Gene regulation in photosynthetic organisms for improved growth

Abstract

Mutant photosynthetic organisms with reduced chlorophyll and increased photosynthetic efficiency are provided. The mutant strains have mutations or weakened: chloroplast SRP54 gene and SGI1 gene; chloroplast SRP54 gene and SGI2 gene; chloroplast SRP54 gene, SGI1 gene and SGI2 gene are disclosed. The mutant photosynthetic organisms exhibit increased productivity relative to wild-type strains. Mutant photosynthetic organisms with mutations or weakened cytoplasmic SRP54 genes are also provided. Methods for producing biomass and other products such as lipids using strains with mutations in the SRP54 gene, SGI1 gene, SGI2 gene, a combination of SGI1 / SRP54, and a combination of the SGI2 gene and the SRP54 gene are provided herein. Constructs and methods for weakening or destroying the SRP54 gene, the SGI1 gene, and the SGI2 gene are also included.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit of priority under 35 USC §119(e) to U.S. Serial No. 62 / 612,251, filed December 29, 2017, and U.S. Serial No. 62 / 690,205, filed June 26, 2018, the entire contents of which are incorporated herein by reference in their entirety.

[0003] Incorporation of Sequence Listing

[0004] The material in the attached sequence listing is hereby incorporated by reference into this application. The attached sequence listing text file named SGI2140_2WO_Sequence_Listing.txt was created on December 18, 2018 and is 419 kb in size. This file can be accessed using Microsoft Word on a computer using Windows OS. Background Art

[0005] Improvements in biomass productivity of photosynthetic organisms are relevant to a variety of commercial applications, from biofuels to high-value products. Genetic manipulation to increase the total protein content of biomass is highly desirable, but strategies for doing so are not obvious in the art.

[0006] Engineering photosynthetic organisms to increase photosynthetic efficiency and thereby achieve higher productivity is a long-standing goal for plant and algae biologists. US 2014 / 0220638 and US 2016 / 030489 (both incorporated herein by reference) describe mutant screening for obtaining algal mutants with reduced chlorophyll, which are impaired in terms of low light adaptation ability, that is, they can maintain the low chlorophyll state of high light adapted cells even under low light. US 2014 / 0220638 describes algal mutants with mutations in the light adaptation regulator LAR1, LAR2, and LAR3 genes, and US 2016 / 0304896 discloses algal mutants with mutations in the chloroplast SRP54 gene. Summary of the Invention

[0007] Disclosed herein are photosynthetic organisms comprising regulatory genes that increase photosynthetic efficiency and productivity, their use in producing products under photoautotrophic conditions, and methods of producing such photosynthetic organisms, as well as nucleic acid molecules and constructs for regulating such genes.

[0008] In one aspect, a mutant photosynthetic organism is provided that includes a mutated or attenuated gene encoding the significant growth improvement gene 2 (SGI2).

[0009] In one aspect, a mutant photosynthetic organism is provided, comprising a mutated or attenuated gene encoding chloroplast signal recognition protein 54 (cpSRP54) and a mutated or attenuated significant growth improvement gene 2 (SGI2).

[0010] In one aspect, a mutant photosynthetic organism is provided, comprising a mutated or attenuated gene encoding chloroplast signal recognition protein 54 (cpSRP54) and a mutated or attenuated significant growth improvement gene 1 (SGI1).

[0011] In one aspect, a mutant photosynthetic organism is provided, comprising a mutated or weakened gene encoding chloroplast signal recognition protein 54 (cpSRP54), a mutated or weakened significant growth improved gene 1 (SGI1), and a mutated or weakened significant growth improved gene 2 (SGI2).

[0012] In one aspect, a mutant photosynthetic organism is provided, comprising a mutated or attenuated gene encoding cytoplasmic signal recognition protein 54 (cytoSRP54) and a mutated or attenuated significant growth improvement gene 2 (SGI2).

[0013] In one aspect, a mutant photosynthetic organism is provided, comprising a mutated or attenuated gene encoding cytoplasmic signal recognition protein 54 (cytoSRP54) and a mutated or attenuated significant growth improvement gene 1 (SGI1).

[0014] In one aspect, a mutant photosynthetic organism is provided, comprising a mutated or weakened gene encoding cytoplasmic signal recognition protein 54 (cytoSRP54), a mutated or weakened significant growth improved gene 1 (SGI1), and a mutated or weakened significant growth improved gene 2 (SGI2).

[0015] In one aspect, a biomass comprising a mutant photosynthetic organism is provided, wherein the mutant photosynthetic organism comprises a mutated or weakened gene encoding chloroplast signal recognition protein 54 (cpSRP54) and a mutated or weakened significant growth improved gene 1 (SGI1) and / or a mutated or weakened significant growth improved gene 2 (SGI2).

[0016] In one aspect, a method for producing a bioproduct is provided. The method comprises culturing a mutant photosynthetic organism, wherein the mutant photosynthetic organism comprises a mutated or weakened gene encoding chloroplast signal recognition protein 54 (cpSRP54) and a mutated or weakened significant growth improvement gene 1 (SGI1) and / or a mutated or weakened significant growth improvement gene 2 (SGI2); and isolating at least one product from the culture.

[0017] On the one hand, a method for inserting a single copy of a CRISPR gene into a selected locus of a microorganism is provided. In some embodiments, the CRISPR gene is codon-optimized for expression in a microorganism. In some embodiments, the inserted CRISPR gene includes multiple heterologous introns. In some embodiments, the number of the heterologous introns can be at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40 or more. Non-limiting examples of the CRISPR gene include Cas9 and Cpf1. In some embodiments, the CRISPR gene can be operably linked to a natural promoter of a microorganism. In some embodiments, the promoter is inducible. In some embodiments, the CRISPR gene can be operably linked to a heterologous promoter of a microorganism.

[0018] In some embodiments, the bioproduct is a lipid, protein, peptide, one or more amino acids, amino acids, one or more nucleotides, vitamins, cofactors, hormones, antioxidants, or pigments or colorants. In some embodiments, the bioproduct is biomass. In some embodiments, the mutant photosynthetic organism is algae, and the biomass is algae biomass.

[0019] In some embodiments, the mutant photosynthetic organism is engineered to contain at least one exogenous gene encoding a polypeptide involved in the production of the lipid. In some embodiments, the mutant photosynthetic organism is cultured phototrophically. In some embodiments, the mutant photosynthetic organism is algae, and the algae is cultured in a pond or ditch.

[0020] In one aspect, a nucleic acid molecule construct for homologous recombination is provided, the nucleic acid molecule construct comprising a nucleotide sequence from or adjacent to a naturally occurring photosynthetic organism gene encoding an SGI2 protein, wherein, before mutation or attenuation of the gene, the SGI2 protein comprises an amino acid sequence having at least 55% identity with an amino acid sequence selected from the group consisting of SEQ ID NO:5, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, and SEQ ID NO:56.

[0021] In one aspect, a plurality of nucleic acid molecule constructs for homologous recombination are provided, the nucleic acid molecule constructs comprising nucleotide sequences from or adjacent to a naturally occurring photosynthetic organism gene encoding a cpSRP54 protein and a photosynthetic organism gene encoding an SGI1 protein, wherein, prior to mutation or attenuation of the gene, the cpSRP54 protein comprises an amino acid sequence having at least 55% identity to SEQ ID NO:68, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, SEQ ID NO:80, SEQ ID NO:81, SEQ ID NO:82, SEQ ID NO:83, SEQ ID NO:84, and SEQ ID NO:85, and wherein, prior to mutation or attenuation of the SGI1 gene, the SGI1 gene encodes a polypeptide having an amino acid sequence comprising an amino acid sequence having at least 55% identity to an amino acid sequence selected from the group consisting of SEQ ID NO:3, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30 NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, and SEQ ID NO:39.

[0022] In one aspect, a plurality of nucleic acid molecule constructs for homologous recombination are provided, the nucleic acid molecule constructs comprising nucleotide sequences from or adjacent to a naturally occurring photosynthetic organism gene encoding a cpSRP54 protein and a photosynthetic organism gene encoding an SGI2 protein, wherein, prior to mutation or attenuation of the gene, the cpSRP54 protein comprises an amino acid sequence having at least 55% identity to SEQ ID NO:68, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, SEQ ID NO:80, SEQ ID NO:81, SEQ ID NO:82, SEQ ID NO:83, SEQ ID NO:84, or SEQ ID No:85, and wherein, prior to mutation or attenuation of the gene, the SGI2 protein comprises an amino acid sequence having at least 55% identity to SEQ ID NO:5, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65 NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55 or SEQ ID NO:56 have an amino acid sequence that is at least 55% identical.

[0023] In one aspect, a nucleic acid molecule construct for expressing an antisense RNA, shRNA, microRNA or ribozyme is provided, wherein the nucleic acid molecule construct comprises a nucleotide sequence complementary to at least a portion of a naturally occurring photosynthetic organism gene encoding an SGI2 protein, wherein, before mutation or attenuation of the gene, the SGI2 protein comprises an amino acid sequence having at least 55% identity to SEQ ID NO:5, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55 or SEQ ID NO:56.

[0024] In one aspect, a plurality of nucleic acid molecule constructs for expressing antisense RNA, shRNA, microRNA or ribozyme are provided, wherein the nucleic acid molecule construct comprises a nucleotide sequence complementary to at least a portion of a naturally occurring photosynthetic organism gene encoding a cpSRP54 protein and a photosynthetic organism gene encoding an SGI1 protein, wherein before mutation or attenuation of the gene, the cpSRP54 protein comprises an amino acid sequence having at least 55% identity to SEQ ID NO:68, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, SEQ ID NO:80, SEQ ID NO:81, SEQ ID NO:82, SEQ ID NO:83, SEQ ID NO:84 or SEQ ID NO:85, and wherein before mutation or attenuation of the SGI1 gene, the SGI1 protein comprises an amino acid sequence having at least 55% identity to SEQ ID NO:3, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15 NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38 or SEQ ID NO:39 have an amino acid sequence that is at least 55% identical.

[0025] In some embodiments, the construct comprises at least a portion of the 5'UTR of cpSRP54, SGI1, SGI2, or a combination of two or more genes, at least a portion of the promoter region of cpSRP54, SGI1, SGI2, or a combination of two or more genes, and / or at least a portion of the 3'UTR of cpSRP54, SGI1, SGI2, or a combination of two or more genes. In some examples, the construct can be an RNAi, ribozyme, or antisense construct and can comprise sequences that begin in the sense or antisense orientation of the transcribed region of cpSRP54, SGI1, SGI2, or a combination of two or more genes. In further examples, a construct can be designed for in vitro or in vivo expression of a guide RNA designed to target cpSRP54, SGI1, SGI2, or a combination of two or more genes and can comprise sequences homologous to a portion of any gene, including, for example, an intron, 5'UTR, promoter region, and / or 3'UTR of a gene. In yet further examples, the construct for attenuating expression of a gene encoding a cpSRP54, SGI1, or SGI2 polypeptide can be a guide RNA or an antisense oligonucleotide, wherein the sequence is homologous to the transcribed region of cpSRP54, SGI1, SGI2, or a combination of two or more genes in the antisense orientation.

[0026] In one aspect, a plurality of nucleic acid molecule constructs for expressing antisense RNA, shRNA, microRNA or ribozyme are provided, wherein the nucleic acid molecule construct comprises a nucleotide sequence complementary to at least a portion of a naturally occurring photosynthetic organism gene encoding a cpSRP54 protein and a photosynthetic organism gene encoding an SGI2 protein, wherein before mutation or attenuation of the gene, the cpSRP54 protein encodes a protein comprising an amino acid sequence having at least 55% identity to SEQ ID NO:68, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, SEQ ID NO:80, SEQ ID NO:81, SEQ ID NO:82, SEQ ID NO:83, SEQ ID NO:84 or SEQ ID No:85, and wherein before mutation or attenuation of the gene, the SGI2 protein encodes a protein comprising an amino acid sequence having at least 55% identity to SEQ ID NO:5, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45 NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55 or SEQ ID NO:56 having an amino acid sequence that is at least 55% identical.

[0027] In one aspect, a plurality of nucleic acid molecules encoding guide RNAs are provided, wherein the guide RNAs comprise at least a portion of a naturally occurring photosynthetic organism gene SGI2, wherein, prior to mutation or attenuation of the gene, the SGI2 gene encodes a protein comprising an amino acid sequence at least 55% identical to SEQ ID NO:5, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, or SEQ ID NO:56.

[0028] In one aspect, a plurality of nucleic acid molecules encoding at least two guide RNAs are provided, wherein the guide RNAs comprise at least a portion of a naturally occurring photosynthetic organism gene encoding cpSRP54 and a photosynthetic organism gene encoding SGI1, wherein prior to mutation or attenuation of the genes, the cpSRP54 encodes a protein comprising an amino acid sequence having at least 55% identity to SEQ ID NO:68, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, SEQ ID NO:80, SEQ ID NO:81, SEQ ID NO:82, SEQ ID NO:83, SEQ ID NO:84, or SEQ ID NO:85, and wherein prior to mutation or attenuation of the SGI1 gene, the SGI1 gene comprises an amino acid sequence having at least 55% identity to SEQ ID NO:3, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18 NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38 or SEQ ID NO:39 have an amino acid sequence that is at least 55% identical.

[0029] In one aspect, a plurality of nucleic acid molecules encoding at least two guide RNAs are provided, wherein the guide RNAs comprise at least a portion of a naturally occurring photosynthetic organism cpSRP54 gene and a photosynthetic organism gene SGI2 gene, wherein prior to mutation or attenuation of the genes, the cpSRP54 gene encodes a protein comprising an amino acid sequence having at least 55% identity to SEQ ID NO:68, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, SEQ ID NO:80, SEQ ID NO:81, SEQ ID NO:82, SEQ ID NO:83, SEQ ID NO:84, or SEQ ID No:85, and wherein prior to mutation or attenuation of the genes, the SGI2 gene comprises an amino acid sequence having at least 55% identity to SEQ ID NO:5, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60 NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55 or SEQ ID NO:56 has an amino acid sequence of at least.

[0030] In one aspect, a method of increasing biomass of a photosynthetic organism is provided, the method comprising modulating the SGI2 gene.

[0031] In one aspect, a method for increasing the biomass of a photosynthetic organism is provided, the method comprising regulating chloroplast signal recognition protein 54 (cpSRP54) and significant growth improvement gene 1 (SGI1), wherein prior to mutation or attenuation of the genes, the cpSRP54 gene encodes a protein comprising an amino acid sequence having at least 55% identity to SEQ ID NO:68, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, SEQ ID NO:80, SEQ ID NO:81, SEQ ID NO:82, SEQ ID NO:83, SEQ ID NO:84, or SEQ ID NO:85, and wherein prior to mutation or attenuation of the SGI1 gene, the SGI1 gene comprises an amino acid sequence having at least 55% identity to SEQ ID NO:3, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18 NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38 or SEQ ID NO:39 has an amino acid sequence of at least.

[0032] In one aspect, a method for increasing the biomass of a photosynthetic organism is provided, the method comprising regulating the chloroplast signal recognition protein 54 gene (cpSRP54) and the significant growth improvement gene 2 (SGI2), wherein prior to mutation or attenuation of the genes, the cpSRP54 gene encodes a protein comprising an amino acid sequence having at least 55% identity to SEQ ID NO:68, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, SEQ ID NO:80, SEQ ID NO:81, SEQ ID NO:82, SEQ ID NO:83, SEQ ID NO:84, or SEQ ID No:85, and wherein prior to mutation or attenuation of the genes, the SGI2 gene comprises an amino acid sequence having at least 55% identity to SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60 NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55 or SEQ ID NO:56 has an amino acid sequence of at least.

[0033] In one aspect, a method for increasing the biomass of a photosynthetic organism is provided, the method comprising regulating cytoplasmic signal recognition protein 54 (cytoSRP54) and significant growth improvement gene 2 (SGI2), wherein prior to mutation or attenuation of the genes, the SGI2 gene encodes a protein comprising an amino acid sequence having at least the amino acid sequence of SEQ ID NO:5, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55 or SEQ ID NO:56.

[0034] In some embodiments, a culture of the mutant photosynthetic organism exhibits greater biomass productivity than a culture of a control photosynthetic organism of the same species. In some embodiments, the mutant photosynthetic organism exhibits greater biomass productivity in a photoautotrophic culture. In some embodiments, under continuous light conditions, the mutant photosynthetic organism exhibits greater biomass productivity than a culture of a control photosynthetic organism of the same species. In some embodiments, under diurnal cycle conditions, the mutant photosynthetic organism exhibits greater biomass productivity than a culture of a control photosynthetic organism of the same species. In some embodiments, under diurnal cycle conditions, the mutant photosynthetic organism exhibits greater biomass productivity than a culture of a control photosynthetic organism of the same species, wherein the light profile simulates a natural daylight profile.

[0035] In some embodiments, increasing the biomass of a photosynthetic organism comprises an increase in total organic carbon. In some embodiments, increasing the biomass of a photosynthetic organism comprises an increase in total lipid content. In some embodiments, increasing the biomass of a photosynthetic organism comprises an increase in total nitrogen content.

[0036] In some embodiments, the mutant photosynthetic organism exhibits a decrease in chlorophyll under low light conditions and a decrease in chlorophyll content above 100, 125, 150, 200, or 250 μE m -2 s -1 The maximum photochemical quantum yield (F) in photosystem II at all physiologically relevant irradiances v / F M ) or greater. In some embodiments, the reduction in chlorophyll is at least 20%, 30%, 40%, 50%, 60%, or 70% relative to a control photosynthetic organism of the same species. In some embodiments, the mutant photosynthetic organism exhibits a chlorophyll reduction of greater than 125, 150, 200, or 250 μE m -2 s -1 Non-photochemical quenching (NPQ) is lower at all physiologically relevant irradiances.

[0037] In some embodiments, the mutant photosynthetic organism exhibits a higher carbon fixation rate per chlorophyll than a control photosynthetic organism of the same species. In some embodiments, the carbon fixation rate is at least 50%, 60%, 70%, 80%, 90%, or 100% higher than the control photosynthetic organism of the same species.

[0038] In some embodiments, the mutant photosynthetic organism exhibits an oxygen evolution rate per milligram of chlorophyll that is at least 100%, 150%, 200%, 300%, 400% or more greater than a control photosynthetic organism of the same species. In some embodiments, the mutant photosynthetic organism exhibits an oxygen evolution rate per gram of total organic carbon (TOC) that is at least 100%, 150%, 200%, 300%, 400% or more greater.

[0039] In some embodiments, the culture of the mutant photosynthetic organism exhibits greater lipid productivity than a culture of a control photosynthetic organism of the same species. In some embodiments, the mutant photosynthetic organism exhibits greater lipid productivity in photoautotrophic culture. In some embodiments, the mutant photosynthetic organism is algae.

[0040] In some embodiments, the mutant photosynthetic organism is generated by modulating the SGI2 gene of the organism. In some embodiments, the mutant photosynthetic organism is generated by modulating the cpSRP54 gene and the SGI1 or SGI2 gene of the organism. In some embodiments, modulating the gene comprises UV irradiation, gamma irradiation, or chemical mutagenesis. In some embodiments, modulating the gene comprises base substitution mutations, insertional mutagenesis, gene replacement, RNAi, antisense RNA, meganuclease genome engineering, one or more ribozymes, and / or CRISPR / Cas systems in the cpSRP54 gene, SGI1 gene, SGI2 gene, or a combination of such genes.

[0041] In some embodiments, prior to mutation or attenuation of the gene, the mutant photosynthetic organism comprises a cpSRP54 gene encoding a protein having an amino acid sequence that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95% identical to an amino acid sequence selected from the group consisting of SEQ ID NO:68, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, SEQ ID NO:80, SEQ ID NO:81, SEQ ID NO:82, SEQ ID NO:83, SEQ ID NO:84 or SEQ ID NO:85. In some embodiments, prior to mutation or attenuation of the gene, the mutant photosynthetic organism comprises a cpSRP54 gene encoding a protein having an amino acid sequence that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95% identical to at least 30, 35, 40, 45, 50, 60, 70, 80, 100, 150, 200, 250, 300 amino acids, or to the entire length of an amino acid sequence selected from the group consisting of SEQ ID NO: 68, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 84, or SEQ ID NO: 85.

[0042] In some embodiments, the mutant photosynthetic organism comprises a mutation in a cpSRP54 gene that occurs outside of the sequence encoding the first 169 amino acids of the cpSRP54 GTPase domain. In some embodiments, the mutation in the cpSRP54 gene encoding the SRP54 protein occurs outside of the sequence encoding the cpSRP54 GTPase domain. In some embodiments, the mutation in the cpSRP54 gene does not comprise a gene-disrupting mutation in the cpSRP54 GTPase domain.

[0043] In some embodiments, prior to mutation or attenuation of the gene, the SGI2 gene of the mutant photosynthetic organism encodes a protein having an amino acid sequence that is at least 50%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% identical to the amino acid sequence of SEQ ID NO:5, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, or SEQ ID NO:56. In some embodiments, prior to mutation or attenuation of the gene, the SGI2 gene of the mutant photosynthetic organism encodes a protein having an amino acid sequence that is identical to at least 30, 35, 40, 45, 50, 60, 70, 80, 100, 150, 200, 250, 300 amino acids or to SEQ ID NO: 5, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, or SEQ ID NO: 56. The amino acid sequence of NO:56 is at least 50%, 65%, 70%, 75%, 80%, 85%, 90%, 95% identical over its entire length.

[0044] In some embodiments, before the mutation or attenuation of the SGI1 gene, the SGI1 gene of the mutant photosynthetic organism encodes a protein having an amino acid sequence similar to SEQ ID NO:3, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, or SEQ ID NO:39. The amino acid sequence of NO:39 is at least 50%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% identical.In some embodiments, prior to mutation or attenuation of the SGI1 gene, the SGI1 gene of the mutant photosynthetic organism encodes a protein having an amino acid sequence that is identical to at least 30, 35, 40, 45, 50, 60, 70, 80, 100, 150, 200, 250, 300 amino acids or to SEQ ID NO: 3, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, At least 50%, 65%, 70%, 75%, 80%, 85%, 90%, 95% identical over the entire length of the amino acid sequence of SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38 or SEQ ID NO:39.

[0045] In some embodiments of the above aspects, the photosynthetic organism is polyploid, e.g., diploid, triploid, or tetraploid. In some embodiments, one or more copies of the gene: cpSRP54, SGI1, or SGI2 are mutated or attenuated, leaving the other copies of the gene unchanged or unattenuated, to generate a mutant photosynthetic organism. In some embodiments, the mutant photosynthetic organism is thereby generated, and relative to a control photosynthetic organism of the same species, the mutant photosynthetic organism exhibits a reduction in chlorophyll under low light conditions and a decrease in chlorophyll under light conditions above 100, 125, 150, 200, or 250 μE m -2 s -1 The maximum photochemical quantum yield (F) in photosystem II at all physiologically relevant irradiances v / F M ) is higher. In some embodiments, the mutant photosynthetic organism is thereby generated, and the mutant photosynthetic organism exhibits greater biomass productivity than a control photosynthetic organism of the same species. In some embodiments, the mutant photosynthetic organism is thereby generated, and the mutant photosynthetic organism exhibits greater lipid productivity than a control photosynthetic organism of the same species.

[0046] In some embodiments of the above aspects, the mutant photosynthetic organism is an alga. In some embodiments, the algae belongs to the genus: Achnanthes, Amphiprora, Amphora, Ankistrodesmus, Asteromonas, Boekelovia, Bolidomonas, Borodinella, Botrydium, Botryococcus, Bracteococcus, Chaetoceros, Cart eria), Chlamydomonas, Chlorococcum, Chlorogonium, Chlorella, Chroomonas, Chrysosphaera, Cricosphaera, Crypthecodinium, Cryptomonas, Cyclotella, Dunaliella, Ellipsoidon, Emiliania , Eremosphaera, Ernodesmius, Euglena, Eustigmatos, Franceia, Fragilaria, Gloeothamnion, Haematococcus, Halocafeteria, Heterosigma, Hymenomonas, Isochrysis, Lepocinclis, Mi cractinium), Monodus, Monoraphidium, Nannochloris, Nannochloropsis, Navicula, Neochloris, Nephrochloris, Nephroselmis, Nitzschia, Ochromonas, Oedogonium, Oocystis, Ostreococcus,Pavlova, Parachlorella, Pascheria, Pelagomonas, Phaeodactylum, Phagus, Picochlorum, Platymonas, Pleurochrysis, Pleurococcus, Prototheca, Pseudochlorella, Pseudoneochloris, Pseudochlorella Pseudostaurastrum, Pyramimonas, Pyrobotrys, Scenedesmus, Skeletonema, Spyrogyra, Stichococcus, Tetraselmis, Thalassiosira, Tribonema, Vaucheria, Viridiella, Vischeria, and Volvox. In some embodiments, the mutant photosynthetic organism is a member of the phylum Chlorophyceae or Charophyceae, and can be, for example, a member of any of the classes Chlorophyceae, Trebouxiophyceae, Chlorodendrophyceae, Ulvophyceae, Pedinophyceae, or Prasinophyceae. For example, the algae mutant can be a species belonging to Chlorophyceae, Trebouxiophyceae, or Prasinophyceae. In some embodiments, the mutant algae cell is a Chlorophyta algae cell, and can be a Chlorophyta algae cell of the class Coccophae, for example, an algae cell of a gene species such as Botrytis cinerea, Chlorella spp., Auxenochlorella spp., Heveochlorella spp., Marinichlorella spp., Pseudochlorella spp., Tetrachlorella spp., Unichlorella spp., Vogelia spp., Microchlorella spp., Microchlorella spp., Oocystis spp., Microchlorophyta spp., or Protothecoides spp. In some embodiments, the mutant algae can be a species belonging to: Auxenochlorella spp., Chlorella spp., Heveochlorella spp., Marinichlorella spp., Pseudochlorella spp., Tetrachlorella spp., Unichlorella spp., Vogelia spp., Microchlorophyta spp., Microchlorophyta spp., Oocystis spp., Microchlorophyta spp., or Protothecoides spp.

[0047] In some embodiments, the mutant photosynthetic microorganism is a cyanobacterium. In some embodiments, the cyanobacterium is a cyanobacterium, Agmenellum, Anabaena, Anatabula, Histocystis, Acanthocystis, Arthrospira, Glomerella, Boshiella, Eyebrow Algae, Tubulospora, Pseudo-green Glue Cyanobacteria, Pseudo-Achromococcus, Chrococcaceae, Hair Needle Algae, Cyanobacteria, Cyanobacteria, Blue Cysts, Spirillum, Blue Silk, Pseudo-cylindrical Algae, Cylindrocystis, Blue Fiber Algae, Small Peel Cyanobacteria, Lateral Algae, Fremyella, Cyanobacteria, Thread-shaped Cyanobacteria, Myxobacterium, Blue-green Algae, Stick Algae, Salt Spirulina, Morphology, Cladophora, Cladophora, Linderella, Cladophora, Microcystis, Myxocystis, Nodularia, Nostoc, Nodularia, Oscillatoria, Phormidium, Floura, Pachydermia, Prochlorococcus, Prochlorococcus, Prochlorophyta, Pseudoanabaena, Gelatophyta, Schizothorax, Pseudobranchia, Spirulina, Stanielia, Starrella, Truebranchia, Combinatorial algae, Synechococcus, Synechocystis, thermosynechocystis, Monophyll, Combinatorial algae, Trichocystis, Echinococcus, or Heterococcus species.

[0048] In certain embodiments, the mutant photosynthetic microorganism is a plant. Non-limiting examples of plants include monocots and dicots, such as crops including cereals (e.g., wheat, corn, rice, millet, barley), fruit crops (e.g., tomatoes, apples, pears, strawberries, oranges), feed crops (e.g., alfalfa), root vegetable crops (e.g., carrots, potatoes, beets, yams), leafy vegetable crops (e.g., lettuce, spinach); flowering plants (e.g., petunias, rose chrysanthemums), conifers and pine trees (e.g., pine fir, spruce), plants for phytoremediation (e.g., plants that accumulate heavy metals); oil crops (e.g., sunflowers, rapeseed) and plants for experimental purposes (e.g., Arabidopsis thaliana).

[0049] Non-limiting examples of mutant dicots include plants belonging to the following orders: Magnoliales, Miciales, Cinnamales, Piperales, Aristolochiales, Nymphaeales, Ranunculales, Papaverales, Sarraceniaceae, Quinceales, Hamamelisales, Eucommiales, Letonales, Myricariales, Fagales, Casuarinales, Dianthusales, Tadpoles, Polygonales, Cyanocoleales, Pentacarales, Camelliales, Malvaceaes, Urticales, Barringolles, Corydalis, Salicales, Glechomales, Heatherales, Pyriculariales, Dioscoreales, Primulales, Rosales, Beansales, Caraganales, Myrtales, Cornales, Proteales, San tales, Rhamnusales, Euonymusales, Euphorbiales, Rhamnusales, Sapindales, Juglansales, Geraniales, Polygalales, Apiaceaeales, Gentianales, Pothosales, Lamiales, Plantaginales, Scrophulariaces, Campanulales, Rubiaces, Chuanluodiales and Asterales.

[0050] Non-limiting examples of mutant monocots include plants belonging to the orders Alismatales, Hydrocharitales, Echinopsales, Mycophylles, Commelinales, Echinopsales, Juncoales, Poaceae, Juncoales, Cyperaceae, Typhaales, Bromelales, Zingiberales, Arecales, Cyperales, Pandanales, Araceae, Liliales, and Orchidales, or plants belonging to gymnosperms, for example, those belonging to the orders Pinales, Ginkgoales, Cycadales, Araucariales, Cupressales, and Ephedales.

[0051] In some embodiments, the mutant plant can be Arabidopsis arenicola, Arabidopsis arenosa, Arabidopsis cebennensis, Arabidopsis croatica, Arabidopsis halleri, Arabidopsis lyrata, Arabidopsis neglecta, Arabidopsis pedemontana, Arabidopsis suecica, Arabidopsis thaliana, Zea mays, Oryza sativa, Triticum aestivum, Solanum tuberosum, Allium cepa, Allium sativum, Glycine max, Solanum lycopersicum, Gossypium hirsutum, Gossypium herbaceum, Gossypium arboreum, Gossypium truncatum, or tomentosum), Brassica nigra, or Brassica sp.

[0052] In some embodiments, regulation of SRP54, SGI1, SGI2, or a combination of one or more genes in a plant can be tissue-specific. In some embodiments, the plant tissue can be a leaf, stem, or root. In some embodiments, regulation of tissue-specific genes can be achieved by regulating tissue-specific non-coding regions of the gene, such as promoters, enhancers, introns, 3'- or 5'-untranslated regions. In some embodiments, regulation of SRP54, SGI1, SGI2, or a combination of one or more genes in a plant can be performed at different developmental stages of the plant.

[0053] These and other objects and features of the present invention will become more fully apparent when the following detailed description of the invention is read in conjunction with the accompanying drawings. BRIEF DESCRIPTION OF THE DRAWINGS

[0054] Figure 1 A-1B. Figure 1 A shows a schematic diagram of the SGI1 gene. The putative positions of the gRNAs designed to disrupt the SGI1 gene (CRISPR target) are indicated. Figure 1 B shows a schematic diagram of the SPR54 gene. The putative positions of the gRNAs designed to disrupt the SPR54 gene (CRISPR target) are indicated.

[0055] Figure 2 A-2C. Figure 2 A shows a schematic diagram of the SGI1 gene. The putative positions of the gRNAs designed to disrupt the SGI1 gene (CRISPR target) are indicated. Figure 2 B shows a schematic diagram of the SGI1 protein. Figure 2 C shows a schematic diagram of the SPR54 gene. The putative positions of the gRNAs designed to disrupt the SPR54 gene (CRISPR target) are indicated.

[0056] Figure 3 . Figure 3 An exemplary domain architecture analysis of the Parachorella sp. SGI2 protein is shown.

[0057] Figure 4 . Figure 4 An exemplary domain architecture analysis of the Oocystis sp. SGI2 protein is shown.

[0058] Figure 5 . Figure 5 An exemplary domain architecture analysis of the Tetraselmis sp. SGI2 protein is shown.

[0059] Figure 6 . Figure 6 An exemplary domain architecture analysis of the Arabidopsis thaliana SGI2 protein is shown.

[0060] Figure 7 . Figure 7 An exemplary domain architecture analysis of the Arabidopsis SGI2 protein is shown.

[0061] Figure 8 . Figure 8 An exemplary domain architecture analysis of the Arabidopsis SGI2 protein is shown.

[0062] Figure 9 . Figure 9 An exemplary domain architecture analysis of the Arabidopsis SGI2 protein is shown.

[0063] Figure 10 A-10B. Figure 10 A shows a schematic diagram of the DNA cassette containing the codon-optimized Cre gene flanked by the nitrite reductase promoter and terminator. Figure 10 B shows a schematic diagram of the DNA cassette including bleR and GFP sequences.

[0064] Figure 11 . Figure 11 Shown are the results of productivity assays of a Pseudochlorella wild-type strain, an SRP54 knockout strain, an SGI2 knockout strain, and a double knockout strain of SGI2 and SRP54.

[0065] Figure 12 A-12B. Figure 12 A shows the results of semi-continuous area TOC productivity assays of the Pseudochlorella wild-type strain (STR00010), SRP54 knockout mutant (STR00625), SGI1 knockout mutant (STR24183), and SGI1 / SRP54 double knockout mutants (STR24538 and STR24550). Figure 12 B shows the results of batch TOC productivity assays of Pseudochlorella wild-type strain (STR00010), SRP54 knockout mutant (STR00625), SGI1 knockout mutant (STR24183), and SGI1 / SRP54 double knockout mutants (STR24538 and STR24550).

[0066] Figure 13 A-13B. Figure 13 A shows the results of the semi-continuous area TOC productivity assay of the indicated Chlorella wild-type strain (STR00010), SRP54 knockout mutant (STR00625), SGI1 knockout mutant (STR00012), SGI2 / SRP54 double knockout mutant (STR25761), and SGI1 / SGI2 / SRP54 triple knockout mutants (STR25761 and STR25762). Figure 13 B shows the results of the assay indicating the batch TOC productivity of the Pseudomonas sp. wild-type strain (STR00010), SRP54 knockout mutant (STR00625), SGI1 knockout mutant (STR00012), SGI2 / SRP54 double knockout mutant (STR25761), and SGI1 / SGI2 / SRP54 triple knockout mutants (STR25761 and STR25762).

[0067] Figure 14 . Figure 14 Shown are the results of batch FAME productivity assays of Pseudochlorella wild-type strain (STR00010), SRP54 knockout mutant (STR00625), SGI1 knockout mutant (STR24183), SGI1 / SRP54 double knockout mutants (STR24538 and STR24540).

[0068] Figure 15 . Figure 15 Shown are the results of batch FAME productivity assays of Pseudochlorella wild-type strain (STR00010), SGI1 knockout mutant (STR00012), SGI2 / SRP54 double knockout mutant (STR00516), and SGI1 / SGI2 / SRP54 triple knockout mutants (STR25761 and STR25762).

[0069] Figure 16 A-16B. Figure 16 A shows a schematic diagram of the selection cassette used to knock out Pseudochlorella SPR54. Figure 16 B shows a schematic diagram of the selection cassette used to knock out Pseudochlorella SGI2.

[0070] Figure 17 . Figure 17 A schematic diagram of the recombinant pCC1BAC vector including Cas9, GFP, BleR, Cre gene, and lox sites is shown. DETAILED DESCRIPTION

[0071] The inventors of the present application surprisingly and unexpectedly discovered that modulation of the SGI1 and SGI2 genes in photosynthetic organisms results in a reduction of chlorophyll under low light conditions and a decrease in the maximum photochemical quantum yield (F) in photosystem II at all physiologically relevant irradiances. v / F M) is higher. In some embodiments, mutant photosynthetic organisms comprising a mutated or weakened SGI1 or SGI2 gene exhibit low non-photochemical quenching (NPQ) at all physiologically relevant irradiances. In some embodiments, mutant photosynthetic organisms comprising a mutated or weakened SGI1 or SGI2 gene exhibit increased biomass compared to a control photosynthetic organism of the same species. In some embodiments, mutant photosynthetic organisms comprising a mutated or weakened SGI1 or SGI2 gene exhibit higher carbon fixation rates on a per chlorophyll basis. In some embodiments, mutant photosynthetic organisms comprising a mutated or weakened SGI1 or SGI2 gene exhibit higher carbon fixation rates on a per TOC basis compared to a control photosynthetic organism of the same species. In some embodiments, mutant photosynthetic organisms comprising a mutated or weakened SGI1 or SGI2 gene exhibit higher oxygen evolution rates per mg chlorophyll compared to a control photosynthetic organism of the same species. In some embodiments, mutant photosynthetic organisms comprising a mutated or weakened SGI1 or SGI2 gene exhibit higher oxygen evolution rates on a per TOC basis compared to a control photosynthetic organism of the same species. In some embodiments, mutant photosynthetic organisms comprising a mutated or attenuated SGI1 or SGI2 gene exhibit higher lipid productivity than control photosynthetic organisms of the same species. In some embodiments, mutant photosynthetic organisms comprising a mutated or attenuated SGI1 or SGI2 gene exhibit greater lipid productivity in photoautotrophic culture.

[0072] The inventors of the present application have also surprisingly discovered a synergistic effect of regulating the SGI1 or SGI2 gene and regulating the SRP54 gene in photosynthetic organisms. In some embodiments, mutant photosynthetic organisms that regulate both SRP54 and SGI1 or SGI2 genes exhibit further chlorophyll reduction, greater biomass increase, higher carbon fixation per chlorophyll, higher carbon fixation per TOC, and higher lipid productivity compared to mutant photosynthetic organisms that regulate only the SGI1 or SGI2 gene.

[0073] SGI1 gene

[0074] As described herein, the significant growth improvement gene 1 (SGI1) polypeptide is a polypeptide comprising two domains: a response reception or "RR" domain (Pfam PF00072) and a Myb domain (Pfam PF00249), wherein the RR domain is located N-terminal to the Myb domain. The RR domain and the Myb domain are separated by an amino acid sequence that is poorly conserved or not conserved among SGI1 polypeptides, sometimes referred to herein as a linker between the two domains, wherein the linker can range in length from, for example, one to 300 amino acids, or from ten to 200 amino acids. The linker region can optionally comprise a nuclear localization sequence (NLS).

[0075] The presence of a response-receiving "RR" domain (Pfam PF00072) is responsible for its bioinformatic annotation as a CheY-like polypeptide. The RR domain extends from approximately amino acid 36 to amino acid 148 of the Pseudochlorella SGI1 polypeptide (SEQ ID NO: 3) and is also characterized in the Conserved Domain Database (CDD) as a "signal-receiving domain," cd00156, extending from approximately amino acid 37 to amino acid 154. The RR domain is also characterized in the Protein Orthologous Clusters database as a "CheY-like Receiving (REC) domain," COG0784, and as an Interpro "CheY-like superfamily" domain, IPR011006, both of which extend from approximately amino acid 33 to approximately amino acid 161 of the Pseudochlorella SGI1 polypeptide of SEQ ID NO: 3. The RR domain is found in bacterial two-component regulatory systems, such as the bacterial chemotaxis two-component system comprising a polypeptide called CheY, where it receives a signal from a sensor partner. The RR domain of such systems is typically found N-terminal to the DNA binding domain and contains a phospho-acceptor site that can be phosphorylated, potentially responsible for their activation or deactivation.

[0076] The RR domain within the SGI1 protein can be characterized, for example, as Pfam PF00072, or as a "signal receiving domain" or simply "receiving domain," and / or can be classified as cd00156 in the Conserved Domain Database (CDD), COG0784 in the Protein Orthologous Cluster Database, or IPR011006 as an Interpro "CheY-like superfamily" domain. RR domains are found in bacterial two-component regulatory systems, such as the bacterial chemotaxis two-component system containing a polypeptide called CheY, where they receive signals from sensor partners. The RR domains of such systems are typically found N-terminal to the DNA binding domain and contain a phosphoacceptor site that can be phosphorylated, potentially responsible for their activation or deactivation.

[0077] The myb domain within the SGI1 protein can be characterized, for example, as pfamPF00249: "Myb-like DNA binding domain", and / or can be identified as the conserved domain TIGR01557 "myb-like DNA binding domain, SHAQKYF class ("SHAQKYF" disclosed as SEQ ID NO: 102)", or as an Interpro homeobox-like domain superfamily domain (IPR009057) and / or an Interpro Myb domain (IPR017930).

[0078] In addition to having an RR domain at the N-terminus of the myb domain, when scanned using a hidden Markov model (HMM) designed to score proteins based on the degree of conserved amino acid match between a query protein amino acid sequence and a region of SGI1 homologs in algae, the SGI1 proteins provided herein can have a score of 300 or greater, 320 or greater, 340 or greater, 350 or greater, 360 or greater, or 370 or greater, wherein highly conserved amino acid positions within the compared regions of the polypeptide are weighted more heavily than poorly conserved amino acid positions to arrive at the score.When the protein sequence of the algal SGI1 polypeptide comprising a single continuous sequence including the developed RR domain, linker and myb domain is scanned with the HMM model, polypeptides having a score of 350 or higher, such as 370 or higher, include, but are not limited to, polypeptides of algal and plant species, Pseudochlorella 1185 (SEQ ID NO: 3), Coccomycetes (SEQ ID NO: 9), Oysterocoele (SEQ ID NO: 10), Chlamydomonas reinhardtii (SEQ ID NO: 11), Volvox carterii (SEQ ID NO: 13), Tetraselmis 105 (SEQ ID NOs: 14, 15 and 16), Oocystis (SEQ ID NO: 17), Micromonas RCC299 (SEQ ID NO: 18), Micromonas pusillus (SEQ ID NO: 19), Pseudosphagnum (SEQ ID NO: 20), Physcomitrella patens (SEQ ID NO: 21), Arabidopsis thaliana (SEQ ID NO: 22), Arabidopsis thaliana (SEQ ID NO: 23), and A. NO: 23), Arabidopsis thaliana (SEQ ID NO: 24), Helianthus annuus (SEQ ID NO: 25), Vitis vinifera (SEQ ID NO: 26), Cinnamomum camphora (SEQ ID NO: 27), Ricinus communis (SEQ ID NO: 28), Tomato (SEQ ID NO: 29), Solanum tuberosum (SEQ ID NO: 30), Gossypium hirsutum (SEQ ID NO: 31), Theobroma cacao (SEQ ID NO: 32), Phaeoli vulgaris (SEQ ID NO: 33), Glycine max (SEQ ID NO: 34), Quinoa quinoa (SEQ ID NO: 35), Apple (Domestica) (SEQ ID NO: 36), Zea mays (SEQ ID NO: 37), Brassica rapa (SEQ ID NO: 38), and Oryza sativa (SEQ ID NO: 39). ID NO: 39) and polypeptides having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to any of the foregoing, wherein the polypeptide has an RR domain and a myb domain, and the RR domain is N-terminal to the myb domain. In various embodiments, the SGI1 polypeptide is from a plant or algal species. The gene encoding the SGI1 polypeptide as provided herein, e.g., a gene that is disrupted or whose expression is attenuated in a mutant as provided herein, can be a naturally occurring gene of a plant or algal species that encodes a polypeptide as disclosed herein in various embodiments.

[0079] In some embodiments, the SGI1 polypeptides disclosed herein are algal SGI1 polypeptides, e.g., having the sequence of a naturally occurring algal SGI1 polypeptide, wherein the algal polypeptide comprises an RR domain and a myb domain, and the RR domain is N-terminal to the myb domain. The algal polypeptide may optionally be at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any algal SGI1 polypeptide disclosed herein. In some embodiments, the SGI1 gene may be a gene encoding an algal SGI1 polypeptide, e.g., a polypeptide having the sequence of a naturally occurring algal SGI1 polypeptide. The SGI1 gene encoding a polypeptide having the sequence of a naturally occurring algal SGI1 polypeptide may be a gene having the sequence of a naturally occurring gene encoding the gene coding sequence, or may have a sequence that is different from the sequence of a naturally occurring gene. In various embodiments, as disclosed herein, the SGI1 gene that is attenuated, mutated, or disrupted in a mutant photosynthetic organism can be a gene identified by BLAST, for example, using the sequences disclosed herein and / or by HMM scanning, wherein the HMM is based on a contiguous amino acid sequence, for example, obtained by comparing at least six SGI polypeptides, wherein the contiguous amino acid sequence comprises an RR domain and a myb domain, wherein the RR domain is N-terminal to the myb domain, and wherein there is a linker sequence between the RR and myb domains that does not belong to either domain.

[0080] In some embodiments, the SGI polypeptide has the sequence of an algal SGI1 polypeptide or is a variant of a naturally occurring algal SGI1 polypeptide that is at least 85%, at least 90%, or at least 95% identical to a naturally occurring algal SGI1 polypeptide, and / or is at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any of SEQ ID NO:3, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, or SEQ ID NO:19.

[0081] In some embodiments, the SGI polypeptide has the sequence of a plant SGI1 polypeptide or is a variant of a naturally occurring plant SGI1 polypeptide that is at least 85%, at least 90%, or at least 95% identical to a naturally occurring algal SGI polypeptide and / or has the sequence of SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, or SEQ ID NO:39. Any of NO:39 has at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity.

[0082] The Pseudochlorella SGI1 gene sequence, provided as SEQ ID NO: 1, was found to encode a polypeptide (SEQ ID NO: 3) comprising two major functional domains, both present in the N-terminal half of the 619 amino acid protein. An exemplary Pseudochlorella SGI1 cDNA sequence is provided as SEQ ID NO: 2.

[0083] No conserved protein domains are found in the region C-terminal to the myb domain of the SGI1 polypeptide, i.e., in the (approximately) C-terminal half of the protein. On the other hand, RR domains and Myb domains (with the myb domain located C-terminally to the RR domain) are found in many proteins encoded in the genomes of Viridiplantae (green plants, including algae). Bioinformatics analysis was used to identify potential orthologs of SGI1 in additional plant and algal species.

[0084] To identify a class of SGI1 proteins from additional photosynthetic organisms, a hidden Markov model (HMM) was constructed to discover the RR domain and myb domain architecture in Pseudochlorella SGI1. As a first step, the Pseudochlorella SGI1 polypeptide sequence (SEQ ID NO: 3) was used to BLAST search the JGI Phytozome database v.12, which contains plant and algal genomes. Four proprietary algal genomes (from Pseudochlorella, Arabidopsis, Tetraselmis, and Oocystis) were also added to the searched database. The search was terminated when approximately 2,000 hits were found. These results were then analyzed by InterProScan (available from EMBL-EBI (European Molecular Biology Laboratory-European Bioinformatics Institute, e.g., at ebi.ac.uk) to ensure that the selected hits had both an Interpro CheY-like superfamily domain (IPR011006) and an Interpro Homeobox-like or Myb domain (IPR009057 or IPR017930). This step reduced the number of selected hits to between 900 and 1,000, with polypeptides clearly identifying a two-domain architecture (RR domain N-terminal-myb domain) in both algae and higher plant polypeptides. The resulting sequences were used to assemble a phylogenetic tree based on sequence homology. The phylogenetic tree showed clear grouping of related polypeptides from algal species, including SGI1 homologs from Pseudochlorella, Tetraselmis, Oocystis, Chlamydomonas, Volvox, Oystercopeia, Microcystis, and Coccomycetes.

[0085] Table: SGI1 orthologs in algal species

[0086] biology Peptide sequence HMM score Pseudochlorella 1185 SEQ ID NO:3 400.20 Coccomannan SEQ ID NO:9 403.0 Marine Bioluminescent Oyster Algae SEQ ID NO: 10 425.8 Chlamydomonas reinhardtii SEQ ID NO:11 413.3 Zofia SEQ ID NO:12 292.6 Volvox carterii SEQ ID NO:13 441.4 Tetraselmis 105 SEQ ID NO:14 403.6 Tetraselmis 105 SEQ ID NO:15 403.0 Tetraselmis 105 SEQ ID NO:16 402.9 Oocystis SEQ ID NO: 17 426.9 Microcystis RC299 SEQ ID NO: 18 418.4 Microcystis SEQ ID NO: 19 405.9

[0087] To establish criteria for possible SGI1 orthologs in other photosynthetic organisms, a hidden Markov model (HMM) was then developed based on the algal cluster of SGI1 polypeptide sequences. The HMM was developed based on the N-terminal portion of the SGI1 polypeptide, which encompasses both the RR and myb domains, including the linker region between the two conserved domains. Sequences at the C-terminus of the polypeptide that did not contain any identifiable conserved structure of the myb domain were excluded from model construction. HMMER 3.1b2 was used to construct the HMM using multiple sequence alignments (MSAs) from the following: proprietary sequences of polypeptides from the genera Pseudochlorella, Oocystis, and Tetraselmis, as well as sequences from public databases of polypeptides from Chlamydomonas reinhardtii, Volvox carterii, Chromium zofus, Coccomyces gloeosporioides, Microcystis RCC299, and Oystercosphaera maritima. The ETE3 toolkit and the eggnog41 workflow were used to generate the multiple sequence alignments (MSAs) of the N-terminal halves of the proteins. This program internally uses the programs Muscle, MAFFT, and ClustalΩ, as well as M-coffee for alignment, trimAI for alignment trimming, and PhyML for phylogenetic perturbations. Unlike a single protein sequence used for homology comparisons, HMMs, for example, capture information from multiple protein sequences and are therefore able to distinguish between highly conserved and highly divergent residues, taking this into account when determining sequence relatedness. When an HMM is used to score sequences, highly conserved residues receive more weight than highly divergent residues, thereby providing superior sensitivity and accuracy compared to simpler PSAs.

[0088] SGI1 HHM was used to assign scores to polypeptides identified in BLAST searches that were also verified to have two conserved domains (RR and myb). In bioinformatics searches, the highest scores found in almost all algal species and single plant polypeptides allowed the identification of proteins of interest in other algal species (Table 1). These represent possible orthologs whose genes could be attenuated or knocked out to provide high-productivity mutants in other organisms.

[0089] Table 2: SGI1 orthologs in plant species

[0090] biology Peptide sequence HMM score Pseudosphagnum moss SEQ ID NO:20 397.3 Physcomitrella patens SEQ ID NO:21 372.3 Arabidopsis thaliana SEQ ID NO:22 371.1 Arabidopsis thaliana SEQ ID NO:23 475.9 Arabidopsis lyrata SEQ ID NO:24 395.5 sunflower SEQ ID NO:25 391.2 Grape SEQ ID NO:26 390.6 Oil-free camphor SEQ ID NO:27 390.1 castor SEQ ID NO:28 390.1 tomato SEQ ID NO:29 388.4 potato SEQ ID NO:30 387.2 Upland cotton SEQ ID NO:31 385.8 cocoa SEQ ID NO:32 383.0 kidney bean SEQ ID NO:33 381.6 soybeans SEQ ID NO:34 381.4 quinoa SEQ ID NO:35 373.7 apple SEQ ID NO:36 372.6 corn SEQ ID NO:37 371.5 turnip SEQ ID NO:38 370.5 rice SEQ ID NO:39 369.6

[0091] Figure 1 A shows a schematic diagram of the SGI1 gene.

[0092] In some embodiments, modulation of the SGI1 gene, such as mutation, attenuation, or knockout of the SGI1 gene in an algal species, for example, increases the maximum photochemical quantum yield (F) in photosystem II. v / F M) (approximately 10%-14%), while exhibiting reduced antennal size (i.e., functional absorption cross-section) compared to the wild-type strain from which it was derived.

[0093] In some embodiments, modulation of the SGI1 gene may also result in reduced antenna size (i.e., functional absorption cross section) of photosystem II (PSII) and photosystem I (PSI) (down 40%-50% relative to wild type), high electron transfer rate on the acceptor side of PSII (1 / τ'Qa) under saturating light (increased by about 35% to about 130%, and at least about 100% relative to wild type in these engineered mutants), and high carbon fixation rate (Pmax) (up to at least 30%-40% relative to wild type), while maintaining the number of photosystems on a per TOC basis, as determined by multiple reaction monitoring protein assays.

[0094] SGI2 gene

[0095] The inventors of the present application have identified significant growth improvement gene 2 (SGI2) as an ortholog present in photosynthetic organisms (e.g., algae), a class of plants regulating genes known as two-component systems (TCSs) because they are known to regulate important cellular processes, including bacterial cell cycle progression and development (Skerker et al., 2015; "Two-component signal transduction pathways regulating growth and cell cycle progression in abacterium: a system-level analysis," PLoS Biology. 3(10):e334), nitrogen sensing (Sanders et al., 1992; "Phosphorylation site of NtrC, a protein phosphatase whose covalent intermediate activates transcription," Journal of Bacteriology. Bacteriology 174(15):5117-22) and bacterial chemotaxis (Sanders et al., 1989; "Identification of the site of phosphorylation of the chemotaxis response regulator protein, CheY"; The Journal of Biological Chemistry 264(36):21770-8). In bacteria, these proteins typically consist of a histidine kinase that detects specific environmental stimuli and a corresponding response regulatory domain (PF00072) that mediates cellular responses, primarily through differential expression of target genes. However, in photosynthetic organisms, the SGI2 gene includes the corresponding response regulatory domain (PF00072) and lacks the other domain of the two-component system.

[0096] Figure 2 A schematic diagram of the SGI1 gene is shown, and Figure 2 A schematic diagram of the corresponding protein is shown in B.

[0097] An exemplary Pseudochlorella sp. SGI2 gene sequence was found, provided as SEQ ID NO:4, which encodes a polypeptide (SEQ ID NO:5) that includes a response regulatory domain (SEQ ID NO:6).

[0098] Exemplary orthologous polypeptide sequences in various photosynthetic organisms are shown in Table 3 below.

[0099] Table 3: Orthologous SGI2 sequences in various photosynthetic organisms

[0100] photosynthetic organisms Peptide sequence Oocystis SEQ ID NO:40 Tetraselmis SEQ ID NO:41 Arabidopsis thaliana SEQ ID NO:42 Arabidopsis thaliana SEQ ID NO:43 Arabidopsis thaliana SEQ ID NO:44 Arabidopsis thaliana SEQ ID NO:45 Arabidopsis thaliana SEQ ID NO:46 soybeans SEQ ID NO:47 Grape SEQ ID NO:48 cocoa SEQ ID NO:49 rice SEQ ID NO:50 corn SEQ ID NO:51 Physcomitrella patens SEQ ID NO:52 Volvox carterii SEQ ID NO:53 Chlamydomonas reinhardtii SEQ ID NO:54 Chlorella vulgaris SEQ ID NO:55 Coccomannan C-169 SEQ ID NO:56

[0101] An exemplary Pseudochlorella sp. SGI2 cDNA sequence is provided as SEQ ID NO: 7. Orthologous cDNA sequences of SGI2 genes in other photosynthetic organisms are shown in Table 4 below.

[0102] Table 4: Orthologous cDNA sequences of SGI2 genes in other photosynthetic organisms

[0103] photosynthetic organisms cDNA sequences Oocystis SEQ ID NO:57 Tetraselmis SEQ ID NO:58 soybeans SEQ ID NO:59 Grape SEQ ID NO:60 cocoa SEQ ID NO:61 rice SEQ ID NO:62 corn SEQ ID NO:63 Physcomitrella patens SEQ ID NO:64 Volvox carterii SEQ ID NO:65 Chlamydomonas reinhardtii SEQ ID NO:66 Coccomannan SEQ ID NO:67

[0104] In some embodiments, the SGI2 polypeptide of a photosynthetic organism comprises an amino acid sequence that is at least 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% identical to SEQ ID NO: 6. In some embodiments, the SGI2 polypeptide of a photosynthetic organism comprises an amino acid sequence that is at least 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% identical to at least 100, 150, 200, 250 amino acids, or the full length of SEQ ID NO: 5, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, or 56.

[0105] In some embodiments, the photosynthetic organism comprises a polynucleotide encoding an SGI2 polypeptide, wherein the nucleic acid sequence of the polynucleotide is at least 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% identical to at least 100, 150, 200, 250 nucleotides or the full length of SEQ ID NO:4, 7, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, or 67.

[0106] In some embodiments, modulation of the SGI2 gene, such as mutation, attenuation, or knockout of the SGI2 gene in a photosynthetic organism (e.g., an algal species), increases the maximum photochemical quantum yield (F) in photosystem II.v / F M )(about 10%-14%), reduced chlorophyll / total organic carbon (TOC), increased biomass.

[0107] SPR54 gene

[0108] Regulation of the SPR54 gene has been described in U.S. Patent Application Publication No. 2016 / 0304896, which is incorporated herein by reference in its entirety. An exemplary Pseudochlorella chloroplast SRP54 (cpSRP54) cDNA sequence is provided as SEQ ID NO: 8, which encodes a polypeptide having SEQ ID NO: 68.

[0109] Other non-limiting exemplary cpSRP54 orthologous polypeptides include GenBank Accession Nos. EDP00260 for Chlamydomonas reinhardtii (SEQ ID NO: 75); EEH59526 for Micromonas pusillus (SEQ ID NO: 76); EEH59526 for Micromonas sp. (SEQ ID NO: 77); ACB42577 for Paulinella chromatophora (SEQ ID NO: 78); ABO94038 for Oystercophora luminescens (SEQ ID NO: 79); Q01H03 for Oystercophora tauricum (SEQ ID NO: 80); EFJ41797 for Volvox carterii (SEQ ID NO: 81); EEC48599 for Phaeodactylum tricornutum (SEQ ID NO: 82); EED94755 for Thalassiosira pseudonana (SEQ ID NO: 83). pseudonana) (SEQ ID NO: 83); EGB12501, for Aureococcus anophagefferens (SEQ ID NO: 84); CBN76263, for Ectocarpus siliculosus (SEQ ID NO: 85).

[0110] In some embodiments, the cpSRP54 gene of a photosynthetic organism encodes a polypeptide having at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, or at least 85%, at least 90%, or at least 95% sequence identity to the cpSRP54 disclosed above.

[0111] Regulation of a combination of SGI2, SGI1 and SRP54, a combination of SGI2 and SRP54 genes, or a combination of SGI1, SGI2 and SRP54 genes in photosynthetic organisms

[0112] Mutant photosynthetic organisms can be produced by regulating a combination of SGI2, SGI1, and SRP54, a combination of SGI2 and SRP54, or a combination of SGI1, SGI2, and SRP54. The SGI1, SGI2, and SRP54 genes can be regulated through UV mutagenesis, gamma irradiation, or genetic engineering techniques. Gene sequences can be altered, partially or completely deleted, and gene expression can be modified.

[0113] In some embodiments, the SGI1, SGI2, and / or SRP54 genes can be operably linked to algal promoter and terminator sequences as described in U.S. Application Publication No. 2017 / 0058303, which is herein incorporated by reference in its entirety.

[0114] In some embodiments, the mutant photosynthetic organism (e.g., plant, algae) has at least a 20% reduction, at least a 30% reduction, at least a 40% reduction, at least a 50% reduction, at least a 55% reduction, at least a 60% reduction, at least a 65% reduction, or at least a 70% reduction in total chlorophyll relative to a control cell, optionally further, wherein the mutant has at least an increased ratio of chlorophyll a to chlorophyll b relative to a control cell, further optionally, wherein the ratio of chlorophyll a to chlorophyll b is at least about 2.8:1, at least about 3:1, at least about 3.2:1, about 3.3:1, at least about 3.5:1, at least about 3.7:1, at least about 3.9:1, at least about 4:1, or at least about 4.3:1.

[0115] In some embodiments, the mutant photosynthetic organism (eg, plant or algae) exhibits: (a) between about 100 and about 2800 μmol photons m -2 sec -1 , between about 150 and about 2800 μmol photons m -2 sec -1 , between about 75 and about 2800 μmol photons m -2 sec -1 , between about 40 and about 2800 μmol photons m -2 sec -1 or between about 10 and about 2800 μmol photons m -2 sec -1 Higher qP relative to control photosynthetic organisms of the same species at all irradiances between;

[0116] (b) Between about 100 and about 2800 μmol photons m -2 sec -1 , between about 150 and about 2800 μmol photons m -2 sec-1 , between about 75 and about 2800 μmol photons m -2 sec -1 , between about 40 and about 2800 μmol photons m -2 sec -1 or between about 10 and about 2800 μmol photons m -2 sec -1 Lower NPQ relative to the control algae at all irradiances between;

[0117] (c) Between about 100 and about 2800 μmol photons m -2 sec -1 , between about 150 and about 2800 μmol photons m -2 sec -1 , between about 75 and about 2800 μmol photons m -2 sec -1 , between about 40 and about 2800 μmol photons m -2 sec -1 or between about 10 and about 2800 μmol photons m -2 sec -1 Higher Y(II) relative to photosynthetic organisms (e.g., algae) at all irradiances in between;

[0118] (d) between about 100 and about 2800 μmol photons m -2 sec -1 , between about 150 and about 2800 μmol photons m -2 sec -1 , between about 75 and about 2800 μmol photons m -2 sec -1 , between about 40 and about 2800 μmol photons m -2 sec -1 , or between about 10 and about 2800 μmol photons m -2 sec -1 Compared with the control algae, the higher F v / F M ;

[0119] (e) between about 250 and about 2800 μmol photons m -2 sec -1 , between about 150 and about 2800 μmol photons m -2 sec -1 , between about 75 and about 2800 μmol photons m -2 sec -1 , between about 40 and about 2800 μmol photons m -2sec -1 or between about 10 and about 2800 μmol photons m -2 sec -1 between, higher ESR(II) relative to control algae;

[0120] (f) oxygen evolution on a per chlorophyll basis is increased by at least 50%, at least 100%, at least 200%, at least 300%, at least 350%, or at least 400% relative to control algae; and

[0121] (g) carbon fixation on a per chlorophyll basis is increased by at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 100% relative to a control photosynthetic organism of the same species.

[0122] In some embodiments, the mutant photosynthetic organism exhibits a biomass productivity that is at least 5%, at least 6%, at least 8%, or at least 10%, at least 15%, at least 25%, or at least 30% greater than control algae cultured under the same conditions.

[0123] In some embodiments, the mutant photosynthetic organism (e.g., plant, algae) exhibits greater productivity relative to control algae in a diurnal cycling culture with variable light intensity simulating natural daylight, optionally wherein the light intensity peaks between about 1900 and about 2000 μmol photons m -2 sec -1 between.

[0124] In some embodiments, the mutant photosynthetic organism (e.g., plant or algae) has greater lipid productivity, e.g., at least 5%, at least 10%, at least 15%, at least 20%, or at least 25% greater lipid productivity relative to a control photosynthetic organism of the same species that does not have the altered or attenuated gene(s).

[0125] definition

[0126] Unless otherwise defined, the meaning of all technical terms and scientific terms used herein is the same as that generally understood by those of ordinary skill in the art to which the present invention belongs. In the event of a conflict, the present application (including definitions) shall prevail. Unless the context otherwise requires, singular terms should include plural meanings, and plural terms should include singular meanings. All disclosures, patents and other references cited herein are incorporated herein by reference in their entirety for all purposes, as if each individual disclosure or patent application is specifically and individually indicated to be incorporated by reference.

[0127] As used in the disclosure and claims, the singular forms "a," "an," and "the" are intended to include the plural forms as well, unless the context clearly indicates otherwise.

[0128] All ranges provided within this application include the upper and lower values ​​of the stated ranges.

[0129] As used herein, the term "and / or" as used in phrases such as "A and / or B" is intended to include "A and B", "A or B", "A" and "B".

[0130] The term "gene" is broadly used to refer to any segment of a nucleic acid molecule (typically DNA, but optionally RNA) that encodes a polypeptide or expressed RNA. Thus, a gene comprises a sequence that encodes an expressed RNA (which may comprise a polypeptide coding sequence or, for example, a functional RNA such as ribosomal RNA, tRNA, antisense RNA, microRNA, short hairpin RNA, ribozyme, etc.). A gene may further include regulatory sequences required for or affecting its expression, as well as sequences related to the protein or RNA coding sequence in its native state, such as intron sequences, 5' or 3' non-translated sequences, etc. In some instances, a "gene" may refer only to the protein-coding portion of a DNA or RNA molecule, which may or may not contain introns. The length of the gene is preferably greater than 50 nucleotides, more preferably greater than 100 nucleotides, and the length can be, for example, between 50 nucleotides and 500,000 nucleotides, such as between 100 nucleotides and 100,000 nucleotides, or between about 200 nucleotides and about 50,000 nucleotides, or between about 200 nucleotides and about 20,000 nucleotides. The gene can be obtained from a variety of sources, including cloning from a source of interest or synthesizing from known or predicted sequence information.

[0131] The term "nucleic acid" or "nucleic acid molecule" refers to a segment of DNA or RNA (e.g., mRNA), and also includes nucleic acids with modified backbones (e.g., peptide nucleic acids, locked nucleic acids) or modified or non-naturally occurring nucleobases. Nucleic acid molecules can be double-stranded, partially double-stranded, or single-stranded; single-stranded nucleic acids, including genes or portions thereof, can be the coding (sense) strand or the non-coding (antisense) strand.

[0132] Nucleic acid molecules can be "derived from" the source of indication, which comprises separating (all or part of) nucleic acid segments from the indicated source. Nucleic acid molecules can also be derived from the source of indication by, for example, direct cloning, PCR amplification, or artificial synthesis from the polynucleotide sources of indication or based on the sequence associated with the polynucleotide sources of indication. Genes or nucleic acid molecules derived from a particular source or species also include genes or nucleic acid molecules with sequence modifications relative to source nucleic acid molecules. For example, genes or nucleic acid molecules derived from a source (e.g., a specific reference gene) can include one or more mutations relative to a source gene or nucleic acid molecule, which are unexpected or intentionally introduced, and if one or more mutations (including substitutions, deletions, or insertions) are intentionally introduced, these sequence changes can be introduced by random or targeted mutations of cells or nucleic acids, by amplification or other gene synthesis or molecular biology techniques, or by chemical synthesis or any combination thereof. A gene or nucleic acid molecule derived from a reference gene or nucleic acid molecule encoding a functional RNA or polypeptide can encode a functional RNA or polypeptide that has at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% sequence identity to the reference or source functional RNA or polypeptide, or to a functional fragment thereof. For example, a gene or nucleic acid molecule derived from a reference gene or nucleic acid molecule encoding a functional RNA or polypeptide can encode a functional RNA or polypeptide that has at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the reference or source functional RNA or polypeptide, or to a functional fragment thereof.

[0133] As used herein, " isolated " nucleic acid or protein are to remove from the environment that its natural environment or nucleic acid or protein exist in nature.For example, isolated protein or nucleic acid molecule are to remove from the cell or biology relevant thereto in its natural or natural environment.In some instances, isolated nucleic acid or protein can be partially or basically purified, but separation does not need the purification of specific level.Therefore, for example, isolated nucleic acid molecule can be the nucleotide sequence that has been excised from its chromosome, genome or the episome that is integrated into in nature.

[0134] A "purified" nucleic acid molecule or nucleotide sequence or protein or polypeptide sequence is substantially free of cellular material and cellular components. A purified nucleic acid molecule or protein can be substantially free of chemicals other than, for example, buffers or solvents. "Substantially free" is not intended to mean that components other than the novel nucleic acid molecules are undetectable.

[0135] The terms "naturally occurring" and "wild-type" refer to forms found in nature. For example, a naturally occurring or wild-type nucleic acid molecule, nucleotide sequence, or protein can be present in material isolated from a natural source and has not been intentionally modified by human manipulation.

[0136] As used herein, " weakened " means that amount, degree, intensity (intensity) or strength (strength) reduce.Weakened gene expression can refer to the significantly reduced amount and / or transcription rate of the gene in question, or the significantly reduced amount and / or transcription rate of the translation, folding or assembly of the encoded protein.As non-limiting examples, weakened gene can be a gene (for example, a gene destroyed by partial or complete deletion, brachymemma, frameshift or insertion mutation) of the expression with minimization due to a change or destruction of a gene regulatory sequence, or can be a gene targeted by a construct (for example, antisense RNA, microRNA, RNAi molecule or ribozyme) that reduces gene expression.

[0137] "Exogenous nucleic acid molecule" or "exogenous gene" refers to a nucleic acid molecule or gene that has been introduced ("transformed") into a cell. A transformed cell may be referred to as a recombinant cell, into which one or more additional exogenous genes may be introduced. A cell is also referred to as "transformed" if the offspring of the cell transformed with the nucleic acid molecule have inherited the exogenous nucleic acid molecule. An exogenous gene may be from a different species (and therefore "heterologous") or from the same species (and therefore "homologous") relative to the transformed cell. An "endogenous" nucleic acid molecule, gene, or protein is a native nucleic acid molecule, gene, or protein because it is present in or produced naturally by the host.

[0138] As used herein, the term "natural" is used to refer to a nucleic acid sequence or amino acid sequence because the nucleic acid sequence or amino acid sequence is naturally present in the host. As used herein, the term "non-natural" is used to refer to a nucleic acid sequence or amino acid sequence that is not naturally present in the host. A nucleic acid sequence or amino acid sequence that has been removed from a cell, subjected to laboratory manipulation, and introduced or reintroduced into a host cell is considered to be "non-natural." A synthetic or partially synthetic gene that is introduced into a host cell is "non-natural." Non-natural genes further comprise genes endogenous to the host microorganism that are operably linked to one or more heterologous regulatory sequences that have been recombined into the host genome.

[0139] "Recombinant" or "engineered" nucleic acid molecules are nucleic acid molecules that have been altered by human manipulation. As non-limiting examples, recombinant nucleic acid molecules include any nucleic acid molecule that: 1) has been partially or completely synthesized or modified in vitro, such as using chemical or enzymatic techniques (e.g., by using chemical nucleic acid synthesis, or by using enzymes for replication, polymerization, digestion (exonucleolysis or endonucleolysis), ligation, reverse transcription, transcription, base modification (including, for example, methylation), integration, or recombination (including homologous and site-specific recombination) of nucleic acid molecules); 2) contains essentially unconnected linked nucleotide sequences; 3) has been engineered using molecular cloning techniques such that it lacks one or more nucleotides relative to the sequence of a naturally occurring nucleic acid molecule; and / or 4) has been manipulated using molecular cloning techniques such that it has one or more sequence changes or rearrangements relative to a naturally occurring nucleic acid sequence. As non-limiting examples, cDNA is a recombinant DNA molecule, such as any nucleic acid molecule that has been produced by one or more polymerase reactions in vitro or to which a linker has been attached or that has been integrated into a vector (such as a cloning vector or expression vector).

[0140] As used herein, the term "recombinant protein" refers to a protein produced by genetic engineering.

[0141] When applied to an organism, the term recombinant, engineered or genetically engineered refers to an organism that has been manipulated by introducing a heterologous or exogenous recombinant nucleic acid sequence into an organism, and includes gene knockout, targeted mutation, gene replacement and promoter replacement, deletion or insertion, and the introduction of a transgenic or synthetic gene into an organism. Recombinant or genetically engineered organisms can also be organisms that have been introduced into constructs for gene "knockdown". Such constructs include but are not limited to RNAi, microRNA, shRNA, siRNA, antisense and ribozyme constructs. Also included are organisms whose genomes have been altered by the activity of meganucleases, zinc finger nucleases, TALEN or Cas / CRISPR systems. Exogenous or recombinant nucleic acid molecules can be integrated into the genome of recombinant / genetically engineered organisms or, in other examples, may not be integrated into the host genome. As used herein, "recombinant microorganisms" or "recombinant host cells" include offspring or derivatives of the recombinant microorganisms of the present invention. Because some modifications may occur in subsequent generations due to mutations or environmental influences, such offspring or derivatives may not actually be identical to the parent cell, but are still included in the scope of the term as used herein.

[0142] The term "promoter" refers to a nucleic acid sequence that is capable of binding to RNA polymerase in a cell and initiating transcription of a downstream (3' direction) coding sequence. A promoter comprises the minimum number of bases or elements necessary to initiate transcription at a detectable level above background. A promoter may comprise a transcription initiation site and a protein binding domain (consensus sequence) responsible for binding to RNA polymerase. Eukaryotic promoters typically, but not always, contain a "TATA" box and a "CAT" box. Prokaryotic promoters may contain -10 and -35 prokaryotic promoter consensus sequences. A large number of promoters from a variety of different sources (including constitutive, inducible, and repressible promoters) are well known in the art. Representative sources include, for example, algae, viruses, mammals, insects, plants, yeast, and bacterial cell types, and suitable promoters from these sources are readily available, or can be prepared synthetically based on publicly available sequences online or, for example, from depository institutions (such as ATCC) and other commercial or individual sources. A promoter may be unidirectional (initiating transcription in one direction) or bidirectional (initiating transcription in either direction). The promoter can be a constitutive promoter, a repressible promoter, or an inducible promoter. In addition to RNA polymerase binding to the gene proximal promoter that initiates transcription, the promoter region can also include additional sequences upstream of the gene, which can be within 1 kb, 2 kb, 3 kb, 4 kb, 5 kb or more of the transcription start site of the gene, wherein the additional sequences can affect the transcription rate of downstream genes and optionally affect the responsiveness of the promoter to development, environment, or biochemical (e.g., metabolic) conditions.

[0143] As used herein, the term "heterologous" refers to a polynucleotide, gene, nucleic acid, polypeptide or enzyme that is derived from a source other than a host organism species. In contrast, "homologous" polynucleotide, gene, nucleic acid, polypeptide or enzyme is used herein to represent a polynucleotide, gene, nucleic acid, polypeptide or enzyme that is derived from a host organism species. When referring to a gene regulatory sequence or referring to an auxiliary nucleic acid sequence for maintaining or manipulating a gene sequence (e.g., promoter, 5' untranslated region, 3' untranslated region, poly A addition sequence, intron sequence, splice site, ribosome bind site, internal ribosome entry sequence, genome homology region, recombination site, etc.), "heterologous" means that a regulatory sequence or auxiliary sequence does not naturally associate with a regulatory sequence or auxiliary nucleic acid sequence that is juxtaposed with the gene in a construct, genome, chromosome or episome. Thus, a promoter that is operably linked to a gene to which it is not operably linked in its native state (i.e., in the genome of a non-genetically engineered organism) is referred to herein as a "heterologous promoter," even though the promoter may be derived from the same species (or in some cases, the same organism) as the gene to which it is linked.

[0144] As used herein, the terms "protein" or "polypeptide" are intended to encompass the singular "polypeptide" as well as the plural "polypeptides," and refer to molecules composed of monomers (amino acids) linearly linked by amide bonds (also known as peptide bonds). The term "polypeptide" refers to any chain or chains of two or more amino acids and does not refer to a specific length of the product. Thus, peptide, dipeptide, tripeptide, oligopeptide, "protein," "amino acid chain," or any other term used to refer to a chain or chains of two or more amino acids are included within the definition of "polypeptide," and the term "polypeptide" may be used instead of or interchangeably with any of these terms.

[0145] Gene and protein accession numbers (usually provided in parentheses after the gene or species name) are unique identifiers for sequence records publicly available on the National Center for Biotechnology Information (NCBI) website (ncbi.nlm.nih.gov), maintained by the United States National Institutes of Health. A "GenInfo Identifier" (GI) sequence identification number is specific to a nucleotide or amino acid sequence. If a sequence is altered in any way, a new GI number is assigned. The Sequence Revision History tool can be used to track the various GI numbers, version numbers, and update dates of sequences that appear in a particular GenBank record. Searching and obtaining nucleic acid or gene sequences or protein sequences based on accession numbers and GI numbers is well known in the fields of, for example, cell biology, biochemistry, molecular biology, and molecular genetics.

[0146] As used herein, the term "percent identity" or "homology" with respect to nucleic acid or polypeptide sequences is defined as the percentage of nucleotide or amino acid residues in a candidate sequence that are identical to those in a known polypeptide, after aligning the sequences for maximum percent identity and, if necessary, introducing gaps to achieve maximum percent homology. N-terminal or C-terminal insertions or deletions should not be construed as affecting homology, and internal deletions and / or insertions of less than about 30, less than about 20, or less than about 10 amino acid residues in a polypeptide sequence should not be construed as affecting homology. Homology or identity at the nucleotide or amino acid sequence level can be determined using the algorithms employed by the programs blastp, blastn, blastx, tblastn, and tblastx (Altschul (1997), Nucleic Acids Res. 25, 3389-3402, and Karlin (1990), Proc. Natl. Acad. Sci. USA 87, 2264-2268) and analyzed by BLAST (Basic Local Alignment Search Tool), which is customized for sequence similarity searches. The method employed by the BLAST programs is to first consider similar segments with and without gaps between the query sequence and the database sequence, then assess the statistical significance of all identified matches, and finally summarize only those matches that meet a preselected significance threshold. For a discussion of fundamental issues in sequence database similarity searches, see Altschul (1994), Nature Genetics 6, 119-129. The search parameters of histogram, description, comparison, expectation (i.e., for reporting the statistical significance threshold value of the matching for the database sequence), cutoff, matrix and filter (low complexity) can be in default settings. The default scoring matrix used by blastp, blastx, tblastn and tblastx is the BLOSUM62 matrix (Henikoff (1992), " Proceedings of the National Academy of Sciences of the U.S.A. " 89,10915-10919), which recommends a query sequence (nucleotide base or amino acid) of length above 85.

[0147] For blastn designed for comparing nucleotide sequences, the scoring matrix is ​​set by the ratio of M (i.e., the reward score for a pair of matching residues) to N (i.e., the penalty for mismatching residues), where the default values ​​for M and N can be +5 and -4, respectively. The four blastn parameters can be adjusted as follows: Q = 10 (gap creation penalty); R = 10 (gap extension penalty); wink = 1 (generate a word hit at each winkth position along the query); and gapw = 16 (sets the window width in which gap alignments are generated). The equivalent Blastp parameter settings for amino acid sequence comparisons can be: Q = 9; R = 2; wink = 1; and gapw = 32. Bestfit comparisons between sequences available in the GCG software package version 10.0 can use the DNA parameters GAP = 50 (gap creation penalty) and LEN = 3 (gap extension penalty), and the equivalent settings in protein comparisons can be GAP = 8 and LEN = 2.

[0148] Thus, reference to a polypeptide or nucleic acid sequence of the invention encompasses sequence identities having at least 40%, at least 45%, at least 50%, at least 55%, at least 70%, at least 65%, at least 70%, at least 75%, at least 80%, or at least 85%, e.g., at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or about 100% sequence identity to the full-length polypeptide or nucleic acid sequence or to fragments thereof, which include a contiguous sequence of at least 50, at least 75, at least 100, at least 125, at least 150 or more amino acid residues of the entire protein; variants of such sequences, e.g., wherein at least one amino acid residue has been inserted into the N- and / or C-terminus and / or internally of one or more of the disclosed sequences containing insertions and substitutions. Contemplated variants may additionally or alternatively include those containing predetermined mutations by, for example, homologous recombination or site-directed or PCR mutagenesis, as well as corresponding polypeptides or nucleic acids from other species, including but not limited to those described herein, alleles or other naturally occurring variants of families of polypeptides or nucleic acids containing insertions and substitutions; and / or derivatives in which the polypeptides have been covalently modified by substitution, chemical, enzymatic or other suitable means with a moiety (e.g., a detectable moiety such as an enzyme) other than a naturally occurring amino acid containing insertions and substitutions.

[0149] As used herein, the phrase "conservative amino acid substitution" or "conservative mutation" refers to the replacement of one amino acid with another amino acid having a common property. A functional method for defining the common properties between individual amino acids is to analyze the normalized frequency of amino acid changes between corresponding proteins of homologous organisms (Schulz (1979), "Principles of Protein Structure", Springer-Verlag). Based on this type of analysis, amino acid groups can be defined in which the amino acids within a group preferentially exchange with each other and are therefore most similar to each other in terms of their effect on the overall protein structure (Schulz (1979), "Principles of Protein Structure", Springer-Verlag). Examples of amino acid groups defined in this way can include: "charged / polar groups" including Glu, Asp, Asn, Gln, Lys, Arg, and His; "aromatic or cyclic groups" including Pro, Phe, Tyr, and Trp; and "aliphatic groups" including Gly, Ala, Val, Leu, Ile, Met, Ser, Thr, and Cys. Within each group, subunits can also be identified. For example, a group of charged / polar amino acids can be subdivided into subunits including: "positively charged subunits," which include Lys, Arg, and His; "negatively charged subunits," which include Glu and Asp; and "polar subunits," which include Asn and Gln. In another example, an aromatic or cyclic group can be subdivided into subunits including: "nitrogen ring subunits," which include Pro, His, and Trp; and "phenyl subunits," which include Phe and Tyr. In another further example, an aliphatic or cyclic group can be subdivided into subunits including: "large aliphatic nonpolar subunits," which include Val, Leu, and Ile; "aliphatic slightly polar subunits," which include Met, Ser, Thr, and Cys; and "small residue subunits," which include Gly and Ala. Examples of conservative mutations include amino acid substitutions of amino acids within the above subunits, such as, but not limited to: Lys for Arg, or vice versa, to maintain a positive charge; Glu for Asp, or vice versa, to maintain a negative charge; Ser for Thr, or vice versa, to maintain a free -OH; and Gln for Asn, or vice versa, to maintain a free -NH. A "conservative variant" is a polypeptide comprising one or more amino acids that have been substituted to replace one or more amino acids of a reference polypeptide (e.g., a polypeptide whose sequence has been published in a publication or sequence database or whose sequence has been determined by nucleic acid sequencing) with an amino acid having a common property (e.g., belonging to the same amino acid group or subunit as described above).

[0150] As used herein, the term "modulating" or "modulation" of a gene refers to changing the nucleic acid sequence of the gene, completely or partially deleting the gene, causing a break in the gene, changing the expression of the gene, inhibiting the expression of the gene, or silencing the expression of the gene. In some embodiments, changing the sequence of a gene is by inserting one or more nucleotides, deleting one or more nucleotides, or replacing nucleotides. Changing the sequence can be achieved by UV irradiation, gamma irradiation, or genetic engineering.

[0151] As used herein, "attenuating gene expression" means reducing or eliminating the expression of a gene in any manner that reduces the production of a fully functional protein.

[0152] As used herein, "expression" includes gene expression at least at the level of RNA production, and "expression product" includes the resulting product, such as a polypeptide or functional RNA (e.g., ribosomal RNA, tRNA, antisense RNA, microRNA, shRNA, ribozyme, etc.). The term "increased expression" includes changes in gene expression to promote increased mRNA production and / or increased polypeptide expression. "Increased production" includes an increase in the amount of polypeptide expression, the level of enzymatic activity of the polypeptide, or a combination of the two, compared to the natural production or enzymatic activity of the polypeptide.

[0153] Some aspects of the present invention comprise the part, basic or complete lack, silence, inactivation or downward regulation of the expression of specific polynucleotide sequence.These genes can partially, basically or completely lack, silence, inactivation, or its expression can be downward regulation, so that influence is carried out by the activity of its coded polypeptide, as the activity of enzyme.By inserting the nucleotide sequence (for example, virus insertion, transposon mutagenesis, meganuclease engineering, homologous recombination or other methods known in the art) that destroys the function and / or expression of gene, gene can partially, basically or completely lack, silence, inactivation or downward regulation.Term " elimination (eliminate) ", " elimination (elimination) " and " knock out (knockout) " can be used interchangeably with term " lack ", " partial lack ", " basic lack " or " complete lack ".In certain embodiments, can be by site-directed homologous recombination engineering microorganism of interest, to knock out specific gene of interest.In still other embodiments, RNAi or antisense DNA (asDNA) construct can be used for partially, basically or completely silence, inactivation or downward regulation specific gene of interest.

[0154] These insertions, deletions or other modifications of certain nucleic acid molecules or specific polynucleotide sequences can be understood to encompass "one or more genetic modifications" or "one or more transformations", so that the resulting strains of these microorganisms or host cells can be understood to be "genetically modified", "genetically engineered" or "transformed".

[0155] As used herein, "up-regulated" or "up-regulation" encompasses an increase in expression of a gene or nucleic acid molecule of interest or enzymatic activity, e.g., an increase in gene expression or enzymatic activity compared to expression or activity in an otherwise identical gene or enzyme that is not upregulated.

[0156] As used herein, "down-regulated" or "down-regulation" encompasses a decrease in the expression of a gene or nucleic acid molecule of interest or an enzymatic activity, e.g., a decrease in gene expression or enzymatic activity compared to the expression or activity in an otherwise identical gene or enzyme that is not down-regulated.

[0157] As used herein, "mutant" refers to an organism that is non-naturally occurring and has a mutation in a gene, the mutation being due to classical mutagenesis (e.g., using gamma irradiation, UV, or chemical mutagens). As used herein, "mutant" also refers to a recombinant cell having an altered gene structure or expression due to genetic engineering, as a non-limiting example, the genetic engineering can include overexpression, including gene expression under different time, biological, or environmental regulation and / or gene expression different from the degree of natural occurrence and / or expression of genes that are non-naturally expressed in recombinant cells; homologous recombination, including knockout and knock-in (e.g., gene replacement with a gene encoding a polypeptide having a higher or lower activity than a wild-type polypeptide and / or a dominant negative polypeptide); gene weakening by RNAi, antisense RNA, or ribozymes, etc.; and genome engineering using large-range nucleases, TALENs, and / or CRISPR technologies, etc. The mutant organism of interest typically has a phenotype different from the phenotype of the corresponding wild-type or ancestral strain lacking the mutation, wherein the phenotype can be assessed by growth assays, product analysis, photosynthetic properties, biochemical assays, etc. When referring to a gene "mutant", it is meant that the gene has at least one base (nucleotide) change, deletion or insertion relative to the natural or wild-type gene. The mutation (change, deletion and / or insertion of one or more nucleotides) can be in the coding region of the gene, or can be in an intron, 3'UTR, 5'UTR or promoter region, for example within 2kb of the transcription start site or within 3kb of the translation start site. As a non-limiting example, a mutant gene can be a gene with an insertion in the promoter region that can increase or decrease gene expression; it can be a gene with a deletion, resulting in the production of a non-functional protein, a truncated protein, a dominant negative protein or no protein; it can be a gene with one or more point mutations that result in an amino acid change in the encoded protein or result in abnormal splicing of the gene transcript, etc. As used herein, a "mutant" refers to an organism that is not naturally occurring and has a mutation in a gene, the mutation occurring due to classical mutagenesis (e.g., using gamma ray irradiation, UV or chemical mutagens). As used herein, "mutant" also refers to a recombinant cell having an altered gene structure or expression due to genetic engineering, which can include, as non-limiting examples, overexpression, gene expression under different temporal, biological, or environmental regulation and / or gene expression to a different extent than that occurring in nature and / or gene expression that is not naturally expressed in the recombinant cell.

[0158] The term "Pfam" refers to a large collection of protein domains and protein families maintained by the Pfam Consortium and available at: Wellcome Trust, Sanger Institute; pfam.sbc.su.se (Stockholm Bioinformatics Center); Janelia Farm, Howard Hughes Medical Institute; Institut national de la Recherche Agronomique. The latest version of Pfam is based on the UniProt protein database version 2012_06. 27.0 (March 2013). Pfam domains and families are identified using multiple sequence alignments and hidden Markov models (HMMs). Pfam-A family or domain assignments are high-quality assignments generated using curated seed alignments of representative members of a protein family, and a hidden Markov model is outlined based on the seed alignments. (Unless otherwise stated, matches of the queried protein to a Pfam domain or family are Pfam-A matches.) All identified sequences belonging to a family are then used to automatically generate a complete alignment of the family (Sonnhammer (1998), Nucleic Acids Research 26, 320-322; Bateman (2000), Nucleic Acids Research 26, 263-266; Bateman (2004), Nucleic Acids Research 32, Database Issue, D138-D141; Finn (2006), Nucleic Acids Research - Database Issue, 44, 137-139. Issue) 34, D247-251; Finn (2010), Nucleic Acids Research - Database Album 38, D211-222). By accessing the Pfam database, for example using any of the above websites, protein sequences can be queried against the HMM using HMMER homology search software (e.g., HMMER2, HMMER3, or higher). Significant matches that identify the queried protein as being in the Pfam family (or having a specific Pfam domain) are those matches whose median score is greater than or equal to the aggregation threshold of the Pfam domain. The expected value (e-value) can also be used as a criterion for including the queried protein in Pfam or determining whether the queried protein has a specific Pfam domain, where a low e-value (much less than 1.0, such as less than 0.1, or less than or equal to 0.01) indicates a low probability that the match is due to chance.

[0159] As used herein, the term "photosynthetic organism" refers to an organism that can convert light energy into chemical energy. In some embodiments, the chemical energy can be later released to fuel the activities of these organisms (energy conversion). In some embodiments, this chemical energy is stored in carbohydrate molecules (such as sugars) that are synthesized from carbon dioxide and water.

[0160] Non-limiting examples of photosynthetic organisms include plants, algae, and cyanobacteria. Non-limiting examples of algae belong to the genus: Algae, Cocos, Diplophyte, Fibrocystis, Astrocystis, Golden Chromophyte, Polly, Boutella, Balloon, Botrytis, Globulus, Chaetoceros, Tetradinium, Chlamydomonas, Chlorocystis, Chlorocystis, Chlorocystis, Chlorocystis, Chlorocystis, Cyanobacteria, Cyanobacteria, Cyanobacteria, Golden Globulus, Globulus, Cryptophytes, Cryptophytes, Cyclotella, Dunaliella, Ellipsoids, Globulus, Unicoccoids, Idylium, Euglena, True Eyed Algae, Vogelia, Fragilis, Lissium, Halococcus, Halophilic Archaea, Heterosigma, Membrane Cells, Isochrysis, Lepidoptera genus, micro-awn algae, garlic algae, mononeedle algae, micro-chlorella, micro-parasitic algae, boat-shaped algae, new green algae, kidney dinoflagellate algae, kidney algae, nitzschia, brown dinoflagellate algae, sheath algae, oocysts, oyster ball algae, Pavlova, pseudo-chlorella, Parrini algae, Plegomena, brown finger algae, bacteriophage, microgreen algae, flat algae, coccolithophore, wide ball algae, protothecoides, pseudo-chlorella, pseudo-neochlorophyte, pseudo-cross-toed algae, tower algae, grape string algae, scenedesmus, bone stripe algae, Spirulina, fission thread algae, four-striped algae, sea ​​streaks, yellow filament algae, a septum algae, fresh green algae, Weishi algae and Volvox genera.

[0161] Non-limiting examples of plants include Arabidopsis arenicola, Arabidopsis isarenosa, Arabidopsis cebennensis, Arabidopsis croatica, Arabidopsis rotundifolia, Arabidopsis lyreleaf, Arabidopsis neglecta, Arabidopsis pedemontana, Arabidopsis suecica, Arabidopsis thaliana, corn, rice, wheat, potato, onion, garlic, soybean, tomato, Gossypium hirsutum, Gossypium herbaceum, Gossypium arboreum, Gossypium tomentosum, Brassica nigra, and Brassica sp.

[0162] As used herein, the term "mutant photosynthetic organism" or "mutant algae" refers to a photosynthetic organism or algae in which at least SGI1, SGI2, a combination of SGI1 and SRP54, a combination of SGI2 and SRP54, or a combination of SGI1, SGI2, and SRP54 is modulated. Such modulation can comprise alteration of a nucleic acid sequence or alteration of expression of one or more genes.

[0163] As used herein, combined regulation of the SGI1 and SRP54 genes refers to regulation of both the SGI1 and SRP54 genes in the same photosynthetic organism. Similarly, combined regulation of the SGI2 and SRP54 genes refers to regulation of both the SGI2 and SRP54 genes in the same photosynthetic organism. Likewise, combined regulation of the SGI1, SGI2, and SRP54 genes refers to regulation of both the SGI1 and SRP54 genes in the same photosynthetic organism.

[0164] As used herein, the term "control photosynthetic organism" refers to a photosynthetic organism that is genetically substantially identical to the mutant photosynthetic organism in all relevant respects, except that the control photosynthetic organism does not have a mutated or attenuated SRP54, SGI1, SGI2, or a combination of two or more genes. For example, the control photosynthetic organism is the same species, and except for the alteration of the cpSRP54, cytoplasmic SRP54, SGI1, or SGI2 gene or the construct used to attenuate cpSRP54, the cytoplasmic SRP54, SGI1, or SGI2 genes present in the mutant are genetically identical, except for minor genomic changes (e.g., "SNPs") that do not affect cell physiology that may occur during mutagenesis through normal breeding. In various embodiments, the control photosynthetic organism is a strain from which the mutant photosynthetic organism having attenuated expression of cytoplasmic SRP54, cpSRP54, SGI1, SGI2, or a combination of at least two genes was derived.

[0165] When referring to photosynthetic organisms (such as algae), the term "low light adapted" means that the photosynthetic organism has increased chlorophyll and photosynthetic properties after being exposed to low light intensity for a period of time sufficient for the changes in chlorophyll and photosynthetic properties to stabilize under low light conditions. Low light can be, for example, less than 200 μE·m -2 ·s -1 , and preferably, about 100 μE·m -2 ·s -1 or less or 50μE·m -2 ·s -1or less, and the time period for adaptation can be at least about four hours, at least about six hours, at least about eight hours, or at least about twelve hours, at least 24 hours, or at least 48 hours, and possibly up to 2 days, 3 days, 4 days, or 5 days.

[0166] "cDNA" is a DNA molecule that includes at least a portion of the nucleotide sequence of an mRNA molecule, except that the DNA molecule replaces the nucleobase thymine or T present in the mRNA sequence with uridine or U. The cDNA can be double-stranded or single-stranded and can be, for example, the complement of the mRNA sequence. In preferred embodiments, the cDNA does not include one or more intron sequences that are present in the naturally occurring gene to which the cDNA corresponds (i.e., a gene present in the genome of an organism). For example, a cDNA can have a sequence upstream of an intron from a naturally occurring gene, juxtaposed with a sequence downstream of an intron from the naturally occurring gene, wherein the upstream and downstream sequences are not juxtaposed in a DNA molecule in nature (i.e., these sequences are not juxtaposed in the naturally occurring gene). cDNA can be produced by reverse transcription of an mRNA molecule, or can be synthesized, for example, by chemical synthesis and / or by using one or more restriction enzymes, one or more ligases, one or more polymerases (including but not limited to thermostable polymerases useful for polymerase chain reaction (PCR)), one or more recombinases, etc., based on knowledge of the cDNA sequence, wherein knowledge of the cDNA sequence can optionally be based on identification of a coding region from a genomic sequence or multiple partial cDNAs compiled from the sequence.

[0167] Algal mutants that are "dysregulated in low light adaptation" (or "locked in high light adaptation" or LIHLA mutants) are mutants that do not exhibit the phenotypic and gene expression changes that are characteristic of low-light-adapted wild-type algal cells, including: a significant increase in chlorophyll and a significant increase in expression of most light-harvesting complex protein (LHCP) genes. Upon adaptation to low light, the algal mutants that are dysregulated in low light adaptation have reduced expression relative to the low-light-adapted wild-type cells of a plurality of genes (e.g., at least ten, at least twenty, at least thirty, at least forty, or at least fifty genes) that are upregulated during low-light adaptation of the wild-type cells. Furthermore, the algal mutants that are dysregulated in low light adaptation have increased expression of genes relative to the low-light-adapted wild-type cells that are downregulated during low-light adaptation of the wild-type cells (e.g., at least five, at least six, at least seven, at least eight, at least nine, or at least ten genes). Further, as disclosed herein, when both the mutant and wild-type cells are adapted to low light, the algal mutant that is deregulated in low-light adaptation can have photosynthetic properties that differ significantly from those of the wild-type cells.

[0168] "Photosynthetic properties", "photosynthetic properties", "photophysiological properties" or "photophysiological parameters" include, but are not limited to, the maximum photosynthetic rate Pmax (calculated on a per cell or per mg chlorophyll basis), the intensity at which photosynthesis is saturated Ek (as measured by oxygen evolution), and the initial slope of the alpha ("alpha (α)") photosynthesis (oxygen evolution) versus irradiance intensity (P / I) curve. Additional photosynthetic properties include various parameters that can be measured using fluorescence detection, including, for example, the maximum photochemical quantum yield F in photosystem II. v / F M photosynthetic quantum yield of photosystem II (PSII), φPSII; photochemical quenching, or the fraction of open PSII centers, qP; nonphotochemical quenching, NPQ; PSII electron transport rate, ETRPSII; PSI electron transport rate, ETR PSI ; PSI functional absorption cross-sectional size (σ PSI ) and the functional absorption cross section of PSII (σ PSII ). This list is not exhaustive, and the term does not exclude other parameters that measure various aspects of photosynthesis.

[0169] Reference to "substantially the same" properties is intended to mean that these properties are within 10%, and preferably within 5%, of the reference value.

[0170] Although methods and materials similar to or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. The materials, methods, and examples are illustrative only and are not intended to be limiting. Other features and advantages of the present invention will become apparent from the detailed description and claims.

[0171] Gene weakening

[0172] Mutant photosynthetic organisms can be generated by any available method, including but not limited to UV irradiation, gamma irradiation, or chemical mutagenesis, and screened for low chlorophyll mutants having the photosynthetic properties disclosed herein. Methods for generating mutants of microbial strains are well known. Mutants can be identified by methods known in the art, including, for example, genomic sequencing, PCR, immunoassays for cpSRP54 or cytoSRP54 proteins, and expression analysis (e.g., reverse transcription / PCR).

[0173] The mutant photosynthetic organisms provided herein can also be genetically engineered in which SGI1, SGI2, cpSRP54, cytoSRP54, a combination of SGI1 and cpSRP54 genes, or a combination of SGI2 and cpSRP54 have been targeted for knockout or gene replacement (e.g., with a mutant form of a gene that encodes a polypeptide having reduced activity relative to the wild-type polypeptide) by homologous recombination. In another example, an algae strain of interest can be engineered by site-directed homologous recombination to insert a specific gene of interest (e.g., a promoter) with or without expression control sequences into a specific genomic locus, or to insert a promoter into a genetic locus of a host microorganism to affect the expression of a specific gene or group of genes at that locus.

[0174] For example, gene knockout or replacement by homologous recombination can be carried out by conversion of a nucleic acid (e.g., DNA) fragment comprising a sequence homologous to the genomic region to be altered, wherein the homologous sequence is interrupted by an exogenous sequence (typically a selectable marker gene that allows selection for integrated constructs). The length of the genomic homologous flanking sequences on either side of the exogenous sequence or the mutated gene sequence can be, for example, at least 50, at least 100, at least 200, at least 300, at least 400, at least 500, at least 600, at least 700, at least 800, at least 900, at least 1,000, at least 1,200, at least 1,500, at least 1,750, or at least 2,000 nucleotides. Knockout or gene " knock-in " construct (wherein exogenous sequence flank is target gene sequence) can be provided in carrier, described carrier can optionally be linearized, for example, outside the zone of experience homologous recombination, be linearized, or can be provided as the linear fragment not under the background of carrier, for example, knock out or knock into construct and can be isolated or synthetic fragment, including but not limited to PCR product.In some instances, split marker system can be used for generating gene knockout by homologous recombination, wherein two DNA fragments can be introduced, described fragment can regenerate selectable marker and destroy interested locus (people (2007) such as Jeong, " FEMS Microbiology Express (FEMS Microbiol Lett) " 273:157-163) by three exchange events.

[0175] In one aspect, the present invention provides genetically modified organisms, such as microorganisms, having one or more genetic modifications that attenuate expression of SGI1, SGI2, cpSRP54, cytoSRP54, a combination of SGI1 and cpSRP54 genes, or a combination of SGI2 and cpSRP54 genes. As used herein, "attenuating expression of SGI1, SGI2, cpSRP54, cytoSRP54, a combination of SGI1 and cpSRP54 genes, or a combination of SGI2 and cpSRP54 genes" means reducing or eliminating expression of one or more of these genes in any manner that reduces production of a fully functional protein.

[0176] For example, a recombinant photosynthetic organism engineered to have attenuated expression of SGI1, SGI2, cpSRP54, cytoSRP54, a combination of SGI1 and cpSRP54 genes, or a combination of SGI2 and cpSRP54 genes can have disrupted SGI1, SGI2, cpSRP54, cytoSRP54, a combination of SGI1 and cpSRP54 genes, or a combination of SGI2 and cpSRP54 genes, wherein the recombinant microorganism can have SGI1, SGI2, cpSRP54, cytoSRP54, a combination of SGI1 and cpSRP54 genes, or a combination of SGI2 and cpSRP54 genes. SGI1, SGI2, cpSRP54, cytoSRP54, a combination of SGI1 and cpSRP54 genes, or a combination of SGI2 and cpSRP54 genes, or a combination of SGI2 and cpSRP54 genes, comprising at least one insertion, mutation, or deletion that reduces or eliminates gene expression such that fully functional SGI1, SGI2, cpSRP54, cytoSRP54, a combination of SGI1 and cpSRP54 genes, or a combination of SGI2 and cpSRP54 genes, or a cytoSRP54 gene is not produced or is produced in an amount lower than that produced by a control photosynthetic organism of the same species. The disrupted SGI1, SGI2, cpSRP54, cytoSRP54, combination of SGI1 and cpSRP54 genes, combination of SGI2 and cpSRP54, or cytoSRP54 gene can be disrupted by, for example, insertion or gene replacement mediated by homologous recombination and / or by the activity of a meganuclease, a zinc finger nuclease (Perez-Pinera et al., (2012), Curr. Opin. Chem. Biol. 16:268-277), TALEN (WO 2014 / 207043; WO 2014 / 076571), or an RNA-guided endonuclease, such as a cas protein of the CRISPR system (e.g., Cas9 protein).

[0177] The CRISPR system, recently reviewed by Hsu et al. (Cell 157:1262-1278, 2014), comprises, in addition to the Cas nuclease polypeptide or complex, a targeting RNA (commonly referred to as "crRNA"), which interacts with the genomic target site through complementarity to the target site sequence, and a trans-activating ("tracr") RNA, which is complexed with the Cas polypeptide and also comprises a region that binds (through complementarity) to the targeting crRNA.

[0178] The present invention contemplates the use of two RNA molecules ("crRNA" and "tracrRNA"), which can be co-transformed into a host strain expressing cas protein or transfected with cas protein (or expressed in a host strain) for genome editing, or the use of a single guide RNA comprising a sequence complementary to the target sequence and a sequence that interacts with the cas protein. That is, in some strategies, the CRISPR system used herein can include two separate RNA molecules (RNA polynucleotides: "tracr-RNA" and "targeter-RNA" or "crRNA," see below), and is referred to herein as "double-molecule DNA-targeting RNA" or "double-molecule DNA-targeting RNA." Alternatively, as shown in the examples, the DNA-targeting RNA can also include a transactivation sequence for interacting with the Cas protein (in addition to targeting homologous ("cr") sequences, i.e., the DNA-targeting RNA can be a single RNA molecule (single RNA polynucleotide), and is referred to herein as "chimeric guide RNA," "single guide RNA," or "sgRNA." The terms "DNA targeting RNA" and "gRNA" are inclusive and refer to both double-molecule DNA targeting RNA and single-molecule DNA targeting RNA (i.e., sgRNA). Single-molecule guide RNA and two-RNA systems have been described in detail in the literature and, for example, in U.S. Patent Application Publication No. US 2014 / 0068797, which is incorporated herein by reference in its entirety.

[0179] Any Cas protein can be used in the methods herein, for example, Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, homologs thereof, or modified forms thereof. In some embodiments, the Cas protein is a Class II Cas protein. As a non-limiting example, the Cas protein can be a Cas9 protein, such as the Cas9 protein of Staphylococcus pyogenes, Streptococcus thermophilus, Streptococcus pneumoniae, Staphylococcus aureus, or Neisseria meningitidis. Other Cas proteins of interest include, but are not limited to, Cpf1 RNA-guided endonuclease (Zetsche et al. (2015), Cell 163: 1-13) and C2c1, C2c2, C2c3 RNA-guided nucleases (Shmakov et al. (2015), Molecular Cell 60: 1-13). Also contemplated are Cas9 proteins provided as SEQ ID NOs: 1-256 and 795-1346 in U.S. Patent Application Publication No. US 2014 / 0068797, as well as chimeric Cas9 proteins that can combine domains from more than one Cas9 protein, and variants and mutants of identified Cas9 proteins. (For example, a Cas9 protein encoded by a nucleic acid molecule introduced into a host cell can include at least one mutation relative to a wild-type Cas9 protein; for example, a Cas9 protein can be inactivated in one of the cleavage domains of the protein, thereby generating a "nickase" variant. Non-limiting examples of mutations include D10A, H840A, N854A, and N863A.) The nucleic acid sequence encoding the Cas protein of the host cell of interest can be codon-optimized.

[0180] Cas nuclease activity cuts the target DNA to produce double-strand breaks. These breaks are then repaired by the cell in one of two ways: non-homologous end joining or homology-directed repair. In non-homologous end joining (NHEJ), double-strand breaks are repaired by directly connecting the broken ends to each other. In this case, no new nucleic acid material is inserted into the site, but some nucleic acid materials may be lost, thereby resulting in deletion or change, usually resulting in mutation. In homology-directed repair, a donor polynucleotide (sometimes referred to as "donor DNA" or "editing DNA") that can have homology with the target DNA sequence of the cut is used as a template for repairing the target DNA sequence of the cut, thereby resulting in genetic information being transferred from the donor polynucleotide to the target DNA. In this way, new nucleic acid material can be inserted / copied into the site. The modification of the target DNA caused by NHEJ and / or homology-directed repair (e.g., using a donor DNA molecule) can result in, for example, gene correction, gene replacement, gene tagging, transgenic insertion, nucleotide deletion, gene disruption, gene mutation, etc.

[0181] In some examples, cleavage of DNA by site-directed modifying polypeptides (e.g., Cas nucleases, zinc finger nucleases, meganucleases, or TALENs) can be used to delete nucleic acid material from a target DNA sequence by cleaving the target DNA sequence and allowing the cell to repair the sequence in the absence of exogenously provided donor polynucleotides. Such NHEJ events can result in mutations ("misrepairs") at the site of reconnection of the cleaved ends, leading to gene disruption.

[0182] Alternatively, if a DNA-targeting RNA is co-administered with a donor DNA to a cell expressing a cas nuclease, the subject methods can be used to add (i.e., insert or replace) nucleic acid material to a target DNA sequence (e.g., to "knock out" or "knock in" nucleic acids encoding proteins (e.g., selectable markers and / or any protein of interest), siRNA, miRNA, etc., by insertional mutagenesis to modify nucleic acid sequences (e.g., to introduce mutations).

[0183] In certain embodiments, the donor DNA can include a gene regulatory sequence (e.g., a promoter) that can be targeted using CRISPR and inserted upstream of the coding region of the gene and upstream of the putative proximal promoter region of the gene, for example, at least 50 bp, at least 100 bp, at least 120 bp, at least 150 bp, at least 200 bp, at least 250 bp, at least 300 bp, at least 350 bp, at least 400 bp, at least 450 bp, or at least 500 bp upstream of the start ATG of the coding region of the cpSRP54 gene. The donor DNA can include sequences that may interfere with the native promoter, such as a selectable marker or any convenient sequence. Additional sequences inserted upstream of the start ATG of the combination of SGI1, SGI2, cpSRP54, cytoSRP54, genes, or open reading frames (e.g., in the 5'UTR or upstream of the transcription start site of the cpSRP54 gene) can reduce or even eliminate expression of endogenous SGI1, SGI2, cpSRP54, cytoSRP54, genes. Alternatively or additionally, the endogenous promoter of the native SGI1, SGI2, cpSRP54, cytoSRP54, or genes can be replaced in whole or in part by a weaker or differently regulated promoter or non-promoter sequence.

[0184] In some instances, the nucleic acid molecule encoding for generating an efficient genome editing cell line introduced into a host cell is mutated relative to the corresponding wild-type enzyme Cas9 enzyme, so that the mutated Cas9 enzyme lacks the ability to cut one or two chains of the target polynucleotide containing the target sequence. For example, aspartic acid to alanine substitution (D10A) in the RuvC I catalytic domain of the Cas9 from Streptococcus pyogenes converts Cas9 from a nuclease that cuts two chains into a nickase (an enzyme that cuts a single chain). Other examples of mutations that cause Cas9 to become nickases include but are not limited to H840A, N854A, and N863A. In certain embodiments, Cas9 nickases can be used in combination with one or more guide sequences (e.g., two guide sequences), which target the sense and antisense strands of a DNA target respectively. This combination allows two chains to be cut and used to induce NHEJ. Two nickase targets (closely approaching but in different chains of the targeted DNA) can be used to induce mutagenic NHEJ. Such targeting of loci using enzymes that cut opposite strains at staggered positions can also reduce off-target cleavage, as both strands must be precisely and specifically cut to achieve genomic mutation.

[0185] In another example, a mutant Cas9 enzyme with an impaired ability to cut DNA can be expressed in a cell, wherein one or more guide RNAs targeting a sequence upstream of the transcription or translation start site of the targeted gene are also introduced. In this case, the Cas enzyme can bind to the target sequence and block transcription of the targeted gene (Qi et al. (2013), Cell 152: 1173-1183).

[0186] In some cases, the Cas polypeptide (such as Cas9 polypeptide) is a fusion polypeptide, including, for example: i) a Cas9 polypeptide (which may optionally be a variant Cas9 polypeptide as described above); and b) a covalently linked heterologous polypeptide (also referred to as a "fusion partner"). A heterologous nucleic acid sequence can be linked to another nucleic acid sequence (e.g., by genetic engineering) to generate a chimeric nucleotide sequence encoding a chimeric polypeptide. In some embodiments, the Cas9 fusion polypeptide is generated by fusing the Cas9 polypeptide with a heterologous sequence that provides subcellular localization (i.e., the heterologous sequence is a subcellular localization sequence, e.g., a nuclear localization signal (NLS) for targeting the nucleus; a mitochondrial localization signal for targeting mitochondria; a chloroplast localization signal for targeting chloroplasts; an ER retention signal, etc.). In some embodiments, the heterologous sequence can provide a tag (i.e., the heterologous sequence is a detectable marker) for tracking and / or purification (e.g., a fluorescent protein, e.g., green fluorescent protein (GFP), YFP, RFP, CFP, mCherry, tdTomato, etc.; a hemagglutinin (HA) tag; a FLAG tag; a Myc tag, etc.).

[0187] The host cell can be genetically engineered (e.g., transduced, transformed, or transfected) using, for example, a vector construct, which can be, for example, a vector for homologous recombination, comprising a nucleic acid sequence homologous to a portion of SGI1, SGI2, cpSRP54, cytoSRP54, a combination of SGI1 and cpSRP54 genes, or a combination of SGI2 and cpSRP54 gene loci of a host cell, or a region adjacent thereto, or can be an expression vector for expressing any one or a combination of: a Cas protein (e.g., a class II Cas protein), a CRISPR chimeric guide RNA, crRNA, and / or tracrRNA, an RNAi construct (e.g., shRNA), an antisense RNA, or a ribozyme. The vector can be in the form of, for example, a plasmid, a viral particle, a bacteriophage, or the like. The vector for expressing a polypeptide or RNA for genome editing can also be designed for integration into the host, for example, by homologous recombination. Vectors containing the polynucleotide sequences described herein, for example, sequences having homology to the host SGI1, SGI2, cpSRP54, cytoSRP54, a combination of SGI1 and cpSRP54 genes, or a combination of SGI2 and cpSRP54 gene sequences (comprising sequences upstream and downstream of the cpSRP54 or cytoSRP54 coding sequence), and optionally, a selectable marker or reporter gene can be used to transform a suitable host to result in attenuation of the SGI1, SGI2, cpSRP54, cytoSRP54, a combination of SGI1 and cpSRP54 genes, or a combination of SGI2 and cpSRP54 genes.

[0188] In some instances, the recombinant photosynthetic organism can reduce, but not eliminate, the expression of SGI1, SGI2, cpSRP54, cytoSRP54, a combination of SGI1 and cpSRP54 genes, or a combination of SGI2 and cpSRP54 genes, and the recombinant photosynthetic organism can have a reduction in chlorophyll of about 10% to about 90%, for example, a reduction in total chlorophyll of about 20% to about 80%. The genetically modified microorganisms provided herein can, in some instances, contain a nucleic acid construct for attenuating the expression of SGI1, SGI2, cpSRP54, cytoSRP54, a combination of SGI1 and cpSRP54 genes, or a combination of SGI2 and cpSRP54 genes. For example, the host microorganism can contain a construct for expressing an RNAi molecule, a ribozyme, or an antisense molecule that reduces the expression of SGI1, SGI2, cpSRP54, cytoSRP54, a combination of SGI1 and cpSRP54 genes, or a combination of SGI2 and cpSRP54 genes. In some examples, a recombinant microorganism as provided herein can comprise at least one introduced (exogenous or non-natural) construct for reducing expression of SGI1, SGI2, cpSRP54, cytoSRP54, a combination of SGI1 and cpSRP54 genes, or a combination of SGI2 and cpSRP54 genes.

[0189] Using methods known in the art, e.g., RNA-Seq or reverse transcription-PCR (RT-PCR), engineered strains can be selected for expression of SGI1, SGI2, cpSRP54, cytoSRP54, a combination of SGI1 and cpSRP54 genes, or a combination of SGI2 and cpSRP54 genes that is reduced, but not eliminated, relative to control cells that do not contain genetic modifications to attenuate expression of SGI1, SGI2, cpSRP54, cytoSRP54, a combination of SGI1 and cpSRP54 genes, or a combination of SGI2 and cpSRP54 genes.

[0190] As provided herein, genetically engineered strains can be engineered to contain constructs for attenuating gene expression by reducing the amount, stability, or translation of mRNA encoding a gene encoding SGI1, SGI2, cpSRP54, cytoSRP54, a combination of SGI1 and cpSRP54 genes, or a combination of SGI2 and cpSRP54 genes. For example, using methods known in the art, photosynthetic organisms, such as plants or algae, or heterokont strains, can be transformed with antisense RNA, RNAi, or ribozyme constructs targeting mRNA of SGI1, SGI2, cpSRP54, cytoSRP54, a combination of SGI1 and cpSRP54 genes, or a combination of SGI2 and cpSRP54 genes. For example, antisense RNA constructs comprising all or part of the transcribed region of a gene can be introduced into a microorganism to reduce gene expression (Shroda et al. (1999), The Plant Cell 11: 1165-78; Ngiam et al. (2000), Appl. Environ. Microbiol. 66: 775-782; Ohnuma et al. (2009), Protoplasma 236: 107-112; Lavaud et al. (2012), PLoS One 7: e36806). Alternatively or additionally, an RNAi construct targeting the cpSRP54 or cytoSRP54 gene (e.g., a construct encoding a short hairpin RNA) can be introduced into a microorganism (such as algae or anisomastigotes) to reduce the expression of the cpSRP54 or cytoSRP54 gene (see, e.g., Cerruti et al. (2011), Eukaryotic Cell (2011) 10: 1164-1172; Shroda et al. (2006), Curr. Genet. 49: 69-84).

[0191] Ribozyme is the RNA-protein complex that cuts nucleic acid in a site-specific manner.Ribozyme has the specific catalytic domain that has endonuclease activity.For example, U.S. Patent No. 5,354,855 reports that some ribozyme can serve as endonuclease, and its sequence specificity is greater than the sequence specificity of known ribonuclease, and approaches the sequence specificity of DNA restriction enzyme.Catalytic RNA construct (ribozyme) can be designed to encode the mRNA base pairing of the gene provided herein, to cut the mRNA target.In some instances, ribozyme sequence can be integrated in the antisense RNA construct to mediate the cutting of target.Can consider various types of ribozyme, its design and purpose are known in the art, and for example described in people such as Haseloff (1988), " nature (Nature) " 334:585-591.

[0192] By means of complementary base pair interaction and site annealing, ribozyme is targeted to a given sequence. This targeting requires two homology segments. The segments of these homologous sequences are located at the flank of the catalytic ribozyme structure defined above. The length of each segment of homologous sequence can be 7 to 15 nucleotides. The only requirement for defining homologous sequence is that on the target RNA, it is separated by the specific sequence used as the cleavage site. For hammerhead ribozyme, the cleavage site is a dinucleotide sequence on the target RNA, which is uracil (U), followed by adenine, cytosine or uracil (A, C or U) (Thompson et al. (1995), < Nucleic Acids Research > 23:2250-68). The frequency of this dinucleotide in any given RNA is statistically 3 in 16. Therefore, for a given target messenger RNA of 1,000 bases, 187 dinucleotide cleavage sites are statistically possible.

[0193] The general design and optimization of ribozyme-directed RNA cleavage activity has been discussed in detail (Haseloff and Gerlach (1988), Nature 334:585-591; Symons (1992), Ann Rev Biochem 61:641-71; Chowrira et al. (1994), J Biol Chem 269:25856-64; Thompson et al. (1995), supra). Designing and testing ribozymes for efficient cleavage of target RNAs is a method well known to those skilled in the art. Examples of scientific methods for designing and testing ribozymes are described by Chowrira et al. (1994), supra; and Lieber and Strauss (1995), Mol Cell Biol. 15:540-51, each of which is incorporated by reference. The identification of effective and preferred sequences for down-regulating a given gene is a matter of preparing and testing the given sequences and is a routinely practiced "screening" method known to those skilled in the art.

[0194] The purposes of RNAi construct are described in the literature cited above and in for example US2005 / 0166289 and WO 2013 / 016267. The double-stranded RNA with homology to the target gene is delivered to the cell or produced in the cell by the expression of RNAi construct (for example, RNAi short hairpin (sh) construct).Construct can include the sequence identical with the target gene, or identical with the sequence of the target gene at least 70%, 80%, 90%, 95% or 95% and 100%.Construct can have at least 20, at least 30, at least 40, at least 50, at least 100, at least 200, at least 300, at least 400, at least 500, at least 600, at least 700, at least 800, at least 900 or at least 10kb with the sequence homologous to the target gene. Expression vectors can be engineered using promoters selected for continuous or inducible expression of RNAi constructs, such as shRNA-producing constructs.

[0195] Nucleic acid constructs for gene attenuation, such as ribozymes, RNAi or antisense constructs, can comprise at least fifteen, at least twenty, at least thirty, at least forty, at least fifty or at least sixty nucleotides that are at least 80% identical, such as at least 85%, at least 90%, at least 95% or at least 99% or complementary to at least a portion of the sequence of endogenous SGI1, SGI2, cpSRP54, cytoSRP54, a combination of SGI1 and cpSRP54 genes, or a combination of SGI2 and cpSRP54 genes of the microorganism to be engineered. Nucleic acid constructs for gene attenuation, such as ribozymes, RNAi or antisense constructs, can comprise at least fifteen, at least twenty, at least thirty, at least forty, at least fifty or at least sixty nucleotides that are at least 80%, such as at least 95%, or about 100%, identical or complementary to the sequence of a naturally occurring gene (e.g., a gene encoding a polypeptide that has at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, or at least 85%, at least 90%, or at least 95% sequence identity to the endogenous SGI1, SGI2, cpSRP54, cytoSRP54, a combination of SGI1 and cpSRP54 genes, or a combination of SGI2 and cpSRP54 genes). For example, a nucleic acid construct for gene attenuation, such as a ribozyme, RNAi, or antisense construct, can comprise at least 15, at least 20, at least 30, at least 40, at least 50, or at least 60 nucleotides that are at least 80% identical or complementary to the sequence of a naturally occurring cpSRP54 gene (e.g., any gene provided herein). The nucleotide sequence can be, for example, from about 30 nucleotides to about 3 kilobases or greater, e.g., 30-50 nucleotides in length, 50 to 100 nucleotides in length, 100 to 500 nucleotides in length, 500 nucleotides to 1 kb in length, 1 kb to 2 kb in length, or 2 to 5 kb in length. For example, the antisense sequence can be from about 100 nucleotides to about 1 kb in length.For example, a nucleic acid construct for gene attenuation, such as a ribozyme, RNAi, or antisense construct, can comprise at least fifteen, at least twenty, at least thirty, at least forty, at least fifty, at least sixty, or at least 100 nucleotides that are at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, or at least 85%, e.g., at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, or at least 95% identical or complementary to an endogenous SGI1, SGI2, cpSRP54, cytoSRP54, a combination of SGI1 and cpSRP54 genes, or a combination of SGI2 and cpSRP54 genes, or a portion thereof.

[0196] The promoter used in the antisense, RNAi or ribozyme construct can be any promoter that is functional in the host organism and suitable for reducing the expression of the target gene to the desired level. Promoters that are functional in algae and anisomastigotes are known in the art and disclosed herein. The construct can be transformed into algae using any feasible method, including any method disclosed herein. Recombinant organisms or microorganisms transformed with nucleic acid molecules for attenuating the expression of SGI1, SGI2, cpSRP54, cytoSRP54, a combination of SGI1 and cpSRP54 genes, or a combination of SGI2 and cpSRP54 genes, such as, but not limited to, antisense, RNAi, or ribozyme constructs, can have the properties of the SGI1, SGI2, cpSRP54, cytoSRP54, a combination of SGI1 and cpSRP54 genes, or a combination of SGI2 and cpSRP54 mutants described herein, including, for example, reduced chlorophyll, increased photosynthetic efficiency, and increased culture productivity relative to a host organism or microorganism that does not contain the exogenous nucleic acid molecule that results in attenuated gene expression.

[0197] Nucleic acid molecules and constructs

[0198] Those skilled in the art will appreciate that many transformation methods can be used for the genetic conversion of microorganisms, and therefore can be used for method of the present invention." stable conversion " is intended to mean that the nucleic acid construct that is incorporated into the biology is integrated into the biological genome, or is a part for stable episomal construct, and can be inherited by its offspring." transient conversion " is intended to mean that polynucleotide is incorporated into the biology, and is not integrated in the genome, or otherwise is set up and stably inherited by successive generations.

[0199] Genetic transformation can cause transgenic, from the stable insertion and / or expression of the construct of cell nucleus or plastid, and can cause the transient expression of transgenic in some cases.These transformation methods can also be used for introducing guide RNA or editing DNA.It has been reported that for more than 30 kinds of different microalgae strains (it belongs to at least about 22 species of green algae, red algae and brown algae, diatom, euglena algae and flagellate algae), the genetic transformation of microalgae is successful (see, for example, Radakovits et al., " Eukaryotic Cell ", 2010; and Gong et al., " Industrial Microbiology and Biotechnology Journal (J.Ind.Microbiol.Biotechnol.) ", 2011). Non-limiting examples of such useful transformation methods include stirred cells in the presence of glass beads or silicon carbide whiskers, as reported by, e.g., Dunahay, Biotechniques, 15(3):452–460, 1993; Kindle, Proceedings of the National Academy of Sciences, 1990; Michael and Miller, Plant J., 13, 427–435, 1998. Electroporation technology has been successfully used for genetic transformation of several microalgae species, including Nannochloropsis (see, e.g., Chen et al., J. Phycol., 44:768–76, 2008), Chlorella (see, e.g., Chen et al., Current Genetics, 39:365–370, 2001; Chow and Tung, Plant Cell Rep., Vol. 18, No. 9, 778–780, 1999), Chlamydomonas (Shimogawara et al., Genetics, 148:1821–1828, 1998), and Dunaliella (Sun et al., Mol. Biotechnol., 30(3):185–192, 2005).Microprojectile bombardment, also known as microparticle bombardment, gene gun transformation, or biolistic bombardment, has been successfully used on several algal species, including, for example, diatom species such as Phaeodactylum (Apt et al., Mol. Gen. Genet., 252:572-579, 1996), Cyclotella and Navicula (Dunahay et al., J. Phyc., 31:1004-1012, 1995), Cylindrotheca (Fischer et al., J. Phyc., 35:113-120, 1999), and Chaetoceros (Miyagawa-Yamaguchi et al., Phycol. Res., 59:113-119, 2011), as well as green algae species such as Chlorella (El-Sheekh, Biologia Plantarum, Vol. 42, No. 2: 209-216, 1999) and Volvox species (Jakobiak et al., Protist, 155: 381-93, 2004). In addition, Agrobacterium-mediated gene transfer technology can also be used for gene transformation of microalgae, as reported by, for example, Kumar, Plant Sci., 166(3): 731-738, 2004 and Cheney et al., Journal of Phycology, Vol. 37, Supplement 11, 2001.

[0200] Transformation vectors or constructs as described herein will typically include a marker gene that imparts a selectable or scorable phenotype to the target host cell (e.g., algae cells), or can be co-transformed with a construct comprising a marker. Many selectable markers have been successfully developed for the effective isolation of genetic transformants of algae. Common selectable markers include antibiotic resistance, fluorescent markers, and biochemical markers. Several different antibiotic resistance genes have been successfully used to select microalgal transformants, including blastocydin, bleomycin (see, e.g., Apt et al., 1996, supra; Fischer et al., 1999, supra; Fuhrmann et al., Plant Journal, 19, 353-61, 1999, Lumbreras et al., Plant Journal, 14(4):441-447, 1998; Zaslavskaia et al., Phycoecology, 36:379-386, 2000), spectinomycin (Cerutti et al., Genetics, 145:97-110, 1997; Doetsch et al., Current Genetics, 146:97-111, 1998). Biology, 39, 49-60, 2001; Fargo, Mol. Cell. Biol., 19: 6980-90, 1999), streptomycin (Berthold et al., Protist., 153: 401-412, 2002), paromomycin (Jakobiak et al., Protist., supra; Sizova et al., Gene., 277: 221-229, 2001), nourseothricin (Zaslavskaia et al., 2000, supra), G418 (Dunahay et al., 1995, supra; Poulsen and Kroger, FEBS Letters, supra).

[0015] The present invention relates to microalgae transformants comprising a plurality of selectable markers, including those for transformants comprising mRNAs, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, proteins, TMPhleomycin D1) resistance (Stevens, Mol. Gen. Genet. 251: 23-30, 1996), as well as paramomycin and neomycin resistance (Sizova et al., 2001, supra). Other fluorescent or chromogenic labels that have been used include luciferase (Falciatore et al., J. Mar. Biotechnol., 1:239–251, 1999; Fuhrmann et al., Plant Mol. Biol., 2004; Jarvis and Brown, Current Genetics, 19:317–322, 1991), β-glucuronidase (Chen et al., 2001, supra; Cheney et al., 2001, supra; Chow and Tung, 1999, supra; El-Sheekh, 1999, supra; Falciatore et al., 1999, supra), and β-glucuronidase (Chen et al., 2001, supra). ; Kubler et al., J. Aquat. Biotech., 1:165–169, 1994), β-galactosidase (Gan et al., J. Appl. Phycol., 15:345–349, 2003; Jiang et al., Plant Cell Rep., 21:1211–1216, 2003; Qin et al., High Technol. Lett., 13:87–89, 2003), and green fluorescent protein (GFP) (Cheney et al., 2001, supra; Ender et al., Plant Cell, 2002; Franklin et al., J. Botanica, 2002; 56, 148, 210).

[0201] Those skilled in the art will readily appreciate that a variety of known promoter sequences can be usefully deployed for transformation systems according to the present invention for microalgae species. For example, promoters commonly used to drive transgenic expression in microalgae include various forms of the cauliflower mosaic virus promoter 35S (CaMV35S), which has been used in both dinoflagellate and green algae (Chow et al., Plant Cell Reports, 18:778-780, 1999; Jarvis and Brown, Current Genetics, 317-321, 1991; Lohuis and Miller, J. Botanica, 13:427-435, 1998). The SV40 promoter from simian virus has also been reported to be active in several algae (Gan et al., Journal of Applied Botany, 151:345-349, 2003; Qin et al., Hydrobiologia, 398-399, 469-472, 1999). Promoters from RBCS2 (ribulose bisphosphate carboxylase, small subunit) of Chlamydomonas sp. (Fuhrmann et al., J. Botany, 19:353-361, 1999) and PsaD (abundant protein of photosystem I complex; Fischer and Rochaix, FEBS Lett., 581:5555-5560, 2001) may also be useful. Fusion promoters of HSP70A / RBCS2 and HSP70A / β2TUB (tubulin) (Schroda et al., J. Botanica, 21: 121-131, 2000) can also be used for improved transgenic expression, wherein the HSP70A promoter can act as a transcriptional activator when placed upstream of other promoters. High-level expression of genes of interest can also be achieved in, for example, diatom species under the control of promoters of the fcp gene encoding the diatom fucoxanthin-chlorophyll a / b binding protein (Falciatore et al., J. Aquat. Biotechnol., 1: 239-251, 1999; Zaslavskaia et al., J. Phyc., 36: 379-386, 2000) or the vcp gene encoding the xanthophyta xanthophyta-chlorophyll a / b binding protein (see U.S. Pat. No. 8,318,482). If desired, inducible promoters can provide rapid and strictly controlled gene expression in transgenic microalgae. For example, the promoter region of the NR gene encoding nitrate reductase can be used as such an inducible promoter. NR promoter activity is typically inhibited by ammonium and induced when ammonium is replaced by nitrate (Poulsen and Kroger, FEBS Letters 272: 3413-3423, 2005), so when microalgae cells are grown in the presence of ammonium / nitrate, gene expression can be turned off or on.Additional algal promoters that may find use in the constructs and transformation systems provided herein include those disclosed in the following patent applications: U.S. Patent No. 8,883,993; U.S. Patent Application Publication No. US 2013 / 0023035; U.S. Patent Application Publication No. US 2013 / 0323780; and U.S. Patent Application Publication No. US 2014 / 0363892.

[0202] The host cell can be an untransformed cell or a cell that has been transfected with at least one nucleic acid molecule. For example, an algal host cell engineered to have attenuated expression of a cpSRP54 gene can further comprise one or more genes that confer any desired property, such as, but not limited to, increased production of a biomolecule of interest (e.g., one or more proteins, pigments, alcohols, or lipids).

[0203] Methods for producing products from photosynthetic organisms

[0204] Also provided herein are methods for producing products from photosynthetic organisms (e.g., algae) by culturing photosynthetic organisms with increased photosynthetic efficiency, such as SGI1, SGI2, cpSRP54, cytoSRP54, a combination of SGI1 and cpSRP54 genes, or a combination of SGI2 and cpSRP54 mutants disclosed herein. The methods comprise culturing a photosynthetic organism mutant SGI1, SGI2, cpSRP54, cytoSRP54, a combination of SGI1 and cpSRP54 genes, or a combination of SGI2 and cpSRP54 in a suitable culture medium to provide a culture of the photosynthetic organism, and recovering biomass or at least one product from the culture. In some embodiments, the product is a lipid. The culture comprising the photosynthetic organism is preferably a photoautotrophic culture, and the culture medium preferably does not contain a significant amount of reduced carbon, i.e., the culture does not contain reduced carbon in a form or level that the algae can use for growth.

[0205] In some embodiments, the photosynthetic organisms can be cultured in any suitable container, including flasks or bioreactors, wherein the photosynthetic organisms can be exposed to artificial light or natural light. Cultures of photosynthetic organisms including mutants can be cultured in a light / dark cycle, which can be, for example, a natural or programmed light / dark cycle, and as illustrative examples, can provide twelve hours of light to twelve hours of darkness, fourteen hours of light to ten hours of darkness, sixteen hours of light to eight hours of darkness, etc.

[0206] Cultivation refers to the intentional promotion of growth (e.g., increase in cell size, cell content, and / or cell activity) and / or reproduction (e.g., increase in cell number through mitosis) of one or more cells by the use of selected and / or controlled conditions. The combination of growth and reproduction can be referred to as proliferation. As shown in the examples herein, mutants provided herein that exhibit a dysregulation of adaptability to low light intensity can achieve higher cell densities in culture over time (e.g., over a period of one week or longer) relative to cultured wild-type algae cells of the same strain that are not dysregulated in low light adaptation. For example, the cpSRP54 mutants can be cultured for at least five days, at least six days, at least seven days, at least eight days, at least nine days, at least ten days, at least eleven days, at least twelve days, at least thirteen days, at least fourteen days, or at least fifteen days, or at least one, two, three, four, five, six, seven, eight, nine, or ten weeks or longer.

[0207] The non-limiting examples of selected and / or controlled conditions that can be used to cultivate recombinant microorganisms can include growth in a culture medium (with known characteristics, such as pH, ionic strength and / or carbon source), a specified temperature, oxygen tension, carbon dioxide level, a bioreactor, etc., or a combination thereof. In certain embodiments, light and a reduced carbon source can be used to grow a mixed diet of microorganisms or host cells. Alternatively, microorganisms or host cells can be phototrophically cultivated. When phototrophically grown, algae strains can advantageously use light as an energy source. Inorganic carbon sources (such as CO 2 or bicarbonate) can be used for biomolecules synthesized by microorganisms. As used herein, "inorganic carbon" comprises carbon-containing compounds or molecules that can not be used as sustainable energy sources by organisms. Typically, "inorganic carbon" can be CO 2 (carbon dioxide), carbonic acid, bicarbonate (bicarbonate salt), carbonate, bicarbonate (bicarbonate salt), etc., or a combination thereof, which can not be further oxidized to obtain sustainable energy, nor can it be used as the source of biological reducing power (reducing power). The microorganism of light autotrophic growth can be grown in a culture medium, wherein inorganic carbon is substantially the only carbon source. For example, in cultures where inorganic carbon is essentially the sole source of carbon, any organic (reduced) carbon molecules or organic carbon compounds that may be provided in the culture medium cannot be taken up and / or metabolized into energy by the cells and / or are not present in amounts sufficient to provide sustainable energy for growth and proliferation of the cell culture.

[0208] Microorganisms and host cells that can be used according to the method of the present invention can be found in different locations and environments around the world. The specific growth medium for the best reproduction and generation of lipids and / or other products can be changed, and can be optimized to promote the growth, reproduction or production of biomass or products (such as lipids, proteins, pigments, antioxidants). Solid and liquid growth mediums are generally available from a variety of sources, such as for the preparation of instructions for specific media applicable to various microbial strains. For example, various fresh water and salt water culture media can be included in Barsanti (2005), " algae: anatomy, biochemistry and biotechnology (Algae:Anatomy, Biochemistry & Biotechnology) ", CRC Press (CRC Press), for the culture medium and method for cultivating algae described in those fresh water and salt water culture media. Algal media recipes can also be found on the websites of various algal culture collections, including, as non-limiting examples, the UTEX Culture Collection of Algae (www.sbs.utexas.edu / utex / media.aspx); the Culture Collection of Algae and Protozoa (www.ccap.ac.uk); and Katedra Botaniky (botany.natur.cuni.cz / algo / caup-media.html).

[0209] Cultural method can optionally comprise the expression of one or more genes that induce and be used to produce product (as but not limited to protein, one or more proteins, antioxidant or pigment that participate in lipid generation), and / or the pathways metabolic in the regulation and control microorganism.Induced expression can comprise and add nutrition or compound in culture, remove one or more components, increase or reduce light and / or temperature and / or promote other operation of gene of interest expression from substratum.This type of operation can depend on the character of (heterologous) promotor that is operably connected to gene of interest to a great extent.

[0210] In some embodiments of the invention, microorganisms that are dysregulated in adapting to low light intensities can be cultured in a "photobioreactor" equipped with an artificial light source and / or having one or more walls that are sufficiently transparent to light (including sunlight) to allow, promote, and / or maintain acceptable microbial growth and proliferation. To produce fatty acid products or triglycerides, photosynthetic microorganisms or host cells can additionally or alternatively be cultured in shake flasks, test tubes, vials, microtiter dishes, Petri dishes, etc., or a combination thereof.

[0211] Alternatively or additionally, recombinant photosynthetic microorganisms or host cells can be grown in ponds, waterways, sea-based growth containers, ditches, trenches, waterways, etc. or their combinations. In such systems, temperature can be unregulated or various heating or cooling methods or devices can be adopted. As with standard bioreactors, inorganic carbon sources (such as, but not limited to CO , bicarbonate, carbonate, etc.) include, but are not limited to, air, CO-rich air, flue gas, etc. or their combinations can be provided to the culture. When flue gas and / or other inorganic sources (except CO ) are provided, it may be necessary to pre-treat this type of source so that the CO level introduced into the (light) bioreactor does not constitute a dangerous and / lethal dose for the growth, proliferation and / or survival of the microorganism.

[0212] The mutant photosynthetic organisms may comprise one or more non-natural genes encoding polypeptides for producing products such as, but not limited to, lipids, colorants or pigments, antioxidants, vitamins, nucleotides, nucleic acids, amino acids, hormones, cytokines, peptides, proteins, or polymers. For example, the encoded polypeptide may be an enzyme, a metabolic regulator, a cofactor, a carrier protein, or a transporter protein. The method comprises culturing a cpSRP54 mutant or a cytoSRP54 mutant to produce biomass or at least one algal product, wherein the mutant comprises at least one non-natural gene encoding a polypeptide involved in product production. Products (e.g., lipids and proteins) can be recovered from the culture by recovery methods known to those skilled in the art, such as by whole culture extraction, e.g., using an organic solvent. In some cases, recovery of fatty acid products can be enhanced by cell homogenization. For example, lipids (such as fatty acids, fatty acid derivatives, and / or triglycerides) can be isolated from algae by extracting the algae with a solvent at elevated temperature and / or pressure, as described in co-pending, commonly assigned U.S. Patent Application Publication No. US2013 / 0225846, which is incorporated herein by reference in its entirety.

[0213] After reviewing this disclosure, other alternative embodiments and methods will be apparent to those skilled in the art. The discussion of the general method provided herein is intended for illustrative purposes only. The following non-limiting examples are provided below.

[0214] Examples

[0215] Example 1

[0216] Generation of Pseudomonas strains overexpressing CAS9

[0217] The generation of Pseudochlorella strains overexpressing Cas9 is described in U.S. Patent Application Publication No. 2016 / 0304896, which is incorporated by reference in its entirety.

[0218] Briefly, vector pSGE-6709 was engineered for expression of the S. pyogenes Cas9 gene in Pseudomonas sp. The vector comprises the following three elements: (1) a Cas9 expression cassette containing an engineered Cas9 gene codon-optimized for Pseudochlorella and containing an intron from Pseudochlorella, further comprising an N-terminal FLAG tag, a nuclear localization signal and operably linked to the Pseudochlorella RPS17 promoter, and a peptide linker terminated by the Pseudochlorella RPS17 terminator; a selectable marker expression cassette containing a blasticidin resistance gene from Aspergillus terreus codon-optimized for Pseudochlorella and containing an intron from Pseudochlorella, operably linked to the Pseudochlorella RPS4 promoter and terminated by the Pseudochlorella RPS4 terminator; and a GFP reporter gene expression cassette containing the TurboGFP gene (Evrogen, Moscow, Russia) driven by the Pseudochlorella ACP1 promoter and terminated by the Pseudochlorella ACP1 terminator.

[0219] The vector was transformed into Pseudomonas sp. by biolistic method. Gene gun system (BioRad Transformation of Pseudochlorella wild-type strain WT-1185 was accomplished using a Gene Gun System) essentially as described in U.S. Patent Publication No. 2014 / 0154806, which is incorporated herein by reference. The DNA for transformation was precipitated onto gold particles adhered to the inside of a length of tubing, and a burst of helium was burned through the tubing positioned within the gene gun to propel the DNA-coated gold particles into Pseudochlorella strain WT-1185 cells adhered to a solid non-selective medium (2% agar plates containing PM074 algal growth medium). Using The gene gun was fired at 600 psi, with two bullets per cell circle fired from a distance of 3-6 cm from the plate. The next day, the cells were transferred to selective medium for the growth of transformed colonies.

[0220] Colonies were screened for full GFP penetrance by flow cytometry and identification of transformed strains whose single fluorescence peak shifted to a higher value than the wild-type fluorescence peak. To demonstrate Cas9 expression, fully infiltrated Cas9 strains were tested for Cas9 expression by anti-Cas9 Western blotting, which showed a significantly shifted fluorescence peak relative to untransformed cells. Based on these screens, isolate 6709-2 was carried forward and given the strain identifier GE-15699.

[0221] Example 2:

[0222] Knockout of CPSRP54 using a fully penetrant Chlorella Cas9 editing line

[0223] Knockout of cpSRP54 using a fully penetrant Pseudochlorella Cas9 editing line is described in U.S. Patent Application Publication No. 2016 / 0304896, which is incorporated by reference in its entirety. Briefly, a chimeric gRNA (SEQ ID NO: 103) was designed, with the last three nucleotides representing the PAM, and synthesized in vitro to target the chloroplast SRP54 gene in the Pseudochlorella coding sequence.

[0224] GE-15699 was transformed by electroporation with 1-2 μg of purified chimeric guide RNA and 1 μg of selectable marker DNA containing a bleomycin resistance "BleR" gene codon-optimized for Pseudochlorella and containing an intron from Pseudochlorella (SEQ ID: 70). The BleR gene was operably linked to the Pseudochlorella RPS4 promoter (SEQ ID: 71) and terminated by the Pseudochlorella RPS4 terminator (SEQ ID: 72).

[0225] Electroporation was performed by inoculating 100 mL of seed culture that was inoculated with 1 × 10 6 cells / ml, so that 1 L of culture was inoculated with 1 × 10 6 On the day of transformation, cells were pelleted by centrifugation at 5000 x g for 20 minutes, washed three times with 0.1 μm filtered 385 mM sorbitol, and resuspended in 385 mM sorbitol to a concentration of 5 × 10 cells / ml. 9 cells / ml. Under different conditions, the TM 100 μL of concentrated cells were electroporated in a 0.2 cm cuvette. The DNA used to optimize electroporation was linearized pSG6640, containing bleR and TurboGFP expression cassettes. The TurboGFP cassette contained the Pseudochlorella ACP1 promoter (SEQ ID NO: 67) and the Pseudochlorella ACP1 terminator (SEQ ID NO: 68) operably linked to the TurboGFP gene (SEQ ID NO: 24). Immediately after electroporation of the pre-cooled cells and cuvette, 1 mL of cold sorbitol was added and used to transfer the cells to 10 mL of PM074. After overnight recovery, the cells were concentrated and spread onto a 13 cm diameter PM074 culture medium containing 250 mg / L zeocin and grown under the conditions listed in the gene gun section.

[0226] Electroporation conditions are 1.0-1.2kV (5000-6000V / cm), 200-300 ohms and 25-50 μF. Using a larger amount of DNA increases the number of obtained bleomycin-resistant colonies, although the effect reaches stability under the amount greater than 4 μg. After electroporation, cells are plated on agar medium (PM130) containing 250 μg / ml bleomycin, to select the transformant incorporating the ble box. Using primers designed for amplification across natural targeting loci (oligo-AE596 and oligo-AE597), transformants are screened by colony PCR. Primers are designed to produce a 700bp band in the absence of integration (e.g., " knock-in " of BleR box) into the locus, or a 4.3kb band if there is a single ble box integrated into the targeting locus. In addition, colony PCR was performed using primers designed to amplify a fragment extending from the cpSRP54 gene (oligo-AE597) to the selectable marker. Depending on the orientation of the integrated ble cassette, a 1.2 kb band will be generated by amplification of primers 405 / 597 or primers 406 / 597 from the inside of the ble cassette to the outside into the cpSRP54 gene. The results show a high frequency of knock-in of the BleR cassette into the targeted locus (between 40% and 45% in this sample) in the absence of homology arms. cpSRP54 knockout results in a light green phenotype.

[0227] Example 3

[0228] Knockout of SgI2 using a fully penetrant Chlorella Cas9 editing line

[0229] Knockout of SGI2 using a fully penetrant Pseudochlorella Cas9 editing line was performed essentially as described above for cpSRP54. Briefly, a chimeric gRNA (SEQ ID NO: 104) was designed, with the last three nucleotides representing the PAM, and synthesized in vitro to target the chloroplast SGI2 gene in the Pseudochlorella coding sequence.

[0230] GE-15699 was transformed by electroporation with 1-2 μg of purified chimeric guide RNA and 1 μg of selectable marker DNA containing a bleomycin resistance "BleR" gene codon-optimized for Pseudochlorella and containing an intron from Pseudochlorella (SEQ ID: 70). The BleR gene was operably linked to the Pseudochlorella RPS4 promoter (SEQ ID: 71) and terminated by the Pseudochlorella RPS4 terminator (SEQ ID: 72).

[0231] Ble-resistant colonies were selected and knockout was confirmed by PCR.

[0232] Example 4

[0233] Knockout of SGI1 using a fully penetrant Chlorella Cas9 editing line

[0234] SGI1 knockout strain 24183 was generated starting from the mother strain GE-15699 expressing Cas9. GE-15699 cells were electroporated with a chimeric gRNA (SEQ ID NO: 105, the last three nucleotides of SEQ ID NO: 105 representing the PAM), and a DNA cassette containing a codon-optimized Cre gene flanked by a nitrite reductase promoter and terminator, and as Figure 10 As shown in A. The box also contains the ble and GFP genes that have been used previously. Ble and GFP are flanked by lox2272 sites. When Cre is expressed, the lox sites recombine and loop out DNA between these sequences. Homologous sequences of the SGI1 gene surrounding the CRISPR target are also located at the ends of the box to enhance single copy integration. In the case of the presence of a box in the SGI1 locus, the sequence is confirmed by DNA sequencing. ddPCR is used to confirm that the copy number is a single copy integrant. The strain is then cultured in a non-ammonium containing media to express Cre. When Cre is expressed, the lox sites recombine and loop out DNA between these sequences.

[0235] Example 5

[0236] Double knockout of SGI2 and CPSRP54 using a fully penetrant Chlorella Cas9 editing line

[0237] Double knockout of SGI2 and SRP54 using a fully penetrant Pseudochlorella Cas9 editing line was performed essentially as described above for cpSRP54. Briefly, two chimeric gRNAs, one for cpSRP54 (SEQ ID NO: 69) and the other for SGI2 (SEQ ID NO: 73), with the last three nucleotides representing the PAM, were designed and synthesized in vitro to target the chloroplast SGI1 gene in the Pseudochlorella coding sequence.

[0238] GE-15699 was transformed by electroporation with 1-2 μg of purified chimeric guide RNA and 1 μg of selectable marker DNA containing a bleomycin resistance "BleR" gene codon-optimized for Pseudochlorella and containing an intron from Pseudochlorella (SEQ ID: 70). The BleR gene was operably linked to the Pseudochlorella RPS4 promoter (SEQ ID: 71) and terminated by the Pseudochlorella RPS4 terminator (SEQ ID: 72).

[0239] Ble-resistant colonies were selected and knockout was confirmed by PCR.

[0240] Example 6

[0241] Double knockout of SGI1 and CPSRP54 using a fully penetrant Chlorella Cas9 editing line

[0242] The Pseudochlorella sp. SGI1 knockout strain 24183 described above was electroporated with a chimeric gRNA targeting cpSRP54 (SEQ ID NO: 69) and a DNA cassette including ble and GFP sequences ( Figure 10 B) to generate a double knockout of SGI1 and cpSRP54. Ble-resistant colonies were selected and knockout was confirmed by PCR. Three double knockout strains were generated: STR24538, STR24540, and STR24541, which were identical in photophysiological properties and physical phenotype.

[0243] Example 7

[0244] Generation of a Chlorella sp. SGI1 knockout strain containing a single copy of the CAS9 gene

[0245] The bleomycin resistance "BleR" gene, which is codon-optimized for Pseudochlorella and includes introns from Pseudochlorella (SEQ ID: 70), a GFP gene, a Cre gene, a lox site, and a Cas9 gene, is cloned into a pCC1BAC vector. The Cas9 gene is operably linked to the Pseudochlorella RPS17 promoter and includes 29 natural PBP introns and is located outside the lox2272 site. The Cas9 gene is terminated by the Pseudochlorella RPS17 terminator. The BleR gene is operably linked to the Pseudochlorella RPS4 promoter (SEQ ID: 71) and terminated by the Pseudochlorella RPS4 terminator (SEQ ID: 72). The GFP gene is operably linked to the Pseudochlorella ACP1 promoter and terminated by the Pseudochlorella ACP1 terminator. The Cre gene is operably linked to the Pseudochlorella nitrite reductase promoter and the Pseudochlorella nitrite reductase terminator. These genes are flanked by a portion of the SGI1 (CheY) sequence that serves as a homologous recombination site. Figure 17 A schematic diagram of the recombinant pCC1BAC vector is shown.

[0246] Transformation of WT Chlorella host strain: STR00010

[0247] A Cas9 gene WT Pseudomonas host strain was co-transformed with a gRNA targeting the SGI1 gene (SEQ ID NO: 74) and a Pvul digested and spin purified selection cassette (NAS00460, SEQ ID NO: 86).

[0248] The selection cassette (NAS00460) includes a fragment comprising a 1.7 kb vector backbone upstream of the SGI1 homologous recombination (HR) upper arm (corresponding to sequence 1-1761 of SEQ ID NO: 86) and a vector-free portion downstream of the SGI1 Hr lower arm, a bleomycin resistance "BleR" gene codon-optimized for Pseudomonas and containing introns from Pseudomonas (SEQ ID: 70), a GFP gene (corresponding to sequence 8260-8961 of SEQ ID NO: 86), and a Cas9 gene. The selection cassette contains ble and GFP within lox sites. The CRE gene (corresponding to sequence 10418-13326 of SEQ ID NO: 86) includes six nitrite reductase codon-optimized Pseudomonas introns under a nitrite reductase inducible promoter (corresponding to sequence 9906-10417 of SEQ ID NO: 86). The Cre gene is terminated by a nitrite reductase terminator (corresponding to sequence 13327-15140 of SEQ ID NO: 86). The Cas9 gene containing 29 natural PBP introns corresponds to sequence 15754 to sequence 25918 of SEQ ID NO: 86. The Cas9 gene is under the Pseudochlorella RPS17 promoter (corresponding to sequence 15166-15753 of SEQ ID NO: 86) and contains 29 natural PBP introns and is located outside the lox site. The Cas9 gene is terminated by the Pseudochlorella RPS17 terminator (corresponding to sequence 25919-26373 of SEQ ID NO: 86).

[0249] The BleR gene is operably linked to the Pseudochlorella RPS4 promoter (SEQ ID: 71) and terminated by the Pseudochlorella RPS4 terminator (SEQ ID: 72). The GFP gene is operably linked to the Pseudochlorella ACP1 promoter (corresponding to sequences 7688 to 8259 of SEQ ID NO: 86) and terminated by the Pseudochlorella ACP1 terminator (corresponding to sequences 8692 to 9830 of SEQ ID NO: 86). The SGI1 homologous recombination (HR) upper arm corresponds to sequences 1762 to 3578 of SEQ ID NO: 86. The SGI1 homologous recombination (HR) lower arm corresponds to sequences 26448 to 28447 of SEQ ID NO: 86. The 5' lox2272 site corresponds to sequences 3831 to 3864 of SEQ ID NO: 86, and the 3' lox2272 site corresponds to sequences 9839 to 9872 of SEQ ID NO: 86. All sequences were within a 2 kb homology region upstream and downstream of the SGI1 CRISPR target.

[0250] When the SGI1 gRNA (SEQ ID NO: 105) and selection cassette (SEQ ID NO: 86) were co-transformed, the SGI1 gene was knocked out, and the selection cassette, which included Cas9, BleR, and GFP genes, was inserted into the SGI1 locus by homologous recombination. The BleR and GFP genes were flanked by lox2272 sites, while the Cas9 and Cre genes of the selection cassette were located outside the lox2272 sites but within the portion of the SGI1 sequence that served as a homologous recombination site.

[0251] Once the selection cassette is inserted into the SGI1 locus, the Cre gene is operably linked to an inducible nitrite reductase promoter. Therefore, when the microorganism is grown in a growth medium comprising nitrite, Cre gene expression is induced. During Cre gene expression, the Cre enzyme acts on the lox2272 site and removes the BleR and GFP sequences flanking the lox sites. This results in a system in which selectable markers (e.g., GFP, other antibiotic markers, e.g., BleR) can be reintroduced during subsequence transformation of other sequences.

[0252] Screening of transformed Pseudomonas strains for Cas9 insertion

[0253] Transformed Chlorella cells were plated to single colonies on selective plates containing ammonium to suppress CRE expression, patched colonies were plated again on selective suppression plates, and screened for knockout using PCR and GFP shift. The PCR primers used to confirm knockout are as follows:

[0254] AE803:AGGCTACTCTCAGACATGACGGTGGCCTCTG (SEQ ID NO:87)

[0255] ST815:GCCACAAATGAAGGTTGGCAGGGTCAGTGC (SEQ ID NO:88)

[0256] PCR positive reactions were sent for sequencing to confirm knockout (insertion of the cassette) and perfect HR. The inventors of the present application surprisingly and unexpectedly found that it was a single copy of the Cas9 gene that was inserted into the SGI1 locus.

[0257] Example 8

[0258] Triple knockout of SGI1, SGI2, and CPSRP54 using a fully penetrant Chlorella single-copy CAS9 editing line

[0259] The Pseudochlorella SGI1 knockout strain STR24129 was generated as described above, having a single copy of Cas9 and Cre inserted into the SGI1 locus, wherein the marker (ble / GFP) was flanked by removal using the SGI1 knockout guide sequence: ACACCACCTTAAGGCACATGAGG (SEQ ID NO: 89).

[0260] The SGI1 knockout strain STR24129 was used as a transformation host to knock out the SGI2 and SRP54 genes. Host strain STR24129 was co-transformed with gRNAs targeting the SGI2 and SRP54 genes and a selection cassette (pSGE06866) comprising ultramers containing homologous recombination (HR) arms for each target (e.g., SRP54 and SGI2). The BleR gene was operably linked to the Pseudochlorella RPS4 promoter (SEQ ID: 71) and terminated by the Pseudochlorella RPS4 terminator (SEQ ID: 72). The GFP gene was operably linked to the Pseudochlorella ACP1 promoter and terminated by the Pseudochlorella ACP1 terminator. The selection cassette included the BleR and GFP markers surrounded by lox sites for potential marker recycling. When Cre is expressed, the lox sites recombine, looping out DNA between these sequences.

[0261] The transformed host cells were plated on selective plates, and patched colonies and single colonies were picked and screened for knockout using PCR. PCR positive reactions were sent for sequencing to confirm the knockout of each target (insertion of the cassette).

[0262] Figure 16A and 16B show schematic diagrams of the selection cassettes used to knock out Pseudochlorella SRP54 and Pseudochlorella SGI2. The sequences of the gRNA and the Ultramer with HR arms are shown below.

[0263] SRP54-EMRE3EUKT592650

[0264] gRNA sequence: GGCGTGGGACATGGTGCGCAAGG (SEQ ID NO:90)

[0265] Ultramer with HR arms to amplify pSGE06866:

[0266] ST938_HR_SRP54-UP

[0267] TGAAGCACCCCCCGGCCTCTCCCCCCGCAGGGCCGCCCCTCCCGCCTCGTCGTGC (SEQ ID NO:91)

[0268] ST939_HR_SRP54-DOWN

[0269] CGCAACGCTCTCCCTCCCCACCCCCCAGCCTCACATCCGCCTCAAGCAGCGCCCTG(SEQ ID NO:92)

[0270] Primer sequences:

[0271] ST949_CasPipe9GT_SRP54-fwd:caagctatgcgaggaagggagggtc(SEQ ID NO:93)

[0272] ST950_CasPipe9GT_SRP54-rev:ctgccgcaagtgagtgtgctgtc(SEQ ID NO:94)

[0273] Additional primers for screening - located in the selection cassette:

[0274] JV946 - Linker 5 - for: caccagatataggtgacccgataac (SEQ ID NO: 95)

[0275] AE608ble rev:AAAACTCCACTGCACCTGCAACAT(SEQ ID NO:96)

[0276] SGI2-EMRE3EUKT590485

[0277] gRNA sequence:

[0278] ST937_crRNA_064_EMRE3EUKT590485:TGCGGTGAAGCTTGGAGCTG (SEQ ID NO:97)

[0279] Ultramer sequence placing the HR arm on PSGE06866

[0280] ST940_HR_SGI2-UP

[0281] TTGCCGTCGACGAGACTTCGGGGCGCGCATTTATCGACTCTCTTGAAGATACACCGGTT(SEQ IDNO:98)

[0282] ST941_HR_SGI2-DOWN

[0283] TCCAATTGTAGATATCATATTGTTTCCGGACCTACCTTACGCACTGAGTGCTGCCAGATGTTCTT(SEQID NO:99)

[0284] Primer sequences:

[0285] ST046CasPipe9GT-064-fwd:gaggtgggtggtagtgcttcgcgaggtg(SEQ ID NO:100)

[0286] ST047CasPipe9GT-064-rev:atcacagctcacagggcagacactgcgtc(SEQ ID NO:101)

[0287] Primer sequences:

[0288] Primers JV946 and AE608 were also used as screening primers.

[0289] Example 9

[0290] Bioinformatics analysis of the domain structure of SGI2 protein

[0291] The domain architecture of exemplary SGI2 proteins from Pseudochlorella, Oocystis, Tetraselmis, and Arabidopsis thaliana was analyzed using the online tool InterProScan (tool version 5.27, database version 66.0, from EMBL-EBI, Hinxton, Cambridgeshire, CB10 1SD, UK).

[0292] like Figure 3-9As shown, a single conserved response-receiving domain was identified at the N-terminus of the SGI2 protein.

[0293] Example 10

[0294] Bioinformatics analysis of the response receptor domains of various SGI2 proteins

[0295] Using the BLOSUM62 matrix, a gap penalty of 10, and an extension penalty of 0.5, a local alignment of the Pseudochlorella sp. response receiver domain (SEQ ID NO: 6) with other orthologous protein pairs from other algal species and various plants was performed. The local alignment of the Pseudochlorella sp. response receiver domain (SEQ ID NO: 6) with various photosynthetic organisms is shown in Table 5 below.

[0296] Table 5: Local alignment of the Pseudochlorella response receptor domain with various orthologous proteins.

[0297]

[0298]

[0299]

[0300] The response receptor domain of Pseudochlorella showed a higher percentage of identity with other algal species and a high degree of similarity with various plant species.

[0301] Example 11

[0302] Screening of low-chlorophyll mutants of Pseudochlorella WT-1185

[0303] After knockout of the SGI1, SGI2, double knockout of SGI1 and cpSRP54, or double knockout of SGI2 and cpSRP54 in Pseudomonas sp., cells from light-colored colonies were selected and allowed to grow under low light (100 μmol photons m -2 sec -1) for one to five days, and then use BD FACSAria II flow cytometer (BD Biosciences, San Jose, California) to sort it by flow cytometry, to select cells with low chlorophyll fluorescence. Usually, the cell part with the minimum about 0.5% to 2% chlorophyll fluorescence compared with the total cell population is selected. After the sorted cell plating, the cell line with the antenna reduction separated by flow cytometry is further initially screened by visually selecting light green or yellow bacterium colonies. In order to screen the cell line with the antenna reduction of presumption from other reduced pigment mutants and false positives, before light physiological measurement, the secondary culture screening of medium throughput is carried out to selected bacterium colonies, so that the isolate is adapted to low light conditions. Chlorophyll fluorescence is monitored during the low light adaptation period to select clones with the chlorophyll fluorescence characteristics of the reduction retained in the high light adaptation state. When transferred to low light from high light, selected clones only show a small amount of increase (relative to wild-type cells) of chlorophyll.

[0304] Use at 75cm 2 165 ml of culture in a tissue culture flask was grown under constant high light (approximately 1,700 μmol photons m -2 sec -1 ) were subjected to semi-continuous culture assays to identify strains with increased productivity (increased biomass production rate, measured as total organic carbon (TOC) accumulation) relative to the wild-type ancestral strain WT-1185. Two 75 cm 2 Flask. The flask has a stopper with a tube connected to a syringe filter for delivering CO2-enriched air (1% CO2) that is bubbled through the culture. The width of the flask (the narrowest dimension) is aligned with the LED light bank. The depth of the culture (the distance from the flask wall closest to the light source to the rear wall of the flask) is approximately 8.0 cm. At the beginning of the light cycle, the culture is diluted daily by removing 65% of the culture volume and replacing it with diluted fresh PM119 medium to accommodate the increase in salinity caused by evaporation from the culture (212 ml di H2O to 1 L PM119 medium). Samples for TOC analysis are taken from the culture removed for dilution.

[0305] Example 12

[0306] Semi-continuous productivity assay of Pseudochlorella mutants

[0307] A strain of Chlorella vulgaris found to have reduced chlorophyll under low light conditions was analyzed to increase productivity. In the productivity assay, photoautotrophic cultures of the mutant were grown under constant light semi-continuous mode (CL-SCPA) for several days, with culture samples removed daily for biomass determination. The light was maintained at a constant 1900-2000 μmol photons m -2 sec -1 In this assay, 225 cm2 of culture medium was inoculated with a seed culture of a given mutant strain. 2 PM119 medium in flasks. Three cultures were started for each strain. The flasks contained a stirring rod and had a stopper with a tube connected to a syringe filter for delivering CO2-enriched air (1% CO2) bubbled through the culture. The width of the flask (the narrowest dimension) was aligned with the LED light bank. The "depth" dimension of the flask extending backward from the light source was 13.7 cm. Taking into account the position of the flask, the farthest distance between the cells in the flask and the surface of the light source was approximately 15.5 cm. The culture was diluted every day by removing 65% of the culture volume and replacing it with diluted fresh PM119 medium to adapt to the increase in salinity due to evaporation in the culture. Samples for TOC analysis were taken from the culture removed for dilution. Once the culture reached a steady state, the semi-continuous productivity assay ran for 12 days.

[0308] The productivity of the assay was assessed by measuring total organic carbon (TOC) from samples removed daily. Total organic carbon (TOC) was determined by diluting 2 mL of cell culture to a total volume of 20 mL with deionized water. Three injections were made per measurement into a Shimadzu TOC-Vcsj analyzer to determine total carbon (TC) and total inorganic carbon (TIC). The furnace was set to 720°C and TOC was determined by subtracting TIC from TC. A 4-point calibration range of 2 ppm to 200 ppm was used, corresponding to 20-2000 ppm of undiluted culture, with a correlation coefficient r2>0.999.

[0309] A number of embodiments of the present invention have been described. However, it should be understood that the elements of the embodiments described herein can be combined to form additional embodiments, and various modifications can be made without departing from the spirit and scope of the present invention. Therefore, other embodiments, alternatives, and equivalents are within the scope of the present invention as described and claimed herein.

[0310] Example 13

[0311] Semi-continuous urea batch assay for Pseudochlorella mutants

[0312] In a SCUBA (semi-continuous urea batch assay), photoautotrophic cultures of the mutants were grown for several days in a semi-continuous mode of diurnal light with nitrogen repletion and then in a nitrogen-depleted batch mode. The light was programmed to mimic the average May 4th day light intensity of 2000 μmol photons m from dark to noon in the Imperial Valley, California. -2 sec -1 Samples were taken daily at "dusk". In this assay, 420 ml of urea-based PM153 medium in a 500 ml square flask was inoculated with a seed culture of a given mutant strain.

[0313] PM152 is a nutrient-depleted medium based on PM074, but contains urea instead of nitrate as a nitrogen source. F / 2 of algae feed part A (Aquatic Eco-Systems) and 1.3 ml of 'Solution C' were added to a final volume of 1 liter of instant sea salt solution (17.5 g / L) (Aquatic Eco-Systems, Apopka, FL). Solution C consisted of 38.75 g / L NaH2PO4 H2O, 758 mg / L thiamine hydrochloride, 3.88 mg / L vitamin B12, and 3.84 mg / L biotin.

[0314] Three cultures were started for each strain. The flasks contained a stir bar and had a stopper with tubing connected to a syringe filter for delivering CO2-enriched air (1% CO2) that was bubbled through the cultures. The flasks were placed with a syringe toward the 0.0875 m 2 The hole of the light is aligned, and the "depth" dimension of the flask extending backward from the light source is 8 cm. For the mensuration of semi-continuous biomass, the culture is diluted every day by removing 40% of the culture volume and replacing it with diluted fresh PM153 culture medium to adapt to the salinity increase caused by evaporation in the culture. From the culture removed for dilution, a sample for TOC analysis is taken out. The semi-continuous productivity assay is run until the culture reaches a steady state. After semi-continuous, the culture is removed from the assay, precipitated using centrifugation and resuspended in 420 ml of nitrogen-depleted PM152 culture medium. Using the same growth conditions as the semi-continuous mode, the culture is cultured in batches for 4-5 days. During batch mode, FAME samples are collected to determine lipid productivity, and TOC samples are collected to determine FAME / TOC.

[0315] Example 14

[0316] Chlorophyll content, antenna size, and photophysiology of Pseudochlorella knockout mutants expressing SGI1, SGI2, SGI1 and SRP54, and SGI2 and SRP54

[0317] By using methanol extraction cells and by spectrophotometric analysis supernatant, determine the chlorophyll content of high productivity mutant. In brief, 500 μ l culture fluid aliquots are pipetted in the 2.0 ml twisted top test tube, and use table microcentrifuge to continue precipitation 10 minutes with 15,000rpm. From precipitation, suck out supernatant, and each precipitate is resuspended in 99.8% methyl alcohol (previously neutralized with magnesium carbonate) of 1.5 ml. 0.2 ml glass beads (diameter is 0.1 mm) are added in each bottle, and knocked and continued 3 minutes. 1.0 ml supernatant is transferred in the new 1.7 ml turnover type pipe, and in table microcentrifuge with 15,000rpm centrifugal and continued 10 minutes. The gained precipitate is white, shows to have extracted fully. Every kind of supernatant of 0.8 ml is pipetted in the optical glass cuvette, and immediately read the absorption wavelength under the wavelength of 720 nm, 665 nm and 652 nm. Spectrophotometric measurements were performed in dual-beam mode using 99.8% methanol blanks. The following equation was used to calculate chlorophyll concentration: Chlorophyll a [gm -3 ]=16.72(A665-A720)+9.16(A652-A720) and chlorophyll b[gm -3 ] = 34.09 (A652-A720)–15.28 (A665-A720). Chlorophyll a and b amounts were normalized on a per-cell and per-TOC basis. While the total chlorophyll amount per cell varied in the SGI1-2261 mutant, it was generally reduced by approximately 30% to approximately 65% ​​relative to wild-type cells, consistent with the observed reduction in antennae size. On a per-TOC basis, the reduction in total chlorophyll in the SGI1 mutant ranged from approximately 30% to approximately 50% relative to wild-type cells.

[0318] In addition to chlorophyll content, the functional absorption cross section of PSII, the functional absorption cross section of PSI, and 1 / τ' of the SGI1 and SGI2 knockout mutants and the double knockouts of SGI1 and SRP54 and SGI2 and SRP54 were analyzed. Qa (The light-saturated rate of electron transfer on the acceptor side of photosystem II at light saturation, a measure of the efficiency of linear photosynthetic electron transport) and the maximum carbon fixation rate Pmax. Cells of wild-type and mutant strains were cultured in the constant light semi-continuous culture assay (CL-SCPA) described above.

[0319] Various photosynthetic parameters were analyzed using the Fluorescence Induction and Relaxation (FIRe) technique, which was developed to measure a comprehensive range of photosynthetic and physiological characteristics of photosynthetic organisms (Gorbunov and Falkowski (2005), "Fluorescence Induction and Relaxation (FIRe) Technique and Instrumentation for Monitoring Photosynthetic Processes and Primary Production in Aquatic Ecosystems": In Photosynthesis: Fundamental Aspects to Global Perspectives, 13th International Photosynthesis Congress, Montreal, August 29-September 3, 2004. (Editors: A. van der Est and D. Bruce), Allen Press, Vol. 2, pp. 1029-1031). The FIRe technique relies on the measurement and analysis of the chlorophyll "variable fluorescence" profile (reviewed by Falkowski et al., 2004, "Development and Application of Variable Chlorophyll Fluorescence Techniques in Marine Ecosystems": Chlorophyll a Fluorescence: A Signature of Photosynthesis (C Papageorgiou and Govingjee, eds., Springer-Verlag, pp. 757-778), which relies on the relationship between chlorophyll fluorescence and the efficiency of photosynthetic processes. This technique provides a set of parameters that characterize the photosynthetic light harvesting process, photochemistry in photosystem II (PSII), and the transport of photosynthetic electrons down to carbon fixation. The measurements performed here were made using a miniature FIRe device manufactured by Maxim Gorbunov, Rutgers University, East Bronxwick, NJ. It is available from Sea-Bird Technologies. The FIRe device is commercially available from Satlantic Scientific (Halifax, Canada, satlantic.com and planet-ocean.co.uk). Further information on the use of the FIRe device is provided in the company brochure.All measurements were performed using constant light (2000 μmol photons m. -2 sec -1 ) semi-continuous culture (CL-SCPA) (see Example 3). In order to obtain FV / FM and σPSII, fluorescence induction and relaxation (FIRe) kinetics were measured in the dark. The F values ​​presented in Table 6 v / F M and σ PSII The values ​​were calculated as the mean of 6 measurements (3 measurements in each of 2 biological replicates), and the errors of these parameters did not exceed 5%.

[0320] The PSI cross section measurements were performed using a modified JTS-10 spectrometer with a filter set for measuring the electrochromic shift (ECS) at 520 nm equipped with a custom single flip flash (STF). The peak power density in the sample chamber was high enough to ensure complete shutdown of the reaction center within approximately 10 μs. The resulting excitation rate was approximately 1-3 hits per reaction center per 10 μs (depending on the functional absorption cross section of the photosystem). The STF generated short, ultrabright blue light pulses (455 nm with a half-bandwidth of 30 nm), and the pulse timing was controlled by the trigger of the JTS-10 spectrometer. The pulse duration was controlled by the STF pulse control box and could be adjusted in the range of 1 μs to 50 μs using the potentiometer on the front panel. To measure the PSI cross section, the culture was diluted to an OD of approximately 0.2 at the chlorophyll maximum (approximately 440 nm) based on measurement of the absorption spectrum of the cell suspension using a Perkin Elmer Lambda 650 spectrophotometer equipped with an integrating sphere. The spectrophotometer was used with intensities ranging from 4000 to 120,000 μmol photons m in the presence of DCMU and hydroxylamine. -2 s -1 The ECS was measured by a 10 μs flash. A simple exponential function was used to fit the experimental curve.

[0321]

[0322] ECS M ECS M is the maximum ECS signal; ItIt is the photon density in photons per square meter; and σ PSI σ PSI The functional cross section of PSI obtained for wild-type Pseudomonas sp. (WT-1185) was (4.0±0.5)×10 -18 (4.0±0.5)×10 -18 m 2These values ​​are close to those under the same conditions (σ PSII =(4.3±0.1)×10 -18 σ PSII =(4.3±0.1)×10 -18 The error of these parameters is estimated to be no more than 20%.

[0323] Carbon fixation rate (C 14 The Pmax) is used in the culture medium containing 0.5g l-1 (5.95mM) sodium bicarbonate and is normalized to 5 μ g chl ml-1 culture to measure.With 20.4 μ Ci ml-1C14-labeled sodium bicarbonate is added in every kind of culture, and is exposed to 2500 μ E and continues 10 minutes.Use 2N HCl acidification sample immediately, and allow its exhaust to spend the night.On the second day, use Beckman LS6500 scintillation counter to measure sample and quantize.

[0324] τ'Qa (the electron transfer time on the acceptor side of PSII measured under saturating light conditions—effectively determined by the slowest step of linear photosynthetic electron transport) was measured from the FIRe light curve and dark-induced relaxation kinetics (DIRK) profiles. The bulk PSII concentration relative to wild type was estimated as (Fv / σ 530PSII The error of these parameters is estimated to be no more than 15%. The optical absorption cross section (averaged over the light source emission spectrum) is estimated using the following equation:

[0325]

[0326] where [Chl / TOC] is the chlorophyll / TOC of the sample, OD(λ)OD(λ)is the optical density of the sample measured at wavelength λλ, ΔlΔl is the beam path length measured in the cuvette (1 cm), and I(λ)I(λ)is the intensity of the light source used to grow the algae at wavelength λλ.

[0327] Table 6. Fluorescence and photosynthetic parameters measured using FIRe technology

[0328]

[0329] The light physiological data, chlorophyll content and productivity data of the wild-type Pseudochlorella strain WT-1185, single knockouts of the SRP54 and SGI2 genes, and double knockouts of the SGI2 and SRP54 genes in Pseudochlorella were summarized and evaluated. All measurements were performed using CL-SCPA cultures. In order to obtain FV / FM and σPSII, fluorescence induction and relaxation (FIRe) kinetics were measured in the dark. The values ​​presented for Fv / Fm and σPSII were calculated as the average of 6 measurements (3 measurements for each replicate in 2 biological replicates) - the error for these parameters did not exceed 5%. τ'Qa (the electron transfer time on the PSII acceptor side measured under saturating light conditions - effectively determined by the slowest step of linear photosynthetic electron transport) was measured from the FIRe light curve and the DIRK spectrum. The PSI cross section measurements were performed as described above. The results are summarized in Table 7 below.

[0330] Table 7. Photophysiology, chlorophyll and productivity data

[0331]

[0332] The functional absorption cross section of PSII was significantly reduced (50%), and the number of functional PSII complexes was also reduced. The cells had an improved carbon fixation capacity (Pmax increased by 26%). Single knockout of SGI2 or SRP54 showed an increase in TOC productivity of at least 17% compared to the wild-type strain. Overall, the double SGI2 / SRP54 knockout strain showed a 32% increase in TOC productivity (two runs of the double SGI2 / SRP54 knockout strain on the CL-SCPA assay showed productivity >40 g / m2 / day), where as Figure 11 As shown, the highest increase in productivity was observed for Pseudochlorella and was higher than the average increase from knocking out either SRP54 or SGI2 alone. The results indicate that there appears to be a synergistic effect on productivity when both the SGI2 and SRP54 genes are knocked out.

[0333] Photophysiological data of the wild-type Pseudochlorella strain WT-1185, single knockouts of the SRP54 and SGI1 genes, and three strains with double knockouts of the SGI1 and SRP54 genes in Pseudochlorella were evaluated. All measurements were performed using CL-SCPA cultures. To obtain FV / FM and σPSII, fluorescence induction and relaxation (FIRe) kinetics were measured in the dark. V / F M and σ PSIIThe values ​​presented are calculated as the average of 6 measurements (3 measurements in each of 2 biological replicates) - the error for these parameters does not exceed 5%. τ'Qa (the electron transfer time on the PSII acceptor side measured under saturating light conditions - effectively determined by the slowest step of linear photosynthetic electron transport) was measured from the FIRe light curve and DIRK spectrum. The results are summarized in Table 8.

[0334] Table 8. Photophysiology of Pseudochlorella strains

[0335]

[0336] Compared with single knockout of SGI1 or SRP54, the functional cross-section of PSII in the SGI1 / SRP54 double knockout strain was significantly reduced, and the light-saturated rate of electron transport was reduced, indicating an increased rate of photosynthesis. The number of functional PSII complexes was also increased. The maximum photochemical quantum yield (F) in photosystem II was significantly increased in the double knockout strain compared with single knockout of SRP54 or SGI1. V / F M ) has improved.

[0337] Example 15

[0338] Microproximate analysis of SGI1 / SGI2, SGI1 / SRP54, and SGI1 / SGI2 / SRP54 knockout mutants

[0339] To determine the overall biomass composition of SGI1 / SGI2, SGI1 / SRP54, and SGI1 / SGI2 / SRP54 knockout mutants, samples from cultures grown in semi-continuous mode diluted 40% daily were quantitatively analyzed to determine the total organic carbon (TOC) and lipid content of the cells in the semi-continuous cultures. After the cultures reached steady state, aliquots of the daily diluted cultures removed were used to analyze lipids, proteins, and carbohydrates. The total organic carbon (TOC) of the algae culture samples was determined by diluting 2 mL of cell culture to a 20 mL total volume with deionized water. Three injections were made each time into a Shimadzu TOC-Vcsj analyzer to determine total carbon (TC) and total inorganic carbon (TIC). The furnace was set to 720°C, and TOC was determined by subtracting TIC from TC. A 4-point calibration range was 2 ppm to 200 ppm, corresponding to 20-2000 ppm for non-diluted cultures, with a correlation coefficient r2>0.999.

[0340] To determine lipid content, FAME analysis was performed on 2 mL samples dried using a GeneVac HT-4X. To the dried precipitate, the following was added: 500 μL of 500 mM KOH in methanol, 200 μL of tetrahydrofuran containing 0.05% butylated hydroxytoluene, 40 μL of a 2 mg / ml C11:0 free fatty acid / C13:0 triglyceride / C23:0 fatty acid methyl ester internal standard mixture, and 500 μL of glass beads (425–600 μm in diameter). The vial was capped with a PTFE septum-lined cap with an open top and placed in a SPEX GenoGrinder at 1.65 krpm for 7.5 minutes. The sample was then heated at 80°C for five minutes and allowed to cool. For derivatization, 500 μL of 10% boron trifluoride in methanol was added to the sample before heating at 80°C for 30 minutes. The test tube was cooled before adding 2 mL of heptane and 500 μL of 5 M NaCl. The sample was then vortexed at 2 krpm for five minutes and finally centrifuged at 1 krpm for three minutes. The heptane layer was sampled using a Gerstel MPS autosampler. 80 μg of C23:0 FAME internal standard was used for quantification.

[0341] Figure 12 A and 12B show the results of semi-continuous area TOC productivity and batch TOC assays for the wild-type strain of Pseudochlorella (STR00010), SRP54 knockout mutant (STR00625), SGI1 knockout mutant (STR24183), and SGI1 / SRP54 double knockout mutants (STR24538 and STR24540), respectively. The SRP54 knockout mutant, SGI1 knockout mutant, and SGI1 / SRP54 double knockout mutant showed increased TOC productivity relative to the wild-type strain of Pseudochlorella.

[0342] Figure 13 A and 13B show the results of semi-continuous area TOC productivity and batch TOC assays for the Pseudochlorella wild-type strain (STR00010), SRP54 knockout mutant (STR00625), SGI1 knockout mutant (STR00012), SGI2 / SRP54 double knockout mutant (STR00516), and SGI1 / SGI2 / SRP54 triple knockout mutants (STR25761 and STR25762), respectively. The SGI1 knockout mutant, the SGI2 / SRP54 double knockout mutant, and the SGI1 / SGI2 / SRP54 triple knockout mutant showed increased TOC productivity relative to the Pseudochlorella wild-type strain.

[0343] Figure 14Shown are the results of batch FAME productivity assays for Pseudochlorella wild-type strain (STR00010), SRP54 knockout mutant (STR00625), SGI1 knockout mutant (STR24183), and SGI1 / SRP54 double knockout mutants (STR24538 and STR24540). The SGI1 knockout mutant and the SGI / SRP54 knockout mutant showed increased FAME productivity relative to the Pseudochlorella wild-type strain.

[0344] Figure 15 Shown are the results of batch FAME productivity assays of Pseudochlorella wild-type strain (STR00010), SGI1 knockout mutant (STR00012), SGI2 / SRP54 double knockout mutant (STR00516), and SGI1 / SGI2 / SRP54 triple knockout mutants (STR25761 and STR25762).

[0345] The headings in this application are for the convenience of the reader only and do not limit the scope of the invention or its embodiments in any way.

[0346] All publications and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference. Sequence Listing <110> Synthetic Genomics I. Agarve FI Kuzminov RR Radakovitz JH Veluto S. Potts R. Sprefiko W.F. Lambert JN Greiner <120> Gene regulation in photosynthetic organisms for improved growth <130> SGI2140-2WO <150> US 62 / 690,205 <151> 2018-06-26 <150> US 62 / 612,251 <151> 2017-12-29 <160> 105 <170> PatentIn version 3.5 <210> 1 <211> 4531 <212> DNA <213> Chlorellopsis <400> 1 atgtctggtt cagctggatc gggccaggct actctcagac atgacggtgg ctctgctggc 60 ggcagtgggc ctgtctcaga cggtttttca ccggccggcc tgaaggtaaa gtagaaagac 120 actcatacac atcttggttc ggcgttgaaa gtaggtcatt aacatactct ataaccaata 180 tttgtaggtt ctggtcgtgg acgacgacct catgtgcctt aaggtggtgt cagccatgtt 240 gaagaggtgc agctatcaag gtgaggtctt tactggtgtc tgttattgct gtaacatcat 300 ttcgctgttg cacaatttaa acatttgtaa tttactgttg ttattgcagt ggccacttgt 360 agcagtggca gcgaggcact gacacttcta cgtgaacgca acgaggacgg atcctccgac 420 cagttcgacc tcgtactgtc agatgtttac atgccgggta tgtcgtattc ctttgtaaac 48​​​​​​​gtggctgcag acatggacgg tttcaagctg cttgaacaca tcggtctaga gttggagctt 720 cccgttatca gtaagttgat cgagccgagt ccagagcgaa gcctgcttct atactattag 780 cagctgtctt ttgatatttg acagcttgac ttgatatggt cacagagcat acttgcaacc 840 aggttacctg ttgaactagc aactgtgccc aagcatctct tcaagcacct ccgtcagtcc 900 atagggtact gttgatttgt actctgcaat actgcactgt aatgcgctgt gaatcactgc 960 ccttcacctc tagatggtgc ttccctggag ccctccccca cctccgcctc aagcccctca 1020 catgcctctc ccccccctgc agtgatgtca tccaacgggg acacgaatgt cgtgctgcgg 1080 ggggtcaccc acggggctgt ggactttctg atcaagcccg ttcgaattga ggagctgcgg 1140 aacgtgtggc agcacgtggt gcgtcgtcgt tccatggcgc tggccaggac gccagacgag 1200 gggggacact cggacgagga ctctcaggtg cccttggcag cttctgggcg gcttgctgtg 1260 tcggatgcca cttggactgg ggatgcacga ggggtggggg gacaatggga gatgggccat 1320 agtaggccag agttgatggc agtggtggtg ggggggagta ggcgggagag aagcagccat 1380 cctggtgttg gttttgatga ttgagtgcat ggggatgatg cacaggtgag ctgactggat 1440 gccttgtctt gctgtgctgc gctgcagcgg cacagtgtga aacgcaagga gtcggagcag 1500 agcccgctgc agctcagcac agagcagggc gggaacaaga agccaagagt ggtgtggtcg 1560 gtggagatgc accaacaggt gtgcttgcgg gcgggtgtat acgggggagg ggggccagct 1620 gctggctgac ctggcgtgcg cggtgcattg cacttggcga tgaggggcgt gcttcagtat 1680 gtagctggga cgcaattggt tgtgctgtgt gaccagtgca caaaatacat ccctgaattc 1740 cagtgggttg aacagagttg tcctggaggt gggaagcaaa cgcgcacgtg gtagagggga 1800 gcagggtgca gaacagccgc agcaggggtg ttgcgcagtg tgcaggtatc ctgcctccat 1860 gccccgggcc atgggcatac tacgctggta ccgtcaggat gggcgttgag cctggcttgg 1920 ggggcagggg gcgagcgaat gcggaatggg agcggcaggt gctgggaggg tggctgactg 1980 gcttgcagga gcgcaagtcc tgtcgggggc gtcgtcctgt tccctcctgc ccgcttcacc 2040 cacgttcact ctcatgcctc cacactcctg ctgctgacac acctgtcgcc acctccgctg 2100 cagtttgtga acgcggtcaa ctccctgggc attgacaagg cggtgcccaa gcggattctg 2160 gacctgatga acgtggaggg gctgacgcgc gagaacgtgg ccagccatct gcaggtgcct 2220 gccatgaccc ctcccaccag ggacctggtg ttttgacacc ctggaactcc tctttgacgg 2280 agcctccagt tcaattccag caatcgaatt gaatcaaaaa gcatgtgcac ccacgtgctg 2340 tttgaatgtc ccatgtggta ggaaacacaa ctgccccctt gccatttgct ggagggtgcc 2400 cgctgcgcca tgcccgagtg cgctgtgctc agcgttgtgc tgcgcccccc gctgactgaa 2460 gctgacagcg tgcggctgag gagggtactg ggggaggggg ggtgggaggc ggccgctggc 2520 ggcggaaggg agggtgtgca cgcatggaca cagggccttt ccgccctgca cggcctctac 2580 tgcaccctgc cacgtgatgt atcgacatgg tgggccatgc tgtgctgtgc cgctgcagaa 2640 gtaccgcctg tacctgaagc gggtggaggg agtgcaatcg ggtgcggcag cctccaagca 2700 gcaccagcac ccgcagtatc accagcagca gcagcagcag caagcgcaac ctcgtgcagc 2760 tgtctcccct gcagcagctt cctttggtgc cctttccttg ggagccccgc agcaggcgca 2820 gcagggcatg ccgcagctgg ggatgcctgt gcaggtgaag actgcccccc cccccctccc 2880 cctttccatc ttccctccat cagcctgctg ttccttaccc ttgtcaaccc gtctctcctt 2940 tttcgcaagc agcgcaccac cccccatgca cgccttgcct ggcactgttg tcagctgccc 3000 ccctagaaat acacaaggtg tgggtgcaac tggtgggacc ccctcccccc cccccctggg 3060 gctgcagggt ctccctccaa acttggcagc catgggatcc cagccgccgc acatcccctt 3120 ccagcaggcc ctggccatgc aggcggcggc tgcggcggct gcagccagcg gcgcgctccc 3180 cgggagtctg cccccctaca tgccaccccc ggggatgatg ccccccggca tgccgggggg 3240 ggtccccggt atgggagggg tggtggggca tcctcaggta cgggcagcac atgagtgggc 3300 aggggtattg gagaggggaa gggcagggag gttgcatgtg aggggctgca tggcaaagag 3360 gctgcagcgc aggtgttgct tgcagcactt cccctcggtg gcgcttgcat caaattttga 3420 atcctccccc gatgggcacg cccgtgtgtg ggggggggtg ggatggggga tgggggtggt 3480 tttgtggcat gtcgggcgct ttcatctacc cgggcccctg cccctgcctg tacgcgtgcg 3540 catgtgtgca gatgcccgcc ccagggatgg actttgcggg tttcaacggg tatggcaacg 3600 ctgcgggggg gctgatgttt ggcgggcagc agcaggcgca gcacgcgcag cagcacgcgt 3660 cagcgcaagc gggctcgctg gcgcagcagc aggcgcagca agtatccatg ggcttgggcc 3720 ttatgccccc cccgttgggg ttcccgccca cctcgctcgc cgcgccagcc ccgcgctccg 3780 cagcaactga gcccgccgca gccccactcc ccctgacgtc ctcgccgcca gctgcttcag 3840 caggcggcag cggcggccca gcagcagctg ctccgcagca cagcagcggc gccgcagcag 3900 cccaagcccc ccatcaccac ccacagtgct cggagcaggg agcggggggg ctcccgcccc 3960 cgctgcccgc gtccagcgcc ccgcagtcct atcccctccc tcccccctcc tcgcaggccg 4020 ctttgcatga cccggacgaa cactaccccc caggctcggc agaggtgagc acgtcccccc 4080 gccccctccc cccccccccc cccccttccc ttcaccctgg cttggcgtgc aatgaaaccc 4140 taaataaccc taaaacctca ttatcagttg caaattggac ccgtgaagcg ggcgggggca 4200 actgcgctct gctggtgtca gcgctgtctc tgccggttcc tgcccagcgt gcgcctgcat 4260 gcaagggggg atgggggggg ggaggcattt aacaataggc cagtcatctc caatccaccg 4320 tcaatttcag ccccctcccc ccccctccct catccccttg cagatgcacc accagcacct 4380 cccagggctg tgtggcttta acccggacga cctgctgggg gggcagctgg gggacatggg 4440 gttcctgggg gagctggggg gggcggtggg aggaaagcac gaacaggacg acttcctgga 4500 cctgctgctg aagggggagg aggagctgtg a 4531 <210> 2 <211> 1860 <212> DNA <213> Chlorellopsis <400> 2 atgtctggtt cagctggatc gggccaggct actctcagac atgacggtgg ctctgctggc 60 ggcagtgggc ctgtctcaga cggtttttca ccggccggcc tgaaggttct ggtcgtggac 120 gacgacctca tgtgccttaa ggtggtgtca gccatgttga agaggtgcag ctatcaagtg 180 gccacttgta gcagtggcag cgaggcactg acacttctac gtgaacgcaa cgaggacgga 240 tcctccgacc agttcgacct cgtactgtca gatgtttaca tgccggacat ggacggtttc 300 aagctgcttg aacacatcgg tctagagttg gagcttcccg ttatcatgat gtcatccaac 360 ggggacacga atgtcgtgct gcggggggtc acccacgggg ctgtggactt tctgatcaag 420 cccgttcgaa ttgaggagct gcggaacgtg tggcagcacg tggtgcgtcg tcgttccatg 480 gcgctggcca ggacgccaga cgagggggga cactcggacg aggactctca gcggcacagt 540 gtgaaacgca aggagtcgga gcagagcccg ctgcagctca gcacagagca gggcgggaac 600 aagaagccaa gagtggtgtg gtcggtggag atgcaccaac agtttgtgaa cgcggtcaac 660 tccctgggca ttgacaaggc ggtgcccaag cggattctgg acctgatgaa cgtggagggg 720 ctgacgcgcg agaacgtggc cagccatctg cagaagtacc gcctgtacct gaagcgggtg 780 gagggagtgc aatcgggtgc ggcagcctcc aagcagcacc agcacccgca gtatcaccag 840 cagcagcagc agcagcaagc gcaacctcgt gcagctgtct cccctgcagc agcttccttt 900 ggtgcccttt ccttgggagc cccgcagcag gcgcagcagg gcatgccgca gctggggatg 960 cctgtgcagg gtctccctcc aaacttggca gccatgggat cccagccgcc gcacatcccc 1020 ttccagcagg ccctggccat gcaggcggcg gctgcggcgg ctgcagccag cggcgcgctc 1080 cccgggagtc tgccccccta catgccaccc ccggggatga tgccccccgg catgccgggg 1140 ggggtccccg gtatgggagg ggtggtgggg catcctcaga tgcccgcccc agggatggac 1200 tttgcgggtt tcaacgggta tggcaacgct gcgggggggc tgatgtttgg cgggcagcag 1260 caggcgcagc acgcgcagca gcacgcgtca gcgcaagcgg gctcgctggc gcagcagcag 1320 gcgcagcaag tatccatggg cttgggcctt atgccccccc cgttggggtt cccgcccacc 1380 tcgctcgccg cgccagcccc gcgctccgca gcaactgagc ccgccgcagc cccactcccc 1440 ctgacgtcct cgccgccagc tgcttcagca ggcggcagcg gcggcccagc agcagctgct 1500 ccgcagcaca gcagcggcgc cgcagcagcc caagcccccc atcaccaccc acagtgctcg 1560 gagcagggag cgggggggct cccgcccccg ctgcccgcgt ccagcgcccc gcagtcctat 1620 cccctccctc ccccctcctc gcaggccgct ttgcatgacc cggacgaaca ctacccccca 1680 ggctcggcag agatgcacca ccagcacctc ccagggctgt gtggctttaa cccggacgac 1740 ctgctggggg ggcagctggg ggacatgggg ttcctggggg agctgggggg ggcggtggga 1800 ggaaagcacg aacaggacga cttcctggac ctgctgctga agggggagga ggagctgtga 1860 <210> 3 <211> 619 <212> PRT <213> Chlorellopsis <400> 3 Met Ser Gly Ser Ala Gly Ser Gly Gln Ala Thr Leu Arg His Asp Gly 1 5 10 15 Gly Ser Ala Gly Gly Ser Gly Pro Val Ser Asp Gly Phe Ser Pro Ala 20 25 30 Gly Leu Lys Val Leu Val Val Asp Asp Asp Leu Met Cys Leu Lys Val 35 40 45 Val Ser Ala Met Leu Lys Arg Cys Ser Tyr Gln Val Ala Thr Cys Ser 50 55 60 Ser Gly Ser Glu Ala Leu Thr Leu Leu Arg Glu Arg Asn Glu Asp Gly 65 70 75 80 Ser Ser Asp Gln Phe Asp Leu Val Leu Ser Asp Val Tyr Met Pro Asp 85 90 95 Met Asp Gly Phe Lys Leu Leu Glu His Ile Gly Leu Glu Leu Glu Leu 100 105 110 Pro Val Ile Met Met Ser Ser Asn Gly Asp Thr Asn Val Val Leu Arg 115 120 125 Gly Val Thr His Gly Ala Val Asp Phe Leu Ile Lys Pro Val Arg Ile 130 135 140 Glu Glu Leu Arg Asn Val Trp Gln His Val Val Arg Arg Arg Ser Met 145 150 155 160 Ala Leu Ala Arg Thr Pro Asp Glu Gly Gly His Ser Asp Glu Asp Ser 165 170 175 Gln Arg His Ser Val Lys Arg Lys Glu Ser Glu Gln Ser Pro Leu Gln 180 185 190 Leu Ser Thr Glu Gln Gly Gly Asn Lys Lys Pro Arg Val Val Trp Ser 195 200 205 Val Glu Met His Gln Gln Phe Val Asn Ala Val Asn Ser Leu Gly Ile 210 215 220 Asp Lys Ala Val Pro Lys Arg Ile Leu Asp Leu Met Asn Val Glu Gly 225 230 235 240 Leu Thr Arg Glu Asn Val Ala Ser His Leu Gln Lys Tyr Arg Leu Tyr 245 250 255 Leu Lys Arg Val Glu Gly Val Gln Ser Gly Ala Ala Ala Ser Lys Gln 260 265 270 His Gln His Pro Gln Tyr His Gln Gln Gln Gln Gln Gln Gln Ala Gln 275 280 285 Pro Arg Ala Ala Val Ser Pro Ala Ala Ala Ser Phe Gly Ala Leu Ser 290 295 300 Leu Gly Ala Pro Gln Gln Ala Gln Gln Gly Met Pro Gln Leu Gly Met 305 310 315 320 Pro Val Gln Gly Leu Pro Pro Asn Leu Ala Ala Met Gly Ser Gln Pro 325 330 335 Pro His Ile Pro Phe Gln Gln Ala Leu Ala Met Gln Ala Ala Ala Ala 340 345 350 Ala Ala Ala Ser Gly Ala Leu Pro Gly Ser Leu Pro Pro Tyr Met 355 360 365 Pro Pro Pro Gly Met Met Pro Pro Gly Met Pro Gly Gly Val Pro Gly 370 375 380 Met Gly Gly Val Val Gly His Pro Gln Met Pro Ala Pro Gly Met Asp 385 390 395 400 Phe Ala Gly Phe Asn Gly Tyr Gly Asn Ala Ala Gly Gly Leu Met Phe 405 410 415 Gly Gly Gln Gln Gln Ala Gln His Ala Gln Gln His Ala Ser Ala Gln 420 425 430 Ala Gly Ser Leu Ala Gln Gln Gln Ala Gln Gln Val Ser Met Gly Leu 435 440 445 Gly Leu Met Pro Pro Pro Leu Gly Phe Pro Pro Thr Ser Leu Ala Ala 450 455 460 Pro Ala Pro Arg Ser Ala Ala Thr Glu Pro Ala Ala Ala Pro Leu Pro 465 470 475 480 Leu Thr Ser Ser Pro Pro Ala Ala Ser Ala Gly Gly Ser Gly Gly Pro 485 490 495 Ala Ala Ala Ala Pro Gln His Ser Ser Gly Ala Ala Ala Ala Gln Ala 500 505 510 Pro His His His Pro Gln Cys Ser Glu Gln Gly Ala Gly Gly Leu Pro 515 520 525 Pro Pro Leu Pro Ala Ser Ser Ala Pro Gln Ser Tyr Pro Leu Pro Pro 530 535 540 Pro Ser Ser Gln Ala Ala Leu His Asp Pro Asp Glu His Tyr Pro Pro 545 550 555 560 Gly Ser Ala Glu Met His His Gln His Leu Pro Gly Leu Cys Gly Phe 565 570 575 Asn Pro Asp Asp Leu Leu Gly Gly Gln Leu Gly Asp Met Gly Phe Leu 580 585 590 Gly Glu Leu Gly Gly Ala Val Gly Gly Lys His Glu Gln Asp Asp Phe 595 600 605 Leu Asp Leu Leu Leu Lys Gly Glu Glu Glu Leu 610 615 <210> 4 <211> 2802 <212> DNA <213> Chlorellopsis <400> 4 atggctgccc ccccagtatc tatctcttcc aattttccaa aggttagtat ttacgtaaca 60 tttgccgaca gttgggcaat aacgctgagt tggagtgttg ccaacaagct tttgtgccgt 120 ttccagggtt tgcgggttct cttggtcgat caacagccaa gtaggagcca tattgaagcg 180 cagctgatgc agccggatct taattacaca ggtttgctgc agttttgcac attccaagct 240 tggcctttct ccgtgccaaa cccagcgcgc tgagctcttg ttgtttgttg cagttactgg 300 ttgcgagagc gtttctgaag ctctttcata ttgccgctcg ggagtaagca gctttgacgt 360 ggtgcttgcg gaggtgggtg gtagtgcttc gcgaggtgca cagtgcgcac cgggaaaaac 420 ttgaaaagta tttgtaaaat taattttgaa acttctgtat tattttacac ctcttaacaa 480 tgcacccaat gtttgttatg agcgccacgt taccggacgt ttgttgcagg caaggatcgt 540 tgccgtcgac gagacttcgg ggcgcgcatt tatcgactct cttgaagata caccggttat 600 tcttatgtcg gagggaagca cgacgggcga cgttcttcgt gcggtgaagc ttggagctgt 660 ggactggctg gataagcctc tctccgtcct gaagctcaag aacatctggc agcactcagt 720 gcgtaaggta ggtccggaaa caatatgata tctacaattg gaaagttacc agtgtcaact 780 atggaaaacg ttgtactggg tgctagtttc agttgagcca gttgcctgta tatgcatata 840 aggggcagtg acgcagtgtc tgccctgtga gctgtgatgc atcagggtgc acctgaagct 900 ggcagtggat cactccaccc aagatgttgt tgcaatccaa tgtgttgctg atgccttgct 960 tttctgactt gcaaacatgg tgtgggataa aagcgttgct agacagccac cgtgctccac 1020 gttgtcttct gcatgcaaaa ctgcagatga tgcagcgcac cacgttttac gacacttgct 1080 ccgagcagcc aacccagccg gcgcgcagca agctttcttc aggaatcgaa tcgccgagca 1140 cacccacgct gggagactct gtggacttgg acgccatctc ggcggcttcc ttcggcagca 1200 tcaaggactt gaccgatttt tcattttcca gcggagctga ggtgggcatc gctggttgtc 1260 cagcactgca gcatttccca ccagcttggt tggttgcctg tgttttagtg cagagcagag 1320 gccgaggcta ctggttcaac cagcctagtt actcaaaaca attttggcaa cctgctgact 1380 tctctcttaa cctgcagagc gtttcacagc atgtacactt ttcagtgggt ttcgtaattt 1440 cgtagcgcac ccgctggctt ttttctgcag gtcctgagag cctcctttga cagctgtgac 1500 ggctccgagg tcaacctagg cagcgctttg ggccagcctc gcccccctct ggcagtcaag 1560 cccagctcct ttggccccct ggtgagtggc atagctcagc aggagaccca caagtggctg 1620 gaacccacca tgttggcgcg caccctgccc tcgcacgcgc ggctgccgtc tgcgcagcgc 1680 gccgcggtgc gccgctgtgg agttgtggtg ttgcggagtc actcgcgggc cagtgcttca 1740 cagcccattc tcgccgcaca caccctgccc gcacaaatgg ctgccacccc cctaaagcgg 1800 tcctcaggcc acccggatgt gctcaggatg gatccgccga atctcgcacc cctcctccct 1860 caatcccggt tgttcagacg gtttggaacc cctccggctc tctacccctc tgcaggtacc 1920 cgtccctccc acctcccagt ggccccagct gcaggctggc tgcgtgtggg gcactcccgt 1980 gggcggcccg ctggcgcccc cctccatgac caacgcccag catggtgccc cccacagcgt 2040 gcccctggca gacgcacact tggccggcag cgccagttac atgtccctct cctctgtgag 2100 tctcctcccc tccaccccta catcttccaa tcgaacatgc gacgcacgca cacccatagt 2160 ccctaaacaa gtgctttggt gttttttcac ttgcaaaccc caaccctgac acctgaagcg 2220 tgacacaggc gactgcgctg ctccccgccc ccacacgccc ttggttgttt gtgccctgca 2280 cttctgccac gacatgcatg tcatgtcttt tcacgcctgc gatgtcgctg cttaaacttg 2340 aaactcattg tggccggggt gcagctcatg gaggaggaca ccccctgtcc cttggacatg 2400 gatgcaccag aggacgggat gcagcttcct gttgacttcc tgtctgttgc caacgtcagc 2460 agcaatggta ggtccagcac cagacgcctc tgtctgctat gagacgcacc tccagccgcc 2520 ccctctggac agacagcgcg ctgcacgctc tgcgcgctgg accttgccgc acacgcgcgc 2580 gacaaggcct ggtgtgatgc ttggatgtgg aaggttccag catggttgga caagatggta 2640 tcctggcaca catattggta tgcagcatac acccaggctg cccccttacc ctcgcacgcc 2700 ctacccctta ctgcaggcag cggtcccatt gggttgaagc tgaagaaaag caacagcctg 2760 ctgaacatga tcaacgcagc gctgatgtct ggtggtcagt ga 2802 <210> 5 <211> 359 <212> PRT <213> Chlorellopsis <400> 5 Met Ala Ala Pro Pro Val Ser Ile Ser Ser Asn Phe Pro Lys Gly Leu 1 5 10 15 Arg Val Leu Leu Val Asp Gln Gln Pro Ser Arg Ser His Ile Glu Ala 20 25 30 Gln Leu Met Gln Pro Asp Leu Asn Tyr Thr Val Thr Gly Cys Glu Ser 35 40 45 Val Ser Glu Ala Leu Ser Tyr Cys Arg Ser Gly Val Ser Ser Phe Asp 50 55 60 Val Val Leu Ala Glu Ala Arg Ile Val Ala Val Asp Glu Thr Ser Gly 65 70 75 80 Arg Ala Phe Ile Asp Ser Leu Glu Asp Thr Pro Val Ile Leu Met Ser 85 90 95 Glu Gly Ser Thr Thr Gly Asp Val Leu Arg Ala Val Lys Leu Gly Ala 100 105 110 Val Asp Trp Leu Asp Lys Pro Leu Ser Val Leu Lys Leu Lys Asn Ile 115 120 125 Trp Gln His Ser Val Arg Lys Met Met Gln Arg Thr Thr Phe Tyr Asp 130 135 140 Thr Cys Ser Glu Gln Pro Thr Gln Pro Ala Arg Ser Lys Leu Ser Ser 145 150 155 160 Gly Ile Glu Ser Pro Ser Thr Pro Thr Leu Gly Asp Ser Val Asp Leu 165 170 175 Asp Ala Ile Ser Ala Ala Ser Phe Gly Ser Ile Lys Asp Leu Thr Asp 180 185 190 Phe Ser Phe Ser Ser Gly Ala Glu Val Leu Arg Ala Ser Phe Asp Ser 195 200 205 Cys Asp Gly Ser Glu Val Asn Leu Gly Ser Ala Leu Gly Gln Pro Arg 210 215 220 Pro Pro Leu Ala Val Lys Pro Ser Ser Phe Gly Pro Leu Val Pro Val 225 230 235 240 Pro Pro Thr Ser Gln Trp Pro Gln Leu Gln Ala Gly Cys Val Trp Gly 245 250 255 Thr Pro Val Gly Gly Pro Leu Ala Pro Pro Ser Met Thr Asn Ala Gln 260 265 270 His Gly Ala Pro His Ser Val Pro Leu Ala Asp Ala His Leu Ala Gly 275 280 285 Ser Ala Ser Tyr Met Ser Leu Ser Ser Leu Met Glu Glu Asp Thr Pro 290 295 300 Cys Pro Leu Asp Met Asp Ala Pro Glu Asp Gly Met Gln Leu Pro Val 305 310 315 320 Asp Phe Leu Ser Val Ala Asn Val Ser Ser Asn Gly Ser Gly Pro Ile 325 330 335 Gly Leu Lys Leu Lys Lys Ser Asn Ser Leu Leu Asn Met Ile Asn Ala 340 345 350 Ala Leu Met Ser Gly Gly Gln 355 <210> 6 <211> 119 <212> PRT <213> Chlorellopsis <400> 6 Gly Leu Arg Val Leu Leu Val Asp Gln Gln Pro Ser Arg Ser His Ile 1 5 10 15 Glu Ala Gln Leu Met Gln Asp Leu Asn Tyr Thr Val Thr Gly Cys Glu 20 25 30 Ser Val Ser Glu Ala Leu Ser Tyr Cys Arg Ser Gly Val Ser Ser Phe 35 40 45 Asp Val Val Leu Ala Glu Ala Arg Ile Val Ala Val Asp Glu Thr Ser 50 55 60 Gly Arg Ala Phe Ile Asp Ser Leu Glu Asp Thr Pro Val Ile Leu Met 65 70 75 80 Ser Glu Gly Ser Thr Thr Gly Asp Val Leu Arg Ala Val Lys Leu Gly 85 90 95 Ala Val Asp Trp Leu Asp Lys Pro Leu Ser Val Leu Lys Leu Lys Asn 100 105 110 Ile Trp Gln His Ser Val Arg 115 <210> 7 <211> 1080 <212> DNA <213> Chlorellopsis <400> 7 atggctgccc ccccagtatc tatctcttcc aattttccaa agggtttgcg ggttctcttg 60 gtcgatcaac agccaagtag gagccatatt gaagcgcagc tgatgcagcc ggatcttaat 120 tacacagtta ctggttgcga gagcgtttct gaagctcttt catattgccg ctcgggagta 180 agcagctttg acgtggtgct tgcggaggca aggatcgttg ccgtcgacga gacttcgggg 240 cgcgcattta tcgactctct tgaagataca ccggttattc ttatgtcgga gggaagcacg 300 acgggcgacg ttcttcgtgc ggtgaagctt ggagctgtgg actggctgga taagcctctc 360 tccgtcctga agctcaagaa catctggcag cactcagtgc gtaagatgat gcagcgcacc 420 acgttttacg acacttgctc cgagcagcca acccagccgg cgcgcagcaa gctttcttca 480 ggaatcgaat cgccgagcac acccacgctg ggagactctg tggacttgga cgccatctcg 540 gcggcttcct tcggcagcat caaggacttg accgatttt cattttccag cggagctgag 600 gtcctgagag cctcctttga cagctgtgac ggctccgagg tcaacctagg cagcgctttg 660 ggccagcctc gccccctct ggcagtcaag cccagctcct ttggccccct ggtacccgtc 720 cctcccacct cccagtggcc ccagctgcag gctggctgcg tgtggggcac tcccgtgggc 780 ggcccgctgg cgcccccctc catgaccaac gcccagcatg gtgcccccca cagcgtgccc 840 ctggcagacg caacacttggc cggcagcgcc agttacatgt ccctctcctc tctcatggag 900 gaggaccc cctgtccctt ggacatggat gcaccagagg acgggatgca gcttcctgtt 960 gacttcctgt ctgttgccaa cgtcagcagc aatggcagcg gtcccattgg gttgaagctg 1020 aagaaaagca acagcctgct gaacatgatc aacgcagcgc tgatgtctgg tggtcagtga 1080 <210> 8 <211> 1707 <212> DNA <213> Nannochloropsis <400> 8 atgcttcggc agcagctgtt gcacagcggc aggcagccgg gtgcgacatg cagcttacta 60 acctgctcga catggcgacc gtctgccttg ttcggccgtc ctaagcccca aaaactgcac 120 agccagcgct tgcagcatca gggccgcccc tcccgcctcg tcgtgcgcag cgcaatgttc 180 gacaacctga gccgcagcct ggagagggcg tgggacatgg tgcgcaagga cgggcggcta 240 acggcggaca acatcaagga gcccatgcgg gagattcgca gggcgctgct tgaggcggat 300 gtgaggctgg gggcgccgct gatcagattc ttggtatcta cccccccccc ctcccaggtc 360 tccctccccg tggtgcgcaa gtttgtgaag gcggtggagg agaaggcgct gggttctgca 420 gtgaccaagg gtgtcacccc cgaccagcag ctggtgaagg tggtgtacga ccagctgcgg 480 gagctgatgg gggggcagca ggaagggctg gtgcccactt cgccagagga gccgcaggtg 540 atcttgatgg cggggctgca gggcacgggg aagacgacag ctgcggggaa gctggccttg 600 ttcctgcaga agaaggggca gaaggtgctg ctggtggcca ccgacatcta ccgccccgcc 660 gccatcgacc agctggtgaa gctggggcgac aggataggg tgccggtgtt ccagctggga 720 acccaggtgc agccgccgga gattgcaagg caggggctgg agaaggcgcg agcagagggg 780 tttgacgccg tcatcgtcga cacggcgggg cggctgcaga tcgaccagag catgatggag 840 gagctggtgc agatcaagtc cacggtgag ccctccgaca cgctgctagt ggtcgatgcg atgacggggc aggaggcagc cgggctggtg aaggcgttca atgatgccgt ggacatcaca 960 ggcgccgtgc tgaccaagct tgacggggac agccgcggcg gcgccgcgct gagcgtgcgc 1020 caggtcagcg ggcggcccat caagtttgtg ggcatggggg agggcatgga ggcgctggag 1080 cccttctacc ccgagcgcat ggccagcagg attctgggca tgggtgacgt ggtcaccctg 1140 gtggagagg ctgaggagag catcaagga gaggaggcgc aggagatatc gcggaagatg ctgtcggcca aatttgactt tgacgacttc ctgaagcagt acaagatggt ggcggggatg gggaacatgg cccaaatcat gaagatgctg ccaggcatga acaagtttac ggagaagcag ctggcgggcg ttgagaagca gtacaaggtg tacgagagca tgatccagag catgacggtg 1380 aaggagcgca agcagccgga gctgttggtg aagtcgccct ccaggaggcg gcgcatagcg 1440 cgcgggtcgg ggcgctcgga gcgggaggtc acagagctgc tgggggtgtt caccaacctg 1500 cggacgcaga tgcagagctt ctccaaaatg atggccatgg gggggatggg catgggctcc 1560 atgatgagcg acgaggagat gatgcaggcc acgctggcag gcgccggccc ccgccccgtg 1620 ccagctggca aggtgcggcg gaagaagctg gccgcggcgg gcgggtcgcg gggcatggct 1680 gagctggcat ccctgaaggc agaatga 1707 <210> 9 <211> 302 <212> PRT <213> Coccochloris <400> 9 Met Gly Leu Lys Ala Arg Ala Ala Ser Val Ser Val His Ser Ser Ala 1 5 10 15 Asn Asn Thr Ala Ser Pro Leu Ser Ser Gly Arg Arg Gly Phe Pro His 20 25 30 Ser Gly Glu Met Ser Gly Glu Asp Leu Ala Arg Ser Asp Ser Trp Glu 35 40 45 Met Phe Pro Ala Gly Leu Lys Val Leu Val Val Asp Asp Asp Pro Leu 50 55 60 Cys Leu Lys Val Val Glu His Met Leu Arg Arg Cys Asn Tyr Gln Val 65 70 75 80 Thr Thr Cys Pro Asn Gly Lys Ala Ala Leu Glu Lys Leu Arg Asp Arg 85 90 95 Ser Val His Phe Asp Leu Val Leu Ser Asp Val Tyr Met Pro Asp Met 100 105 110 Asp Gly Phe Lys Leu Leu Glu His Ile Gly Leu Glu Leu Asp Leu Pro 115 120 125 Val Ile Met Met Ser Ser Asn Gly Glu Thr Asn Val Val Leu Arg Gly 130 135 140 Val Thr His Gly Ala Val Asp Phe Leu Ile Lys Pro Val Arg Val Glu 145 150 155 160 Glu Leu Arg Asn Val Trp Gln His Val Val Arg Arg Lys Arg Asp Gln 165 170 175 Ala Val Ser Gln Ala Arg Asp Ser Arg Asp Ile Ser Asp Glu Glu Gly 180 185 190 Thr Asp Asp Gly Lys Pro Arg Asp Lys Lys Arg Lys Glu Val Ile Leu 195 200 205 Val Leu Trp Trp Asp Met Gln Arg Arg Asp Ser Asp Asp Gly Val Ser 210 215 220 Ala Lys Lys Ala Arg Val Val Trp Ser Val Glu Met His Gln Gln Phe 225 230 235 240 Val Gln Ala Val Asn Gln Leu Gly Ile Asp Lys Ala Val Pro Lys Arg 245 250 255 Ile Leu Asp Leu Met Asn Val Asp Gly Leu Thr Arg Glu Asn Val Ala 260 265 270 Ser His Leu Gln Val Pro His Leu Ser Ile Phe Ser Pro Leu Phe Ala 275 280 285 Glu Leu Met Ser Thr Leu Pro Arg Arg Cys Phe Tyr Asp Phe 290 295 300 <210> 10 <211> 269 <212> PRT <213> Oceanic luminescent ostreococcus <400> 10 Phe Pro Ala Gly Leu Gly Val Leu Val Val Asp Asp Asp Leu Leu Cys 1 5 10 15 Leu Lys Val Val Glu Lys Met Leu Lys Ala Cys Lys Tyr Lys Val Thr 20 25 30 Ala Cys Ser Thr Ala Lys Thr Ala Leu Glu Ile Leu Arg Thr Arg Lys 35 40 45 Glu Glu Phe Asp Ile Val Leu Ser Asp Val His Met Pro Asp Met Asp 50 55 60 Gly Phe Lys Leu Leu Glu Ile Ile Gln Phe Glu Leu Ala Leu Pro Val 65 70 75 80 Leu Met Met Ser Ala Asn Ser Asp Ser Ser Val Val Leu Arg Gly Ile 85 90 95 Ile His Gly Ala Val Asp Tyr Leu Leu Lys Pro Val Arg Ile Glu Glu 100 105 110 Leu Arg Asn Ile Trp Gln His Val Val Arg Arg Asp Tyr Ser Ser Ala 115 120 125 Lys Ser Ser Gly Ser Glu Asp Val Glu Ala Ser Ser Pro Ser Lys Arg 130 135 140 Ala Lys Thr Ser Gly Ser Asn Ser Lys Ser Glu Glu Val Asp Arg Thr 145 150 155 160 Ala Ser Glu Met Ser Ser Gly Lys Ala Arg Lys Lys Pro Thr Gly Lys 165 170 175 Lys Gly Gly Lys Ser Val Lys Glu Ala Glu Lys Lys Asp Val Val Asp 180 185 190 Asn Ser Asn Ser Lys Lys Pro Arg Val Val Trp Ser Ala Glu Leu His 195 200 205 Ala Gln Phe Val Thr Ala Val Asn Gln Leu Gly Ile Asp Lys Ala Val 210 215 220 Pro Lys Arg Ile Leu Asp Leu Met Gly Val Gln Gly Leu Thr Glu Asn 225 230 235 240 Val Ala Ser His Leu Gln Lys Tyr Arg Leu Tyr Leu Lys Arg Leu Gln 245 250 255 Gly Asn Asp Ala Arg Gly Gly Gly Asn Ala Ser Ser Thr 260 265 <210> 11 <211> 941 <212> PRT <213> Chlamydomonas reinhardtii <400> 11 Met Asp Ser Gln Gly Val Lys Leu Glu Glu His Pro Gly His Thr Gly 1 5 10 15 Gly His Trp Gln Gly Phe Pro Ala Gly Leu Arg Leu Leu Val Val Asp 20 25 30 Asp Asp Pro Leu Cys Leu Lys Val Val Glu Gln Met Leu Arg Lys Cys 35 40 45 Ser Tyr Glu Val Thr Val Cys Ser Asn Ala Thr Thr Ala Leu Asn Ile 50 55 60 Leu Arg Asp Lys Asn Thr Glu Tyr Asp Leu Val Leu Ser Asp Val Tyr 65 70 75 80 Met Pro Asp Met Asp Gly Phe Arg Leu Leu Glu Leu Val Gly Leu Glu 85 90 95 Met Asp Leu Pro Val Ile Met Met Ser Ser Asn Gly Asp Thr Ser Asn 100 105 110 Val Leu Arg Gly Val Thr His Gly Ala Cys Asp Tyr Leu Ile Lys Pro 115 120 125 Val Arg Leu Glu Glu Leu Arg Asn Leu Trp Gln His Val Val Arg Arg 130 135 140 Arg Arg Gln His Ala Gln Glu Ile Asp Ser Asp Glu Gln Ser Gln Glu 145 150 155 160 Arg Asp Glu Asp Gln Thr Arg Asn Lys Arg Lys Ala Asp Ala Ala Gly 165 170 175 Val Thr Gly Asp Gln Cys Arg Leu Asn Gly Ser Gly Ser Gly Gly Ala 180 185 190 Ala Gly Pro Gly Ser Gly Gly Gly Ala Gly Gly Met Thr Asp Glu Met 195 200 205 Leu Met Met Ser Gly Gly Glu Asn Gly Ser Asn Lys Lys Ala Arg Val 210 215 220 Val Trp Ser Val Glu Met His Gln Gln Phe Val Asn Ala Val Asn Gln 225 230 235 240 Leu Gly Ile Asp Lys Ala Val Pro Lys Lys Ile Leu Glu Ile Met Gly 245 250 255 Val Asp Gly Ser Ala Gly Arg Leu Ala Asp Thr Ser Gly Arg Asp Val 260 265 270 Cys Gly Thr Val Tyr Arg Leu Tyr Leu Lys Arg Val Ser Gly Val Thr 275 280 285 Pro Ser Gly His His His Asn Ala Ala His Lys Ser Asn Lys Pro Ser 290 295 300 Pro His Thr Thr Pro Pro Pro Pro Ala Leu Pro Gly Gln Ala Gly Thr 305 310 315 320 His Pro Ala Asn Gln Ala Thr Ala Ile Pro Pro Pro Pro Gln Pro Gly 325 330 335 Ser Gly Thr Ala Ala Gly Ala Gly Ala Ala Ala Ala Gly Thr Gly Gly 340 345 350 Gly Ala Ala Ala Ala Asn Gly His Ala Ala Thr Thr Gly Ala Gly Thr 355 360 365 Pro Gly Ala Ala Pro Gly Ala Gly Gly Gly Val Gly Gly Thr Gly Ala 370 375 380 Gly Gly Leu Gly Ser Gly Pro Asp Gly Ala Ala Ala Ala Ala Gly Pro 385 390 395 400 Gly Pro Gly Ala Ala Val Pro Gly Gly Leu Gly Gly Leu Pro Leu Pro 405 410 415 Pro Gly Ala Gly Pro Gly Pro Gly Pro Gly Gly Phe Gly Gly Pro Ser 420 425 430 Pro Pro Pro Pro Pro His Pro Ala Ala Leu Leu Ala Asn Pro Met Ala 435 440 445 Ala Ala Val Ala Gly Leu Asn Gln Ser Leu Leu Asn Ala Met Gly Ser 450 455 460 Leu Gly Val Gly Val Gly Gly Met Ser Pro Leu Gly Pro Val Gly Pro 465 470 475 480 Leu Gly Pro Leu Gly Gly Leu Pro Gly Leu Pro Gly Met Gln Pro Pro 485 490 495 Pro Leu Gly Met Gly Gly Leu Gln Pro Gly Met Gly Pro Leu Gly Pro 500 505 510 Leu Gly Leu Pro Gly Met Gly Gly Leu Pro Gly Leu Pro Gly Met Asn 515 520 525 Pro Met Ala Asn Leu Met Gln Gly Met Ala Ala Gly Met Ala Ala Ala 530 535 540 Asn Gln Met Asn Gly Met Gly Gly His Met Gly Gly His Met Gly Gly 545 550 555 560 Met Asn Gly Pro Met Gly Ala Leu Ala Gly Met Asn Gly Leu Asn Gly 565 570 575 Ala Met Met Gly Gly Leu Pro Gly Met Gly Gly Pro Gln Asn Met Phe 580 585 590 Gln Ala Ala Ala Ala Ala Ala Ala Gln Gln Gln Gln Gln Gln Gln Glu 595 600 605 Gln Gln His Ala Met Met Gln Gln Ala Ala Ala Gly Leu Leu Ala Ser 610 615 620 Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Ala 625 630 635 640 Leu Gln Gln Gln Gln Gln Gln Gly Met Ala Val Ser Pro Pro Gly Pro 645 650 655 His Asn Ala Thr Pro Asn Gly Gln Leu His Thr His Pro Gln Ala His 660 665 670 His Pro His Gln His Gly Leu His Ala His Ala His Pro His Gln His 675 680 685 Leu Asn Thr Ala Pro Ala Gly Ala Leu Gly Leu Ser Pro Pro Gln Pro 690 695 700 Pro Ala Gly Leu Leu Ser Ala Ser Gly Leu Ser Ser Gly Pro Asp Gly 705 710 715 720 Ser Gly Leu Gly Ser Gly Val Gly Gly Leu Leu Asp Gly Leu Gln Gln 725 730 735 His Pro His His Pro Gln Leu Gln Leu Ala Gly Ser Leu Gly Thr Gly 740 745 750 Gly Thr Gly Arg Ser Ser Gly Ala Ala Gly Arg Gly Ser Leu Asp Leu 755 760 765 Pro Ala Asp Leu Met Gly Met Ala Leu Leu Asp Phe Pro Pro Val Pro 770 775 780 Val Pro Gly Gly Ala Asp Val Gly Met Ala Gly Ala Gly Gly Gly Ala 785 790 795 800 Ala Gly Ala His His His Gly His Gln Gly His Gln Gly Ile Gly Gly 805 810 815 Gly Ala Gly Val Gly Ile Ala Gly Gly Val Gly Cys Gly Val Pro Ala 820 825 830 Ala Ala His Gly Leu Glu Pro Ala Ile Leu Met Asp Asp Pro Ala Asp 835 840 845 Leu Gly Ala Val Phe Ser Asp Val Met Tyr Gly Thr Pro Gly Gly Gly 850 855 860 Gly Val Pro Gly Gly Val Pro Gly Gly Gly Val Gly Leu Gly Leu Gly 865 870 875 880 Ala Gly Gln Val Pro Ser Gly Pro Ala Gly Ala Gly Gly Leu His Ser 885 890 895 His His His Gln His His His His Gln His His Leu Gly His Val Val 900 905 910 Pro Val Gly Gly Val Asp Pro Leu Ala Gly Asp Ala Ala Lys Met Ala 915 920 925 Met Asn Asp Asp Asp Phe Phe Asn Phe Leu Leu Lys Asn 930 935 940 <210> 12 <211> 523 <212> PRT <213> Isochrysis zofingiensis <400> 12 Met Asp Gly Phe Lys Leu Leu Glu Thr Val Gly Leu Glu Leu Asp Leu 1 5 10 15 Pro Val Ile Met Met Ser Ser Asn Gly Glu His Thr Thr Val Met Arg 20 25 30 Gly Val Thr His Gly Ala Cys Asp Phe Leu Ile Lys Pro Val Arg Ile 35 40 45 Glu Glu Leu Arg Asn Ile Trp Gln His Val Ile Arg Arg Thr Arg His 50 55 60 Pro Val Phe Arg Asp Leu Glu Pro Asp Asp His Glu Gly Gly Asp Tyr 65 70 75 80 Glu Ala Ser Lys Lys Arg Lys Asp Leu Tyr Arg Gly Glu Asn Ser Ser 85 90 95 Gly Ser Gly Gly Ala Gly Gly Leu Glu Arg Asp Asp Asp Gly Ser Ala 100 105 110 Ser Lys Lys Pro Arg Val Val Trp Ser Val Glu Met His Gln Gln Phe 115 120 125 Val Gln Ala Val Asn Gln Leu Gly Ile Asp Lys Ala Val Pro Lys Lys 130 135 140 Ile Leu Glu Leu Met Asn Val Asp Gly Leu Thr Arg Glu Asn Val Ala 145 150 155 160 Ser His Leu Gln Lys Tyr Arg Leu Tyr Leu Lys Arg Val Gln Gly Val 165 170 175 Gln Ala Pro Phe Gly Leu Pro Asn Ile Gln Leu Pro Arg Gln Thr Ser 180 185 190 Ser Lys Gly Ala Gly Ser Ser Ser Gln Gln Gln His His Gln Gln Gln 195 200 205 Gln His Gln Gln Gln His Gln His Gln His Gln Thr Ala Leu Gly Thr 210 215 220 Gly Gln Gln Gln Ser His Gln Leu Gln Pro Cys Pro Val Ser Thr Ala 225 230 235 240 Thr Pro Val Met Pro Ser Pro Asp Ala Met Val Ala Ala Ser Met Met 245 250 255 Ser Ser Gln Ala Met Ala Ala Met Ala Pro Gly Val Met Asn Pro Met 260 265 270 Thr Ala Met Asn Ser Met Met Ala Gly Leu Asn Pro Asn Met Met Gly 275 280 285 With Ala Ala Gly Leu Gly Leu Ala Gly Leu Gly Ile Gly Gly With Ala 290 295 300 Gly His Pro Val Pro Asn Pro Met Leu Ala Gly Met Gly Pro Met Gly 305 310 315 320 Leu Gly Leu Pro Pro Pro Pro Gly Met Pro Pro Pro Pro Pro Gly Met 325 330 335 Pro Pro Gly Met Pro Pro Gly Met Pro Pro Gly Met Pro Ala Met Met 340 345 350 Gln Gly Leu Ser Met Ala Gly Met Ser His Leu Ala Ala Ala Gly Met 355 360 365 Arg Pro Pro Pro Gly Ala Leu Gly Gly His Leu Gly Gly Pro Gly Leu 370 375 380 Ser Pro Phe Gly Pro Pro Pro Pro Pro Gly Ala Asp Pro Ala Asn Met 385 390 395 400 Met Ala Asn Met Ser Ser Met Met Ala Asn Met Gln Ala Ala Leu Ala 405 410 415 Phe Gln Ala Asp Ala Ala Ala Ala Ala Gln His Gln Ala Ala Ser Thr 420 425 430 Gly Ser Val Ala Pro Gly Arg Gln Gln Gln Val His Gln His Gln Gln 435 440 445 Ala Val Gly Met Ala Val Asp Asp Ala Ala Ala Phe Pro Ser Pro Gly 450 455 460 Cys Arg Pro Asn Gly Ser Ala Asp Ala Gly Ala Gln Ser Ala Ala Glu 465 470 475 480 Pro Asn Asp Phe Ser Arg Val Phe Asp Asp Pro Phe Ala Gln Pro Ala 485 490 495 Ala Ser Pro Ser Gly Ala Ala Ala Ala Gly Ser Asn Glu Ala Pro Gly 500 505 510 Met Asp Asp Phe Leu Asp Phe Phe Leu Lys Ser 515 520 <210> 13 <211> 834 <212> PRT <213> Volvox carteri <400> 13 Met Asp Gly Arg Ala Glu Gly Thr Val Ala Ile Lys Gln Glu Asp His 1 5 10 15 Ala Ser Gly His Trp His Asn Phe Pro Ala Gly Leu Arg Leu Leu Val 20 25 30 Val Asp Asp Asp Pro Leu Cys Leu Lys Val Val Glu Gln Met Leu Arg 35 40 45 Lys Cys Ser Tyr Asp Val Thr Thr Cys Thr Asn Ala Thr Met Ala Leu 50 55 60 Asn Leu Leu Arg Asp Lys Ser Thr Glu Tyr Asp Leu Val Leu Ser Asp 65 70 75 80 Val Tyr Met Pro Asp Met Asp Gly Phe Lys Leu Leu Glu Val Val Gly 85 90 95 Leu Glu Met Asp Leu Pro Val Ile Met Met Ser Ser Asn Gly Asp Thr 100 105 110 Ser Asn Val Leu Arg Gly Val Thr His Gly Ala Cys Asp Tyr Leu Ile 115 120 125 Lys Pro Val Arg Leu Glu Glu Leu Arg Asn Leu Trp Gln His Val Val 130 135 140 Arg Arg Arg Arg Gln Leu Asn Leu Asp Met Asp Ser Asp Glu His Ser 145 150 155 160 Gln Glu Arg Asp Asp Asp Gln Gly Arg Lys Arg Lys Ala Asp Thr Ala 165 170 175 Gly Cys Ile Gly Asp Gln Leu Arg Met Met Gly Ala Gly Cys Ser Gly 180 185 190 Gly Ala Asn Gly Leu Gly Ser Thr Gly Asn Leu Gly Ala Val Ala Thr 195 200 205 Gly Ser Ala Gly Leu Gly Leu Gly Leu Gly Thr Ala Ala Asp Glu Leu 210 215 220 Gly Leu Gly Leu Asp Asn Gly Ser Ser Lys Lys Ala Arg Val Val Trp 225 230 235 240 Ser Val Glu Met His Gln Gln Phe Val Asn Ala Val Asn Gln Leu Gly 245 250 255 Ile Asp Lys Ala Val Pro Lys Lys Ile Leu Glu Ile Met Asn Val Asp 260 265 270 Gly Leu Thr Arg Glu Asn Val Ala Ser His Leu Gln Lys Tyr Arg Leu 275 280 285 Tyr Leu Lys Arg Val Ser Gly Ala Gln Gln Pro Gly Gln Asn Arg Val 290 295 300 Ser Arg Pro Ser Pro Pro Gln Pro Gln Ser Pro Gln Val Pro Ser Gln 305 310 315 320 Gln Gln Gln Ser Leu Pro Gly Gly Gly Gly Ala Ala Ala Ala Gly Ala 325 330 335 Gly Gln Leu Gln Gly Gly Gly Gly Ala Ala Ala Ala Ala Ser Leu 340 345 350 Ala Ser Ile Leu Ala Gly Gly Gly Pro Ala Gly Gly Gly Ala Gly Ala 355 360 365 Gly Pro Pro Pro Gly Gly Gly Gln Leu Gly Ala Asp Gly Gly Gly Pro 370 375 380 Gly Pro Gly Leu Ser Ser Ala Val Ala Asn Ala Met Ser Ala Ala Ala 385 390 395 400 Ala Ala Gly Gly Phe Pro Thr Pro Pro Pro Pro Pro Pro Pro Pro His Pro 405 410 415 Ala Ala Leu Leu Ala Ala Asn Pro Met Met Ala Ala Ala Gly Leu 420 425 430 Asn Pro Leu Leu Gly Ala Met Gly Gly Leu Gly Val Gly Pro Leu Gly 435 440 445 Pro Leu Asn Pro Leu Asn Gly Met Pro Met Pro Gly Met Gln Pro Pro 450 455 460 Leu Gly Leu Leu Pro Gly Leu Pro Gly Pro Gly Gly Gln Leu Gly Leu 465 470 475 480 Gly Pro Leu Gly Pro Ile Gly Leu Pro Gly Pro Gly Pro Leu Pro Ser 485 490 495 Leu Pro Ala Gly Leu Pro Leu Asn Pro Met Ala Asn Gly Leu Gln Gln 500 505 510 Met Ala Ala Ala Asn Leu Met Gln Gly Met Ala Gly Met Gly Gln Leu 515 520 525 Pro Ala Leu Ser Met Asn Gly Met Asn Gly Ile Met Gly Pro Leu Pro 530 535 540 Gly Val Gly Leu Pro Gly Pro Gln Gln His Leu Phe Pro Gln Gln Gln 545 550 555 560 Gln Pro His Leu Gln Gln Gln Gln Gln Gln Gln Gln Gln Lys Asp Leu 565 570 575 Gln Met Ala Gln Lys Gln His Gln Ala Ala Ala Ala Ala Val 580 585 590 Ala Ala Ala Val Ala Ala Ala Gln His Gln Gln Gln Gln Pro Gln Ala 595 600 605 Gln Gln Gln Pro Gln Pro Gln Gln Gln Gln Gln Gln Pro Gly Lys Leu 610 615 620 Pro Gln Ala Thr Val Gly Thr Pro Ala Leu Ala Ser Pro Ala Gly Ala 625 630 635 640 Leu Pro Arg Gln Pro Ser Gly Gln His Pro His Thr Leu Ser Ser Ser 645 650 655 Ser Leu His Thr Gln Gln Pro His Gln Gln Gln Leu Leu His Ser Gln 660 665 670 Pro Ser Ser Thr His Leu Ala Thr Asn Asn Thr Leu Ala Met Ala Pro 675 680 685 Ala Leu Asn Gly Thr Leu Asp Val Gly Gly Lys Gly His Leu His Ala 690 695 700 Ala Gly Gly Gln Gly Ala Gly Ala Gly Ala Gly Ala Val Leu Asp Ile 705 710 715 720 Pro Pro Asp Leu Ile Gly Gly Leu Ile Glu Asp Gly Phe Gly Ala Pro 725 730 735 Pro Gly Pro Thr Ile Gln Leu Ala His Gly Thr Ala Ala Val Leu Asp 740 745 750 Pro Thr Met Leu Leu Asp Glu Gly Asp Asn Ser Asp Phe Ala Ala Val 755 760 765 Phe Gln Glu Met Ser Ser Tyr Gly Gly Gly Gly Val Ile Gly Gly Gly 770 775 780 Gly Ser Gly Ala Gly Ala Met Gly Val Leu Gly His Gly Leu Leu Ala 785 790 795 800 Ala Gly Gly Pro Val Met Val Asp Val Ala Ala Gly Leu Ala Gly Val 805 810 815 Thr Glu Thr Ala Thr Arg Val Asp Asp Asp Phe Leu Asn Phe Leu Leu 820 825 830 Lys Ser <210> 14 <211> 446 <212> PRT <213> Tetraselmis <400> 14 Met Ser Cys Thr Val Ala Ser Phe Pro Pro Ala Ala Gly Gly Gln Gly 1 5 10 15 Ser Pro Ala Thr Pro Val Pro Tyr Gln Asp Leu Leu Val Lys Arg Gln 20 25 30 Asp Gln Trp Ser Asn Phe Pro Ala Gly Leu Arg Val Leu Val Ala Asp 35 40 45 Asn Asp Pro Ala Ser Leu Gln Gln Val Glu Lys Met Leu Lys Lys Cys 50 55 60 Ser Tyr Gln Val Thr Leu Cys Ser Ser Gly Lys Asn Ser Leu Glu Ile 65 70 75 80 Leu Arg Lys Arg Arg Glu Glu Phe Asp Leu Val Leu Ala Asp Ala Asn 85 90 95 Leu Pro Asp Ile Asp Gly Phe Lys Leu Leu His Val Cys His Thr Glu 100 105 110 Leu Ser Leu Pro Val Val Leu Met Ser Gly Thr Ser Asp Thr Gln Leu 115 120 125 Val Met Arg Gly Val Met Asp Gly Ala Arg Asp Phe Leu Ile Lys Pro 130 135 140 Leu Arg Val Glu Glu Leu Lys Val Leu Trp Gln His Leu Val Arg Phe 145 150 155 160 Thr Ser Glu Ile Thr Lys Thr Asp Ala Gln Leu Asn Val Val Lys Val 165 170 175 Glu Leu Asp Gly Gly Arg Pro Ala Gly Glu Val Ser Thr Ser Gln Asn 180 185 190 Gly Ser Gln Cys Thr Glu Arg Glu Gly Glu Gly Asn Ser Ser Lys Lys 195 200 205 Gln Arg Met Asn Trp Ser Asp Glu Met His Gln Gln Phe Val Asn Ala 210 215 220 Val Asn Gln Leu Gly Ile Asp Lys Ala Val Pro Lys Arg Ile Leu Asp 225 230 235 240 Leu Met Ser Val Glu Gly Leu Thr Arg Glu Asn Val Ala Ser His Leu 245 250 255 Gln Lys Tyr Arg Ile Tyr Leu Lys Arg Met Ala Asn His Gln Glu Asn 260 265 270 Gly Lys Gln Ala Val Met Ser Thr Asp Thr Ile Ala Arg Ala Glu Ala 275 280 285 Ala Tyr Gln Gly Gly Met Pro Gln Gly Gln Gln Met Met Gln Gln Glu 290 295 300 His Ser Gly Gln Ala Val Gln Tyr Ser Gln Pro His Ala Pro Gly Gly 305 310 315 320 Leu His Gln Gln Ala Met Pro Ala Gln Met His Met Gly Met Met Pro 325 330 335 Ala Gly Pro Gln Pro Gly Ser Met Gln Met Ala Pro His His Val Met 340 345 350 Gln Met Pro Asn Gly Gln Val Met Val Met Gln Gln Met Gly Pro Arg 355 360 365 Pro Gly Met Pro Pro Gly Met Pro Gln Gln Met Met Ala Ser Ser Gln 370 375 380 Gln Met Gly Met Leu Gln Pro Gly Met Pro Ala Gly Gln Met Leu His 385 390 395 400 Phe Gln His Pro Gln Gln Val His Gln His Pro Pro Ser Ser Gly Pro 405 410 415 Met His Ala Val Gln His Met Glu Tyr Ala Tyr Ser Gln Pro Met Gln 420 425 430 Met Ala Gly Trp Pro Val Gln Gly Gln Pro Gly Asn Gln Ala 435 440 445 <210> 15 <211> 490 <212> PRT <213> Tetraselmis <400> 15 Met Thr Pro Thr Pro Pro Met Ser Cys Thr Val Ala Ser Phe Pro Pro 1 5 10 15 Ala Ala Gly Gly Gln Gly Ser Pro Ala Thr Pro Val Pro Tyr Gln Asp 20 25 30 Leu Leu Val Lys Arg Gln Asp Gln Trp Ser Asn Phe Pro Ala Gly Leu 35 40 45 Arg Val Leu Val Ala Asp Asn Asp Pro Ala Ser Leu Gln Gln Val Glu 50 55 60 Lys Met Leu Lys Lys Cys Ser Tyr Gln Val Thr Leu Cys Ser Ser Gly 65 70 75 80 Lys Asn Ser Leu Glu Ile Leu Arg Lys Arg Arg Glu Glu Phe Asp Leu 85 90 95 Val Leu Ala Asp Ala Asn Leu Pro Asp Ile Asp Gly Phe Lys Leu Leu 100 105 110 His Val Cys His Thr Glu Leu Ser Leu Pro Val Val Leu Met Ser Gly 115 120 125 Thr Ser Asp Thr Gln Leu Val Met Arg Gly Val Met Asp Gly Ala Arg 130 135 140 Asp Phe Leu Ile Lys Pro Leu Arg Val Glu Glu Leu Lys Val Leu Trp 145 150 155 160 Gln His Leu Val Arg Phe Thr Ser Glu Ile Thr Lys Thr Asp Ala Gln 165 170 175 Leu Asn Val Val Lys Val Glu Leu Asp Gly Gly Arg Pro Ala Gly Glu 180 185 190 Val Ser Thr Ser Gln Asn Gly Ser Gln Cys Thr Glu Arg Glu Gly Glu 195 200 205 Gly Asn Ser Ser Lys Lys Gln Arg Met Asn Trp Ser Asp Glu Met His 210 215 220 Gln Gln Phe Val Asn Ala Val Asn Gln Leu Gly Ile Asp Lys Ala Val 225 230 235 240 Pro Lys Arg Ile Leu Asp Leu Met Ser Val Glu Gly Leu Thr Arg Glu 245 250 255 Asn Val Ala Ser His Leu Gln Lys Tyr Arg Ile Tyr Leu Lys Arg Met 260 265 270 Ala Asn His Gln Glu Asn Gly Lys Gln Ala Val Met Ser Thr Asp Thr 275 280 285 Ile Ala Arg Ala Glu Ala Ala Tyr Gln Gly Gly Met Pro Gln Gly Gln 290 295 300 Gln Met Met Gln Gln Glu His Ser Gly Gln Ala Val Gln Tyr Ser Gln 305 310 315 320 Pro His Ala Pro Gly Gly Leu His Gln Gln Ala Met Pro Ala Gln Met 325 330 335 His Met Gly Met Met Pro Ala Gly Pro Gln Pro Gly Ser Met Gln Met 340 345 350 Ala Pro His His Val Met Gln Met Pro Asn Gly Gln Val Met Val Met 355 360 365 Gln Gln Met Gly Pro Arg Pro Gly Met Pro Pro Gly Met Pro Gln Gln 370 375 380 Met Met Ala Ser Ser Gln Gln Met Gly Met Leu Gln Pro Gly Met Pro 385 390 395 400 Ala Gly Gln Met Leu His Phe Gln His Pro Gln Gln Val His Gln His 405 410 415 Pro Pro Ser Ser Gly Pro Met His Ala Gly Gly Glu Met Ile Asp Pro 420 425 430 Gly Ser Met Gln Arg Leu His Gln Gln Pro His Tyr Ile Gly Pro Asn 435 440 445 Gly Gln His Met Pro Ala Pro Ala Met Gly Met Pro Ser Gly Thr Val 450 455 460 Gln His Met Glu Tyr Ala Tyr Ser Gln Pro Met Gln Met Ala Gly Trp 465 470 475 480 Pro Val Gln Gly Gln Pro Gly Asn Gln Ala 485 490 <210> 16 <211> 574 <212> PRT <213> Tetraselmis <400> 16 Met Thr Met Pro Leu Gly Gly Gly Leu Cys Met Lys Asp Arg Ile His 1 5 10 15 Gly Asp Glu Arg Tyr Arg Ser Lys Ala Lys Arg Gln Val Asn Thr Ile 20 25 30 Phe Ala Phe Thr Gln Arg Asn Thr Trp Arg Gly Arg Phe Arg Leu Cys 35 40 45 Ser Tyr Arg Thr Thr Glu Leu Leu Gly Gly Ser Lys Thr Thr Glu Pro 50 55 60 Gly Arg Gly Thr Phe Val Leu Gln Ile Phe Met Cys Val Lys Asn Ala 65 70 75 80 Ser Ile Asp Asp Gly Ser Arg His Ile Ser Thr Ser Arg Gly Leu Glu 85 90 95 Ser Val Leu Lys Arg Arg Gly Gly Gln Gly Ala Pro Ala Ala Pro Val 100 105 110 Pro Tyr His Asp Leu Leu Val Lys Arg Gln Asp Gln Trp Ser Asn Phe 115 120 125 Pro Ala Gly Leu Arg Val Leu Val Ala Asp Asn Asp Pro Ala Ser Leu 130 135 140 Gln Gln Val Glu Lys Met Leu Lys Lys Cys Ser Tyr Gln Val Thr Leu 145 150 155 160 Cys Ser Ser Gly Lys Asn Ser Leu Glu Ile Leu Arg Lys Arg Arg Glu 165 170 175 Glu Phe Asp Leu Val Leu Ala Asp Ala Asn Leu Pro Asp Ile Asp Gly 180 185 190 Phe Lys Leu Leu His Val Cys His Thr Glu Leu Ser Leu Pro Val Val 195 200 205 Leu Met Ser Gly Thr Ser Asp Thr Gln Leu Val Met Arg Gly Val Met 210 215 220 Asp Gly Ala Arg Asp Phe Leu Ile Lys Pro Leu Arg Val Glu Glu Leu 225 230 235 240 Lys Val Leu Trp Gln His Leu Val Arg Phe Thr Ser Glu Ile Thr Lys 245 250 255 Thr Asp Ala Gln Leu Asn Val Val Lys Val Glu Leu Asp Ser Gly Arg 260 265 270 Pro Ala Gly Glu Val Ser Thr Ser Gln Asn Gly Ser Gln Cys Ala Glu 275 280 285 Arg Glu Gly Glu Gly Asn Ser Ser Lys Lys Gln Arg Met Asn Trp Ser 290 295 300 Asp Glu Met His Gln Gln Phe Val Asn Ala Val Asn Gln Leu Gly Ile 305 310 315 320 Asp Lys Ala Val Pro Lys Arg Ile Leu Asp Leu Met Ser Val Glu Gly 325 330 335 Leu Thr Arg Glu Asn Val Ala Ser His Leu Gln Lys Tyr Arg Ile Tyr 340 345 350 Leu Lys Arg Met Ala Asn His Gln Glu Asn Gly Lys Gln Ala Val Met 355 360 365 Ser Thr Asp Thr Ile Ala Arg Ala Glu Ala Ala Tyr Gln Gly Gly Met 370 375 380 Pro Gln Gly Gln Gln Met Met Gln Gln Glu His Ser Gly Gln Ala Val 385 390 395 400 Gln Tyr Ser Gln Pro His Ala Pro Ser Gly Leu His Gln Gln Ala Met 405 410 415 Pro Ala Gln Met His Met Gly Met Met Pro Ala Gly Pro Gln Pro Gly 420 425 430 Ser Met Gln Met Ala Pro His His Val Met Gln Met Pro Asn Gly Gln 435 440 445 Val Met Val Met Gln Gln Met Gly Pro Arg Pro Gly Met Pro Pro Gly 450 455 460 Met Pro Gln Gln Met Met Ala Ser Ser Gln Gln Met Gly Met Leu Gln 465 470 475 480 Pro Gly Met Pro Ala Gly Gln Met Leu His Phe Gln His Pro Gln Gln 485 490 495 Val His Gln His Pro Pro Ser Ser Gly Pro Met His Ala Gly Gly Glu 500 505 510 Met Ile Asp Pro Gly Ser Met Gln Arg Leu His Gln Gln Pro His Tyr 515 520 525 Ile Val Pro Asn Ala Gln His Met Pro Ala Pro Ala Met Gly Met Pro 530 535 540 Pro Gly Ala Val Gln His Met Glu Tyr Ala Tyr Ser Gln Pro Met Gln 545 550 555 560 Met Ala Gly Trp Pro Val Gln Gly Gln Pro Gly Ser Gln Ala 565 570 <210> 17 <211> 674 <212> PRT <213> Oocystis <400> 17 Met Leu Ala Phe Thr His Gln Arg Met Thr Thr Ala Pro Ala Leu Ala 1 5 10 15 Val Ala Thr Ser His Phe Phe Ala His Val Arg Val Thr Thr Gly Ser 20 25 30 Ser Ala Ile Ala Thr Val Phe Ala Ala Arg Ser Arg Gly Ser Gly Leu 35 40 45 Leu Ala Gly Phe Asn Thr Met Glu Asn Val Lys Val Glu Val Pro Glu 50 55 60 Val Val Pro Glu Asn Val Asn Phe Pro Ala Gly Leu Lys Val Leu Val 65 70 75 80 Val Asp Asp Asp Pro Leu Cys Leu Lys Val Ile Asp Gln Met Leu Arg 85 90 95 Arg Cys Asn Tyr Ala Ala Thr Thr Cys Gln Ser Ser Leu Glu Ala Leu 100 105 110 Glu Leu Leu Arg Ser Ser Lys Glu Asn His Phe Asp Leu Val Leu Ser 115 120 125 Asp Val Tyr Met Pro Asp Met Asp Gly Phe Lys Leu Leu Glu Ile Ile 130 135 140 Gly Leu Glu Met Gly Leu Pro Val Ile Met Met Ser Ser Asn Gly Glu 145 150 155 160 Thr Gly Val Val Phe Arg Gly Val Thr His Gly Ala Val Asp Phe Leu 165 170 175 Ile Lys Pro Val Arg Ile Glu Glu Leu Arg Asn Leu Trp Gln His Val 180 185 190 Val Arg Lys Thr Met Val Val Pro Ser Asn Asp Lys Ala Thr Ser Glu 195 200 205 Glu Asp Gly Glu Glu Ser Lys His Arg Val Asp Arg Lys Arg Lys Glu 210 215 220 Ser Phe His Ser Arg Ala Arg Glu Gln Val Glu Ile Ala Cys Ser Val 225 230 235 240 Val Pro Ala Leu Leu Trp Pro Thr Val Pro Pro Ser Ser Val His Pro 245 250 255 Thr Ser Ser Ser Phe Leu Arg Ser His Val Leu Leu Leu Gln Arg Ser 260 265 270 Ser Gly Gly Lys Asp Val Leu Asp Glu Gly Gly Ser Asn Ala Lys Lys 275 280 285 Pro Arg Val Val Trp Ser Val Glu Met His Gln Gln Phe Val Asn Ala 290 295 300 Val Asn Gln Leu Gly Ile Asp Lys Ala Val Pro Lys Arg Ile Leu Asp 305 310 315 320 Leu Met Asn Val Asp Gly Leu Thr Arg Glu Asn Val Ala Ser His Leu 325 330 335 Gln Lys Tyr Arg Leu Tyr Leu Lys Arg Val Ala Gly Ile Asn Thr Ala 340 345 350 Thr Gly Ser Arg Asn Gly Lys Gly Arg Ser Asp Val Ser Gly Leu Ser 355 360 365 Gly Met Pro Asn Gly Ser Leu Pro Met Pro Gly Met Met Pro Pro His 370 375 380 Met Ala Ala Gly Met Leu Leu Ala Gly Met Ala Ala Asp Val Gly Pro 385 390 395 400 Arg Pro His Pro Phe Pro Ile Met Pro Met Pro Ala Met Ala Leu Gln 405 410 415 Gly Met His Gly Gly Met Ala Gln Met Met Gln Leu Pro Pro Gly Met 420 425 430 Pro Pro Pro Met Met Met Pro Met Ala Pro Leu Leu Pro Ser Gln Leu 435 440 445 Ala Ala Leu Gly Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Val Ala 450 455 460 Arg Ser Glu Ser Met Pro Ser Glu Asn Gly Val Ala Gly Pro Ser Gly 465 470 475 480 Ser Phe Thr Ala Met Leu Asn Gly Pro Ala Pro Met Glu Ser Ser Pro 485 490 495 Phe Ala Ala Leu Gln Val Phe Gly Pro Pro Gln Gly Met Glu Gln Leu 500 505 510 Thr Gln Gln Gln Gln Gln Gln Gln Gln Ala Gly Ala Ala Ala Phe Val 515 520 525 Ala Ala Phe Ala Ala Ala Asn Gly Gly Asp Met Gln Gly Gly Gly Gly 530 535 540 Gly Pro Gly Pro Met Leu Gly Gly Ala Gly Gly Ala Gly Pro Leu Leu 545 550 555 560 Gly Gly Val Gly Gly Gly Asp Pro Leu His Gly Gly Gly Gly Ser Ser 565 570 575 Ala Leu Gly Gly Arg Pro Met Met Ser Ala Glu Gln Pro Met Gly Gly 580 585 590 Ser Gly Gly Leu Ala Ser Asn Ser Leu Thr Val Gln Gln Asn Asp Leu 595 600 605 Ala Gln Met Cys Ser Gln Leu Asp Val Asn Gly Leu Gln Ala Val Ala 610 615 620 Ala Ala Ala Ala Ala Gly Ala Met Gly Ala Pro Gly Gly Ala Gly Gly 625 630 635 640 Ala Met Pro Pro Ser Ser Val Gly Gly Val Gly Pro Asp Met Lys Leu 645 650 655 Thr Glu Gln Asp Asp Phe Phe Ser Phe Leu Leu Lys Asp Ser Asn Leu 660 665 670 Ile Asp <210> 18 <211> 488 <212> PRT <213> Microcystis <400> 18 Met Ser Thr Pro Ala Val Ser Lys Gly Phe Pro Ile Gly Leu Arg Val 1 5 10 15 Leu Val Val Asp Asp Asp Pro Leu Cys Leu Lys Ile Val Glu Lys Met 20 25 30 Leu Lys Arg Cys Gln Tyr Glu Val Thr Thr Phe Ser Arg Gly Ala Glu 35 40 45 Ala Leu Lys Thr Leu Arg Glu Arg Lys Asp Asp Phe Asp Ile Val Leu 50 55 60 Ser Asp Val His Met Pro Asp Met Asp Gly Phe Lys Leu Leu Glu His 65 70 75 80 Ile Ala Leu Glu Leu Asp Ile Pro Val Met Met Met Ser Ala Asn Cys 85 90 95 Ala Thr Asp Val Val Leu Arg Gly Ile Ile His Gly Ala Val Asp Tyr 100 105 110 Leu Leu Lys Pro Val Arg Ile Glu Glu Leu Arg Asn Ile Trp Gln His 115 120 125 Val Val Arg Arg Lys Arg Glu Ser Ser Gln Gly Asn Leu Arg Ser Gly 130 135 140 Glu Gly Gly Ser Asn Gly Arg Thr Val Ser Gly Gly Ser Thr Gly Glu 145 150 155 160 Gly Gly Gly Lys Asp Ser Lys Gly Ser Ser Glu Gln His Gly Asp Ala 165 170 175 Lys Asp Lys Thr Gly Ser Ala Gly Gly Ser Gly Gly Ser Ser Lys Arg 180 185 190 Lys Lys Gly Ser Gly Lys Lys Gly Asp Glu Gly Thr Asp Glu Val Lys 195 200 205 Asp Gly Ser Gly Gly Asp Glu Asn Glu Asp Ser Ser Ala Leu Lys Lys 210 215 220 Pro Arg Val Val Trp Ser Ala Glu Leu His Gln Gln Phe Val Thr Ala 225 230 235 240 Val Asn Gln Leu Gly Ile Asp Lys Ala Val Pro Lys Arg Ile Leu Asp 245 250 255 Leu Met Gly Val Gln Gly Leu Thr Arg Glu Asn Val Ala Ser His Leu 260 265 270 Gln Lys Tyr Arg Leu Tyr Leu Lys Arg Leu Gln Gly Val Asn Ser Gly 275 280 285 Gly Ala Pro Gly Gly Gly Pro Gly Phe Met Ser Pro Ile Ala Leu Asp 290 295 300 Gly Ser Met Val Gln Gly Gly Pro Gly Gly Arg Val Gly Ser Pro Ala 305 310 315 320 Ile Gly Gly Pro Asn Gly Pro Ile Met Val Gly His Gly His Ile Asp 325 330 335 Pro Ala Met Leu Ala Gly Gly Ala Pro Gln Thr Ile Gln Met Gly Met 340 345 350 Val Tyr Gly Gly Pro Gly Met Gly Pro Pro Gln Met Met Ala Pro Asn 355 360 365 Gly Lys Gly Gly Gly Gly Met Pro Gly Gly Tyr Val Met Gln Pro Gly 370 375 380 Gln Met Met Ala Pro Asn Gly Gln Met Met Pro Val Gly Gln Met Gly 385 390 395 400 Pro Gly Gly Met Met Val Gln Gly Pro Gly Gly Gly Met Met Gln Met 405 410 415 His Asp Gly Gly Met Met Asn Gly Asn Gly Ser Tyr Gly Ser Leu Gln 420 425 430 Asn Met Lys Gln Gly Asn Gly Val Val Met Met Pro Asn Gly Gly Met 435 440 445 Gly Gly Val Asp Gly Ala Ile Pro Asn Met Ala Thr Gly Leu Ile Asn 450 455 460 Gly Gln Gly Leu Pro Asp Asp Asp Val Leu Asp Met Phe Leu Lys Asp 465 470 475 480 Gly Leu Pro Glu Gly Glu Gly Phe 485 <210> 19 <211> 544 <212> PRT <213> Micromonas pusilla <400> 19 Met Thr Ala Glu Lys Lys Glu Leu Lys Val Phe Pro Ala Gly Leu Arg 1 5 10 15 Val Leu Val Val Asp Asp Asp Pro Leu Cys Leu Arg Ile Val Glu Lys 20 25 30 Met Leu Lys Arg Cys Gln Tyr Glu Val Thr Thr Phe Ser Arg Gly Ala 35 40 45 Glu Ala Leu Glu Thr Leu Arg Ala Arg Arg Asp Asp Phe Asp Ile Val 50 55 60 Leu Ser Asp Val His Met Pro Asp Met Asp Gly Phe Lys Leu Leu Glu 65 70 75 80 His Ile Ala Leu Glu Leu Asp Val Pro Val Met Met Met Ser Ala Asn 85 90 95 Cys Ala Thr Asp Val Val Leu Arg Gly Ile Ile His Gly Ala Val Asp 100 105 110 Tyr Leu Leu Lys Pro Val Arg Leu Glu Glu Leu Arg Asn Ile Trp Gln 115 120 125 His Val Val Arg Arg Gln Arg Glu Pro Ser Lys Asp Gly Ala Ala Gly 130 135 140 Lys Gly Gly Gly Ala Ser Gly Ala Pro Glu Val Ser Gly Asp Thr His 145 150 155 160 Ala Asn Thr Asp Asp Lys Gln Asp Gly Asn Ala Thr Asp Ser Lys Gly 165 170 175 Ser Gly Ser Gln Lys Arg Lys Ser Gly Lys Ser Gly Asp Asp Gly Gly 180 185 190 Lys Asp Gly Gly Gly Ser Gly Gly Lys Asp Gly Asp Ala Ser Asn Lys 195 200 205 Gly Asn Asn Asn Lys Arg Lys Lys Gly Lys Ser Asn Asp Ala Thr Glu 210 215 220 Thr Ala Gly Gly Ala Gly Val Glu Asp Asn Asp Asp Thr Ser Gly Leu 225 230 235 240 Lys Lys Pro Arg Val Val Trp Ser Pro Glu Leu His Gln Gln Phe Val 245 250 255 Thr Ala Val Asn Gln Leu Gly Ile Asp Lys Ala Val Pro Lys Arg Ile 260 265 270 Leu Asp Leu Met Gly Val Gln Gly Leu Thr Arg Glu Asn Val Ala Ser 275 280 285 His Leu Gln Lys Tyr Arg Leu Tyr Leu Lys Arg Leu Gln Gly Val Asn 290 295 300 Asn Asn Gly Thr Val Pro Ser Gly Ala Ala Gly Phe Met Thr Gly Leu 305 310 315 320 Ala Ile Asp Gly Val Gly Gly Val Met Gly Pro Pro Thr Thr Gly Ser 325 330 335 Pro Ala Met Asn Gly Pro Gly Gly Pro Gly Gly Gly Leu Val Met Gly 340 345 350 Pro Gly His Met Gly Gly Pro His Met Asp Gly Ser Gly Met Met His 355 360 365 Met Gly Pro Gly Gly Pro Met Ala Gly Met Thr Val Val Tyr Gly Gly 370 375 380 Gly Met Pro Gly Gly Met Pro Gly Gly Ala Asp Ser Lys Asn Gly Ala 385 390 395 400 Ser Gly Gln Pro Pro Pro Gly Gly Tyr Val Val Met Gly Gly Pro His 405 410 415 Gly Gly Gly Pro Gly Gly Ala Pro Met Met Met Gln His Gly Gly Met 420 425 430 Val Pro Gly Pro Gly Pro Gly Leu Val Pro Gly Pro Gly Gly Ser Leu 435 440 445 Met Met Pro Ala Gly Met Met Pro Asp Gly Gly Gly Gly Met Val Gly 450 455 460 Val His Val Gly Pro Gly Val Val Met Gly Gln His Gln Leu Gly Gly 465 470 475 480 Lys His Ser Ser Gly Gly Ala Gly Met Ala Gly Gly Ser Ala Ala Gly 485 490 495 Lys Gly Ala Gln Arg Gly Gly Val Gly Gly Ala Phe Asp Val Pro Pro 500 505 510 Thr Asn Gly Ser Leu Asp Ala Asp Glu Ile Gly Asp Asp Val Leu Thr 515 520 525 Met Phe Leu Lys Asp Gly Leu Pro Glu Met Asn Asp Gly Asp Ala Leu 530 535 540 <210> 20 <211> 776 <212> PRT <213> Sphagnum pseudotenuifolium <400> 20 Met Ser Gly Gly Asp Leu Ser Arg Val Arg Glu Gly Thr Ala Asp Leu 1 5 10 15 Asp Pro Val Met Ala Ser His Gln His Pro Pro Pro Arg Gln Gln Ser 20 25 30 His Gln Gln Pro Lys Asn His Gln Gln Glu Ala His Gln Gln His Cys 35 40 45 Ser Ser Ala Glu Thr Thr Ser Pro Asn Asn Thr Ala Arg Gly Ala Gly 50 55 60 Ala Thr Tyr Gly Lys Met Glu Pro Ala Asp Asp Phe Pro Ala Gly Leu 65 70 75 80 Arg Ile Leu Val Val Asp Asp Asp Pro Thr Cys Leu Ala Ile Leu Lys 85 90 95 Lys Met Leu Gln Gln Cys Ser Tyr Gln Val Thr Thr Cys Gly Arg Ala 100 105 110 Thr Arg Ala Leu Glu Leu Leu Arg Glu Asp Lys Asp Lys Phe Asp Leu 115 120 125 Val Ile Ser Asp Val Tyr Met Pro Asp Met Asp Gly Phe Lys Leu Leu 130 135 140 Glu Leu Val Gly Leu Glu Met Asp Leu Pro Val Ile Met Met Ser Gly 145 150 155 160 Asn Gly Glu Thr Ser Val Val Met Lys Gly Ile Thr His Gly Ala Cys 165 170 175 Asp Tyr Leu Leu Lys Pro Val Arg Ile Glu Glu Leu Ser Asn Ile Trp 180 185 190 Gln His Val Val Arg Lys Leu Arg Ser Glu Pro Lys Glu His Ser Ala 195 200 205 Ser Leu Glu Asp Gly Asp Arg Gln Arg Arg Gly Gly Ala Glu Asp Ala 210 215 220 Asp Asn Thr Ser Ser Ala Ala Asp Thr Ala Asp Gly Ile Trp Arg Asn 225 230 235 240 Lys Lys Lys Lys Glu Ala Lys Glu Asp Glu Glu Asp Phe Glu Gln Asp 245 250 255 Asn Asp Asp Pro Ser Thr Leu Lys Lys Pro Arg Val Val Trp Ser Val 260 265 270 Glu Leu His Gln Gln Phe Val Ser Ala Val Asn Gln Leu Gly Ile Asp 275 280 285 Lys Ala Val Pro Lys Arg Ile Leu Glu Leu Met Ser Val Gln Gly Leu 290 295 300 Thr Arg Glu Asn Val Ala Ser His Leu Gln Lys Tyr Arg Leu Tyr Leu 305 310 315 320 Lys Arg Leu Ser Gly Val Thr Ser Gln Ser Asn Ser Leu Asn Val Ser 325 330 335 Phe Gly Gly Pro Asp Ala Gly Tyr Gly Gly Leu Phe Gly Leu Asp Glu 340 345 350 Met Ser Asp Tyr Arg Asn Leu Val Thr Asn Gly His Leu Pro Ala Gln 355 360 365 Thr Ile Ala Ala Leu His His Ala Asn Met Ala Gly Arg Leu Gly Ala 370 375 380 Ser Ser Gly Met Val Gly Pro Ser Ser Pro Leu Asp Pro Ser Val Leu 385 390 395 400 Ala Gln Ile Ala Ala Leu Gln Ser Gly Ser Leu Pro Arg Pro Gly Met 405 410 415 Asp Gly Ser Leu Gln Gly Asn Gln Ala Gly Leu Leu Gln Ser Leu Ser 420 425 430 Gly Ala Leu Asp Tyr Asn Ser Leu His Gln Ser His Leu Leu Pro Ala 435 440 445 Ile Gly Gln Leu Gly Gln Leu Asp Glu Leu Pro Ser Leu Lys Ser Met 450 455 460 Gln His Gln Leu Gly Met Gly Ser Leu Gly Gly Ser Thr Arg Asn Leu 465 470 475 480 Ala Gly Ser Pro Asn Glu Glu Leu Thr Met Gln Leu Leu Gln Gln Arg 485 490 495 Ala Gln Gln Gln Ser Gly Gly Ser Pro Ile Asn Leu Pro Gln Ala Thr 500 505 510 Gly Ile Leu Arg Pro Leu Ser Ser Asn Ile Asn Gln Gly Gly Ser Val 515 520 525 Pro Asn Leu Val Gly Val Ile Pro Gly Thr Ala Ile Gly Leu Ser Asn 530 535 540 Met Cys Ser Gly Gly Arg Glu Phe Gly Ser Ser Ser Gly Leu Leu Ser 545 550 555 560 Ala Ser Gly Ser Leu Met Gln Ser Ser Thr Val Glu Ala Gln Asn Leu 565 570 575 Asn Phe Gly Gly Ser Ser Gly Ser Ser Gly Cys Ser Phe Gln Ala Ser 580 585 590 Val Leu Ser Ser Lys Thr Gly Gly Leu Glu Asp Leu Asn Pro Ala Lys 595 600 605 Arg Val Arg Thr Thr Tyr Ser Ala Leu Ser His Ser Ser Pro Asp Leu 610 615 620 Gly Gln Ser Ser Arg Pro Ala Trp Leu Gly Ser Gln Glu Gly Leu Val 625 630 635 640 His Gly Asp Pro Val Tyr Ser Pro His Gln Leu Ser Leu Pro Arg Gln 645 650 655 Asp Ile Val Gly Gly Ile Gly Ser Ser Gly Arg Pro Ala Tyr Met Gly 660 665 670 Ser Gln Ser Met Gly Ser Leu Gly Met Asn Phe Pro Leu Ser Leu Ala 675 680 685 Val Asp Ala Gly Ala Val Arg Pro Ser Leu Thr Arg Gly Gln Ser Leu 690 695 700 Thr Glu Gln Val Ala Ala Asn Arg Glu Leu Lys Phe Pro Lys Glu Glu 705 710 715 720 Arg Gly Arg Asp Asn Leu Met Cys Ala Arg Leu Gly Gly Gly Met Ile 725 730 735 Thr Asn Glu Ser Ser Ser Glu Glu Leu Leu Asn Tyr Leu Lys Gln Ser 740 745 750 His Glu Gly Leu Gly Phe Met Glu Gly Asp Leu Val Ser Asp Gly Tyr 755 760 765 Pro Val Asp Asn Leu Tyr Val Lys 770 775 <210> 21 <211> 715 <212> PRT <213> Physcomitrella patens <400> 21 Met Gly Gly Gly Tyr Leu Ser Ser Thr Val Asn Met Gly Glu Ser Arg 1 5 10 15 Asp Gly Gly Ser Pro Ala Met Ala Thr Leu Gln Gln Gln Gln Lys His 20 25 30 Gln Pro Leu Asn Pro Asn His Gln Asn Pro Arg Asn Arg Ser Asn Ser 35 40 45 Ser Pro Thr Asn Cys Tyr Ser Asn Thr Ala Trp Gly Ala Lys Pro Ala 50 55 60 Lys Leu Asp Thr Pro Asp Glu Phe Pro Val Gly Met Arg Val Leu Val 65 70 75 80 Val Asp Asp Asn Pro Thr Cys Leu Met Ile Leu Glu Gln Met Leu Val 85 90 95 Arg Cys Ala Tyr Arg Val Thr Thr Cys Gly Lys Ala Thr Glu Ala Leu 100 105 110 Ser Met Leu Arg Glu Asp Ile Gly Lys Phe Asp Val Val Ile Ser Asp 115 120 125 Val Asp Met Pro Asp Met Asp Gly Phe Lys Leu Leu Glu Leu Val Gly 130 135 140 Leu Glu Met Asp Leu Pro Val Ile Met Val Ser Gly Asn Gly Glu Thr 145 150 155 160 Ser Ala Val Met Lys Gly Ile Thr His Gly Ala Cys Asp Tyr Leu Leu 165 170 175 Lys Pro Val Arg Ile Glu Glu Leu Arg Asn Ile Trp Gln His Val Val 180 185 190 Arg Lys Lys Arg Arg Glu Val Lys Ala Val Ala Thr Lys Ser Val Glu 195 200 205 Glu Ala Gly Gly Cys Glu Arg Pro Lys Arg Gly Gly Gly Ala Asp Asp 210 215 220 Ala Asp Tyr Thr Ser Ser Ala Thr Asp Thr Thr Asp Ser Asn Trp Lys 225 230 235 240 Leu Thr Lys Arg Arg Lys Gly Glu Phe Lys Asp Glu Asn Glu Glu Asp 245 250 255 Asn Glu Gln Glu Asn Asp Asp Pro Ser Thr Leu Lys Arg Pro Arg Val 260 265 270 Val Trp Ser Val Glu Leu His Gln Gln Phe Val Ser Ala Val Asn Gln 275 280 285 Leu Gly Ile Asp Lys Ala Val Pro Lys Arg Ile Leu Glu Leu Met Gly 290 295 300 Val Gln Gly Leu Thr Arg Glu Asn Val Ala Ser His Leu Gln Lys Tyr 305 310 315 320 Arg Leu Tyr Leu Lys Arg Leu Ser Gly Val Thr Ser Gln Gln Gly Asn 325 330 335 Met Ser Ala His Phe Gly Gly Ser Asp Pro Phe Cys Met Met Pro Pro 340 345 350 Asp Met Ser Leu Ala Asn Gly Gln Leu Thr Pro Gln Ala Leu Ala Lys 355 360 365 Phe His Met Leu Gly Arg Met Asn Ala Thr Asn Gly Ile Gly Phe Ser 370 375 380 Gly Gly Gly Leu Asp Pro Gly Met Asn Gln Met Phe Leu Gln Asp Leu 385 390 395 400 Pro Arg Pro Pro Gln Leu Asn Ser Met Leu Arg Asn Asn Thr Gly Leu 405 410 415 Leu Ala Ser Val Pro Asn Gly Leu Gln His Leu Glu Gln Leu Ser Glu 420 425 430 Pro His His Val His Val Val Asn Glu Leu Glu His Tyr Pro Ser Asn 435 440 445 Thr Lys Val Tyr Pro Gln Leu Asn Gly Asn Leu Asp Val Ser Val Gly 450 455 460 Pro Leu Gly Ala Ala Asn Gly Asn Leu Ala Ser Asn Pro Asn Ser Asp 465 470 475 480 Thr Leu Leu Met His Ile Leu His Ser Arg Ala Ser Gln Gln Gly Val 485 490 495 Gly Ser Pro Ser Thr Leu Pro Gln Pro Arg Cys Gly Leu Asn Pro Thr 500 505 510 His Leu Leu Ser Asn Asp Ile Asn Phe Ala Pro Val Gly Ser Leu Pro 515 520 525 Asn Leu Ala Gly Ser Leu Gly Pro Ala Val Gly Leu Ser Ala Ile Pro 530 535 540 Gly Ser Ala Gly Gly Arg Asp Leu Ser Pro Ser Val Gly Gly Ser Gly 545 550 555 560 Ala Ser Leu Ser Ser Pro Leu Gly Ser Leu Val Arg Arg Pro Leu Met 565 570 575 Ala Glu Glu Gln Ser Asn Pro Val Asn Ser Thr Asn Gly Thr Tyr Ser 580 585 590 Met Ala His Ser Gly Gln Ser Pro Lys Pro Ser Gly Asp Thr Leu Pro 595 600 605 Thr Pro Leu Asn Glu Gly Leu Glu Gln Gln Gln Pro Leu Trp Ala Leu 610 615 620 Tyr Gln Asn Pro Met Asn Gln Leu Ser His Gly Pro Ser Gln Gly Phe 625 630 635 640 Pro His Asp Ser Leu Gln Trp Ser Val Leu Thr Glu Asn Leu Ser Phe 645 650 655 Gly Asp Met Gly Gln Ser Leu Ser Ala Gly Leu Ile Ser Gln Phe Ser 660 665 670 Ser Gln Gly Gln Asp Asn Gly Ile Gly Phe Ala Pro Pro Ser Gln Arg 675 680 685 Gly Ser Tyr Thr Arg Gln Ser Val Ser Phe Pro Ala Ser Ser Ala Leu 690 695 700 Asp Gly Arg Met Val Arg Ser Ser Tyr Glu Pro 705 710 715 <210> 22 <211> 664 <212> PRT <213> Arabidopsis thaliana <400> 22 Met Val Asn Pro Gly His Gly Arg Gly Pro Asp Ser Gly Thr Ala Ala 1 5 10 15 Gly Gly Ser Asn Ser Asp Pro Phe Pro Ala Asn Leu Arg Val Leu Val 20 25 30 Val Asp Asp Asp Pro Thr Cys Leu Met Ile Leu Glu Arg Met Leu Met 35 40 45 Thr Cys Leu Tyr Arg Val Thr Lys Cys Asn Arg Ala Glu Ser Ala Leu 50 55 60 Ser Leu Leu Arg Lys Asn Lys Asn Gly Phe Asp Ile Val Ile Ser Asp 65 70 75 80 Val His Met Pro Asp Met Asp Gly Phe Lys Leu Leu Glu His Val Gly 85 90 95 Leu Glu Met Asp Leu Pro Val Ile Met Met Ser Ala Asp Asp Ser Lys 100 105 110 Ser Val Val Leu Lys Gly Val Thr His Gly Ala Val Asp Tyr Leu Ile 115 120 125 Lys Pro Val Arg Ile Glu Ala Leu Lys Asn Ile Trp Gln His Val Val 130 135 140 Arg Lys Lys Arg Asn Glu Trp Asn Val Ser Glu His Ser Gly Gly Ser 145 150 155 160 Ile Glu Asp Thr Gly Gly Asp Arg Asp Arg Gln Gln Gln His Arg Glu 165 170 175 Asp Ala Asp Asn Asn Ser Ser Ser Val Asn Glu Gly Asn Gly Arg Ser 180 185 190 Ser Arg Lys Arg Lys Glu Glu Glu Val Asp Asp Gln Gly Asp Asp Lys 195 200 205 Glu Asp Ser Ser Ser Leu Lys Lys Pro Arg Val Val Trp Ser Val Glu 210 215 220 Leu His Gln Gln Phe Val Ala Ala Val Asn Gln Leu Gly Val Asp Lys 225 230 235 240 Ala Val Pro Lys Lys Ile Leu Glu Met Met Asn Val Pro Gly Leu Thr 245 250 255 Arg Glu Asn Val Ala Ser His Leu Gln Lys Tyr Arg Ile Tyr Leu Arg 260 265 270 Arg Leu Gly Gly Val Ser Gln His Gln Gly Asn Met Asn His Ser Phe 275 280 285 Met Thr Gly Gln Asp Gln Ser Phe Gly Pro Leu Ser Ser Leu Asn Gly 290 295 300 Phe Asp Leu Gln Ser Leu Ala Val Thr Gly Gln Leu Pro Pro Gln Ser 305 310 315 320 Leu Ala Gln Leu Gln Ala Ala Gly Leu Gly Arg Pro Thr Leu Ala Lys 325 330 335 Pro Gly Met Ser Val Ser Pro Leu Val Asp Gln Arg Ser Ile Phe Asn 340 345 350 Phe Glu Asn Pro Lys Ile Arg Phe Gly Asp Gly His Gly Gln Thr Met 355 360 365 Asn Asn Gly Asn Leu Leu His Gly Val Pro Thr Gly Ser His Met Arg 370 375 380 Leu Arg Pro Gly Gln Asn Val Gln Ser Ser Gly Met Met Leu Pro Val 385 390 395 400 Ala Asp Gln Leu Pro Arg Gly Gly Pro Ser Met Leu Pro Ser Leu Gly 405 410 415 Gln Gln Pro Ile Leu Ser Ser Ser Val Ser Arg Arg Ser Asp Leu Thr 420 425 430 Gly Ala Leu Ala Val Arg Asn Ser Ile Pro Glu Thr Asn Ser Arg Val 435 440 445 Leu Pro Thr Thr His Ser Val Phe Asn Asn Phe Pro Ala Asp Leu Pro 450 455 460 Arg Ser Ser Phe Pro Leu Ala Ser Ala Pro Gly Ile Ser Val Pro Val 465 470 475 480 Ser Val Ser Tyr Gln Glu Glu Val Asn Ser Ser Asp Ala Lys Gly Gly 485 490 495 Ser Ser Ala Ala Thr Ala Gly Phe Gly Asn Pro Ser Tyr Asp Ile Phe 500 505 510 Asn Asp Phe Pro Gln His Gln Gln His Asn Lys Asn Ile Ser Asn Lys 515 520 525 Leu Asn Asp Trp Asp Leu Arg Asn Met Gly Leu Val Phe Ser Ser Asn 530 535 540 Gln Asp Ala Ala Thr Ala Thr Ala Thr Ala Ala Phe Ser Thr Ser Glu 545 550 555 560 Ala Tyr Ser Ser Ser Ser Thr Gln Arg Lys Arg Arg Glu Thr Asp Ala 565 570 575 Thr Val Val Gly Glu His Gly Gln Asn Leu Gln Ser Pro Ser Arg Asn 580 585 590 Leu Tyr His Leu Asn His Val Phe Met Asp Gly Gly Ser Val Arg Val 595 600 605 Lys Ser Glu Arg Val Ala Glu Thr Val Thr Cys Pro Pro Ala Asn Thr 610 615 620 Leu Phe His Glu Gln Tyr Asn Gln Glu Asp Leu Met Ser Ala Phe Leu 625 630 635 640 Lys Gln Glu Gly Ile Pro Ser Val Asp Asn Glu Phe Glu Phe Asp Gly 645 650 655 Tyr Ser Ile Asp Asn Ile Gln Val 660 <210> 23 <211> 1036 <212> PRT <213> Arabidopsis rotundifolia <400> 23 Leu Ser Lys Lys Gln Asn Glu Asp Ala Ser Gly Arg Lys Glu Glu Asp 1 5 10 15 Gly Lys Gly Asn Glu His Asn Gly Met Glu Ser Cys Thr Arg Met Lys 20 25 30 Arg Thr Val Trp Thr Val Glu Leu His Gln Lys Phe Val Asn Ala Phe 35 40 45 Gln Gln Leu Gly Leu Asp Lys Ala Ser Pro Glu Gln Ile His Ala Leu 50 55 60 Met Asn Val Glu Gly Leu Pro Val Ile Asn Val Ala Ser His Leu Gln 65 70 75 80 Lys Tyr Arg Leu Phe Leu Lys Lys Ile Tyr Glu Gly Gln Gln Leu Asp 85 90 95 Met Ala Thr Ile Gln Leu Leu Leu Ser Ala Gly Ser His Phe Pro Gln 100 105 110 Thr Pro Trp Thr Asn His Cys Ser Ser Phe Ile Gln Gln Gly His His 115 120 125 Gln Asn Ser Ser Asn Ser Ser Glu Thr Tyr His Thr Thr Leu Ser Pro 130 135 140 Arg Val Gln Lys Val Asn Thr Phe Gln Pro Ser Ser Ser Pro Leu Lys 145 150 155 160 Pro Leu Leu Phe Pro Lys Ser Asn Ile Ser Ala Phe Lys Glu Asp Phe 165 170 175 Lys Ser Ile Lys Glu Pro Ala Ile Val Gly Asp Ser Ser Leu Asp Ser 180 185 190 Ser Lys Pro Arg Asn Ser Phe Gln Thr Ala Ser Lys Phe Pro Lys Thr 195 200 205 Asp Pro Cys Thr Gly Ser Tyr Ile Ile Glu Ile Met Thr Glu Pro Tyr 210 215 220 Tyr Gly Lys Ser Ser Arg Arg His Ser Asn Phe Ser Ala Tyr Met Gly 225 230 235 240 Asp Phe Lys Ser Ile Lys Asp Pro Glu Ile Val Gln Glu Ser Arg Thr 245 250 255 Arg Lys Asn His Gly Arg Val Val Trp Ser His Glu Leu His Gln Lys 260 265 270 Phe Leu Asn Ala Ile Asp Gln Leu Gly Gly Asn Glu Lys Ala Ile Pro 275 280 285 Lys Lys Ile Leu Ala Val Met Asn Val Glu Gly Leu Thr Arg Leu Asn 290 295 300 Val Ala Thr His Leu Gln Lys Tyr Arg Gln Cys Cys Ser Ala Glu Ala 305 310 315 320 Gln Gln Leu Asn Met Ala Thr Arg Lys Leu Pro Ser Ser Glu His Leu 325 330 335 Pro Gln Ser Pro Ser Thr Asn His His Ser Ser Leu Ser Pro Arg Val 340 345 350 Gln Asp Val Asn Ile Arg Leu Trp Ser Ser Ser Pro Lys Arg Gln Asp 355 360 365 Gln Ile Leu Val Tyr Val Leu Phe Ser Phe Glu Asn Asp Asn Gly Arg 370 375 380 Glu Glu Thr Thr Cys Arg Arg Ile Ala Ser Thr Met Glu Leu Gly Ser 385 390 395 400 Thr Glu Asp Gly Arg His Asp Lys Phe Pro Val Gly Met Arg Val Leu 405 410 415 Ala Val Asp Asp Asn Pro Thr Cys Leu Arg Lys Leu Glu Glu Leu Leu 420 425 430 Leu Arg Cys Lys Tyr His Val Thr Lys Thr Met Glu Ser Arg Lys Ala 435 440 445 Leu Glu Leu Leu Arg Glu Asn Ser Asn Met Phe Asp Leu Val Ile Ser 450 455 460 Asp Val Glu Met Pro Asp Thr Asp Gly Phe Lys Leu Leu Glu Ile Gly 465 470 475 480 Leu Glu Met Asp Leu Pro Val Ile Met Leu Ser Ala His Ser Asp Tyr 485 490 495 Asp Ser Val Met Lys Gly Ile Ile His Gly Ala Cys Asp Tyr Leu Val 500 505 510 Lys Pro Val Gly Leu Lys Glu Leu Gln Asn Ile Trp His His Val Val 515 520 525 Lys Lys Asn Ile Lys Ser Tyr Ala Lys Asn Ile Gly Pro Ser Arg Gln 530 535 540 Leu Leu Pro Pro Ser Glu Ser Asn Leu Val Pro Ser Ala Ser Lys Lys 545 550 555 560 Arg Lys Glu Lys Ala Ser Asp Ser Gly Asp Glu Asp Asp Ser Asp Arg 565 570 575 Glu Glu Asp Asp Gly Glu Gly Ser Glu Gln Asp Gly Glu Glu Ser Gly 580 585 590 Thr Arg Lys Lys Pro Arg Val Val Trp Ser Gln Glu Leu His Gln Lys 595 600 605 Phe Val Ser Ala Val Gln Gln Leu Gly Leu Asp Lys Ala Val Pro Lys 610 615 620 Lys Ile Leu Asp Leu Met Ser Ile Glu Gly Leu Thr Arg Glu Asn Val 625 630 635 640 Ala Ser His Leu Gln Lys Tyr Arg Leu Tyr Leu Lys Lys Ile Asp Glu 645 650 655 Gly Gln Gln Gln Asn Met Thr Pro Asp Ala Phe Gly Thr Arg Asp Ser 660 665 670 Ser Tyr Phe Gln Met Ala Gln Leu Asp Gly Leu Arg Asp Phe Thr Ala 675 680 685 Thr Arg Gln Ile Pro Ser Ser Gly Leu Leu Ser Arg Ser His Leu Thr 690 695 700 Lys Leu Gln Pro Pro Met Tyr Ser Ser Ile Asn Leu Gln Gly Met Asn 705 710 715 720 Ser Ser Ser Phe Ile Gln Gln Gly His His His Asn Ser Ser Asn Ser 725 730 735 Ala Asn Pro Phe Gly Thr Tyr His Thr Thr Leu Ser Pro Arg Ile Gln 740 745 750 Asn Val Asn Leu Leu Gln Arg Thr Ser Ser Pro Leu Glu Thr Leu Gln 755 760 765 Phe Pro Arg Ser Lys Ser Tyr Ile Gly Asp Phe Lys Gly Ile Gly Asp 770 775 780 Arg Ala Val Gly Gly Ser Phe Leu Asp Ser Cys Met Pro Phe Gly Ser 785 790 795 800 Ser Ser Thr Ser Leu Pro Ser Ala Ser Thr Asn Thr Leu Met Leu Gln 805 810 815 Ala Asn Tyr Thr Gln Pro Leu His Ile Ala Ser Asp Gly Asn Gln Pro 820 825 830 Cys Ile Glu Gly Thr Pro Ser Asn Ser Ala Ser Pro Asn Ile Ser Phe 835 840 845 Gln Gly Leu Ser Arg Phe Pro Ser His Ser Trp Gln Gly Asn Leu Asn 850 855 860 Thr Thr Arg Phe Pro Pro Ser Ser Leu Pro Leu Asn Gln Ala Phe Leu 865 870 875 880 Pro Asp Gln Val Thr Cys Ala Gly Asn Asn Leu Gly Asp Cys Thr Ser 885 890 895 Leu Val Ser Ala Gly Asn Pro Gly Gly Glu Met Gln Cys Glu Pro Gln 900 905 910 Leu Leu Gly Gly Phe Met Gln Asn Met Asn Pro Leu Asp Gly Gln Lys 915 920 925 Trp Glu Gln Gln Asn Ser Met Leu Asn Asn Pro Phe Gly Asn Ile Glu 930 935 940 Tyr Pro Leu Ser Ala Asp Asn Met Val Phe Arg Asp Asn Asn Ala Thr 945 950 955 960 Arg Asn Lys Gly Leu Asp Glu Ser Leu Met Asn Pro Ile Asp Asn Ser 965 970 975 Gln Glu Tyr Val Gly Lys Ala Thr Thr Met Leu Asp Pro Glu Met Lys 980 985 990 Ser Gly Lys Pro Glu Asn Asp Asn Gln His Asp Val Phe Asp Asp Ile 995 1000 1005 Met Asn Glu Met Met Lys Gln Glu Glu Asn Asn Gly Met Val Ser 1010 1015 1020 Val Ala Thr Arg Phe Gly Phe Asp Ser Phe Pro Pro Pro 1025 1030 1035 <210> 24 <211> 774 <212> PRT <213> Arabidopsis lyrata <400> 24 Met Gly Asp Phe Lys Ser Ile Lys Glu Pro Glu Ile Val Gln Glu Ser 1 5 10 15 Arg Thr Arg Lys Asn His Gly Arg Val Val Trp Ser His Glu Leu His 20 25 30 Gln Lys Phe Leu His Ala Ile Asp Gln Leu Gly Gly Asn Asp Lys Ala 35 40 45 Ile Pro Lys Lys Ile Leu Ala Val Met Asn Val Glu Gly Leu Thr Arg 50 55 60 Leu Asn Val Ala Thr His Leu Gln Lys Tyr Arg Gln Cys Cys Ser Thr 65 70 75 80 Glu Ala Gln Gln Leu Asn Met Ala Thr Arg Lys Leu Pro Ser Ser Glu 85 90 95 His Leu Pro Gln Ser Pro Ser Thr Asn His His Ser Ser Leu Ser Pro 100 105 110 Arg Val Gln Asp Asn Asp Asn Gly Arg Glu Glu Thr Thr Cys Arg Arg 115 120 125 Ile Ala Ser Thr Met Glu Leu Gly Ser Thr Glu Asp Gly Arg His Asp 130 135 140 Lys Phe Pro Val Gly Met Arg Val Leu Ala Val Asp Asp Asn Pro Thr 145 150 155 160 Cys Leu Arg Lys Leu Glu Glu Leu Leu Leu Arg Cys Lys Tyr His Val 165 170 175 Thr Lys Thr Met Glu Ser Arg Lys Ala Leu Glu Leu Leu Arg Glu Asn 180 185 190 Ser Asn Met Phe Asp Leu Val Ile Ser Asp Val Glu Met Pro Asp Thr 195 200 205 Asp Gly Phe Lys Leu Leu Glu Ile Gly Leu Glu Met Asp Leu Pro Val 210 215 220 Ile Met Leu Ser Ala His Ser Asp Tyr Asp Ser Val Met Lys Gly Ile 225 230 235 240 Ile His Gly Ala Cys Asp Tyr Leu Val Lys Pro Val Gly Leu Lys Glu 245 250 255 Leu Gln Asn Ile Trp His His Val Val Lys Lys Asn Ile Lys Ser Tyr 260 265 270 Ala Lys Asn Ile Gly Pro Ser Arg Gln Leu Leu Pro Pro Ser Glu Ser 275 280 285 Asn Leu Val Pro Ser Ala Ser Lys Lys Arg Lys Glu Lys Ala Asn Asp 290 295 300 Ser Gly Asp Glu Asp Asp Ser Asp Arg Glu Glu Asp Asp Gly Glu Gly 305 310 315 320 Ser Glu Gln Asp Gly Asp Glu Ala Gly Thr Arg Lys Lys Pro Arg Val 325 330 335 Val Trp Ser Gln Glu Leu His Gln Lys Phe Val Ser Ala Val Gln Gln 340 345 350 Leu Gly Leu Asp Lys Ala Val Pro Lys Lys Ile Leu Asp Leu Met Ser 355 360 365 Ile Glu Gly Leu Thr Arg Glu Asn Val Ala Ser His Leu Gln Lys Tyr 370 375 380 Arg Leu Tyr Leu Lys Lys Ile Asp Glu Gly Gln Gln Gln Asn Met Thr 385 390 395 400 Pro Asp Ala Phe Gly Thr Arg Asp Ser Ser Tyr Phe Gln Met Ala Gln 405 410 415 Leu Asp Gly Leu Arg Asp Phe Thr Ala Thr Arg Gln Ile Pro Ser Ser 420 425 430 Gly Leu Leu Ser Arg Ser His Leu Thr Lys Leu Gln Pro Pro Met Tyr 435 440 445 Ser Ser Ile Asn Leu Gln Gly Met Asn Ser Ser Ser Phe Ile Gln Gln 450 455 460 Gly His His His Asn Ser Ser Asn Ser Ala Asn Pro Phe Gly Thr Tyr 465 470 475 480 His Thr Thr Leu Ser Pro Arg Ile Gln Asn Val Asn Leu Phe Gln Arg 485 490 495 Thr Ser Ser Pro Leu Glu Thr Leu Gln Phe Pro Arg Ser Lys Ser Tyr 500 505 510 Ile Gly Asp Phe Lys Gly Ile Gly Asp Arg Ala Val Gly Gly Ser Phe 515 520 525 Leu Asp Ser Cys Met Pro Phe Gly Ser Ser Ser Thr Ser Leu Pro Ser 530 535 540 Ala Ser Thr Asn Thr Leu Met Leu Gln Ala Asn Tyr Thr Gln Pro Leu 545 550 555 560 His Ile Ser Ser Asp Gly Asn Gln Pro Cys Ile Glu Gly Thr Pro Ser 565 570 575 Asn Ser Ala Ser Pro Asn Ile Ser Phe Gln Gly Leu Ser Arg Phe Pro 580 585 590 Ser His Ser Trp Gln Gly Asn Leu Asn Thr Thr Arg Phe Pro Pro Ser 595 600 605 Ser Leu Pro Leu Asn Pro Ala Phe Leu Pro Asp Gln Val Thr Cys Ala 610 615 620 Gly Asn Asn Leu Gly Asp Cys Thr Ser Leu Val Ser Ala Gly Asn Pro 625 630 635 640 Gly Gly Glu Ile Gln Cys Glu Pro Gln Leu Leu Gly Gly Phe Met Gln 645 650 655 Asn Met Asn Pro Leu Asp Gly Gln Lys Trp Glu Gln Gln Asn Cys Thr 660 665 670 Met Leu Asn Asn Pro Phe Gly Asn Ile Glu Tyr Pro Leu Pro Ala Asp 675 680 685 Asn Met Val Phe Arg Asp Asn Asn Ala Thr Arg Ser Lys Gly Leu Asp 690 695 700 Glu Ser Leu Met Asn Pro Ile Asp Asn Ser Gln Glu Tyr Val Gly Lys 705 710 715 720 Ala Thr Thr Met Leu Asp Pro Glu Met Lys Ser Gly Lys Pro Glu Asn 725 730 735 Asp Asn Gln His Asp Val Phe Asp Asp Leu Met Asn Glu Met Met Lys 740 745 750 Gln Glu Glu Asn Asn Gly Met Val Ser Val Ala Thr Arg Phe Gly Phe 755 760 765 Asp Ser Phe Pro Pro Pro 770 <210> 25 <211> 578 <212> PRT <213> Sunflower <400> 25 Met Thr Thr Gly Ser Ser Phe Gly Ser Gly Ser Leu Gly Cys Lys Gln 1 5 10 15 Glu Thr Gly Val Pro Asp Gln Phe Pro Ala Gly Leu Arg Val Leu Val 20 25 30 Val Asp Asp Asp Val Ile Cys Leu Lys Ile Leu Glu Gln Met Leu Arg 35 40 45 Arg Cys Ser Tyr His Val Thr Thr Cys Ser Gln Ala Thr Ala Ala Leu[[ID=3i]] 50 55 60 Asn Leu Leu Arg Glu Arg Lys Gly Cys Phe Asp Val Val Leu Ser Asp 65 70 75 80 Val His Met Pro Asp Met Asp Gly Phe Lys Leu Leu Glu Leu Val Gly 85 90 95 Leu Glu Met Asp Leu Pro Val Ile Met Met Ser Ala Asp Gly Arg Thr 100 105 110 Asn Leu Val Leu Arg Gly Ile Arg His Gly Ala Cys Asp Tyr Leu Ile 115 120 125 Lys Pro Ile Arg Glu Glu Gln Leu Lys Asn Ile Trp Gln His Val Ile 130 135 140 Arg Lys Lys Trp Asn Glu Asn Lys Glu His Glu His Ser Gly Ser Val 145 150 155 160 Asp Asp Lys Asp Arg His Lys Arg Gly Gly Asp Asp Asn Asp Tyr Ala 165 170 175 Ser Ser Val Asn Glu Gly Gly Asp Gly Ile Leu Thr Ser His Lys Lys 180 185 190 Lys Arg His Asn Asn Lys Glu Glu Asp Asp Gly Glu Leu Glu Thr Asp 195 200 205 Glu Pro Gly Gly Ser Lys Lys Ala Arg Val Val Trp Ser Val Glu Leu 210 215 220 His Gln Gln Phe Val Thr Ala Val Asn Gln Leu Gly Ile Asp Lys Ala 225 230 235 240 Val Pro Lys Arg Ile Leu Glu Leu Met Asn Val Pro Gly Leu Thr Arg 245 250 255 Glu Asn Val Ala Ser His Leu Gln Lys Phe Arg Leu Tyr Leu Lys Arg 260 265 270 Leu Ser Gly Val Ala Gln Gln Gly Gly Gly Pro Asn Ser Phe Cys Gly 275 280 285 Ser Ile Asp Gln Asn Pro Lys Leu Ala Ser Tyr Ala Arg Phe Glu Ile 290 295 300 Gln Ala Leu Ala Ala Ser Gly Gln Ile Pro Pro Gln Thr Leu Val Ala 305 310 315 320 Leu His Ala Glu Leu Leu Gly Gln Pro Thr Ala Asn Val Gly Met Pro 325 330 335 Val Leu Asp His Gln Pro Leu Met Gln Pro Ser Lys Cys Gly Pro Val 340 345 350 Asp His Val Met Ser Tyr Gly Gln Thr Leu Pro Ser Asn Val Thr Lys 355 360 365 Gln Val Pro Gln Pro Ala Ile Glu Asp Val His Ser Gly Leu Gly Ala 370 375 380 Trp His Ser Asn Asn Met Val Gly Gly Tyr Gly Gln Leu Gly Gly Gln 385 390 395 400 Asn Trp His Asn Met Leu Leu Gly Met Leu Gln Ser Gln Ser His Gln 405 410 415 Leu Gln Lys Gln Ser Ile Thr Val Gln Pro Ser Arg Leu Val Val Pro 420 425 430 Ser Gln Ser Ser Asn Phe Gln Ala Val Asn Asn Gly Val Pro Val Asn 435 440 445 Gln Thr Thr Gly Phe Asn Asn Ser Thr Val Ile Asn Tyr Ala Val Gly 450 455 460 Gln Arg Thr Glu Arg Asp Val Glu Asn Gln Ile Gly Gly Gln Ser Ser 465 470 475 480 Val Ser Asn Ile Ser Val Lys Glu Met Gly Glu Lys Gln Ile Ser Phe 485 490 495 Gly Glu Ser Val His Val Leu Asp Gln Gly Ser Leu Arg Asn Leu Gly 500 505 510 Phe Val Gly Lys Lys Ser Ser Ile Pro Ser Arg Phe Ala Val Tyr Glu 515 520 525 Ala Ala Glu Ser Leu Thr His Asn Leu Asn Tyr Gly Asp Asn Asn Gly 530 535 540 Glu Arg Arg Val Lys Gln Glu Pro Asn Ile Glu Phe Leu Glu Asn Ser 545 550 555 560 Lys Ala Gly Ala His Arg Val Ser Gln Asn Asp Leu Met Ser Lys Gln 565 570 575 Val Arg <210> 26 <211> 428 <212> PRT <213> Grape <400> 26 Met Ala Ala Leu Leu Lys Val Pro Pro Gln Ser Ser Gly Gly Thr Asn 1 5 10 15 Gly Ser Cys Lys Ala Asp Val Val Val Ser Asp Gln Phe Pro Ala Gly 20 25 30 Leu Arg Val Leu Val Val Asp Asp Asp Val Thr Cys Leu Lys Ile Leu 35 40 45 Glu Gln Met Leu Arg Arg Cys Leu Tyr His Val Thr Thr Cys Ser Gln 50 55 60 Ala Thr Ile Ala Leu Asn Ile Leu Arg Glu Lys Lys Gly Cys Phe Asp 65 70 75 80 Ile Val Leu Ser Asp Val His Met Pro Asp Met Asp Gly Tyr Lys Leu 85 90 95 Leu Glu His Val Gly Leu Glu Met Asp Leu Pro Val Ile Met Met Ser 100 105 110 Ala Asp Gly Arg Thr Ser Ala Val Met Arg Gly Ile Arg His Gly Ala 115 120 125 Cys Asp Tyr Leu Ile Lys Pro Ile Arg Glu Glu Glu Leu Lys Asn Ile 130 135 140 Trp Gln His Val Val Arg Lys Lys Trp Asn Glu Asn Lys Glu His Glu 145 150 155 160 His Ser Gly Ser Leu Glu Asp Asn Asp Arg His Lys Arg Gly Gly Glu 165 170 175 Asp Ala Glu Tyr Ala Ser Ser Val Asn Glu Gly Ala Glu Gly Ile Leu 180 185 190 Lys Gly Gln Lys Lys Arg Arg Asp Ser Lys Asp Glu Asp Asp Gly Glu 195 200 205 Leu Glu Asn Glu Asp Pro Ser Thr Ser Lys Lys Pro Arg Val Val Trp 210 215 220 Ser Val Glu Leu His Gln Gln Phe Val Ser Ala Val Asn Gln Leu Gly 225 230 235 240 Ile Asp Lys Ala Val Pro Lys Arg Ile Leu Glu Leu Met Asn Val Pro 245 250 255 Gly Leu Thr Arg Glu Asn Val Ala Ser His Leu Gln Lys Phe Arg Leu 260 265 270 Tyr Leu Lys Arg Leu Ser Gly Val Ala Gln Gln Gln Gly Gly Ile Pro 275 280 285 Asn Ser Phe Cys Gly Pro Val Glu Pro Asn Val Lys Leu Gly Ser Leu 290 295 300 Gly Arg Phe Asp Ile Gln Ala Leu Ala Ala Ser Gly Gln Ile Pro Pro 305 310 315 320 Gln Thr Leu Ala Ala Leu Gln Ala Glu Leu Leu Gly Arg Pro Thr Ser 325 330 335 Asn Leu Val Leu Pro Ala Met Asp Gln Pro Ala Leu Leu Gln Ala Ser 340 345 350 Leu Gln Gly Pro Lys Cys Ile Pro Val Glu His Gly Val Ala Phe Gly 355 360 365 Gln Pro Leu Val Lys Cys Gln Thr Asn Ile Ser Lys His Phe Pro Pro 370 375 380 Thr Val Val Ser Thr Glu Asp Val Pro Ser Gly Phe Gly Ala Trp Pro 385 390 395 400 Ser Asn Ser Leu Gly Thr Val Gly Thr Ser Gly Ser Leu Gly Gly Leu 405 410 415 Ser Ala Gln Asn Asn Asn Ile Leu Met Asp Met Lys 420 425 <210> 27 <211> 659 <212> PRT <213> Amborella <400> 27 Met Ala Asn Val Gln Lys Leu Pro His Ser Ser Ile Ser Thr Ala Ser 1 5 10 15 Ser Tyr Gly Ser Cys Arg Gly Glu Gly Val Pro Asp Gln Phe Pro Ala 20 25 30 Gly Leu Arg Val Leu Val Val Asp Asp Asp Thr Thr Cys Leu Arg Ile 35 40 45 Leu Glu Gln Met Leu Arg Lys Cys Met Tyr Lys Val Thr Thr Cys Cys 50 55 60 Arg Ala Thr Asp Ala Leu Asp Thr Leu Arg Gly Ser Lys Gly Cys Phe 65 70 75 80 Asp Val Val Ile Ser Asp Val Tyr Met Pro Asp Met Asp Gly Phe Lys 85 90 95 Leu Leu Glu His Val Gly Leu Glu Met Asp Leu Pro Val Ile Met Met 100 105 110 Ser Ala Asp Ala Arg Phe Ser Ala Val Met Lys Gly Ile Lys His Gly 115 120 125 Ala Cys Asp Tyr Leu Ile Lys Pro Val Arg Ile Glu Glu Leu Lys Asn 130 135 140 Ile Trp Gln His Val Val Arg Lys Lys Trp Asn Glu Thr Lys Glu His 145 150 155 160 Asp Gln Ser Gly Ser Ile Glu Asp Asn Glu Arg His Lys Arg Gly Ser 165 170 175 Asp Asp Ala Glu Tyr Ala Ser Ser Val Asn Glu Gly Thr Asp Gly Asn 180 185 190 Trp Lys Val Gln Lys Lys Arg Lys Asp Ser Lys Glu Glu Glu Asp Asp 195 200 205 Gly Glu Gln Glu Asn Glu Asp Pro Ser Ala Ala Lys Lys Pro Arg Val 210 215 220 Val Trp Ser Val Glu Leu His Gln Gln Phe Val Asn Ala Val Asn Gln 225 230 235 240 Leu Gly Ile Asp Lys Ala Val Pro Lys Arg Ile Leu Glu Leu Met Asn 245 250 255 Val Gln Gly Leu Thr Arg Glu Asn Val Ala Ser His Leu Gln Lys Phe 260 265 270 Arg Leu Tyr Leu Lys Arg Leu Ser Gly His Gln Ala Gly Val Ser Ser 275 280 285 Ser Phe Cys Gly Ser Val Asp Pro Asn Ser Lys Leu Gly Pro Leu Ser 290 295 300 Gln Leu Asp Ile Arg Ala Leu Thr Ala Ser Gly Gln Ile Pro Ser Gln 305 310 315 320 Thr Leu Ala Ala Leu Gln Ala Glu Leu Leu Gly Arg Pro Ser Asn Asn 325 330 335 Val Ala Met Pro Val Tyr Gly Gln Thr Leu Val Lys Cys Gln Pro Asn 340 345 350 Leu Pro Lys Gln Phe Pro Gln Pro Asn Leu Pro Val Asp Asp Val Gln 355 360 365 Ser Ser Leu Ser Ile Trp Gln His His Leu Ser Ser Gly Met Pro Leu 370 375 380 Gly Gly Leu Asn Pro Gln Asn Asn Gly Leu Leu Met Gln Gln Gln Gln 385 390 395 400 Gln Leu Thr Ile Glu Ser Asn Arg Pro Cys Asn Val Gln Pro Ser Cys 405 410 415 His Val Ala Pro Ser Asn Gly Gly Phe Thr Met Arg Asn Asn Pro Thr 420 425 430 Ser Ser Asn Ala Ser Ser Val Glu Tyr Asn Ser Leu Leu Ser Ser Gln 435 440 445 Gly Asp Val Gly Gln Ile Ser Gln Ala Ser Gly Ser Asp Leu Ala Thr 450 455 460 Thr Val Gln Ser Asn Gly Gly Phe Lys Ser Leu Asp Tyr Arg Asn Met 465 470 475 480 Gly Gln Val Ser Leu Glu Ser Thr Ser Asp Leu Val Ser Thr Gln Asn 485 490 495 Asn Gly Phe Lys Gly Met Glu Leu Arg Asn Val Gly Ser Leu Gly Gly 500 505 510 Tyr Pro Leu Ser Ser Ser Val Ser Ala Gly Ser Thr Lys Thr Glu Asn 515 520 525 Gly Gln Ser Phe Ser Gln Val Arg Thr Gly Pro Arg Met Ser Met Gly 530 535 540 Pro Thr Gly Gln Phe Val Gly Pro Pro Thr Ile Arg Arg Leu Pro Met 545 550 555 560 Val Asp Gly Gly Thr His Arg Asn Ser Leu Gly Phe Val Gly Lys Gly 565 570 575 Val Ser Ile Pro Ser Arg Phe Met Pro Asp Ser Gly Ser Pro Thr Gly 580 585 590 Val Gly Glu Glu Cys Thr Leu Pro Lys Gln Glu Val Asp Pro Asp Phe 595 600 605 Phe Asp Ser Leu Lys Val Gly Pro Val Gly Val Gln His Tyr Ala Ser 610 615 620 Gly Asp Leu Met Ser Val Leu Ser Lys Gln Gln Gln Ala Ser Thr Gly 625 630 635 640 Asn Leu Asp Cys Glu Phe Gly Ile Asp Gly Tyr Gln Leu Gly Asn Ile 645 650 655 His Val Lys <210> 28 <211> 669 <212> PRT <213> Castor <400> 28 Met Ala Ala Leu Gln Arg Val Ala Ser Ser Val Ser Ala Thr Ala Ser 1 5 10 15 Asn Tyr Ser Ser Cys Lys Gly Asn Gly Val Val Thr Ala Thr Ala Asp 20 25 30 Val Ala Val Ser Asp Gln Phe Pro Ala Gly Leu Arg Val Leu Val Val 35 40 45 Asp Asp Asp Thr Thr Cys Leu Arg Ile Leu Glu Gln Met Leu Arg Arg 50 55 60 Cys Leu Tyr His Val Thr Thr Cys Ser Gln Ala Lys Val Ala Leu Asn 65 70 75 80 Leu Leu Arg Glu Arg Lys Gly Cys Phe Asp Val Val Leu Ser Asp Val 85 90 95 His Met Pro Asp Met Asp Gly Phe Lys Leu Leu Glu His Val Gly Leu 100 105 110 Glu Met Asp Leu Pro Val Ile Met Met Ser Ala Asp Gly Arg Thr Ser 115 120 125 Ala Val Met Arg Gly Ile Arg His Gly Ala Cys Asp Tyr Leu Ile Lys 130 135 140 Pro Ile Arg Glu Glu Glu Leu Lys Asn Ile Trp Gln His Val Val Arg 145 150 155 160 Lys Lys Trp His Glu Asn Lys Glu Ile Glu His Ser Gly Ser Leu Glu 165 170 175 Asp Asn Asp Arg His Lys Arg Gly Asn Glu Asp Ala Glu Tyr Thr Ser 180 185 190 Ser Val Asn Glu Gly Thr Glu Gly Val Leu Lys Gly Gln Lys Arg Arg 195 200 205 Ser Asn Ser Lys Asp Glu Asp Asp Gly Glu Pro Asp Ser Asp Asp Pro 210 215 220 Ser Thr Ser Lys Lys Pro Arg Val Val Trp Ser Val Glu Leu His Gln 225 230 235 240 Gln Phe Val Ser Ala Val Asn Gln Leu Gly Ile Asp Lys Ala Val Pro 245 250 255 Lys Arg Ile Leu Glu Leu Met Asn Val Pro Gly Leu Thr Arg Glu Asn 260 265 270 Val Ala Ser His Leu Gln Lys Phe Arg Leu Tyr Leu Lys Arg Leu Ser 275 280 285 Gly Val Ala Gln Gln Gly Gly Ile Ser Ser Thr Phe Cys Gly Pro Met 290 295 300 Asp Ser Asn Val Lys Leu Asn Ser Leu Gly Arg Phe Asp Ile Gln Ala 305 310 315 320 Leu Ala Ala Ser Gly Gln Ile Pro Pro Gln Thr Leu Ala Ala Leu His 325 330 335 Ala Glu Leu Phe Gly Arg Pro Thr Gly Ser Leu Val Thr Thr Met Asp 340 345 350 Gln Pro Thr Leu Leu Gln Ala Ser Arg Gln Ser Pro Lys Cys Ile Pro 355 360 365 Val Glu His Gly Val Thr Phe Gly Gln Pro Ile Val Lys Cys Ser Ser 370 375 380 Gly Ile Ser Lys His Phe Pro Gln Asn Met Val Ser Val Glu Glu Val 385 390 395 400 Ser Ser Gly Tyr Gly Ala Trp Pro Ser Asn Ser Leu Gly Thr Val Gly 405 410 415 Pro Ser Thr Asn Leu Gly Gly Met Thr Thr Gln Asn Gly Asn Met Leu 420 425 430 Met Asp Ile Phe His Gln Gln Gln Lys Gln Gln Gln Pro Gln Gln Gln 435 440 445 Gln Ser Leu Ala Asp Pro Ser Arg Ser Ile Asn Val Gln Pro Ser Cys 450 455 460 Leu Val Val Pro Ser Gln Ser Ser Ala Cys Phe Gln Ala Gly Asn Ser 465 470 475 480 Pro Ala Ser Val Asn Gln Ser Asn Phe Asn Arg Asn Val Val Ile Asp 485 490 495 Tyr Ser Leu Leu Ser Ser Gln Ser Asn Asn Ser Ala Leu Asn Ile Gly 500 505 510 His Ile Pro Glu Gly Asp Leu Lys Thr Thr Gly Ala Val Asn Gly Tyr 515 520 525 Ser Ala Pro Gly Ser Leu Ser Pro Pro Ala Ser Ser Cys Ser Val Asn 530 535 540 Ala Asp Ser Gly Val Pro Arg Gln Val Gln Asn Pro Thr Leu Ala Phe 545 550 555 560 Gly Ala Val Arg Gln Leu Pro Ala Leu Ser Pro Asn Ile Phe Asn Ile 565 570 575 Gln Gly Ser Tyr Gly Val Arg Ser Asp Asp Ile Leu Asp Gln Gly Pro 580 585 590 Phe Phe Lys Asn Leu Gly Phe Val Gly Lys Gly Thr Cys Ile Pro Ser 595 600 605 Arg Phe Ala Val Asp Glu Phe Glu Thr Pro Ser Ser Asn Leu Ser His 610 615 620 Gly Lys Leu Tyr Val Glu Asn Asn Asp Asn Lys Val Lys Gln Glu Pro 625 630 635 640 Asn Ile Asp Phe Thr Asp Thr Ser Arg Val Gly Ile Pro Val Leu Gln 645 650 655 Gln Tyr Pro Pro Asn Asp Leu Met Ser Val Phe Thr Glu 660 665 <210> 29 <211> 654 <212> PRT <213> Tomato <400> 29 Met Val Ser Met Ser Gly Glu Val Ala Thr Cys Lys Ser Glu Ala Thr 1 5 10 15 Val Val Thr Asp His Phe Pro Val Gly Leu Arg Val Leu Val Val Asp 20 25 30 Asp Asp Val Val Cys Leu Arg Ile Ile Glu Gln Met Leu Arg Arg Cys 35 40 45 Lys Tyr Ser Val Thr Thr Cys Thr Gln Ala Met Val Ala Leu Asn Leu 50 55 60 Leu Arg Glu Lys Arg Gly Thr Phe Asp Ile Val Leu Ser Asp Val His 65 70 75 80 Met Pro Asp Met Asp Gly Phe Lys Leu Leu Glu Leu Val Gly Leu Glu 85 90 95 Met Asp Leu Pro Val Ile Met Met Ser Gly Asp Gly Arg Thr Asn Leu 100 105 110 Val Met Arg Gly Val Gln His Gly Ala Cys Asp Tyr Leu Ile Lys Pro 115 120 125 Ile Arg Asp Glu Glu Leu Lys Asn Ile Trp Gln His Val Val Arg Lys 130 135 140 Arg Tyr Asn Ser Ser Lys Glu Pro Glu Cys Ser Gly Ser Leu Asp Asp 145 150 155 160 Asn Asp Arg Tyr Arg Arg Arg Ser Asp Asp Ala Glu Cys Ala Ser Ser 165 170 175 Val Ile Glu Gly Ala Asp Gly Val Leu Lys Pro Gln Lys Lys Lys Arg 180 185 190 Glu Ala Lys Glu Asp Asp Thr Glu Met Glu Asn Asp Asp Pro Ser Thr 195 200 205 Thr Lys Lys Pro Arg Val Val Trp Ser Val Glu Leu His Gln Gln Phe 210 215 220 Val Ser Ala Val Asn Gln Leu Gly Ile Asp Lys Ala Val Pro Lys Arg 225 230 235 240 Ile Leu Glu Leu Met Asn Val Pro Gly Leu Thr Arg Glu Asn Val Ala 245 250 255 Ser His Leu Gln Lys Phe Arg Leu Tyr Leu Lys Arg Leu Ser Gly Val 260 265 270 Val Gln Gln Gln Gly Gly Leu Pro Ser Thr Phe Cys Gly Pro Ile Glu 275 280 285 Gln Asn Ser Glu Leu Gly Ser Leu Gly Arg Phe Asp Ile Gln Ala Leu 290 295 300 Ala Ala Ser Gly Gln Ile Pro Pro Glu Thr Leu Thr Ala Leu His Ala 305 310 315 320 Glu Leu Leu Gly Arg Ser Thr Ser Asn Leu Val Leu Pro Ala Val Glu 325 330 335 Gln Gln Asn Leu Val Gln Val Ser Leu Gln Gln Ala Lys Cys Ile Pro 340 345 350 Val Asp Gln Val Met Ala Tyr Gly Gln Pro Leu Leu Lys Cys Pro Ala 355 360 365 Ser Ile Ser Asn Ser Lys His Leu Ser Gln Ala Ile Leu Ser Ala Glu 370 375 380 Asp Val His Ser Gly Phe Gly Ser Gln Arg Ala Lys Asn Ile Cys Met 385 390 395 400 Val Pro Ser Ser Asn Pro Ile Ala Pro Asn Ser Asn Met Leu Thr Ala 405 410 415 Met Met Gln Gln Gln Gln Trp Gln Lys Gln Gln Gln Ile Glu Leu Gln 420 425 430 His Arg Gln Ser Gly Pro Pro Glu Val Asn Arg Ser Ile Asn Val Gln 435 440 445 Pro Ser Cys Leu Val Leu Pro Ser Gln Leu Pro Gly His Phe Gln Val 450 455 460 Gly Asp Ser Pro Ala Ser Ile Ser Arg Ala Gly Ser Leu Ser Lys Ser 465 470 475 480 Ser Val Ile Asp Tyr Gly Val Leu Ser Pro Gln Ser Asn Asn Ser Ser 485 490 495 Gly Val Val Gln Val Leu Asp Arg Glu Leu Lys Pro Glu Cys Gly Leu 500 505 510 Asn Arg Leu Pro Ser Gly Gly Ser Leu Ser Arg Ser Cys Ser Ile Asn 515 520 525 Ala Asp Asn Ser Val Asp Leu Gln Leu His Asn Ser Ser Ser Ala Phe 530 535 540 Gly Ser Ser Lys Gln Leu Pro Gly Leu Ile Pro Ser His Leu Gly Ser 545 550 555 560 Pro Val Pro Tyr Cys Ile Asn Ser Ser Leu Val Leu Asp Gln Gly Arg 565 570 575 Met Lys Gly Ala Ser Ile Pro Ser Arg Phe Ala Val Asp Glu Ser Asp 580 585 590 Ser Pro Met Cys Asn Phe Asn Thr Ala Lys Ile Tyr Leu Glu Glu Thr 595 600 605 Lys Val Lys Gln Glu Pro Asn Met Asn Val Met Glu Asn Ala Lys Val 610 615 620 Gly Pro Ala Ile Phe Gln Lys Phe Gln Pro Gly Asp Leu Met Ser Val 625 630 635 640 Phe Arg Leu Ser Phe Ala Arg Val Lys Val Ser Ser Ser Pro 645 650 <210> 30 <211> 653 <212> PRT <213> Potato <400> 30 Met Ser Gly Asp Val Ala Thr Cys Lys Ser Glu Ala Thr Val Val Thr 1 5 10 15 Asp His Phe Pro Leu Gly Leu Arg Val Leu Val Val Asp Asp Asp Val 20 25 30 Val Cys Leu Arg Ile Ile Glu Gln Met Leu Arg Arg Cys Lys Tyr Ser 35 40 45 Val Thr Thr Cys Thr Gln Ala Met Val Ala Leu Asn Leu Leu Arg Glu 50 55 60 Lys Arg Gly Thr Phe Asp Ile Val Leu Ser Asp Val His Met Pro Asp 65 70 75 80 Met Asp Gly Phe Lys Leu Leu Glu Leu Val Gly Leu Glu Met Asp Leu 85 90 95 Pro Val Ile Met Met Ser Gly Asp Gly Arg Thr Asn Leu Val Met Arg 100 105 110 Gly Val Gln His Gly Ala Cys Asp Tyr Leu Ile Lys Pro Ile Arg Asp 115 120 125 Glu Glu Leu Lys Asn Ile Trp Gln His Val Val Arg Lys Arg Tyr Asn 130 135 140 Ser Ser Lys Glu Leu Glu Cys Ser Gly Ser Leu Asp Asp Asn Asp Arg 145 150 155 160 Tyr Lys Arg Gly Ser Asp Asp Ala Glu Cys Ala Ser Ser Val Ile Glu 165 170 175 Gly Ala Asp Gly Val Leu Lys Pro Gln Lys Lys Lys Arg Glu Ala Lys 180 185 190 Glu Glu Asp Asp Thr Glu Met Glu Asn Asp Asp Pro Ser Thr Ser Lys 195 200 205 Lys Pro Arg Val Val Trp Ser Val Glu Leu His Gln Gln Phe Val Ser 210 215 220 Ala Val Asn Gln Leu Gly Ile Asp Lys Ala Val Pro Lys Arg Ile Leu 225 230 235 240 Glu Leu Met Asn Val Pro Gly Leu Thr Arg Glu Asn Val Ala Ser His 245 250 255 Leu Gln Glu Asn Gln Lys Phe Arg Leu Tyr Leu Lys Arg Leu Ser Gly 260 265 270 Val Val Gln Gln Gln Gly Gly Leu Pro Ser Thr Phe Cys Gly Pro Ile 275 280 285 Glu Gln Asn Ser Glu Leu Gly Ser Leu Gly Arg Phe Asp Ile Gln Ala 290 295 300 Leu Ala Ala Ser Gly Gln Ile Pro Pro Glu Thr Leu Thr Ala Leu His 305 310 315 320 Ala Glu Leu Leu Gly Arg Ser Thr Ser Asn Leu Val Leu Pro Ala Val 325 330 335 Glu Ile Gln Asn Leu Leu Gln Ala Ser Leu Gln Gln Ala Lys Cys Ile 340 345 350 Pro Ala Asp Gln Val Met Ala Tyr Gly Gln Pro Leu Leu Lys Cys His 355 360 365 Pro Ser Ile Ser Asn Ser Lys His Leu Ser Gln Ser Ile Leu Ser Ala 370 375 380 Glu Asp Val His Ser Gly Phe Gly Ser Gln Arg Ala Lys Asn Ile Cys 385 390 395 400 Leu Val Pro Ser Ser Asn Pro Ile Gly Leu Ala Ala Pro Asn Ser Asn 405 410 415 Met Leu Met Ala Met Met Gln Gln Gln Gln Trp Gln Lys Gln Gln Gln 420 425 430 Met Glu Leu Gln His Arg Arg Ser Gly Pro Pro Glu Val Asn His Ser 435 440 445 Ile Asn Val Gln Pro Ser Cys Leu Val Leu Pro Ser Gln Leu Pro Gly 450 455 460 Asn Phe Gln Val Gly Asp Ser Pro Ala Ser Ile Ser Arg Ala Gly Ser 465 470 475 480 Leu Ser Lys Ser Ser Val Ile Asp Tyr Gly Val Leu Ser Pro Gln Ser 485 490 495 Asn Asn Ser Ser Gly Val Val Gln Val Leu Asp Arg Glu Leu Lys Pro 500 505 510 Glu Cys Gly Leu Asn Arg Leu Pro Ser Gly Gly Ser Leu Ser Arg Ser 515 520 525 Cys Ser Ile Asn Ala Asp Asn Ser Val Gly Leu Gln Leu His Asn Ser 530 535 540 Ser Ser Ala Phe Gly Ser Ser Lys Gln Leu Pro Ala Leu Ile Pro Asn 545 550 555 560 His Leu Gly Ser Pro Val Pro Tyr Tyr Ile Asn Ser Ser Gln Val Leu 565 570 575 Asp Gln Gly His Thr Arg Asn Pro Gly Val Gly Lys Cys Ala Ser Ile 580 585 590 Pro Ser Arg Phe Ala Val Asp Glu Ser Asp Ser Pro Met Cys Asn Phe 595 600 605 Asn Thr Ala Lys Asn Tyr Leu Glu Glu Thr Lys Val Lys Gln Glu Pro 610 615 620 Asn Met Asn Val Met Glu Asn Ala Lys Val Gly Pro Ala Ile Phe Gln 625 630 635 640 Lys Phe Gln Pro Gly Asp Leu Met Ser Val Phe Ser Asp 645 650 <210> 31 <211> 669 <212> PRT <213> Upland cotton <400> 31 Met Ala Thr Met His Arg Val Val Gln Ser Ser Val Ser Thr Ser Asp 1 5 10 15 Ala Thr Thr Thr Ser Tyr Asp Gly Leu Thr Ser Cys Lys Ala Ala Asp 20 25 30 Ile Val Ile Ser Asp Gln Phe Pro Ala Gly Leu Arg Val Leu Val Val 35 40 45 Asp Asp Asp Ile Thr Cys Leu Lys Ile Leu Glu Lys Met Leu His Arg 50 55 60 Cys Arg Tyr His Val Thr Thr Cys Pro Gln Ala Lys Val Ala Leu Asn 65 70 75 80 Leu Leu Arg Glu Arg Lys Gly Cys Phe Asp Val Ile Leu Ser Asp Val 85 90 95 Tyr Met Pro Asp Met Asp Gly Tyr Lys Leu Leu Glu His Val Gly Leu 100 105 110 Glu Met Asp Leu Pro Val Ile Met Met Ser Ala Asp Gly Ser Thr Arg 115 120 125 Ala Val Met Lys Gly Ile Arg His Gly Ala Cys Asp Tyr Leu Ile Lys 130 135 140 Pro Ile Arg Glu Glu Glu Leu Lys Asn Ile Trp Gln His Val Val Arg 145 150 155 160 Lys Lys Trp Asn Glu Asn Lys Glu Leu Glu His Ser Gly Ser Leu Asp 165 170 175 Asp Thr Asp Gln His Lys Gln Arg His Asp Asp Ala Glu Tyr Ala Ser 180 185 190 Ser Val Asn Asp Ala Thr Glu Thr Ser Leu Lys Pro Leu Lys Lys Arg 195 200 205 Ser Asn Ser Lys Glu Glu Asp Asp Gly Glu Ile Asp Asn Asp Asp Pro 210 215 220 Ser Thr Ser Lys Lys Pro Arg Val Val Trp Ser Val Glu Leu His Gln 225 230 235 240 Gln Phe Val Ser Ala Val Asn Gln Leu Gly Ile Asp Lys Ala Val Pro 245 250 255 Lys Arg Ile Leu Glu Leu Met Asn Val Pro Gly Leu Thr Arg Glu Asn 260 265 270 Val Ala Ser His Leu Gln Lys Phe Arg Leu Tyr Leu Lys Arg Ile Ser 275 280 285 Gly Val Ala Gln Gln Gly Gly Ile Ala Asn Pro Leu Cys Gly Pro Val 290 295 300 Glu Ala Asn Val Lys Ile Gly Ser Leu Gly Ser Phe Asn Ile Gln Ala 305 310 315 320 Leu Ala Ala Ser Gly Gln Ile Pro Pro Gln Thr Leu Ala Ala Val His 325 330 335 Ala Glu Leu Leu Gly Arg Ser Ala Gly Asn Leu Val Val Ala Thr Asp 340 345 350 Gln Pro Ala Leu Leu Gln Ala Thr Pro Gln Gly Ala Lys Cys Ile Gln 355 360 365 Val Asp Gln Gly Val Ala Phe Val Gln His Ser Val Lys Ser Glu Ser 370 375 380 Ser Ser Ser Lys His Phe Ser Gln Ser Phe Ala Pro Val Glu Asp Val 385 390 395 400 Ala Ser Gly Phe Arg Ser Trp Pro Ser Asn Asn Ile Gly Thr Ala Gly 405 410 415 Pro Ser Asn Ser Gly Gly Leu Ser Ser Gln Asn Gly Asn Met Leu Ile 420 425 430 Asp Leu Leu Gln Gln Gln Gln Gln Leu Gln Lys Pro Gln Gln Arg Ser 435 440 445 Thr Val Ser Glu Leu Arg Arg Ser Ile Asn Val Gln Pro Ser Cys His 450 455 460 Val Val Pro Ser Gln Ser Ser Ala Ser Phe Arg Ala Gly Asn Ser Pro 465 470 475 480 ...

Claims

1. A mutant Pseudochlorella microorganism comprising a disruption of a gene encoding chloroplast signal recognition protein 54 (cpSRP54) of SEQ ID NO: 68, and a disruption of a gene encoding significant growth improvement gene 2 (SGI2) of SEQ ID NO:

5.

2. A mutant Pseudocerulina microorganism comprising a disruption of a gene encoding chloroplast signal recognition protein 54 (cpSRP54) of SEQ ID NO: 68, and a disruption of a gene encoding significant growth improvement gene 1 (SGI1) of SEQ ID NO:

3.

3. The mutant Pseudochlorella microorganism according to claim 2, further comprising a disruption of significant growth improvement gene 2 (SGI2).

4. The mutant Pseudochlorella microorganism of claim 1, wherein the mutant exhibits a reduction in chlorophyll under low light conditions and a decrease in chlorophyll under light conditions above 100 μE m -2 s -1 The maximum photochemical quantum yield (F) in photosystem II at all physiologically relevant irradiances v / F M ) is higher, the low light condition is less than 200 μE m -2 s -1 .

5. The mutant Pseudochlorella microorganism of claim 1, wherein the mutant exhibits a reduction in chlorophyll of at least 30% relative to a control Pseudochlorella microorganism of the same species.

6. The mutant Pseudochlorella microorganism of claim 1, wherein the mutant exhibits a higher carbon fixation rate on a per chlorophyll basis than a control Pseudochlorella microorganism of the same species.

7. The mutant Pseudochlorella microorganism of claim 6, wherein the mutant exhibits a Pmax that is 26% higher than a control Pseudochlorella microorganism of the same species.

8. The mutant Pseudochlorella microorganism of claim 1, wherein a culture of the mutant exhibits greater biomass productivity than a culture of a control Pseudochlorella microorganism of the same species.

9. The mutant Pseudochlorella microorganism of claim 8, wherein the mutant exhibits greater biomass productivity in photoautotrophic culture.

10. The mutant Pseudochlorella microorganism according to any one of claims 1 to 3, wherein the mutant is a genetically engineered mutant.

11. The mutant Pseudochlorella microorganism of claim 10, wherein the mutant has been genetically engineered by insertional mutagenesis, gene replacement, RNAi, antisense RNA, meganuclease genome engineering, one or more ribozymes, and / or a CRISPR / Cas system.

12. The mutant Pseudochlorella microorganism according to claim 11, wherein the mutant has been genetically engineered by the CRISPR / Cas system.

13. The mutant Pseudochlorella microorganism of claim 2, wherein a culture of the mutant Pseudochlorella microorganism exhibits greater lipid productivity than a culture of a control Pseudochlorella microorganism of the same species.

14. A biomass comprising the mutant Pseudochlorella microorganism according to any one of claims 1 to 13.

Images