ILDR2 antagonists and combinations thereof

Abstract

This invention relates to novel pharmaceutical combination products comprising an ILDR2 antagonist according to any one of the preceding claims, plus one or more other therapeutically active compounds, and to novel specific ILDR2 antagonists.

Description

[0001] Field of the Invention

[0002] The present invention relates to novel pharmaceutical combinations comprising an ILDR2 antagonist, plus one or more other therapeutically active compounds, as well as novel specific ILDR2 antagonists.

[0003] background

[0004] The B7 family of immunomodulatory ligands consists of structurally related cell surface protein ligands that bind to receptors on lymphocytes that modulate immune responses.

[0005] Activation of T and B lymphocytes is initiated by engagement of cell surface antigen-specific T cell receptors or B cell receptors, but additional signals delivered simultaneously via B7 ligands determine the final immune response. These 'co-stimulatory' or 'co-inhibitory' signals are delivered by B7 ligands via the CD28 family of receptors on lymphocytes.

[0006] The B7 protein family includes: B7.1 (CD80), B7.2 (CD86), inducible co-stimulatory ligand (ICOS-L), programmed death-1 ligand (PD-L1, also known as B7-1), programmed death-2 ligand (PD-L2), B7-H3 and B7-H4. Members of this family have been characterized primarily in humans and mice, but some members have also been found in birds. They share 20-40% amino acid identity and are structurally related, with the extracellular domain containing tandem domains associated with variable and constant immunoglobulin domains. B7 ligands are expressed in lymphoid and non-lymphoid tissues. The importance of this family in regulating immune responses has been shown by the development of immunodeficiency and autoimmune diseases in mice with mutations in B7 family genes. Manipulation of signals delivered by B7 ligands has shown potential in the treatment of autoimmune diseases, inflammatory diseases and cancer.

[0007] Interactions between B7 family members and their respective co-stimulatory receptors (usually members of the CD28-related family) enhance immune responses, whereas interactions with co-inhibitory receptors (such as CTLA4) attenuate immune responses.

[0008] Apparently, each B7 molecule has developed its own niche in the immune system. As the specific niches of B7 family members are constantly being dissected, their diagnostic and therapeutic potential becomes increasingly apparent. Many B7 superfamily members were initially characterized as T cell co-stimulatory molecules. However, it has recently become clear that they can also co-inhibit T cell responses. Therefore, B7 family members may have an opposite effect on the immune response.

[0009] Members of the B7 family have emerged as targets for immune checkpoint inhibitor therapy.

[0010] The PD-L1 inhibitor atezolizumab (MPDL3280) is a fully humanized engineered IgG1 antibody that has efficacy in the treatment of a variety of different cancers, including melanoma, lung cancer, bladder cancer, and kidney cancer. Avelumab (MSB0010718C) is a fully human IgG1 antibody that has shown efficacy in metastatic or locally advanced solid tumors. Durvalumab is an anti-PD-L1 antibody that has been combined with alternative immune checkpoint inhibitors to show efficacy in metastatic urothelial bladder cancer.

[0011] The PD1 inhibitors nivolumab and pembrolizumab bind to the PD-L1 receptor PD-1 and inhibit the binding of PD-L1 to PD-1.

[0012] Tremelimumab (formerly known as tesimumab, CP-675,206) is a fully human monoclonal antibody (IgG2) against CTLA-4. It blocks the binding of antigen presenting cell ligands B7.1 and B7.2 to CTLA-4, resulting in inhibition of downregulation of B7-CTLA-4-mediated T cell activation. Ipilimumab is a similar antibody with a similar mode of action, but with an IgG1 isotype.

[0013] Enoblituzumab (also known as MGA271) is an antibody that targets B7-H3, which is overexpressed on tumor cells and cancer stem-like cells, as well as on the supporting tumor vasculature and underlying tissue or stroma.

[0014] However, despite the tremendous success of the approaches identified above, some of them have proven to be unsustainable in their efficacy, ie, relapse of the disease occurs, and / or are ineffective for a given disease type.

[0015] Therefore, there is a great need in the field of immune checkpoint inhibitor therapy to provide new and improved therapies as well as to improve existing therapies.

[0016] The recently identified ILDR2 (immunoglobulin-like domain-containing receptor 2), also known as C10RF32, is a new member of the B7 / CD28 family. ILDR2 contains an IgV domain; it is also a type I membrane protein, like other known B7 members – this ultimately led to its annotation to the B7 family. In addition, two alternatively spliced ​​variants of ILDR2 (H19011-1-P8 and H19011-1-P9), which only share the first five exons with wild-type C10RF32, are similar to known B7 family members in the size of their exons and the location of the IgV and transmembrane domains within these exons. For a complete characterization of ILDR2, see WO2009032845, the contents of which are incorporated herein by reference.

[0017] To date, no therapy has been developed targeting this recently identified receptor.It is therefore an object of the present invention to provide new and improved immune checkpoint inhibitor therapies targeting ILDR2. SUMMARY OF THE INVENTION

[0019] The present invention provides novel pharmaceutical combination products comprising an ILDR2 antagonist, plus one or more other therapeutically active compounds, as well as novel specific ILDR2 antagonists. The general advantages of the present invention and its features are discussed in detail below. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] The term "mIgG" refers to murine immunoglobulin G. The term "hIgG" refers to human immunoglobulin G.

[0022] The terms "aPD-L1", "aPDL1", "aILDR2" and "BAY1905254" are defined elsewhere herein.

[0023] The term "isotype control" refers to the use of a monoclonal antibody of the same isotype, same species, but directed against an unrelated antigen. Isotype controls are widely used to set the level of distinction between nonspecific background and positive fluorescent staining.

[0024] The term "isotype ADC" refers to the use of antibody drug conjugates (ADCs) comprising the same toxin and a monoclonal antibody of the same isotype, same species, but directed against unrelated antigens.

[0025] Figure 1 : Significance of BAY1905254 treatment compared to isotype control as determined by two-way ANOVA analysis. The growth of B16F10 tumors was significantly delayed by treatment with BAY1905254 compared to isotype control. Start of treatment (d0). Experimental conditions are shown in the table below:

[0026] .

[0027] Figure 2 : Treatment with E10 antibody did not affect the growth of the B16F10 tumor model. The start of treatment (d0). The experimental conditions are shown in the table below:

[0028] .

[0029] Figure 3 : Significance of monotherapy and combination treatments relative to isotype control as determined by two-way ANOVA analysis. No monotherapy efficacy was observed with aPD-L1 treatment and BAY1905254 treatment relative to isotype control. The combination of aPD-L1 and BAY1905254 synergistically delayed tumor growth relative to control. Start of treatment: q3d ip. Experimental conditions are shown in the table below:

[0030] .

[0031] Figure 4 : Significance of the combined treatment of aPD-L1 and BAY1905254 compared to isotype control as determined by two-way ANOVA analysis. BAY1905254 alone did not show tumor growth delay in the CT26 tumor model at a dose of 3 mg / kg. At 10 mg / kg, aPD-L1 showed efficacy relative to isotype control, which was synergistically improved by combining 10 mg / kg of aPD-L1 with 3 mg / kg of BAY1905254. Start of treatment (d7): q3d ip. Experimental conditions are shown in the table below:

[0032] .

[0033] Figure 5 : Significance of monotherapy and combination treatment relative to isotype control as determined by two-way ANOVA analysis. Treatment of the 3C9-D11-H11 model with monotherapy aPD-L1 achieved a significant delay in tumor growth relative to isotype control, while this was not the case for BAY1905254. Combining aPD-L1 with BAY1905254 showed synergy and prevented tumor outgrowth. Start of treatment (d8): q3d ip. Experimental conditions are shown in the table below:

[0034] .

[0035] Figure 6: Significance of monotherapy and combination treatments relative to isotype control as determined by two-way ANOVA analysis. Treatment of the B16F10 OVA model with monotherapy BAY1905254 resulted in a moderate delay in tumor growth. This was synergistically improved when BAY1905254 was combined with OVA and CPG. Start of treatment (d9): q3d ip. Experimental conditions are shown in the table below:

[0036] .

[0037] Figure 7 : Significance of monotherapy and combination treatments relative to isotype control as determined by two-way ANOVA analysis. Treatment of the B16F10 OVA model with monotherapy BAY1905254 resulted in a moderate delay in tumor growth. This was synergistically improved when BAY1905254 was combined with docetaxel. Start of treatment (d8): q3d ip. Experimental conditions are shown in the table below:

[0038] .

[0039] Figure 8 : Significance of monotherapy and combination treatments relative to isotype control as determined by two-way ANOVA analysis. Treatment of the B16F10 OVA model with BAY1905254 monotherapy did not result in a delay in tumor growth. However, when BAY1905254 was combined with the C4.4a ADC, a synergistic effect was seen. Start of treatment (d6): q3d ip. Experimental conditions are shown in the table below:

[0040] .

[0041] Fig. 9A : Tumor shrinking activity of different antibodies in the B16F10 syngeneic mouse model. Tumor shrinking activity was measured as the reduction in tumor volume relative to isotype control.

[0042] Fig. 9B : Abnormal behavior of selected anti-ILDR2 antibodies according to the present invention in IL2 induction assay compared to anti-PD-L1 antibodies.

[0043] Fig. 9C : Tumor reducing activity of selected anti-ILDR2 antibodies according to the invention in the CT26 syngeneic mouse model. Tumor reducing activity was measured as a reduction in tumor volume relative to an isotype control.

[0044] definition

[0045] Unless otherwise defined, all technical and scientific terms used herein have the meanings commonly understood by those of ordinary skill in the art to which the invention belongs. However, the following references can provide a general definition of many terms used in the present invention for those of ordinary skill in the art to which the invention belongs, and can be referenced and used, as long as such definitions are consistent with the meanings commonly understood in the art. Such references include, but are not limited to, Singleton et al., Dictionary of Microbiology and Molecular Biology (2nd edition, 1994); The Cambridge Dictionary of Science and Technology (Walker edited, 1988); Hale & Marham, The Harper Collins Dictionary of Biology (1991); and Lackie et al., The Dictionary of Cell & Molecular Biology (3rd edition, 1999); and Cellular and Molecular Immunology, edited by Abbas, Lichtman and Pober, 2nd edition, WB Saunders Company. Any additional technical resources available to those of ordinary skill in the art can be consulted, which provide definitions of the terms used herein with the meanings commonly understood in the art. For the purposes of the present invention, the following terms are further defined. Additional terms are defined elsewhere in the specification.As used herein and in the appended claims, the singular forms "a", "an", and "the" include plural referents unless the context clearly dictates otherwise.

[0046] "Amino acids" may be referred to herein by either their commonly known three letter symbols or by the single-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Likewise, nucleotides may be referred to by their commonly accepted single-letter codes.

[0047] The term "combination product" in the present invention is used as known to those skilled in the art, and the combination product may be a fixed combination product, a non-fixed combination product or a kit-of-parts.

[0048] A "fixed combination" in the present invention is used as known to the skilled person and is defined as a combination wherein, for example, the first active ingredient, e.g. an ILDR2 antagonist of the present invention, and the further active ingredient are present together in one unit dose or in one single entity. An example of a "fixed combination" is a pharmaceutical composition wherein the first active ingredient and the further active ingredient are present in a mixture for simultaneous administration, e.g. in a formulation. Another example of a "fixed combination" is a pharmaceutical combination wherein the first active ingredient and the further active ingredient are present in one unit rather than in a mixture.

[0049] A non-fixed combination or "kit of parts" in the present invention is used as known to the person skilled in the art and is defined as a combination product wherein the first active ingredient and the further active ingredient are present in more than one unit. An example of a non-fixed combination or kit of parts is a combination product wherein the first active ingredient and the further active ingredient are present separately. The components of the non-fixed combination or kit of parts may be administered separately, sequentially, simultaneously, concurrently or chronologically staggered.

[0050] "Antibodies", also synonymously referred to as "immunoglobulins" (Ig), generally comprise four polypeptide chains, two heavy (H) chains and two light (L) chains, and are therefore multimeric proteins or their equivalent Ig homologues (e.g., camelid nanobodies comprising only heavy chains, single domain antibodies (dAbs) that may be derived from heavy or light chains); including full-length functional mutants, variants or derivatives thereof (including but not limited to murine, chimeric, humanized and fully human antibodies that retain the essential epitope binding characteristics of an Ig molecule (or, where necessary, modified by The invention relates to immunoglobulins that are capable of undergoing affinity maturation or deimmunization, and include dual specific, bispecific, multispecific and dual variable domain immunoglobulins. The immunoglobulin molecule can be of any class (e.g., IgG, IgE, IgM, IgD, IgA and IgY) or subclass (e.g., IgG1, IgG2, IgG3, IgG4, IgA1 and IgA2) and allotype. In one embodiment of the invention, the anti-ILDR2 antibody is fully human and is of the IgG2 subclass.

[0051] As used herein, an "antibody-based binding protein" may refer to a protein containing at least one antibody-derived V H 、V L or C H Any protein that is an immunoglobulin domain. Such antibody-based proteins include, but are not limited to (i) F binding proteins c Fusion protein comprising a receptor or a receptor component and all or part of an immunoglobulin C Hdomain, (ii) binding protein, wherein V H and or V L domains coupled to alternative molecular scaffolds, or (iii) molecules wherein the immunoglobulin V H and / or V L and / or C H The domains are combined and / or assembled in a manner not normally found in naturally occurring antibodies or antibody fragments.

[0052] As used herein, "antibody derivatives or fragments" refer to molecules comprising at least one polypeptide chain derived from an antibody that is not full-length, including but not limited to (i) Fab fragments, which are composed of variable light (V L ), variable weight (V H ), constant light (C L ) and constant weight 1(C H 1) a monovalent fragment consisting of two Fab domains; (ii) a F(ab')2 fragment, which is a bivalent fragment comprising two Fab fragments connected by a disulfide bridge at the hinge region; (iii) F ab (F d ) fragment, which consists of V H and C H 1 domain composition; (iv) variable fragment (F v ) fragment, which consists of the V L and V H domain composition; (v) domain antibody (dAb) fragments, which contain a single variable domain; (vi) isolated complementarity determining regions (CDRs); (vii) single chain F v Fragment (scF v ); (viii) a diabody, which is a bivalent bispecific antibody, wherein V H and V L The domains are expressed on one polypeptide chain, but using a linker that is too short to allow pairing between the two domains on the same chain, thereby forcing the domains to pair with the complementary domains of another chain and create two antigen-binding sites; and (ix) linear antibodies, which comprise a pair of tandem F v Segment (V H -C H 1-V H -C H 1), which together with the complementary light chain polypeptide form a pair of antigen binding regions; and (x) other non-full-length portions of immunoglobulin heavy and / or light chains, alone or in any combination, or mutants, variants or derivatives thereof.

[0053] As used herein, the term "modified antibody format" encompasses antibody-drug-conjugates, polyalkylene oxide-modified scFvs, monobodies, diabodies, camelid antibodies, domain antibodies, bispecific antibodies or trispecific antibodies, IgA, or two IgG structures connected by a J chain and a secretory component, shark antibodies, a New World primate framework + non-New World primate CDRs, an IgG4 antibody with the hinge region removed, an IgG with two additional binding sites engineered into the CH3 domain, an antibody with an altered Fc region to enhance affinity for Fcγ receptors, a dimeric construct comprising CH3+VL+VH, and the like.

[0054] As used herein, "antibody mimics" refers to proteins that do not belong to the immunoglobulin family, and even non-proteins, such as aptamers or synthetic polymers. Some types have antibody-like β-folded structures. Potential advantages of "antibody mimics" or "alternative scaffolds" over antibodies are better solubility, higher tissue permeability, higher stability against heat and enzymes, and relatively low production costs.

[0055] Some antibody mimetics can be provided in large libraries that provide specific binding candidates for each envisioned target. Just like antibodies, target-specific antibody mimetics can be developed by using high throughput screening (HTS) techniques and mature display technologies (such as phage display, bacterial display, yeast or mammalian display). Currently developed antibody mimetics include, for example, ankyrin repeat proteins (called DARPins), C-type lectins, Staphylococcus aureus ( S. aureus ), transferrin, lipocalin, the 10th type III domain of fibronectin, Kunitz domain protease inhibitors, ubiquitin-derived binders (called avidins), gamma-crystallin-derived binders, cysteine ​​knots or knottins, binders based on the thioredoxin A scaffold, nucleic acid aptamers, artificial antibodies produced by molecular imprinting of polymers, peptide libraries from bacterial genomes, SH-3 domains, stradobodies, "A domains" of membrane receptors stabilized by disulfide bonds and Ca2+, CTLA4-based compounds, FynSH3 and aptamers (oligonucleic acid or peptide molecules that bind to specific target molecules).

[0056] The term "Fc region" is used herein to define the C-terminal region of an immunoglobulin heavy chain that contains at least a portion of a constant region. The term includes native sequence Fc regions and variant Fc regions. Unless otherwise indicated herein, the amino acid residues in the Fc region or constant region are numbered according to the EU numbering system, also known as the EU index, as described in Kabat et al., Sequences of Proteins of Immunological Interest, 5th Edition, Public Health Service, National Institutes of Health, Bethesda, MD, 1991.

[0057] As used herein, "ILDR2" relates to immunoglobulin-like domain-containing receptor 2, also known as C10RF32, which is a novel member of the B7 / CD28 family. For a complete characterization of ILDR2, see WO2009032845, the contents of which are incorporated herein by reference.

[0058] The terms "anti-ILDR2 antibody" and "antibody that binds to ILDR2" refer to an antibody that is capable of binding to ILDR2 with sufficient affinity so that the antibody can be used as a diagnostic and / or therapeutic agent targeting ILDR2. In one embodiment, the extent of binding of the anti-ILDR2 antibody to unrelated, non-ILDR2 proteins is less than about 5%, or preferably less than about 2%, of the binding of the antibody to ILDR2, as measured, for example, by surface plasmon resonance (SPR). In certain embodiments, the antibody that binds to ILDR2 has a p-value of ≤ 1 μM, ≤ 100 nM, ≤ 10 nM, ≤ 1 nM, ≤ 0.1 nM, ≤ 0.01 nM, or ≤ 0.001 nM (e.g., 10 -8 M or less, e.g. 10 -8 M to 10 -13 M, for example 10 -9 M to 10 -13 In certain embodiments, the anti-ILDR2 antibody binds to an ILDR2 epitope that is conserved among ILDR2 from different species.

[0059] As used herein, the term "complementarity determining region" (CDR; e.g., CDR1, CDR2, and CDR3) refers to the amino acid residues of an antibody variable domain whose presence is essential for antigen binding. Each variable domain typically has three CDR regions identified as CDR1, CDR2, and CDR3. Each complementarity determining region can comprise amino acid residues from a "complementarity determining region" as defined by Kabat (e.g., approximately residues 24-34 (L1), 50-56 (L2), and 89-97 (L3) in the light chain variable domain, and 31-35 (H1), 50-65 (H2), and 95-102 (H3) in the heavy chain variable domain; (Kabat et al., Sequences of Proteins of Immulological Interest, 5th ed., Public Health Service, National Institutes of Health, Bethesda, MD. (1991)), and / or those residues from a "hypervariable loop" (e.g., approximately residues 26-32 (L1), 50-52 (L2), and 91-96 (L3) in the light chain variable domain, and 26-32 (H1), 53-55 (H2), and 96-101 (H3) in the heavy chain variable domain; (Chothia and Lesk; J Mol. Biol 196:901-917 (1987). In some cases, the complementarity determining region can include amino acids from both the CDR regions and the hypervariable loops according to the Kabat definition.

[0060] Depending on the amino acid sequence of the constant domain of their heavy chains, intact antibodies can be divided into different "classes". There are five major classes of intact antibodies: IgA, IgD, IgE, IgG and IgM, and several of them can be further divided into "subclasses" (isotypes), such as IgG1, IgG2, IgG3, IgG4, IgA1 and IgA2. A preferred class of immunoglobulins for use in the present invention is IgG.

[0061] The heavy chain constant domains corresponding to different classes of antibodies are called [α], [δ], [ε], [γ] and [μ], respectively. The subunit structures and three-dimensional configurations of different classes of immunoglobulins are well known. As used herein, antibodies are conventionally known antibodies and their functional fragments.

[0062] Variants of antibodies or antigen-binding antibody fragments contemplated in the present invention are molecules in which the binding activity of the antibody or antigen-binding antibody fragment is retained.

[0063] Here, a "human" antibody or antigen-binding fragment thereof is defined as one that is not chimeric (e.g., not "humanized") and is not (in whole or in part) from a non-human species. A human antibody or antigen-binding fragment thereof may be derived from a human or may be a synthetic human antibody. A "synthetic human antibody" is defined herein as an antibody having a sequence that is derived in whole or in part from a synthetic sequence based on an analysis of a known human antibody sequence on a computer chip (in silico). The design of a human antibody sequence or fragment thereof on a computer chip may be achieved, for example, by analyzing a database of human antibody or antibody fragment sequences and designing a polypeptide sequence using the data obtained therefrom. Another example of a human antibody or antigen-binding fragment thereof is one that is encoded by a nucleic acid isolated from an antibody sequence library of human origin (e.g., such a library is based on antibodies obtained from a natural source of a human). Examples of human antibodies include antibodies as described in Söderlind et al., Nature Biotech. 2000, 18: 853-856.

[0064] As used herein, the term "monoclonal antibody" refers to an antibody obtained from a substantially homogeneous antibody population, that is, except for possible mutations (e.g., naturally occurring mutations) that may be present in small amounts, the individual antibodies constituting the population are identical. Therefore, the term "monoclonal" indicates that the antibody is not a feature of a mixture of discrete antibodies. In contrast to polyclonal antibody preparations that typically include different antibodies for different determinants (epitopes), each monoclonal antibody of a monoclonal antibody preparation is directed to a single determinant on an antigen. In addition to its specificity, the advantage of a monoclonal antibody preparation is that they are not usually contaminated by other immunoglobulins. The term "monoclonal" should not be construed as requiring the production of antibodies by any ad hoc method. The term monoclonal antibody specifically includes chimeric, humanized, and human antibodies.

[0065] An "isolated" antibody is one that has been identified and separated from the cellular components in which it is expressed. Contaminating components of the cell are materials that would interfere with the diagnostic or therapeutic use of the antibody, and may include enzymes, hormones, and other proteinaceous or nonproteinaceous solutes.

[0066] An "isolated" nucleic acid is one that has been identified and separated from a component of its natural environment. An isolated nucleic acid includes a nucleic acid molecule contained in cells that ordinarily contain the nucleic acid molecule, but the nucleic acid molecule is present extrachromosomally or at a chromosomal location that is different from its natural chromosomal location.

[0067] As used herein, an antibody that "specifically binds to," "specifically targets," or "specifically recognizes" an antigen of interest (e.g., a tumor-associated polypeptide antigen target) is an antibody that binds to the antigen with sufficient affinity so that the antibody can be used as a therapeutic agent targeting cells or tissues expressing the antigen, and does not significantly cross-react with other proteins, or does not significantly cross-react with proteins other than orthologs and variants (e.g., mutant forms, splice variants, or proteolytic truncated forms) of the above-mentioned antigen targets. As used herein, the term "specifically recognizes" or "specifically binds to" or "specifically targets" a particular polypeptide or an epitope on a particular polypeptide target can be exhibited, for example, by an antibody or antigen-binding fragment thereof having a monovalent KD for the antigen of less than about 10 -4 M, alternatively less than about 10 -5 M, alternatively less than about 10 -6 M, alternatively less than about 10 -7 M, alternatively less than about 10 -8 M, alternatively less than about 10 -9 M, alternatively less than about 10 -10 M, alternatively less than about 10 -11 M, alternatively less than about 10 -12 M, or less. If the antibody can distinguish an antigen or one or more reference antigens, such an antibody "specifically binds to", "specifically targets" or "specifically recognizes" such an antigen. In its most general form, "specific binding", "specifically binds to", "specifically targets" or "specifically recognizes" refers to the ability of an antibody to distinguish a target antigen from an unrelated antigen, as determined, for example, according to one of the following methods. Such methods include, but are not limited to, surface plasmon resonance (SPR), Western blot, ELISA-, RIA-, ECL-, IRMA-tests and peptide scanning. For example, a standard ELISA assay can be performed. Standard color development (e.g., a secondary antibody with horseradish peroxidase and tetramethylbenzidine and hydrogen peroxide) can be scored. The reaction in some wells is scored by, for example, an optical density at 450 nm. A common background (=negative reaction) can be 0.1 OD; a common positive reaction can be 1 OD. This means that the negative / positive difference is more than 5 times, 10 times, 50 times, and preferably more than 100 times. Typically, determination of binding specificity is performed not by using a single reference antigen, but by using a collection of about three to five unrelated antigens (eg, milk powder, BSA, transferrin, etc.).

[0068] "Binding affinity" or "affinity" refers to the strength of the sum of non-covalent interactions between a single binding site of a molecule and its binding partner. Unless otherwise indicated, as used herein, "binding affinity" refers to the intrinsic binding affinity that reflects a 1:1 interaction between members of a binding pair (e.g., an antibody and an antigen). The dissociation constant "KD" is often used to describe the affinity between a molecule (e.g., an antibody) and its binding partner (e.g., an antigen), i.e., how tightly a ligand binds to a specific protein. Ligand-protein affinity is affected by non-covalent intermolecular interactions between the two molecules. Affinity can be measured by common methods known in the art, including those described herein.

[0069] As used herein, the term "epitope" includes any protein determinant that is capable of specific binding to an immunoglobulin or T cell receptor. Epitope determinants are usually composed of chemically active surface groups of molecules, such as amino acids or sugar side chains, or a combination thereof, and usually have specific three-dimensional structural characteristics as well as specific charge characteristics.

[0070] An "antibody that binds to the same epitope as a reference antibody" or an "antibody that competes for binding with a reference antibody" refers to an antibody that blocks binding of the reference antibody to its antigen by 50% or more in a competition assay, and conversely, the reference antibody blocks binding of the antibody to its antigen by 50% or more in a competition assay. Exemplary competition assays are provided herein.

[0071] The term "immunoconjugate" (interchangeably referred to as "antibody-drug conjugate" or "ADC") refers to an antibody conjugated to one or more cytotoxic or cytostatic agents such as chemotherapeutic agents, drugs, growth inhibitors, toxins (e.g., protein toxins, enzymatically active toxins of bacterial, fungal, plant or animal origin, or fragments thereof), or radioactive isotopes (i.e., radioconjugates). In the treatment of cancer, immunoconjugates have been used for local delivery of cytotoxic agents, i.e., drugs that kill or inhibit cell growth or proliferation (e.g., Liu et al., Proc Natl. Acad. Sci. (1996), 93, 8618-8623)). Immunoconjugates allow targeted delivery of the drug moiety to tumors, as well as intracellular accumulation therein, where systemic administration of the unconjugated drug can result in unacceptable levels of toxicity to normal cells and / or tissues. Toxins used in antibody-toxin conjugates include bacterial toxins such as diphtheria toxin, plant toxins such as ricin, and small molecule toxins such as geldanamycin. Toxins can exert their cytotoxic effects through mechanisms including tubulin binding, DNA binding, or topoisomerase inhibition.

[0072] "Percent (%) sequence identity" relative to a reference polynucleotide or polypeptide sequence, respectively, is defined as the percentage of nucleic acids or amino acid residues in a candidate sequence that are identical to the nucleic acids or amino acid residues in the reference polynucleotide or polypeptide sequence, respectively, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percentage of sequence identity. Conservative substitutions are not considered part of sequence identity. Preferably, gapless alignments are used. Alignment for the purpose of determining amino acid sequence identity percentages can be achieved in various ways within the technical scope of the art, for example, using publicly available computer software, such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software. Those skilled in the art can determine appropriate parameters for aligning sequences, including any algorithm required for achieving maximum alignment over the full length of the compared sequences. "Sequence homology" indicates the percentage of amino acids that are identical or represent conservative amino acid substitutions.

[0073] "Neoplastic diseases" are conditions that lead to the growth of tumors - both benign and malignant. A neoplasm is an abnormal growth of cells, also called a tumor. DETAILED DESCRIPTION OF THE INVENTION

[0075] Before describing the present invention in detail, it should be understood that the present invention is not limited to the specific components of the device or the process steps of the method, because such devices and methods can be changed. It should also be understood that the terms used herein are only for the purpose of describing specific embodiments, and are not intended to be restrictive. It must be noted that, as used in the specification and the appended claims, the singular forms "one", "a kind of" and "the / said" include singular and / or plural indicators, unless the context clearly indicates otherwise. It should also be understood that, in the case of providing a parameter range limited by a numerical value, the range is considered to include these limiting values.

[0076] It is further understood that the embodiments disclosed herein are not meant to be understood as separate embodiments that are not related to each other. Features discussed with one embodiment are intended to be disclosed in conjunction with other embodiments shown herein as well. If in one case, a particular feature is not disclosed by one embodiment, but is disclosed by another embodiment, the skilled person will understand that this does not necessarily mean that the feature is not intended to be disclosed by the other embodiment. It will be understood by those skilled in the art that it is the gist of this application to disclose the features for other embodiments as well, but this has not yet been done for the sake of clarity and to keep the specification within a manageable range.

[0077] In addition, the contents of the prior art documents mentioned herein are incorporated herein by reference. This refers in particular to prior art documents that disclose standards or conventional methods. In that case, incorporation by reference mainly has the purpose of providing sufficient enabling disclosure content and avoiding lengthy repetition.

[0078] According to one aspect of the present invention, there is provided a pharmaceutical combination comprising an ILDR2 antagonist, plus optionally one or more other therapeutically active compounds.

[0079] Preferably, the ILDR2 antagonist of the present invention is an anti-ILDR2 antibody. More preferably, the anti-ILDR2 antibody is an antibody as further described herein below.

[0080] According to one embodiment of the present invention, the other therapeutically active compound is at least one selected from the group consisting of:

[0081] • PD-L1 antagonists

[0082] • Taxane or taxane derivative

[0083] • vaccine

[0084] • CpG oligodeoxynucleotides, and / or

[0085] • Compounds targeting c4.4A.

[0086] Preferably, the PD-L1 antagonist is an anti-PD-L1 antibody. More preferably, the anti-PD-L1 antibody comprises the variable domain of atezolizumab. Even more preferably, the anti-PD-L1 antibody is atezolizumab.

[0087] As used herein, the term "taxane derivative" refers to a cytotoxic or cytostatic compound comprising a taxadiene core. More preferably, the taxane derivative is paclitaxel, docetaxel or cabazitaxel.

[0088] The term "CpG oligodeoxynucleotide" refers to a single-stranded synthetic DNA molecule containing a cytosine triphosphate deoxynucleotide ("C") followed by a guanine triphosphate deoxynucleotide ("G"). "p" refers to a phosphodiester bond between consecutive nucleotides, although some ODNs have a modified thiophosphate (PS) backbone instead. When the CpG motif is unmethylated, they act as an immunostimulant. In one embodiment, the CpG oligodeoxynucleotide is ODN1826, such as sold by Invivogen, having a nucleotide sequence of SEQ ID No 17 (tccatgacgttcctgacgtt).

[0089] C4.4A (LYPD3, UniProtKB - O95274 (LYPD3_HUMAN)) is an internalized cell surface protein that has been identified as a surface marker associated with cancer and metastasis. Therefore, C4.4A (LYPD3) can be used as a marker for targeting anticancer drugs to tumors. By conventional methods, such as by phage display or immunization, or by library screening using a suitable screening method, a technician can generate compounds targeting C4.4A. Therefore, such compounds targeting C4.4A can be antibodies, antibody fragments or derivatives that retain target binding ability, or antibody mimetics. Further, such compounds targeting c4.4A can be small molecules.

[0090] In one embodiment, the compound targeting C4.4A is an antibody drug conjugate comprising an antibody targeting C4.4A, or a fragment or derivative thereof, or an antibody mimetic conjugated to a cytotoxic agent or cytostatic agent. Preferably, the compound targeting C4.4A is BAY1129980, which consists of an anti-C4.4A (LYPD3) antibody conjugated to auristatin.

[0091] The present invention also provides an antibody-drug conjugate (ADC, immunoconjugate) comprising an anti-ILDR2 antibody conjugated to one or more cytotoxic agents such as chemotherapeutic agents or drugs, growth inhibitory agents, toxins (e.g., protein toxins, enzymatically active toxins of bacterial, fungal, plant, human or animal origin, or fragments thereof), or radioactive isotopes. Preferably, the anti-ILDR2 antibody is an antibody as described herein below, most preferably, the anti-ILDR2 antibody is BAY1905254.

[0092] In one embodiment, the immunoconjugate is an antibody-drug conjugate (ADC) in which the antibody is conjugated to one or more drugs, including but not limited to maytansines (see U.S. Pat. Nos. 5,208,020, 5,416,064 and European Patent EP0425235); auristatins, such as monomethyl auristatin drug moieties DE and DF (MMAE and MMAF) (see U.S. Pat. Nos. 5,635,483 and 5,780,588, and 7,498,298); dolastatin; calicheamicin or a derivative thereof; anthracyclines, such as daunorubicin or doxorubicin; methotrexate; vindesine; taxanes, such as docetaxel, paclitaxel, larotaxel, tesetaxel and ortataxel; trichothecenes; and CC1065.

[0093] In another embodiment, the immunoconjugate comprises an antibody as described herein conjugated to an enzymatically active toxin or fragment thereof, including but not limited to diphtheria A chain, non-binding active fragments of diphtheria toxin, exotoxin A chain (from Pseudomonas aeruginosa ( Pseudomonas aeruginosa )), ricin A chain, abrin A chain, sarcocarpin A chain, α-sarcin, tung oil tree ( Aleurites fordii ) protein, dianthin protein, pokeweed ( Phytolaca americana ) proteins (P API, P APII and PAP-S), momordica charantia inhibitor, curcin, crotin, sapaonaria officinalis inhibitor, gelonin, mitogellin, restrictocin, phenomycin, enomycin and tricothecene.

[0094] In another embodiment, the immunoconjugate comprises an antibody as described herein that is conjugated to a radioactive atom to form a radioconjugate. Various radioisotopes can be used to produce radioconjugates. Examples include 227Th, 225Ac, 211At, 131I, 125I, 90Y, 186Re, 188Re, 153Sm, 212Bi, 32P, 212Pb and Lu radioisotopes. When the radioconjugate is used for detection, it can include radioactive atoms for scintigraphic studies, such as Tc99m, or spin labels for nuclear magnetic resonance (NMR) imaging, such as iodine-123, iodine-131, indium-111, fluorine-19, carbon-13, nitrogen-15, oxygen-17, gadolinium, manganese or iron again.

[0095] Conjugates of the antibody and cytotoxic agent can be prepared using a variety of bifunctional protein coupling agents, such as N-succinimidyl-3-(2-pyridyldithio) propionate (SPDP), succinimidyl-4-(N-maleimidomethyl) cyclohexane-1-carboxylate (SMCC), iminothiolane (IT), bifunctional derivatives of imidoesters (e.g., dimethyl adipate HCl), active esters (e.g., disuccinimidyl suberate), aldehydes (e.g., glutaraldehyde), bis-azido compounds (e.g., bis(p-azidobenzoyl)hexanediamine), bis-diazonium derivatives (e.g., bis-(p-diazoniumbenzoyl)-ethylenediamine), diisocyanates (e.g., toluene 2,6-diisocyanate), and bis-active fluorine compounds (e.g., 1,5-difluoro-2,4-dinitrobenzene).

[0096] The linker can be a "cleavable linker" that facilitates release of the cytotoxic drug in the cell, for example, an acid-labile linker, a peptidase-sensitive linker, a photolabile linker, a dimethyl linker, or a disulfide-containing linker (Chari et al., Cancer Res. 52: 127-131 (1992)).

[0097] The immunoconjugates or ADCs herein specifically contemplate, but are not limited to, such conjugates prepared with cross-linking reagents including, but not limited to, BMPS, EMCS, GMBS, HBVS, LC-SMCC, MBS, MPBH, SBAP, SIA, SIAB, SMCC, SMPB, SMPH, sulfo-EMCS, sulfo-GMBS, sulfo-KMUS, sulfo-MBS, sulfo-SIAB, sulfo-SMCC, and sulfo-SMPB, and SVSB (succinimidyl-(4-vinyl sulfone) benzoate), which is commercially available (e.g., from Pierce Biotechnology, Inc., Rockford, IL., USA).

[0098] According to one embodiment of the present invention, ILDR2 antagonists and other therapeutically active compounds:

[0099] • provided in the same dosage unit, or

[0100] • Supplied in individual dosage units.

[0101] According to another embodiment of the present invention, the ILDR2 antagonist and other therapeutically active compound:

[0102] • Administered simultaneously, or

[0103] • Administer sequentially, i.e. one after the other.

[0104] According to one embodiment of the invention, the ILDR2 antagonist is an antibody, a fragment or derivative thereof, a modified antibody form or an antibody mimetic, all of which have ILDR2 binding properties.

[0105] According to a further aspect of the present invention, there is provided an anti-ILDR2 antibody, or a fragment or derivative thereof, or a modified antibody form, all of which have ILDR2 binding properties, comprising at least three CDR heavy chain sequences:

[0106] SEQ ID No 1 CDR1 HC

[0107] SEQ ID No 2 CDR2 HC

[0108] SEQ ID No 3 CDR3 HC.

[0109] According to a further aspect of the present invention, there is provided an anti-ILDR2 antibody, or a fragment or derivative thereof, or a modified antibody form, all of which have ILDR2 binding properties, comprising at least three CDR light chain sequences:

[0110] SEQ ID No 4 CDR1 LC

[0111] SEQ ID No 5 CDR2 LC

[0112] SEQ ID No 6 CDR3 LC.

[0113] Wherein, "HC" represents heavy chain, and "LC" represents light chain. The above sequence is the CDR of BAY1905254 (also referred to herein as 59-08.B02).

[0114] According to one embodiment, the anti-ILDR2 antibody, fragment or derivative or modified antibody form comprises at least one heavy or light chain variable region sequence which is 95% identical, preferably 96 or even 97% identical, more preferably 98% or even 99% identical, and most preferably 100% identical to a sequence selected from:

[0115] SEQ ID No 7 HC VD

[0116] SEQ ID No 8 LC VD

[0117] Wherein, "VD" represents the variable domain. The above sequence is the variable domain of BAY1905254 (synonymically referred to herein as 59-08.B02 or B02).

[0118] According to a further embodiment, the anti-ILDR2 antibody, fragment or derivative or modified antibody form comprises at least one heavy or light chain sequence which is 95% identical, preferably 96% or even 97% identical, more preferably 98% or even 99% identical, and most preferably 100% identical to a sequence selected from:

[0119] SEQ ID No 42 HC

[0120] SEQ ID No 43 LC

[0121] Wherein, "HC" represents heavy chain, and "LC" represents light chain. The above sequences are the heavy chain and light chain sequences of BAY1905254 (also referred to herein as 59-08.B02).

[0122] According to a further aspect of the present invention, there is provided an anti-ILDR2 antibody, or a fragment or derivative thereof, or a modified antibody form, all of which have ILDR2 binding properties, comprising at least one combination of three CDR heavy chain sequences selected from the group consisting of:

[0123] SEQ ID No. 18 – 20, 61-02.C05

[0124] SEQ ID No. 24 – 26, 56-02.E08

[0125] SEQ ID No 30-32, and / or 74.15.G09

[0126] SEQ ID No. 36 – 38 56.02.E10.

[0127] According to a further aspect of the present invention, there is provided an anti-ILDR2 antibody, or a fragment or derivative thereof, or a modified antibody form, all of which have ILDR2 binding properties, comprising at least one combination of three CDR light chain sequences selected from the group consisting of:

[0128] SEQ ID No. 21 – 23, 61-02.C05

[0129] SEQ ID No. 27 – 29, 56-02.E08

[0130] SEQ ID No 33-35 and / or 74.15.G09

[0131] SEQ ID No. 39 – 41 56.02.E10.

[0132] The above sequences are the CDRs of antibodies 61-02.C05, 56-02.E08, 74.15.G09 and 56.02.E10.

[0133] According to a further aspect of the present invention, there is provided an anti-ILDR2 antibody, or a fragment or derivative thereof, or a modified antibody form, all of which have ILDR2 binding properties, comprising at least one heavy or light chain variable region sequence which is 95% identical, preferably 96 or even 97% identical, more preferably 98% or even 99% identical, and most preferably 100% identical to a sequence selected from:

[0134] SEQ ID No 9, 61-02.C05 HC VD

[0135] SEQ ID No. 10, 61-02.C05 LC VD

[0136] SEQ ID No 11, 56-02.E08 HC VD

[0137] SEQ ID No. 12, 56-02.E08 LC VD

[0138] SEQ ID No 13, 74.15.G09 HC VD

[0139] SEQ ID No 14, 74.15.G09 LC VD

[0140] SEQ ID No 15, and / or 56.02.E10 HC VD

[0141] SEQ ID No 16 56.02.E10 LC VD.

[0142] The above sequences are the variable domains of antibodies 61-02.C05, 56-02.E08, 74.15.G09 and 56.02.E10.

[0143] According to a further embodiment of the present invention, there is provided an anti-ILDR2 antibody, or a fragment or derivative thereof, or a modified antibody form, all of which have ILDR2 binding properties, comprising at least one heavy or light chain sequence which is 95% identical, preferably 96 or even 97% identical, more preferably 98% or even 99% identical, and most preferably 100% identical to a sequence selected from the group consisting of:

[0144] SEQ ID No 44,

[0145] SEQ ID No 45,

[0146] SEQ ID No 46,

[0147] SEQ ID No 47,

[0148] SEQ ID No 48,

[0149] SEQ ID No 49,

[0150] SEQ ID No 50, and / or

[0151] SEQ ID No 51.

[0152] The table below shows an overview of these sequences and the antibodies to which they belong.

[0153] SEQ ID No Antibody + Type 7 B02 (=59-08.B02) heavy chain variable domain 8 B02 (=59-08.B02) light chain variable domain 9 C05 (=61-02.C05) heavy chain variable domain 10 C05 (=61-02.C05) light chain variable domain 11 E08 (=56-02.E08) heavy chain variable domain 12 E08 (=56-02.E08) light chain variable domain 13 G09 (=74.15.G09) heavy chain variable domain 14 G09 (=74.15.G09) light chain variable domain 15 E10 (=56.02.E10) heavy chain variable domain 16 E10 (=56.02.E10) light chain variable domain 42 B02(=59-08.B02) heavy chain 43 B02(=59-08.B02) light chain 44 C05(=61-02.C05) heavy chain 45 C05(=61-02.C05) light chain 46 E08(=56-02.E08) heavy chain 47 E08(=56-02.E08) light chain 48 G09(=74.15.G09) heavy chain 49 G09(=74.15.G09) light chain 50 E10(=56.02.E10) heavy chain 51 E10(=56.02.E10) light chain

[0154] According to one embodiment of the present invention, the ILDR2 antibody or fragment or derivative or modified antibody form is selected from 61-02.C05, 56-02.E08, 74-15.G09 and 59-08.B02.

[0155] According to one embodiment of the present invention, the ILDR2 antagonist or antibody, or fragment or derivative or modified antibody form, measured by fluorescence activated cell scanning (FACS), is expressed at 25 nM (2,5 x 10 -8 M) or smaller K d Dissociates from human ILDR2.

[0156] Preferably, the K d More preferably, the K d More preferably, the K d More preferably, the K d More preferably, the K d More preferably, the K d is 3 nM or less. Most preferably, the K d 2 nM or less.

[0157] According to a further aspect of the present invention, there is provided an ILDR2 antagonist or antibody, or a fragment or derivative or modified antibody form which competes with an ILDR2 antibody according to the above description for binding to ILDR2.

[0158] According to another aspect of the present invention, there is provided an isolated nucleic acid sequence or a collection thereof, which encodes an ILDR2 antibody, or a fragment or derivative or modified antibody form according to the above description.

[0159] According to another aspect of the present invention, there is provided a vector comprising at least one nucleic acid sequence according to the above description.

[0160] According to another aspect of the present invention, there is provided an isolated cell expressing an ILDR2 antibody, or a fragment or derivative or modified antibody form according to the above description, and / or comprising a nucleic acid sequence or a collection thereof according to the above description, or a vector according to the above description.

[0161] According to one embodiment of the present invention, the pharmaceutical combination product comprises an ILDR2 antagonist or antibody, or a fragment or derivative or modified antibody form according to the above description.

[0162] Treatment

[0163] The method of treatment involves administering to a subject in need of treatment a therapeutically effective amount of an antibody or antigen-binding fragment thereof contemplated by the present invention or variant thereof. A "therapeutically effective" amount is defined herein as an amount of an antibody or antigen-binding fragment, as a single dose or according to a multiple dose regimen, alone or in combination with other agents, that is in sufficient quantity to result in a reduction in the adverse condition, however, the amount is still toxicologically tolerable. The subject may be a human or non-human animal (e.g., rabbit, rat, mouse, dog, monkey or other lower primate).

[0164] According to another aspect of the present invention, there is provided an ILDR2 antagonist or antibody, or fragment or derivative or modified antibody form, or a combination product comprising an ILDR2 antagonist according to the above description for use as a medicament.

[0165] One embodiment of the present invention is to provide an antibody or an antigen-binding fragment thereof for use as a pharmaceutical agent for cancer treatment.

[0166] According to one embodiment, an ILDR2 antagonist or antibody, or fragment or derivative or modified antibody form, or a combination product comprising an ILDR2 antagonist, is for use in the treatment of a patient who:

[0167] • Have a neoplastic disease such as cancer, or an immune disease or disorder

[0168] • are at risk of developing a neoplastic disease such as cancer, or an immune disease or disorder, and / or

[0169] • diagnosed with a neoplastic disease, such as cancer, or an immune disease or disorder, wherein the ILDR2 antagonist is administered in one or more therapeutically effective doses.

[0170] According to another embodiment, a method for treating a patient is provided.

[0171] • Have a neoplastic disease such as cancer, or an immune disease or disorder

[0172] • are at risk of developing a neoplastic disease such as cancer, or an immune disease or disorder, and / or

[0173] • diagnosed with a neoplastic disease such as cancer, or an immune disease or disorder,

[0174] The method comprises administering to the patient an ILDR2 antagonist or antibody, or a fragment or derivative or modified antibody form according to the above description, or a combination product comprising an ILDR2 antagonist, in one or more therapeutically effective doses.

[0175] A further embodiment of the invention is the use of an antibody or antigen-binding fragment thereof in the manufacture of a medicament for the treatment of cancer.

[0176] The antibodies or antigen-binding fragments thereof of the invention can be used as therapeutic or diagnostic tools in various conditions with abnormal ILDR2 signaling (e.g., cell proliferative disorders, such as cancer). Disorders and conditions suitable for treatment with the antibodies of the invention can be, but are not limited to, solid tumors, such as breast cancer, respiratory tract cancer, brain cancer, reproductive organ cancer, digestive tract cancer, urinary tract cancer, eye cancer, liver cancer, skin cancer, head and neck cancer, thyroid cancer, parathyroid cancer, and distant metastases thereof. These conditions also include lymphomas, sarcomas, and leukemias.

[0177] Digestive tract tumors include, but are not limited to, anal cancer, colon cancer, colorectal cancer, esophageal cancer, gallbladder cancer, stomach cancer, pancreatic cancer, rectal cancer, small intestine cancer, and salivary gland cancer.

[0178] Examples of esophageal cancer include, but are not limited to, esophageal cell carcinoma and adenocarcinoma, as well as squamous cell carcinoma, leiomyosarcoma, malignant melanoma, rhabdomyosarcoma, and lymphoma.

[0179] Examples of gastric cancer include, but are not limited to, intestinal-type and diffuse-type gastric adenocarcinoma.

[0180] Examples of pancreatic cancer include, but are not limited to, ductal adenocarcinoma, adenosquamous carcinoma, and pancreatic endocrine tumors.

[0181] Examples of breast cancer include, but are not limited to, triple negative breast cancer, invasive ductal carcinoma, invasive lobular carcinoma, ductal carcinoma in situ, and lobular carcinoma in situ.

[0182] Examples of respiratory tract cancers include, but are not limited to, small cell lung cancer and non-small cell lung cancer, as well as bronchial adenoma and pleuropulmonary blastoma.

[0183] Examples of brain cancer include, but are not limited to, brainstem and hypothalamic gliomas, cerebellar and cerebral astrocytomas, glioblastomas, medulloblastomas, ependymomas, and neuroectodermal and pineal tumors.

[0184] Tumors of male reproductive organs include, but are not limited to, prostate cancer and testicular cancer. Tumors of female reproductive organs include, but are not limited to, endometrial cancer, cervical cancer, ovarian cancer, vaginal cancer, and vulvar cancer, as well as uterine sarcoma.

[0185] Examples of ovarian cancer include, but are not limited to, serous tumors, endometrioid tumors, mucinous cystadenocarcinomas, granulosa cell tumors, Sellet cell tumors, and androcyte tumors of the ovary.

[0186] Examples of cervical cancer include, but are not limited to, squamous cell carcinoma, adenocarcinoma, adenosquamous carcinoma, small cell carcinoma, neuroendocrine tumors, glassy cell carcinoma, and chorioglandular carcinoma.

[0187] Tumors of the urinary tract include, but are not limited to, bladder cancer, penile cancer, kidney cancer, renal pelvis cancer, ureter cancer, urethral cancer, and hereditary and sporadic papillary renal cancer.

[0188] Examples of renal cancer include, but are not limited to, renal cell carcinoma, urothelial cell carcinoma, juxtaglomerular cell tumor (reninoma), angiomyolipoma, renal oncocytoma, Bellini duct carcinoma, clear cell sarcoma of the kidney, mesoblastic nephroma, and Wilms tumor.

[0189] Examples of bladder cancer include, but are not limited to, transitional cell carcinoma, squamous cell carcinoma, adenocarcinoma, sarcoma, and small cell carcinoma.

[0190] Eye cancers include, but are not limited to, intraocular melanoma and retinoblastoma.

[0191] Examples of liver cancer include, but are not limited to, hepatocellular carcinoma (hepatocellular carcinoma with or without fibrolamellar variant), cholangiocarcinoma (intrahepatic bile duct carcinoma), and mixed hepatocellular cholangiocarcinoma.

[0192] Skin cancers include, but are not limited to, squamous cell carcinoma, Kaposi's sarcoma, malignant melanoma, Merkel cell skin cancer, and non-melanoma skin cancer.

[0193] Head and neck cancers include, but are not limited to, squamous cell carcinoma of the head and neck, laryngeal cancer, hypopharyngeal cancer, nasopharyngeal cancer, oropharyngeal cancer, salivary gland cancer, lip cancer and oral cavity cancer, and squamous cell carcinoma.

[0194] Lymphomas include, but are not limited to, AIDS-related lymphoma, non-Hodgkin's lymphoma, cutaneous T-cell lymphoma, Burkitt's lymphoma, Hodgkin's disease, and lymphomas of the central nervous system.

[0195] Sarcomas include, but are not limited to, soft tissue sarcomas, osteosarcomas, malignant fibrous histiocytomas, lymphosarcoma, and rhabdomyosarcomas.

[0196] Leukemias include, but are not limited to, acute myeloid leukemia, acute lymphoblastic leukemia, chronic lymphocytic leukemia, chronic myeloid leukemia, and hairy cell leukemia.

[0197] In addition, the antibodies or antigen-binding fragments thereof of the present invention may also be used as therapeutic or diagnostic tools in various other disorders in which ILDR2 is involved. Example

[0198] Although the invention has been illustrated and described in detail in the drawings and the foregoing description, such illustration and description should be regarded as illustrative or exemplary rather than restrictive; the invention is not limited to the disclosed embodiments. Other variations of the disclosed embodiments can be understood and implemented by a person skilled in the art in the practice of the claimed invention by studying the drawings, the disclosure and the appended claims. In the claims, the word "comprising" does not exclude other elements or steps, and the indefinite article "a" or "an" does not exclude a majority. The fact that certain measures are only recited in mutually different dependent claims does not indicate that a combination of these measures cannot be used to advantage. Any reference signs in the claims should not be construed as limiting the scope.

[0199] All amino acid sequences disclosed herein are shown from N-terminus to C-terminus; all nucleic acid sequences disclosed herein are shown from 5'→3'.

[0200] 1. Tumor Mouse Model

[0201] The following syngeneic tumor models were used subcutaneously in the in vivo experiments: B16-F10 cells represent a mouse melanoma cell line derived from the skin of C57BL / 6J mice. CT26 is an undifferentiated colon cancer cell line induced by N-nitroso-N-methylurethane (NNMU). It is a fibroblast type and is derived from BALB / c mice. 3C9-D11-H11 cells are hybridoma B lymphocytes generated by fusing spleen cells with Sp2 / 0-Ag14 myeloma cells. Splenocytes are derived from BALB / c mice immunized with purified porcine parvovirus (PPV).

[0202] 2. Antibody Generation

[0203] Antibodies against ILDR2 were generated by phage display. Briefly, panning reactions were performed in solution using streptavidin-coated magnetic beads to capture biotinylated antigens. Beads were recovered using a magnetic stand (Promega). All phage panning experiments used a XOMA031 human fab antibody phage display library (XOM A Corporation, Berkeley, CA) blocked with 5% skim milk.

[0204] The desired proteins for phage display were biotinylated using the Sulfo-NHS-LC-Biotin Kit (Pierce). Free biotin was removed from the reaction by dialysis against an appropriate buffer. Biotinylated proteins included the same mouse IgG 2a Sequence fused ILDR2-HM and control antigen ECD. The control antigen was used for the depletion step in the panning experiment. During the panning process, it was necessary to remove streptavidin beads and mouse IgG 2aUnnecessary binding agent of Fc domain.To achieve this, streptavidin beads are coupled to control antigen.Then phage aliquots are mixed with these 'exhausted' beads and incubated for 30 minutes at room temperature (RT).Then the exhausted beads are discarded.In order to select the specific binding agent for ILDR2-HM, the closed and exhausted phage library is mixed with magnetic beads, which are coupled with biotinylated ILDR2-HM.The reaction is incubated for 1-2 hours at RT, and non-specific phage is removed by washing with PBS-T and PBS.After washing, the bound phage is eluted by incubation with 100 mM triethylamine (EMD), and the eluate is neutralized by adding Tris-HCl pH 8.0 (Teknova).The resulting E. coli lawn is scraped off and resuspended in liquid growth medium. A small aliquot of the resuspended cells was inoculated into a 100 mL culture (2YT with 5% dHO and ampicillin) and grown at 37°C until the OD at 600 nM reached 0.5. This culture was infected with M13K07 helper phage (New England Biolabs) and kanamycin (selective antibiotic for M13K07) was added. The culture was then maintained at 25°C to allow phage packaging. Aliquots of the culture supernatant were continued for subsequent rounds of panning or fab binding screening. In addition to using the phage supernatant from the previous round of rescue to replace the phage library, the second and subsequent rounds were performed in the same manner. The phage eluate was infected into TG1 Escherichia coli ( E. coli), which makes the cells transformed by XOMA031 phagemid.Then the transformed cells are spread on selective agar plates (ampicillin) and incubated overnight at 37°C.The XOMA031 library is based on phagemid constructs, which also function as IPTG-inducible fab expression vectors.The eluted phage pool from the 3rd round of panning is diluted and infected into TG1 Escherichia coli cells (Lucigen) so that a single colony is generated when spread on agar plates.Each clone is grown in 1 mL culture (2YT with glucose and ampicillin) and protein expression is induced by adding IPTG (Teknova).The expression culture is incubated overnight at 25°C.Then, the Fab protein secreted into the periplasm of E. coli is extracted for analysis.Each sample plate also includes duplicate "blank PPE" wells to serve as negative controls.These are produced by non-inoculated cultures, and their treatment is the same as fab PPE. FACS analysis is used to identify fabs with affinity for ILDR2. The combination of each fab PPE and HEK-293T cells (293T-huILDR2 cells) overexpressing human ILDR2 was tested. All analyses included negative control HEK-293T cells (293T-EV cells) simulated with 'empty vector' control plasmid transfection. Reagent preparation and washing steps were carried out in FACS buffer (PBS with 1% BSA). Fab and blank PPE were mixed with aliquots of cells, incubated at 4 ° C for 1 hour, and then washed with FACS buffer. Then, cells were mixed with anti-C-myc primary antibody (Roche). After the same incubation and washing steps, cells were stained with anti-mouse IgG Fc AlexaFlour-647 antibody (Jackson Immunoresearch). After the final incubation and washing, cells were fixed in 4% paraformaldehyde prepared in FACS buffer. Samples were read on the HTFC screening system (Intellicyt). Data were analyzed using FCS Express (De Novo Software, CA, USA) or FloJo (De Novo Software, CA, USA). Based on these results, five binders were selected for further analysis and then reformatted into full-length IgG.

[0205] Table 1: Antibodies used in this study

[0206] Aliases Full name B02 59-08.B02 C05 61-02.C05 E08 56-02.E08 G09 74.15.G09 E10 56.02.E10

[0207] As a comparison, anti-PD-L1 antibody was used in some experiments. Anti-PD-L1 antibody (also referred to herein as aPDL1) is a chimera of the variable domain of atezolizumab and a human IgG2 domain.

[0208] 3. Antibody Production

[0209] These IgGs were expressed and purified using standard procedures. In brief, IgG was produced by mammalian cell culture using HEK293-6E cells of transient transfection. Heavy and light chains were cloned into pTT5 Dual vector system. In a shake flask utilizing F17 culture medium (Life Technologies; supplemented with 0.1% Pluronic F68 (Life Technologies) and 4 mM Glutamax (Life Technologies)), the cell culture scale was 4 x 1.5 l. 24 hours after transfection, 1% FCS "ultra-low" IgG (Life Technologies) and 0.5 mM valproic acid (Sigma Aldrich) were added. 6.0 l cell supernatants were sterilized by filtration and stored at 4 ° C before purification. IgG was purified using standard purification protocols. The capture step was affinity chromatography on MabSelect SuRe, followed by preparative SEC on Superdex 200. Using AEKTA Explorer100 System (GE-Healthcare), the filtered (0.2 µm) supernatant from HEK-293 cells was directly loaded onto a MabSelect SuRe column (200 ml). After elution from the first column, the peak fractions were combined and neutralized using 3.0 M Tris pH 9. After sterile filtration, the filtrate was stored at 4 ° C until SEC. A single injection was performed on a Superdex 200 preparative grade XK 50 / 100 (column volume ~ 1.8 L) using the same chromatography system.

[0210] The peaks were combined. The final IgG-containing fractions were concentrated to approximately 10 mg / ml using an Amicon ultra-15 concentrator (Millipore, 30 kDa MWCO). The amount and concentration of protein were determined by a Nanodrop UV spectrophotometer. The samples were sterile filtered, aliquoted, frozen in liquid nitrogen and stored at -80°C.

[0211] 4. Characterization of Antigen Binding of Selected Antibodies

[0212] Binding to HEK cells stably transfected with human ILDR2 was quantified by flow cytometry, and K was determined using an algorithm designed to extrapolate affinity based on binding curves. DValues. Briefly, hIgG1 was added to a constant number of cells (100,000 cells / well) in 16 wells of a 96-well plate at a binding site concentration range of 3 pM – 209 nM. One well contained cells without any IgG added as a blank well. The cells were equilibrated at 4°C for 4 hours. After one FACS buffer wash of the cells, an excess of Cy5-labeled goat anti-human polyclonal antibody (Jackson ImmunoResearch 109-606-097) was added to each well at 90 nM. After incubation with the labeled pAb for 30 minutes (at 4°C), the cells were washed twice, and then the mean fluorescence intensity (MFI) over approximately 10,000 "events" was recorded using an Intellicyte flow cytometer. The K of IgG binding to ILDR2-expressing HEK 293 cells was estimated by fitting the MFI versus IgG binding site concentration curve using a 1:1 equilibrium model as detailed in Drake and Klakamp (2007). D Experiments performed with HEK cells expressing murine ILDR2 resulted in similar binding. Control experiments using untransfected cells demonstrated that binding was strictly ILDR2-dependent. The results are shown in Table 2 below.

[0213] Table 2: Dissociation constants of antibodies according to the invention

[0214] Binder Kd(nM) B02 2.0 C05 10.7 E08 2.7 G09 12.4

[0215] 5. Anti-tumor efficacy, such as tumor shrinkage activity of selected binders in syngeneic in vivo mouse models

[0216] To determine anti-tumor efficacy, such as, for example, tumor shrinkage effects of each binding agent, two syngeneic mouse models (B16F10, CT26) were used, as discussed above. It was demonstrated that anti-ILDR2 antibody E10 showed no tumor shrinkage at all when measured against an isotype control, whereas anti-PD-L1 antibody and anti-ILDR2 antibody B02 did show tumor shrinkage (see Fig. 9A ).

[0217] 6. Modulation of ILDR2 activity in the MLR by selected binding agents

[0218] In order to determine the effect of these antibodies on ILDR2 function, an immunomodulatory assay, i.e., a mixed lymphocyte reaction assay, was performed. A mixed lymphocyte reaction (MLR) is a test in which lymphocyte populations are mixed together and the resulting reaction is measured. Technically, it is an ex vivo cellular immunoassay that occurs between two allogeneic lymphocyte populations. In a one-way MLR, only one lymphocyte population can respond or proliferate. In a two-way MLR, both populations can proliferate. MLR is performed to evaluate how T cells respond to external stimuli, for example, exposure to immune checkpoint inhibitors, such as anti-PD-1 antibodies (Wang et al. 2014) and anti-PD-L1 antibodies. In this context, antibody-induced IL-2 secretion was measured with this assay.

[0219] In this case, CD4 T cells from one donor were co-cultured with M-CSF mature monocytes from another donor for 5 days in the presence of various ILDR2 antibodies, function blocking PD-L1 antibodies, or isotype controls. The supernatant was harvested and the concentration of ILDR2 (a classical T cell activation marker) was determined by Elisa. As expected, anti-PD-L1 antibodies induced a significant increase in IL-2 secretion over isotype controls. An ILDR2 antibody, E10, had a similar effect. The results are shown in Fig. 9B and Table 3 below.

[0220] Table 3: IL2 induction by selected antibodies

[0221] Binder IL2 concentration (% over isotype control) aPDL1 247 + / -21 B02 91 + / -11 C05 82 + / -9 E08 74 + / -12 G09 86 + / -8 E10 223 + / -30

[0222] This prompted the inventors to test those further anti-ILDR2 antibodies in further in vivo models, which, like B02, do not mediate IL-2 induction in the MLR. It was demonstrated that in the CT26 model, antibodies G09, E08, B02 and C05 showed similar anti-tumor efficacy when measured against isotype controls (see Fig. 9C ). Therefore, it is very surprising that the anti-ILDR2 antibodies G09, E08, B02, and C05 have cytokine-inducing activities in immunomodulatory assays that are lower than those of anti-PD-L1 antibodies, but show anti-tumor activities similar to those of anti-PD-L1 antibodies in in vivo tumor models.

[0223] In the IL-2 secretion assay, only one anti-ILDR2 antibody (i.e., E10) showed similar behavior to the comparative anti-PD-L1 antibody - however, was inactive in the in vivo assay. The remaining anti-ILDR2 antibodies tested did not trigger IL-2 secretion, but, despite this, proved active in the in vivo assay. Therefore, the inventors conclude that the IL-2 secretion assay does not predict the in vivo activity of anti-ILDR2 antibodies. Instead, it appears that the epitope space delineated by the anti-ILDR2 antibodies demonstrated in vivo activity, delineating an epitope space suitable for the generation of ILDR2 antibodies with in vivo anti-tumor activity and therefore therapeutic potential.

[0224] In assays where cytokine induction activity is measured as IL-2, TNFα, IL-6 and / or IFNγ secretion relative to an isotype control,

[0225] • Preferred ILDR2 antagonists should have ≤ 40% IL-2 induction compared to anti-PD-L1 antibodies

[0226] • Preferred ILDR2 antagonists have ≤ 28% TNFα induction compared to anti-PD-L1 antibodies

[0227] • Preferred ILDR2 antagonists should induce ≤ 50% IL-6 compared to anti-PD-L1 antibodies

[0228] • Preferred ILDR2 antagonists have ≤ 68% IFNγ induction compared to anti-PD-L1 antibodies.

[0229] 7. In vivo experiments using B02 (BAY1905254)

[0230] Anti-PD-L1 (also referred to herein as aPDL1) antibodies are chimeras of the variable domains of atezolizumab and human IgG2 domains. BAY1905254 (also referred to herein as aILDR2) consists of a variable domain and a constant domain framework that binds to the extracellular domain of ILDR2. In in vivo experiments, both aPD-L1 and aILDR2 are defined by human IgG2 isotype controls. E10 consists of a variable domain and a constant domain framework that binds to the extracellular domain of ILDR2, and in in vivo experiments, it is defined by a mouse IgG1 isotype control.

[0231] All animal experiments were performed in accordance with the German Animal Welfare Law and were approved by the local government.

[0232] 7.1. B16-F10 preventive treatment

[0233] Eight-week-old female C57Bl / 6N Crl BR mice (weight 18-20 g) from Charles River Deutschland, Sulzfeld were used for the B16F10 tumor model. The experiments were started after an 8-day acclimation period. The animals were kept in a 12-hour light / dark cycle. Food and water were available ad libitum. The housing temperature was maintained at 21°C. Mice (n=12 / group) were treated with 1 x 10 4 B16-F10 tumor cells were inoculated sc into the left flank and assigned to experimental groups. At the start of treatment, animals were marked and each cage was labeled with cage number, study number and number of animals / cage.

[0234] The adjustment for in vivo administration was achieved by diluting the stock solution in DPBS (Biochrom) without Ca2+, Mg2+, pH 7.4, to an administration volume of 5 ml / kg. The agent was administered ip at 10 mg / kg q3d x 6, starting with tumor inoculation. The results are shown in Figure 1 and 2 And Table 3-6.

[0235] Table 3: Average tumor size per group as measured at 7 different time points after tumor inoculation

[0236] .

[0237] Table 4: Treatment efficacy shown as tumor size (T / C) of treatment groups relative to isotype control

[0238] .

[0239] Table 5: Average tumor size per group as measured at 7 different time points after tumor inoculation

[0240] .

[0241] Table 6: Treatment efficacy shown as tumor size (T / C) of treatment groups relative to isotype control

[0242] .

[0243] 7.2. B16-F10 therapeutic treatment and synergistic efficacy in combination with aPD-L1

[0244] Eight-week-old female C57Bl / 6N Crl BR mice (weight 18-20 g) from Charles River Deutschland, Sulzfeld were used for the B16-F10 tumor model. The experiments were started after a 5-day acclimation period. The animals were kept in a 12-hour light / dark cycle. Food and water were available ad libitum. The housing temperature was maintained at 21°C. Mice (n=11 / group) were treated with 1 x 10 4 B16F10 tumor cells were inoculated sc into the left flank and assigned to experimental groups by stratified randomization (a method for dividing mice into groups with equal distribution of tumor size) on day 3 after tumor inoculation. At the start of treatment, animals were marked and each cage was labeled with cage number, study number and number of animals / cage.

[0245] Adjustment for in vivo administration was achieved by diluting the stock solution in DPBS (Biochrom) without Ca2+, Mg2+, pH 7.4, to an administration volume of 5 ml / kg, and the agent was administered ip at 10 mg / kg q3d x 5, starting on d3. Results are shown in Figure 3 and Tables 7-8.

[0246] Table 7: Average tumor size per group as measured at 5 different time points after tumor inoculation

[0247] .

[0248] Table 8: Treatment efficacy shown as tumor size (T / C) of treatment groups relative to isotype control

[0249] .

[0250] 7.3. CT26 treatment and synergistic efficacy with aPD-L1

[0251] Eight-week-old female Balb / cAnN mice (weight 18-20 g) from Charles River Deutschland, Sulzfeld were used for the CT26 tumor model. The experiments were started after a 5-day acclimation period. The animals were kept in a 12-hour light / dark cycle. Food and water were available ad libitum. The housing temperature was maintained at 21°C. Mice (n=12 / group) were treated with 5 x 10 5 CT26 tumor cells were inoculated sc into the left flank and assigned to experimental groups by stratified randomization (a method for dividing mice into groups with equal distribution of tumor size) on day 7 after tumor inoculation. At the start of treatment, animals were marked and each cage was labeled with the cage number, study number and number of animals / cage.

[0252] Adjustment for in vivo administration was achieved by diluting the stock solution in DPBS (Biochrom) without Ca2+, Mg2+, pH 7.4 to achieve an administration volume of 5 ml / kg. aPD-L1 was administered ip at 10 mg / kg q3d x 3, and BAY1905254 was administered ip at 3 mg / kg q3d x 3, all treatments starting on d7. Results are shown in Figure 4 and Tables 9-10.

[0253] Table 9: Mean tumor size per group as measured at 4 different time points after tumor inoculation

[0254] .

[0255] Table 10: Treatment efficacy shown as tumor size (T / C) of treatment groups relative to isotype control

[0256] .

[0257] 7.4. 3C9-D11-H11 treatment and synergistic efficacy with aPD-L1

[0258] Eight-week-old female Balb / cAnN mice (weight 18-20 g) from Charles River Deutschland, Sulzfeld were used for the 3C9-D11-H11 tumor model.

[0259] The experiment was started after a 12-day acclimation period. The animals were kept in a 12-hour light / dark cycle. Food and water were available ad libitum. The housing temperature was maintained at 21°C. Mice (n=12 / group) were treated with 1 x 10 4 3C9-D11-H11 tumor cells were inoculated sc into the left flank and assigned to experimental groups by stratified randomization (a method for dividing mice into groups with equal distribution of tumor size) on day 8 after tumor inoculation. At the start of treatment, animals were marked and each cage was labeled with cage number, study number and number of animals / cage.

[0260] The adjustment for in vivo administration was achieved by diluting the stock solution in DPBS (Biochrom) without Ca2+, Mg2+, pH 7.4, to an administration volume of 5 ml / kg. The agent was administered ip at 10 mg / kg q3d x 5, starting on d8. The results are shown in Figure 5 and Tables 11-12.

[0261] Table 11: Average tumor size per group as measured at 6 different time points after tumor inoculation

[0262] .

[0263] Table 12: Treatment efficacy shown as tumor size (T / C) of treatment groups relative to isotype control

[0264] .

[0265] 8. Other combinations

[0266] 8.1. Combination with immunostimulatory CpG oligonucleotides (OVA vaccine)

[0267] Nine-week-old female C57Bl / 6N Crl BR mice (weight 18-20 g) from Charles River Deutschland, Sulzfeld were used for the B16F10 OVA tumor model. This model is a derivative of the B16-F10 cell line expressing the chicken alloantigen ovalbumin, which can be recognized by antigen-specific T cells. The experiments were started after a 13-day adaptation period. The animals were kept in a 12-hour light / dark cycle. Food and water were available ad libitum. The housing temperature was maintained at 21°C. Mice (n=12 / group) were treated with 1 x 10 4 B16-F10 OVA tumor cells were inoculated sc into the left flank and assigned to experimental groups. At the start of treatment, animals were marked and each cage was labeled with cage number, study number and number of animals / cage.

[0268] Adjustment for in vivo administration of isotype control and BAY 1905254 in an administration volume of 5 ml / kg was achieved by diluting the stock solution in DPBS (Biochrom) without Ca2+, Mg2+, pH 7.4. The agent was administered ip at 10 mg / kg q3d x3, starting on day 8. On day 9, 50µg OVA (in 50µl) + 10 µg CPG (in 10µl) + 140µl PBS = 200µl / mouse was applied subcutaneously to the left flank adjacent to the tumor. The CpG oligonucleotide used was ODN 1826 (5'-tccatgacgttcctgacgtt-3'; bases are phosphorothioate / nuclease resistant) specific for mouse TLR9 (Invivogen #tlrl-1826-5). The results are shown in Figure 6 and Tables 13-14.

[0269] Table 13: Average tumor size per group as measured at 6 different time points after tumor inoculation

[0270] .

[0271] Table 14: Treatment efficacy shown as tumor size of treated groups relative to control (T / C)

[0272] .

[0273] 8.2. Combination with docetaxel

[0274] Eight-week-old female C57Bl / 6N Crl BR mice (weight 18-20 g) from Charles River Deutschland, Sulzfeld were used for the B16-F10 OVA tumor model. This model is a derivative of the B16F10 cell line expressing the alloantigen ovalbumin, which can be recognized by antigen-specific T cells. The experiments were started after a 5-day adaptation period. The animals were kept in a 12-hour light / dark cycle. Food and water were available ad libitum. The housing temperature was maintained at 21°C. Mice (n=12 / group) were treated with 1 x 10 4 B16F10 OVA tumor cells were inoculated sc into the left flank and assigned to experimental groups. At the start of treatment, animals were marked and each cage was labeled with cage number, study number and number of animals / cage.

[0275] Adjustment for in vivo administration of isotype control and BAY 1905254 was achieved by diluting the stock solution in DPBS (Biochrom) without Ca2+, Mg2+, pH 7.4, with an administration volume of 5 ml / kg. The agent was administered ip at 10 mg / kg q3d x3, starting on day 8. On day 8, docetaxel was administered once at 20 mg / kg, iv, with a stock solution of 80 mg / 4 ml diluted in 0.9% NaCl for infusion purposes. The results are shown in Figure 7 and Tables 15-16.

[0276] Table 15: Mean tumor size per group as measured at 4 different time points after tumor inoculation

[0277] .

[0278] Table 16: Treatment efficacy shown as tumor size of treated groups relative to control (T / C)

[0279] .

[0280] 8.3. Combination with C4.4A ADC

[0281] Nine week old female Balb / cAnN mice (weight 18-20 g) from Charles River Deutschland, Sulzfeld were used for the CT26 C4.4a tumor model. This model is a derivative of the parental CT26 model expressing murine C4.4a on the surface of tumor cells.

[0282] The experiment was started after a 15-day acclimation period. The animals were kept in a 12-h light / dark cycle. Food and water were available ad libitum. The housing temperature was maintained at 21°C. Mice (n=12 / group) were treated with 1 x 10 5 CT26 tumor cells were inoculated sc into the left flank and assigned to experimental groups by stratified randomization (a method used to divide mice into groups with equal distribution of tumor size) on day 6 after tumor inoculation.

[0283] At the start of treatment, animals were marked and each cage was labeled with the cage number, study number and number of animals / cage. Adjustments for in vivo administration were prepared with an administration volume of 10 ml / kg by diluting the stock solution in DPBS (Biochrom) without Ca2+, Mg2+, pH 7.4. Agents (control + BAY 1905254) were administered ip at 10 mg / kg q3d x 5, starting on day 6.

[0284] The C4.4A ADC (antibody-drug conjugate BAY1129980), composed of antibodies against structural homologs of the urokinase-type plasminogen activator receptor (uPAR) and the tumor-associated antigen C4.4a, and conjugated to a cytotoxic agent, was administered at 10 mg / kg iv q4dx3, starting on day 6. Results are shown in Figure 8 and Tables 17-18.

[0285] Table 17: Average tumor size per group as measured at 6 different time points after tumor inoculation

[0286] .

[0287] Table 18: Treatment efficacy shown as tumor size of treated groups relative to control (T / C)

[0288] .

[0289] sequence

[0290] Reference is made herein to the sequences shown in the following table. In the event of any ambiguity between this table and the WIPO standard sequence listing which forms part of the present specification and its disclosure, the sequences and qualifiers in this table shall be deemed to be correct.

[0291]

[0292]

[0293]

[0294]

Claims

1. A pharmaceutical combination product comprising an ILDR2 antagonist, plus optionally one or more other therapeutically active compounds, wherein the ILDR2 antagonist is an anti-ILDR2 antibody, or a fragment or derivative thereof, or a modified antibody, all of which have ILDR2 binding properties, comprising the following CDR heavy chain sequence and paired CDR light chain sequence: SEQ ID NO: 1 CDR1 heavy chain SEQ ID NO: 2 CDR2 heavy chain SEQ ID NO: 3 CDR3 heavy chain SEQ ID NO: 4 CDR1 light chain SEQ ID NO: 5 CDR2 light chain; and SEQ ID NO: 6 CDR3 light chain, The fragment or derivative is selected from Fab, F(ab')2, scFv and diabody.

2. A combination product according to claim 1, wherein the other therapeutically active compound is at least one selected from the group consisting of: PD-L1 antagonists, Taxane or a taxane derivative, vaccine, CpG oligodeoxynucleotides, and / or Compounds targeting c4.4A.

3. A combination product according to any one of claims 1 and 2, wherein the ILDR2 antagonist and the other therapeutically active compound provided in the same dosage unit, or Supplied in individual dosage units.

4. A combination product according to any one of claims 1 and 2, wherein the ILDR2 antagonist and the other therapeutically active compound Configured for simultaneous administration, or Configured to be administered sequentially, ie one after the other.

5. An anti-ILDR2 antibody, or a fragment or derivative thereof, or a modified antibody, all of which have ILDR2 binding properties, comprising three CDR heavy chain sequences and paired CDR light chain sequences: SEQ ID No 1 CDR1 Heavy chain SEQ ID No 2 CDR2 Heavy chain SEQ ID No 3 CDR3 Heavy chain SEQ ID No 4 CDR1 Light chain SEQ ID No 5 CDR2 Light chain SEQ ID No 6 CDR3 light chain, The fragment or derivative is selected from Fab, F(ab')2, scFv and diabody.

6. The anti-ILDR2 antibody, or a fragment or derivative thereof, or a modified antibody according to claim 5, comprising at least one heavy chain or light chain variable region sequence selected from the following sequences: SEQ ID No 7 Heavy chain variable domain SEQ ID No 8 Light chain variable domain.

7. An anti-ILDR2 antibody, or a fragment or derivative thereof, or a modified antibody according to any one of claims 5 to 6, comprising a sequence selected from the group consisting of: SEQ ID No 42 Heavy chain SEQ ID No 43 Light chain.

8. An anti-ILDR2 antibody, or a fragment or derivative thereof, or a modified antibody, all of which have ILDR2 binding properties, comprising a set of 6 CDRs, the set of 6 CDRs consisting of 3 CDR heavy chain sequences and paired CDR light chain sequences, wherein the set of CDRs is selected from: SEQ ID NOs 18-20 as heavy chain CDRs 1-3, respectively, and SEQ ID NOs 21-23 as light chain CDRs 1-3, respectively, SEQ ID NOs 24-26 as heavy chain CDRs 1-3, respectively, and SEQ ID NOs 27-29 as light chain CDRs 1-3, respectively, and SEQ ID NOs 30-32 as heavy chain CDRs 1-3, respectively, and SEQ ID NOs 33-35 as light chain CDRs 1-3, respectively, The fragment or derivative is selected from Fab, F(ab')2, scFv and diabody.

9. An anti-ILDR2 antibody, or a fragment or derivative thereof, or a modified antibody, all of which have ILDR2 binding properties, comprising a combination of a heavy chain variable region sequence and a light chain variable region sequence, wherein the combination is selected from: A combination of SEQ ID No 9 as the heavy chain variable domain, and SEQ ID No 10 as the light chain variable domain; A combination of SEQ ID No 11 as the heavy chain variable domain, and SEQ ID No 12 as the light chain variable domain; and A combination of SEQ ID No 13 as the heavy chain variable domain and SEQ ID No 14 as the light chain variable domain, The fragment or derivative is selected from Fab, F(ab')2, scFv and diabody.

10. An anti-ILDR2 antibody, or a fragment or derivative thereof, or a modified antibody, all of which have ILDR2 binding properties, comprising a combination of a heavy chain sequence and a light chain sequence, wherein the combination is selected from: A combination of SEQ ID No 44 as the heavy chain and SEQ ID No 45 as the light chain; A combination of SEQ ID No 46 as the heavy chain, and SEQ ID No 47 as the light chain; and A combination of SEQ ID No 48 as a heavy chain and SEQ ID No 49 as a light chain, The fragment or derivative is selected from Fab, F(ab')2, scFv and diabody.

11. A combination product or anti-ILDR2 antibody, or fragment or derivative thereof, or modified antibody according to any one of claims 1, 5, 8 or 9, wherein the ILDR2 antagonist or anti-ILDR2 antibody, or fragment or derivative thereof, or modified antibody has a K of 25 nM or less as determined by fluorescence activated cell scanning. d Dissociates from human ILDR2.

12. An antibody-drug conjugate comprising the anti-ILDR2 antibody according to any one of claims 5 to 11, or a fragment or derivative thereof, or a modified antibody.

13. An isolated nucleic acid or collection thereof encoding an anti-ILDR2 antibody, or a fragment or derivative thereof, or a modified antibody according to any one of claims 5 to 11.

14. A vector comprising at least one isolated nucleic acid according to claim 13.

15. An isolated cell expressing an anti-ILDR2 antibody, or a fragment or derivative thereof, or a modified antibody according to any one of claims 5 to 11, and / or comprising a nucleic acid or a collection thereof according to claim 13, or a vector according to claim 14.

16. A pharmaceutical combination according to any one of claims 1 to 4, comprising an anti-ILDR2 antibody, or a fragment or derivative thereof, or a modified antibody according to any one of claims 5 to 11.

17. Use of an anti-ILDR2 antibody, or a fragment or derivative thereof, or a modified antibody, or a combination product comprising an ILDR2 antagonist according to any one of the preceding claims for the preparation of a medicament for the treatment of a malignancy selected from melanoma, colon cancer and myeloma.

Images