Nucleoside enzymes with reduced activity

Abstract

The present invention aims to provide an enzyme agent useful for reducing purine bodies in beer or beer-like beverages and its use. Provided is a nucleoside enzyme agent characterized in that the guanine deaminase activity relative to the nucleoside enzyme activity, that is, the activity ratio (U / U) is 0.4 or less.

Description

Technical Field

[0001] The present invention relates to a novel nucleoside enzyme agent. In particular, it relates to a nucleoside enzyme agent useful for reducing purine bodies in beer or beer-like beverages. This application claims priority based on Japanese patent application No. 2018-022542 filed on February 9, 2018, and the entire contents of the patent application are cited by reference. Background Art

[0002] Due to the westernization of diet and the increase in alcohol intake, the prevalence of hyperuricemia and gout based on it has an upward trend. As one of the causes of these diseases, purine bodies in food or beverages are considered a problem. For example, liver, fish sperm or fish eggs, some fish and shellfish contain a large amount of purine bodies. In addition, alcoholic beverages, especially brewed wine (beer, wine, etc.) also contain more purine bodies. Since alcoholic beverages are often taken daily, they are considered to be important as risk factors for hyperuricemia and gout. For example, for beer, sparkling wine and other beer-like beverages, purine bodies from raw materials (malt, etc.) are usually contained in 100mL, and it is urgently desired to provide beer / beer-like beverages (low-purine beer / beer-like beverages) that reduce the content of purine bodies.

[0003] So far, attempts have been made to reduce the purine bodies in beer. For example, in the method described in patent document 1, in the manufacturing process, by making an enzyme (purine nucleoside phosphorylase or nucleosidase) act on wort, the purine nucleosides in the wort are decomposed into ribose and free purine bases. Free purine bases are assimilated by yeast during fermentation. As a result, the amount of purine bodies (free purine bases, nucleotides, nucleosides) in the beer product is reduced. Nucleosidase useful for reducing purine bodies in beer is also reported in patent document 2. In addition, a method for removing purine bodies by using an adsorbent is also proposed (patent document 3). Patent document 4 also mentions that nucleosidase can be used to reduce purine bodies in beer, and various microorganisms are disclosed to have nucleoside decomposition activity. An example of nucleosidase from microorganisms is disclosed in patent document 5. It should be noted that the terminal substance of the purine body metabolic pathway of yeast fermentation in the manufacture of beer is xanthine, and yeast fermentation increases xanthine (patent document 6).

[0004] Prior art literature

[0005] Patent Literature

[0006] Patent Document 1: Japanese Patent No. 3824326

[0007] Patent Document 2: Japanese Patent No. 3824353

[0008] Patent Document 3: Japanese Patent Application Publication No. 2004-113189

[0009] Patent Document 4: International Publication No. 96 / 025483 Pamphlet

[0010] Patent Document 5: Japanese Patent Application Laid-Open No. 10-57063

[0011] Patent Document 6: Japanese Patent Application Publication No. 2012-125205 Summary of the invention

[0012] As mentioned above, although report the various technologies for removing the purine bodies in beer, there is no example of practicalization, and the demand for the technology of making low-purine body beer is still very high. In addition, for beer-like beverages such as sparkling wine, although by reducing the malt utilization rate or using the raw material beyond the malt can reduce the purine body content, the raw material used is restricted, therefore, can not be said to be a fundamental solution. Therefore, problem of the present invention is to provide particularly useful enzyme agent and purposes thereof for reducing the purine bodies in beer or beer-like beverage.

[0013] Under the above-mentioned problem, the inventors etc. have carried out in-depth research in order to develop the enzyme agent useful for manufacturing low-purine body beer / beer-like beverage.Purine body exists in the manufacturing process that can be assimilated by yeast purine body (assimilating purine body) and purine body (non-assimilating purine body) .If utilizing nucleosidase, then can reduce the purine body in beer / beer-like beverage, but can not remove the situation of non-assimilating purine body or generate non-assimilating purine body because of mixed enzyme activity, in the final product (beer), still residual purine body.In order to solve this problem, think that in the manufacturing process of beer / beer-like beverage, suppressing the generation of xanthine as one of non-assimilating purine body is effective, and research is carried out.As a result, successfully obtain the nucleosidase agent with low guanine deaminase activity of catalysis generating xanthine by guanine deamidation reaction.The effect of this novel nucleosidase agent is evaluated, and the result confirms that it is useful to reduce non-assimilating purine body (in other words, assimilating purine body increases). In addition, the characteristics of the nucleosidase agent (the degree of guanine deaminase activity relative to the nucleosidase activity) required for the production of beer / beer-like beverages that are desired to be low-purine products have been successfully determined.

[0014] As a result of the above intensive research, a novel nucleoside enzyme agent which is extremely useful for producing low-purine beer / beer-like beverages has been successfully obtained. Based on this result, the following invention is provided.

[0015] [1] A nucleosidase agent characterized in that the guanine deaminase activity relative to the nucleosidase activity, i.e., the activity ratio (U / U) is 0.4 or less.

[0016] [2] The nucleoside enzyme agent according to [1], wherein the activity ratio is 0.36 or less.

[0017] [3] A nucleoside enzyme agent according to [1] or [2], wherein the nucleoside enzyme contained therein comprises an amino acid sequence of sequence number 1 or sequence number 21, or an amino acid sequence that is 85% or more identical to the amino acid sequence of sequence number 1 or sequence number 21, or an amino acid sequence of sequence number 2 or sequence number 22, or an amino acid sequence that is 88% or more identical to the amino acid sequence of sequence number 2 or sequence number 22.

[0018] [4] The nucleoside enzyme agent according to [3], wherein the amino acid sequence of the nucleoside enzyme is 90% or more identical to the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 21 or the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 22.

[0019] [5] The nucleoside enzyme agent according to [1] or [2], wherein the nucleoside enzyme contained therein has the following enzymatic properties:

[0020] (1) Action: It catalyzes the hydrolysis of purine nucleosides into D-ribose and purine bases. It also exhibits activity in the presence of adenosine, adenine, inosine, hypoxanthine, guanosine, guanine, and xanthine.

[0021] (2) Molecular weight: The molecular weight without N-type sugar chains is about 49 kDa (measured by SDS-PAGE).

[0022] (3) Optimum temperature: 55℃~60℃,

[0023] (4) Temperature stability: Stable below 55°C (pH 6.0, 30 minutes).

[0024] [6] The nucleoside enzyme agent according to [5], wherein the nucleoside enzyme contained therein further has the following enzymatic properties:

[0025] (5) Optimum pH: 3.5,

[0026] (6) pH stability: Stable in the pH range of 3.5 to 7.5 (30°C, 30 minutes).

[0027] [7] The nucleoside enzyme agent according to [1] or [2], wherein the nucleoside enzyme contained therein has the following enzymatic properties:

[0028] (1) Action: It catalyzes the hydrolysis of purine nucleosides into D-ribose and purine bases. It also exhibits activity in the presence of adenosine, adenine, inosine, hypoxanthine, guanosine, guanine, and xanthine.

[0029] (2) Molecular weight: The molecular weight without N-type sugar chains is about 40 kDa (measured by SDS-PAGE).

[0030] (3) Optimum temperature: 50℃~55℃,

[0031] (4) Temperature stability: Stable below 65°C (pH 4.5, 60 minutes).

[0032] [8] The nucleoside enzyme agent according to [7], wherein the nucleoside enzyme contained therein further has the following enzymatic properties:

[0033] (5) Optimum pH: 4.5,

[0034] (6) pH stability: Stable in the pH range of 3.5 to 7.5 (30°C, 30 minutes).

[0035] [9] The nucleoside enzyme agent according to any one of [3] to [8], wherein the nucleoside enzyme is derived from Penicillium multicolor.

[0036]

[10] The nucleoside enzyme agent according to [9], wherein the Penicillium multicolor is IFO 7569 strain or a variant thereof. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 This is the reaction process of the saccharification (feeding) test.

[0038] Figure 2 Comparison of purine content in wort. The purine content in the saccharified wort was analyzed by high performance liquid chromatography.

[0039] Figure 3 This is the action temperature range of nucleosidase derived from Penicillium multicolor IFO 7569. Enzyme reaction was carried out under various temperature conditions in the presence of 7 types of purines, and the free purine base ratio was determined.

[0040] Figure 4 This is the pH range of action of nucleosidase derived from Penicillium multicolor IFO 7569. Enzyme reaction was carried out under various pH conditions in the presence of 7 types of purines, and the free purine base ratio was determined.

[0041] Figure 5 Nucleosidase purified from Penicillium multicolor IFO 7569. Results of DEAE HP column chromatography are shown.

[0042] Figure 6The results of molecular weight determination (SDS-PAGE) of each purified enzyme (peak 1 to 3) are shown on the left. The results of peak 1 and 2 are shown on the right. The results of peak 3 are shown on the right. The sample treated with PNGase F (lane with "no sugar chain") and the sample not treated (lane with "sugar chain") were electrophoresed and stained with CBB. The left lane is a molecular weight marker (myosin (200 kDa), β-galactosidase (116.3 kDa), phosphorylase B (97.4 kDa), BSA (66.3 kDa), glutamate dehydrogenase (55.4 kDa), lactate dehydrogenase (36.5 kDa), carbonic acid dehydrogenase (31.0 kDa), trypsin inhibitor (21.5 kDa), lysozyme (14.4 kDa), aprotinin (6.0 kDa), insulin B chain (3.5 kDa), insulin A chain (2.5 kDa)).

[0043] Figure 7 The molecular weights of the purified enzymes (peaks 1 to 3) are shown. The results of the N-terminal amino acid analysis are also shown.

[0044] Figure 8 These are the sequences of probes used in gene cloning: upper part: for PN1 (SEQ ID NO: 18), lower part: for PN2 (SEQ ID NO: 19).

[0045] Fig. 9 The results of gene cloning show the genome sequence encoding the enzyme of peak 3 (PN1) (upper row, sequence number 4) and the genome sequence encoding the enzyme of peaks 1 and 2 (PN2) (lower row, sequence number 6).

[0046] Fig.10 The results of gene cloning show the cDNA sequence encoding the enzyme of peak 3 (PN1) (upper row, sequence number 3) and the cDNA sequence encoding the enzyme of peaks 1 and 2 (PN2) (lower row, sequence number 5).

[0047] Fig.11 The results of gene cloning show the amino acid sequence of the enzyme of peak 3 (PN1) (upper row, sequence number 1) and the amino acid sequence of the enzyme of peaks 1 and 2 (PN2) (lower row, sequence number 2).

[0048] Fig.12 The cDNA base number, intron number, amino acid length, molecular weight and estimated pI were compared between the enzyme in peak 3 (PN1) and the enzyme in peaks 1 and 2 (PN2).

[0049] Fig.13 It is the optimum temperature for the purified enzyme (PN1).

[0050] Fig.14 is the temperature stability of the purified enzyme (PN1).

[0051] Fig.15 This is the optimum pH for the purified enzyme (PN1).

[0052] Fig.16 is the pH stability of the purified enzyme (PN1).

[0053] Fig.17 It is the result of electrophoresis of the recombinantly produced enzyme (PN2).

[0054] Fig.18 It is the optimum temperature for the purified enzyme (PN2).

[0055] Fig.19 is the temperature stability of the purified enzyme (PN2).

[0056] Fig. 20 This is the optimum pH for the purified enzyme (PN2).

[0057] Fig.21 is the pH stability of the purified enzyme (PN2).

[0058] Fig. 22 Results of saccharification (feed) experiments using recombinantly produced enzyme (PN2).

[0059] Fig.23 This is the reaction process of the saccharification (feeding) test.

[0060] Fig.24 This is a comparison of the amount of purines in wort. The saccharification test was performed at pH 4.5 to 5.5. The amount of each purine in the saccharified wort was analyzed by high performance liquid chromatography.

[0061] Fig.25 It is the relationship between the guanine deaminase activity relative to the nucleosidase activity and the assimilable purine composition ratio in the wort. DETAILED DESCRIPTION

[0062] 1. Nucleoside enzyme agents

[0063] The present invention relates to a nucleoside enzyme useful for producing low-purine beer or beer-like beverages. "Beer-like beverages" refer to beverages with a beer flavor, and in the present invention, preferably a fermented beverage using malt as part of the raw materials, and more preferably a fermented beverage produced by a method including a step of producing wort from malt before the fermentation step.

[0064] The main purpose of the nucleosidase of the present invention is to manufacture low-purine beer or beer-like beverages, but other uses can also use the nucleosidase of the present invention. For example, in order to reduce the purine bodies in food or beverages other than beer or beer-like beverages, the nucleosidase of the present invention can also be used. If the nucleosidase of the present invention is used in the manufacturing process of food or beverage, the purine nucleosides from the raw materials can be converted into free purine bases. If the free purine bases are removed in the subsequent manufacturing process, food and beverages with reduced purine body content can be obtained. Therefore, the nucleosidase of the present invention can be used in the manufacture of food or beverages that can remove free purine bases in the manufacturing process. The example of corresponding food and beverage is food and beverage that utilizes fermentation based on microorganisms that can assimilate free purine bases, i.e., fermented food and fermented beverage. Specifically, various pickles, miso, soy sauce, yogurt, fermented milk, lactic acid bacteria beverages, Shaoxing wine, grape wine, etc. can be cited. When the present invention is adopted in the manufacture of these foods and beverages, for example, the nucleoside enzyme agent of the present invention is added to the raw material before or during fermentation to make it work, and the purine nucleoside in the raw material is decomposed into D-ribose and purine base. The generated purine base is typically assimilated by microorganisms during fermentation. As a result, the total amount of purine bodies is reduced in food or beverage.

[0065] The nucleosidase agent of the present invention is characterized by a guanine deaminase activity relative to nucleosidase activity, that is, an activity ratio (U / U) of 0.4 or less. That is, the intercalated guanine deaminase activity is low relative to the activity of the nucleosidase as the main component.

[0066] When using the nucleosidase of the present invention to manufacture low-purine beer, the nucleosidase of the invention is typically added to the wort to decompose the purine nucleosides in the wort into D-ribose and purine bases. The yeast used in the fermentation of known beer is usually unable to assimilate purine nucleosides, but can assimilate guanine and adenine in free purine bases. Therefore, if the purine nucleosides in the wort are converted into free purine bases by the action of the nucleosidase of the present invention, the yeast assimilates the free purine bases in the fermentation process to obtain beer with a reduced total amount of purine bodies (this is also the case when manufacturing beer-like beverages).

[0067] The guanine deaminase mixed in the nucleosidase agent is an enzyme that catalyzes the reaction of converting the guanine of the assimilative purine into the xanthine as the non-assimilative purine. If the guanine deaminase activity is high, the amount of non-assimilative purine (xanthine) generated when the nucleosidase agent is acted on becomes more, and the residual purine volume in the final product (beer) increases. Therefore, in order to obtain the beer of low purine volume, it is preferred to use the nucleosidase agent with low guanine deaminase activity to improve the assimilative purine constituent ratio (ratio of assimilative purine to non-assimilative purine) in the wort. The assimilative purine constituent ratio depends on the generation of the assimilative purine carried out by the purine nucleosidase as the main component of the nucleosidase agent and the generation of the non-assimilative purine (xanthine) carried out by the guanine deaminase. In other words, the guanine deaminase activity (activity ratio) relative to the nucleosidase activity is the determining factor of the assimilative purine constituent ratio. Considering the residual purine content in the final product (beer), the assimilative purine composition ratio in the wort after the enzyme reaction is preferably 90% or more. The assimilative purine composition ratio is preferably 91% or more, more preferably 92% or more, further preferably 93% or more, further preferably 94% or more, and most preferably 95% or more. According to the experimental results shown in the Examples described below, the relationship between the guanine deaminase activity relative to the nucleosidase activity and the assimilative purine composition ratio is as follows: Fig.25 As shown, in order to make the assimilative purine constituent ratio 90% or more, it is necessary to make the guanine deaminase activity relative to the nucleosidase activity 0.4 (U / U) or less. Therefore, in order to achieve its purpose, the nucleosidase agent of the present invention is characterized by the characteristic that "the guanine deaminase activity relative to the nucleosidase activity, that is, the activity ratio (U / U) is 0.4 (U / U) or less". In order to further increase the assimilative purine constituent ratio, the guanine deaminase activity relative to the nucleosidase activity is preferably 0.36 (U / U) or less, more preferably 0.3 (U / U) or less, more preferably 0.2 (U / U) or less, and even more preferably 0.1 (U / U) or less.

[0068] The nucleosidase as the main component of the nucleosidase agent of the present invention can be obtained by culturing a microorganism (nucleosidase producing strain) that produces nucleosidase. Ochrobactrum, Streptococcus, Pediococcus, Leuconostoc, Lactobacillus, Escherichia, Citrobacter, Serratia, Alcaligenes, Flavobacterium, Bacillus, Corynebacterium, Staphylococcus, etc. can be used. The nucleosidase producing strains are selected from microorganisms such as the genus Saccharomyces, the genus Saccharomyces, the genus Debaryomyces, the genus Pichia, the genus Hansenula, the genus Sporobolomyces, the genus Sporidiobolus, the genus Aspergillus, and the genus Penicillium. The nucleosidase producing strains may be wild strains or mutants (e.g., mutants obtained by ultraviolet irradiation). Specific examples of nucleosidase-producing strains include Ochrobactrum anthropi (FERM BP-5377), Streptococcus citrovorum, Pediococcus pentosaceus (IFO 3182), Leuconostoc dextranicum, Lactobacillus plantarum (Lactobacillus arabinosus) (IFO 3070), Lactobacillus plantarum (Lactobacillus cucumeris) (IFO 3074), Escherichia coli B biotin less, Citrobacter freundii (IFO13546), Serratia marcescens (IFO 3073), and Lactobacillus plantarum (Lactobacillus cucumeris) (IFO 3074).3736), Alcaligenes faecalis, Flavobacterium meningosepticum (DSM2800), Bacillus cereus, Corynebacterium glutamicum (ATCC13060), Staphylococcus aureus (IFO 3060), Arthrobacter ureafaciens (Arthrobacter globiformis) (IFO 12140), Comamonas testosteroni (Pseudomonas dacunhae) (IFO 12048), Pseudomonas putida, Bacillus aneurinolyticus, Bacillus thuringiensis (IFO 12140), 3951), Kluyveromyces marxianus (Saccharomyces maxianus) (IFO 0277), Debaryomyces pseudopolymorphus, Pichia pseudopolymorpha (IFO 1026), Pichia capsulata (Hansenula capsulata) (IFO 0721), Sporobolomyces salmonicolor (IFO 1038), Sporidiobulus salmonicolor (Sporobolomyces odorus) (IFO 1035), Aspergillus niger (IFO 4416), Penicillium spinulosum (IAM 7047), Aspergillus awamori (IFO 1039), Kluyveromyces marxianus (Saccharomyces maxianus) (IFO 0277), Debaryomyces pseudopolymorphus, Pichia pseudopolymorpha (IFO 1026), Pichia capsulata (Hansenula capsulata) (IFO 0721), Sporobolomyces salmonicolor (IFO 1038), Sporobolomyces salmonicolor (Sporobolomyces odorus) (IFO 1035), Aspergillus niger (IFO 4416), Penicillium spinulosum (IAM 7047), Aspergillus awamori (IFO 4033), Aspergillus oryzae (IAM 2630), Aspergillus flavus (IFO 5839), Aspergillus terreus (IFO 5445), Aspergillus sojae (IFO4386), Aspergillus parasiticus (IFO 4082), Penicillium sp. It should be noted that a host microorganism into which a nucleosidase gene obtained from a nucleosidase producing strain (or a gene obtained by modifying the gene) has been introduced can also be used as a nucleosidase producing strain.

[0069] When the mixed guanine deaminase activity of the nucleosidase obtained from the production strain is high, for example, the mixed guanine deaminase activity can be reduced to a desired level by appropriately combining various chromatography (ion exchange chromatography, hydrophobic chromatography, affinity chromatography, etc.), heat treatment, pH treatment, salting out, etc. for purification. It should be noted that a mutant strain with low mixed guanine deaminase activity relative to nucleosidase activity can also be obtained by subjecting the production strain to mutation treatment (irradiation by ultraviolet rays, X-rays, gamma rays, etc., treatment with nitrous acid, hydroxylamine, N-methyl-N'-nitro-N-nitrosoguanidine, etc.). The "mixed guanine deaminase activity relative to nucleosidase activity" as an indicator can be evaluated by the method described later.

[0070] It is preferred that the nucleosidase from Penicillium multicolor is used as the main component to constitute the nucleosidase agent of the present invention. The "nucleosidase from Penicillium multicolor" herein refers to the nucleosidase produced by a microorganism classified as Penicillium multicolor (which can be a wild strain or a variant), or the nucleosidase gene of Penicillium multicolor (which can be a wild strain or a variant) and obtained by genetic engineering methods. Therefore, the recombinant produced by the host microorganism into which the nucleosidase gene obtained from Penicillium multicolor (or the gene obtained by modifying the gene) is introduced also belongs to the "nucleosidase from Penicillium multicolor".

[0071] It is particularly preferred that the nucleosidase constituting the nucleosidase agent of the present invention is one of the two nucleosidase enzymes obtained from Penicillium multicolor (hereinafter referred to as "PN1" and "PN2" corresponding to the description in the embodiment (it can also be its equivalent). In one embodiment, the nucleosidase agent of the present invention contains both of these two nucleosidase enzymes (it can also be its equivalent). The equivalent here refers to an enzyme having an equivalent amino acid sequence and performing the same function (specifically, enzyme activity). The amino acid sequence of PN1 is shown in sequence number 1, and the amino acid sequence of PN2 is shown in sequence number 2. In addition, the amino acid sequence of the mature form of PN1 is shown in sequence number 21, and the amino acid sequence of the mature form of PN2 is shown in sequence number 22. The nucleosidase constituting the preferred embodiment of the nucleosidase agent contains the sequence The amino acid sequence of column number 1 or the amino acid sequence of sequence number 21 or the amino acid sequence of sequence number 2 or the amino acid sequence of sequence number 22 or the amino acid sequence equivalent to any one of these amino acid sequences. " Equivalent amino acid sequence " herein refers to a part different from the sequence (amino acid sequence of sequence number 1, the amino acid sequence of sequence number 21, the amino acid sequence of sequence number 2 or the amino acid sequence of sequence number 22) as a benchmark, but the difference will not cause the amino acid sequence of substantial influence on the function of protein (referring to nucleosidase activity here). Therefore, the enzyme with the polypeptide chain consisting of the equivalent amino acid sequence shows nucleosidase activity. The degree of activity is not particularly limited as long as it can play the function as nucleosidase. But, preferably, it is equal to or higher than the enzyme with the polypeptide chain consisting of the reference sequence.

[0072] "Part of the amino acid sequence is different" typically means that the amino acid sequence is mutated (changed) by the deletion or substitution of 1 to several (the upper limit is, for example, 3, 5, 7, 10) amino acids constituting the amino acid sequence, or the addition or insertion of 1 to several (the upper limit is, for example, 3, 5, 7, 10) amino acids, or a combination thereof. The difference in the amino acid sequence here is allowed as long as the nucleoside enzyme activity is maintained (the activity may also vary slightly). As long as this condition is met, the position where the amino acid sequence is different is not particularly limited, and differences can occur at multiple positions. The "multiple" here, for the amino acid sequence of sequence number 1 or sequence number 21, is a number equivalent to less than about 15% of all amino acids, preferably a number equivalent to less than about 10%, more preferably a number equivalent to less than about 5%, even more preferably a number equivalent to less than about 3%, and most preferably a number equivalent to less than about 1%. On the other hand, the number of amino acids corresponding to less than about 12% of all amino acids, preferably less than about 10%, more preferably less than about 5%, even more preferably less than about 3%, and most preferably less than about 1%, is equivalent to the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 22. That is, when the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 21 is used as a reference, the equivalent protein has, for example, about 85% or more, preferably about 90% or more, more preferably about 95% or more, even more preferably about 98% or more, and most preferably about 99% or more homology, and when the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 22 is used as a reference, it has, for example, about 88% or more, preferably about 90% or more, more preferably about 95% or more, even more preferably about 98% or more, and most preferably about 99% or more homology. It should be noted that the difference in amino acid sequence may occur at multiple positions.

[0073] Preferably, an equivalent amino acid sequence is obtained by generating conservative amino acid substitutions in amino acid residues that are not essential for nucleosidase activity. "Conservative amino acid substitution" herein refers to replacing a certain amino acid residue with an amino acid residue having a side chain of the same nature. Amino acid residues are divided into several families according to their side chains, such as basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), non-polar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), β-branched side chains (e.g., threonine, valine, isoleucine), aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Conservative amino acid substitutions are preferably substitutions between amino acid residues within the same family.

[0074] However, the homology (%) of two amino acid sequences or two nucleic acid sequences (hereinafter "two sequences" is used as a term including them) can be determined, for example, by the following steps. First, the two sequences are arranged in a manner that enables optimal comparison (for example, a gap can be introduced in the first sequence to optimize its alignment with the second sequence). When the molecule (amino acid residue or nucleotide) at a specific position of the first sequence is the same as the molecule at the corresponding position of the second sequence, it can be said that the molecules at that position are the same. The homology of two sequences is a function of the number of identical positions common to the two sequences (i.e., homology (%) = number of identical positions / total number of positions × 100), preferably taking into account the number and size of the gaps required for optimization of the alignment.

[0075] The comparison of two sequences and the determination of homology can be achieved using a mathematical algorithm. As a specific example of a mathematical algorithm that can be used for sequence comparison, there is an algorithm described in Karlin and Altschul (1990) Proc. Natl. Acad. Sci. USA 87: 2264-68 and modified in Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90: 5873-77, but it is not limited to this. Such an algorithm has been incorporated into the NBLAST program and the XBLAST program (version 2.0) described in Altschul et al. (1990) J. Mol. Biol. 215: 403-10. In order to obtain an equivalent nucleotide sequence, for example, it is sufficient to perform a BLAST nucleotide search in the NBLAST program with score = 100 and wordlength = 12. To obtain equivalent amino acid sequences, for example, a BLAST polypeptide search can be performed with score=50 and wordlength=3 in the XBLAST program. To obtain gapped alignments for comparison, Gapped BLAST described in Altschul et al. (1997) Amino Acids Research 25(17):3389-3402 can be used. When using BLAST and Gapped BLAST, the default parameters of the corresponding programs (e.g., XBLAST and NBLAST) can be used. For details, please refer to http: / / www.ncbi.nlm.nih.gov. As an example of other mathematical algorithms that can be used for sequence comparison, there is the algorithm described in Myers and Miller (1988) Comput Appl Biosci. 4:11-17. Such algorithms have been incorporated into the ALIGN program that can be used in the GENESTREAM network server (IGH Montpellier, France) or the ISREC server. When the ALIGN program is used for comparison of amino acid sequences, for example, the PAM120 residue mass table can be used with gap length penalty=12 and gap penalty=4.

[0076] The homology between two amino acid sequences can be determined using the GAP program of the GCG software package, using a Blossom 62 matrix or a PAM250 matrix, with a gap weight of 12, 10, 8, 6 or 4, and a gap length weight of 2, 3 or 4. Alternatively, the identity between two nucleic acid sequences can be determined using the GAP program of the GCG software package (available at http: / / www.gcg.com), with a gap weight of 50 and a gap length weight of 3.

[0077] The nucleosidase constituting the nucleosidase of the present invention can be a part of a larger protein (e.g., fusion protein). As the sequence attached in the fusion protein, for example, a sequence useful for purification such as multiple amino acid residues, an additional sequence for ensuring stability during recombinant production, etc. can be cited.

[0078] Nucleosidase with the above-mentioned amino acid sequence can be easily prepared by genetic engineering methods. For example, it can be prepared by transforming a suitable host cell (for example Escherichia coli) with the DNA encoding the nucleosidase, and reclaiming the protein expressed in the transformant. The recovered protein can be suitably purified according to the purpose. If this enzyme is obtained as a recombinant protein in this way, various modifications can be made. For example, if the DNA encoding the nucleosidase and other suitable DNA are inserted into the same vector and the vector is used to produce the recombinant protein, the nucleosidase consisting of the recombinant protein connected with any peptide or protein can be obtained. In addition, the addition of sugar chains and / or lipids or the modification of the processing that produces the N-terminal or C-terminal can be implemented. By modification as above, the extraction, purification, or additional biological functions of the recombinant protein can be simplified.

[0079] The following enzymatic properties can also be used to characterize PN1 and PN2.

[0080] <Enzymatic properties of PN1>

[0081] (1) Function

[0082] PN1 is a nucleosidase that catalyzes the reaction of hydrolyzing purine nucleosides into D-ribose and purine bases. Purine nucleosides are glycosides formed by bonding purine bases and reducing groups of sugars with N-glycosidic bonds. Examples of purine nucleosides are adenosine, guanosine, and inosine. In addition, purine bases are a general term for bases with a purine skeleton, and specific examples are adenine, guanine, hypoxanthine, and xanthine. It should be noted that, in addition to purine nucleosides and purine bases, purine nucleotides are also included, and compounds with a purine skeleton are collectively referred to as purine bodies.

[0083] PN1 also shows activity in the presence of adenosine, adenine, inosine, hypoxanthine, guanosine, guanine and xanthine. That is, it is not substantially inhibited by the degradation products. This feature is particularly important in the application of this enzyme in the manufacture of food and beverages. Using PN1 showing this feature, purine nucleosides from raw materials can be effectively decomposed in the manufacturing process of food and beverages.

[0084] (2) Molecular weight

[0085] When PN1 is in its native form, it contains sugar chains (i.e., glycoproteins), and the molecular weight before the removal of N-type sugar chains is about 53 kDa (molecular weight measured by SDS-PAGE). If measured by gel permeation chromatography, it is about 126 kDa, and it is presumed that a dimer is formed. On the other hand, if the molecular weight is measured by SDS-PAGE after the removal of the N-type sugar chains, it is shown to be about 49 kDa. Therefore, the molecular weight of this enzyme when it does not contain N-type sugar chains is about 49 kDa (molecular weight measured by SDS-PAGE).

[0086] (3) Optimum temperature

[0087] The optimum temperature of PN1 is 55°C to 60°C. Such a high optimum temperature is advantageous in the production of foods and beverages that undergo a process at a relatively high temperature. The optimum temperature can be evaluated by quantifying ribose as a reaction product using an acetate buffer (pH 4.3) and guanosine as a substrate.

[0088] (4) Temperature stability

[0089] When PN1 is treated in an acetate buffer (pH 4.5) for 60 minutes, it maintains 80% or more of its activity at a temperature of 45° C. or less. Therefore, for example, if the temperature during treatment is in the range of 5° C. to 45° C., the residual activity after treatment is 80% or more.

[0090] On the other hand, when PN1 was treated in phosphate buffer (pH 6.0) for 30 minutes, it maintained an activity of 80% or more at a temperature of 55° C. or less. Therefore, for example, if the temperature during treatment was in the range of 5° C. to 55° C., the residual activity after treatment was 80% or more.

[0091] PN1, which exhibits excellent temperature stability, can exhibit high activity even under relatively high temperature conditions such as in the beer feeding process.

[0092] PN1 can be further characterized by the following enzymatic properties (5) and (6).

[0093] (5) Optimum pH

[0094] The optimum pH of PN1 is 3.5. The optimum pH can be determined based on the results of measurement in a citric acid buffer solution in the pH range of pH 2.5 to 3.5, an acetic acid buffer solution in the pH range of pH 3.5 to 5.5, and a potassium phosphate buffer solution in the pH range of pH 5.5 to 6.5, for example.

[0095] (6) pH stability

[0096] PN1 shows stable activity in a wide pH range. For example, if the pH of the enzyme solution provided for treatment is in the range of 3.5 to 7.5, then after treatment at 30°C for 30 minutes, it shows an activity of more than 80% of the maximum activity. In addition, in the case of treatment at 50°C for 60 minutes, if the pH of the enzyme solution provided for treatment is in the range of 3.5 to 7.5, then after treatment, it shows an activity of more than 80% of the maximum activity. It should be noted that pH stability can be judged based on the results measured in citric acid buffer for the pH range of pH 2.5 to 3.5, in acetic acid buffer for the pH range of pH 3.5 to 5.5, and in potassium phosphate buffer for the pH range of pH 5.5 to 6.5.

[0097] <Enzymatic properties of PN2>

[0098] (1) Function

[0099] PN2 is a nucleosidase that catalyzes the decomposition of purine nucleosides into D-ribose and purine bases.

[0100] PN2 also shows activity in the presence of adenosine, adenine, inosine, hypoxanthine, guanosine, guanine and xanthine. That is, it is not substantially inhibited by the degradation products. This feature is particularly important in the manufacture of food and beverages using this enzyme. Using PN1 that shows this feature, purine nucleosides from raw materials can be effectively decomposed during the manufacture of food and beverages.

[0101] (2) Molecular weight

[0102] When PN2 is in its native form, it contains sugar chains (i.e., glycoproteins), and the molecular weight before the removal of N-type sugar chains is about 51 kDa (molecular weight measured by SDS-PAGE). If measured by gel permeation chromatography, it is about 230 kDa. On the other hand, if the molecular weight is measured by SDS-PAGE after the removal of N-type sugar chains, it is about 40 kDa. Therefore, the molecular weight of this enzyme when it does not contain N-type sugar chains is about 40 kDa (molecular weight measured by SDS-PAGE).

[0103] (3) Optimum temperature

[0104] The optimum temperature of PN2 is 50°C to 55°C. Such a high optimum temperature is advantageous in the production of foods and beverages that undergo a processing step at a relatively high temperature. The optimum temperature can be evaluated by quantifying ribose as a reaction product using an acetate buffer (pH 4.3) and guanosine as a substrate.

[0105] (4) Temperature stability

[0106] When PN2 is treated in an acetate buffer (pH 4.5) for 60 minutes, it maintains 80% or more of its activity at a temperature below 65° C. Therefore, for example, if the temperature during treatment is in the range of 5° C. to 65° C., the residual activity after treatment is 80% or more.

[0107] On the other hand, when PN2 is treated in phosphate buffer (pH 6.0) for 30 minutes, it maintains 80% or more of its activity at a temperature below 55° C. Therefore, for example, if the temperature during treatment is in the range of 5° C. to 55° C., the residual activity after treatment is 80% or more.

[0108] PN2, which exhibits excellent temperature stability, can exhibit high activity even under relatively high temperature conditions such as in the beer feeding process.

[0109] PN2 can be further characterized by the following enzymatic properties (5) and (6).

[0110] (5) Optimum pH

[0111] The optimum pH of PN2 is 4.5. The optimum pH can be determined based on the results of measurement in a citric acid buffer solution in the pH range of pH 2.5 to 3.5, an acetic acid buffer solution in the pH range of pH 3.5 to 5.5, and a potassium phosphate buffer solution in the pH range of pH 5.5 to 6.5, for example.

[0112] (6) pH stability

[0113] PN2 shows stable activity in a wide pH range. For example, if the pH of the enzyme solution provided for treatment is in the range of 3.5 to 7.5, then after treatment at 30°C for 30 minutes, it shows more than 80% of the maximum activity. In addition, in the case of treatment at 50°C for 60 minutes, if the pH of the enzyme solution provided for treatment is in the range of 4.5 to 7.5, then after treatment, it shows more than 80% of the maximum activity. It should be noted that pH stability can be judged based on the results measured in citric acid buffer for the pH range of pH 2.5 to 3.5, in acetic acid buffer for the pH range of pH 3.5 to 5.5, and in potassium phosphate buffer for the pH range of pH 5.5 to 6.5.

[0114] As shown in the examples described below, the present inventors have succeeded in isolating and purifying a nucleoside enzyme having the above-mentioned properties from Penicillium multicolor IFO 7569. It should be noted that Penicillium multicolor IFO 7569 is a strain stored in the Independent Administrative Institution Product Evaluation and Technology Foundation (2-5-8, Kazusa Kamata, Kisarazu City, Chiba Prefecture) (listed as NBRC7569 in the NBRC Culture Catalogue), and can be obtained through prescribed procedures.

[0115] The content of nucleosidase in the nucleosidase of the present invention is not particularly limited. For example, 100U to 100000U of nucleosidase is contained in each 1g of nucleosidase. The form of the nucleosidase of the present invention can be liquid or solid (including powder). In addition to the active ingredient (i.e., the enzyme), the nucleosidase of the present invention can also contain excipients, buffers, suspending agents, stabilizers, preservatives, preservatives, physiological saline, etc. As excipients, lactose, sorbitol, D-mannitol, maltodextrin, white sugar, etc. can be used. As buffers, phosphates, citrates, acetates, etc. can be used. As stabilizers, propylene glycol, ascorbic acid, etc. can be used. As preservatives, phenol, benzalkonium chloride, benzyl alcohol, chlorobutanol, methyl parahydroxybenzoate, etc. can be used. As preservatives, benzalkonium chloride, parahydroxybenzoic acid, chlorobutanol, etc. can be used.

[0116] 2. Method for producing nucleoside enzyme agent

[0117] The nucleosidase agent of the present invention can be obtained by the following method, i.e., a method having the following characteristics: a step of culturing a microorganism that produces nucleosidase (step (1)) and a step of recovering the nucleosidase from the culture solution and / or the bacterial cell after culturing (step (2)). The microorganism that produces nucleosidase is, for example, Penicillium multicolor, preferably Penicillium multicolor IFO 7569 strain or a variant thereof. The variant can be obtained by irradiation with ultraviolet rays, X-rays, gamma rays, etc., treatment with nitrous acid, hydroxylamine, N-methyl-N'-nitro-N-nitrosoguanidine, etc.

[0118] Culture conditions and culture methods are not particularly limited as long as they can produce nucleosidase. That is, the method and culture conditions of the culture of the microorganism suitable for use can be appropriately set as conditions for producing nucleosidase. As the culture method, any one of liquid culture and solid culture is acceptable, preferably liquid culture is utilized. Its culture conditions are described as an example of liquid culture.

[0119] As a culture medium, there is no particular limitation as long as it is a culture medium in which the microorganisms used can grow. For example, a carbon source such as glucose, sucrose, gentiobiose, soluble starch, glycerol, dextrin, molasses, and organic acid can be added, and a nitrogen source such as ammonium sulfate, ammonium carbonate, ammonium phosphate, ammonium acetate, or peptone, yeast extract, corn steep liquor, casein hydrolyzate, wheat bran, meat extract can be further added, and a culture medium with inorganic salts such as potassium salt, magnesium salt, sodium salt, phosphate, manganese salt, iron salt, and zinc salt can be further added. In order to promote the growth of the transformant used, vitamins, amino acids, etc. can be added to the culture medium. The pH of the culture medium is adjusted to about 3 to 8, preferably about 4 to 7, and the culture temperature is usually about 20 to 40°C, preferably about 25 to 35°C, and cultured under aerobic conditions for 1 to 20 days, preferably about 3 to 10 days. As a culture method, for example, a shaking culture method and an aerobic deep culture method based on a fermenter can be used.

[0120] After culturing under the above conditions, the target enzyme (nucleosidase) is recovered from the culture fluid or the bacterial cell (step (2)). When recovered from the culture fluid, for example, after removing insoluble matter by filtering the culture supernatant, centrifuging, etc., various chromatograms such as salting out, dialysis, ion exchange resins, etc. using ultrafiltration membrane concentration, ammonium sulfate precipitation, etc. are appropriately combined to separate and purify, thereby obtaining the nucleosidase. On the other hand, when recovered from the bacterial cell, for example, after the bacterial cell is crushed by pressure treatment, ultrasonic treatment, etc., separation and purification are carried out in the same manner as above, thereby obtaining the nucleosidase. It should be noted that the above-mentioned series of operations (crushing, separation, purification of the bacterial cell) can also be carried out after the bacterial cell is recovered from the culture fluid in advance by filtering, centrifuging, etc.

[0121] In one embodiment, in order to obtain a liquid nucleoside enzyme agent by a simple operation, the enzyme agent is produced by a production method comprising the following steps (I) and (II).

[0122] (I) Step of culturing a microorganism producing nucleosidase

[0123] (II) Step of removing bacterial cells after cultivation

[0124] Step (I) is the same as step (1) above, so its description is omitted. In step (II) following step (I), the bacterial cells are removed by centrifugation, filtration, filter treatment, etc. The culture solution without bacterial cells thus obtained is used as a nucleoside enzyme agent directly or after further treatment (i.e., a step of purifying the culture solution after removing the bacterial cells (step (III)).

[0125] It is also possible to utilize recombinant bacteria into which nucleosidase genes have been introduced to manufacture nucleosidase agents. When utilizing recombinant bacteria to manufacture nucleosidase agents, after obtaining recombinant bacteria (transformant) by importing nucleosidase genes into appropriate host microorganisms, the transformant is cultured under conditions that produce proteins encoded by the genes imported therein (step (i)). With regard to various vector host systems, the culture conditions of transformants are well known, and appropriate culture conditions can be easily set by those skilled in the art. After the culture step, the protein (i.e., nucleosidase) produced is recovered (step (ii)). Recovery and subsequent purification are carried out in the same manner as in the above-mentioned manner.

[0126] As the nucleosidase gene, it is preferred to use a gene containing a DNA encoding the amino acid sequence of sequence number 1 (DNA encoding PN1), a DNA encoding the amino acid sequence of sequence number 21 (DNA encoding the mature form of PN1), a DNA encoding the amino acid sequence of sequence number 2 (DNA encoding PN2), or a DNA encoding the amino acid sequence of sequence number 22 (DNA encoding the mature form of PN2). Specific examples of this embodiment are a DNA composed of the base sequence of sequence number 3 (corresponding to the cDNA encoding the amino acid sequence of sequence number 1), a DNA composed of the base sequence of sequence number 23 (corresponding to the cDNA encoding the amino acid sequence of sequence number 21), a DNA composed of the base sequence of sequence number 4 (corresponding to the genomic DNA encoding the amino acid sequence of sequence number 1), a DNA composed of the base sequence of sequence number 5 (corresponding to the cDNA encoding the amino acid sequence of sequence number 2), a DNA composed of the base sequence of sequence number 24 (corresponding to the cDNA encoding the amino acid sequence of sequence number 22), and a DNA composed of the base sequence of sequence number 6 (corresponding to the genomic DNA encoding the amino acid sequence of sequence number 2).

[0127] The above-mentioned nucleosidase gene can be prepared in an isolated state by referring to the sequence information disclosed in this specification or the attached sequence table using standard genetic engineering methods, molecular biology methods, biochemical methods, chemical synthesis, PCR methods (such as overlapping PCR) or a combination thereof.

[0128] Generally speaking, when a part of a DNA encoding a certain protein is modified, sometimes the protein encoded by the modified DNA has the same function as the protein encoded by the DNA before modification. That is, sometimes the modification of the DNA sequence does not substantially affect the function of the encoded protein, and the function of the encoded protein is maintained before and after the modification. Therefore, as a nucleosidase gene, a gene containing a DNA (hereinafter also referred to as "equivalent DNA") having a base sequence equivalent to the base sequence used as a benchmark (any sequence in sequence numbers 3 to 6, 23, and 24) and encoding a protein with nucleosidase activity can be used. The "equivalent base sequence" here refers to a base sequence that is different from a part of the DNA shown in the base sequence used as a benchmark, but the function of the protein encoded by it (here, nucleosidase activity) is not substantially affected by the difference.

[0129] A specific example of equivalent DNA is a DNA that hybridizes a base sequence complementary to a base sequence used as a benchmark under stringent conditions. "Stringent conditions" herein refer to conditions that form so-called specific hybridization without forming non-specific hybridization. Such stringent conditions are well known to those skilled in the art, and can be set, for example, with reference to Molecular Cloning (Third Edition, Cold Spring Harbor Laboratory Press, New York), Current protocols in molecular biology (edited by Frederick M. Ausubel et al., 1987). Examples of stringent conditions include incubation at about 50° C. using a hybridization solution (50% formamide, 10×SSC (0.15 M NaCl, 15 mM sodium citrate, pH 7.0), 5×Denhardt's solution, 1% SDS, 10% dextran sulfate, 10 μg / ml of modified salmon sperm DNA, 50 mM phosphate buffer (pH 7.5)), and then washing at about 65° C. using 0.1×SSC, 0.1% SDS. Examples of more preferred stringent conditions include conditions using, as a hybridization solution, 50% formamide, 5×SSC (0.15 M NaCl, 15 mM sodium citrate, pH 7.0), 1×Denhardt's solution, 1% SDS, 10% dextran sulfate, 10 μg / ml of modified salmon sperm DNA, 50 mM phosphate buffer (pH 7.5)).

[0130] As other specific examples of equivalent DNA, there can be cited a DNA that is composed of a base sequence that contains one or more (preferably one to several) base substitutions, deletions, insertions, additions or inversions of the base sequence used as a reference and encodes a protein with nucleosidase activity. The substitution, deletion, etc. of the base can occur at multiple sites. The "multiple" here varies depending on the position and type of the amino acid residues in the three-dimensional structure of the protein encoded by the DNA, for example, 2 to 40 bases, preferably 2 to 20 bases, and more preferably 2 to 10 bases.

[0131] The equivalent DNA has, for example, 70% or more, preferably 80% or more, further preferably about 90% or more, further preferably 95% or more, and most preferably 99% or more homology with the base sequence used as a reference (any of sequence numbers 3 to 6, 23, and 24).

[0132] As above equivalent DNA for example can obtain by the following manner: utilize restriction enzyme to handle, the processing that carries out via nuclease or DNA ligase etc., based on the introduction of site-directed mutagenesis method (Molecular Cloning, Third Edition, Chapter 13, Cold Spring Harbor Laboratory Press, New York) or random mutagenesis method (Molecular Cloning, Third Edition, Chapter 13, Cold Spring Harbor Laboratory Press, New York) variation etc., with the mode that comprises the replacement, disappearance, insertion, additional and / or inversion of base, the DNA with reference base sequence is modified.In addition, also can obtain equivalent DNA by other methods such as ultraviolet irradiation.As another example of equivalent DNA, can enumerate owing to confirm the different DNA of base as above with SNP (single nucleotide polymorphism) as the polymorphism of representative.

[0133] In order to obtain the recombinant bacteria that imports the nucleosidase gene, typically, an expression vector containing the nucleosidase gene is constructed and the host cell is transformed with the expression vector. It can be considered that the type of the host cell selects an appropriate vector. As a vector using Escherichia coli as a host, M13 phage or its modified body, lambda phage or its modified body, pBR322 or its modified body (pB325, pAT153, pUC8, etc.) etc. can be exemplified, as a vector using yeast as a host, pYepSec1, pMFa, pYES2 etc. can be exemplified, as a vector using insect cells as a host, pAc, pVL etc. can be enumerated, as a vector using mammalian cells as a host, pCDM8, pMT2PC etc. can be exemplified.

[0134] "Expression vector" refers to a vector that can introduce a nucleic acid inserted into the vector into a target cell (host cell) and can express it in the cell. An expression vector usually contains a promoter sequence required for the expression of the inserted nucleic acid, an enhancer sequence that promotes expression, etc. An expression vector containing a selection marker can also be used. When using the expression vector, the selection marker can be used to confirm whether the expression vector is introduced (and its degree).

[0135] Insertion of DNA into the vector, insertion of a selectable marker gene (if necessary), insertion of a promoter (if necessary), etc. can be carried out using standard recombinant DNA techniques (for example, refer to Molecular Cloning, Third Edition, 1.84, Cold Spring Harbor Laboratory Press, New York, well-known methods using restriction endonucleases and DNA ligases).

[0136] Transformants produced by the above expression vectors can be prepared by transfection or transformation. Transfection and transformation can be carried out by calcium phosphate coprecipitation, electroporation (Potter, H. et al., Proc. Natl. Acad. Sci. USA 81, 7161-7165 (1984)), lipofection (Felgner, P. et al., Proc. Natl. Acad. Sci. USA 84, 7413-7417 (1984)), microinjection (Graessmann, M. & Graessmann, A., Proc. Natl. Acad. Sci. USA 73, 366-370 (1976)), Hanahan's method (Hanahan, D., J. Mol. Biol. 166, 557-580 (1983)), lithium acetate method (Schiestl, R. et al., Proc. Natl. Acad. Sci. USA 73, 366-370 (1976)), al., Curr. Genet. 16, 339-346 (1989)), protoplast-polyethylene glycol method (Yelton, MM et al., Proc. Natl. Acad. Sci. 81, 1470-1474 (1984)), etc.

[0137] The host cell is not particularly limited as long as it expresses the nucleoside enzyme, and can be, for example, bacteria of the genus Bacillus such as Bacillus subtilis, Bacillus licheniformis, and Bacillus circulans, lactic acid bacteria such as Lactococcus, Lactobacillus, Streptococcus, Leuconostoc, and Bifidobacterium, other bacteria such as Escherichia and Streptomyces, yeasts such as Saccharomyces, Kluyveromyces, Candida, Torula, and Torulopsis, and Aspergillus oryzae and Aspergillus niger. niger) and other Aspergillus, Penicillium, Trichoderma, Fusarium and other filamentous fungi (fungi).

[0138] Example

[0139] <Example 1> Acquisition and identification of novel nucleosidase

[0140] 1. Acquisition of novel nucleosidase

[0141] In order to find out the enzyme useful for making low-purine beer, screening was implemented with more than 10,000 kinds of microorganisms as the object. As a result, 4 strains of microorganisms, namely Penicillium multicolor IFO 7569, Bacillus brevis IFO 15304, Brevibacillus linens IFO 12141, and Mucor javanicus 4068 were identified as promising candidates. For the nucleosidase produced by these microorganisms, it is assumed that it is used in the feeding process of beer, and the action and effect under the normal conditions (saccharification test) of the feeding process are evaluated. It should be noted that Penicillium multicolor IFO 7569 was identified again afterwards, and the result was identified as Penicillium maximae.

[0142] (1) Cultivation method of Penicillium polychromatum IFO 7569 strain

[0143] Penicillium multicolor IFO 7569 strain was inoculated into 100 mL of the culture medium B described below, and cultured in a 500 mL Sakaguchi flask at 27° C. with shaking for 48 to 72 hours. The pre-culture solution was transferred to 2 L of the culture medium B described below, and cultured at 27° C. with aeration and stirring for 120 to 188 hours. The culture solution was filtered through diatomaceous earth to remove the bacterial cells, and the obtained culture supernatant was concentrated using an ultrafiltration membrane to obtain a freeze-dried powder.

[0144] <Cultivation medium A>

[0145] 1% Lustergen FK (Nidian Chemical)

[0146] 1% yeast extract (Difco)

[0147] 0.5% NaCl

[0148] pH7.0

[0149] <Cultivation medium B>

[0150] 1% Lustergen FK (Nidian Chemical)

[0151] 1% yeast extract (Difco)

[0152] 2% corn flour (Matsumoto Nohsan)

[0153] 0.5% NaCl

[0154] pH 6.5

[0155] (2) Cultivation methods of Bacillus brevis IFO 15304, Brevibacterium linen IFO 12141, and Mucor javanica 4068

[0156] Bacillus brevis IFO 15304 strain and Brevibacterium linen IFO 12141 strain were inoculated into 10 mL of the above-mentioned culture medium A and cultured at 30° C. in a test tube under shaking for 48 hours. On the other hand, Mucor javanica IFO 4068 strain was inoculated into 10 mL of the above-mentioned culture medium B and cultured under the same conditions. The culture solution was transferred to 50 mL of the present culture medium of the same composition and cultured at 30° C. under shaking for 120 hours. The culture solution was centrifuged to remove the bacterial cells, and a freeze-dried powder was obtained from the obtained supernatant.

[0157] (3) Determination of nucleoside enzyme activity

[0158] Nucleosidase activity is defined by quantifying the ribose generated by the reaction with guanosine as the substrate. 1 mL of the reaction solution contains 0.1 M acetate buffer (pH 4.3), 8 mM guanosine and an appropriate amount of enzyme. The reaction starts when guanosine is added and reacts at 55°C for 30 minutes. After adding 1.5 mL of 0.5% dinitrosalicylic acid solution to stop the reaction, it is boiled for 10 minutes. The absorbance at 540 nm of the cooled reaction solution is measured, and the activity value is calculated by subtracting the absorbance of the reaction solution without adding the enzyme. The amount of enzyme that generates 1 μmol of ribose in 30 minutes is defined as 1U of enzyme activity.

[0159] (4) Glycation test

[0160] 80 g of ground malt, 320 mL of water and 320 U of nucleosidase were added to carry out a saccharification test to prepare wort. The reaction process is shown in Figure 1 The amount of each purine in the saccharified wort was quantitatively analyzed by high performance liquid chromatography under the following conditions.

[0161] <HPLC conditions>

[0162] Column: Asahipak GS-220HQ

[0163] Mobile phase: 150 mM sodium phosphate buffer (pH 2.5)

[0164] Temperature: 35℃

[0165] Flow rate: 0.5mL / min

[0166] Detection: 260nm

[0167] The analysis results are shown in Figure 2 The figure also shows the free purine base ratio calculated by the following formula.

[0168] Free purine base ratio (%) = {purine base / (purine nucleoside+purine base)}×100

[0169] In the wort to which the nucleosidase from Penicillium multicolor IFO 7569 strain (P.multicolor) was added, the purine nucleosides decreased and the purine bases increased. As a control, it was considered that the nucleosidase from Bacillus brevis IFO 15304 strain, Brevibacillus linens IFO 12141 strain, and Mucor javanicus 4068 strain may be inhibited by the degradation products (adenine, guanine, hypoxanthine, xanthine), and the amount of purine nucleosides did not change significantly.

[0170] (5) Study on the characteristics of the nucleosidase from Penicillium multicolor IFO 7569 (P. multicolor nucleosidase)

[0171] In order to analyze the characteristics of the Penicillium multicolor nucleosidase, the action temperature range and the action pH range were studied using the solution of the following composition (hereinafter referred to as simulated wort).

[0172] Adenosine 0.08mmol / L

[0173] Adenine 0.43mmol / L

[0174] Inosine 0.49mmol / L

[0175] Hypoxanthine 0.08mmol / L

[0176] Guanosine 0.67mmol / L

[0177] Guanine 1.45mmol / L

[0178] Xanthoglobin 0.00mmol / L

[0179] Xanthine 0.08mmol / L

[0180] (5-1) Action temperature range

[0181] 9U of Penicillium polychromatum nucleosidase was added to 2mL of simulated wort, and the reaction was carried out at pH 5.5 for 1 hour at various temperatures. The mixture was diluted 10 times with 150mM sodium phosphate buffer (pH 2.5) as the mobile phase of HPLC and quantitatively analyzed by high performance liquid chromatography. The free purine base ratio was calculated by the following formula. At a reaction temperature of 50°C to 60°C, the free purine base ratio was 90% or more ( Figure 3 ).

[0182] Free purine base ratio (%) = {purine base / (purine nucleoside+purine base)}×100

[0183] (5-2) pH range of action

[0184] 9U of Penicillium multicolor nucleosidase was added to 2mL of simulated malt juice, and the reaction was carried out at 55°C for 1 hour at various pH values. Then, the mixture was diluted 10 times with 150mM sodium phosphate buffer (pH2.5) as the mobile phase of HPLC and quantitatively analyzed by high performance liquid chromatography. Citric acid buffer was used for pH4.5 to pH6.0, and MES buffer was used for pH6.0 to pH6.5. The free purine base ratio was calculated in the same way as in the study of the action temperature range. In the case of citric acid buffer, the free purine body ratio was 80% or more at pH4.5 to pH5.5. In the case of MES buffer, the free purine body ratio was 80% or more at pH6.0 to pH6.5 ( Figure 4 ).

[0185] (6) Purification of nucleosidase from Penicillium multicolor IFO 7569

[0186] The nucleoside enzyme was purified by hydroxyapatite column, anion exchange column, hydrophobic column, and gel filtration column chromatography. A series of purification steps are shown below. First, 0.1 g of freeze-dried powder prepared from the culture solution of Penicillium multicolor IFO 7569 strain was dissolved in 5 mL of buffer (5 mM potassium phosphate buffer (pH 6) + 0.3 M NaCl) and applied to a hydroxyapatite column (BioRad) equilibrated with the same buffer. The adsorbed protein was eluted with a 5 mM to 300 mM phosphate gradient and the active fraction was recovered. The obtained active fraction was dialyzed with a buffer (20 mM potassium phosphate buffer (pH 5.5)) and applied to a DEAE HP column (GE Healthcare) equilibrated with the same buffer. The adsorbed protein was eluted with a 0 mM to 500 mM NaCl gradient, and 3 peaks were confirmed ( Figure 5 ). Fr.2 was determined as peak 1, Fr.8 and 9 were determined as peak 2, and Fr.14 and 15 were determined as peak 3.

[0187] The recovered peak 3 was dialyzed with a buffer solution (20 mM acetate buffer (pH 4.5) + 30% saturated ammonium sulfate) and applied to a Phenyl HP column (GE Healthcare) equilibrated with the same buffer. The adsorbed protein was eluted with a gradient of 30% saturated to 0% ammonium sulfate and the active fraction was recovered. The obtained active fraction was dialyzed with a buffer solution (20 mM sodium phosphate buffer (pH 6)) and concentrated to 0.5 mL using an ultrafiltration membrane. The concentrated active fraction was applied to a HiLoad 16 / 60 Superdex 200 (GE Healthcare) equilibrated with the same buffer and the active fraction was recovered. The purified enzyme obtained was determined to be a single band by SDS-PAGE ( Figure 6 The molecular weight was estimated to be about 53 kDa by SDS-PAGE and about 126 kDa by gel filtration chromatography ( Figure 7). The sugar chains of the purified enzyme were removed using PNGaseF (New England BioLabs). The treatment method was in accordance with the attached instructions. SDS-PAGE after treatment showed that the molecular weight changed from about 53 kDa to about 49 kDa by removing the N-type sugar chain ( Figure 6 , 7 ). The recovered peaks 1 and 2 were purified in the same manner, and the molecular weight was determined by SDS-PAGE and gel filtration chromatography. The molecular weight was estimated to be about 51 kDa by SDS-PAGE and about 230 kDa by gel filtration chromatography ( Figure 7 ). The sugar chains of the purified enzyme were removed using PNGaseF (New England BioLabs). SDS-PAGE after treatment showed that the molecular weight changed from about 51 kDa to about 40 kDa by removing the N-type sugar chains ( Figure 6 , 7 ).

[0188] The N-terminal amino acid sequence of each purified enzyme (peak 1 to 3) was analyzed using a protein sequencer (Shimadzu Corporation), and the sequence was estimated to be the following.

[0189] N-terminal amino acid sequence of peak 1: ADKHYAIMDNDWYTA (SEQ ID NO: 7)

[0190] N-terminal amino acid sequence of peak 2: ADKHYAIMDNDWYTA (SEQ ID NO: 8)

[0191] N-terminal amino acid sequence of peak 3: VETKLIFLT (SEQ ID NO: 9)

[0192] Peak 1 and peak 2 have the same molecular weight and N-terminal amino acid sequence, and are presumed to be the same enzyme ( Figure 7 ). The N-terminal amino acid sequence of Peak 3 was subsequently analyzed to determine that it was actually "VEILLISLT" (SEQ ID NO: 20). In the following studies, this enzyme is referred to as PN2, and the enzyme of Peak 3 is referred to as PN1.

[0193] 2. Gene cloning

[0194] The following degenerate primers were designed based on the determined N-terminal amino acid sequence and nucleosidase conserved sequence, and PCR was performed using the genomic DNA of Penicillium multicolor as a template.

[0195] <Degenerate primers for PN1>

[0196] FW: ACIAARTAYMGNTTYYTIAC (serial number 10)

[0197] RV: CATNCCNCKNGTCCAYTGNCC (serial number 11)

[0198] <Degenerate primers for PN2>

[0199] FW: GCNATHATGGAYAAYGAYTGGTAYAC (serial number 12)

[0200] RV: GCNGCNGTYTCRTCCCARAANGG (serial number 13)

[0201] The obtained amplified fragment was subcloned into pMD20-T (TaKaRa) and sequenced. Figure 8 The probes shown were used for Southern blotting and colony hybridization. The resulting fragments were sequenced to identify the base sequences in the genomes of PN1 and PN2 ( Fig. 9 ).

[0202] Next, mRNA was prepared from the genomic DNA of Penicillium multicolor, and cDNA was prepared from the mRNA using SMARTER RACE5' / 3' (TaKaRa). Then, PCR was performed using the following primers, and the amplified fragments were sequenced to determine the base sequences of PN1 and PN2 in the cDNA ( Fig.10 In addition, the amino acid sequences of PN1 and PN2 were identified by the determined base sequences ( Fig.11 ). It should be noted that Fig.12 PN1 and PN2 were compared in .

[0203] <PCR primers for PN1>

[0204] FW: ATGGCACCTAAGAAAATCATCATTG (sequence number 14)

[0205] RV:TTAGTGGAAGATTCTATCGATGAGG (sequence number 15)

[0206] <PCR primers for PN2>

[0207] FW: ATGCATTTCCCTGTTTCATTGCCGC (sequence number 16)

[0208] RV:TCAACGCTCATTTCTCAGGTCGG (sequence number 17)

[0209] 3. Study on various properties of enzyme PN1

[0210] (1) Optimum temperature

[0211] The optimum temperature of the nucleoside enzyme (PN1) in peak 3 recovered from the DEAE HP column was analyzed. The results for each temperature are shown in Fig.13The optimum temperature under this condition is 55℃~60℃.

[0212] (2) Temperature stability

[0213] The temperature stability of the nucleosidase in peak 3 recovered from the DEAE HP column was analyzed. When treated at pH 4.5 for 60 minutes at each temperature, 80% of the residual activity was observed at 45°C, and when treated at pH 6.0 for 30 minutes, 80% of the residual activity was observed at 55°C. Fig.14 ).

[0214] (3) Optimum pH

[0215] The optimum pH of the nucleosidase in peak 3 recovered from the DEAE HP column was analyzed. Citric acid buffer was used for pH 2.5 and pH 3.5, acetic acid buffer was used for pH 3.5, pH 4.5 and pH 5.5, and potassium phosphate buffer was used for pH 5.5 and pH 6.5. The optimum pH was pH 3.5 ( Fig.15 ).

[0216] (4) pH stability

[0217] The pH stability of the nucleosidase of peak 3 recovered from the DEAE HP column was analyzed at each pH when treated at 30°C for 30 minutes and at 50°C for 60 minutes. The same buffer as used in the study of the optimal pH was used, and potassium phosphate buffer was used for pH 7.5. When treated at 30°C for 30 minutes, more than 80% of residual activity was shown at pH 3.5 to 7.5, and when treated at 50°C for 60 minutes, more than 80% of residual activity was shown at pH 3.5 to 7.5 ( Fig.16 ).

[0218] 4. Recombinant production of enzyme PN2

[0219] Insert the PN2 cDNA fragment into the cloning site of the expression vector to construct the PN2 expression vector. Use the expression vector to transform Aspergillus oryzae (A.oryzae(pyrG-)). The obtained transformant was subjected to liquid culture for 4 days (30°C, 300rpm). The culture supernatant was recovered and the nucleosidase activity was measured. As a result, a transformant showing activity was obtained. In addition, the culture supernatant was subjected to sugar chain removal treatment and electrophoresis, and the result confirmed a band of a size consistent with the estimated molecular weight ( Fig.17 ).

[0220] 5. Study on various properties of enzyme PN2

[0221] Various properties of recombinantly produced PN2 were investigated. The experimental methods and conditions were the same as those for PN1.

[0222] (1) Optimum temperature

[0223] The optimum temperature is 50℃~55℃( Fig.18 ).

[0224] (2) Temperature stability

[0225] When treated at pH 4.5 for 60 minutes at each temperature, 80% of the residual activity was observed at 65°C, and when treated at pH 6.0 for 30 minutes, 80% of the residual activity was observed at 55°C. Fig.19 ).

[0226] (3) Optimum pH

[0227] Use citric acid buffer for pH 2.5 and pH 3.5, acetic acid buffer for pH 3.5, pH 4.5 and pH 5.5, and potassium phosphate buffer for pH 5.5 and pH 6.5. The optimum pH is pH 4.5 ( Fig. 20 ).

[0228] (4) pH stability

[0229] The pH stability was analyzed when the treatment was performed at 30°C for 30 minutes and at 50°C for 60 minutes at each pH. The same buffer as used in the study of the optimal pH was used. When the treatment was performed at 30°C for 30 minutes, more than 80% of the residual activity was shown at pH 3.5 to 7.5, and when the treatment was performed at 50°C for 60 minutes, more than 80% of the residual activity was shown at pH 4.5 to 7.5 ( Fig.21 ).

[0230] 6. Glycosylation test of enzyme PN2

[0231] The saccharification test was conducted using the recombinantly produced PN2. The test method and conditions were the same as those in 1.(4) above. The amount of each purine in the saccharified wort was quantitatively analyzed by high performance liquid chromatography. The analysis results are shown in Fig. 22 It can be seen that the purine nucleosides in the wort to which PN2 (nucleosidase) was added decreased, and the purine bases increased.

[0232] 7. Saccharification test under low pH conditions

[0233] In order to further confirm the usefulness of the nucleoside enzyme from Penicillium multicolor IFO 7569 strain in the production of beer or beer-like beverages, a saccharification test was conducted near the optimal pH of the enzyme (pH 4.5-5.5) to study whether the desired effect (i.e., reduction of purine bodies) can be obtained. 80 g of ground malt, 320 mL of water and 2400 U of nucleoside enzyme were added, and the pH of the initial (52°C) and 60°C steps was adjusted to pH 4.5, pH 5.0 or pH 5.5 for saccharification test to prepare wort. The reaction process is shown in Fig.23The amount of each purine in the saccharified wort was quantitatively analyzed by high performance liquid chromatography under the following conditions. The analysis results are shown in Fig.24 It can be seen that even when the present nucleosidase is saccharified at pH 4.5 to 5.5, the ratio of free purine bases is 90% or more, purine nucleosides are sufficiently reduced, and purine bases are increased ( Fig.24 ).

[0234] <HPLC conditions>

[0235] Column: Asahipak GS-220HQ

[0236] Mobile phase: 150 mM sodium phosphate buffer (pH 2.5)

[0237] Temperature: 35℃

[0238] Flow rate: 0.5mL / min

[0239] Detection: 260nm

[0240] 8. Summary

[0241] Nucleosidase from Penicillium multicolor IFO 7569 strain demonstrates the optimum temperature and temperature stability that are suitable for adopting in the feeding process of beer. In addition, it is found that pH stability and temperature stability are excellent, and it is not limited to the manufacture of beer or beer-like beverages, and can also be used for various purposes. In this way, a novel nucleosidase that is extremely useful to reducing the purine bodies in the beverage and food is successfully obtained.

[0242] <Example 2> Preparation of nucleoside enzyme agent

[0243] The variant of Penicillium multicolor IFO 7569 was inoculated into 100 mL of the following culture medium B and cultured in a 500 mL Sakaguchi flask at 27° C. with shaking for 48 to 72 hours. The pre-culture solution was transferred to 2 L of the following culture medium B and cultured at 27° C. with aeration and stirring for 190 to 240 hours. The culture solution was filtered through diatomaceous earth to remove the bacterial cells, and the obtained culture supernatant was concentrated using an ultrafiltration membrane to obtain a nucleoside enzyme solution. It should be noted that three variants with different guanine deaminase production capabilities were used to prepare nucleoside enzyme solutions (samples 1 to 3).

[0244] <Cultivation medium A>

[0245] 1% Lustergen FK (Nidian Chemical)

[0246] 1% yeast extract (Difco)

[0247] 0.5% NaCl

[0248] pH7.0

[0249] <Cultivation medium B>

[0250] 1% Lustergen FK (Nidian Chemical)

[0251] 1% yeast extract (Difco)

[0252] 2% corn flour (Matsumoto Nohsan)

[0253] 0.5% NaCl

[0254] pH 6.5

[0255] <Example 3> Xanthine production test

[0256] 0.1 ml of 1 mM guanine solution dissolved in 50 mM hydrochloric acid was added to 0.8 ml of 150 mM sodium acetate buffer (pH 4.3) to prepare substrate solution. 0.1 ml of enzyme solution (samples 1 to 3) of each nucleosidase diluted with purified water in a manner such that the nucleosidase activity becomes 500 u / g was added to 0.9 ml of substrate solution and reacted at 52°C. After 1 hour, 0.1 ml of the reaction solution was sampled. After the enzyme reaction was stopped by boiling for 10 minutes, it was diluted 2 times with purified water and passed through a 0.45 μm membrane filter. The solution after the filter treatment was supplied to HPLC to quantify the amount of xanthine generated.

[0257] (HPLC analysis conditions)

[0258] Column: Asahipak GS220-HQ No.M211036

[0259] Solvent: 150 mM sodium dihydrogen phosphate pH 2.5

[0260] Flow rate: 0.5ml / min

[0261] Column temperature: 35°C

[0262] Injection volume: 10 μL

[0263] Detection: 260nm

[0264] Analysis time: 60 minutes

[0265] The amount of enzyme that converts 1 pmol of guanine into xanthine in 1 minute was defined as 1 U, and the guanine deaminase activity of the nucleosidase enzyme solution was calculated by the following formula.

[0266] Guanine deaminase activity (u / ml) = xanthine production after 60 minutes of reaction (μmol / ml) × 1 / 60 × 1000000

[0267] On the other hand, the nucleosidase activity of each nucleosidase enzyme solution (samples 1 to 3) was determined by the method described in "(3) Determination of nucleosidase activity" of Example 1, and the guanine deaminase activity relative to the nucleosidase activity (u / u) was calculated (Table 1).

[0268] [Table 1]

[0269] [Table 1]

[0270] Comparison of guanine deaminase activity

[0271]

[0272] <Example 4> Saccharification test

[0273] The enzyme solution of nucleosidase of Example 2 (samples 1 to 3) was used to perform a saccharification test and analyze the assimilable purine composition ratio. 80 g of ground malt, 320 mL of water and 2400 U of nucleosidase were added, and the pH of the initial (52°C) and 60°C steps was adjusted to pH 4.5 to perform a saccharification test and prepare wort. The reaction process is shown in Fig.23 The amount of each purine in the saccharified wort was quantitatively analyzed by high performance liquid chromatography under the following conditions.

[0274] <HPLC conditions>

[0275] Column: Asahipak GS-220HQ

[0276] Mobile phase: 150 mM sodium phosphate buffer (pH 2.5)

[0277] Temperature: 35℃

[0278] Flow rate: 0.5mL / min

[0279] Detection: 260nm

[0280] The assimilatory purine composition ratio of each nucleosidase enzyme solution was calculated by the following formula and compared (Table 2). It should be noted that the assimilatory purine composition ratio is the ratio of assimilatory purines (adenine, guanine) to non-assimilatory purines (adenosine, guanosine, inosine, xanthine, xanthine, hypoxanthine).

[0281] Anabolic purine composition ratio (%) = anabolic purine amount / (anabolic purine amount + non-anabolic purine amount) × 100

[0282] [Table 2]

[0283] [Table 2]

[0284]

[0285] According to the above experimental results, the relationship between guanine deaminase activity and assimilable purine composition ratio relative to nucleosidase activity is as follows Fig.25 Therefore, it was confirmed that since the assimilatory purine constituent ratio was 90% or more, the guanine deaminase activity relative to the nucleosidase activity was 0.4 (U / U) or less, and a nucleosidase enzyme solution satisfying this condition was obtained (sample 1).

[0286] Industrial Applicability

[0287] The nucleosidase of the present invention has low guanine deaminase activity and is useful for producing low-purine beer / beer-like beverages. In addition to low-purine beer / beer-like beverages, the present invention can also be used in the production of various low-purine foods or beverages.

[0288] The present invention is not limited to the embodiments and examples of the invention described above. Various modifications that can be easily thought of by a person skilled in the art are also included in the present invention without departing from the description of the claims. The contents of papers, patent publications, patent publications, etc. explicitly mentioned in this specification are cited in their entirety by reference. Sequence Listing <110> AMANO ENZYME PRODUCTS CO., LTD. Suntory Holdings Co., Ltd. <120> Nucleoside enzymes with reduced activity <130> AE17006P <150> JP P2018-022542 <151> 2018-02-09 <160> twenty four <170> PatentIn version 3.5 <210> 1 <211> 424 <212> PRT <213> Penicillium multicolor <400> 1 Met Ala Pro Lys Lys Ile Ile Ile Asp Thr Asp Pro Gly Ile Asp Asp 1 5 10 15 Ile Leu Ala Leu Leu Leu Ala Leu Ser Ser Lys Pro Glu Asp Val Glu 20 25 30 Ile Leu Leu Ile Ser Leu Thr Phe Gly Asn Ile Glu Val Lys Asn Cys 35 40 45 Leu Arg Asn Val Val Ser Met Phe His Ile Leu Glu Arg Glu Ile Gln 50 55 60 Trp Arg Arg Gly Asn Gly Lys Ser Glu Gly Tyr Gly Thr Met Arg Ala 65 70 75 80 Phe Arg Pro Val Val Ala Val Gly Ala Glu Asp Pro Leu Glu Asp Gln 85 90 95 Lys Met Leu Ala Asp Tyr Phe His Gly Thr Asp Gly Leu Gly Gly Ile 100 105 110 His Ala Ser His Pro His Leu Thr Pro Ser Lys Ala Trp Glu His Leu 115 120 125 Phe Thr Pro Ala Val Asp Pro Gln Gly Ile Glu Pro Val Gln Thr Gly 130 135 140 Ala Gly Pro Gly Asp His Ser Phe Ile Pro Ser Arg Leu Pro Ala His 145 150 155 160 Lys Glu Ile Leu Arg Ala Leu Arg Gln Asn Glu Pro Asp Thr Val Thr 165 170 175 Leu Val Ala Val Gly Pro Leu Thr Asn Leu Ala Leu Ala Ala Ala Glu 180 185 190 Asp Pro Glu Thr Phe Leu Arg Val Lys Glu Val Val Val Met Gly Gly 195 200 205 Ala Ile Asn Gln Pro Gly Asn Val Thr Pro Val Gly Glu Phe Asn Ala 210 215 220 Tyr Ala Asp Ala Val Ala Ala Ala Arg Val Phe Ala Leu Thr Ser Pro 225 230 235 240 Asn Pro Asn Ser Thr Leu Pro Pro Thr Thr Ser Pro Leu Leu Gly Leu 245 250 255 Tyr Pro Ala Lys Leu Ser Arg Gln Leu Thr Leu Arg Leu Phe Pro Leu 260 265 270 Asp Ile Thr Leu Arg His Asn Leu Ser Arg Gly Gln Phe Arg Gln Ala 275 280 285 Val Glu Pro Leu Leu Ala Thr Gly Ser Pro Leu Ala Glu Trp Val Thr 290 295 300 Ala Phe Met Gly His Thr Phe Arg Thr Leu Glu Arg Leu His Pro Gly 305 310 315 320 His Glu Gly Asp Glu Ala Gln Leu Ser Leu His Asp Pro Val Cys Val 325 330 335 Trp Tyr Ala Leu Thr Ala Glu Asp Ser His Trp Thr Pro Ser Ala Asn 340 345 350 Ser Pro Glu Asp Ile Arg Val Glu Thr Leu Gly Gln Trp Thr Arg Gly 355 360 365 Met Cys Val Ile Asp Gly Arg Asn Arg His Lys Ile Asp Gly Asp Glu 370 375 380 Glu Ser Ser Ser Asp His Gly Leu Trp Leu Ser Ala Arg Ala Gly Asn 385 390 395 400 Arg Ile Leu Arg Met Asp Gly Ser Pro Ala Glu His Thr Phe Gly Lys 405 410 415 Ile Leu Ile Asp Arg Ile Phe His 420 <210> 2 <211> 380 <212> PRT <213> Penicillium multicolor <400> 2 Met His Phe Pro Val Ser Leu Pro Leu Leu Cys Gly Ser Leu Leu Pro 1 5 10 15 Leu Ile Thr Gly Thr Leu Ala Val Pro Lys Ala Ser Arg Ala Asp Lys 20 25 30 His Tyr Ala Ile Met Asp Asn Asp Trp Tyr Thr Ala Gly Phe Val Pro 35 40 45 Tyr Leu Ile Ala Leu Asp Gly Asp Val Glu Val Leu Gly Leu Ala Ser 50 55 60 Asp Thr Ala Asn Thr Trp Gln Pro Gln Val Ala Leu His Ala Val Ala 65 70 75 80 Thr Leu Glu Ala Gly Asn Leu Ser Cys Ile Pro Val Tyr Pro Gly Ser 85 90 95 Thr Trp Pro Leu Ile Asn Thr Pro Asn Arg Phe Gln Ala Trp Glu Met 100 105 110 Val His Gly Lys Leu Pro Trp Glu Gly Ala Phe Ala Pro Glu Asn Lys 115 120 125 Thr Leu Glu Ala Glu Gly Asn Asp Pro Thr Ser Gly Asn Pro Asn Arg 130 135 140 Ile Val Lys Ala Ala Phe Lys Glu Gly Phe Pro Lys Gly Lys Pro Glu 145 150 155 160 Asn Arg Thr Ser Ala Ala Asn Phe Met Val Glu Met Val His Lys Tyr 165 170 175 Pro Gly Gln Val Ser Ile Tyr Ser Ala Gly Ala Leu Thr Asn Val Ala 180 185 190 Leu Ala Val Arg Met Asp Pro Gln Phe Ala Ser Leu Ala Lys Glu Leu 195 200 205 Val Ile Met Gly Gly Tyr Val Asp Leu Asn Met Leu Gln Ala Thr Gly 210 215 220 Ser Val Leu Leu Ala Asp Leu Gln Ser Asp Ile Asn Leu Met Ile Asp 225 230 235 240 Pro Glu Ala Ser Lys Ile Ala Leu Thr Ala Glu Phe Pro Asn Ile Thr 245 250 255 Ile Ala Gly Asn Val Ala Asn Gln Val Phe Pro Thr Lys Glu Phe Val 260 265 270 Asp Glu Ile Ala Ser Val Pro Asn Pro Tyr Ser Lys Leu Phe His Asp 275 280 285 Tyr Tyr Asp Leu Ser Phe Pro Phe Trp Asp Glu Thr Ala Ala Ala Leu 290 295 300 Met Val Asp Pro Thr Leu Ala Thr Asn Gln Thr Ser Val Phe Leu Asp 305 310 315 320 Val Asp Thr Ala Tyr Gly Ser Pro Asn Tyr Gly Asn Ile His Val Tyr 325 330 335 Gln Lys Ala Leu Ala Pro Val Gly Ile Arg Glu Val Asn Phe Val Phe 340 345 350 Gln Val Asp Gly Asp Arg Leu Lys Gln Arg Ile Lys His Ser Leu Gln 355 360 365 Tyr Pro Lys Ser Cys Ala Asp Leu Arg Asn Glu Arg 370 375 380 <210> 3 <211> 1275 <212> DNA <213> Penicillium multicolor <400> 3 atggcaccta agaaaatcat cattgacact gacccgggta tcgatgacat cctggcactg 60 ctgctggctc tgtcatctaa gccagaggat gttgagattc tacttatctc tttaacattt 120 ggaaacattg aggtgaagaa ctgtcttcga aatgtggtct ccatgtttca tatcctcgag 180 cgcgagatcc agtggcgtcg tggtaacggc aagtccgaag gctatggcac tatgcgtgct 240 ttccgcccag tagtagccgt gggagcggaa gatcccttgg aagaccagaa gatgctcgct 300 gattatttcc atggaaccga tggccttggt ggcatccatg ctagtcaccc acatctcact 360 ccaagcaagg cctgggagca tctattcacc ccggccgtgg atccccaggg gatcgagcct 420 gtgcaaacgg gagctggtcc cggcgaccat tcctttatcc catcaagact acctgcacac 480 aaggagattc ttcgtgcact gcgccagaat gagcctgaca ccgtgactct cgtggcggtt 540 ggtccactga ccaacttggc cttggcagca gcagaggatc ccgaaacctt cctacgtgtc 600 aaggaggtcg ttgtgatggg tggagcaatc aaccagcctg gaaatgtcac ccccgttgga 660 gaattcaacg cctacgcaga cgccgttgca gctgcgcgag tctttgcgct gacatcacct 720 aatcccaact cgactctacc accgaccacg agtccactac ttggcctgta ccctgcaaag 780 ctcagccgac aattgactct gcgtctcttc ccgctggaca tcaccctgcg ccataacctg 840 tcccgcggcc aattccgcca agcagttgag cctctcctcg caacaggctc acccctcgct 900 gaatgggtga cagcattcat gggacacacg ttccgaaccc tggaacgcct gcaccccggc 960 catgagggcg atgaagccca gctgagtctc cacgaccctg tctgtgtgtg gtatgccctt 1020 acagcagagg attcgcactg gactccctcc gccaattccc cagaggacat tcgtgttgag 1080 acattgggcc agtggacgcg tggtatgtgc gtaatcgatg gccgaaaccg ccataagatt 1140 gatggcgacg aggaaagctc gagtgatcat ggtctgtggt tgagtgctcg tgcaggaaac 1200 cgcattttgc gaatggatgg atcgccagcc gaacacacgt tcggcaagat cctcatcgat 1260 agaatcttcc actaa 1275 <210> 4 <211> 1016 <212> DNA <213> Penicillium multicolor <400> 4 gtacccattt tctaacacta tctggacagc acccacatct cactccaagc aaggcctggg 60 agcatctatt caccccggcc gtggatcccc aggggatcga gcctgtgcaa acgggagctg 120 gtcccggcga ccattccttt atcccatcaa gactacctgc acacaaggag attcttcgtg 180 cactgcgcca gaatgagcct gacaccgtga ctctcgtggc ggttggtcca ctgaccaact 240 tggccttggc agcagcagag gatcccgaaa ccttcctacg tgtcaaggag gtcgttgtga 300 tgggtggagc aatcaaccag cctggaaatg tatgaacccc gtcgaaacac ccatttgata 360 ataagtcatt aaccgcgatt gactaggtca cccccgttgg agaattcaac gcctacgcag 420 acgccgttgc agctgcgcga gtctttgcgc tgacatcacc taatcccaac tcgactctac 480 caccgaccac gagtccacta cttggcctgt accctgcaaa gctcagccga caattgactc 540 tgcgtctctt cccgctggac atcaccctgc gccataacct gtcccgcggc caattccgcc 600 aagcagttga gcctctcctc gcaacaggct cacccctcgc tgaatgggtg acagcattca 660 tgggacacac gttccgaacc ctggaacgcc tgcaccccgg ccatgagggc gatgaagccc 720 agctgagtct ccacgaccct gtctgtgtgt ggtatgccct tacagcagag gattcgcact 780 ggactccctc cgccaattcc ccagaggaca ttcgtgttga gacattgggc cagtggacgc 840 gtggtatgtg cgtaatcgat ggccgaaacc gccataagat tgatggcgac gaggaaagct 900 cgagtgatca tggtctgtgg ttgagtgctc gtgcaggaaa ccgcattttg cgaatggatg 960 gatcgccagc cgaacacacg ttcggcaaga tcctcatcga tagaatcttc cactaa 1016 <210> 5 <211> 1143 <212> DNA <213> Penicillium multicolor <400> 5 atgcatttcc ctgtttcatt gccgctgttg tgcggctctt tgctgcctct catcaccggc 60 accctggcag tgcccaaggc ctcgcgtgcc gacaagcact atgccatcat ggacaatgat 120 tggtacacag cgggtttcgt gccttacctg atcgccctcg atggcgatgt ggaggttctg 180 ggcctagcct ctgacaccgc aaacacctgg cagcctcagg tcgctctgca cgctgtcgca 240 actctggaag ctggcaactt gagctgtatc cccgtttacc caggctcgac atggccgctc 300 atcaacaccc ccaaccgctt ccaggcgtgg gaaatggttc atggcaagct gccatgggag 360 ggtgcttttg cgccggagaa caagactctc gaggccgagg gtaacgatcc tacctctggc 420 aaccccaacc gtatcgtcaa ggccgctttc aaggaagggt tccccaaggg caagcccgag 480 aacagaacat ctgctgccaa cttcatggtc gagatggtgc acaagtaccc cggccaggtc 540 tcgatctact ctgctggagc cctgaccaat gttgcgctgg ctgtgcgcat ggatccccag 600 tttgcatctc tggctaagga gttggttatc atgggtggat acgtcgattt gaatatgctc 660 caggccactg gaagtgtctt gctggctgat cttcaatctg atatcaactt gatgattgat 720 cccgaggcct ccaagatcgc attgactgcc gaattcccca atatcaccat cgccggtaac 780 gtcgccaacc aggtctttcc taccaaggag ttcgtcgacg agatcgcctc cgttccaaac 840 ccctacagca agctcttcca cgactactac gatctgtcct tccccttctg ggatgagacg 900 gctgccgcgc tgatggttga ccctactctt gctaccaacc agacctctgt cttcctcgac 960 gtggataccg cttatggtag ccccaactat ggtaacattc acgtttacca gaaggctctt 1020 gcccctgttg gtatccggga ggtcaacttt gtcttccagg ttgatgggga tagacttaag 1080 cagcgcatca agcactctct gcagtacccc aagtcatgcg ccgacctgag aaatgagcgt 1140 tga 1143 <210> 6 <211> 847 <212> DNA <213> Penicillium multicolor <400> 6 acgatcctac ctctggcaac cccaaccgta tcgtcaaggc cgctttcaag gaagggttcc 60 ccaagggcaa gcccgagaac agaacatctg ctgccaactt catggtcgag atggtgcaca 120 agtaccccgg ccaggtctcg atctactctg ctggagccct gaccaatgtt gcgctggctg 180 tgcgcatgga tccccagttt gcatctctgg ctaaggagtt ggttatcatg ggtggatacg 240 tcgatttgaa tatgctccag gccactggaa gtgtcttgct ggctgatctt caatctgatg 300 tatgtttcat tcccggcttc tatcagctgt gttcatctgc taacttctct ttagatcaac 360 ttgatgattg atcccgaggc ctccaagatc gcattgactg ccgaattccc caatatcacc 420 atcgccggta acgtcgccaa ccaggtcttt cctaccaagg agttcgtcga cgagatcgcc 480 tccgttccaa acccctacag caagctcttc cacgactact acgatctgtc cttccccttc 540 tgggatgaga cggctgccgc gctgatggtt gaccctactc ttgctaccaa ccagacctct 600 ggtgagttta atctcgcatt gacacttgta tgaacaaatc taacagctta tagtcttcct 660 cgacgtggat accgcttatg gtagccccaa ctatggtaac attcacgttt accagaacgc 720 tcttgcccct gttggtatcc gggaggtcaa ctttgtcttc caggttgatg gggatagact 780 taagcagcgc atcaagcact ctctgcagta ccccaagtca tgcgccgacc tgagaaatga 840 gcgttga 847 <210> 7 <211> 15 <212> PRT <213> Penicillium multicolor <400> 7 Ala Asp Lys His Tyr Ala Ile Met Asp Asn Asp Trp Tyr Thr Ala 1 5 10 15 <210> 8 <211> 15 <212> PRT <213> Penicillium multicolor <400> 8 Ala Asp Lys His Tyr Ala Ile Met Asp Asn Asp Trp Tyr Thr Ala 1 5 10 15 <210> 9 <211> 9 <212> PRT <213> Penicillium multicolor <400> 9 Val Glu Thr Lys Leu Ile Phe Leu Thr 1 5 <210> 10 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Primer <220> <221> misc_feature <222> (3)..(3) <223> Inosine <220> <221> misc_feature <222> (6)..(6) <223> g or a <220> <221> misc_feature <222> (9)..(9) <223> t or c <220> <221> misc_feature <222> (10)..(10) <223> a or c <220> <221> misc_feature <222> (12)..(12) <223> any of a, g, c, or t <220> <221> misc_feature <222> (15)..(15) <223> t or c <220> <221> misc_feature <222> (16)..(16) <223> t or c <220> <221> misc_feature <222> (18)..(18) <223> Inosine <400> 10 acnaartaym gnttyytnac 20 <210> 11 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Primer <220> <221> misc_feature <222> (4)..(4) <223> any of a, g, c, or t <220> <221> misc_feature <222> (7)..(7) <223> any of a, g, c, or t <220> <221> misc_feature <222> (9)..(9) <223> g or t <220> <221> misc_feature <222> (10)..(10) <223> any of a, g, c, or t <220> <221> misc_feature <222> (16)..(16) <223> t or c <220> <221> misc_feature <222> (19)..(19) <223> any of a, g, c, or t <400> 11 catnccnckn gtccaytgnc c 21 <210> 12 <211> 26 <212> DNA <213> Artificial sequence <220> <223> Primer <220> <221> misc_feature <222> (3)..(3) <223> any of a, g, c, or t <220> <221> misc_feature <222> (6)..(6) <223> a, c, or t <220> <221> misc_feature <222> (12)..(12) <223> t or c <220> <221> misc_feature <222> (15)..(15) <223> t or c <220> <221> misc_feature <222> (18)..(18) <223> t or c <220> <221> misc_feature <222> (24)..(24) <223> t or c <400> 12 gcnathatgg ayaaygaytg gtayac 26 <210> 13 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Primer <220> <221> misc_feature <222> (3)..(3) <223> any of a, g, c, or t <220> <221> misc_feature <222> (6)..(6) <223> any of a, g, c, or t <220> <221> misc_feature <222> (9)..(9) <223> t or c <220> <221> misc_feature <222> (12)..(12) <223> g or a <220> <221> misc_feature <222> (18) <223> g or a <220> <221> misc_feature <222> (21)..(21) <223> any of a, g, c, or t <400> 13 gcngcngtyt crtcccaraa ngg 23 <210> 14 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 14 atggcaccta agaaaatcat cattg 25 <210> 15 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 15 ttagtggaag attctatcga tgagg 25 <210> 16 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Primer <400> 16 atgcatttcc ctgtttcatt gccgc 25 <210> 17 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 17 tcaacgctca tttctcaggt cgg 23 <210> 18 <211> 574 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 18 gaggatcccg aaaccttcct acgtgtcaag gaggtcgttg tgatgggtgg agcaatcaac 60 cagcctggaa atgtatgaac cccgtcgaaa cacccatttg ataataagtc attaaccgcg 120 attgactagg tcacccccgt tggagaattc aacgcctacg cagacgccgt tgcagctgcg 180 cgagtctttg cgctgacatc acctaatccc aactcgactc taccaccgac cacgagtcca 240 ctacttggcc tgtaccctgc aaagctcagc cgacaattga ctctgcgtct cttcccgctg 300 gacatcaccc tgcgccataa cctgtcccgc ggccaattcc gccaagcagt tgagcctctc 360 ctcgcaacag gctcacccct cgctgaatgg gtgacagcat tcatgggaca cacgttccga 420 accctggaac gcctgcaccc cggccatgag ggcgatgaag cccagctgag tctccacgac 480 cctgtctgtg tgtggtatgc ccttacagca gaggattcgc actggactcc ctccgccaat 540 tccccagagg acattcgtgt tgagacattg ggcc 574 <210> 19 <211> 509 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 19 agacaccgca aacacctggc agcctcaggt cgctctgcac gctgtcgcaa ctctggaagc 60 tggcaacttg agctgtatcc ccgtttaccc aggctcgaca tggccgctca tcaacacccc 120 caaccgcttc caggcgtggg aaatggttca tggcaagctg ccatgggagg gtgcttttgc 180 gccggagaac aagactctcg aggccgaggg taacgatcct acctctggca accccaaccg 240 tatcgtcaag gccgctttca aggaagggtt ccccaagggc aagcccgaga acagaacatc 300 tgctgccaac ttcatggtcg agatggtgca caagtacccc ggccaggtct cgatctactc 360 tgctggagcc ctgaccaatg ttgcgctggc tgtgcgcatg gatccccagt ttgcatctct 420 ggctaaggag ttggttatca tgggtggata cgtcgatttg aatatgctcc aggccactgg 480 aagtgtcttg ctggctgatc ttcaatctg 509 <210> 20 <211> 9 <212> PRT <213> Penicillium multicolor <400> 20 Val Glu Ile Leu Leu Ile Ser Leu Thr 1 5 <210> 21 <211> 394 <212> PRT <213> Penicillium multicolor <400> 21 Val Glu Ile Leu Leu Ile Ser Leu Thr Phe Gly Asn Ile Glu Val Lys 1 5 10 15 Asn Cys Leu Arg Asn Val Val Ser Met Phe His Ile Leu Glu Arg Glu 20 25 30 Ile Gln Trp Arg Arg Gly Asn Gly Lys Ser Glu Gly Tyr Gly Thr Met 35 40 45 Arg Ala Phe Arg Pro Val Val Ala Val Gly Ala Glu Asp Pro Leu Glu 50 55 60 Asp Gln Lys Met Leu Ala Asp Tyr Phe His Gly Thr Asp Gly Leu Gly 65 70 75 80 Gly Ile His Ala Ser His Pro His Leu Thr Pro Ser Lys Ala Trp Glu 85 90 95 His Leu Phe Thr Pro Ala Val Asp Pro Gln Gly Ile Glu Pro Val Gln 100 105 110 Thr Gly Ala Gly Pro Gly Asp His Ser Phe Ile Pro Ser Arg Leu Pro 115 120 125 Ala His Lys Glu Ile Leu Arg Ala Leu Arg Gln Asn Glu Pro Asp Thr 130 135 140 Val Thr Leu Val Ala Val Gly Pro Leu Thr Asn Leu Ala Leu Ala Ala 145 150 155 160 Ala Glu Asp Pro Glu Thr Phe Leu Arg Val Lys Glu Val Val Val Met 165 170 175 Gly Gly Ala Ile Asn Gln Pro Gly Asn Val Thr Pro Val Gly Glu Phe 180 185 190 Asn Ala Tyr Ala Asp Ala Val Ala Ala Ala Arg Val Phe Ala Leu Thr 195 200 205 Ser Pro Asn Pro Asn Ser Thr Leu Pro Pro Thr Thr Ser Pro Leu Leu 210 215 220 Gly Leu Tyr Pro Ala Lys Leu Ser Arg Gln Leu Thr Leu Arg Leu Phe 225 230 235 240 Pro Leu Asp Ile Thr Leu Arg His Asn Leu Ser Arg Gly Gln Phe Arg 245 250 255 Gln Ala Val Glu Pro Leu Leu Ala Thr Gly Ser Pro Leu Ala Glu Trp 260 265 270 Val Thr Ala Phe Met Gly His Thr Phe Arg Thr Leu Glu Arg Leu His 275 280 285 Pro Gly His Glu Gly Asp Glu Ala Gln Leu Ser Leu His Asp Pro Val 290 295 300 Cys Val Trp Tyr Ala Leu Thr Ala Glu Asp Ser His Trp Thr Pro Ser 305 310 315 320 Ala Asn Ser Pro Glu Asp Ile Arg Val Glu Thr Leu Gly Gln Trp Thr 325 330 335 Arg Gly Met Cys Val Ile Asp Gly Arg Asn Arg His Lys Ile Asp Gly 340 345 350 Asp Glu Glu Ser Ser Ser Asp His Gly Leu Trp Leu Ser Ala Arg Ala 355 360 365 Gly Asn Arg Ile Leu Arg Met Asp Gly Ser Pro Ala Glu His Thr Phe 370 375 380 Gly Lys Ile Leu Ile Asp Arg Ile Phe His 385 390 <210> 22 <211> 351 <212> PRT <213> Penicillium multicolor <400> 22 Ala Asp Lys His Tyr Ala Ile Met Asp Asn Asp Trp Tyr Thr Ala Gly 1 5 10 15 Phe Val Pro Tyr Leu Ile Ala Leu Asp Gly Asp Val Glu Val Leu Gly 20 25 30 Leu Ala Ser Asp Thr Ala Asn Thr Trp Gln Pro Gln Val Ala Leu His 35 40 45 Ala Val Ala Thr Leu Glu Ala Gly Asn Leu Ser Cys Ile Pro Val Tyr 50 55 60 Pro Gly Ser Thr Trp Pro Leu Ile Asn Thr Pro Asn Arg Phe Gln Ala 65 70 75 80 Trp Glu Met Val His Gly Lys Leu Pro Trp Glu Gly Ala Phe Ala Pro 85 90 95 Glu Asn Lys Thr Leu Glu Ala Glu Gly Asn Asp Pro Thr Ser Gly Asn 100 105 110 Pro Asn Arg Ile Val Lys Ala Ala Phe Lys Glu Gly Phe Pro Lys Gly 115 120 125 Lys Pro Glu Asn Arg Thr Ser Ala Ala Asn Phe Met Val Glu Met Val 130 135 140 His Lys Tyr Pro Gly Gln Val Ser Ile Tyr Ser Ala Gly Ala Leu Thr 145 150 155 160 Asn Val Ala Leu Ala Val Arg Met Asp Pro Gln Phe Ala Ser Leu Ala 165 170 175 Lys Glu Leu Val Ile Met Gly Gly Tyr Val Asp Leu Asn Met Leu Gln 180 185 190 Ala Thr Gly Ser Val Leu Leu Ala Asp Leu Gln Ser Asp Ile Asn Leu 195 200 205 Met Ile Asp Pro Glu Ala Ser Lys Ile Ala Leu Thr Ala Glu Phe Pro 210 215 220 Asn Ile Thr Ile Ala Gly Asn Val Ala Asn Gln Val Phe Pro Thr Lys 225 230 235 240 Glu Phe Val Asp Glu Ile Ala Ser Val Pro Asn Pro Tyr Ser Lys Leu 245 250 255 Phe His Asp Tyr Tyr Asp Leu Ser Phe Pro Phe Trp Asp Glu Thr Ala 260 265 270 Ala Ala Leu Met Val Asp Pro Thr Leu Ala Thr Asn Gln Thr Ser Val 275 280 285 Phe Leu Asp Val Asp Thr Ala Tyr Gly Ser Pro Asn Tyr Gly Asn Ile 290 295 300 His Val Tyr Gln Lys Ala Leu Ala Pro Val Gly Ile Arg Glu Val Asn 305 310 315 320 Phe Val Phe Gln Val Asp Gly Asp Arg Leu Lys Gln Arg Ile Lys His 325 330 335 Ser Leu Gln Tyr Pro Lys Ser Cys Ala Asp Leu Arg Asn Glu Arg 340 345 350 <210> 23 <211> 1185 <212> DNA <213> Penicillium multicolor <400> 23 gttgagattc tacttatctc tttaacattt ggaaacattg aggtgaagaa ctgtcttcga 60 aatgtggtct ccatgtttca tatcctcgag cgcgagatcc agtggcgtcg tggtaacggc 120 aagtccgaag gctatggcac tatgcgtgct ttccgcccag tagtagccgt gggagcggaa 180 gatcccttgg aagaccagaa gatgctcgct gattatttcc atggaaccga tggccttggt 240 ggcatccatg ctagtcaccc acatctcact ccaagcaagg cctgggagca tctattcacc 300 ccggccgtgg atccccaggg gatcgagcct gtgcaaacgg gagctggtcc cggcgaccat 360 tcctttatcc catcaagact acctgcacac aaggagattc ttcgtgcact gcgccagaat 420 gagcctgaca ccgtgactct cgtggcggtt ggtccactga ccaacttggc cttggcagca 480 cgagaggatc ccgaaacctt cctacgtgtc aaggaggtcg ttgtgatggg tggagcaatc 540 aaccagcctg gaaatgtcac ccccgttgga gaattcaacg cctacgcaga cgccgttgca 600 gctgcgcgag tctttgcgct gacatcacct aatcccaact cgactctacc accgaccacg 660 agtccactac ttggcctgta ccctgcaaag ctcagccgac aattgactct gcgtctcttc 720 ccgctggaca tcaccctgcg ccataacctg tcccgcggcc aattccgcca agcagttgag 780 cctctcctcg caacaggctc acccctcgct gaatgggtga cagcattcat gggacacacg 840 ttccgaaccc tggaacgcct gcaccccggc catgagggcg atgaagccca gctgagtctc 900 cacgaccctg tctgtgtgtg gtatgccctt acagcagagg attcgcactg gactccctcc 960 gccaattccc cagaggacat tcgtgttgag acattgggcc agtggacgcg tggtatgtgc 1020 gtaatcgatg gccgaaaccg ccataagatt gatggcgacg aggaaagctc gagtgatcat 1080 ggtctgtggt tgagtgctcg tgcaggaaac cgcattttgc gaatggatgg atcgccagcc 1140 gaacacacgt tcggcaagat cctcatcgat agaatcttcc actaa 1185 <210> 24 <211> 1056 <212> DNA <213> Penicillium multicolor <400> 24 gccgacaagc actatgccat catggacaat gattggtaca cagcgggttt cgtgccttac 60 ctgatcgccc tcgatggcga tgtggaggtt ctgggcctag cctctgacac cgcaaacacc 120 tggcagcctc aggtcgctct gcacgctgtc gcaactctgg aagctggcaa cttgagctgt 180 atccccgttt acccaggctc gacatggccg ctcatcaaca cccccaaccg cttccaggcg 240 tgggaaatgg ttcatggcaa gctgccatgg gagggtgctt ttgcgccgga gaacaagact 300 ctcgaggccg agggtaacga tcctacctct ggcaacccca accgtatcgt caaggccgct 360 ttcaaggaag ggttccccaa gggcaagccc gagaacagaa catctgctgc caacttcatg 420 gtcgagatgg tgcacaagta ccccggccag gtctcgatct actctgctgg agccctgacc 480 aatgttgcgc tggctgtgcg catggatccc cagtttgcat ctctggctaa ggagttggtt 540 atcatgggtg gatacgtcga tttgaatatg ctccaggcca ctggaagtgt cttgctggct 600 gatcttcaat ctgatatcaa cttgatgatt gatcccgagg cctccaagat cgcattgact 660 gccgaattcc ccaatatcac catcgccggt aacgtcgcca accaggtctt tcctaccaag 720 gagttcgtcg acgagatcgc ctccgttcca aacccctaca gcaagctctt ccacgactac 780 tacgatctgt ccttcccctt ctgggatgag acggctgccg cgctgatggt tgaccctact 840 cttgctacca accagacctc tgtcttcctc gacgtggata ccgcttatgg tagccccaac 900 tatggtaaca ttcacgttta ccagaaggct cttgcccctg ttggtatccg ggaggtcaac 960 tttgtcttcc aggttgatgg ggatagactt aagcagcgca tcaagcactc tctgcagtac 1020 cccaagtcat gcgccgacct gagaaatgag cgttga 1056

Claims

1. A nucleoside enzyme agent, characterized in that A composition comprising a nucleosidase consisting of an amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 21 or SEQ ID NO: 22 as an active ingredient, and guanine deaminase as an inclusion, wherein the guanine deaminase activity relative to the nucleosidase activity, i.e., the activity ratio (U / U) is greater than 0 and is less than 0.

4.

2. The nucleoside enzyme agent according to claim 1, wherein The activity ratio is 0.36 or less.

3. The nucleoside enzyme agent according to claim 1 or 2, wherein The nucleosidase contained has the following enzymatic properties: (1) Action: It catalyzes the hydrolysis of purine nucleosides into D-ribose and purine bases. It also exhibits activity in the presence of adenosine, adenine, inosine, hypoxanthine, guanosine, guanine, and xanthine. (2) Molecular weight: The molecular weight without N-type sugar chains is about 49 kDa, which is the molecular weight measured by SDS-PAGE. (3) Optimum temperature: 55℃~60℃, (4) Temperature stability: Stable below 55°C at pH 6.0 for 30 minutes.

4. The nucleoside enzyme agent according to claim 3, wherein The nucleosidase contained further has the following enzymatic properties: (5) Optimum pH: 3.5, (6) pH stability: Stable in the pH range of 3.5 to 7.5 at 30°C for 30 minutes.

5. The nucleoside enzyme agent according to claim 1 or 2, wherein The nucleosidase contained has the following enzymatic properties: (1) Action: It catalyzes the hydrolysis of purine nucleosides into D-ribose and purine bases. It also exhibits activity in the presence of adenosine, adenine, inosine, hypoxanthine, guanosine, guanine, and xanthine. (2) Molecular weight: The molecular weight without N-type sugar chains is about 40 kDa, which is the molecular weight measured by SDS-PAGE. (3) Optimum temperature: 50℃~55℃, (4) Temperature stability: Stable below 65°C, pH 4.5, for 60 minutes.

6. The nucleoside enzyme agent according to claim 5, wherein The nucleosidase contained further has the following enzymatic properties: (5) Optimum pH: 4.5, (6) pH stability: Stable in the pH range of 3.5 to 7.5 at 30°C for 30 minutes.

7. The nucleoside enzyme agent according to claim 1 or 2, wherein The nucleosidase is from Penicillium multicolor.

8. The nucleoside enzyme agent according to claim 7, wherein The Penicillium multicolor is IFO 7569 strain or its variant strain.

Images