcgccc gaccaccagg gcaagggtct gggcagcgcc gtcgtgctcc 4440 ccggagtgga ggcggccgag cgcgccgggg tgcccgcctt cctggagacc tccgcgcccc 4500 gcaacctccc cttctacgag cggctcggct tcaccgtcac cgccgacgtc gaggtgcccg 4560 aaggaccgcg cacctggtgc atgacccgca agcccggtgc ctgaatctag gtcgacctgc 4620 agaagcttgc ctcgagcagc gctgctcgag agatctacgg gtggcatccc tgtgacccct 4680 ccccagtgcc tctcctggcc ctggaagttg ccactccagt gcccaccagc cttgtcctaa 4740 taaaattaag ttgcatcatt ttgtctgact aggtgtcctt ctataatatt atggggtgga 4800 ggggggtggt atggagcaag gggcaagttg ggaagacaac ctgtagggcc tgcggggtct 4860 attgggaacc aagctggagt gcagtggcac aatcttggct cactgcaatc tccgcctcct 4920 gggttcaagc gattctcctg cctcagcctc ccgagttgtt gggattccag gcatgcatga 4980 ccaggctcag ctaatttttg tttttttggt agagacgggg tttcaccata ttggccaggc 5040 tggtctccaa ctcctaatct caggtgatct acccaccttg gcctcccaaa ttgctgggat 5100 tacaggcgtg aaccactgct cccttccctg tccttctgat tttgtacccg ggactagaag 5160 atgggcggga gtcttctggg caggcttaaa ggctaacctg gtgtgtgggc gttgtcctgc 5220 aggggaattg aacaggtgta aaattggagg gacaagactt cccacagatt ttcggttttg 5280 tcgggaagtt ttttaatagg ggcaaatagg aaaatggagg ataggagtca tctggggttt 5340 atgcagcaaa actacaggta tattgcttgt atccgcctcg gagatttcca tgaggagata 5400 <h2 style=";text-align:left;direction:ltr">aagacatgtc acccgagttt atactctcct gcttagatcc tactacagta tgaaatacag 5460<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> tgtngcgagg tagactatgt aagcagattt aatcatttta aagagcccag tacttcatat 5520<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> ccatttctcc cgctccttct gcagccttat caaaaggtat ttagaacact cattttagcc 5580<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> ccattttcat ttattatact ggcttatcca acccctagac agagcattgg cattttccct 5640<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> ttcctgatct tagaagtctg atgactcatg aaaccagaca gattagttac atacaccaca 5700<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> aatcgaggct gtagctgggg cctcaacact gcagttcttt tataactcct tagtacactt 5760<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> tttgttgatc ctttgccttg atccttaatt ttcagtgtct atcacctctc ccgtcaggtg 5820<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> gtgttccaca tttgggccta ttctcagtcc agggagtttt acaacaatag atgtattgag 5880<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> aatccaacct aaagcttaac tttccactcc catgaatgcc tctctccttt ttctccatta 5940<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> taactgagct atnaccatta atggtttcag gtggatgtct cctcccccaa tatacctgat 6000<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> gtatctacat attgccaggc tgatatttta agacatnaaa ggtatatttc attattgagc 6060<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> cacatggtat tgattactgc tactaaaatt ttgtcattgt acacatctgt aaaaggtggt 6120<h2 style=";text-align:left;direction:ltr"> tccttttgga atgcaaagtt caggtgtttg ttgtctttcc tgacctaagg tcttgtgagc 6180 ttgtattttt tctatttaag cagtgctttc tcttggactg gcttgactca tggcattcta 6240 cacgttattg ctggtctaaa tgtgattttg ccaagcttct tcaggaccta taattttgct 6300 tgacttgtag ccaaacacaa gtaaaatgat taagcaacaa atgtatttgt gaagcttggt 6360 ttttaggttg ttgtgttgtg tgtgcttgtg ctctataata atactatcca ggggctgggag 6420 aggtggctcg gagttcaaga gcacagactg ctcttccaga agtcctgagt tcaattccca 6480 gcaaccacat ggtggctcac aaccatctgt aatgggatct gatgccctct tctggtgtgt 6540 ctgaagacca caagtgtatt cacattaat aaataatcct ccttctttt ctttttttt 6600 6660 tccaatatgg nagccaataa tcaaatactc ttnagcactg gaaatgtacc aaagactat 6720 tttatttaag tgnactgtgg acaggaggc cataactgca gacttgtggg atacagaaga 6780 ccaatgcaga cttaatgtct tttctcttac actaagcaat aaagaataa aaattgaact 6840 tctagtatcc tatttgttaa actgctagct ttactaactt ttgtgcttca tctatacaaa 6900 gctgaaagct aagtctgcag ccattactaa acatgaaagc aagtaatgat aattttggat 6960 ttcaaaaatg tagggccaga gtttagccag ccagtggtgg tgcttgcctt tatgccttaa 7020 tcccagcact ctggaggcag agacaggcag atctctgagt ttgagcccag cctggtctac 7080 acatcaagtt ctatctagga tagccaggaa tacacacaga aaccctgttg gggagggggg 7140 ctctgagatt tcataaatt ataattgaag cattccctaa tgagccacta tggatgtggc 7200 taaatccgtc tacctttctg atgagatttg ggtattattt tttctgtctc tgctgttggt 7260 tgggtctttt gacactgtgg gctttcttaa agcctcttc cctgccatgt ggtctcttgt 7320 ttgctactaa cttcccatgg cttaaatggc atggctttt gccttctaag ggcagctgct 7380 gagntttgca gcctgatttc cagggtgggg ttgggaaatc tttcaaacac taaaattgtc 7440 ctttaatttt tttttaaaaa atgggttata taataaacct cataaaaatag ttatgaggag 7500 tgaggtggac taatattaat gagtccctcc cctataaaag agctattaag gctttttgtc 7560 ttatactaac ttttttt aatgtggtat ctttagaacc aagggtctta gagttttagt 7620 atacagaaac tgttgcatcg cttaatcaga ttttctagtt tcaatccag agaatccaaa 7680 ttctcacag ccaagtcaa attagaatt tctgacttta atgttattg ctactgtgaa 7740 tataaaatga tagctttcc tgaggcaggg tctcactatg tatctctgcc tgatctgca 7800 caagatatgt agactaagt tctgcctgct ttgtctcct gatactaag gttaaaatgt 7860 agtaatactt tggaacttg caggtcagat tctttag gggacacact aagggagctt 7920 gggtgatagt tggtaatgt gtttaagtga tgaaaacttg aattattac accgcaacct 7980 actttttaaa aaaaaaagcc aggctgtta gagcatgcta agggatccct aggacttgct 8040 gagcacaca gagtagtact tggcaggctc ctggtgagag catatttca aaaaaaggc 8100 agacaaccaa gaaactacag taaggttacc tgtctttaac catctgcata tacacaggga 8160 tattaaaata ttccaata tattcattc aagttttccc ccatcaatt gggacatgga 8220 tttctccggt gatatggcag agttggaac taaacaatg ttggttttgt gatttgtga 8280 attgttttca agtgatagtt aaagcccatg agatacagaa caaagctgct atttcgaggt 8340 ctcttggtta tactcagaag cacttctttg ggtttccctg cactatcctg atcatgtgct 8400 aggcctncct taggctgatt gttgttcaaa taacttaagt ttcctgtcag gtgatgtcat 8460 atgatttcat atatcaaggc aaaacatgtt atatatgtta aacatttgna cttaatgtga 8520 aagttaggtc tttgtgggtt ttgattttaa tttcaaaacc tgagctaaat aagtcatttt 8580 acatgtctta catttggtga attgtatatt gtggtttgca ggcaagactc tctgacctag 8640 taaccctcct atagagcact ttgctgggtc acaagtctag gagtcaagca tttcaccttg 8700 aagttgagac gttttgttag tgtatactag ttatatgttg gaggacatgt ttatccagaa 8760 gatattcagg actatttttg actgggctaa ggaattgatt ctgattagca ctgttagtga 8820 gcattgagtg gcctttaggc ttgaattgga gtcacttgta tatctcaaat aatgctggcc 8880 ttttttnaaa agcccttgtt ctttatcacc ctgttttcta cataattttt gttcaaagaa 8940 atacttgttt ggatctcctt ttgacaacaa tagcatgttt tcaagccata ttttttttcc 9000 tttttttttt tttttttggt ttttcgagac agggtttctc tgtatagccc tggctgtcct 9060 ggaactcact ttgtagacca ggctggcctc gaactcagaa atccgcctgc ctctgcctcc 9120 tgagtgccgg gattaaaggc gtgcaccacc acgcctggct aagttggata ttttgtatat 9180 aactataacc aatactaact ccactgggtg gatttttaat tcagtcagta gtcttaagtg 9240 gtctttattg gcccttatta aaatctactg ttcactctaa cagaggctgt tggactagtg 9300 gnactaagca acttcctacg gatatactag cagataaggg tcagggatag aaactagtct 9360 agcgttttgt atacctacca gcttatacta ccttgttctg atagaaatat ttaggacatc 9420 tagcttatcg atccg 9435 <210> 34 <211> 747 <212> DNA <213> Unknown <220> <223> IgGFc (Mouse) <400> 34 atgtacagga tgcaactcct gtcttgcatt gcactaagtc ttgcacttgt cacgaattcg 60 atatcggcca tggttagatc tggttgtaag ccttgcatat gtacagtccc agaagtatca 120 tctgtcttca tcttcccccc aaagcccaag gatgtgctca ccattactct gactcctaag 180 gtcacgtgtg ttgtggtaga catcagcaag gatgatcccg aggtccagtt cagctggttt 240 gtagatgatg tggaggtgca cacagctcag acgcaacccc gggaggagca gttcaacagc 300 actttccgct cagtcagtga acttcccatc atgcaccagg actggctcaa tggcaaggag 360 ttcaaatgca gggtcaacag tgcagctttc cctgccccca tcgagaaaac catctccaaa 420 accaaaggca gaccgaaggc tccacaggtg tacaccattc cacctcccaa ggagcagatg 480 gccaaggata aagtcagtct gacctgcatg ataacagact tcttccctga agacattact 540 gtggagtggc agtggaatgg gcagccagcg gagaactaca agaacactca gcccatcatg 600 gacacagatg gctcttactt cgtctacagc aagctcaatg tgcagaagag caactgggag 660 gcaggaaata ctttcacctg ctctgtgtta catgagggcc tgcacaacca ccatactgag 720 aagagcctct cccactctcc tggtaaa 747 <210> 35 <211> 195 <212> DNA <213> Unknown <220> <223> S2-VaTx3 with signal <400> 35 atgcgccgcg gccgcctgct ggagatcgcc ctgggcttca ccgtgctgct ggcctcctac 60 acctcccacg gcgccgacgc cgctgaattc gagtgccgct ggtacctggg cggctgcaag 120 gaggactccg agtgctgcga gcacctgcag tgccactcct actgggagtg gtgcctgtgg 180 gacggctcct tctaa 195 <210> 36 <211> 324 <212> DNA <213> Unknown <220> <223> S2-DkTx with signal <400> 36 atgcgccgcg gccgcctgct ggagatcgcc ctgggcttca ccgtgctgct ggcctcctac 60 acctcccacg gcgccgacgc cgctgaattc ggatctgact gcgccaagga gggcgaggtg 120 tgctcctggg gcaagaagtg ctgcgacctg gacaacttct actgccccat ggagttcatc 180 ccccactgca agaagtacaa gccctacgtg cccgtgacca ccaactgcgc caaggagggc 240 gaggtgtgcg gctggggctc caagtgctgc cacggcctgg actgccccct ggccttcatc 300 ccctactgcg agaagtaccg ctaa 324 <210> 37 <211> 873 <212> DNA <213> Unknown <220> <223> VatX3 target vector cassette: signal -> VaTx3 -> Furin -> IgGFc <400> 37 atgtacagga tgcaactcct gtcttgcatt gcactaagtc ttgcacttgt cacgaattcg 60 ggatctgagt gccgctggta cctgggcggc tgcaaggagg actccgagtg ctgcgagcac 120 ctgcagtgcc actcctactg ggagtggtgc ctgtgggacg gctccttccg acggaagcga 180 gggatatcgg ccatggttag atctggttgt aagccttgca tatgtacagt cccagaagta 240 tcatctgtct tcatcttccc cccaaagccc aaggatgtgc tcaccattac tctgactcct 300 aaggtcacgt gtgttgtggt agacatcagc aaggatgatc ccgaggtcca gttcagctgg 360 tttgtagatg atgtggaggt gcacacagct cagacgcaac cccgggagga gcagttcaac 420 agcactttcc gctcagtcag tgaacttccc atcatgcacc aggactggct caatggcaag 480 gagttcaaat gcagggtcaa cagtgcagct ttccctgccc ccatcgagaa aaccatctcc 540 aaaaccaaag gcagaccgaa ggctccacag gtgtacacca ttccacctcc caaggagcag 600 atggccaagg ataaagtcag tctgacctgc atgataacag acttcttccc tgaagacatt 660 actgtggagt ggcagtggaa tgggcagcca gcggagaact acaagaacac tcagcccatc 720 atggacacag atggctctta cttcgtctac agcaagctca atgtgcagaa gagcaactgg 780 gaggcaggaa atactttcac ctgctctgtg ttacatgagg gcctgcacaa ccaccatact 840 gagaagagcc tctcccactc tcctggtaaa taa 873 <210> 38 <211> 993 <212> DNA <213> Unknown <220> <223> DkTx target vector cassette: signal -> DkTx -> Furin -> IgGFc <400> 38 atgtacagga tgcaactcct gtcttgcatt gcactaagtc ttgcacttgt cacgaattcg 60 ggatctgact gcgccaagga gggcgaggtg tgctcctggg gcaagaagtg ctgcgacctg 120 gacaacttct actgccccat ggagttcatc ccccactgca agaagtacaa gccctacgtg 180 cccgtgacca ccaactgcgc caaggagggc gaggtgtgcg gctggggctc caagtgctgc 240 cacggcctgg actgccccct ggccttcatc ccctactgcg agaagtaccg ccggaagcga 300 gggatatcgg ccatggttag atctggttgt aagccttgca tatgtacagt cccagaagta 360 tcatctgtct tcatcttcc cccaaagccc areatgtgc tcaccattac tctgactcct 420 aaggtcacgt gtgttgtggt agacatcagc agatgatc ccgaggtcca gttcagctgg 480 tttgtagatg atgtggaggt gcacacagct cagacgcaac cccgggagga gcagttcaac 540 agcactttcc gctcagtcag tgaacttccc atcatgcacc aggactggct caatggcaag 600 gagttcaaat gcagggtcaa cagtgcagct ttccctgccc ccatcgagaa aaccatctcc 660 aaaaccaaag gcagaccgaa ggctccacag gtgtacacca ttccacctcc caaggagcag 720 atggccaagg ataaagtcag tctgacctgc atgataacag acttcttccc tgaagacatt 780 actgtggagt ggcagtggaa tgggcagcca gcggagaact acaagaacac tcagcccatc 840 atggacacag atggctctta cttcgtctac agcaagctca atgtgcagaa gagcaactgg 900 gaggcagaa atactttcac ctgctctgtg ttacatgagg gcctgcacaa ccaccatact 960 Gagaagagcc tctccactc tcctggtaaa taa 993 <210> 39 <211> 681 <212> DNA <213> Unknown <220> <223> IgGFc (human) <400> 39 gacaaaactc acacatgccc accgtgccca gcacctgaac tcctgggggg accgtcagtc 60 ttcctcttcc ccccaaaacc caaggacacc ctcatgatct cccggacccc tgaggtcaca 120 tgcgtggtgg tggacgtgag ccacgaagac cctgaggtca agttcaactg gtacgtggac 180 ggcgtggagg tgcataatgc caagacaaag ccgcgggagg agcagtacaa cagcacgtac 240 cgtgtggtca gcgtcctcac cgtcctgcac caggactggc tgaatggcaa ggagtacaag 300 tgcaaggtct ccaacaaagc cctcccagcc cccatcgaga aaaccatctc caaagccaaa 360 gggcagcccc gagaaccaca ggtgtacacc ctgcccccat cccgggagga gatgaccaag 420 aaccaggtca gcctgacctg cctggtcaaa ggcttctatc ccagcgacat cgccgtggag 480 tgggagagca atgggcagcc ggagaacaac tacaagacca cgcctcccgt gctggactcc 540 gacggctcct tcttcctcta cagcaagctc accgtggaca agagcaggtg gcagcagggg 600 aacgtcttct catgctccgt gatgcacgag gctctgcaca accactacc gcagaagagc ctctccctgt ctccgggtaa a 681 <210> 40 <211> 3778 <212> DNA <213> Source(Unknown) <220> <223> AAVSI license plate: ingredient <400> 40 tgctttctct gaccagcatt ctctcccctg ggcctgtgcc gctttctgtc tgcagcttgt ggcctgggtc acctctacgg ctggcccaga tccttccctg ccgcctcctt caggttccgt 120 cttcctccac tccctcttcc ccttgctctc tgctgtgttg ctgcccaagg atgctctttc 180 cggagcactt ccttctcggc gctgcaccac gtgatgtcct ctgagcggat cctccccgtg 240 tctgggtcct ctccgggcat ctctcctccc tcacccaacc cctgccgtc ttcactcgct 300 gggttccctt ttccttctcc ttctggggcc tgtgccatct ctcgtttctt aggatggcct 360 tctccgacgg atgtctccct tgcgtcccgc ctccccttct tgtaggcctg catcatcacc 420 gtttttctgg acaaccccaa agtaccccgt ctccctggct ttagccacct ctccatcctc 480 ttgctttctt tgcctggaca ccccgttctc ctgtggattc gggtcacctc tcactccttt 540 catttgggca gctcccctac cccccttacc tctctagtct gtgctagctc ttccagcccc 600 ctgtcatggc atcttccagg ggtccgagag ctcagctagt cttcttctc caacccgggc 660 ccctatgtcc acttcaggac agcatgtttg ctgcctccag ggatcctgtg tccccgagct 720 gggaccacct tatattccca gggccggtta atgtggctct ggttctgggt acttttatct 780 gtcccctcca ccccacagtg gggcaagctt ctcgagttgg ggttgcgcct tttccaaggc 840 agccctgggt ttgcgcaggg acgcggctgc tctgggcgtg gttccgggaa acgcagcggc 900 gccgaccctg ggtctcgcac attcttcacg tccgttcgca gcgtcacccg gatcttcgcc 960 gctacccttg tgggcccccc ggcgacgctt cctgctccgc ccctaagtcg ggaaggttcc 1020 ttgcggttcg cggcgtgccg gacgtgacaa acggaagccg cacgtctcac tagtaccctc 1080 gcagacggac agcgccaggg agcaatggca gcgcgccgac cgggatgggc tgtggccaat 1140 agcggctgct cagcagggcg cgccgagagc agcggccggg aaggggcggt gcgggaggcg 1200 gggtgtgggg cggtagtgtg ggccctgttc ctgcccgcgc ggtgttccgc attctgcaag 1260 cctccggagc gcacgtcggc agtcggctcc ctcgttgacc gaatcaccga cctctctccc 1320 cagggtctag acgccaccat ggtgtccaag ggcgaggagg tgatcaagga gttcatgcgc 1380 ttcaaggtgc gcatggaggg ctccatgaac ggccacgagt tcgagatcga gggcgagggc 1440 gagggccgcc cctacgaggg cacccagacc gccaagctga aggtgaccaa gggcggcccc 1500 ctgcccttcg cctgggacat cctgtccccc cagttcatgt acggctccaa ggcctacgtg 1560 aagcaccccg ccgacatccc cgactacaag aagctgtcct tccccgaggg cttcaagtgg 1620 gagcgcgtga tgaacttcga ggacggcggc ctggtgaccg tgacccagga ctcctccctg 1680 caggacggca ccctgatcta caaggtgaag atgcgcggca ccaacttccc ccccgacggc 1740 cccgtgatgc agaagaagac catgggctgg gaggcctcca ccgagcgcct gtacccccgc 1800 gacggcgtgc tgaagggcga gatccaccag gccctgaagc tgaaggacgg cggccactac 1860 ctggtggagt tcaagaccat ctacatggcc aagaagcccg tgcagctgcc cggctactac 1920 tacgtggaca ccaagctgga catcacctcc cacaacgagg actacaccat cgtggagcag 1980 tacgagcgct ccgagggccg ccaccacctg ttcctgggat ccgagggcag aggaagcctt 2040 ctaacatgcg gtgacgtgga ggagaatccc ggcccttccg ggatgaccga gtacaagccc 2100 acggtgcgcc tcgccacccg cgacgacgtc cccagggccg tacgcaccct cgccgccgcg 2160 ttcgccgact accccgccac gcgccacacc gtcgatccgg accgccacat cgagcgggtc 2220 accgagctgc aagaactctt cctcacgcgc gtcgggctcg acatcggcaa ggtgtgggtc 2280 gcggacgacg gcgccgcggt ggcggtctgg accacgccgg agagcgtcga agcgggggcg 2340 gtgttcgccg agatcggccc gcgcatggcc gagttgagcg gttcccggct ggccgcgcag 2400 caacagatgg aaggcctcct ggcgccgcac cggcccaagg agcccgcgtg gttcctggcc 2460 accgtcggcg tctcgcccga ccaccagggc aagggtctgg gcagcgccgt cgtgctcccc 2520 ggagtggagg cggccgagcg cgccggggtg cccgccttcc tggagacctc cgcgccccgc 2580 aacctcccct tctacgagcg gctcggcttc accgtcaccg ccgacgtcga ggtgcccgaa 2640 ggaccgcgca cctggtgcat gacccgcaag cccggtgcct gaatctaggt cgacattcta 2700 cttggtaccc tgtgccttct agttgccagc catctgttgt ttgcccctcc cccgtgcctt 2760 ccttgaccct ggaaggtgcc actcccactg tcctttccta ataaaatgag gaaattgcat 2820 cgcattgtct gagtaggtgt cattctattc tggggggtgg ggtggggcag gacagcaagg 2880 gggaggattg ggaagacaat agcaggcatg ctggggatgc ggtgggctct atggaagctt 2940 tactagggac aggattggtg acagaaaagc cccatcctta ggcctcctcc ttcctagtct 3000 cctgatattg ggtctaaccc ccacctcctg ttaggcagat tccttatctg gtgacacacc 3060 cccatttcct ggagccatct ctctccttgc cagaacctct aaggtttgct tacgatggag 3120 ccagagagga tcctgggagg gagagcttgg cagggggtgg gagggaaggg ggggatgcgt 3180 gacctgcccg gttctcagtg gccaccctgc gctaccctct cccagaacct gagctgctct 3240 gacgcggctg tctggtgcgt ttcactgatc ctggtgctgc agcttcctta cacttcccaa 3300 gaggagaagc agtttggaaa aacaaaatca gaataagttg gtcctgagtt ctaactttgg 3360 ctcttcacct ttctagtccc caatttatat tgttcctccg tgcgtcagtt ttacctgtga 3420 gataaggcca gtagccagcc ccgtcctggc agggctgtgg tgaggagggg ggtgtccgtg 3480 tggaaaactc cctttgtgag aatggtgcgt cctaggtgtt caccaggtcg tggccgcctc 3540 tactcccttt ctctttctcc atccttcttt ccttaaagag tccccagtgc tatctgggac 3600 atattcctcc gcccagagca gggtcccgct tccctaaggc cctgctctgg gcttctgggt 3660 ttgagtcctt ggcaagccca ggagaggcgc tcaggcttcc ctgtccccct tcctcgtcca 3720 ccatctcatg cccctggctc tcctgcccct tccctacagg ggttcctggc tctgctct 3778 <210> 41 <211> 602 <212> PRT <213> Unknown <220> <223> Human mutant BChE <400> 41 Met His Ser Lys Val Thr Ile Ile Cys Ile Arg Phe Leu Phe Trp Phe 1 5 10 15 Leu Leu Leu Cys Met Leu Ile Gly Lys Ser His Thr Glu Asp Asp Ile 20 25 30 Ile Ile Ala Thr Lys Asn Gly Lys Val Arg Gly Met Asn Leu Thr Val 35 40 45 Phe Gly Gly Thr Val Thr Ala Phe Leu Gly Ile Pro Tyr Ala Gln Pro 50 55 60 Pro Leu Gly Arg Leu Arg Phe Lys Lys Pro Gln Ser Leu Thr Lys Trp 65 70 75 80 Ser Asp Ile Trp Asn Ala Thr Lys Tyr Ala Asn Ser Cys Cys Gln Asn 85 90 95 Ile Asp Gln Ser Phe Pro Gly Phe His Gly Ser Glu Met Trp Asn Pro 100 105 110 Asn Thr Asp Leu Ser Glu Asp Cys Leu Tyr Leu Asn Val Trp Ile Pro 115 120 125 Ala Pro Lys Pro Lys Asn Ala Thr Val Leu Ile Trp Ile Tyr Gly Gly 130 135 140 Gly Phe Gln Thr Gly Thr Ser Ser Leu His Val Tyr Asp Gly Lys Phe 145 150 155 160 Leu Ala Arg Val Glu Arg Val Ile Val Val Ser Met Asn Tyr Arg Val 165 170 175 Gly Ala Leu Gly Phe Leu Ala Leu Pro Gly Asn Pro Glu Ala Pro Gly 180 185 190 Asn Met Gly Leu Phe Asp Gln Gln Leu Ala Leu Gln Trp Val Gln Lys 195 200 205 Asn Ile Ala Ala Phe Gly Gly Asn Pro Lys Ser Val Thr Leu Phe Gly 210 215 220 Glu Ser Ser Gly Ala Ala Ser Val Ser Leu His Leu Leu Ser Pro Gly 225 230 235 240 Ser His Ser Leu Phe Thr Arg Ala Ile Leu Gln Ser Gly Ser Ala Asn 245 250 255 Ala Pro Trp Ala Val Thr Ser Leu Tyr Glu Ala Arg Asn Arg Thr Leu 260 265 270 Asn Leu Ala Lys Leu Thr Gly Cys Ser Arg Glu Asn Glu Thr Glu Ile 275 280 285 Ile Lys Cys Leu Arg Asn Lys Asp Pro Gln Glu Ile Leu Leu Asn Glu 290 295 300 Ala Phe Val Val Pro Tyr Gly Thr Ala Leu Gly Val Asn Phe Gly Pro 305 310 315 320 Thr Val Asp Gly Asp Phe Leu Thr Asp Met Pro Asp Ile Leu Leu Glu 325 330 335 Leu Gly Gln Phe Lys Lys Thr Gln Ile Leu Val Gly Val Asn Lys Asp 340 345 350 Glu Gly Thr Trp Phe Leu Val Gly Gly Ala Pro Gly Phe Ser Lys Asp 355 360 365 Asn Asn Ser Ile Ile Thr Arg Lys Glu Phe Gln Glu Gly Leu Lys Ile 370 375 380 Phe Phe Pro Gly Val Ser Glu Phe Gly Lys Glu Ser Ile Leu Phe His 385 390 395 400 Tyr Thr Asp Trp Val Asp Asp Gln Arg Pro Glu Asn Tyr Arg Glu Ala 405 410 415 Leu Gly Asp Val Val Gly Asp Tyr Asn Phe Ile Cys Pro Ala Leu Glu 420 425 430 Phe Thr Lys Lys Phe Ser Glu Trp Gly Asn Asn Ala Phe Phe Tyr Tyr 435 440 445 Phe Glu His Arg Ser Ser Lys Leu Pro Trp Pro Glu Trp Met Gly Val 450 455 460 Met His Gly Tyr Glu Ile Glu Phe Val Phe Gly Leu Pro Leu Glu Arg 465 470 475 480 Arg Asp Asn Tyr Thr Lys Ala Glu Glu Ile Leu Ser Arg Ser Ile Val 485 490 495 Lys Arg Trp Ala Asn Phe Ala Lys Tyr Gly Asn Pro Asn Glu Thr Gln 500 505 510 Asn Asn Ser Thr Ser Trp Pro Val Phe Lys Ser Thr Glu Gln Lys Tyr 515 520 525 Leu Thr Leu Asn Thr Glu Ser Thr Arg Ile Met Thr Lys Leu Arg Ala 530 535 540 Gln Gln Cys Arg Phe Trp Thr Ser Phe Phe Pro Lys Val Leu Glu Met 545 550 555 560 Thr Gly Asn Ile Asp Glu Ala Glu Trp Glu Trp Lys Ala Gly Phe His 565 570 575 Arg Trp Asn Asn Tyr Met Met Asp Trp Lys Asn Gln Phe Asn Asp Tyr 580 585 590 Thr Ser Lys Lys Glu Ser Cys Val Gly Leu 595 600 <210> 42 <211> 1806 <212> DNA <213> Unknown <220> <223> Nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 41 <400> 42 atgcacagca aggtgaccat catctgcatc aggttcctgt tctggttcct gctgctgtgc 60 atgctgatcg gcaagagcca caccgaggac gacatcatca tcgccaccaa gaacggcaag 120 gtgaggggca tgaacctgac cgtgttcggc ggcaccgtga ccgccttcct gggcatcccc 180 tacgcccagc cccccctggg caggctgagg ttcaagaagc cccagagcct gaccaagtgg 240 agcgacatct ggaacgccac caagtacgcc aacagctgct gccagaacat cgaccagagc 300 ttccccggct tccacggcag cgagatgtgg aaccccaaca ccgacctgag cgaggactgc 360 ctgtacctga acgtgtggat ccccgccccc aagcccaaga acgccaccgt gctgatctgg 420 atctacggcg gcggcttcca gaccggcacc agcagcctgc acgtgtacga cggcaagttc 480 ctggccaggg tggagagggt gatcgtggtg agcatgaact acagggtggg cgccctgggc 540 ttcctggccc tgcccggcaa ccccgaggcc cccggcaaca tgggcctgtt cgaccagcag 600 ctggccctgc agtgggtgca gaagaacatc gccgccttcg gcggcaaccc caagagcgtg 660 accctgttcg gcgagagcag cggcgccgcc agcgtgagcc tgcacctgct gagccccggc 720 agccacagcc tgttcaccag ggccatcctg cagagcggca gcgccaacgc cccctgggcc 780 gtgaccagcc tgtacgaggc caggaacagg accctgaacc tggccaagct gaccggctgc 840 900 ctgctgaacg aggccttcgt ggtgccctac ggcaccgccc tgggcgtgaa cttcggcccc 960 accgtggacg gcgacttcct gaccgacatg cccgacatcc tgctggagct gggccagttc 1020 aagaagaccc agatcctggt gggcgtgaac aaggacgagg gcacctggtt cctggtgggc 1080 ggcgccccg gcttcagcaa ggacaacaac agcatcatca ccaggaagga gttccaggag 1140 ggcctgaaga tcttctccc cggcgtgagc gagttcggca aggagagcat cctgttccac 1200 tacaccgact gggtggacga ccagaggccc gagaactaca gggaggccct gggcgacgtg 1260 gtgggcgact acaacttcat ctgccccgcc ctggagttca ccaagaagtt cagcgagtgg 1320 ggcaacaacg ccttcttcta ctacttcgag cacaggagca gcaagctgcc ctggcccgag 1380 tggatgggcg tgatgcacgg ctacgagatc gagttcgtgt tcggcctgcc cctggagagg 1440 agggacaact acaccaaggc cgaggagatc ctgagcagga gcatcgtgaa gaggtgggcc 1500 aacttcgcca agtacggcaa ccccaacgag acccagaaca acagcaccag ctggcccgtg 1560 ttcaagagca ccgagcagaa gtacctgacc ctgaacaccg agagcaccag gatcatgacc 1620 aagctgagggg cccagcagtg caggttctgg accagctct tcccaggt gctggagatg 1680 accggcaca tcgacgaggc cgagtgggag tggaggccg gcttccacag gtggacaac 1740 tacatgatgg actgaagaa ccagttcac gactacacca gcaagaagga gagctgcgtg 1800 ggcctg 1806 <210> 43 <211> 603 <212> PRT <213> Unknown <220> <223> BChE <400> 43 Met Gln Thr Gln His Thr Lys Val Thr Gln Thr His Phe Leu Leu Trp 1 5 10 15 Ile Leu Leu Leu Cys Met Pro Phe Gly Lys Ser His Thr Glu Glu Asp 20 25 30 Phe Ile Ile Thr Thr Lys Thr Gly Arg Val Arg Gly Leu Ser Met Pro 35 40 45 Val Leu Gly Gly Thr Val Thr Ala Phe Leu Gly Ile Pro Tyr Ala Gln 50 55 60 Pro Leu Gly Ser Leu Arg Phe Lys Lys Pro Gln Pro Leu Asn Lys 65 70 75 80 Trp Pro Asp Has Only Thr Gln Tyr Only Ass On Cys Tyr 85 90 95 Asn Ile Asp Gln Ala Phe Pro Gly Phe Gln Gly Ser Glu Met Trp Asn 100 105 110 Pro Asn Thr Asn Leu Ser Glu Asp Cys Leu Tyr Leu Asn Val Trp Ile 115 120 125 Pro Val Pro Lys Pro Lys Asn Ala Thr Val Met Val Trp Ile Tyr Gly 130 135 140 Gly Gly Phe Gln Thr Gly Thr Ser Ser Leu Pro Val Tyr Asp Gly Lys 145 150 155 160 Phe Leu Ala Arg Val Glu Arg Val Ile Val Val Ser Met Asn Tyr Arg 165 170 175 Val Gly Ala Leu Gly Phe Leu Ala Phe Pro Gly Asn Pro Asp Ala Pro 180 185 190 Gly Asn Met Gly Leu Phe Asp Gln Gln Leu Ala Leu Gln Trp Val Gln 195 200 205 Arg Asn Ile Ala Ala Phe Gly Gly Asn Pro Lys Ser Ile Thr Ile Phe 210 215 220 Gly Glu Ser Ser Gly Ala Ala Ser Val Ser Leu His Leu Leu Cys Pro 225 230 235 240 Gln Ser Tyr Pro Leu Phe Thr Arg Ala Ile Leu Glu Ser Gly Ser Ala 245 250 255 Asn Ala Pro Trp Ala Val Lys His Pro Glu Glu Ala Arg Asn Arg Thr 260 265 270 Leu Thr Leu Ala Lys Phe Thr Gly Cys Ser Lys Glu Asn Glu Met Glu 275 280 285 Met Ile Lys Cys Leu Arg Ser Lys Asp Pro Gln Glu Ile Leu Arg Asn 290 295 300 Glu Arg Phe Val Leu Pro Ser Asp Ser Ala Leu Gly Ile Asn Phe Gly 305 310 315 320 Pro Thr Val Asp Gly Asp Phe Leu Thr Asp Met Pro His Thr Leu Leu 325 330 335 Gln Leu Gly Lys Val Lys Lys Ala Gln Ile Leu Val Gly Val Asn Lys 340 345 350 Asp Glu Gly Thr Trp Phe Leu Val Gly Gly Ala Pro Gly Phe Ser Lys 355 360 365 Asp Asn Asp Ser Leu Ile Thr Arg Lys Glu Phe Gln Glu Gly Leu Asn 370 375 380 Met Tyr Phe Pro Gly Val Ser Arg Leu Gly Lys Glu Ala Val Leu Phe 385 390 395 400 Tyr Tyr Val Asp Trp Leu Gly Glu Gln Ser Pro Glu Val Tyr Arg Asp 405 410 415 Ala Leu Asp Asp Val Ile Gly Asp Tyr Asn Ile Ile Cys Pro Ala Leu 420 425 430 Glu Phe Thr Lys Lys Phe Ala Glu Leu Glu Asn Asn Ala Phe Phe Tyr 435 440 445 Phe Phe Glu His Arg Ser Ser Lys Leu Pro Trp Pro Glu Trp Met Gly 450 455 460 Val Met His Gly Tyr Glu Ile Glu Phe Val Phe Gly Leu Pro Leu Gly 465 470 475 480 Arg Arg Val Asn Tyr Thr Arg Ala Glu Glu Ile Phe Ser Arg Ser Ile 485 490 495 Met Lys Thr Trp Ala Asn Phe Ala Lys Tyr Gly His Pro Asn Gly Thr 500 505 510 Gln Gly Asn Ser Thr Met Trp Pro Val Phe Thr Ser Thr Glu Gln Lys 515 520 525 Tyr Leu Thr Leu Asn Thr Glu Lys Ser Lys Ile Tyr Ser Lys Leu Arg 530 535 540 Ala Pro Gln Cys Gln Phe Trp Arg Leu Phe Phe Pro Lys Val Leu Glu 545 550 555 560 Met Thr Gly Asp Ile Asp Glu Thr Glu Gln Glu Trp Lys Ala Gly Phe 565 570 575 His Arg Trp Ser Asn Tyr Met Met Asp Trp Gln Ass Gln Phe Ass Asp 580 585 590 Tyr Thr Ser Lys Lys Glu Ser Cys Thr Ala Leu 595 600 <210> 44 <211> 1809 <212> DNA <213> Source(Unknown) <220> <223> SEQ ID NO: 43 of the following sequence <400> 44 atgcagaccc agcacaccaa ggtgacccag acccacttcc tgctgtggat cctgctgctg tgcatgccct tcggcaagag ccacaccgag gaggacttca tcatcaccac caagaccggc agggtgaggg gcctgagcat gcccgtgctg ggcggcaccg tgaccgcctt cctgggcatc 180 ccctacgccc agccccccct gggcagcctg aggttcaaga agccccagcc cctgaacaag 240 tggcccgaca tccacaacgc cacccagtac gccaacagct gctaccaga catcgaccag gccttccccg gcttccaggg cagcgagatg tggaacccca acaccaacct gagcgaggac 360 tgcctgtacc tgaacgtgtg gatccccgtg cccaagccca agaacgccac cgtgatggtg 420 tggatctacg gcggcggctt ccagaccggc accagcagcc tgcccgtgta cgacggcaag 480 ttcctggcca gggtggagag ggtgatcgtg gtgagcatga actacagggt gggcgccctg 540 ggcttcctgg ccttccccgg caaccccgac gcccccggca acatgggcct gttcgaccag 600 cagctggccc tgcagtgggt gcagaggaac atcgccgcct tcggcggcaa ccccaagagc 660 atcaccatct tcggcgagag cagcggcgcc gccagcgtga gcctgcacct gctgtgcccc 720 cagagctacc ccctgttcac cagggccatc ctggagagcg gcagcgccaa cgccccctgg 780 gccgtgaagc accccgagga ggccaggaac aggaccctga ccctggccaa gttcaccggc 840 tgcagcaagg agaacgagat ggagatgatc aagtgcctga ggagcaagga cccccaggag 900 atcctgagga acgagaggtt cgtgctgccc agcgacagcg ccctgggcat caacttcggc 960 cccaccgtgg acggcgactt cctgaccgac atgccccaca ccctgctgca gctgggcaag 1020 gtgaagaagg cccagatcct ggtgggcgtg aacaaggacg agggcacctg gttcctggtg 1080 ggcggcgccc ccggcttcag caggacac gacagcctga tcaccagga ggagttccag gagggcctga acatgtactt ccccggcgtg agcaggctgg gcaaggaggc cgtgctgttc tactacgtgg actggctggg cgagcagagc cccgaggtgt acagggacgc cctggacgac 1260 gtgatcggcg actacaacat catctgcccc gccctggagt tcaccaagaa gttcgccgag ctggagaaca acgccttctt ctacttcttc gagcacagga gcagcaagct gccctggccc gagtggatgg gcgtgatgca cggctacgag atcgagttcg tgttcggcct gcccctgggc 1440 aggagggtga actacaccag ggccgaggag atcttcagca ggagcatcat gaagacctgg gccaacttcg ccaagtacgg ccaccccac ggcacccagg gcaacagcac catgtggccc gtgttcacca gcaccgagca gaagtacctg accctgaaca ccgagaagag caagatctac agcaagctga gggcccccca gtgccagttc tggaggctgt tcttccccaa ggtgctggag 1680. atgaccggcg acatcgacga gaccgagcag gagtggaagg ccggcttcca caggtggagc 1740. aactacatga tggactggca gaaccagttc aacgactaca ccagcaaga ggagagctgc accgccctg 1809 <210> 45 <211> 275 <212> PRT <213> Unknown <220> <223> mGLP-1 (GLY8 Mutant with IgG-Fc Fusion) <400> 45 Met Tyr Arg Met Gln Leu Leu Ser Cys Ile Ala Leu Ser Leu Ala Leu 1 5 10 15 Val Thr Asn Ser His Gly Glu Gly Thr Phe Thr Ser Asp Val Ser Ser 20 25 30 Tyr Leu Glu Gly Gln Ala Ala Lys Glu Phe Ile Ala Trp Leu Val Lys 35 40 45 Gly Arg Gly Arg Ser Gly Cys Lys Pro Cys Ile Cys Thr Val Pro Glu 50 55 60 Val Ser Ser Val Phe Ile Phe Pro Pro Lys Pro Lys Asp Val Leu Thr 65 70 75 80 Ile Thr Leu Thr Pro Lys Val Thr Cys Val Val Val Asp Ile Ser Lys 85 90 95 Asp Asp Pro Glu Val Gln Phe Ser Trp Phe Val Asp Asp Val Glu Val 100 105 110 His Thr Ala Gln Thr Gln Pro Arg Glu Glu Gln Phe Asn Ser Thr Phe 115 120 125 Arg Ser Val Ser Glu Leu Pro Ile Met His Gln Asp Trp Leu Asn Gly 130 135 140 Lys Glu Phe Lys Cys Arg Val Asn Ser Ala Ala Phe Pro Ala Pro Ile 145 150 155 160 Glu Lys Thr Ile Ser Lys Thr Lys Gly Arg Pro Lys Ala Pro Gln Val 165 170 175 Tyr Thr Ile Pro Pro Pro Lys Glu Gln Met Ala Lys Asp Lys Val Ser 180 185 190 Leu Thr Cys Met Ile Thr Asp Phe Phe Pro Glu Asp Ile Thr Val Glu 195 200 205 Trp Gln Trp Asn Gly Gln Pro Ala Glu Asn Tyr Lys Asn Thr Gln Pro 210 215 220 Ile Met Asp Thr Asp Gly Ser Tyr Phe Val Tyr Ser Lys Leu Asn Val 225 230 235 240 Gln Lys Ser Asn Trp Glu Ala Gly Asn Thr Phe Thr Cys Ser Val Leu 245 250 255 His Glu Gly Leu His Asn His His Thr Glu Lys Ser Leu Ser His Ser 260 265 270 Pro Gly Lys 275 <210> 46 <211> 825 <212> DNA <213> Unknown <220> <223> Nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 45 <400> 46 atgtacagga tgcagctgct gagctgcatc gccctgagcc tggccctggt gaccaacagc 60 cacggcgagg gcaccttcac cagcgacgtg agcagctacc tggagggcca ggccgccaag 120 gagttcatcg cctggctggt gaagggcagg ggcaggagcg gctgcaagcc ctgcatctgc 180 accgtgcccg aggtgagcag cgtgttcatc ttccccccca agcccaagga cgtgctgacc 240 atcaccctga cccccaaggt gacctgcgtg gtggtggaca tcagcaagga cgaccccgag 300 gtgcagttca gctggttcgt ggacgacgtg gaggtgcaca ccgcccagac ccagcccagg 360 gaggagcagt tcaacagcac cttcaggagc gtgagcgagc tgcccatcat gcaccaggac 420 tggctgaacg gcaaggagtt caagtgcagg gtgaacagcg ccgccttccc cgcccccatc 480 gagaagacca tcagcaagac caagggcagg cccaaggccc cccaggtgta caccatcccc 540 ccccccaagg agcagatggc caaggacaag gtgagcctga cctgcatgat caccgacttc 600 ttccccgagg acatcaccgt ggagtggcag tggaacggcc agcccgccga gaactacaag 660 aacacccagc ccatcatgga caccgacggc agctacttcg tgtacagcaa gctgaacgtg 720 cagaagagca actgggaggc cggcaacacc ttcacctgca gcgtgctgca cgagggcctg 780 cacaaccacc acaccgagaa gagcctgagc cacagccccg gcaag 825 <210> 47 <211> 36 <212> DNA <213> Unknown <220> <223> Primer A <400> 47 gctctagagc caccatgcag actcagcata ccaagg 36 <210> 48 <211> 42 <212> DNA <213> Unknown <220> <223> Primer B <400> 48 cgggatccac cggtttagag agctgtacaa gattctttct tg 42 <210> 49 <211> 36 <212> DNA <213> Unknown <220> <223> Primer C <400> 49 cccaagcttg ccaccatgca tagcaaagtc acaatc 36 <210> 50 <211> 38 <212> DNA <213> Unknown <220> <223> Primer D <400> 50 acgcgtcgac ttagagaccc acacaacttt ctttcttg 38 <210> 51 <211> 1701 <212> DNA <213> Unknown <220> <223> PAL <400> 51 atgaagacgc tgtcacaggc ccagtccaag acctcctccc agcagttctc cttcaccggc 60 aactcctccg ccaacgtgat catcggcaac cagaagctga ccatcaacga cgtggcccgc 120 gtggcccgca acggcaccct ggtgtccctg accaacaaca ccgacatcct gcagggcatc 180 caggcctcct gcgactacat caacaacgcc gtggagtccg gcgagcccat ctacggcgtg 240 acctccggct tcggcggcat ggccaacgtg gccatctccc gcgagcaggc ctccgagctg 300 cagaccaacc tggtgtggtt cctgaagacc ggcgccggca acaagctgcc cctggccgac 360 gtgcgcgccg ccatgctgct gcgcgccaac tcccacatgc gcggcgcctc cggcatccgc 420 ctcgagctga tcaagcgcat ggagatcttc ctgaacgccg gcgtgacccc ctacgtgtac 480 gagttcggct ccatcggcgc ctccggcgac ctggtgcccc tgtcctacat caccggctcc 540 ctgatcggcc tggacccctc cttcaaggtg gacttcaacg gcaaggagat ggacgccccc 600 accgccctgc gccagctgaa cctgtccccc ctgaccctgc tgcccaagga gggcctggcc 660 atgatgaacg gcacctccgt gatgaccggc atcgccgcca actgcgtgta cgacacccag 720 atcctgaccg ccatcgccat gggtgtacac gctctggaca tccaggccct gaacggcacc 780 aaccagtcct tccacccctt catccacaac tccaagcccc accccggcca gctgtgggcc 840 gccgaccaga tgatctccct cctcgccaac tcccagctgg tgcgcgacga gctggacggc 900 aagcacgact accgcgacca cgagctgatc caggaccgct actccctgcg ctgcctgccc 960 cagtacctgg gccccatcgt ggacggcatc tcccagatcg ccaagcagat cgagatcgag 1020 atcaactccg tgaccgacaa ccccctgatc gacgtggaca accaggcctc ctaccacggc 1080 ggcaacttcc tgggccagta cgtgggcatg ggcatggacc acctgcgcta ctacatcggc 1140 ctgctggcca agcacctgga cgtgcagatc gccctgctgg cctcccccga gttctccaac 1200 ggcctgcccc cctccctgct gggcaaccgc gagcgcaagg tgaacatggg cctgaagggc 1260 ctgcagatct gcggtaactc gataatgccc ctgctgacct tctacggcaa ctccatcgcc 1320 gaccgcttcc ccacccacgc cgagcagttc aaccagaaca tcaactccca gggctacacc 1380 tccgccaccc tggcccgccg ctccgtggac atcttccaga actacgtggc catcgccctg 1440 atgttcggcg ttcaagctgt agacctgcgc acctacaaga agaccggcca ctacgacgcc 1500 cgcgcctccc tgtcccccgc caccgagcgc ctgtactccg ccgtgcgcca cgtggtgggc 1560 cagaagccca cctccgaccg cccctacatc tggaacgaca acgagcaggg cctggacgag 1620 cacatcgccc gcatctccgc cgacatcgca gcaggtggcg tgatcgtgca ggccgtgcag 1680 gacatcctgc cctccctgca c 1701 <210> 52 <211> 1128 <212> DNA <213> Unknown <220> <223> HSV-TK <400> 52 atggcttcgt accccggcca tcagcacgcg tctgcgttcg accaggctgc gcgttctcgc 60 ggccatagca accgacgtac ggcgttgcgc cctcgccggc agcaagaagc cacggaagtc 120 cgcccggagc agaaaatgcc cacgctactg cgggtttata tagacggtcc ccacgggatg 180 gggaaaacca ccaccacgca actgctggtg gccctgggtt cgcgcgacga tatcgtctac 240 gtacccgagc cgatgactta ctggcgggtg ctgggggctt ccgagacaat cgcgaacatc 300 tacaccacac aacaccgcct tgaccagggt gagatatcgg ccggggacgc ggcggtggta 360 atgacaagcg cccagataac aatgggcatg ccttatgccg tgaccgacgc cgttctggct 420 cctcatatcg ggggggaggc tgggagctca catgccccgc ccccggccct caccctcatc 480 ttcgaccgcc atcccatcgc cgccctcctg tgctacccgg ccgcgcgata ccttatgggc 540 agcatgaccc cccaggccgt gctggcgttc gtggccctca tcccgccgac cttgcccggc 600 acaaacatcg tgttgggggc ccttccggag gacagacaca tcgaccgcct ggccaaacgc 660 cagcgccccg gcgagcggct tgacctggct atgctggccg cgattcgccg cgtttacggg 720 ctgcttgcca atacggtgcg gtatctgcag ggcggcgggt cgtggcggga ggattgggga 780 cagctttcgg ggacggccgt gccgccccag ggtgccgagc cccagagcaa cgcgggccca 840 cgaccccata tcggggacac gttatttacc ctgtttcggg cccccgagtt gctggccccc 900 aacggcgacc tgtacaacgt gtttgcctgg gccttggacg tcttggccaa acgcctccgt 960 cccatgcacg tctttatcct ggattacgac caatcgcccg ccggctgccg ggacgccctg 1020 ctgcaactta cctccgggat gatccagacc cacgtcacca ccccaggctc cataccgacg 1080 atctgcgacc tggcgcgcac gtttgcccgg gagatggggg aggctaac 1128 <210> 53 <211> 474 <212> DNA <213> Unknown <220> <223> yCD <400> 53 atggtgaccg gcggcatggc ctccaagtgg gaccagaagg gcatggacat cgcctacgag 60 gaggccgccc tgggctacaa ggagggcggc gtgcccatcg gcggctgcct gatcaacaac 120 aaggacggct ccgtgctggg ccgcggccac aacatgcgct tccagaaggg ctccgccacc 180 ctgcacggcg agatctccac cctggagaac tgcggccgcc tggagggcaa ggtgtacaag 240 gacaccaccc tgtacaccac cctgtccccc tgcgacatgt gcaccggcgc catcatcatg 300 tacggcatcc cccgctgcgt ggtgggcgag aacgtgaact tcaagtccaa gggcgagaag 360 tacctgcaga cccgcggcca cgaggtggtg gtggtggacg acgagcgctg caagaagatc 420 atgaagcagt tcatcgacga gcgcccccag gactggttcg aggacatcgg cgag 474 <210> 54 <211> 1356 <212> DNA <213> Unknown <220> <223> PAH <400> 54 atgtccactg cggtcctgga aaacccaggc ttgggcagga aactctctga ctttggacag 60 gaaacaagct atattgaaga caactgcaat caaaatggtg ccatatcact gatcttctca 120 ctcaaagaag aagttggtgc attggccaaa gtattgcgct tatttgagga gaatgatgta 180 aacctgaccc acattgaatc tagaccttct cgtttaaaga aagatgagta tgaatttttc 240 acccatttgg ataaacgtag cctgcctgct ctgacaaaca tcatcaagat cttgaggcat 300 gacattggtg ccactgtcca tgagctttca cgagataaga agaaagacac agtgccctgg 360 ttcccaagaa ccattcaaga gctggacaga tttgccaatc agattctcag ctatggagcg 420 gaactggatg ctgaccaccc tggttttaaa gatcctgtgt accgtgcaag acggaagcag 480 tttgctgaca ttgcctacaa ctaccgccat gggcagccca tccctcgagt ggaatacatg 540 gaggaagaaa agaaaacatg gggcacagtg ttcaagactc tgaagtcctt gtataaaacc 600 catgcttgct atgagtacaa tcacattttt ccacttcttg aaaagtactg tggcttccat 660 gaagataaca ttccccagct ggaagacgtt tctcaattcc tgcagacttg cactggtttc 720 cgcctccgac ctgtggctgg cctgctttcc tctcgggatt tcttgggtgg cctggccttc 780 cgagtcttcc actgcacaca gtacatcaga catggatcca agcccatgta tacccccgaa 840 cctgacatct gccatgagct gttgggacat gtgcccttgt tttcagatcg cagctttgcc 900 cagttttccc aggaaattgg ccttgcctct ctgggtgcac ctgatgaata cattgaaaag 960 ctcgccacaa tttactggtt tactgtggag tttgggctct gcaaacaagg agactccata 1020 aaggcatatg gtgctgggct cctgtcatcc tttggtgaat tacagtactg cttatcagag 1080 aagccaaagc ttctccccct ggagctggag aagacagcca tccaaaatta cactgtcacg 1140 gagttccagc ccctgtatta cgtggcagag agttttaatg atgccaagga gaaagtaagg 1200 aactttgctg ccacaatacc tcggcccttc tcagttcgct acgacccata cacccaaagg 1260 attgaggtct tggacaatac ccagcagctt aagattttgg ctgattccat taacagtgaa 1320 attggaatcc tttgcagtgc cctccagaaa ataaag 1356 <210> 55 <211> 723 <212> DNA <213> Unknown <220> <223> GTPCH <400> 55 atggagaagc cgcggggagt caggtgcacc aatgggttct ccgagcgtga actacctcgt 60 cctggagcaa gcccacctgc agagaagtcc cgacctcctg aagcaaaggg cgcacagccg 120 gccgacgcct ggaaggcagg gcggcaccgc agcgaggagg aaaaccaggt gaacctcccc 180 aaactggcgg ccgcttactc gtccattctg ctctcgctgg gcgaggaccc ccagcggcag 240 gggctgctca agacgccctg gagggcggcc accgccatgc agtacttcac caagggatac 300 caggagacca tctcagatgt cctgaatgat gctatatttg atgaagatca tgacgagatg 360 gtgattgtga aggacataga tatgttctcc atgtgtgagc atcaccttgt tccatttgta 420 ggaagggtcc atattggcta tcttcctaac aagcaagtcc ttggtctcag taaacttgcc 480 aggattgtag aaatctacag tagacgacta caagttcaag agcgcctcac caaacagatt 540 gcggtggcca tcacagaagc cttgcagcct gctggcgttg gagtagtgat tgaagcgaca 600 cacatgtgca tggtaatgcg aggcgtgcag aaaatgaaca gcaagactgt cactagcacc 660 atgctgggcg tgttccggga agaccccaag actcgggagg agttcctcac actaatcagg 720 agc 723 <210> 56 <211> 432 <212> DNA <213> Unknown <220> <223> PTPS <400> 56 atgagcgctg ctggtgatct tcgtcgtcgt gcgcgactgt cgcgcctcgt gtccttcagc 60 gcgagccacc ggctgcacag cccatctctg agcgatgaag agaacttaag agtgtttggg 120 aaatgcaaca atccgaatgg ccacgggcac aactataaag ttgtggtgac agtccatgga 180 gagattgatc ctgttacagg aatggttatg aatttgaccg acctcaaaga atacatggag 240 gaggccatca tgaagcctct tgatcacaag aacctggacc tggatgtgcc gtactttgcg 300 gatgctgtga gcacgacaga aaatgtagct gtctacatct gggaaagcct ccagaaactt 360 cttccagtgg gagctcttta taaagtaaaa gtgtttgaaa ccgacaacaa catcgtagtc 420 tataaaggag aa 432 <210> 57 <211> 783 <212> DNA <213> Unknown <220> <223> SR (Micromelalopha reductase) <400> 57 atggagggcg ggctggggcg tgctgtgtgc ttgctgaccg gggcctcccg cggcttcggc 60 cggacgctgg ccccgctcct ggcctcgctg ctgtcgcccg gctccgtgct tgtccttagc 120 gcccgcaacg acgaggcact gcgccagctg gaggccgagc tgggcgccga gcggtctggc 180 ctgcgcgtgg tgcgggtgcc cgccgacctg ggcgccgagg ccggcttgca gcagctgctc 240 ggcgccctgc gcgagctccc ccggcccaag gggctgcagc gactgctgct tatcaacaac 300 gcgggctctc ttggggatgt gtccaaaggc ttcgtggacc tgagtgactc cactcaagtg 360 aacaactact gggcactgaa cttgacctcc atgctctgcc tgacttccag cgtcctgaag 420 gccttcccgg acagtcctgg cctcaacaga accgtggtta acatctcgtc cctctgtgcc 480 ctgcaacctt tcaaaggctg ggcgctgtac tgtgcaggaa aggctgctcg tgatatgctg 540 ttccaggtcc tggcgctgga ggaacctaat gtgagggtgc tgaactatgc cccaggtcct 600 ctggacacag acatgcagca gttggcccgg gagacctccg tggacccaga catgcgaaaa 660 gggctgcagg agctgaaggc aaaggggaag ctggtggatt gcaaggtgtc agcccagaaa 720 ctgctgagct tactggaaaa ggacgagttc aagtctggag cccacgtgga cttctatgac 780 aaa 783 <210> 58 <211> 4413 <212> DNA <213> Unknown <220> <223> Factor VIII minus B <400> 58 atgcaaatag agctctccac ctgcttcttt ctgtgccttt tgcgattctg ctttagtgcc 60 accagaagat actacctggg tgcagtggaa ctgtcatggg actatatgca aagtgatctc 120 ggtgagctgc ctgtggacgc aagatttcct cctagagtgc caaaatcttt tccattcaac 180 acctcagtcg tgtacaaaaa gactctgttt gtagaattca cggatcacct tttcaacatc 240 gctaagccaa ggccaccctg gatgggtctg ctaggtccta ccatccaggc tgaggtttat 300 gatacagtgg tcattacact taagaacatg gcttcccatc ctgtcagtct tcatgctgtt 360 ggtgtatcct actggaaagc ttctgaggga gctgaatatg atgatcagac cagtcaaagg 420 gagaaagaag atgataaagt cttccctggt ggaagccata catatgtctg gcaggtcctg 480 aaagagaatg gtccaatggc ctctgaccca ctgtgcctta cctactcata tctttctcat 540 gtggacctgg taaaagactt gaattcaggc ctcattggag ccctactagt atgtagagaa 600 gggagtctgg ccaaggaaaa gacacagacc ttgcacaaat ttactact ttttgctgta 660 tttgatgaag ggaaaagttg gcactcagaa acaaagaact ccttgatgca ggatagggat 720 gctgcatctg ctcgggcctg gcctaaaatg cacacagtca atggttatgt aaacaggtct 780 ctgccaggtc tgattggatg ccacaggaaa tcagtctatt ggcatgtgat tggaatgggc 840 accactcctg aagtgcactc aatattcctc gaaggtcaca cattctttgt gaggaaccat 900 cgccagggcgt ccttggaaat ctcgccaata actttcctta ctgctcaaac actcttgatg 960 gaccttggac agtttctact gttttgtcat atctcttcc accaacatga tggcatggaa 1020 gcttatgtca aagtagacag ctgtccagag gaaccccaac tacgaatgaa aataatgaa 1080 gaagcgaag actatgatga tgatcttact gattctgaaa tggatgtggt caggtttgat 1140 gatgacaact ctccttcct tatccaaatt cgctcagttg ccaagaagca tcctaaaact 1200 tgggtacatt acattgctgc tgaagaggag gactgggact atgctccctt agtcctcgcc 1260 cccgatgaca gaagttataa aagtcaatat ttgaacaatg gccctcagcg gattggtagg 1320 aagtacaaaa aagtccgatt tatggcatac acagatgaaa cctttaagac tcgtgaagct 1380 attcagcatg aatcaggaat cttgggacct ttactttatg gggaagttgg agacacactg 1440 ttgattatat ttaagaatca agcaagcaga ccatataaca tctaccctca cggaatcact 1500 gatgtccgtc ctttgtattc areagatta ccaaaaggtg taaaacattt gaagggattt 1560 1620 actaaatcag atcctcggtg cctgacccgc tattactcta gtttcgttaa tatggagaga 1680 gatctagctt caggactcat tggccctc cctcatctgct aaagaatc tgtagatca 1740 agaggaaacc agataatgtc agacaagagg aatgtcatcc tgttttctgt atttgatgag 1800 aaccgaagct ggtacctcac agagaatata caacgctttc tcccaatcc agctggagtg 1860 cagcttgagg atccagagtt ccaagcctcc aacatcatgc acagcatca tggctatgtt 1920 tttgatagtt tgcagttgtc agtttgttg catgaggtgg catactggta cattctaagc 1980 attggagcac agactgactt ccttctgtc ttctctctg gatatacctt caacacaa 2040 atggtctatg aagacacact caccctattc ccattctcag gagaaactgt cttcatgtcg 2100 atggaaaacc caggtctatg gattctgggg tgccacact cagacttcg gaacagaggc 2160 atgaccgcct tactgaggt tctagttgt vakagaaca ctggtgatta ttacgaggac 2220 agttatgaag atatttcagc atacttgctg agtaaaaaca atgccattga accaagaagc 2280 ttctcccaga attcagaca ccctagcact aggcaaagc atttaatgc caccccacca 2340 gtcttgaaac gccatcaacg ggaaataact cgtactactc ttcagtcaga tcaagaggaa 2400 attgactatg atgataccat atcagttgaa atgaagaagg aagattttga catttatgat 2460 gaggatgaaa atcagagccc ccgcagcttt caaaagaaaa cacgacacta ttttattgct 2520 gcagtggaga ggctctggga ttatgggatg agtagctccc cacatgttct aagaaacagg 2580 gctcagagtg gcagtgtccc tcagttcaag aaagttgttt tccaggaatt tactgatggc 2640 tcctttactc agcccttata ccgtggagaa ctaaatgaac atttggact cctggggcca 2700 tatataagag cagaagttga agataatatc atggtaactt tcagaaatca ggcctctcgt 2760 ccttatcct tctattctag ccttatttct tatgagaag atcagaggca aggagcagaa 2820 cctagaaaaa actttgtcaa gcctaatgaa accaaactt acttttggaa agtgcaacat 2880 catatggcac ccactaaaga tgagtttgac tgcaaagcct gggcttattt ctctgatgtt 2940 gacctggaaa aagatgtgca ctcaggcctg attggacccc ttctggtctg ccacactaac 3000 acactgaacc ctgctcatgg gagacaagtg acagtacagg aatttgctct gtttttcacc 3060 atctttgatg agaccaaaag ctggtacttc actgaaaata tggaaagaa ctgcagggct 3120 ccctgcaata tccagatgga agatcccact ttaagaga attatcgctt ccatgcaatc 3180 aatggctaca taatggatac actacctggc ttagtaatgg ctcaggatca aaggattcga 3240 tggtatctgc tggcatggg tgtcatga aacatccatt ctattcattt tgtcatt 3300 gtgttcactg tacgaaaaaa agaggagatt aaaatggcac tgtacaatct ctatccaggt 3360 gttttgaga cagtggaat gttaccatcc aaagctggaa tttggcggt ggaatgcctt 3420 attggcgagc atctacatgc tgggatgagc acacttttc tggtgtacag caataagtgt 3480 cagactcccc tgggaatggc tctggacac attigagatt cagactc agcttcagga 3540 caatggac agtgggcccc aaagctggcc agactcatt attccggatc atcaatgcc 3600 tggagcacca aggagccctt ttgatgatc tgttggattc tgttggcacc atgattatt 3660 cacggcatca agacccaggg tgcccgtcag aagttctcca gcctacat ctctcagttt 3720 atcatcatgt atcatcttga tgggagag tggcatgt atcgaggaaa ttccactgga 3780 accttaatgg tcttctttgg caatgtggat tcatctggga taaaacacaa tatttttaac 3840 cctccaatta ttgctcgata catccgtttg cacccaactc attatagcat tcgcagcact 3900 cttcgcatgg agttgatggg ctgtgattta aatagttgca gcatgccatt gggaatggag 3960 agtaaagcaa tatcagatgc acagattact gcttcatcct actttaccaa tatgtttgcc 4020 acctggtctc cttcaaaagc tcgacttcac ctccaaggga ggagtaatgc ctggagacct 4080 caggtgaata atccaaaaga gtggctgcaa gtggacttcc agaagacaat gaaagtcaca 4140 ggagtaacta ctcagggagt aaaatctctg cttaccagca tgtatgtgaa ggagttcctc 4200 atctccagca gtcaagatgg ccatcagtgg actctctttt ttcagaatgg caaagtaaag 4260 gtttttcagg gaaatcaaga ctccttcaca cctgtggtga actctctaga cccaccgtta 4320 ctgactcgct accttcgaat tcacccccag agttgggtgc accagattgc cctgaggatg 4380 gaggttctgg gctgcgaggc acaggacctc tac 4413 <210> 59 <211> 7053 <212> DNA <213> Unknown <220> <223> Factor VIII <400> 59 atgcaaatag agctctccac ctgcttcttt ctgtgccttt tgcgattctg ctttagtgcc 60 accagaagat actacctggg tgcagtggaa ctgtcatggg actatatgca aagtgatctc 120 ggtgagctgc ctgtggacgc aagatttcct cctagagtgc caaaatcttt tccattcaac 180 acctcagtcg tgtacaaaaa gactctgttt gtagaattca cggatcacct tttcaacatc 240 gctaagccaa ggccaccctg gatgggtctg ctaggtccta ccatccaggc tgaggtttat 300 gatacagtgg tcattacact taagaacatg gcttcccatc ctgtcagtct tcatgctgtt 360 ggtgtatcct actggaaagc ttctgaggga gctgaatatg atgatcagac cagtcaaagg 420 gagaaagaag atgataaagt cttccctggt ggaagccata catatgtctg gcaggtcctg 480 aaagagaatg gtccaatggc ctctgaccca ctgtgcctta cctactcata tctttctcat 540 gtggacctgg taaaagactt gaattcaggc ctcattggag ccctactagt atgtagagaa 600 gggagtctgg ccaaggaaaa gacacagacc ttgcacaaat ttatactact ttttgctgta 660 tttgatgaag ggaaaagttg gcactcagaa acaaagaact ccttgatgca ggatagggat 720 gctgcatctg ctcgggcctg gcctaaaatg cacacagtca atggttatgt aaacaggtct 780 ctgccaggtc tgattggatg ccacaggaaa tcagtctatt ggcatgtgat tggaatgggc 840 accactcctg aagtgcactc aatattcctc gaaggtcaca catttcttgt gaggaaccat 900 cgccaggcgt ccttggaaat ctcgccaata actttcctta ctgctcaaac actcttgatg 960 gaccttggac agtttctact gttttgtcat atctcttccc accaacatga tggcatggaa 1020 gcttatgtca aagtagacag ctgtccagag gaaccccaac tacgaatgaa aaataatgaa 1080 gaagcggaag actatgatga tgatcttact gattctgaaa tggatgtggt caggtttgat 1140 gatgacaact ctccttcctt tatccaaatt cgctcagttg ccaagaagca tcctaaaact 1200 tgggtacatt acattgctgc tgaagaggag gactgggact atgctccctt agtcctcgcc 1260 cccgatgaca gaagttataa aagtcaatat ttgaacaatg gccctcagcg gattggtagg 1320 aagtacaaaa aagtccgatt tatggcatac acagatgaaa cctttaagac tcgtgaagct 1380 attcagcatg atcaggaat cttgggacct ttacttag gggaagttgg agacacactg 1440 ttgattatat ttagaatca agcaagcaga ccatataaca tctaccctca cggaatcact 1500 gatgtccgtc ctttgtattc aaggatta ccaaaggtg taaaacttt gaaggatttt 1560 ccaattctgc caggagaat attcaatat aaatggacag tgactgtaga agatgggcca 1620 actaaatcag atcctcggtg cctgacccgc tattactcta gtttcgttaa tatggagaga 1680 gatctagctt caggactcat tggccctc ctcatctgct aaagaatc tgtagatca 1740 agaggaaacc agataatgtc agacaagagg aatgtcatcc tgttttctgt atttgatgag 1800 aaccgaagct ggtacctcac agagaatata caacgctttc tcccaatcc agctggagtg 1860 cagcttgagg atccagagtt ccaagcctcc aacatcatgc acagcatca tggctatgtt 1920 tttgatagtt tgcagttgtc agtttgttg catgaggtgg catactggta cattctaagc 1980 attggagcac agactgactt cctttctgtc ttctctctg gatatacctt caacacaa 2040 atggtctatg aagacacact caccctattc ccattctcag gagaaactgt cttcatgtcg 2100 atggaaaacc caggtctatg gattctgggg tgccacaact cagactttcg gaacagaggc 2160 atgaccgcct tactgaaggt ttctagttgt gacaagaaca ctggtgatta ttacgaggac 2220 agttatgaag atatttcagc atacttgctg agtaaaaaca atgccattga accaagaagc 2280 ttctcccaga attcaagaca ccctagcact aggcaaaagc aatttaatgc caccacaatt 2340 ccagaaaatg acatagagaa gactgaccct tggtttgcac acagaacacc tatgcctaaa 2400 atacaaaatg tctcctctag tgatttgttg atgctcttgc gacagagtcc tactccacat 2460 gggctatcct tatctgatct ccaagaagcc aaatatgaga ctttttctga tgatccatca 2520 cctggagcaa tagacagtaa taacagcctg tctgaaatga cacacttcag gccacagctc 2580 catcacagtg gggacatggt atttacccct gagtcaggcc tccaattaag attaaatgag 2640 aaactgggga caactgcagc aacagagttg aagaaacttg atttcaaagt ttctagtaca 2700 tcaaataatc tgatttcaac aattccatca gacaatttgg cagcaggtac tgataataca 2760 agttccttag gacccccaag tatgccagtt cattatgata gtcaattaga taccactcta 2820 tttggcaaaa agtcatctcc ccttactgag tctggtggac ctctgagctt gagtgaagaa 2880 aataatgatt caaagttgtt agaatcaggt ttaatgaata gccaagaaag ttcatgggga aaaaatgtat cgtcaacaga gagtggtagg ttatttaag ggaaaagagc tcatggacct gctttgttga ctaaagataa tgccttattc aaagttagca tctctttgtt aaagacaaac aaaacttcca fathercagc aactataga aagactcaca ttgatggccc atcattatta attgagaata gtccatcagt ctggcaaaat attacka gtgacactga gtttaaaaaa gtgacacctt tgattcatga cagaatgctt atggacaaaa atgctacagc tttgaggcta aatcatatgt caataaaac tacttcatca aaaaacatgg aaatggtcca acagaaaaaa 3360. gagggcccca ttccaccaga tgcacaaaat ccagatatgt cgttctttaa gatgctattc ttgccagaat cagcaaggtg gatacaaagg actcatgga agaactctct gaactctggg caaggcccca gtccaaagca attagtatcc ttaggaccag aaaaatctgt ggaaggtcag aatttcttgt ctgagaaaaa caaagtggta gtaggaaagg gtgaatttac aaaggacgta ggactcaaag agatggtttt tccaagcagc agaaacctat ttcttactaa cttggataat 3600 ttacatgaaa atatacaca catchaaga aaaaaaattc aggaagaat agaaagaag 3660 gaaacattaa tccaagagaa tgtagttttg cctcagatac atacagtgac tggcactaag 3720 aatttcatga agaacctttt cttactgagc actaggcaaa atgtagaagg ttcatatgac 3780 ggggcatatg ctccagtact tcagatttt aggtcattaa atgattcaac aaatagaaca 3840 aagaaacaca cagctcattt ctcaaaaaaaaaacttgga aggcttggga 3900 aatcaacca agcaattgt agagaatat gcatgcacca caggaatc tcctaataca 3960 agccagcaga atttgtcac gcaacgtagt aagagagctt tgaacaatt cagactccca 4020 ctagaagaaa cagaacttga aaaaaggata attgtgtg acacctcac ccagtggtcc 4080 aaaaacatga aacattgac cccgagcacc ctcacacaga tagactaca tgagaggag 4140 aaaggggcca tactcagtc tccttatca gattgcctta cgaggagtca tagcatccct 4200 caagcaaata gatctccatt accattgca aaggtatcat cattccattc tattagacct 4260 atatatctga ccagggtcct attccaagac aactcttctc atcttccagc agcatcttat 4380. 4380. 4380. 4380. 4380. 4380. 4380. 4380. 4380 aacctttctt tagccattct aaccttggag atgactggtg atcaagaga ggttggctcc ctggggacaa gtgccacaaa ttcagtcacaa ttgagaaag ttgagaacac tgttctcccg 4560. aaaccagact tgcccaaaac atctggcaaa gttgaattgc ttccaaaagt tcacatttat cagaaggacc tattccctac ggaaactagc aatgggtctc ctggccatct ggatctcgtg gaagggagcc ttcttcaggg aacagaggga gcgattaagt ggaatgaagc aaacagacct 4680. ggaaaagttc cctttctgag agtagcaaca gaaagctctg caaagactcc ctccaagcta ttggatcctc ttgcttgggga taccactat ggtactcaga taccaaaaga agagtggaa 4860. tcccaagaga agtcaccaga aaaaacagct tttaagaaaa agtaccat tttgtccctg aacgcttgtg aaagcaatca tgcaatagca gcaataaatg agggacaaaa tagcccgaa 4980. cctgggcaa gcaaggtagg actgaaggc tgtgctctca aaacccacca gtcttgaaac gccatcaacg ggaaataact cgtactactc ttcagtcaga tcaagaggaa 5040 attgactatg atgataccat atcagttgaa atgaagaagg aagattttga catttatgat 5100 gaggatgaaa atcagagccc ccgcagcttt caaaagaaaa cacgacacta ttttattgct 5160 gcagtggaga ggctctggga ttatgggatg agtagctccc cacatgttct aagaaacagg 5220 gctcagagtg gcagtgtccc tcagttcaag aaagttgttt tccaggaatt tactgatggc 5280 tcctttatc agcccttata ccgtggagaa ctaaatgaac atttggact cctggggcca 5340 tatataagag cagaagttga agataatatc atggtaactt tcagaaatca ggcctctcgt 5400 ccttatcct tctattctag ccttatttct tatgagaag atcagaggca aggagcagaa 5460 cctagaaaaa actttgtcaa gcctaatgaa accaaactt acttttggaa agtgcaacat 5520 catatggcac ccactaaaga tgagtttgac tgcaaagcct gggcttattt ctctgatgtt 5580 gacctggaaa aagatgtgca ctcaggcctg attggacccc ttctggtctg ccacactaac 5640 acactgaacc ctgctcatgg gagacaagtg acagtacagg aatttgctct gtttttcacc 5700 atctttgatg agaccaaaag ctggtacttc actgaaaata tggaaagaa ctgcagggct 5760 ccctgcaata tccagatgga agatcccact ttaagaga attatcgctt ccatgcaatc 5820 aatggctaca taatggatac actacctggc ttagtaatgg ctcaggatca aaggattcga 5880 tggtatctgc tgcatggg tgtgg aacatccatt ctattcattt tgtcatt 5940 gtgttcactg tacgaaaaaa agaggagtat aaaatggcac tgtacaatct ctatccaggt 6000 gttttgaga cagtggaat gttaccatcc aaagctggaa tttggcggt ggaatgcctt 6060 attggcgagc atctacatgc tgggatgagc acacttttc tggtgtacag caataagtgt 6120 cagactcccc tgggaatggc tctggacac attagagatt cagactac agctcagga 6180 aatatggac agtggcccc aaagctggcc agactcatt attccggatc atcaatgcc 6240 6300 cacggcatca agacccaggg tgcccgtcag aagttctcca gcctacat ctctcagttt 6360 atcatcatgt atagtcttga tgggagag tggcatgt atcgaggaa tccactgga 6420 accttaatgg tcttctttgg caatgtggat tcatctggga taaaacacaa tatttttaac 6480 cctccaatta ttgctcgata catccgtttg cacccaactc attatagcat tcgcagcact 6540 cttcgcatgg agttgatggg ctgtgattta aatagttgca gcatgccatt gggaatggag 6600 agtaaagcaa tatcagatgc acagattact gcttcatcct actttaccaa tatgtttgcc 6660 acctggtctc cttcaaaagc tcgacttcac ctccaaggga ggagtaatgc ctggagacct 6720 caggtgaata atccaaaaga gtggctgcaa gtggacttcc agaagacaat gaaagtcaca 6780 ggagtaacta ctcagggagt aaaatctctg cttaccagca tgtatgtgaa ggagttcctc 6840 atctccagca gtcaagatgg ccatcagtgg actctctttt ttcagaatgg caaagtaaag 6900 gtttttcagg gaaatcaaga ctccttcaca cctgtggtga actctctaga cccaccgtta 6960 ctgactcgct accttcgaat tcacccccag agttgggtgc accagattgc cctgaggatg 7020 gaggttctgg gctgcgaggc acaggacctc tac 7053 <210> 60 <211> 1827 <212> DNA <213> Unknown <220> <223> Albumin <400> 60 atgaagtggg taacctttat ttcccttctt tttctcttta gctcggctta ttccaggggt 60 gtgtttcgtc gagatgcaca caagagtgag gttgctcatc ggtttaaaga tttgggagaa 120 gaaaatttca aagccttggt gttgattgcc tttgctcagt atcttcagca gtgtccattt 180 gaagatcatg taaaattagt gaatgaagta actgaatttg caaaaacatg tgttgctgat 240 gagtcagctg aaaattgtga caaatcactt catacccttt ttggagacaa attatgcaca 300 gttgcaactc ttcgtgaaac ctatggtgaa atggctgact gctgtgcaaa acaagaacct 360 gagagaaatg aatgcttctt gcaacacaaa gatgacaacc caaacctccc ccgattggtg 420 agaccagagg ttgatgtgat gtgcactgct tttcatgaca atgaagagac atttttgaaa 480 aaatacttat atgaaattgc cagaagacat ccttactttt atgccccgga actccttttc 540 tttgctaaaa ggtataaagc tgcttttaca gaatgttgcc aagctgctga taaagctgcc 600 tgcctgttgc caaagctcga tgaacttcgg gatgaaggga aggcttcgtc tgccaaacag 660 agactcaagt gtgccagtct ccaaaaattt ggagaaagag ctttcaaagc atgggcagta 720 gctcgcctga gccagagatt tcccaaagct gagtttgcag aagtttccaa gttagtgaca 780 gatcttacca aagtccacac ggaatgctgc catggagatc tgcttgaatg tgctgatgac 840 agggcggacc ttgccaagta tatctgtgaa aatcaagatt cgatctccag taaatgaag 900 gaatgctgtg aaaaacctct gttggaaaaa tccactgca ttgccgaagt ggaaaatgat 960 gagatgcctg ctgacttgcc ttcattagct gctgattttg ttgaagtaa ggatgtttgc 1020 aaaaactatg ctgaggcaaa ggatgtcttc ctgggcatgt ttttgtatga atatgcaaga 1080 aggcatcctg attactctgt cgtgctgctg ctgagacttg ccaagacata tgaaaccact 1140 ctagagaagt gctgtgccgc tgcagatcct catgaatgct atgccaaagt gttcgatgaa 1200 tttaaacctc ttgtggaaga gcctcagaat ttaatcaaac aaaattgtga gctttttgag 1260 cagcttggag agtacaaatt ccagaatgcg ctattagttc gttacaccaa gaagtaccc 1320 caagtgtcaa ctccaactct tgtagaggtc tcaagaaacc taggaaaagt gggcagcaaa 1380 tgttgtaaac atcctgaagc aaaaagaatg ccctgtgcag aagactatct atccgtggtc 1440 ctgaaccagt tatgtgtgtt gcatgagaaa acgccagtaa gtgacagagt caccaaatgc 1500 tgcacagaat ccttggtgaa caggcgacca tgcttttcag ctctggaagt cgatgaaaca 1560 tacgttccca aagagtttaa tgctgaaaca ttcaccttcc atgcagatat atgcacactt 1620 tctgagaagg agagacaaat caagaaacaa actgcacttg ttgagctcgt gaaacacaag 1680 cccaaggcaa caaaagagca actgaaagct gttatggatg atttcgcagc ttttgtagag 1740 aagtgctgca aggctgacga taaggagacc tgctttgccg aggagggtaa aaaacttgtt 1800 gctgcaagtc aagctgcctt aggctta 1827 <210> 61 <211> 1389 <212> DNA <213> Unknown <220> <223> Factor IX <400> 61 gccaccatgc agcgcgtgaa catgatcatg gcagaatcac caggcctcat caccatctgc 60 cttttaggat atctactcag tgctgaatgt acagtttttc ttgatcatga aaacgccaac 120 aaaattctga atcggccaaa gaggtataat tcaggtaaat tggagaagtt tgttcaaggg 180 aaccttgaga gagaatgtat ggagaaaag tgtagttttg aagaagcacg agaagttttt 240 gaaaacactg aaagaacaac tgaattttgg aagcagtatg ttgatggaga tcagtgtgag 300 tccaatccat gtttaaatgg cggcagttgc aggatgaca ttaattccta tgaatgttgg 360 tgtccctttg gatttgaagg aaagaactgt gaattagatg taacatgtaa cattaagaat 420 ggcagatgcg agcagttttg taaaaatagt gctgataaca aggtggtttg ctcctgtact 480 gagggatatc gacttgcaga aaaccagaag tcctgtgaac cagcagtgcc atttccatgt 540 ggaagagttt ctgtttcaca aacttctaag ctcaccccgtg ctgagactgt ttttcctgat 600 gtggactatg taaattctac tgaagctgaa accattttgg ataacatcac tcaaagcacc 660 caatcattta atgacttcac tcgggttgtt ggtggagaag atgccaaacc aggtcaattc 720 ccttggcagg ttgttttgaa tggtaaagtt gatgcattct gtggaggctc tatcgttaat 780 gaaaaaatgga ttgtaactgc tgcccactgt gttgaaactg gtgttaaaat tacagttgtc 840 gcaggtgaac ataatattga ggagacagaa catacagagc aaaagcgaaa tgtgattcga 900 attattcctc accacaacta caatgcagct attaataagt acaaccatga cattgccctt 960 ctggaactgg acgaaccctt agtgctaaac agctacgtta cacctatttg cattgctgac 1020 aaggaataca cgaacatctt cctcaaattt ggatctggct atgtaagtgg ctggggaaga 1080 gtcttccaca aagggagatc agctttagtt cttcagtacc ttagagttcc acttgttgac 1140 cgagccacat gtcttcgatc tacaaagttc accatctata acaacatgtt ctgtgctggc 1200 ttccatgaag gaggtagaga ttcatgtcaa ggagatagtg ggggacccca tgttactgaa 1260 gtggaaggga ccagtttctt aactggaatt attagctggg gtgaagagtg tgcaatgaaa 1320 ggcaaatatg gaatatatac caaggtatcc cggtatgtca actggattaa ggaaaaaaca 1380 aagctcact 1389 <210> 62 <211> 432 <212> DNA <213> Unknown <220> <223> H-FABP <400> 62 atggtggacg ctttcctggg cacctggaag ctagtggaca gcaagaattt cgatgactac 60 atgaagtcac tcgctcatat actcataacc ttccccctac cctcaggtgt gggttttgct 120 Methionine - Lysine - Serine - Threonine - Alanine - Histidine - Isoleucine - Threonine - Isoleucine - Threonine - Proline - Proline - Proline - Tyrosine - Proline - Glutamine - Valine - Glycine - Phenylalanine - Alanine 120 accaggcagg tggccagcat gaccaagcct accacaatca tcgaaaagaa tggggacatt 180 Threonine - Arginine - Glycine - Glycine - Alanine - Serine - Methionine - Threonine - Lysine - Proline - Threonine - Histidine - Isoleucine - Isoleucine - Glutamic - Acid - Lysine - Lysine - Tryptophan - Aspartic - Acid - Isoleucine 180 ctcaccctaa aaacacacag caccttcaag aacacagaga tcagctttaa gttgggggtg 240 Leucine - Threonine - Proline - Lysine - Lysine - Histidine - Glutamine - Histidine - Leucine - Glutamine - Glutamine - Glutamine - Glutamic - Acid - Isoleucine - Serine - Phenylalanine - Lysine - Leucine - Glycine - Valine 240 gagttcgatg agacaacagc agatgacagg aaggtcaagt ccattgtgac actggatgga 300 Glutamic - Acid - Phenylalanine - Aspartic - Acid - Glutamic - Acid - Threonine - Serine - Aspartic - Acid - Aspartic - Acid - Arginine - Lysine - Valine - Lysine - Serine - Isoleucine - Valine - Aspartic - Acid - Leucine - Aspartic - Acid - Glycine 300 gggaaacttg ttcacctgca gaaatgggac gggcaagaga ccacacttgt gcgggagcta 360 Glycine - Lysine - Leucine - Phenylalanine - Threonine - Alanine - Glutamine - Asparagine - Glycine - Aspartic - Acid - Glycine - Lysine - Glutamic - Acid - Proline - Histidine - Leucine - Cysteine - Glycine - Serine - Alanine 360 attgatggaa aactcatcct gacactcacc cacggcactg cagtttgcac tcgcacttat 420 Isoleucine - Aspartic - Acid - Glycine - Lysine - Leucine - Isoleucine - Proline - Aspartic - Acid - Leucine - Threonine - Histidine - Glycine - Threonine - Alanine - Glutamine - Phenylalanine - Cysteine - Serine - Alanine - Leucine - Tyrosine 420 gagaaagagg ca 432 Glutamic - Acid - Lysine - Glutamic - Acid - Alanine 432 <210> 63<210> 63 <211> 462<211> 462 <212> DNA<212> DNA <213> 未知(Unknown)<213> Unknown <220><220> <223> 心肌肌红蛋白<223> Cardiac Myoglobin <400> 63<400> 63 atggggctca gcgacgggga atggcagttg gtgctgaacg tctgggggaa ggtggaggct 60 Methionine - Glycine - Leucine - Serine - Aspartic - Acid - Glycine - Asparagine - Glycine - Glutamine - Leucine - Valine - Leucine - Asparagine - Valine - Tryptophan - Glycine - Lysine - Valine - Glutamic - Acid - Alanine 60 gacatcccag gccatgggca ggaagtcctc atcaggctct ttaagggtca cccagagact 120 Aspartic - Acid - Isoleucine - Proline - Alanine - Methionine - Glycine - Glutamine - Lysine - Valine - Leucine - Isoleucine - Glutamine - Alanine - Leucine - Phenylalanine - Lysine - Glycine - Threonine - Glutamine - Arginine - Threonine 120 ctggagaagt ttgacaagtt caagcacctg aagtcagagg acgagatgaa ggcgtctgag 180 Leucine - Glutamic - Acid - Lysine - Phenylalanine - Aspartic - Acid - Lysine - Serine - Lysine - Histidine - Leucine - Glutamic - Acid - Serine - Glutamic - Acid - Aspartic - Acid - Glutamic - Acid - Glycine - Valine - Glutamic - Acid 180 gacttaaaga agcatggtgc caccgtgctc accgccctgg gtggcatcct taagaagaag 240 gggcatcatg aggcagagat taagcccctg gcacagtcgc atgccaccaa gcacaagatc 300 cccgtgaagt acctggagtt catctcggaa tgcatcatcc aggttctgca gagcaagcat 360 cccggggact ttggtgctga tgcccagggg gccatgaaca aggccctgga gctgttccgg 420 aaggacatgg cctccaacta caaggagctg ggcttccagg gc 462 <210> 64 <211> 1293 <212> DNA <213> Unknown <220> <223> GFAP <400> 64 atggagagga gacgcatcac ctccgctgct cgccgctcct acgtctcctc aggggagatg 60 atggtggggg gcctggctcc tggccgccgt ctgggtcctg gcacccgcct ctccctggct 120 cgaatgcccc ctccactccc gacccgggtg gatttctccc tggctggggc actcaatgct 180 ggcttcaagg agacccgggc cagtgagcgg gcagagatga tggagctcaa tgaccgcttt 240 gccagctaca tcgagaaggt tcgcttcctg gaacagcaaa acaaggcgct ggctgctgag 300 ctgaaccagc tgcgggccaa ggagcccacc aagctggcag acgtctacca ggctgagctg 360 cgagagctgc ggctgcggct cgatcaactc accgccaaca gcgcccggct ggaggttgag 420 agggacaatc tggcacagga cctggccact gtgaggcaga agctccagga tgaaaccaac 480 ctgaggctgg aagccgagaa caacctggct gcctatagac aggaagcaga tgaagccacc 540 ctggcccgtc tggatctgga gaggaagatt gagtcgctgg aggaggagat ccggttcttg 600 aggaagatcc acgaggagga ggttcgggaa ctccaggagc agctggcccg acagcaggtc 660 catgtggagc ttgacgtggc caagccagac ctcaccgcag ccctgaaaga gatccgcacg 720 cagtatgagg caatggcgtc cagcaacatg catgaagccg aagagtggta ccgctccaag 780 tttgcagacc tgacagacgc tgctgcccgc aacgcggagc tgctccgcca ggccaagcac 840 gaagccaacg actaccggcg ccagttgcag tccttgacct gcgacctgga gtctctgcgc 900 ggcacgaacg agtccctgga gaggcagatg cgcgagcagg aggagcggca cgtgcgggag 960 gcggccagtt atcaggaggc gctggcgcgg ctggaggaag aggggcagag cctcaaggac 1020 gagatggccc gccacttgca ggagtaccag gacctgctca atgtcaagct ggccctggac 1080 atcgagatcg ccacctacag gaagctgcta gagggcgagg agaaccggat caccattccc 1140 gtgcagacct tctccaacct gcagattcga gggggcaaaa gcaccaaaga cggggaaaat 1200 cacaaggtca caagatatct caaaagcctc acaatacgag ttataccaat acaggctcac 1260 cagattgtaa atggaacgcc gccggctcgc ggt 1293 <210> 65 <211> 276 <212> DNA <213> Unknown <220> <223> S100B <400> 65 atgtctgagc tggagaaggc catggtggcc ctcatcgacg ttttccacca atattctgga 60 agggagggag acaagcacaa gctgaagaaa tccgaactga aggagctcat caacaatgag 120 ctttcccatt tcttagagga aatcaaagag caggaggttg tggacaaagt catggaaaca 180 ctggacaatg atggagacgg cgaatgtgac ttccaggaat tcatggcctt tgttgccatg 240 gttactactg cctgccacga gttctttgaa catgag 276 <210> 66 <211> 1069 <212> DNA <213> Unknown <220> <223> PYY (Homo sapiens) <400> 66 gcccctggag gaactgaacc cactatcggt catggggccg agactaaatg tggcgggttg 60 tctttaatct gctgccaaga ggaaactcat tcaggcaagt tcagcccttt atgaggaatt 120 cccctgtggt cacattccaa ttcctggacc tgctgccacc ctcagaactg catgctcctt 180 cttcagactt tctaagaatg actcaggtca ttggtggagt gaagtcaaga tttccaactc 240 agtcacctga agagatggag ataccattca tggagctgga ggtccctgga gatttgggaa 300 ttcagataac aagctaagat aaggagtttg cctacctctg tcctagagcg aagcctgagc 360 cttgggcgcg cagcacacca caagtatctg ttactgtgtt ttgcagaagc ttcaggcggg 420 gatataagcc ccacaaggaa agcgctgagc agaggaggcc tcagcttgac ctgcggcagt 480 gcagcccttg ggacttccct cgccttccac ctcctgctcg tctgcttcac aagctatcgc 540 tatggtgttc gtgcgcaggc cgtggcccgc cttgaccaca gtgcttctgg ccctgctcgt 600 ctgcctaggg gcgctggtcg acgcctaccc catcaaaccc gaggctcccg gcgaagacgc 660 ctcgccggag gagctgaacc gctactacgc ctccctgcgc cactacctca acctggtcac 720 ccggcagcgg tatgggaaaa gagacggccc ggacacgctt ctttccaaaa cgttcttccc 780 cgacggcgag gaccgccccg tcaggtcgcg gtcggagggc ccagacctgt ggtgaggacc 840 cctgaggcct cctgggagat ctgccaacca cgcccacgtc atttgcatac gcactcccga 900 ccccagaaac ccggattctg cctcccgacg gcggcgtctg ggcagggttc gggtgcggcc 960 ctccgcccgc gtctcggtgc ccccgccccc tgggctggag ggctgtgtgt ggtccttccc 1020 tggtcccaaa ataaagagca aattccacag aaacggaaaa aaaaaaaaa 1069 <210> 67 <211> 3670 <212> DNA <213> Unknown <220> <223> TIMP2 (Homo sapiens) <400> 67 cgcagcaaac acatccgtag aaggcagcgc ggccgccgag aaccgcagcg ccgctcgccc 60 gccgcccccc accccgccgc cccgcccggc gaattgcgcc ccgcgcccct cccctcgcgc 120 ccccgagaca aagaggagag aaagtttgcg cggccgagcg gggcaggtga ggagggtgag 180 ccgcgcggga ggggcccgcc tcggccccgg ctcagccccc gccgcgcc ccagcccgcc 240 gccgcgagca gcgcccggac cccccagcgg cggcccccgc ccgcccagcc cccggcccg 300 ccatgggcgc cgcggcccgc acctgcggc tgcgctcgg cctcctgctg ctggcgacgc 360 tgcttcgccc ggccgacgcc tgcagctgct ccccggtgca cccgcaacag gcgttttgca 420 atgcagatgt agtgatcagg gccaaagcgg tcagtgagaa ggaagtggac tctggaaacg 480 acatttatgg caaccctatc aagaggatcc agtatgagat caagcagata aagatgttca 540 aagggcctga gaaggatata gagttatct acacggcccc ctcctcggca gtgtgtgggg 600 tctcgctgga cgttggagga aagaaggaat atctcattgc aggaaaggcc gagggggacg 660 gcaagatgca catcaccctc tgtgacttca tcgtgccctg ggacaccctg agcaccacccc 720 agaagaagag cctgaaccac aggtaccaga tgggctgcga gtgcaagatc acgcgctgcc 780 ccatgatccc gtgctacatc tcctccccgg acgagtgcct ctggatggac tgggtcacag 840 agaagaacat caacgggcac caggccaagt tcttcgcctg catcaagaga agtgacggct 900 cctgtgcgtg gtaccgcggc gcggcgcccc ccaagcagga gtttctcgac atcgaggacc 960 cataagcagg cctccaacgc ccctgtggcc aactgcaaaa aaagcctcca agggtttcga 1020 ctggtccagc tctgacatcc cttcctggaa acagcatgaa taaaacactc atcccatggg 1080 tccaaattaa tatgattctg ctcccccctt ctccttttag acatggttgt gggtctggag 1140 ggagacgtgg gtccaaggtc ctcatcccat cctccctctg ccaggcacta tgtgtctggg 1200 gcttcgatcc ttgggtgcag gcagggctgg gacacgcggc ttccctccca gtccctgcct 1260 tggcaccgtc acagatgcca agcaggcagc acttagggat ctcccagctg ggttagggca 1320 gggcctggaa atgtgcattt tgcagaaact tttgagggtc gttgcaagac tgtgtagcag 1380 gcctaccagg tccctttcat cttgagaggg acatggccct tgttttctgc agcttccacg 1440 cctctgcact ccctgcccct ggcaagtgct cccatcgccc cggtgcccac catgagctcc 1500 cagcacctga ctccccccac atccaagggc agcctggaac cagtggctag ttcttgaagg 1560 agccccatca atcctattaa tcctcagaat tccagtggga gcctccctct gagccttgta 1620 gaaatgggag cgagaaaccc cagctgagct gcgttccagc ctcagctgag tctttttggt 1680 ctgcacccac ccccccaccc cccccccccc gcccacatgc tccccagctt gcaggaggaa 1740 tcggtgaggt cctgtcctga ggctgctgtc cggggccggt ggctgccctc aaggtccctt 1800 ccctagctgc tgcggttgcc attgcttctt gcctgttctg gcatcaggca cctggattga 1860 gttgcacagc tttgctttat ccgggcttgt gtgcagggcc cggctgggct ccccatctgc 1920 acatcctgag gacagaaaaa gctgggtctt gctgtgccct cccaggctta gtgttccctc 1980 cctcaaagac tgacagccat cgttctgcac ggggctttct gcatgtgacg ccagctaagc 2040 atagtaagaa gtccagccta ggaagggaag gattttggag gtaggtggct ttggtgacac 2100 actcacttct ttctcagcct ccaggacact atggcctgtt ttaagagaca tcttattttt 2160 ctaaaggtga attctcagat gataggtgaa cctgagttgc agatatacca acttctgctt 2220 gtatttctta aatgacaaag attacctagc taagaaactt cctagggaac tagggaacct 2280 atgtgttccc tcagtgtggt ttcctgaagc cagtgatatg ggggttagga taggaagaac 2340 tttctcggta atgataagga gaatctcttg tttcctccca cctgtgttgt aaagataaac tgacgatata caggcacatt atgtaaacat acacacgcaa tgaaaccgaa gcttggcggc ctgggcgtgg tcttgcaaaa tgcttccaaa gccaccttag cctgttctat tcagcggcaa ccccaaagca cctgttaaga ctcctgaccc cccaagtggca tgcagccccc atgcccaccg ggacctggtc agcacagatc ttgatgactt ccctttctag ggcagactgg gagggtatcc 2640. aggaatcggc ccctgcccca cggggcgtttt catgctgtac agtgacctaa agttggtaag atgtcataat ggaccagtcc atgtgatttc agtataca actccaccag acccctccaa cccatataac accccacccc tgttcgcttc ctgtatggtg atatcatatg taacatttac tcctgtttct gctgattgtt tttttaatgt tttggtttgt ttttgacatc agctgtaatc 2880. attcctgtgc tgtgtttttt attacccttg gtaggtatta gacttgcact tttttaaaaa 2940 aaggtttctg catcgtgga gcatttgacc cagagtgga cgcgtggcct atgcaggtgg attccttcag gtctttcctt tggttctttg agcatctttg ctttcattcg tctcccgtct 3060 ttggttctcc agttcaaatt attgcaaagt aaaggatctt tgagtaggtt cggtctgaaa 3120 ggtgtggcct ttatatttga tccacacacg ttggtctttt aaccgtgctg agcagaaaac 3180 aaaacaggtt aagaagagcc gggtggcagc tgacagagga agccgctcaa ataccttcac 3240 aataaatagt ggcaatatat ataggtta agaaggctct ccatttggca tcgtttaatt 3300 tatatgttat gttctaagca cagctctctt ctcctatttt catcctgcaa gcaactcaaa 3360 atatttaaaa taaagtttac attgtagtta ttttcaaatc tttgcttgat aagtattaag 3420 aaatattgga cttgctgccg taatttaaag ctctgttgat tttgtttccg tttggatttt 3480 tgggggaggg gagcactgtg tttatgctgg aatatgaagt ctgagacctt ccggtgctgg 3540 gaacacacaa gagttgttga aagttgacaa gcagactgcg catgtctctg atgctttgta 3600 tcattcttga gcaatcgctc ggtccgtgga caataaacag tattatcaaa gagaaaaaaa 3660 aaaaaaaaaa 3670

Claims

1. A use of a physiologically tailored tissue organoid in the preparation of a medicament for monitoring and treating diabetes or obesity in an individual in need thereof, the physiologically tailored tissue organoid comprising: a) a plurality of genetically engineered cells, the plurality of genetically engineered cells comprising at least one recombinant gene encoding a therapeutic agent, wherein when the therapeutic agent is administered to an individual in need thereof, the therapeutic agent improves the health of the individual, and wherein the therapeutic agent comprises one or more of glucagon-like peptide 1 and modified glucagon-like peptide 1; and b) acellular dermal tissue, wherein the genetically engineered cells are derived from embryonic stem cells, human induced pluripotent stem cells and / or epidermal stem cells taken from an individual; and The physiologically tailored tissue organoids are non-immunogenic skin transplants.

2. The method of claim 1, wherein the therapeutic agent is constitutively expressed or induced to express by an inducible factor.

3. The use according to claim 1 or 2, wherein the therapeutic agent further comprises DkTx or VaTx.

4. The use according to claim 3, wherein the amino acid sequence of DkTx is shown in SEQ ID NO:

36.

5. The use according to claim 3, wherein the amino acid sequence of VaTx is shown in SEQ ID NO:

35.

6. The use of claim 1, wherein the expression of the therapeutic agent is induced by alcohol.

7. The use of claim 1 or 2, wherein the therapeutic agent further comprises hBChE.

8. The use of claim 1, wherein the tissue organoid is biointegrated into the individual by transplantation or surgical implantation.

9. The use according to claim 1, wherein the amino acid sequence of the modified glucagon-like peptide 1 is as shown in SEQ ID NO: 45.

Images