Immunomodulatory small hairpin RNA molecules

Abstract

The present invention generally relates to specific immunomodulatory RNA species having a small hairpin structure (shRNA) and capable of binding to the retinoic acid-inducible gene I receptor (RIG-I). In particular, the RNA species comprises nucleotide insertions to produce a kink in the stem region. Compositions comprising such shRNAs are also contemplated for use as adjuvants in antiviral or anticancer drugs or vaccines.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application refers to and claims the benefit of priority from Singapore Patent Application No. 10201800434S filed on January 17, 2018, which is incorporated herein by reference in its entirety for all purposes under PCT Rule 4.18 including the incorporation of any element or part of the description, claims or drawings not included herein but which is referred to under PCT Rule 20.5(a). Technical Field

[0003] The present invention generally relates to structure-guided RNA design for developing potent immunomodulatory RNA species that activate retinoic acid-inducible gene I receptor (RIG-I), RNA molecules obtained therefrom, compositions containing them, and uses and methods of use thereof. Background Art

[0004] There is an increasing public health need for immunomodulatory molecules with novel mechanisms of action that could be used as antiviral products or vaccine adjuvants. By targeting the host rather than the virus, such molecules could effectively block a broad spectrum of viral infections. Early and ongoing drug development programs mostly target pathogens and their essential enzymes. Molecular targets that modulate the host immune response to infection have been largely overlooked. A key advantage of targeting host molecules is reduced sensitivity to viral adaptive mutations.

[0005] Retinoic acid-inducible gene I (RIG-I)-like receptors (RLRs) are an important class of pattern recognition receptors that sense viral RNA during viral infection. RLRs consist of three members: retinoic acid-inducible gene 1 (RIG-I), melanoma differentiation-associated gene 5 (MDA5), and Laboratory of Genetics and Physiology 2 (LGP2). They play an essential role in sensing viral infection and initiating interferon-mediated antiviral immune responses. RLRs are a common class of pattern recognition receptors (PRRs) that detect viral RNA in the cytoplasm of infected cells and trigger innate immune responses by producing proinflammatory cytokines and type I interferons. RLRs have the ability to distinguish between self and non-self RNA through certain motifs that represent the characteristics of viral replication.

[0006] RIG-I is able to detect RNA produced by viruses because of the presence of triphosphorylated moieties on the RNA strands of replicating viruses, while endogenous RNA is further processed to include a 5' cap (Hornung et al. (2006), Science 314(5801):994-7). Partially complementary terminal sequences present in the origin of replication of ssRNA viruses that fold to form a handle-like structure are also recognized by RIG-I (Schlee et al. (2009), Immunity 31(1):25-34). In addition, RIG-I also recognizes fast-recovery-based pairing structures that interfere with the formation of defective RNA genomes (Strahle et al. (2006), Virology 351(1):101-11). In addition to 5' triphosphate-terminated RNA, RIG-I also recognizes and binds 5' diphosphorylated RNA and capped RNA (Devarkar et al. (2016) Proc. Natl. Acad. Sci. USA 113(3):596-601; Goubau et al. (2014), Nature 514(7522):372-5).

[0007] The core of RLR is a specific DExD / H-box RNA helicase (composed of Hel1, Hel2 and the insertion domain Hel2i) that recognizes the double-stranded RNA backbone. The C-terminal domain (CTD) is a Zn-containing 2+Together, HEL-CTD forms an RNA-sensing module responsible for detecting chemical and structural features of captured RNA species in order to determine whether to allow RLR activation (Kohlway et al. (2013), EMBO Rep [European Molecular Biology Society Reports] 14(9):772-9; Luo et al. (2011), Cell [Cell] 147(2):409-22; Schlee (2013), Immunobiology [Immunobiology] 218:1322-1335). The N-terminal tandem caspase activation and recruitment domains (CARDs) of RIG-I and MDA5 are signaling domains responsible for activating downstream signaling by interacting with and oligomerizing the adaptor protein MAVS (mitochondrial antiviral signaling protein) on the outer mitochondrial membrane (Kawai et al. (2005), Nat Immunol [Natural Immunology] 6:981-988; Meylan et al. (2005) Nature [Nature] 437:1167-1172; Peisley et al. (2014) Nature [Nature] 509:110-114; Seth et al. (2005) Cell [Cell] 122:669-682; Wu et al. (2014), Mol Cell [Molecular Cell] 55:511-523; Xu et al. (2005) Mol Cell [Molecular Cell] 19:727-740). RIG-I and MDA5 recognize different but overlapping RNA virus subgroups. This is related to their RNA recognition preferences. Although RIG-I prefers short duplex RNAs with 5' terminal triphosphates, MDA5 synergistically binds long duplex RNAs without requiring RNA preferences for characteristic ends at the 5' end (Kato et al. (2006), Nature [Nature] 441: 101-105; Loo & Gale (2011), Immunity [Immunity] 34: 680-692; Wu & Chen (2014), Annu Rev Immunol [Annual Review of Immunology] 32: 461-488; Zheng et al. (2015), Nucleic Acids Res Nucleic Acids Res 43:1216-1230; Kowalinski et al. (2011), Cell 147:423-435; Luo et al. (2011), Cell 147:409-422, Wu et al. (2013), Cell 152:276-289).

[0008] In the cytoplasm, RIG-I exists in an autoinhibitory conformation, in which the CARD interacts with the HEL2i domain during the normal state of the cell (Kowalinski et al., supra; Zheng et al., supra). When it encounters pathogenic RNA after viral infection, the protein undergoes conformational rearrangement and ATP hydrolysis occurs. As a result, the N-terminal CARD will be exposed to allow interaction with MAVS (Wu & Chen et al., supra; Wu et al., supra). MAVS will then activate downstream signaling via IRF3, IRF7, and NFκB transcription factors to trigger the production of type I interferon (IFN-I) and proinflammatory cytokines (Seth et al., supra; Peisley et al., supra; Hiscott et al. (2006), Trends Mol Med 12:53-56; Iwanaszko & Kimmel (2015), BMC genomics 16:307; Ramos & Gale (2011), Curr Opin Virol 1:167-176). The CTD of RIG-I recognizes and is activated by 5' triphosphorylated RNAs that are normally produced during viral replication (Hornung et al. (2006), Science 314:994-997). In addition to 5' triphosphorylated RNA, RIG-I also recognizes the terminal 5' diphosphate and cap 0 moieties as non-self RNA (Devarkar et al. (2016) Proc. Natl. Acad. Sci. USA [Proceedings of the National Academy of Sciences of the United States] 113(3):596-601; Goubau et al. (2014), Nature [Nature] 514(7522):372-5). Recent studies have shown that RIG-I has a higher preference for poly U / UC stretches and AU-rich RNA (Runge et al. (2014), PLoS pathogens [Public Library of Science - Pathogens] 10:e1004081; Schnell et al. (2012), PLoS Pathog [Public Library of Science - Pathogens] 8:e1002839). In addition, short RNA hairpins with a minimum length of 10-12 base pairs can bind and activate RIG-I (Kohlway et al., supra; Zheng et al., supra). It has also been reported that short RNA duplexes trigger RIG-I-mediated apoptosis in a cell type and length-dependent manner (Ishibahi et al. (2011), Sci. Signal. 4(198), ra74).

[0009] Given the advanced knowledge of innate immune activation via RIG-I, it is attractive to develop broad-spectrum immunomodulators for antiviral and anticancer therapeutics targeting RIG-I (Elion & Cook (2018), Oncotarget, 2018, Vol. 9, (Issue 48), pp. 29007-29017; Elion et al. (2019), Cancer Research, author manuscript first published online on September 17, 2018; DOI: 10.1158 / 0008-5472; Duewell et al. (2014), Cell Death and Differentiation 21, 1825-1837). Many immunomodulators have been reported as synthetic PAMPs (pathogen-associated molecular patterns) that target the RIG-I-mediated IFN-I production signaling pathway (Yong & Luo (2018), Front Immunol 9: 1379). Among the reported active agents, 5' triphosphorylated short double-stranded RNA is the most potent RIG-I specific ligand (Goubau et al., supra; Hornung et al., supra; Kato et al. (2011), Nature 441:101-105; Schmidt et al. (2009), Proc Natl Acad Sci USA 106:12067-12072). In cell-based assays and animal studies, 5' pppRNA treatment activates RIG-I-mediated antiviral defense signaling pathways and protects cells from infection with a variety of viruses (such as influenza, vesicular stomatitis, dengue fever, and chikungunya viruses) (Chiang et al. (2015), J Virol 89(15):8011-25; Lee et al. (2018), Nucleic Acids Res 46(4):1635-1647). Recent pioneering studies have demonstrated the in vivo activity of these short RNA species (Linehan et al. (2018), Science advances 4: e1701854), where the optimal short stem-loop RNA (SLR) lengths were 10 and 14 bp, with one end being a stable tetraloop and the other end being a 5' ppp blunt-ended base pair. Compared to poly ICs (which are synthetic long duplex RNAs of non-uniform length that are known to broadly activate TLR3, MDA5, and RIG-I), RIG-I-specific ligands such as SLRs have greater IFN-I specificity and can activate new signaling pathways.

[0010] Therefore, in addition to their potential as vaccine adjuvants and antiviral agents, immunomodulatory (immunostimulatory) RNAs can be powerful innate immune activators used in combination with cancer immunotherapy (Moore et al. (2016), Cancer Immunol Res [Cancer Immunology Research] 4, 1061-1071, doi: 10.1158 / 2326-6066), or they can have antitumor activity on their own, similar to other therapies targeting cellular nucleic acid sensors (Junt & Barchet (2015), Nat Rev Immunol [Natural Immunology Review] 15, 529-544).

[0011] Dengue virus (DENV) is an arbovirus that is transmitted to humans by the bites of infected Aedes mosquitoes. DENV is a part of Flaviridae and a member of the genus Flavivirus. The virus family includes other viruses known to pose a health threat to the global population, including yellow fever virus (YFV), West Nile virus (WNV) and Japanese encephalitis virus (JEV). DENV is an enveloped virus that contains a single-stranded positive RNA genome. The viral genome encodes a large polyprotein that is processed into three structural proteins (capsid protein, prM protein and envelope protein) and seven non-structural proteins (NS1, NS2A, NS2B, NS3, NS4A, NS4B and NS5) by viral proteases and host proteases. The spread of DENV involves the transfer of the virus from the saliva of the mosquito in the bite to the dermis of human skin. The outermost epidermal layer contains keratinocytes and Langerhans cells (LC), which are skin-resident antigen-presenting cells (APCs) involved in detecting pathogens that penetrate the skin barrier. The dermis, located beneath the epidermal layer, is composed of fibroblasts and immune cells (including macrophages, T cells, and dendritic cells), and is distributed with blood vessels and lymphatic vessels that enable immune cells to migrate to draining lymph nodes. Antigen-presenting cells (APCs) are the main host cells for DENV infection. Specialized APCs in the skin are particularly important in establishing infection because they are located at the point of viral entry into the host. After DENV infection, viral RNA binds to RIG-I and MDA5 in the cytoplasm of these cells, thereby activating APCs.

[0012] Therefore, specific and potent RNA species capable of modulating RIG-I-mediated immune responses are of great value for the development of new therapeutic agents and useful research tools. Summary of the invention

[0013] The present invention meets this need by providing small hairpin RNA (shRNA) molecules that are capable of modulating RIG-I mediated immune responses and therefore have potential use as therapeutic agents, particularly as adjuvants and antiviral agents, and as research tools.

[0014] Thus, in a first aspect, the present invention relates to a small hairpin RNA (shRNA) molecule having the following structure, in the 5' to 3' direction,

[0015] X1-L-X2,

[0016] in,

[0017] X1 and X2 are each nucleotide sequences of 8 to 30 nucleotides in length and have sufficient complementarity to each other to form a double-stranded stem structure;

[0018] L is the nucleotide sequence that forms the loop region;

[0019] The first nucleotide at the 5' end of X1 is designated as n1 and is diphosphorylated or triphosphorylated, and the last nucleotide at the 3' end of X2 is designated as nx, where x is an integer from 25 to 65;

[0020] The shRNA molecule comprises a nucleotide insertion at position n7 or higher in X1 or at position nx-6 or lower in X2, which remains unpaired in the double-stranded stem structure and generates a kink.

[0021] In these shRNA molecules, L may be a nucleotide sequence of 1 to 10 nucleotides in length, preferably 2 to 4 nucleotides in length.

[0022] In various embodiments of the shRNA molecule, the 5' terminal nucleotide, ie, the first nucleotide of the X1 arm, is triphosphorylated.

[0023] In various embodiments, the shRNA molecule is blunt ended, ie, does not contain 5' or 3' overhangs. It is further preferred that the 5' and 3' terminal nucleotides are base paired with each other such that there are no unpaired nucleotides at the ends of the molecule.

[0024] In various embodiments, X1 and X2 are each a nucleotide sequence of 10 to 25 nucleotides in length, preferably 10, 11, 20, 21, 30 or 31 or 10-20 nucleotides in length, more preferably 10 or 11 nucleotides in length. It may be preferred that X1 and X2 have the same length, not counting nucleotide insertions that create kinks, and are 10, 20 or 30 nucleotides in length, preferably 10 nucleotides.

[0025] In various embodiments, X1 and X2 are fully complementary to each other except for the insertion of a nucleotide that creates a kink.

[0026] Nucleotide insertion can be a nucleotide insertion of 1-2 nucleotides, preferably a nucleotide insertion of a mononucleotide. In certain embodiments, nucleotide insertion is a nucleotide insertion in X1. Nucleotide insertion can be selected from the following positions: positions ranging from n7 to the position directly upstream of the 3' terminal position of X1 (the penultimate position of X1) or from the second position of X2 (the 5' terminal position directly downstream) to nx-6. In its various embodiments, nucleotide insertion can be selected from the following positions: positions ranging from n9 to the position of 2 or 3 nucleotides upstream of the first nucleotide of the loop region, or from the position of 2 or 3 nucleotides downstream of the last nucleotide of the loop region to nx-8. Nucleotide insertion can be preferably in the X1 sequence, preferably at position n9.

[0027] In various embodiments, the nucleotide insertion is a purine or pyrimidine nucleotide, preferably a purine nucleotide selected from G and A.

[0028] The loop region L may comprise or consist of the sequence UUCG.

[0029] In various embodiments, X1 comprises or consists of a nucleotide sequence selected from the group consisting of:

[0030] rrrnnyyyryy (SEQ ID NO: 1);

[0031] sswwwwssrss (SEQ ID NO: 2);

[0032] ggannnnnnnn (SEQ ID NO: 3);

[0033] ggannnnnncc (SEQ ID NO: 4);

[0034] ggannuncncc (SEQ ID NO: 5);

[0035] ggawwuscncc (SEQ ID NO: 6);

[0036] ggauuuccrcc (SEQ ID NO: 7);

[0037] ggauuuccacc (SEQ ID NO: 8); or

[0038] ggauuuccgcc (SEQ ID NO:9),

[0039] wherein r is g or a, y is u or c, w is a or u, s is g or c, and n is a, g, u or c.

[0040] In various embodiments, X2 comprises or consists of a nucleotide sequence selected from the group consisting of:

[0041] rrrrrnnyyy (SEQ ID NO: 10);

[0042] sssswwwwss (SEQ ID NO: 11);

[0043] nnnnnnnucc (SEQ ID NO: 12);

[0044] ggnnnnnucc (SEQ ID NO: 13);

[0045] gggnannucc (SEQ ID NO: 14);

[0046] gggwawwucc (SEQ ID NO: 15);

[0047] ggggaaaucc (SEQ ID NO: 16),

[0048] wherein r is g or a, y is u or c, w is a or u, s is g or c, and n is a, g, u or c.

[0049] In various embodiments, the shRNA molecule comprises or consists of a nucleotide sequence selected from the group consisting of:

[0050] rrrnnyyyryyuucgrrrrrnnyyy (SEQ ID NO: 17);

[0051] sswwwwssrssuucgsssswwwwss(SEQ ID NO:18);

[0052] ggannnnnnnnuucgnnnnnnnnucc(SEQ ID NO:19);

[0053] ggannnnnnccuucgggnnnnnnucc(SEQ ID NO:20);

[0054] ggannuncnccuucggggnannucc (SEQ ID NO:21);

[0055] ggawwuscnccuucggggwawwucc(SEQ ID NO:22);

[0056] ggauuuccnccuucgggggaaaucc (SEQ ID NO: 23);

[0057] ggauuuccrccuucgggggaaaucc (SEQ ID NO: 24);

[0058] ggauuuccaccuucgggggaaaucc (SEQ ID NO:25); or

[0059] ggauuuccgccuucgggggaaaucc (SEQ ID NO: 26),

[0060] wherein r is g or a, y is u or c, w is a or u, s is g or c, and n is a, g, u or c.

[0061] The shRNA molecule preferably binds specifically to human retinoic acid inducible gene 1 receptor (RIG-I).

[0062] In another aspect, the invention relates to a composition comprising at least one shRNA molecule according to the invention. Such a composition may comprise one species of such shRNA, or may comprise a plurality of different shRNA molecules according to the invention.

[0063] The composition may be a pharmaceutical composition, such as an immunostimulatory or antiviral or anticancer composition. The immunostimulatory composition may be a vaccine composition further comprising a vaccine, wherein one or more shRNA molecules are adjuvants. If the composition is an antiviral composition, it may further comprise an additional active antiviral agent. If the composition is an anticancer composition, it may further comprise an additional active anticancer agent. The compositions of the present invention may comprise one or more preferably pharmaceutically acceptable excipients, independently of their use.

[0064] The present invention also includes the use of the shRNA molecules of the present invention as adjuvants or as antiviral agents or as anticancer agents. It is also contemplated that the shRNA molecules of the present invention or the compositions of the present invention are used to stimulate the immune system or treat / prevent viral infections or treat or prevent cancer in a subject in need thereof. The shRNA molecules can be used as adjuvants for active agents or for their own antiviral or anticancer activity.

[0065] Another aspect of the invention features a method for stimulating the immune system in a subject in need, the method comprising administering to the subject an effective amount of an shRNA molecule according to the invention or a composition of the invention. Another method of the invention is for treating or preventing viral infection in a subject in need, the method comprising administering to the subject an effective amount of an shRNA molecule according to the invention or a composition of the invention. Yet another method of the invention is for treating or preventing cancer in a subject in need, the method comprising administering to the subject an effective amount of an shRNA molecule according to the invention or a composition of the invention.

[0066] In yet another aspect, the present invention relates to a method for modifying a small hairpin RNA (shRNA) molecule having the following structure, in the 5' to 3' direction,

[0067] X1-L-X2,

[0068] in,

[0069] X1 and X2 are each nucleotide sequences of 8 to 30 nucleotides in length and have sufficient complementarity to each other to form a double-stranded stem structure;

[0070] L is the nucleotide sequence that forms the loop region;

[0071] The first nucleotide at the 5' end of X1 is designated as n1 and the last nucleotide at the 3' end of X2 is designated as nx, where x is an integer from 25 to 65;

[0072] The method comprises introducing a nucleotide insertion at position n7 or higher in X1 or at position nx-6 or lower in X2, the nucleotide insertion remaining unpaired in the double-stranded stem structure to generate a kink.

[0073] Hereinafter, the present invention will be described in more detail with reference to the accompanying drawings and examples. BRIEF DESCRIPTION OF THE DRAWINGS

[0074] The invention will be better understood with reference to the detailed description when considered in conjunction with the non-limiting examples and accompanying drawings.

[0075] Figure 1 Insertion of guanosine along the 3p10L RNA hairpin backbone (SEQ ID NO: 37) differentially alters RIG-I enzymatic and cellular activity. (A) Design of hairpin RNA that introduces bulges / kinks along the RNA stem. (B) HEK-Lucia TM RIG-I and HEK-Lucia TMCell-based assay of different RNAs in the null. RNA was transfected at a fixed concentration of 100 nM and luminescence was measured 24 hours after transfection. Results were measured in triplicate and expressed in RLU. (C) ATPase activity of the RNA with the highest cell-based assay activity (3p10LG9; SEQ ID NO: 26) and the lowest activity (3p10LG5; SEQ ID NO: 30) compared to the parental strand of the RNA (3p10L; SEQ ID NO: 37). Data were fit to the Michaelis-Menten equation and K m,ATP and K cat,ATP hsRIG-I . The saturation amount is determined.

[0076] Figure 2 Insertion of a purine base at position 9 along the hairpin RNA improves the potency of immRNA3p10L. (A) Design of a hairpin RNA with different bases introduced at position 9 along the stem region of the RNA. (B) HEK-Lucia TM RIG-I and HEK-Lucia TM Cell-based assays of different RNAs in the null. RNA was transfected at a fixed concentration of 100 nM and luminescence was measured 24 hours after transfection. Results were measured in triplicate and expressed in RLU. (C) ATPase activity of RNA with different base insertions at position 9. Data fit the Michaelis-Menten equation and K m,ATP and K cat,ATP The expression of hsRIG-I was determined by the saturation level of RNA.

[0077] Figure 3 . In two different reporter gene cells, 3p10LA9 (SEQ ID NO: 25) showed stronger activity than 3p10LG9 (SEQ ID NO: 26) and 3p10L (SEQ ID NO: 37). (A) RNA was transfected into HEK-Lucia cells at different RNA concentrations. TM RIG-I was added and luminescence was measured 24 hours after transfection. Results were measured in triplicate and expressed as a normalized percentage of maximal activity compared to the logarithmic concentration. 50 is 133 nM, 3p10LA9 is 199 nM, 3p10L is 108 nM, B) RNA was transfected into HEK-Lucia cells at a fixed concentration of 100 nM TM RIG-I and measured luminescence 4, 6, 8, 10, 12, 24, 48 and 72 hours after transfection. C) RNA was transfected into THP1-Dual TM48 h after transfection, and the luminescence was measured. The results were measured in triplicate and expressed as a percentage of the maximum activity compared to the logarithmic concentration. 50 is 91 nM, 3p10LA9 is 51 nM, 3p10L is 226 nM, D) RNA was transfected into THP1-Dual at a fixed concentration of 100 nM TM The cells were plated and luminescence was measured at 4, 6, 8, 10, 12, 24, 48 and 72 hours after transfection.

[0078] Figure 4 .Michaelis-Menten plots showing the ATPase activity of Mus musculus RIG-I (mmRIG-I) and mmRIG-IΔCARD bound to different RNA molecules. (A) Catalytic rate in the ATP concentration range of 0 to 5 mM - for mmRIG-I stimulated by short RNA hairpins with different stem modifications. (B) Catalytic rate in the ATP concentration range of 0 to 5 mM - for mmRIG-I stimulated by RNA hairpins with different base compositions. (C) Catalytic rate in the ATP concentration range of 0 to 5 mM - for mmRIG-I stimulated by RNA hairpins with different lengths.

[0079] Figure 5 .Screening of immRNA constructs that induce type I IFN. A) RIG-I ligand immunomodulatory RNA (immRNA) was transfected into HEK-293T cells containing a stably integrated luciferase reporter gene (MX1P-luc) driven by the MX1 promoter. RNA was transfected with different concentrations obtained by serial dilution (2x), and luminescence was measured 24h after transfection. The results are expressed as the percentage of RLU measured by 312nM treatment of OHYr23 (parental construct; SEQ ID NO: 37). B) HEK293T cells expressing luciferase driven by the MX1 promoter were transfected with 10nM OHYr23. These cells were co-transfected with OHYr10 (SEQ ID NO: 30) or OHYr09 (SEQ ID NO: 34) in a concentration range (0nM-312nM). Cells were lysed with Brightglo and luminescence was read. Error bars are for triplicate transfections / condition.

[0080] Figure 6 Screening for immRNA constructs that induce type I IFN. Transfect immRNA into THP1-Dual TMIn cells, the cells were derived from the human THP-1 monocytic cell line by stable integration of the lucia luciferase reporter gene driven by ISG 54. The luciferase reporter gene response was normalized to 100% and plotted against the logarithmic concentration of RNA. The EC50 value of OHYr05 (SEQ ID NO: 26) was determined to be 3.47 nM, compared to OHYr23 (SEQ ID NO: 37) with an EC50 of 14 nM.

[0081] Figure 7 .HEK-Lucia TM RIG-I and HEK-Lucia TM Cell-based assays under different ImmRNA conditions in the ineffective. A) ImmRNAs of different lengths, B) ImmRNAs with different guanosine insertions. C) ImmRNAs with different nucleotides at position 9. RNAs of different lengths were transfected at a fixed concentration of 100 nM, and luminescence was measured 24 hours after transfection. The results were measured in triplicate and expressed in RLU.

[0082] Figure 8 .In A)THP1-Dual TM cells and B) HEK-Lucia TM Comparison between the activity of commercial RNA and ImmRNA OHYr16 (3p10LA9; SEQ ID NO: 25) in RIG-I. RNA of different concentrations was transfected into both cells and serially diluted 2x. Luminescence values ​​were recorded 24 hours after transfection.

[0083] Fig. 9 .in)THP1-Dual TM cells and B) HEK-Lucia TM Stability test of 1 mmRNA OHYr16 (3p10LA9; SEQ ID NO: 25) and commercially available RNA in RIG-I. RNA was incubated in serum-free medium for 24, 48, 72 and 96 hours before transfection into cells. Luminescence values ​​were measured 24 hours after transfection.

[0084] Fig.10.The position of the kink in the immRNA affects the biological activity. A) Kinks at nucleotide positions 5 (OHYr10), 19 (OHYr11), and 21 (OHYr01) abolish IFN production. % luciferase activity is normalized to the value detected from OHYr23 used at 312 nM. B) A kink on the 5' side of the immRNA at position 9 counted from the stem (OHYr05) increases the biological activity compared to no kink (OHYr23), and a kink on the 3' side of the immRNA at position 9 counted from the stem (OHYr02) abolishes the biological activity. % luciferase activity is normalized to the value detected from OHYr23 used at 100 nM. C) Purines at kink position 9 (guanine in OHYr05 and adenine in OHYr16) have higher biological activity than pyrimidines at kink position 9 (uracil in OHYr17 and cytosine in OHYr18). Directly transfected HEK293T MX1P-luc reporter cells were used as readout in AC.

[0085] Fig.11 .The length of the stem affects the biological activity of immRNA. OHYr23 (length is 10 nucleotides) and OHYr08 (length is 30 nucleotides) have high activity in the HEK293T MX1P-luc reporter gene assay. In contrast, OHYr12 (length is 6 nucleotides), OHYr20 (length is 9 nucleotides), OHYr03 (length is 11 nucleotides), OHYr07 (length is 12 nucleotides) and OHYr13 (length is 14 nucleotides) show low or no biological activity. % Luciferase activity is normalized to the value detected from OHYr23 used at 100 nM. Directly transfected HEK293T MX1P-luc reporter gene cells are used as the readout in AC.

[0086] Fig.12.3p10LG9 (SEQ ID NO: 26) induces interferon response and is effective as a prophylactic for DENV-2 infection in U937-DC-SIGN cells and A549 cells. (A) The structures and sequences of 3p10L (SEQ ID NO: 37) and 3p10LG9 (SEQ ID NO: 26) are shown in the table. (B) 3p10L, 3p10LG9 (SEQ ID NO: 26) or G9neg (SEQ ID NO: 26, without 5' phosphorylation) were transfected into U937-DC-SIGN or A549 cells. The supernatant was collected and incubated on ISRE-luc HEK-293T reporter cells. Luminescence was measured after 6 h of incubation with the supernatant. The EC50 values ​​(nM) of 3p10L (SEQ ID NO: 37) and 3p10LG9 (SEQ ID NO: 26) are shown in the table. (C) Transfected cells were infected with DENV-2 (TSV01) at an MOI of -1 and stained with antibodies that bind to NS1 and E protein (4G2) at 24 h post-infection. The EC50 values ​​(nM) of 3p10L (SEQ ID NO: 37) and 3p10LG9 (SEQ ID NO: 26) are shown in the table. (D) Representative flow cytometry images of infected U937-DC-SIGN cells (left) or A549 cells (right) are shown. For U937-DC experiments: symbols are mean ± SEM, n = 6 (from two independent experiments). For A549 experiments: symbols are mean ± SEM, n = 4 (from two independent experiments). Statistical significance of the luciferase assay and infection assay was calculated using ordinary two-way ANOVA for U937-DC (p=0.013, p<0.0001) and A549 (p=0.0058, p<0.0001) in (B) and (C), respectively.

[0087] Fig.13.3p10LG9 / OHYr05 (SEQ ID NO:26) has a higher efficacy in preventing DENV-2 infection than 3p10L / OHYr23 (SEQ ID NO:37) in primary human skin DCs. (A) Human skin DCs were transfected with 250nM, 125nM and 62nM of 3p10LG9 (SEQ ID NO:26) or 3p10L (SEQ ID NO:37) and incubated for 24h. The supernatant was incubated with HEK-293T cells containing a luciferase reporter gene (ISRE-luc) driven by an interferon-stimulated response element (ISRE-luc), and luminescence was measured after 6h (right figure). The results are shown as fold change compared to G9neg (SEQ ID NO:26, no 5' phosphorylation). Each symbol represents a sample from one donor. Statistical significance (p<0.05) was determined using a two-way ANOVA with Dunnett's multiple comparison test (ns: not significant). (B) Human skin DCs transfected for 24 h with 250 nM, 125 nM, and 62 nM 3p10LG9 (SEQ ID NO: 26) or 3p10L (SEQ ID NO: 37) were infected with DENV-2 at an MOI of 5 for 48 h. The percentage of DENV-2 infected cells in each subset of skin DCs was quantified by intracellular staining with 4G2 antibody using flow cytometry. For each condition, the percentage of infected cells was normalized to G9neg (SEQ ID NO: 26, without 5' phosphorylation). (CE) The percentage of infected cells for each subset of skin DCs obtained from the data plotted in (B) after transfection with 62 nM 3p10LG9 (SEQ ID NO: 26) or 3p10L (SEQ ID NO: 37) (left), and representative flow cytometry (right). (C) CD11c DDCs, (D) Langerhans cells, (E) CD14 DDCs. Each symbol represents one donor. Bars represent mean ± SD. Statistical significance (p < 0.05) was determined using two-way ANOVA with Dunnett's multiple comparison test (*P ≤ 0.05, **P ≤ 0.01, ***P ≤ 0.005).

[0088] Fig.14.immRNA 3p10LG9 has a therapeutic effect against DENV-2 infection in primary human skin DC. (AC) Human skin DC were transfected, infected with DENV2 at MOI 5 and introduced 62nM 3p10L (SEQ ID NO:37), 3p10LG9 (SEQ ID NO:26) or G9neg (SEQ ID NO:26, without 5' phosphorylation) at various time points after infection. The figure showing the percentage of infected cells in each subset of skin DC (left) is reflected by intracellular staining of 4G2 antibody, as shown in the FACS figure (right). For this particular donor, the percentage of infected cells under each condition was normalized to the G9neg control. (A) CD11c dermal DC, (B) Langerhans cells, (C) CD14 dermal DC. Each point represents a sample from one donor. Statistical significance was determined using one-way ANOVA with multiple comparisons (*P≤0.05, **P≤0.01, ***P≤0.005).

[0089] Fig.15 When immRNA was used as an adjuvant for DENV-2 VLP vaccine, it enhanced antibody production and increased protection. 10ug DENV-2 VLP was injected with 25ug immRNA mixed with JET-PEI or poly I:C in vivo and then injected intramuscularly into CD11c-cre-IFNAR fl / fl In mice (Zust et al. (2014), J Virol. 88(13):7276-85). (A) Immunization and challenge schedule for vaccination experiments. (B) From infection 10 6 Viral RNA (vRNA) was extracted from the plasma of DENV-2 VLP-inoculated mice (n=5-9) with pfu of DENV-2. The concentration of vRNA in plasma was determined by Taqman assay. The bars represent mean ± SEM. Statistical significance was determined by Student's t-test (*P≤0.05, **P≤0.01, ****P≤0.0001, ns: not significant). (C) Endpoint titer DENV-2 ELISA, in which plasma was from DENV-2 VLP-inoculated mice bled on days 21 and 28 after inoculation. The bars represent mean ± SEM. Statistical significance was determined by Student's T-test (*P≤0.05, ns: not significant). (D) Survival curves were generated using the Kaplan-Meier method, and the significance of differences was calculated using the log-rank test (ns: not significant). (E) Body weight was measured within 6 days after infection and plotted as % of initial body weight. Mice with more than 20% weight loss were considered moribund and were euthanized. Bars represent mean ± SEM. Statistical significance was determined using two-way ANOVA with multiple comparisons (P = 0.0007).

[0090] Fig.16 .3p10LG9 (SEQ ID NO: 26) increases CD80 expression in primary human skin DC subsets. Primary human skin cells were transfected with 250nM 3p10LG9 or G9neg, or treated with 1000U recombinant human IFNβ as a positive control. After 72h, the mean fluorescence intensity (MFI) of CD80 expression in each subset of skin antigen presenting cells was measured. Lines connect data points from individual donors (n=4). Statistical significance was determined using a paired T test (*P≤0.05).

[0091] Fig.17 . Upregulation of innate immune genes induced by immRNA in human antigen presenting cells. Genes differentially expressed in antigen presenting cells from human skin treated with r05 (SEQ ID NO: 26) compared to the same cells treated with rNEG (SEQ ID NO: 26, without 5' phosphorylation) were analyzed. Data points are from human CD11c + DDC、CD14 + Cells, CD141 + DDC and Langerhans cells. Each symbol represents a single cell. The transcriptome of the cells was sequenced using single-cell RNAseq SMART-seq v2 technology. The data show the top six DEGs when comparing r05 vs rNEG treated cells. The y-axis represents the fold change of gene expression in log2 scale.

[0092] Fig.18.3p10LG9-induced interferon signaling is RIG-I dependent. (A) HEK-293T cells were transfected with 50ng pUNO-hRIG-I or pUNO-hMDA5. These cells were then transfected with 10nM of 3p10LG9, 3p10L or G9neg. The supernatant from these transfected HEK-293T cells was incubated with HEK-293T cells containing an interferon-stimulated response element-driven luciferase reporter gene (ISRE-luc). Luminescence was measured after 6h of incubation with the supernatant. Bars represent mean ± SD. Statistical significance was determined using a one-way ANOVA test with multiple comparisons (*P≤0.05, **P≤0.01, ***P≤0.005). (B) 3p10LG9, 3p10L, G9neg or LMW poly I: C were transfected into RIG-I knocked out U937-DC cells (KO) or parental U937-DC cells (WT). Gene expression analysis of IFNB, DDX58 (RIG-I), MDA5 and RSAD2 (Viperin) mRNA extracted from transfected U937-DC cells: Data are expressed as fold changes compared to the mean of RIG-I WT samples processed by G9neg. Bars show mean ± SD of triplicate transfections, and data are representatives of two independent experiments. Statistical significance was determined using a two-tailed Student's t test (***P≤0.001, ****P≤0.0001).

[0093] Fig.19.3p10LG9's antiviral effect is RIG-I and IFNAR signal-dependent. (A) Supernatants from U937-DC cells transfected with immRNA or poly I:C were incubated with HEK-293T cells containing an interferon-stimulated response element-driven luciferase reporter gene (ISRE-luc). Luminescence was measured after incubation with the supernatant for 6 h. The bars show the mean ± SD of triplicate transfections, and the data are representative of two independent experiments. Statistical significance was determined using a two-tailed Student's t-test (*P≤0.05, **P≤0.01, ***P≤0.001, ****P≤0.0001). (B) U937-DC cells pretreated with immRNA or poly I:C for 24 h were infected with DENV-2TSV01 (MOI-1). 24 h after infection, antibodies targeting NS1 and E-protein fusion loop (4G2) were used to quantify the infected live cells by flow cytometry. The bar shows the mean ± SD of triplicate transfections, and the data are representative of two independent experiments. The statistical significance between the treatment methods in each cell type was determined by a two-tailed Student's t-test (*P≤0.05, ***P≤0.001). (C) Representative FACS images of live U937-DC cells stained with antibodies targeting NS1 and E-protein (4G2). HMW: high molecular weight, LMW: low molecular weight. (D) The antiviral effect of 3p10LG9 is type I interferon dependent. U937-DC SIGN cells were transfected with immRNA, poly I:C or treated with IFNβ (interferon) for 6 hours, followed by the addition of 10ug / mL of anti-IFNAR blocking antibodies or isotype controls. Supernatants were collected after overnight incubation and incubated with HEK-293T cells containing a luciferase reporter gene (ISRE-luc) driven by an interferon-stimulated response element. Luminescence was measured after incubation for 6h with the supernatant. The error bars shown are the mean ± SD of triplicate transfections from two independent experiments. Statistical significance was determined using a two-tailed Student's t test (*P≤0.05, **P≤0.01, ****P≤0.0001). (E) U937-DC cells were infected with DENV-2TSV01 (MOI-1). Live cells infected were quantitatively infected by flow cytometry with antibodies targeting NS1 and E-protein (antibody 4G2) 24h after infection. The error bars represent the mean ± SD of triplicate transfections from two independent experiments. Statistical significance was determined using a two-tailed Student's t test (***P≤0.001, ****P≤0.0001).

[0094] Fig. 20.3p10LG9 is taken up by primary human skin cells. Skin cells were transfected with different concentrations of 3p10LG9 labeled with Alexa-Fluor 647. Cells were analyzed by flow cytometry 24 h after transfection. Statistical significance between different cell types at different concentrations of 3p10LG9-red was calculated using repeated measures two-way ANOVA (p=0.0026), symbols represent mean±SD, n=3.

[0095] Fig.21 .A549 cell viability assay after treatment with immRNA. Quantification of viable cells 24 h after transfection with different concentrations of 3p10LG9 (SEQ ID NO: 26), 3p10LA9 (SEQ ID NO: 25) or 3p10LG9 without 5' triphosphate. Dox (adriamycin) was used as a positive control for cell death. DETAILED DESCRIPTION

[0096] The following specific embodiments mention specific details and embodiments in which the present invention may be practiced by way of illustration. These embodiments are described in sufficient detail to enable those skilled in the art to practice the present invention. Other embodiments may be used, and structural and logical changes may be made without departing from the scope of the present invention. Various embodiments are not necessarily mutually exclusive, as some embodiments may be combined with one or more other embodiments to form new embodiments.

[0097] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art. The singular terms "a", "an", "the" include plural references unless the context clearly indicates otherwise. Similarly, the word "or / or" is intended to include "and / and / and", unless the context clearly indicates otherwise. The term "comprising" means "including". In the event of a conflict, the present specification (including the interpretation of the term) shall prevail.

[0098] The present invention is based on the efforts of the inventors to analyze the effects of structural modifications of short 5' triphosphorylated RNA on RIG-I signaling activation. In these studies, it was found that the introduction of mismatches in the known short hairpin RNA 3p10L (SEQ ID NO: 37) to produce insertions along the RNA stem significantly affected biological activity. The RNA studied is generally designed as a hairpin RNA, wherein a thermodynamically stable UUCG tetraloop is present at one end to ensure that RIG-I binds in a single direction, and thus the kink of the upper and lower strands of RIG-I can be effectively studied.

[0099] Based on the crystallographic data obtained previously, the CTD and HEL1 of RIG-I are proved to form rigid fixation on the first 4 nucleotides of 5' and 3' ends of RNA molecules, and the HEL2i domain and stem region interact with each other from the 5th nucleotide of the upper chain to base 9 (PDB id:4AY2, 5F9H, 3ZD6, 3ZD7 and 5E3H). Observe the HEL2i domain to scan along the stem region of RNA. The relative position of HEL2i has an impact on RIG-I activation, because the CARD domain interacts with the HEL2i domain in the non-activated conformation. Observe that the insertion produced on the stem of RNA has an allosteric effect on the relative movement of the domain, which also affects the robustness of the I type interferon activation via RIG-I. Especially, the insertion of purine at the position 9 of the RNA stem triggers a higher I type interferon response. Conformational dynamics studies by HDX-MS demonstrated that binding of 3p10LG9 (SEQ ID NO: 26) to RIG-I increased CARD exposure compared to the known 3p10L RNA (SEQ ID NO: 37). These findings emphasize that structural modifications of short hairpin RNAs can enhance type I interferon activation via RIG-I.

[0100] Cell-based assays indicate that an insertion introduced at position 9 of the upper strand (3p10LG9) enhances type I interferon activation. Based on a model of 3p10LG9, the addition of the insertion present in 3p10LG9 interacts with the rear surface of the helicase 2i domain of RIG-I. In crystal structures captured with many different RNA ligands and ATP analogs, the HEL2i domain is the most mobile domain and samples the RNA strand. Without wishing to be bound by any particular theory, it is hypothesized that the kink at position 9 may lock the α-helical bundle in HEL2i in an extended conformation and in a position to oust the CARD domain resting on the HEL2i domain. Based on the proposed mechanism of ATPase activity and signaling, RIG-I locked in an activated conformation for a longer period of time would improve the ability to maintain type I interferon production.

[0101] To further verify this hypothesis, HDX-MS was performed to compare regions in RIG-I that undergo faster hydrogen-deuterium exchange. In HDX-MS, more dynamic regions will experience higher deuterium incorporation, while rigid regions will have lower deuterium incorporation. Several regions of the RIG-I protein with higher deuterium incorporation were observed when bound to 3p10LG9 compared to 3p10L. One of the regions showing higher deuterium exchange is the latch peptide (Y103-114) of the CARD domain, which binds to the RIG-I HEL2i domain in an inactive conformation. Therefore, when RIG-I binds to 3p10LG9, the CARD is more exposed and less protected from deuterium incorporation than when RIG-I binds to 3p10L. Another region that shows high protection against deuterium incorporation when bound to 3p10LG9 is motif Ia and motif Ic of the helicase 1 domain. This suggests that 3p10LG9 binds more tightly to the HEL1 domain compared to 3p10L. In addition, the HEL1 domain, the cap loop of the CTD, and the binding site of the CTD to 3p10LG9 also showed lower hydrogen-deuterium exchange, indicating that 3p10LG9 binds more tightly than 3p10L. Although the HEL1 and CTD domains do not directly interact with the CARD domain, the overall tighter binding of HEL1 and CTD to RNA suggests that the helicase domain is compressed as a whole. According to previous biochemical and structural studies, compression of the helicase during ATP binding events brings the CTD domain and CARD domain into close proximity, and the conflict of the domains releases the CARD for downstream signaling events.

[0102] Without wishing to be bound by any particular theory, it is hypothesized from the data obtained that the interaction of a more compacted RIG-I helicase domain with RNA would lead to a more sustained release of the CARD domain due to tighter binding to 3p10LG9.

[0103] The kink created by the insertion of G at position 5 (3p10LG5) of the hairpin RNA abolishes type I interferon activation. Based on the model of 3p10LG5, the kink introduced into 3p10LG5 interacts with the HEL1 domain. HEL1 is primarily involved in RNA binding. The region where the kink interacts with the HEL1 domain is the region that interacts with motif IIa. Based on the structure of SF2 helicase, motif IIa has been shown to interact with RNA and to show structural conservation among members of the DEAD-box family. This motif IIa may be an important motif for forming stable interactions with RNA. As previously observed, mutation of residue Q380 to proline (a key residue in motif IIa in hsRIG-I) abolishes type I interferon activation (Louber et al. (2015), BMC biology 13:54). The kink introduced at position 5 of the upper strand of the hairpin RNA could potentially interfere with the clamping of the HEL1 domain on RNA required for RNA binding and RIG-I activation. The ability of RIG-I to discriminate nucleotides and its preference for certain RNAs with stretches of uracil have been previously reported (Runge et al. (2014), PLoS pathogens 10:e1004081; Schnell et al. (2012), PLoS Pathog 8:e1002839). For different nucleotides at kink position 9, perturbations in the HEL2i domain were more likely to require the presence of larger purines than the smaller side chains of pyrimidines.

[0104] Thus, the inventors demonstrated that structural modifications of the stem RNA can alter the robustness of type I interferon activation. It was found that unlike the introduction of a guanosine insertion at position 5 of the stem (which abolished type I interferon activation), a purine-based insertion at position 9 of the RNA stem enhanced RIG-I activation and type I interferon signaling.

[0105] Based on previous work to determine the minimal RNA ligand required for interferon activation, the inventors made various modifications to the original sequence and tested the ability of these newly designed immunomodulatory RNAs (immRNAs) to activate RIG-I-mediated innate immune responses in host cells. The newly designed candidate immRNAs were found to have a higher potency in activating type I interferon responses than the parental constructs and were used to study their protective effects against DENV infection in human cell lines as well as human skin cell assay models to evaluate their potential as preventive and therapeutic molecules.

[0106] Therefore, the present invention relates to newly discovered small hairpin RNA (shRNA) molecules having the structure X1-L-X2 in the 5' to 3' direction.

[0107] "Small hairpin RNA" or "shRNA" used interchangeably herein refers to small hairpin ribonucleic acid molecules, which are polynucleotides having a sugar-phosphate backbone comprising ribose units and comprising the nucleobases adenine, guanine, uracil and cytosine. According to the IUPAC nomenclature, the corresponding nucleotide units are designated as A, G, U and C herein. In addition, according to the IUPAC nomenclature, the symbols W and S are used for weak interactions (2H bonds), i.e. A / U, and strong interactions (3H bonds), i.e. G / C, respectively, and the symbols Y and R are used for nucleotides with pyrimidine (C and U) and purine (G and A) nucleobases.

[0108] The RNA molecules described herein typically contain up to 80 nucleotides, preferably 21 to 65 nucleotides, and more preferably about 25 nucleotides. Although RNA is usually single-stranded, the self-complementarity of the 5' and 3' ends of the molecule leads to the formation of a secondary structure, commonly referred to as a "hairpin structure", which consists of a stem region of two complementary arms (i.e., a 5' arm and a 3' arm) that are usually connected by a loop structure.

[0109] All nucleotide sequences disclosed herein, if not otherwise indicated, are always presented in the 5' to 3' direction. Similarly, if reference is made to nucleotide positions within a molecule, the positions are always determined by counting nucleotides from the 5' end (the first nucleotide on the 5' end being at position 1).

[0110] Although RNA molecules are generally referenced hereinafter, and all specific molecules disclosed are unmodified (except that all are diphosphorylated or triphosphorylated at the 5' end), it is understood that modified derivatives of these molecules can be provided, wherein, for example, the sugar-phosphate backbone is modified, for example, to improve metabolic stability. Exemplary modifications include, but are not limited to, the use of phosphorothioates instead of the native backbone or 2'-fluorine modifications. Thus, all embodiments disclosed herein relating to unmodified RNA molecules can be similarly practiced with modified RNA molecules, as long as the basic structural determinants described herein are retained.

[0111] The shRNA molecules of the present invention are diphosphorylated or triphosphorylated at the 5' end. This means that the monophosphate group on the 5' carbon of the ribose unit of the 5' terminal nucleotide is replaced by a di- or tri-phosphate group. Therefore, all molecules disclosed herein are diphosphorylated or triphosphorylated at their 5' end with respect to their nucleotide sequence, without specifying this point. Triphosphorylated molecules are particularly preferred.

[0112] In the RNA molecule of the present invention, X1 and X2 are each nucleotide sequences of 8 to 30 nucleotides in length, which have sufficient complementarity to form a double-stranded stem structure. When "complementarity" is mentioned, it refers to typical Watson-Crick base pairing complementarity, i.e., A is complementary to U, and G is complementary to C. Complementarity can be given as a % numerical value, which is calculated by dividing the paired nucleotides of a given single-stranded sequence segment by the total number of nucleotides in the segment x 100. For example, if 9 nucleotides in a 10-nucleotide-long sequence can be paired by Watson-Crick base pairing, the complementarity will be 90%. Therefore, "complete complementarity" refers to that all nucleotides of a given sequence segment can be paired with the corresponding complementary sequence by Watson-Crick base pairing. For molecules of the present invention, this may mean that all nucleotides of X1 can be base paired with all nucleotides of X2, and vice versa.

[0113] The X1 region is the 5' terminal sequence of the shRNA molecule, and is therefore also referred to as the 5' arm herein. Similarly, since the X2 region is the 3' terminal portion, it is also referred to as the 3' arm. The two sequences are covalently linked to each other by the loop region L. The loop region is a nucleotide sequence that forms a loop region of 1 or more unpaired nucleotides that form the paired sequence segments connecting X1 and X2. The length of the loop can be 1 to 10 nucleotides, for example, a length of 2 to 8, 2 to 6, 3 to 5, 2 to 4 or 3 or 4 nucleotides. In various embodiments, the loop region L of the molecule of the present invention comprises or is composed of the following: a sequence YYYR, WWSS, UYYG, YUCR, UUSS, WWCG, UUCS, UUCR, YYCG, YUCG, WUCG or UUCG of 4 nucleotides.

[0114] According to conventional nomenclature, as described above, the first nucleotide at the 5' end of X1 is named n1 and the last nucleotide at the 3' end of X2 is named nx, where x is an integer representing the total number of nucleotides in the RNA molecule. Typically, x is an integer from 25 to 65. Therefore, n1 is the nucleotide at the 5' end, and nx is the nucleotide at the 3' end. According to this nomenclature, n9 represents the nucleotide at position 9 counting from the 5' end, and nx-1 (x minus 1) represents the penultimate nucleotide, i.e. the nucleotide upstream of the 3' terminal nucleotide nx. "Upstream" as used herein refers to being located in the 5' direction relative to a reference nucleotide, and "downstream" as used herein refers to being located in the 3' direction relative to a reference point.

[0115] The shRNA molecules of the present invention are characterized in that they contain nucleotide insertions at positions n7 or higher in X1 or at positions nx-6 or lower in X2, which remain unpaired in the double-stranded stem structure and produce a kink. "n7 or higher" refers to any position located at position 7 or downstream thereof (i.e., in the 3' direction) counting from the 5' end, including positions 8, 9, 10, 11, etc. "nx-6 or lower" therefore refers to positions x-6 (x minus 6), i.e., 6 positions upstream of the 3' terminal nucleotide. In an RNA molecule of 25 nucleotides in length, position nx-6 would therefore be position n (25-6) = n19. The term "kink" as used herein describes a distortion ("bulge") in a stem structure produced by unpaired nucleotides on only one strand of an otherwise double-stranded stem structure.

[0116] In various embodiments, the shRNA molecules of the invention are blunt-ended, i.e., X1 and X2, excluding kink-generating insertions, are of the same length, wherein the 5' and 3' terminal nucleotides of the molecule hybridize to each other, preferably by Watson-Crick base pairing, such that the double-stranded stem structure includes the two terminal nucleotides.

[0117] In various embodiments, X1 and X2 are each nucleotides of length 10 to 25 nucleotides, preferably 10, 11, 20, 21, 30 or 31 or 10-20 nucleotides, more preferably nucleotide sequences of length 10 or 11 nucleotides. It is generally preferred that the length of X1 and X2 differs by only one nucleotide, which is a nucleotide that is inserted to produce a kink in the structure. It has been found that for a length of 10 nucleotides or a multiple of 10 nucleotides, i.e., a stem region of 10, 20, 30 or other base pairs, the biological activity seems to be the highest. It is preferred that the small RNA molecule has a double-stranded stem region of 10 base pairs in length.

[0118] Particularly preferred are shRNA molecules in which X1 and X2 are completely complementary to each other except for the nucleotide insertion that creates a kink.

[0119] Although the kink-generating nucleotide insertion may in principle be of any length, it is preferred that it is a short nucleotide insertion of only up to 5, preferably up to 3, more preferably 1 or 2, most preferably only one nucleotide in length. Although the insertion may consist of any nucleotide, it is preferred that the insertion consists of a purine nucleotide, i.e. A or G. In various embodiments, it is preferred that the insertion is a single nucleotide selected from A and G, wherein in some embodiments A is preferred due to higher activity.

[0120] It has been found that insertion into the 5' arm, ie the X1 sequence, generally appears to be more effective in modulating the biological activity of the shRNA. Thus, it is preferred that the insertion is into the X1 sequence.

[0121] In addition, as mentioned above, it has been found that the position of insertion significantly affects activity. It is preferred to insert up to one nucleotide of the X1 sequence at position n7 or higher before the 3' end of the X1 sequence (i.e. the nucleotide upstream of the last paired nucleotide before the start of the loop region (the penultimate nucleotide of the X1 sequence)). Although insertions at positions 7 and 8 can be functional, it has been found that biological activity is significantly increased if inserted at position 9 or higher. Preferred positions are position 9 and positions between position 9 and position 2 or 3, preferably position 3, nucleotides upstream of the first loop nucleotide. In molecules where the 5' arm length is 11 nucleotides, this means that position 9 is particularly preferred because it is at least a position downstream of the 5' end and 3 positions upstream of the first loop nucleotide.

[0122] In alternative embodiments, the insert may also be positioned in the 3' arm. In such embodiments, the insertion may be in the second nucleotide of the X2 sequence (i.e., the nucleotide immediately downstream of the first paired nucleotide of the X2 sequence), or any subsequent position up to position nx-6, i.e., 7 positions upstream of the 3' end of the X2 sequence. These positions include nx-7, nx-8, and nx-9.

[0123] In various embodiments, X1 may comprise, consist essentially of, or consist of a nucleotide sequence selected from the group consisting of:

[0124] rrrnnyyyryy (SEQ ID NO: 1);

[0125] sswwwwssrss (SEQ ID NO: 2);

[0126] ggannnnnnnn (SEQ ID NO: 3);

[0127] ggannnnnncc (SEQ ID NO: 4);

[0128] ggannuncncc (SEQ ID NO: 5);

[0129] ggawwuscncc (SEQ ID NO: 6);

[0130] ggauuuccrcc (SEQ ID NO: 7);

[0131] ggauuuccacc (SEQ ID NO: 8); or

[0132] ggauuuccgcc (SEQ ID NO:9),

[0133] wherein r is g or a, y is u or c, w is a or u, s is g or c, and n is a, g, u or c. In these sequences, the bold nucleotides are preferably inserted, i.e., unpaired. In all exemplary X1 sequences disclosed herein, the inserted, i.e., unpaired, nucleotide is preferably at position 9. Preferably, in these embodiments, the X2 sequence is the complete complement of the sequence, except for the inserted nucleotides.

[0134] Thus, in various embodiments, the X2 sequence comprises, consists essentially of, or consists of a nucleotide sequence selected from the group consisting of:

[0135] rrrrrnnyyy (SEQ ID NO: 10);

[0136] sssswwwwss (SEQ ID NO: 11);

[0137] nnnnnnnucc (SEQ ID NO: 12);

[0138] ggnnnnnucc (SEQ ID NO: 13);

[0139] gggnannucc (SEQ ID NO: 14);

[0140] gggwawwucc (SEQ ID NO: 15);

[0141] ggggaaaucc (SEQ ID NO: 16),

[0142] wherein r is g or a, y is u or c, w is a or u, s is g or c, and n is a, g, u or c. In these embodiments, X2 preferably does not include a nucleotide insertion, so that the insertion is located at a position in the 5' arm. In addition, in these embodiments, it is preferred that the X1 sequence is a completely complementary sequence to the sequence, except for the inserted nucleotides.

[0143] Together with the preferred loop sequences, the shRNA molecules of the invention preferably comprise, consist essentially of or consist of a nucleotide sequence selected from the group consisting of:

[0144] rrrnnyyyryyuucgrrrrrnnyyy (SEQ ID NO: 17);

[0145] sswwwwssrssuucgsssswwwwss(SEQ ID NO:18);

[0146] ggannnnnnnnuucgnnnnnnnnucc(SEQ ID NO:19);

[0147] ggannnnnnccuucgggnnnnnnucc(SEQ ID NO:20);

[0148] ggannuncnccuucggggnannucc (SEQ ID NO:21);

[0149] ggawwuscnccuucggggwawwucc(SEQ ID NO:22);

[0150] ggauuuccnccuucgggggaaaucc (SEQ ID NO: 23);

[0151] ggauuuccrccuucgggggaaaucc (SEQ ID NO: 24);

[0152] ggauuuccaccuucgggggaaaucc (SEQ ID NO:25); or

[0153] ggauuuccgccuucgggggaaaucc (SEQ ID NO: 26),

[0154] wherein r is g or a, y is u or c, w is a or u, s is g or c, and n is a, g, u or c. In these sequences, the bold nucleotides are insertions, i.e., unpaired. Therefore, the inserted nucleotide is preferably located at position 9.

[0155] The present invention also relates to shRNA molecules comprising, consisting essentially of or consisting of SEQ ID Nos. 25-32 and 42-43, in particular 25, 26, 42 and 43.

[0156] In various embodiments of the invention, the shRNA molecules are further characterized in that they bind to the innate immune receptor retinoic acid inducible gene 1 (RIG-I), in particular Homo sapiens RIG-I. The binding is preferably specific, in that the binding occurs preferentially to RIG-I over other potential binding partners, such as other immune receptors or other members of the RLR family. This preference may mean that the binding affinity is at least 10x higher, preferably at least 100x higher than the binding affinity of other receptors.

[0157] In various alternative embodiments encompassed by the present invention, the shRNA may not have a nucleotide insertion in the position defined above, but rather a nucleotide insertion further upstream of the 5' arm or further downstream of the 3' arm. In some embodiments, an insertion in position n5 may be preferred, although the present invention is not limited thereto. It has been found that these molecules, particularly shRNAs having a nucleotide sequence shown in SEQ ID NO:30, can act as RIG-I antagonists and thus inhibit RIG-I mediated signal transduction. In addition to the different positions of nucleotide insertion, all embodiments disclosed herein for shRNAs having a nucleotide insertion at position n7 or higher in X1 or position nx-6 or lower in X2 as described above are similarly applicable to these shRNA molecules having an unpaired nucleotide insertion closer to the end of the stem.

[0158] The utility of the shRNA molecules of the present invention is that they are immunomodulatory RNA (immRNA), i.e., modulate the immune system. Typically, this means that they are immunostimulatory, although in some embodiments immunosuppressive activity may also be desired.

[0159] Therefore, the invention further relates to compositions comprising at least one shRNA molecule of the present invention. In various embodiments, such compositions may also comprise a large number of such shRNA molecules that are different in sequence or structure. Such multiple shRNA molecules according to the present invention may comprise at least 2, 3, 4, 5, 6, 7, 8, 9 or 10 or more different types of shRNA molecules. In addition to RNA molecules of the present invention, these compositions may also comprise various other components, including but not limited to other RNA molecules not according to the present invention.

[0160] The composition may be a pharmaceutical composition, in particular an immunostimulatory composition. In such a composition, the shRNA molecule may be used as an adjuvant and thus increase the immune response to the selected antigen, which may also be included in such a composition or may be formulated separately. In such a composition, the shRNA may alternatively or additionally not (not only) act as an adjuvant, but may itself have immunostimulatory activity, and may therefore, for example, act as an antiviral or anticancer agent.

[0161] Exemplary immunostimulatory compositions include vaccine compositions that may further comprise an actual vaccine (e.g., a pathogen, a toxin, etc., such as an attenuated virus or bacterium, or a viral or bacterial protein). In such embodiments, one or more shRNA molecules may be used as an adjuvant.

[0162] Alternatively, the composition may be an antiviral composition, optionally further comprising an active antiviral agent.

[0163] In another alternative, the composition can be an anticancer composition, optionally further comprising an active anticancer agent. Exemplary anticancer agents include, but are not limited to, chemotherapeutics and cell checkpoint inhibitors. Suitable checkpoint inhibitors include, but are not limited to, CTLA4, PD-1, and PD-L1 inhibitors. Suitable chemotherapeutic drugs include, but are not limited to, antibodies, alkylating agents, topoisomerase inhibitors, antimetabolites, and antimicrotubule agents.

[0164] In both antiviral and anticancer agents, the shRNA molecules of the present invention can be the active agent, or can be co-formulated or co-administered with the active agent, antiviral or anticancer agent. In the latter embodiments, the shRNA can act as an adjuvant or active agent or both.

[0165] Independent of the specific type of composition, the composition may further comprise one or more excipients generally known and used for the intended purpose, such as pharmaceutically acceptable excipients. Such components include adjuvants and carriers, such as solvents, preservatives, and the like.

[0166] Therefore, the use of the shRNA molecules of the present invention as adjuvants or antiviral agents or anticancer agents is clearly expected. Therefore, in various embodiments, the present invention is characterized in that the shRNA molecules of the present invention or any composition containing them are used to stimulate the immune system or treat or prevent viral infection or cancer in a subject in need. The subject can be a mammal, preferably a human. Similarly, the present invention encompasses a method for stimulating the immune system or treating or preventing viral infection or treating or preventing cancer in a subject in need, the method comprising administering an effective amount of shRNA molecules according to the present invention or compositions as described herein to the subject. "Effective amount" used herein refers to the amount required to cause a desired biological response (i.e., typically relative to a non-stimulated state or treatment of viral infection, activating the immune system). Therefore, an effective amount can be a treatment or prevention effective amount. In these methods, shRNA molecules can be co-administered with an active agent (e.g., an inoculating agent) or a therapeutically active agent (e.g., an antiviral agent or an anticancer agent).

[0167] In the above uses and methods, administration may be local administration or systemic administration.

[0168] In various embodiments of the present invention, the viral infection to be treated or prevented includes, but is not limited to, dengue virus infection.

[0169] In a further embodiment of the present invention, the immRNA disclosed herein is used for cancer treatment or prevention (prevention method). Therefore, the above-mentioned method for treating or preventing viral infection can be similarly practiced for different indications for cancer treatment or prevention.

[0170] The inventors have discovered that shRNA activity can be modulated by structural modifications in which nucleotide insertions are produced in the stem structure. As a result of this discovery, the present invention also relates to methods utilizing said discovery, in which a given small hairpin RNA (shRNA) molecule is modified by nucleotide insertions in the 5' arm to increase its biological activity. In these methods, the template shRNA preferably has the following structure, in the 5' to 3' direction

[0171] X1-L-X2,

[0172] in,

[0173] X1 and X2 are each nucleotide sequences of 8 to 30 nucleotides in length and have sufficient complementarity to each other to form a double-stranded stem structure;

[0174] L is the nucleotide sequence that forms the loop region;

[0175] The first nucleotide at the 5' end of X1 is named n1 and the last nucleotide at the 3' end of X2 is named nx, wherein x is an integer from 25 to 65. In various embodiments, shRNA is about elements X1, X2 and L as described above in conjunction with the modified shRNA molecules of the present invention. These templates are modified by: introducing nucleotide insertions at positions n7 or higher in X1 or positions nx-6 or lower in X2, which remain unpaired in the double-stranded stem structure to produce a kink. In a further embodiment, such insertions can also be at different positions, as described above for shRNAs that work as RIG-I antagonists. The appropriate method for producing this insertion is well known to those skilled in the art, and is routinely practiced in the art. In addition, in the examples section herein, exemplary techniques for generating such molecules are described by reference to specific sequences. In addition, if not yet present, the template molecule can be modified by: phosphorylating the 5' end so that it is diphosphorylated or triphosphorylated. Suitable methods for this are known to those skilled in the art.

[0176] It should be understood that all embodiments disclosed herein relating to the RNA molecules of the invention apply analogously to all compositions, uses and methods described herein, and vice versa.

[0177] The present invention is further illustrated by the following examples. However, it should be understood that the present invention is not limited to the exemplary embodiments.

[0178] Examples

[0179] Materials and Methods

[0180] Protein expression and purification

[0181] The constructs of human RIG-I (hsRIG-I) and CARD-free human RIG-I (hsRC2) in pETSUMO were transformed into Rosetta II E. coli cells (Novagen, Madison, USA) and grown in LB liquid medium supplemented with 2.5% (w / v) glycerol 50 mM phosphate buffer (pH 7.4, with antibiotics kanamycin (50 mg / L) and chloramphenicol (37 mg / L). The cultures were grown at 37°C with shaking at 200 rpm until OD 600 Reach 0.8. The culture was cooled to 18°C ​​and induced with 0.5 mM isopropyl-β-D-thiogalactopyranoside (IPTG) for 20 hours. The cells were collected by centrifugation at 4000 rpm for 10 minutes at 4°C and stored at -80°C. The collected cells were thawed and resuspended in a lysis buffer containing 25 mM HEPES (pH 8.0), 500 mM NaCl, 10% (v / v) glycerol and 5 mM β-ME. The cells were lysed at 800 bar by a homogenizer (GEA). The lysate was clarified by centrifugation at 40000 rpm for 40 minutes at 4°C. The supernatant containing the target protein with a hexahistidine tag was incubated and purified with Ni-NTA microbeads (Thermofisher). After elution, the target protein was cleaved overnight at 4°C with SUMO protease at a ratio of 1:40 (w / w). The proteins were further purified by Ni-heparin HP tandem columns to capture the protease and cleave the His tag and further polish the proteins. They were further purified by size exclusion chromatography using HiLoad 16 / 600 Superdex 200 (GE Healthcare) columns, concentrated with vivaspin 30000 MWCO cutoff (GE Healthcare Life Sciences), and analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and then purified by Quantification was performed by measuring absorbance at 280 nm using a spectrophotometer (Thermo Fisher Scientific, USA). Proteins were stored in a buffer containing 25 mM HEPES pH 7.4, 150 mM NaCl, 5% (v / v) glycerol and 2 mM DTT and flash frozen in liquid nitrogen.

[0182] In vitro transcription of RNA

[0183] RNA was transcribed using complementary DNA oligonucleotide pairs containing a T7 promoter chemically synthesized by IDT (Integrated DNA Technologies, Inc). Briefly, complementary DNA oligonucleotide pairs were annealed by heating to 95°C and slowly cooling to room temperature. In vitro transcription reactions were reacted at 37°C for 16 hours in the following: 40 mMTris-HCl pH 7.9, 30 mM MgCl2, 2 mM spermidine, 10 mM DTT, 0.01% Triton-X100, 5 mM GTP and 4 mM NTP (CTP, ATP and UTP), 1 μM annealed DNA template, 400 nM T7 RNA polymerase, 0.2 U / mL thermostable inorganic pyrophosphatase. The transcribed RNA was purified by one volume of phenol: chloroform: isoamyl alcohol (25:24:1) followed by ethanol precipitation. The RNA pellet was resuspended in 10 mM HEPES buffer (pH 7.4) and further purified by Hi-Trap Q HP column. The eluted RNA was ethanol precipitated and further purified from 20% denaturing urea-PAGE. RNA of the expected size was excised from the gel, extracted, and then ethanol precipitated. The purified RNA was resuspended in a buffer containing 10 mM MOPS pH 7, 1 mM EDTA, and 50 mM NaCl.

[0184] The RNA molecules thus generated are shown in Table 1, where bold letters indicate unpaired nucleotides in the stem region that create kinks in the structure. All immRNAs used were 5'-triphosphorylated unless explicitly stated to the contrary.

[0185] Table 1. Synthetic RNA molecules

[0186]

[0187]

[0188]

[0189] NADH-coupled ATPase assay

[0190] In a buffer containing 25mM MOPs pH 7.4, 150mM KCl, 2mM DTT and 0.01% Triton X-100, in the presence of a 5X assay mixture containing 1mM NADH, 100U / ml lactate dehydrogenase, 500U / ml pyruvate kinase, 2.5mM phosphoenolpyruvate, hsRIG-I was subjected to an ATPase assay. To determine the Km of ATP, 20nM target protein was used. A saturating amount of RNA was added at a concentration of 1μM, and the protein RNA mixture was incubated for 2 hours before the start of the reaction. The reaction was initiated by adding ATP and MgCl2 in a 1 to 1 molar ratio (diluted to 8 different concentrations ranging from 39nM to 5000nM) and monitored at room temperature in a 96-well plate format at 340nm Ab for 10 minutes using a Cytation 3 cell imaging multi-mode plate reader (BioTek). All data were obtained in triplicate and analyzed using GraphPad The rate of NADH hydrolysis as a function of ATP concentration was plotted using the Michaelis-Menten equation (GraphPad Software, Inc.), version 6 program. Rates were obtained over a 10-minute duration and corrected for background NADH decomposition.

[0191] Cell culture and IFN-β induction assay

[0192] HEK-Lucia derived from HEK293 cells TM RIG-I cells and THP1-Dual derived from THP-1 cells TM It is a cell line generated to express a secreted Lucia luciferase reporter gene. The reporter gene is controlled by the IFN-inducible ISG54 promoter, which is enhanced by a poly-IFN stimulation response element (ISRE). The cells were stored in Dulbecco's Modified Eagle Medium (DMEM, GIBCO) supplemented with 10% fetal bovine serum in T-75 flasks. IFN-β induction assays were performed in 96-well plates with a seeding density of 50,000 cells / well. LyoVec (InvivoGen) was used to transfect cells with different concentrations of RNA from 300nM to 6nM. After 24 hours, 10 μL of cell culture medium was collected and mixed with 50 μl of QUANTI-Luc TM(an assay reagent containing all components required for quantitative measurement of Lucia luciferase activity) was mixed. Luminescence was measured using a Biotek Synergy H1 microplate reader (Biotek, Winooski, VT, USA). Time point experiments were performed in a 96-well plate format using 100 nM RNA for up to 72 hours.

[0193] Cell-based inhibition assay

[0194] Using HEK-Lucia TM Cell-based inhibition assays were performed with RIG-I cells. HEK-Lucia TM RIG-I cells were seeded at a seeding density of 50,000 cells / well and transfected using LyoVec as recommended by the manufacturer with 10 nM 3p10L and different concentrations of the antagonist 3p10LG5 ranging from 300 nM to 6 nM. After 24 hours, 10 μL of cell culture medium was collected and mixed with 50 μL of QUANTI-Luc TM Mix and measure luminescence using Biotek Synergy H1 plates. All assays were performed in triplicate in Corning 96-well plates. The half-maximal inhibitory concentration (IC) of the inhibitors was determined using GraphPad Prism version 6 (GraphPad Software, La Jolla, CA, USA). 50 ).

[0195] Hydrogen / deuterium exchange (HDX) coupled to mass spectrometry (HDX-MS)

[0196] 5 μl of 10 μM RIG-I protein in 25 mM HEPES (pH 7.4), 150 mM NaCl, 5% glycerol and 2 mM DTT was incubated with 10-fold excess RNA ligands 3p10LG5, 3p10LG9 and 3p10LA9 at 4°C for 1 hour. The protein complex mixture was diluted into 20 μl D2O in exchange buffer (50 mM HEPES (pH 7.4), 150 mM NaCl, 5 mM MgCl2, 2 mM DTT) and incubated at 4°C and quenched by mixing with 25 μl ice-cold 4M gHCL, 1% trifluoroacetic acid. The samples were incubated overnight at room temperature in D2O in exchange buffer containing 3M gHCL (50 mM HEPES (pH 7.4), 150 mM NaCl, 5 mM MgCl2, 2 mM DTT and 3M gHCL). After the quench reaction, the sample tubes were immediately placed on dry ice until the samples were injected into the HDX platform. After injection, the samples were passed through an immobilized pepsin column (2 mm × 2 cm) at 200 μl min-1, and the digested peptides were captured on a 2 mm × 1 cm C8 trap column (Agilent) and desalted. The peptides were separated by a 2.1 mm × 5 cm C18 column (1.9 μm Hypersil Gold, Thermo Fisher Scientific) with a linear gradient of 4%-40% CH3CN and 0.3% formic acid for 5 minutes. Sample processing, protein digestion and peptide separation were performed at 4°C. Mass spectrometry data were obtained using an Orbitrap mass spectrometer (Q Exactive, Thermo Fisher Scientific) with a measurement resolution of 65,000 at m / z 400. HDX analysis was performed in triplicate using a single preparation of each protein-ligand complex. The intensity-weighted average m / z center of mass value was calculated for each peptide envelope and subsequently converted to a percentage of deuterium incorporation. Back exchange was corrected based on an estimated 70% deuterium recovery and accounting for the known 80% deuterium content in the deuterium exchange buffer. When two samples were compared, the perturbation %d was determined by calculating the difference between the two samples. HDX Workbench colored each peptide according to the smooth color gradient HDX Perturbation Description (%D) shown in each indicator figure. Differences in %D between -5% and 5% were considered non-significant and were colored gray according to the HDX Perturbation Description (Pascal et al., 2012). In addition, an unpaired t-test was calculated to detect statistically significant (P<0.05) differences between samples at each time point. For each peptide in the data set, there was at least one time point with a p-value less than 0.05, which further confirmed that the difference was significant.

[0197] Data presentation: HDX data from all overlapping peptides were combined into a single amino acid value using the residue averaging method. Briefly, for each residue, the deuterium incorporation values ​​from all overlapping peptides and the peptide length were combined. A weighting function was applied, with shorter peptides having larger weights and longer peptides having smaller weights. Each weighted deuterium incorporation value was then averaged to produce a single value for each amino acid. The first two residues of each peptide, as well as proline, were omitted from the calculation. This approach is similar to that described previously (Keppel & Weis, 2015).

[0198] Isolation of human skin DCs

[0199] The protocol for isolating single cells from human skin was previously described in detail (Cerny et al. (2014), PLoS Pathog. 2014; 10(12): e1004548). To isolate human skin cells, 300 mm raw skin sections were incubated for 12 hours in RPMI + 10% heat-inactivated FBS (Gibco) containing 0.8 mg / ml collagenase (type IV, Worthington-Biochemical) and 0.05 mg / ml DNase I (Roche). After incubation, cells were filtered through a 70 μm filter to obtain a single cell suspension.

[0200] Cell lines

[0201] HEK-293T, U937 and A549 cells (ATCC) were grown in RPMI supplemented with 10% fetal bovine serum (FBS) (Gibco). U937 cells expressing DC-SIGN were generated by lentiviral transfection (Züst et al. (2013), PLoS Pathog [Public Library of Science-Pathogens] 9:e1003521). HEK-293T cells expressing MX1P-luc were generated by Georg Kochs (Kochs et al. (2009), J Gen Virol [Journal of General Virology] 90:2990-2994) (University of Freiburg, Germany). HEK-293T cells containing the ISRE-luc reporter gene plasmid were generated by transfecting 0.5 μg of ISRE-luc plasmid using 293fectin transfection reagent (Thermo Fisher Scientific).

[0202] RIG-I knockout cell lines were generated by lentiviral transduction of U937-DC cells with pRRL-gRNA-Cas9-T2A plasmid containing a gRNA sequence targeting exon 1 of RIG-I. Plasmids containing RIG-I gRNA were obtained from Dr. Alvin Tan (Genome Institute of Singapore, A*STAR, Singapore). Lentiviral particles were prepared on 293T cells using 293fectin transfection reagent (Thermo Fisher Scientific) with the following three plasmids: (i) pMDLg / pRRE, which includes gag, encoding the major structural protein of the virion; pol, responsible for retrovirus-specific enzymes; and RRE, a Rev protein binding site that promotes RNA export from the nucleus. (ii) pRSV-Rev, encoding HIV-1rev under the transcriptional control of the RSV U3 promoter; (iii) pMD2.G, a plasmid expressing the VSV-G envelope. pMDLg / pRRE (Addgene #12251), pRSV-Rev (Addgene #12253), and pMD2.g were generated by Professor Didier Trono (Lausanne, Switzerland). The culture medium was supplemented with 2 μg / ml puromycin and successfully transduced cells were selected. Genomic DNA was extracted from cells using the "HotSHOT" genomic DNA preparation method described in (Truett et al. (2000), BioTechniques [Biotechnology] 29: 52-54). Purified DNA was sent for sequencing (First Base) using primers flanking exon 1 (Forward: 5'GGAGGGAAACGAAACTAGCC 3' (SEQ ID NO:46) and Reverse: 5'GCTCCTCAAACTCTGGCAAC 3' (SEQ ID NO:47). The sequence was compared to the human DDX58 sequence publicly available on Ensembl (ENSG00000107201.9).

[0203] Virus

[0204] The DENV-2 strain TSV01 (NCBI accession number AY037116.1) used for human cell line infection experiments is a patient isolate passaged 5-20 generations in C6 / 36 mosquito cells. D2Y98P used for primary human skin DC infection is derived from an infectious clone. The enhanced viral RNA synthesis of D2Y98P is mapped to a natural mutation in the NS4b protein, and the mutation has no effect on the IFN inhibitory ability of the virus (Grant et al. (2011), Journal of Virology [Journal of Virology] 85: 7775-7787).

[0205] Screening of RNA using the type I interferon bioassay.

[0206] HEK-293T MX1P-luc cells were plated at 2.5 × 10 4 The density of each cell is inoculated into white 96-well plates and incubated overnight. immRNA is diluted to suitable concentration, and transfected with 293fectin transfection reagent (Thermo Fisher Scientific) according to the instructions of manufacturers. Cells are incubated for 24h, then cracked and analyzed using Bright-Glo luciferase assay system (Promega) on GloMax-Multi microplate reader (Promega) according to the instructions of manufacturers.

[0207] Quantitative PCR (qPCR)

[0208] U937-DC SIGN cells were plated at 3.0 × 10 5 The density of each cell was inoculated in 500 μl RPMI containing 10% FBS in 24-well plates, and incubated overnight. ImmRNA was diluted to a suitable concentration and transfected (triplicate) with Hilymax (Dojindo Molecular Technologies) according to the manufacturer's instructions. After incubation for 24 h, cells were centrifuged at 500 x g for 4 minutes and harvested in Trizol reagent (Thermo Fisher Scientific), and total RNA was harvested according to the manufacturer's instructions. RNA was reversely transcribed using SuperScript VILO cDNA synthesis kit (Invitrogen). PCR primers were purchased from Integrated DNA Technology, and iTaq Universal SYBR Green Supermix (Bio-rad Laboratories) was used on ABI 7900HT real-time PCR system (Applied Biosystems). Primer sequences can be found in the table below. Analysis of qPCR data was performed by relative quantification by the ΔΔCt method using β-actin as a reference gene control.

[0209]

[0210]

[0211] Bioassay for type I interferon production

[0212] The supernatant from the immRNA transfected cells was incubated with HEK-293T cells transfected with 0.5 μg ISRE-luc plasmid the day before and seeded in 96-well white opaque plates the next day. The supernatant was incubated for 6 h, then lysed and analyzed using the Bright-Glo luciferase assay system (Promega) on a GloMax-Multi microplate reader (Promega) according to the manufacturer's instructions.

[0213] Type I interferon bioassay on immRNA-transfected HEK-293T cells expressing RLR.

[0214] HEK-293T cells were plated at 1.25 × 10 5 The cells were seeded at a density of 10 cells in RPMI containing 10% FBS in a 24-well plate. Lyovec (Invitrogen) was used to transfect 50 ng of pUNO-hRIG-I or pUNO-hMDA5 (Luo et al. (2011), Cell 147:409-422) and the cells were incubated overnight. HEK-293T cells expressing RLR were transfected with immRNA. After 24 hours of transfection with dsRNA, supernatants from the cells were harvested and type I interferon bioassays were performed using HEK-293T cells expressing ISRE-luc.

[0215] U937-DC SIGN cell IFNAR blocking assay

[0216] U937-DC SIGN cells were plated at 0.6 × 10 5 The density of cells was seeded in 96-well plates and transfected with immRNA (triplicate) using Hilymax (Dongren Molecular Technology) according to the manufacturer's instructions. After 6 hours, anti-human IFNAR blocking antibodies (clone MMHAR-2, PBL Interferon Source) or IgG isotype controls (R&D systems) were added at a concentration of 10ug / mL. After incubation overnight, the supernatant was harvested and a bioassay of type I interferon was performed. U937-DC SIGN cells were infected with DENV-2 (TSV01) at MOI-1 and the infection was quantified.

[0217] DENV-2 infection and flow cytometric analysis.

[0218] U937-DC SIGN cells were plated at 0.6 x 10 per well. 5 A549 cells were seeded at a density of 1.0 x 10 cells per well in 96-well plates and transfected with immRNA using Hilymax (Dongren Molecular Technology) according to the manufacturer's instructions (triplicate). 4The cells were seeded in 96-well plates at a density of 10 cells and transfected with immRNA using 293fectin transfection reagent (Thermo Fisher Scientific) according to the manufacturer's instructions. After incubation for 24 hours, the transfected U937-DC-SIGN and A549 cells were infected with DENV-2 (TSV01 strain) at MOI-1 and MOI-5, respectively. The cells were incubated with RPMI containing DENV-2 for 2 hours. After two washes, the infected cells were resuspended in RPMI containing 10% FBS and placed in an incubator for 24 hours. For FACS analysis, the washed cells were fixed and permeabilized by resuspending the cells in Cytofix / Cytoperm buffer (BD Biosciences). Dengue E protein was stained with anti-E protein antibody (4G2) (ATCC) conjugated to Alexa 647 and anti-NS1 antibody conjugated to Alexa 488. Fluorescence on these cells was measured on a BD FACS Canto II analyzer (BD Biosciences) and analyzed on Flowjo (Treestar). Cells that stained positive for both NS1 and E proteins were considered infected.

[0219] Human skin DCs were isolated and transfected with immRNA as described above. For preventive studies, isolated human skin DCs were infected with DENV-2 (D2Y98P strain) at an MOI of 5 24 h after transfection. For therapeutic studies, isolated human skin DCs were infected with DENV-2 (D2Y98P strain) at an MOI of 5 and immRNA transfection was performed at 4 h, 6 h, and 24 h after infection. 72 h after infection, infected cells were analyzed by flow cytometry to determine the percentage of infected cells. 1000 U of human recombinant IFN-b (Immunotools) was added to the cells 4 h after infection. Flow cytometry was performed on an LSRII (Becton Dickinson [BD]) and data were analyzed using FlowJo (Tree Star). The following reagents for staining human skin DC were used: fixable live / dead dye (Thermo Fisher Scientific), anti-CD1a (HI149) (Biolegend), anti-CD11c (B-ly6), anti-CD45 (HI30), anti-HLA-DR (L243) (all from BD Biosciences), anti-CD141 (AD5-14H12) (Miltenyi), anti-CD14 (RMO52) (Beckman Coulter), and anti-E protein conjugated to Alexa647 (4G2) (ATCC).

[0220] RNAseq experiments

[0221] Single-cell RNAseq: Skin cell subsets were identified as described for flow cytometry analysis and sorted individually into 96-well PCR plates and immediately frozen. Single cells were processed using the SMARTseq2 protocol (Picelli et al. (2014), Nature Protocols 9:171-181) with the following modifications:

[0222] 1.1 mg / ml BSA lysis buffer ( Thermo Fisher Scientific, Waltham, Massachusetts, USA)

[0223] 2. Use 200 pg cDNA and 1 / 5 reaction of Illumina Nextera XT kit (Illumina, San Diego, CA, USA)

[0224] The length distribution of cDNA libraries was monitored using a DNA high sensitivity kit on a Perkin Elmer Labchip (Perkin Elmer, Waltham, Mass., USA). All samples were subjected to 2x151 cycles of indexed paired-end sequencing on an Illumina HiSeq 4000 system (Illumina, San Diego, Calif., USA) (309 samples / lane).

[0225] Paired-end raw reads were aligned to the human reference genome using RSEM version 1.3.0 (36). The human reference genome GRCh38 version 25 (https: / / www.gencodegenes.org / human / release_25.html) released by Gencode was used. Transcripts / million reads (TPM) values ​​were calculated using RSEM version 1.3.0 (Li & Dewey (2011), BMC Bioinformatics [BMC Bioinformatics] 12: 323) and logarithmic transformation -log2 (expression + 1)- was used for downstream analysis. Quality control, hypervariable gene selection, principal component analysis (PCA) and differential gene analysis were performed using the Seurat R software package version 2.0 (Butler et al. (2018), Nat Biotechnol [Natural Biotechnology] 36: 411-420). Low-quality cells in our dataset were filtered out based on a threshold for the number of detected genes (at least 200 unique genes per cell), and all genes that were not detected in at least 1.9% of all our single cells were discarded, leaving 159 cells and 15,174 genes for all further analysis. After scaling the data, principal component analysis (PCA) was performed on the 810 hypervariable genes. Differential gene expression was analyzed using the negative bimodal Wald test, selecting genes with adjusted p-values ​​(Benjamini-Hochberg correction) to estimate fold changes < 0.05.

[0226] Bulk RNAseq: 500 cells were sorted per subpopulation and donor and RNA was isolated using the PicoPure RNA Isolation Kit. cDNA libraries were prepared according to Picelli et al. (supra) with the following modifications:

[0227] 1.1 mg / ml BSA lysis buffer ( Thermo Fisher Scientific, Waltham, Massachusetts, USA)

[0228] 2. Add 20 μM TSO;

[0229] 3. Use 200 pg cDNA and 1 / 5 reaction of Illumina Nextera XT kit (Illumina, San Diego, CA, USA).

[0230] The length distribution of cDNA libraries was monitored using a DNA high sensitivity kit on a Perkin Elmer Labchip (Perkin Elmer, Waltham, Mass., USA). All samples were subjected to 2x151 cycles of indexed paired-end sequencing on an Illumina HiSeq 4000 system (Illumina, San Diego, Calif., USA) (32 samples / lane).

[0231] Paired-end reads of 150 bp (300 bp per pair) were mapped to human transcriptome sequences obtained from Gencode version 29 using Salmon (version 0.11.3) (Patro et al. (2017), Nat Rev Immunol 14:417-419). Transcript counts obtained from Salmon were summarized into gene counts using the tx2gene R / Bioconductor package (Soneson et al. (2015), F1000 Res 4:1521-18). The summarized gene counts for samples associated with the compared conditions were loaded into DESeq2 (Love et al. (2014), Genome Biol 15:31-21). Genes with at least one count in at least one sample were retained in the data set. Count data were fitted to a negative binomial generalized linear model using DESeq2. Size factors for library size normalization and mean and dispersion parameters for each gene were estimated using the estimate size factor and estimate dispersion functions. Differential gene expression was analyzed using the negative binomial Wald test. The p-values ​​of the estimated fold changes were corrected for multiple testing using the Benjamini-Hochberg method, and differentially expressed genes were selected based on an adjusted p-value < 0.05. The list of genes identified as differentially expressed after G9 stimulation in each cell type was provided to Ingenuity Pathway Analysis along with their respective fold changes and p-values. TM (IPA) software. Differential expression-based pathway enrichment analysis was performed in IPA to identify pathways that were significantly regulated by stimulation in each cell type.

[0232] Example 1: HEL2i domain sampling RNA PAMPs for RIG-I activation

[0233] To infer the structural basis of RNA sensing by RIG-I proteins, five available structures of the human RIG-I HEL-CTD dsRNA complex were compared. By superimposing the unchanged HEL1-dsRNA-CTD domain, it was found that the HEL2-HEL2i domains move relative to each other along the dsRNA backbone. HEL2i plays a central role in releasing the CARD domain after binding to RNA PAMPs. This is mediated by two opposing functional surfaces: an RNA sampling surface with conserved RNA recognition residues (K508-Q511 in human RIG-I) and a surface that interacts with the CARD2 domain and isolates its release (Luo (2014) RNA Biol [RNA Biology] 11: 25-32; Zheng et al., supra). In the five structures, HEL2i samples approximately 5 base pairs (base pairs 5-10, counting from the 5'-terminal triphosphorylated nucleotide of the top chain). It is hypothesized, but not limited to, that any structural perturbation in this region will affect the intramolecular movement of the HEL-CTD domains relative to each other and alter the kinetics of CARD release, i.e., the threshold for activation. To test this hypothesis, RNA nucleotide insertions and point mutations were introduced into the starting immRNA-3p10L (5' triphosphorylated RNA with a 10 base-paired stem region; SEQ ID NO:37) as described by Kohlway et al. (2013, supra) and evaluated using biochemical and cell-based assays.

[0234] Example 2: Position-specific guanosine insertion differentially activates RIG-I

[0235] To evaluate how the inserted nucleotide affects the ability of 3p10L (SEQ ID NO:37) to activate RIG-I, six RNA species with one guanosine inserted along the dsRNA stem of 3p10L, namely 3p10LG5 (SEQ ID NO:30), 3p10LG7 (SEQ ID NO:29), 3p10LG9 (SEQ ID NO:26), 3p10LG17 (SEQ ID NO:28), 3p10LG19 (SEQ ID NO:31), and 3p10LG21 (SEQ ID NO:27), were generated and the relative IFN production activities of these RNAs were compared with those of 3p10L (SEQ ID NO:37). Figure 1 A) Using HEK-Lucia TM RIG-I reporter gene cell line (HEK-Lucia TMThese RNA molecules were tested with null cells as a control to determine which insertions in the stem region could lead to higher IFN-β activity. One of the RNAs (3p10LG9; SEQ ID NO:26) with a guanine insertion at position 9 of the stem in the hairpin RNA was a potent inducer of RIG-I activation, with at least 3-fold higher IFN-β induction compared to the parental immunomodulatory RNA (immRNA) 3p10L ( Figure 1 B). RNAs with G insertions at position 7 or position 17 had comparable activity to 3p10L. ATPase assays using 20 nM hsRIG-I protein and saturating concentrations of immRNA (1 μM) showed that the Kcat of ATP was 9.01 s for 3p10L and 3p10LG9, respectively. -1 and 11.7s -1 ( Figure 1 C) Thus, immRNAs with G-insertions at least 6 base pairs from the 5' ppp end still have agonistic effects, and the insertion at position G9 is the most potent activator of RIG-I.

[0236] Compared to those activating immRNAs described above, immRNA 3p10LG5 (SEQ ID NO: 30) was significantly higher in enzyme activity and cell activity assays ( Figure 1 B and C) showed no activity, suggesting that 3p10LG5 inactivates RIG-I. To further demonstrate this, a cell-based competitive inhibition assay was used and the half-maximal inhibitory concentration (IC 50 ) was 34 nM. This was measured by transfecting 10 nM 3p10L (SEQ ID NO: 37) in the presence of increasing concentrations of 3p10LG5 ( Figure 1 D). The results indicate that 3p10LG5 acts as an antagonist of RIG-I. To ensure that all immRNAs with G-insertions bind to RIG-I, analytical gel filtration experiments were performed using purified hsRC2 protein and immRNA. It was found that all immRNAs were able to form stable RIG-I:RNA complexes in a buffer with physiological concentrations of electrolytes (data not shown). In summary, by introducing G-insertions at different positions in 3p10L, 3p10LG9 was identified as the most potent RIG-I agonist among those tested, and 3p10LG5 was determined to be a RIG-I antagonist.

[0237] Example 3: Purine base insertion at position 9 of immRNA increases potency

[0238] To evaluate whether insertion of different bases at position 9 of 3p10L differentially activates RIG-I, the G9 residue of 3p10LG9 was replaced with adenosine, uridine, or cytosine ( Figure 2 A) In stimulating HEK-Lucia TM After 24 hours in RIG-I cells, 3p10LG9 (SEQ ID NO: 26) and A9 (SEQ ID NO: 25) had similar IFN-β activation activity, which was approximately two times that observed with 3p10L. Figure 2 B), immRNAs with pyrimidine insertions (3p10LC9 (SEQ ID NO:43) and U9 (SEQ ID NO:42)) showed similar levels of activity. ImmRNAs with purine insertions (3p10LG9 and A9) performed better than those with pyrimidine insertions in the ATPase assay: higher kcat values ​​were observed (11.7 and 12.6 compared to 8.3 and 7.3 s -1 ) and higher catalytic efficiency (25.3 and 29.3 compared to 18.9 and 19.3 mM -1 s -1 )( Figure 2 C) These results suggest that the insertion of a purine base at position 9 enhances 3p10L by increasing the enzymatic and IFN-inducing activities of RIG-I.

[0239] Example 4: HDX-MS captures stronger allosteric effects upon 3p10LG9 binding to RIG-I compared to 3p10L

[0240] HDX-MS is a sensitive and robust method for studying protein dynamics after ligand binding (Zheng et al. (2017), Nat Commun [Nature Communication] 8:923; Zheng et al. (2015), supra). The intramolecular interaction of HEL2i with CARD and the allosteric release of CARD during RIG-I recognition of RNA were captured. Briefly, the protein-RNA complex was exposed to deuterated water, denatured into peptides, and processed for LC-MS as described by Zheng et al. (2015, supra). HDX data were merged and mapped to the structural model using the residual averaging method using HDX Workbench as previously described (Keppel & Weis 82015, Journal of the American Society for Mass Spectrometry 26:547-554; Pascal et al. (2012), Journal of the American Society for Mass Spectrometry 23:1512-1521; Zheng et al. (2015), supra).

[0241] To mechanistically explain the higher enzymatic and cellular activity of 3p10LG9 compared to 3p10L, the structural dynamics of RIG-I upon binding to 3p10LG9 and 3p10L were analyzed using hydrogen / deuterium exchange-mass spectrometry (HDX-MS). HDX mapping revealed that the CARD domain, and in particular the CARD2 latch peptide (Y103-114), showed higher deuterium incorporation in 3p10LG9 compared to 3p10L in the case of hsRIG-I. Key differences between 3p10L and 3p10LG9 include tighter binding of 3p10LG9 to hsRIG-I in the HEL1 domain, specifically motifs Ia (F296-310) and Ic (I343-366), which are known to interact with RNA. Another observation was that the CTD cap loop (F842-856) and CTD binding region (V893-904) bound more tightly to 3p10LG9 than to 3p10L (data not shown). HDX-MS showed that 3p10LG9 bound more tightly to HEL-CTD than to 3p10L, further destabilizing the CARD2-HEL2i intramolecular inhibitory interface, leading to more exposure of CARD and greater RIG-I stimulation (data not shown). When the RIG-I3p10LG9 complex was modeled, the inserted G9 base position appeared to be in close proximity to the back of HEL2i, leading to the conclusion that the G9 insertion restricted HEL2i movement and provided additional repulsive forces to release CARD from the HEL-CTD:3p10LG9 complex.

[0242] Example 5: 3p10LA9 shows time- and cell type-dependent enhanced activity compared to 3p10LG9

[0243] To further explore the cellular activity of the lead immRNA, a cell-based kinetic experiment was performed by observing the concentration-dependent response and time-dependent response of the two best immRNAs 3p10LG9 (SEQ ID NO: 26) and A9 (SEQ ID NO: 25) to 3p10L (SEQ ID NO: 37). In HEK-LuciaTM RIG-I cells, 3p10LG9 and A9 showed similar and higher activity than 3p10L at 24 hours after transfection ( Figure 3 A). In the time-dependent experiment, the stimulatory activity of the three immRNAs was clearly detected at 24 h after transfection and continued to increase at 48 and 72 h after transfection. Notably, after 24 h, 3p10A9 became more potent than 3p10LG9 and stimulated more luciferase signal ( Figure 3 B) Then a second type of cells - THP1-Dual TM , which are monocytes with IRF-Luc reporter gene. 50The values ​​cannot be determined accurately, but 3p10LA9 appears to be the most potent immRNA, followed by 3p10LG9, and 3p10L the least potent. Figure 3 C). In THP-1 reporter cells, the difference between 3p10LA9 and 3p10LG9 became more obvious in a concentration-dependent and time-dependent manner ( Figure 3 C and 3D).

[0244] Example 6: Biochemical characterization of different immRNA molecules

[0245] To test the ability of different immRNAs to activate RIG-I, purified recombinant full-length RIG-I was subjected to a NADH-coupled ATPase assay with saturating amounts of immRNA before initiating the reaction with different concentrations of ATP. Briefly, the assay was performed in a buffer containing 25 mM MOPS pH 7.4, 150 mM KCl, 2 mM DTT, and 0.01% Triton X-100 in the presence of a 5X assay mix containing 1 mM NADH, 100 U / ml lactate dehydrogenase, 500 U / ml pyruvate kinase, and 2.5 mM phosphoenolpyruvate. These experiments demonstrated that some immRNAs activated RIG-I, such as OHYr05 (SEQ ID NO: 26) and OHYr23 (3p10L; SEQ ID NO: 37), while other RNA molecules, such as OHYr22 (SEQ ID NO: 45) and OHYr12 (SEQ ID NO: 33) were unable to activate RIG-I ( Figure 4 ). The sequence information of all RNAs used is shown in Table 1 above.

[0246] Table 2 shows the Kcat, Km and Kcat / Km values ​​of the ATPase activity of mmRIG-I binding to different immRNAs.

[0247] Table 2: Kcat, Km and Kcat / Km values ​​of different immRNAs

[0248]

[0249] Example 7: The ability of different immRNAs in inducing interferon in human cells

[0250] Different approaches were used to test the biological function of the immRNA. First, human embryonic kidney (HEK-293T) reporter cells were directly transfected using 293fectin as a transfection reagent. The luciferase reporter gene was driven by MX1, an IFN-stimulated gene downstream of interferon (IFN)β binding to the interferon receptor. The previously published construct OHYr23 / 3p10L (SEQ ID NO:37) was used for comparison. Two constructs, OHYr05 and OHYr06 (SEQ ID No.26 and 25; see Table 1), were found to be almost 10 times more potent than OHYr23 in inducing IFN production ( Figure 5 ). Also use THP1-Dual TM Cell test of interferon induction ability. THP1-Dual TM OHYr05 was derived from the human THP-1 monocytic cell line by stable integration of a luciferase reporter gene driven by ISG 54. The lower EC50 value of OHYr05 compared to OHYr23 indicates that OHYr05 is able to elicit a half-maximal interferon response at a lower concentration of 3.47 nM ( Figure 6 ). HEK-Lucia is also used TM RIG-I cells (these are HEK-Lucia cells that express high levels of human Rig-I TM Null cells) and HEK-Lucia TM Ineffective cells ( Figure 7 ) performed a cell-based assay to test ImmRNA. Cells were transfected with 100 nM immRNA, and for comparison, two commercially available RNA poly I:C and 3p-hpRNA (Everwin Genetics) were included in the assay. 3p-hpRNA is an in vitro transcribed RNA sequence from influenza A virus (H1N1) with a length of 87 nucleotides. 3p-hpRNA is a RIG-I specific agonist ( Figure 8 a and b).

[0251] To test the stability of OHYr16, poly I; C and 3p-hpRNA, HEK-Lucia TM RIG-I cells and THP1-Dual TM Prior to incubation of cells with these RNA molecules at room temperature in serum-free medium for 24, 48, 72, and 96 hours. The tested RNAs were stable in serum-free medium for up to 96 hours ( Fig. 9 a and 9b).

[0252] Example 8: Sequence modification to improve the biological activity of OHYr23

[0253] A number of sequence modifications were made to OHYr23 (SEQ ID NO: 37) and their effects on biological activity were tested using the MX1P luciferase reporter assay as a readout.

[0254] Location of immRNA kinks (nucleotide insertions) and nucleotide changes

[0255] OHYr23 (SEQ ID NO:37) does not have a kink. However, OHYr05 (SEQ ID NO:26), which is more effective than OHYr23 in IFN induction, has a kink created by the addition of a guanine to one side of the stem. We tested whether the position of the kink had an effect on immRNA function. We found that kinks closer to the end of the stem, including nucleotide positions 5 (OHYr10; SEQ ID NO:30), 19 (OHYr11; SEQ ID NO:31), and 21 (OHYr01; SEQ ID NO:27), reduced IFN production ( Fig.10 A). Therefore, a kink at nucleotide position 9 or higher of the stem is preferred to increase biological function. In addition, a kink at the 5' side of the hairpin performs better than a kink at the same distance from the stem on the 3' side of the hairpin (compare OHYr02 and OHYr05) ( Fig.10 B).

[0256] Next, we evaluated whether the biological activity of the immRNA is affected by the nature of the nucleotide at the kink position. We found that purines at kink position 9 (guanine in OHYr05 and adenine in OHYr16) performed better than pyrimidines at kink position 9 (uracil in OHYr17 and cytosine in OHYr18). Fig.10 C).

[0257] Effects of immRNA stem length on innate immune activation

[0258] To find out how immRNA stem length affects binding to RNA-binding molecules and subsequent downstream signaling, we compared immRNAs of different lengths. Fig.11 As shown in A, OHYr05 with a length of 10 nucleotides had the highest activity. It was also found that OHYr23 (10 nucleotides, Fig.11 ), OHYr06 (length 20 nucleotides, Fig.10 A) and OHYr08 (length 30 nucleotides, Fig.11 ). In contrast, the shorter constructs OHYr12 (6 nucleotides in length) and OHYr20 (9 nucleotides in length), as well as the longer constructs OHYr03 (11 nucleotides in length), OHYr07 (12 nucleotides in length), and OHYr13 (14 nucleotides in length) showed low or no biological activity ( Fig.11).

[0259] These data suggest that the stem length of 10 nucleotides is the most biologically active species, while shorter stems or longer stems outside the 10-nucleotide rule are less active.

[0260] Example 9: Antiviral effects of immRNA in human cells

[0261] Induction of IFN is one of several antiviral defense strategies of cells. To test whether the antiviral effector mechanism induced by immRNA can block subsequent infection, U937-DC-SIGN cells (monocytes stably expressing DC-SIGN) and the human lung fibroblast cell line A594 ( Fig.12 A) and subsequently infected with DENV ( Fig.12 B). As a negative control, a 3p10LG9 construct without 5' phosphorylation (G9neg) was used. The percentage of infected cells was quantified by flow cytometry using fluorescently labeled antibodies specific for E and NS1 proteins to detect intracellular infection. In both human cell lines, 3p10LG9 activated the IFN response more effectively than 3p10L in a dose-dependent manner.

[0262] To determine whether immRNA can inhibit DENV infection, we transfected U937-DC-SIGN cells and A549 cells with 3p10L and 3p10LG9 and infected the cells with DENV-2 24 h after transfection. The percentage of infected cells was quantified by flow cytometry using fluorescently labeled antibodies specific for E and NS1 proteins to detect intracellular viral proteins. In U937-DC-SIGN and A549 cells, 3p10LG9 and 3p10L reduced DENV infection in a dose-dependent manner, with 3p10LG9 being more effective than 3p10L ( Fig.12 C and 12D). Interestingly, transfection of U937-DC SIGN cells with either immRNA above 62 nM resulted in reduced efficacy of type I interferon production and diminished antiviral effects. Taken together, these results suggest that 3p10LG9 is more potent than 3p10L in inducing IFN signaling and antiviral responses to DENV2 infection in U937-DC and A549 human cell lines.

[0263] Example 10: Innate immune activation in ex vivo human antigen presenting cells (adjuvant effect)

[0264] Antigen presenting cells (APC) (including dendritic cells and macrophages) are important mediators for the generation of adaptive immune responses and immune memory. After infection or vaccination, APCs are activated by pathogen-associated molecular patterns (PAMPs) bound to pathogen recognition receptors (PRRs) on the surface or inside of APCs. RNA binding molecules RIG-I and MDA5 are examples of PRRs that can specifically target and activate APCs. In order to test the potential of immRNA to activate primary human cells via RIG-I, human skin is used as a model organ. Skin (from mastectomy) is one of the few organs that can be used for human research, and because it contains a large number of dendritic cell subsets and macrophages (which are representatives of APC populations in general human tissues), it is very valuable.

[0265] Healthy skin samples were processed to prepare single cell suspensions, which can be used for transfection with immRNA and downstream analysis. Methods for skin cell preparation and infection with DENV have been previously described (Cerny et al. (2014), PLoS Pathog. [Public Library of Science - Pathogens] 2014; 10(12): e1004548). CD14 + Dermal dendritic cells (DDC), CD11c + DDC、CD141 + DDCs and Langerhans cells (LCs) were distinguished by staining and gating strategies.

[0266] Efficient DENV infection of DCs in the skin suggests that they play an important role in the systemic spread of DENV. Infected DCs can carry the virus from the site of infection to secondary lymphoid organs, such as lymph nodes. To test whether immRNA can block infection of primary human skin cells, healthy skin samples were processed to prepare single cell suspensions for transfection with immRNA and subsequent flow cytometric analysis (Cerny et al., supra). A fluorescently labeled version of 3p10LG9 (3p10LG9-RED) that can be tracked by flow cytometry was first used to test which cells were most efficiently transfected with immRNA. All cell types were transfectable, with CD14 + DDCs were the most efficient uptakers, followed by CD11c + DDC and Langerhans cells, among which CD141 + DDC had the lowest uptake efficiency. When immRNA-RED was added to cells in the absence of transfection reagent, uptake was minimal, indicating that immRNA uptake by phagocytosis is minimal ( Fig. 20 ).

[0267] First, we tested which cells were most efficiently transfected using a fluorescently tagged version of OHYr05 (OHYr5-RED) that can be tracked by flow cytometry. All cell types were transfected, except for MP, CD14 + DDC and CD11c + Uptake was most efficient in DDC (data not shown). Uptake was minimal when immRNA-RED was added to cells in the absence of transfection reagent, indicating that uptake of immRNA by phagocytosis is minimal.

[0268] Example 11: Preventive and therapeutic antiviral effects of immRNA in ex vivo human APCs

[0269] It was tested whether human skin APC treated with immRNA had a protective effect against DENV infection. To this end, skin single cell suspensions were treated with 250nM, 125nM and 62nM of OHYr05 (SEQ ID NO: 26), OHYr23 (SEQ ID NO: 37) and OHYrNEG (SEQ ID NO: 26, without 5' phosphorylation), and then, after 24h, the supernatant was collected for ISRE-luciferase assay and cells were infected with DENV at MOI 5. 48h after infection, cells were stained for flow cytometry-based infection quantification (Cerny et al., supra). Based on the ISRE luciferase assay ( Fig.13 A), Prophylactic treatment of human skin APCs with 3p10LG9 more effectively induced type I IFN compared to those treated with 3p10L. Prophylactic treatment of human skin APCs with immRNA also protected cells from DENV infection in a dose-dependent manner. EC50 values ​​showed that 3p10LG9 had a significant inhibitory effect on CD11c compared to 3p10L. + DDC (3p10LG9: 13.6 nM, 3p10L: 81.0 nM), LC (3p10LG9: 15.5 nM, 3p10L: 123.3 nM) and CD14 + DDC (3p10LG9: 15.5 nM, 3p10L: 121.6 nM) was more effective in inducing antiviral responses ( Fig.13 B) At the lowest concentration tested (62 nM), 3p10LG9 was effective in reducing the expression of infected CD11c + DDC (p≤0.01) and CD14 + The number of DDCs (p≤0.05) was significantly more effective than 3p10L ( Fig.13 CE).

[0270] To determine whether immRNA could serve as a therapeutic against DENV-infected skin APCs, skin single cell suspensions were infected with DENV at an MOI of 5 and treated with 62 nM 3p10LG9 at 4 h, 6 h, and 24 h post-infection. Cells were stained 48 h post-infection for flow cytometry-based infection quantification. Since infection efficacy varied by up to 40% between individual skin samples, infections were normalized to G9neg controls starting at the 4 h post-infection time point. The inhibitory effect of 3p10LG9 was moderate overall. A significant reduction in infected cells following 3p10LG9 treatment was only seen in Langerhans cells, and only at the early time points of 4 h and 6 h post-infection ( Fig.14 B) At early time points, CD11c + DDC( Fig.14 A) and CD14 + DDC( Fig.14 The therapeutic effect seen in C) is smaller. When treated 24 h after infection, 3p10LG9 treated CD11c + The percentage of DDC cells tended to be higher than that of G9neg-treated cells. Without wishing to be bound by any theory, it is possible that the virus more effectively suppresses the antiviral response in this cell subset, disrupting the activity of the RIG-I ligand. In summary, these data suggest that 3p10LG9 has a modest therapeutic antiviral effect against DENV-2 infection in primary human skin APCs.

[0271] Example 12: Adjuvant activity of immRNA

[0272] RIG-I agonists, which are stimulators of innate immune cells, can be used as adjuvants for vaccines. To test the ability of immRNA to act as a vaccine adjuvant in vivo, mice were immunized with commercially available DENV-2 virus-like particles (VLPs) mixed with 3p10LG9 (SEQ ID NO: 26) by injecting the compound together with the transfection reagent JetPEI. As negative controls, VLPs mixed with 3p10Lneg (3p10LG9, without a triphosphate group at the 5' end) and VLPs without an adjuvant were used. VLPs were mixed with polyIC as a positive control. When 3p10LG9 was used in combination with VLPs as an adjuvant, the antibody response to the VLPs was increased compared to the formulation with G9neg ( Fig.15 Mice immunized with 3p10LG9-adjuvanted VLPs had reduced viral loads after challenge with dengue virus strain D2Y98P compared to the G9neg-treated group and the unadjuvanted VLP-treated group. Mice immunized with 3p10LG9-adjuvanted VLPs also had a survival advantage after challenge compared to the unadjuvanted VLP-treated group ( Fig.15 ).

[0273] In addition to the in vivo adjuvant activity, the adjuvant capacity of immRNA in human cells was also investigated: for this experiment, primary human skin antigen-presenting cells were treated with immRNA to upregulate the immune co-stimulatory molecule CD80 ( Fig.16 ).

[0274] 35 h after transfection, the activation profile of immRNA treatment was assessed by mRNA sequencing (RNAseq) of single and bulk sorted skin APC subsets. A total of 159 single APCs (combined CD11c + DDC、CD141 + DDC、CD14 + Principal component analysis of differentially expressed genes (DEGs) in 3G10LG9-treated cells and LCs clearly separated 3G10LG9- and G9neg-treated cells. In 3G10LG9-treated cells, the six most highly downregulated genes included the chemokine CXCL5 and the cytokine IL-1B, as well as ribosomal proteins (data not shown). The six most highly upregulated genes included five interferon-induced genes (ISG15, ISG20, IFI6, IFIT3, and IFITM3) and the immune cell homing chemokine receptor CCR7 ( Fig.17 To further assess transcriptome changes in more than one donor following immRNA activation, bulk-sorted skin APC subsets from five donors were sequenced. Similar to the single-cell analysis, CD14 + The cells were transcriptionally distinct from other APC subsets (data not shown). Nevertheless, there was a high degree of overlap in DEGs between cell types, suggesting that at least some immRNA-mediated activation is common to all skin APC subsets. At the same time, several of the top twelve DEGs identified in single-cell analysis were confirmed in bulk cell analysis (data not shown). A heat map of DEGs selected based on a defined set of genes associated with antiviral responses in host cells showed that various genes were upregulated for 3p10LG9-treated cells and pIC-treated cells. However, 3p10LG9 appears to be a stronger activator of antiviral host response genes compared to pIC. This may be related to the cell type-specific expression levels of RIG-I and TLR3 (ligands for immRNA and pIC). Ingenuity pathway analysis of the DEGs for each cell type showed that the top three pathways were common to each APC subset. However, other pathways are more cell type-specific, such as “Role of RIG-I-like receptors in antiviral innate immunity,” which is expressed in CD141 + This cell type, in turn, is not associated with the antigen presentation pathway.

[0275] These data highlight that immRNAs potently activate antiviral transcriptional programs in primary human APCs. This is important because APCs are known to play a key role in antiviral responses during natural infection.

[0276] Example 13: immRNA-mediated viral inhibition is RIG-I and type I IFN-dependent

[0277] We experimentally tested whether short hairpin immRNA molecules bind to RIG-I but not to MDA5. To this end, immRNA constructs were co-transfected with RIG-I overexpression plasmids or MDA5 overexpression plasmids in HEK293T cells, and found that 3p10LG9 activation of IFN signaling was significantly enhanced in the case of RIG-I overexpression, and this enhancement was greater when compared to MDA5 overexpression ( Fig.18 A). Next, RIG-I knockout (RIG-I KO) U937-DC-SIGN cells were generated using CRISPR-cas9-mediated gene knockdown using gRNA designed to target human RIG-I exon 1, and these cells were transfected with immRNA and G9neg. After transfection with 3p10LG9 or 3p10L, the expression of interferon-stimulated genes (ISGs) was significantly suppressed in RIG-I KO U937-DC SIGN cells ( Fig.18 B). This inhibitory effect was observed despite a slight increase in IFNB transcript levels in G9neg (control)-treated RIG-I KO cells (1.3-fold increase) compared to WT cells. DDX58 transcript levels were detectable despite the absence of protein because the primers used in RT-qPCR were designed for a region away from exon 1, which is the target region for disruption by the gRNA. DDX58 transcript levels were significantly higher in RIG-I KO G9neg control-treated cells (2.4-fold) compared to WT cells. However, this increase in baseline ISG levels in RIG-I KO cells had no significant effect on type I interferon activation, as there was no increase in luciferase signal detected in the ISRE luciferase assay ( Fig.19 A). These results indicate that 3p10LG9 is a more potent inducer of IFN-stimulated genes compared to the parental construct 3p10L and that upregulation of IFNs and ISGs is RIG-I-dependent. To determine whether the antiviral effect is RIG-I-dependent, WT and RIG-I KO U937-DC were treated prophylactically with immRNA or poly I:C (low or high molecular weight), and 24 hours later the cells were infected with DENV-2. Type I IFN activity was observed only with WT but not with RIG-I knockout U937-DC cells ( Fig.19A). RIG-I KO U937-DC cells showed a significantly higher percentage of DENV-2 infection compared to WT U937-DC cells. When pretreated with immRNA or poly I:C, DENV replication was significantly inhibited in WT but not in RIG-I KO U937-DCSIGN cells ( Fig.19 B and C), indicating that the observed antiviral effect is RIG-I dependent.

[0278] To determine whether the antiviral effects observed with 3p10LG9 were type I IFN-dependent, U937-DC SIGN cells were transfected with 3p10LG9 and an interferon alpha receptor (IFNAR) blocking antibody was used to prevent IFN activation by type I IFNs produced in response to RIG-I signaling. In the presence of anti-IFNAR antibodies, ISRE-induced luciferase signaling was effectively inhibited, demonstrating the functionality of the assay ( Fig.19 D). Importantly, anti-IFNAR blocking antibodies abolished the 3p10LG9 antiviral effect, and DENV-2 replication was as efficient as in G9neg-treated U937-DC SIGN cells ( Fig.19 E). In summary, the experiments show that the antiviral effect observed in U937-DC SIGN cells treated with 3p10LG9 is RIG-I and type I IFN signaling dependent.

[0279] Example 14: Cytotoxic effect of immRNA on cancer cell line A549

[0280] The immRNA 3p10LG9 (SEQ ID NO:26) and 3p10LA9 (SEQ ID NO:25) showed increasing cytotoxic effects with increasing concentrations. 3p10LG9 without 5' triphosphate served as a control and did not show any cytotoxic effect. This control excluded potential cytotoxic effects of the transfection procedure on the cells. For this experiment, A549 cells were seeded in 96-well plates. One day later, the cells were transfected with immRNA using 239fectin and incubated in an incubator at 37°C for 24h. CCK-8 reagent (Dongaren) was then added to the cells and incubated in the dark for 30 minutes before adding the stop solution. The colorimetric test depends on the dehydrogenase activity in living cells, and the OD value of each well is proportional to the number of living cells. The OD450 value was measured on a microplate reader ( Fig.21 ).

[0281] The invention has been described broadly and generically herein. Each of the narrower genus and subgeneric classifications that fall within the overall disclosure also forms a part of the invention. This includes the general description of the invention, with the proviso or negative limitation that removes any subject matter from that genus, regardless of whether the removed material is specifically stated herein. Other embodiments are within the scope of the following claims. In addition, when features or aspects of the invention are described in terms of Markush groups, those skilled in the art will recognize that the invention also thereby describes any individual or subgroup of individuals of the Markush group.

[0282] Those skilled in the art will readily appreciate that the present invention is well suited to achieve the objects and obtain the objects and advantages mentioned as well as those inherent therein. In addition, it will be apparent to those skilled in the art that various substitutions and modifications may be made to the invention disclosed herein without departing from the scope and spirit of the invention. The compositions, methods, procedures, treatments, molecules and specific compounds described herein currently represent preferred embodiments, are exemplary, and are not intended to limit the scope of the invention. Those skilled in the art will appreciate changes and other uses therein, which are included within the spirit of the invention as defined by the scope of the claims. The listing or discussion of previously published documents in this specification should not be considered as an admission that the documents are part of the prior art or are common general knowledge.

[0283] The invention exemplarily described herein can be appropriately implemented in the absence of any one or more elements, one or more limitations not specifically disclosed herein. Therefore, for example, the terms "comprise", "include", "contain", etc. should be interpreted broadly and without limitation. The word "comprise" or variations such as "include" or "contain" will therefore be understood to imply the inclusion of the whole or whole group, but do not exclude any other whole or whole group. In addition, the terms and expressions used herein are used as descriptive terms rather than restrictive terms, and there is no intention to exclude any equivalents or parts of the features shown and described when using these terms and expressions, but to recognize that various modifications can be within the scope of the present invention. Therefore, it should be understood that although the present invention has been specifically disclosed by exemplary embodiments and optional features, those skilled in the art can use modifications and variations of the invention disclosed therein herein, and it is believed that such modifications and variations are within the scope of the present invention.

[0284] The contents of all literature and patent documents cited herein are incorporated by reference. Sequence Listing <110> Nanyang Technological University A*STAR <120> Immunomodulatory small hairpin RNA molecules <130> P20113769WP <150> SG10201800434S <151> 2018-01-17 <160> 55 <170> PatentIn version 3.5 <210> 1 <211> 11 <212> RNA <213> Artificial Sequence <220> <223> X1 sequence <220> <221> Features not yet classified <222> (4)..(5) <223> n is a, c, g, or u <400> 1 rrrnnyyyry y 11 <210> 2 <211> 11 <212> RNA <213> Artificial Sequence <220> <223> X1 sequence <400> 2 sswwwwssrs s 11 <210> 3 <211> 11 <212> RNA <213> Artificial Sequence <220> <223> X1 sequence <220> <221> Features not yet classified <222> (4)..(11) <223> n is a, c, g, or u <400> 3 ggannnnnnn n 11 <210> 4 <211> 11 <212> RNA <213> Artificial Sequence <220> <223> X1 sequence <220> <221> Features not yet classified <222> (4)..(9) <223> n is a, c, g, or u <400> 4 ggannnnnnc c 11 <210> 5 <211> 11 <212> RNA <213> Artificial Sequence <220> <223> X1 sequence <220> <221> Features not yet classified <222> (4)..(5) <223> n is a, c, g, or u <220> <221> Features not yet classified <222> (7) <223> n is a, c, g, or u <220> <221> Features not yet classified <222> (9)..(9) <223> n is a, c, g, or u <400> 5 ggannuncnc c 11 <210> 6 <211> 11 <212> RNA <213> Artificial Sequence <220> <223> X1 sequence <220> <221> Features not yet classified <222> (9)..(9) <223> n is a, c, g, or u <400> 6 ggawwuscnc c 11 <210> 7 <211> 11 <212> RNA <213> Artificial Sequence <220> <223> X1 sequence <400> 7 ggauuuccrc c 11 <210> 8 <211> 11 <212> RNA <213> Artificial Sequence <220> <223> X1 sequence <400> 8 ggauuuccac c 11 <210> 9 <211> 11 <212> RNA <213> Artificial Sequence <220> <223> X1 sequence <400> 9 ggauuuccgc c 11 <210> 10 <211> 10 <212> RNA <213> Artificial Sequence <220> <223> X2 Sequence <220> <221> Features not yet classified <222> (6)..(7) <223> n is a, c, g, or u <400> 10 rrrrrnnyyy 10 <210> 11 <211> 10 <212> RNA <213> Artificial Sequence <220> <223> X2 Sequence <400> 11 sssswwwwss 10 <210> 12 <211> 10 <212> RNA <213> Artificial Sequence <220> <223> X2 Sequence <220> <221> Features not yet classified <222> (1)..(7) <223> n is a, c, g, or u <400> 12 nnnnnnnucc 10 <210> 13 <211> 10 <212> RNA <213> Artificial Sequence <220> <223> X2 Sequence <220> <221> Features not yet classified <222> (3)..(7) <223> n is a, c, g, or u <400> 13 ggnnnnnucc 10 <210> 14 <211> 10 <212> RNA <213> Artificial Sequence <220> <223> X2 Sequence <220> <221> Features not yet classified <222> (4) <223> n is a, c, g, or u <220> <221> Features not yet classified <222> (6)..(7) <223> n is a, c, g, or u <400> 14 gggnannucc 10 <210> 15 <211> 10 <212> RNA <213> Artificial Sequence <220> <223> X2 Sequence <400> 15 gggwawwucc 10 <210> 16 <211> 10 <212> RNA <213> Artificial Sequence <220> <223> X2 Sequence <400> 16 ggggaaaucc 10 <210> 17 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> shRNA <220> <221> Features not yet classified <222> (4)..(5) <223> n is a, c, g, or u <220> <221> Features not yet classified <222> (21)..(22) <223> n is a, c, g, or u <400> 17 rrrnnyyyry yuucgrrrrr nnyyy 25 <210> 18 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> shRNA <400> 18 sswwwwssrs suucgssssw wwwss 25 <210> 19 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> shRNA <220> <221> Features not yet classified <222> (4)..(11) <223> n is a, c, g, or u <220> <221> Features not yet classified <222> (16)..(22) <223> n is a, c, g, or u <400> 19 ggannnnnnn nuucgnnnnn nnucc 25 <210> 20 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> shRNA <220> <221> Features not yet classified <222> (4)..(9) <223> n is a, c, g, or u <220> <221> Features not yet classified <222> (18)..(22) <223> n is a, c, g, or u <400> 20 ggannnnnnccuucgggnnnnnucc 25 <210> twenty one <211> 25 <212> RNA <213> Artificial Sequence <220> <223> shRNA <220> <221> Features not yet classified <222> (4)..(5) <223> n is a, c, g, or u <220> <221> Features not yet classified <222> (7) <223> n is a, c, g, or u <220> <221> Features not yet classified <222> (9)..(9) <223> n is a, c, g, or u <220> <221> Features not yet classified <222> (19)..(19) <223> n is a, c, g, or u <220> <221> Features not yet classified <222> (21)..(22) <223> n is a, c, g, or u <400> twenty one ggannuncnccuucgggggnannucc 25 <210> twenty two <211> 25 <212> RNA <213> Artificial Sequence <220> <223> shRNA <220> <221> Features not yet classified <222> (9)..(9) <223> n is a, c, g, or u <400> 22 ggawwuscnc cuucggggwa wwucc 25 <210> 23 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> shRNA <220> <221> Unclassified feature <222> (9)..(9) <223> n is a, c, g, or u <400> 23 ggauuuccnc cuucggggga aaucc 25 <210> 24 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> shRNA <400> 24 ggauuuccrc cuucggggga aaucc 25 <210> 25 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> OHYr16 / 3p10LA9 <400> 25 ggauuuccac cuucggggga aaucc 25 <210> 26 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> OHYr05 / 3p10LG9 <400> 26 ggauuuccgc cuucggggga aaucc 25 <210> 27 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> OHYr01 / 3p10LG21 <400> 27 ggagguuucc uucgggaaac gcucc 25 <210> 28 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> OHYr02 / 3p10LG17 <400> 28 ggauuucggc uucggcgcga aaucc 25 <210> 29 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> OHYr04 / 3p10LG7 <400> 29 ggauucgcuc cuucgggagg aaucc 25 <210> 30 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> OHYr10 / 3p10LG5 <400> 30 ggacgcuuuc cuucgggaaa ggucc 25 <210> 31 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> OHYr11 / p310LG19 <400> 31 ggauuggucc uucgggacgc aaucc 25 <210> 32 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> OHYr14 / 3p10LG8 <400> 32 ggauuucgcc cuucggggga aaucc 25 <210> 33 <211> 16 <212> RNA <213> Artificial Sequence <220> <223> OHYr12 <400> 33 ggacgcuucg gcgucc 16 <210> 34 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> OHYr09 <400> 34 ggacgugcuu cggcacgucc 20 <210> 35 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> OHYr20 <400> 35 ggauuucccu ucggggaaau cc 22 <210> 36 <211> 26 <212> RNA <213> Artificial Sequence <220> <223> OHYr03 <400> 36 ggauuucgcg cuucggcgcg aaaucc 26 <210> 37 <211> 24 <212> RNA <213> Artificial Sequence <220> <223> OHYr23 / 3p10L <400> 37 ggacguacgu uucgacguac gucc 24 <210> 38 <211> 28 <212> RNA <213> Artificial Sequence <220> <223> OHYr07 <400> 38 ggacguacgu gcuucggcac guacgucc 28 <210> 39 <211> 32 <212> RNA <213> Artificial Sequence <220> <223> OHYr13 <400> 39 ggacguacgu acgcuucggc guacguacgu cc 32 <210> 40 <211> 44 <212> RNA <213> Artificial Sequence <220> <223> OHYr06 <400> 40 ggacguacgu acguacgugc uucggcacgu acguacguac gucc 44 <210> 41 <211> 64 <212> RNA <213> Artificial Sequence <220> <223> OHYr08 <400> 41 ggacguacgu acgugcacgu acguacgugc uucggcacgu acguacgugc acguacguac 60 gucc 64 <210> 42 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> OHYr17 / 3p10LU9 <400> 42 ggauuucaua cuucgguuga aaucc 25 <210> 43 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> OHYr18 / 3p10LC9 <400> 43 ggauuucgcg cuucggccga aaucc 25 <210> 44 <211> 24 <212> RNA <213> Artificial Sequence <220> <223> OHYr21 <400> 44 ggauuucccc uucgggggaa aucc 24 <210> 45 <211> twenty four <212> RNA <213> Artificial Sequence <220> <223> OHYr22 <400> 45 ggagggaaac uucgguuucc cucc 24 <210> 46 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primers <400> 46 ggagggaaac gaaactagcc 20 <210> 47 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primers <400> 47 gctcctcaaa ctctggcaac 20 <210> 48 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> IFNB positive sense primer <400> 48 ctctcctgtt gtgcttctcc 20 <210> 49 <211> twenty two <212> DNA <213> Artificial Sequence <220> <223> IFNB antisense primer <400> 49 gtcaaagttc atcctgtcct tg 22 <210> 50 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ACTB sense primer <400> 50 tcgtgcgtga cattaaggag 20 <210> 51 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ACTB antisense primer <400> 51 gtcaggcagc tcgtagctct 20 <210> 52 <211> twenty two <212> DNA <213> Artificial Sequence <220> <223> DDX58 positive sense primer <400> 52 gccattacac tgtgcttgga ga 22 <210> 53 <211> twenty two <212> DNA <213> Artificial Sequence <220> <223> DDX58 antisense primer <400> 53 ccagttgcaa tatcctccac ca 22 <210> 54 <211> twenty three <212> DNA <213> Artificial Sequence <220> <223> RSAD2 positive sense primer <400> 54 cacaaagaag tgtcctgctt ggt 23 <210> 55 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> RSAD2 antisense primer <400> 55 aagcgcatat attcatccag aataag 26

Claims

1. A shRNA molecule having the following structure in the 5' to 3' direction, X1-L-X2, in, X1 and X2 are each nucleotide sequences having the same length, excluding single nucleotide insertions that generate kinks, of 10 nucleotides in length, and have complete complementarity with each other to form a double-stranded stem structure; L is a nucleotide sequence forming a loop region and consists of the nucleotide sequence UUCG; The first nucleotide at the 5' end of X1 is designated as n1 and is di- or tri-phosphorylated, and the last nucleotide at the 3' end of X2 is designated as nx, where x is the integer 25; The shRNA molecule comprises a single nucleotide insertion at position n9 in X1, the single nucleotide insertion remains unpaired in the double-stranded stem structure and creates a kink, and wherein the single nucleotide insertion is a purine nucleotide selected from G and A, wherein the shRNA molecule specifically binds to human retinoic acid-inducible gene I receptor, wherein X1 consists of the nucleotide sequence ggauuuccacc (SEQ ID NO: 8) or ggauuuccgcc (SEQ ID NO: 9), and X2 consists of the nucleotide sequence ggggaaaucc (SEQ ID NO: 16).

2. The shRNA molecule of claim 1, wherein the nucleotide at the 5' end is triphosphorylated.

3. The shRNA molecule of claim 1 or 2, wherein the shRNA molecule is blunt-ended.

4. The shRNA molecule of claim 1, wherein X1 consists of the nucleotide sequence ggauuuccgcc (SEQ ID NO: 9).

5. The shRNA molecule of claim 1, wherein the shRNA molecule consists of the nucleotide sequence ggauuuccaccuucgggggaaaucc (SEQ ID NO: 25).

6. The shRNA molecule of claim 1, wherein the shRNA molecule consists of the nucleotide sequence ggauuuccgccuucgggggaaaucc (SEQ ID NO: 26).

7. The shRNA molecule of claim 1, wherein the RNA is phosphorothioate RNA or is modified with a 2'-fluoro group.

8. A composition comprising the shRNA molecule according to any one of claims 1 to 6.

9. The composition of claim 8, wherein the composition comprises a plurality of shRNA molecules according to any one of claims 1-6.

10. The composition of claim 8 or 9, wherein the composition is a pharmaceutical composition.

11. The composition of claim 9, wherein the composition is an immunostimulatory composition.

12. The composition of claim 11, wherein the immunostimulatory composition is a vaccine composition further comprising a vaccine, and wherein one or more of the shRNA molecules is an adjuvant.

13. The composition of claim 10, wherein the composition is an antiviral composition.

14. The composition of claim 10, wherein the composition is an anti-cancer composition.

15. The composition of claim 8, further comprising one or more excipients.

16. Use of an effective amount of the shRNA molecule according to any one of claims 1 to 7 or the composition according to any one of claims 8 to 12 or 15 in the preparation of a medicament for preventing or treating dengue virus infection in a subject in need thereof.

17. Use of an effective amount of the shRNA molecule according to any one of claims 1 to 7 or the composition according to any one of claims 8 to 11 or 13 to 15 in the preparation of a medicament for preventing or treating non-small cell lung cancer in a subject in need thereof.

18. The use according to claim 16 or 17, wherein the drug is administered topically or systemically.

19. A method for modifying shRNA molecules in vitro, wherein the small hairpin RNA (shRNA) molecule has the following structure in the 5' to 3' direction, X1-L-X2, in X1 and X2 are each nucleotide sequences having the same length, excluding single nucleotide insertions that generate kinks, of 10 nucleotides in length, and have complete complementarity with each other to form a double-stranded stem structure; L is a nucleotide sequence forming a loop region and consists of the nucleotide sequence UUCG; The first nucleotide at the 5' end of X1 is named n1 and the last nucleotide at the 3' end of X2 is named nx, where x is the integer 25; The method comprises introducing a single nucleotide insertion at position n9 in X1, wherein the single nucleotide insertion remains unpaired in the double-stranded stem structure to generate a kink, and wherein the single nucleotide insertion is a purine nucleotide selected from G and A, wherein the shRNA molecule specifically binds to human retinoic acid-inducible gene I receptor, wherein X1 consists of the nucleotide sequence ggauuuccacc (SEQ ID NO: 8) or ggauuuccgcc (SEQ ID NO: 9), and X2 consists of the nucleotide sequence ggggaaaucc (SEQ ID NO: 16).

Images