Analysis and diagnosis methods using RNA modifications

Abstract

The present application provides a novel method for analyzing biological or medical states. The present invention is based on the discovery that RNA modification information can be used in the analysis of biological or medical states, and provides a novel method for analyzing biological or medical states. The present invention can analyze various biological or medical states including diseases, and can fully predict early cancers (e.g., pancreatic cancer, colorectal cancer, gastric cancer, etc.).

Description

Technical Field

[0001] The present invention relates to a method for characterizing and classifying biological objects. More specifically, the present invention relates to a method for classifying and characterizing biological objects based on modification information on RNA. Background Art

[0002] Like deoxyribonucleic acid (DNA), ribonucleic acid (RNA) is a molecule that carries information possessed by living things. It is well known that DNA is modified by methylation and the function thereof is controlled, and in recent years, examples of modifications also occurring in RNA have been reported.

[0003] In order to analyze various biological conditions including diseases, attempts have been made to associate information such as DNA mutations, mRNA expression levels, and protein expression levels with biological conditions. However, even using this information, there are many cases where early-stage cancers and the like cannot be fully predicted.

[0004] Prior art literature

[0005] Non-patent literature

[0006] Non-patent literature 1: Pagliarini DJ, Cell Metab. 2016 Jul 12; 24(1): 13-4. doi: 10.1016 / j.cmet.2016.06.018. Summary of the invention

[0007] Solutions for solving problems

[0008] The present invention provides a new method for analyzing a biological state or a medical state based on the discovery that RNA modification information can be used in the analysis of a biological state or a medical state.

[0009] Therefore, the present invention provides the following solutions.

[0010] (Diagnostic Method)

[0011] (Item A1) A method for analyzing a state of an object, comprising: an acquisition step of acquiring modification information <RNA mod> on at least one RNA in the object; and a step of analyzing the state of the object based on the modification information.

[0012] (Item A2) The method according to any one of the above items, wherein the RNA includes microRNA.

[0013] (Item A3) The method according to any one of the above items, wherein the modification comprises methylation.

[0014] (Item A3-1) The method according to any one of the above items, wherein the modification comprises methylation on a nucleoside.

[0015] (Item A3-2) The method according to any one of the above items, wherein the modification includes methylation on a nucleic acid base.

[0016] (Item A4) The method according to any one of the above items, wherein the modification on the above RNA includes methylation of microRNA.

[0017] (Item A4-1) The method according to any one of the above items, wherein the modification information on the above RNA includes methylation on nucleosides of the microRNA.

[0018] (Item A4-2) The method according to any one of the above items, wherein the modification information on the above RNA includes methylation on the nucleic acid base of the microRNA.

[0019] (Item A5) The method according to any one of the above items, wherein the modification is m 6 A.

[0020] (Item A6) The method according to any one of the above items, wherein the modification information includes modification position information.

[0021] (Item A7) The method according to any one of the above items, wherein the modification information includes information on the amount of modified RNA.

[0022] (state)

[0023] (Item A8) The method according to any one of the above items, wherein the condition is a medical condition or a biological condition.

[0024] (Item A9) The method according to any one of the above items, wherein the state is a state of microorganisms (eg, intestinal bacteria, epidermal bacteria) in the above object.

[0025] (Item A10) The method according to any one of the above items, wherein the biological state is aging or a differentiation state of cells.

[0026] (Item A11) A method according to any one of the above items, wherein the above medical condition includes cancer, inflammatory bowel disease or intestinal immunity.

[0027] (Item A12) The method according to any one of the above items, wherein the above cancer includes at least one of pancreatic cancer (such as early pancreatic cancer), liver cancer, gallbladder cancer, bile duct cancer, gastric cancer and colon cancer.

[0028] (Item A13) The method according to any one of the above items, wherein the state is the responsiveness of the subject to a drug or treatment.

[0029] (Medicine, treatment)

[0030] (Item A14) The method according to any one of the above items, wherein the treatment is radiation treatment or surgery.

[0031] (Item A15) The method according to any one of the above items, wherein the treatment is treatment using heavy particle beams (such as Carbon / HIMAC) or X-rays.

[0032] (Item A16) The method according to any one of the above items, wherein the above-mentioned drug is an anticancer drug, a molecular targeted drug, an antibody drug, a biological agent (such as a nucleic acid, a protein), or an antibiotic.

[0033] (Item A17) The method according to any one of the above items, wherein the drug is Lonsurf (TAS102), gemcitabine, CDDP, 5-FU, cetuximab, a nucleic acid drug or a histone demethylase inhibitor.

[0034] (Item A18) The method according to any one of the above items, wherein the drug is an anticancer drug, and the responsiveness includes a responsiveness of whether the subject has resistance to the anticancer drug.

[0035] (Item A19) The method according to any one of the above items, wherein a drug for treating the object and / or a treatment for the object is indicated based on the reactivity.

[0036] (Item A20) The method according to any one of the above items, wherein a drug for treating the above condition is indicated from among the plurality of drugs based on the above reactivity with respect to the plurality of drugs.

[0037] (Item A21) The method according to any one of the above items, wherein the analysis is based on comparison of the modification information of the subject before and after administration of the drug or the treatment.

[0038] (Nearby Information)

[0039] (Item A22) A method according to any one of the above items, which includes a step of analyzing the above-mentioned state of the above-mentioned object based on at least one information selected from a group consisting of the following information, wherein the above-mentioned information is the age, gender, race, ancestry information, medical history, treatment history, smoking status, drinking status, occupational information, living environment information, disease marker information, nucleic acid information (including nucleic acid information of bacteria in the above-mentioned object), metabolite information, protein information, intestinal bacteria information, epidermal bacteria information and any combination of these.

[0040] (Item A23) A method according to any one of the above items, wherein the above nucleic acid information is selected from the group consisting of genomic information, epigenetic information, transcriptome expression level information, RIP sequencing information, microRNA expression level information and a combination of any of these.

[0041] (Item A24) A method according to any one of the above items, wherein the RIP sequencing information includes RIP sequencing information of drug resistance pump P-glycoprotein.

[0042] (Item A25) A method according to any one of the above items, wherein the RIP sequencing information includes RIP sequencing information of feces of the subject.

[0043] (Item A26) The method according to any one of the above items, wherein the RIP sequencing information includes RIP sequencing information of Escherichia coli in feces of the subject.

[0044] (Additional information about modification information)

[0045] (Item A27-1) A method according to any one of the above items, comprising the step of analyzing the above state of the above object based on modification information on the above RNA in a resistant strain that is resistant to a drug or treatment, or in a combination of the resistant strain and a cell strain from which the resistant strain is derived.

[0046] (Item A27-2) A method according to any one of the above items, wherein the above-mentioned agent or treatment includes treatment using Lonsurf (TAS102), gemcitabine, CDDP, 5-FU, cetuximab, nucleic acid drugs, histone demethylase inhibitors, or heavy particle radiation (such as Carbon / HIMAC) or X-rays.

[0047] (Item A28) A method according to any one of the above items, wherein modification information on at least 2,000 types of RNA is analyzed.

[0048] (Item A29) A method according to any one of the above items, comprising the step of calculating the probability of the above state based on the plurality of the above modification information.

[0049] (Item A30) A method according to any one of the above items, wherein the modification information includes a plurality of modification information on RNA containing the same sequence.

[0050] (Item A31) A method according to any one of the above items, further comprising the step of analyzing the state of the object based on structural information of RNA.

[0051] (Item A32-1) A method according to any one of the above items, which includes a step of analyzing the above state of the above object based on the modification information of RNA in an organism, wherein the organism is knocked out of at least one of a methylase (such as Mettl3, Mettl14, Wtap), a demethylase (such as FTO, AlkBH5) and a methylation recognition enzyme (such as YTHDF1, YTHDF2, YTHDF3, etc., family molecules with a YTH domain).

[0052] (Item A32-2) A method according to any one of the above items, which includes a step of analyzing the above state of the above object based on at least one recognition motif information in methylases (such as Mettl3, Mettl14, Wtap), demethylases (such as FTO, AlkBH5) and methylation recognition enzymes (such as YTHDF1, YTHDF2, YTHDF3 and other family molecules with YTH domain).

[0053] (Item A33) A method according to any one of the above items, comprising the step of performing a principal component analysis.

[0054] (Sample)

[0055] (Item A34) <Analysis service of samples obtained using commercially available kits>

[0056] The method according to any one of the above items, wherein the modification information is obtained from a delivered sample derived from the target.

[0057] (Item A35) A method according to any one of the above items, wherein the sample is transported frozen.

[0058] (Item A36) The method according to any one of the above items, wherein the sample obtained from the object on site is analyzed on site.

[0059] (Item A37-1) A method according to any one of the above items, wherein the sample includes at least one of blood, a biopsy sample (such as a liquid biopsy sample), oral mucosa, saliva, sweat, tears, urine, feces or skin epidermis.

[0060] (Item A37-2) A method according to any one of the above items, wherein the above RNA includes RNA derived from a microorganism in the above object.

[0061] (purification)

[0062] (Item A38) The method according to any one of the above items, comprising the step of purifying the above RNA by purification means.

[0063] (Item A39) A method according to any one of the above items, comprising a step of purifying the modified RNA.

[0064] (Item A40) The method according to any one of the above items, wherein the purification means comprises a nucleic acid that is at least partially complementary to the RNA.

[0065] (Item A41) The method according to any one of the above items, wherein the purification means comprises an antibody.

[0066] (Item A42) The method according to any one of the above items, wherein the antibody is specific for the modification.

[0067] (Item A43) The method according to any one of the above items, wherein the antibody is specific for the RNA.

[0068] (Item A44) The method according to any one of the above items, wherein the antibody is specific for the modified RNA.

[0069] (Item A45) The method according to any one of the above items, wherein the purification means is arranged at a predetermined position on the plate.

[0070] (Item A46) The method according to any one of the above items, wherein the predetermined position of the plate is determined by a Monte Carlo method.

[0071] (Measurement method)

[0072] (Item A47) The method according to any one of the above items, wherein the modification information is obtained by PCR.

[0073] (Item A48) The method according to any one of the above items, wherein the modification information is obtained by mass spectrometry.

[0074] (Item A49) The method according to any one of the above items, wherein the modification information is obtained by MALDI-MS.

[0075] (Pretreatment of measurement)

[0076] (Item A50) The method according to any one of the above items, comprising the step of treating the RNA with bromoacetaldehyde or chloroacetaldehyde.

[0077] (Item A51) The method according to any one of the above items, wherein a coating agent containing 3-hydroxypicolinic acid is used.

[0078] (Food Inspection Methods)

[0079] (Item B1) The method according to any one of the above items, wherein the object is a food.

[0080] (Item B2) The method according to any one of the above items, wherein the food is meat.

[0081] (Item B3) The method according to any one of the above items, wherein the state of the object is the quality of food.

[0082] (Item B4) The method according to any one of the above items, wherein the quality of the above food is the origin, age, time after processing, denaturation after processing, taste quality, active oxygen status, fatty acid status or maturity of the food.

[0083] (Item B5) The method according to any one of the above items, further comprising the step of analyzing the state of the subject based on information on metabolites.

[0084] (Species classification method)

[0085] (Item C1) The method according to any one of the above items, wherein the state is a species classification.

[0086] (Item C2) The method according to any one of the above items, wherein the state is the species classification of at least one microorganism in the microorganism population.

[0087] (Item C3) The method according to any one of the above items, wherein the state is the species classification of Koji yeast.

[0088] (system)

[0089] (Item D1) A system for determining a state of an object based on RNA modification information, comprising:

[0090] a measuring unit for measuring the modification state of RNA;

[0091] A calculation unit that calculates the modification state on the RNA based on the result of the measurement; and

[0092] An analyzing / determining unit analyzes and determines the state of the object based on the modified state.

[0093] (Item D2) The system according to any one of the above items, wherein the measuring unit is a mass spectrometer.

[0094] (Item D3) The system according to any one of the above items, wherein the measuring unit is MALDI-MS.

[0095] (Item D4) The system according to any one of the above items, comprising the features according to any one of items A2 to A12.

[0096] (Measurement equipment (flat plate))

[0097] (Item E1) A device for determining a state of an object based on modification information of RNA,

[0098] The device includes a configuration unit for configuring at least one RNA purified from a sample from the subject,

[0099] The configuration unit is configured to provide modification information on the at least one RNA in a manner that is read by a detector,

[0100] The state of the object is determined based on the modification information.

[0101] (Item E2) An apparatus according to any one of the above items, which is used for mass spectrometry.

[0102] (Item E3) The apparatus according to any one of the above items, which is used for MALDI-MS.

[0103] (Concentration beads)

[0104] (Item F1) A composition for purifying RNA to determine the state of a target based on modification information of the RNA,

[0105] The composition comprises means for capturing at least one RNA in the subject,

[0106] The captured RNA is characterized in that it provides modification information on the RNA by being read by a detector.

[0107] The state of the object is determined based on the modification information.

[0108] (Item F2) The composition according to any one of the above items, wherein the means comprises a nucleic acid that is at least partially complementary to the RNA.

[0109] (Item F3) The composition according to any one of the above items, wherein the above means is a means for capturing modified RNA.

[0110] (Item F4) The composition according to any one of the above items, wherein the means comprises a molecule specific for the modified RNA.

[0111] (Item F5) The composition according to any one of the above items, wherein the means comprises a molecule specific for the modified RNA.

[0112] (Item F6) The composition according to any one of the above items, wherein the molecule comprises an antibody.

[0113] (Item F7) The composition according to any one of the above items, wherein the means comprises a magnetic carrier.

[0114] (Reagent test kit)

[0115] (Item H1) A kit for determining the state of a subject based on RNA modification information,

[0116] The kit comprises at least one of the composition described in any one of the above items and an apparatus for obtaining a sample from the subject, and instructions for using at least one of the composition and the apparatus.

[0117] (Item H2) The kit according to any one of the above items, further comprising the device according to any one of the above items.

[0118] (Item H3) The kit according to any one of the above items, further comprising a coating agent for coating on the RNA, wherein the RNA is disposed in the above device.

[0119] (Item H4) The kit according to any one of the above items, wherein the coating agent contains 3-hydroxypicolinic acid.

[0120] (Item H5) The kit according to any one of the above items, wherein the kit indicates a delivery address for the sample.

[0121] (Item H6) A kit according to any one of the above items, wherein the sample comprises at least one of blood, a biopsy sample such as a liquid biopsy sample, oral mucosa, saliva, sweat, tears, urine, feces, or skin epidermis.

[0122] (program)

[0123] (Item I1) A program for determining a state of an object based on modification information of RNA, the program being constructed in a manner of executing the following steps: a step of comparing modification information on at least one RNA of the object with reference modification information of the RNA; and a step of determining the state of the object based on an output result of the comparison step.

[0124] (Item I2) A program according to any one of the above items, wherein the reference modification information is constructed based on modification information on the RNA in an object different from the object.

[0125] (Item I3) A program according to any one of the above items, wherein the reference modification information is modification information on the RNA of the object acquired at a time different from the modification information.

[0126] (Method of using resistant strains)

[0127] (Item J1) A method for determining modification information of RNA related to resistance to a drug, the method comprising the step of obtaining modification information on at least one RNA derived from a cell line resistant to the drug, wherein the method determines that the modification information on the RNA is related to resistance to the drug when comparing the modification information on the RNA between a cell line having the resistance and a cell line derived from a cell line having the resistance and observing the difference.

[0128] (Item J2) The method according to any one of the above items, wherein a combination of differences in a plurality of modification information on a plurality of RNAs is determined to be associated with resistance to the above-mentioned drug.

[0129] In the present invention, it is intended that further combinations may be provided based on the explicit combinations of one or more features described above. If the following detailed description is read and understood as needed, further embodiments and advantages of the present invention may be known to those skilled in the art.

[0130] Effects of the Invention

[0131] According to the present invention, the state of a subject (biological state or medical state) can be analyzed and predicted based on RNA modification information by a method different from conventional ones. BRIEF DESCRIPTION OF THE DRAWINGS

[0132] Figure 1 This is a diagram showing the results of MALDI-TOF / TOF measurement of synthetic microRNA 200-c-5p. Series of both 3' terminal fragments and 5' terminal fragments were observed.

[0133] Figure 2 This is a diagram showing the results of MALDI-TOF / TOF measurement of DNA double strands of a synthetic oligo DNA having a sequence complementary to microRNA-369-3p and its antisense synthetic DNA.

[0134] Figure 3 It is a figure which shows the result of MALDI-TOF / TOF measurement of double-stranded synthetic miR-369.

[0135] Figure 4 This figure shows the results of MALDI-TOF / TOF measurement of a precursor corresponding to miR-369 in RNA of cultured cells, which was selected and fragmented by ISD.

[0136] Figure 5 The graph shows the intensity of MS signals of methylated miR-21-5p (upper) and let-7a-5p (lower) for normal tissue and tumor tissue. The m / z at the arrow position is the signal from the methylated RNA fragment. The vertical axis represents the signal intensity measured by the mass spectrometer.

[0137] Figure 6 The graph shows the intensity of the MS signal of methylated miR-200c-3p (upper) and miR-200c-5p (lower) for normal tissue and tumor tissue. The m / z at the arrow position is the signal from the methylated RNA fragment. The vertical axis represents the signal intensity measured by the mass spectrometer.

[0138] Figure 7 The figure shows the intensity of the MS signal of methylated miR-17c-5p for normal tissue and tumor tissue. The m / z at the position of the arrow is the signal from the methylated RNA fragment. The vertical axis represents the signal intensity measured by the mass spectrometer.

[0139] Figure 8 The graphs show the ratio (%) of methylated RNA in RNA of the comparison sequence between normal tissue and tumor tissue of the large intestine and the RNA expression level (bottom) for miR-200c-3p, miR-21-5p, miR-let7a-5p and miR-17-5p. NS indicates no significant difference.

[0140] Fig. 9This is a diagram showing the MS signal of miR-200c-5p indicating the presence of methylation. Ammonia treatment was performed to confirm the internal sequence. The width of the two arrows indicates the mass difference of the corresponding nucleotides detected.

[0141] Fig.10 Comparison of the methylation rates of miR-21-5p, miR-17-5p, let7a-5p, and miR-200c-5p in samples obtained before primary tumor resection (Before) and samples obtained when metastasis was found (After) from human colorectal cancer patients with metastasis found 1 to 2 years after primary tumor resection, and serum samples from patients with inflammatory bowel disease (IBD) and Crohn's disease (Crohn). The vertical axis represents the methylation rate of the target miRNA measured by mass spectrometry.

[0142] Fig.11 (c) shows the mass spectra of miR-17 and let-7a obtained from pancreatic cancer patient-derived tissues, indicating that both methylated and unmethylated peaks were detected. (d) shows the positions of modified nucleotides in each miRNA.

[0143] Fig.12 This is a methylation analysis of let-17a concentrated from a serum sample from a pancreatic cancer patient using MALDI-TOF-MS / MS. The upper part shows the analysis results of the parent ion (MS analysis), indicating that both methylated and unmethylated peaks were detected. The lower part shows the analysis results of the fragment ions (12 to 19 bases) (MS / MS analysis), indicating that methylation occurred at the 19th position adenine.

[0144] Fig.13 This is a methylation analysis of miR-17 concentrated from serum samples of pancreatic cancer patients using MALDI-TOF-MS / MS. The upper part shows the analysis results of the parent ion (MS analysis), indicating that both methylated and unmethylated peaks were detected. The lower part shows the analysis results of the fragment ions (11 to 20 bases) (MS / MS analysis), indicating that methylation occurred at the 13th position adenine.

[0145] Fig.14 This is a methylation analysis of miR-21 concentrated from serum samples of pancreatic cancer patients using MALDI-TOF-MS / MS. The upper part shows the analysis results of the parent ion (MS analysis), indicating that both methylated and unmethylated peaks were detected. The lower part shows the analysis results of the fragment ions (5 to 11 bases) (MS / MS analysis), indicating that methylation occurred at the 9th cytosine.

[0146] Fig.15 This is a methylation analysis of miR-200c obtained by concentrating serum samples from pancreatic cancer patients using MALDI-TOF-MS / MS. The upper part shows the analysis results of the parent ion (MS analysis), indicating that both methylated and unmethylated peaks were detected. The lower part shows the analysis results of the fragment ions (bases 4 to 10) (MS / MS analysis), indicating that methylation occurred at cytosine at position 9.

[0147] Fig.16 The methylation levels of miRNAs are upregulated in pancreatic cancer tissues. (a, b) show the comparison of the methylation levels of miR-17 (a) and let-7a (b) in normal tissues (n=12, left) and pancreatic cancer tissues (n=12, right) of pancreatic cancer patients. *P<0.01 (t test). (c, d) show the comparison of the methylation levels of miR-17 (c) and let-7a (d) in the serum obtained from healthy controls (n=5, left) and pancreatic cancer patients (n=5, right). The serum of the healthy controls was obtained from liver transplant donors who were confirmed to be tumor-free by endoscopy, CT, and detection of several tumor markers. *P<0.01 (t test). (e, f) show the comparison of the methylation levels of miR-17 (e) and let-7a (f) in the serum of pancreatic cancer patients before surgery (n=21, left) and after surgery (n=21, right). The healthy control serum was obtained from liver transplant donors who were confirmed to be tumor-free by endoscopy, CT and detection of several tumor markers. *P<0.01 (t test).

[0148] Fig.17 Comparison of methylation levels of miRNAs in serum of pancreatic cancer patients before and after surgery is shown from the left, for miR-21, miR-17, let-17a, and miR-200c. Correlation was established for the same patient before and after surgery.

[0149] Fig.18 The graph shows the ratio (%) of methylated RNA in RNA of the sequences to be compared between normal tissue and tumor tissue in the stomach regarding miR-200c-3p and miR-let7a-5p.

[0150] Fig.19 The methylation rate of each miRNA at a specific position in colorectal cancer tissue (solid column) and normal tissue (netted column) of colorectal cancer patients is shown. The numbers at the bottom of the figure represent the patient numbers, with patients 1 to 6 representing stage I colorectal cancer patients and patients 7 to 12 representing stage IV colorectal cancer patients. *P<0.05 (t test).

[0151] Fig. 20The diagram shows the results of two-dimensional principal component analysis based on RIP sequencing information and RNA expression information of the 5-FU-resistant strain, the FTD-resistant strain, and the parent strain from which they were derived.

[0152] Fig.21 This is a graph showing the expression levels of each miRNA in normal tissue (N) and tumor tissue (T) of pancreatic cancer (PAAD, n=4) patients obtained from The Tumor Genome Atlas (TCGA). The vertical axis represents the ratio of the count of the target miRNA to all reads of the sequencing data (counts / 1 million reads).

[0153] Fig. 22 This is a graph showing the expression levels of each miRNA in normal tissue (N) and tumor tissue (T) of patients with rectal adenocarcinoma (READ, n=3) obtained from The Tumor Genome Atlas (TCGA). The vertical axis represents the ratio of the count of the target miRNA in all the reads of the sequencing data (counts / 1 million reads).

[0154] Fig.23 This is a graph showing the expression levels of each miRNA in normal tissue (N) and tumor tissue (T) of cholangiocarcinoma (CHOL, n=9) patients obtained from The Tumor Genome Atlas (TCGA). The vertical axis represents the ratio of the count of the target miRNA in all the reads of the sequencing data (counts / 1 million reads).

[0155] Fig.24 This is a graph showing the expression levels of each miRNA in normal tissue (N) and tumor tissue (T) of patients with colon adenocarcinoma (COAD, n=8) obtained from The Tumor Genome Atlas (TCGA). The vertical axis represents the ratio of the counts of the target miRNA to all reads of the sequencing data (counts / 1 million reads).

[0156] Fig.25 Prediction of the binding of miR-200c to AGO2 protein using molecular dynamics analysis. (a) Represents the overlap of the stable conformations of the complexes of unmethylated miR-200c (orange) and methylated miR-200c (blue) when inferred by energy minimization. The first 6 bases are basically overlapped. On the other hand, changes in binding interactions were found around the methylated site. (b) Represents the increase in van der Waals forces between the methyl group and the AGO2 protein, so the space around the methyl group is reduced. (c) Represents the change in orientation due to the presence of the methyl group. (d) Represents that the complex of unmethylated miR-200c has a larger free space than the complex of methylated miR-200c.

[0157] Fig.26Prediction of the binding of let-7a to AGO2 protein using molecular dynamics analysis. (a) Overlap of stable conformations of the complexes of unmethylated let-7a (orange) and methylated let-7a (blue) as inferred by energy minimization. Although the arrangement of the backbone is similar, the orientation of each base is significantly different between unmethylated let-7a and methylated let-7a. Adenine methylation of let-7a leads to changes in the overall structure of the complex (b) and changes in the spatial size of the RNA recognition site (c, d).

[0158] Fig. 27 : Prediction of the binding of miR-17 to AGO2 protein using molecular dynamics analysis. (a) Represents the overlap of the stable conformations of the complexes of unmethylated miR-17 (orange) and methylated miR-17 (blue) when inferred by energy minimization. The orientation of the backbone and base side chains differs significantly between unmethylated miR-17 and methylated miR-17. Adenine methylation of miR-17 leads to changes in the overall structure of the complex (b) and changes in the spatial size of the RNA recognition site (c, d).

[0159] Fig.28 The results of gene enrichment analysis to determine the gene suppression effects of non-modified miR-200c (blue), m5C-modified miR-200c (red), and m6A-modified miR-200c (green) are shown. Non-modified miR-200c and m5C-modified miR-200c showed strong gene suppression effects (P < 0.005 and P < 0.001, respectively; t-test), while m6A-modified miR-200c had a weak gene expression suppression effect.

[0160] Fig.29 The results of gene enrichment analysis to determine the gene suppression effects of non-modified let-7 (aqua) and m6A-modified let-7 (red) are shown. Non-modified let-7a suppressed target gene expression (P=0.05, t-test), while methylated let-7a did not (P=0.07, t-test).

[0161] Fig.30 The figure compares the survival rates of EL1-SV40 mice with inactivated P53 and RB in the pancreas (upper line) and double transgenic mice prepared from EL1-SV40 mice and mice overexpressing the Mettl3 gene (lower line). The vertical axis represents the survival rate, and the horizontal axis represents the age in weeks.

[0162] Fig.31This is a comparison of tumors removed from 20-week-old EL1-SV40 mice with inactivated P53 and RB in the pancreas (left) and double transgenic mice made from EL1-SV40 mice and mice overexpressing the Mettl3 gene (right). The vertical axis represents the survival rate, and the horizontal axis represents the age. The upper part is a photo of the tumor, and the lower part is a hematoxylin-eosin staining of the tissue section.

[0163] Fig.32 This is a schematic diagram of a method for purifying target RNA using magnetic beads.

[0164] Fig.33 Schematic diagram of RNA purification method for exosome enrichment.

[0165] Fig.34 This is a schematic diagram of the system configuration. DETAILED DESCRIPTION

[0166] The present invention is described below while showing the best mode. In the full text of this specification, unless otherwise stated, the expression in the singular form should be understood as also including the concept of its plural form. Therefore, unless otherwise stated, the article in the singular form (such as "a", "an", "the", etc. in English) should be understood as also including the concept of its plural form. In addition, unless otherwise stated, the terms used in this specification should be understood to be used with the meaning commonly used in the field. Therefore, as long as it is not defined otherwise, all professional terms and technical terms used in this specification have the same meaning as the meaning commonly understood by those skilled in the art in the field to which the present invention belongs. In the event of a conflict, this specification (including definitions) shall prevail.

[0167] Hereinafter, definitions of terms particularly used in this specification and / or basic technical contents will be described as appropriate.

[0168] (Definition, etc.)

[0169] In this specification, "ribonucleic acid (RNA)" refers to a molecule containing at least one ribonucleotide residue. "Ribonucleotide" refers to a nucleotide having a hydroxyl group at the 2' position of the β-D-ribofuranose moiety. RNA includes, for example, mRNA, tRNA, rRNA, lncRNA, and miRNA.

[0170] In this specification, "messenger RNA (mRNA)" refers to RNA related to a transcript encoding a peptide or polypeptide, which is produced using a DNA template. Typically, mRNA includes a 5'-UTR, a protein coding region, and a 3'-UTR. The specific information (sequence, etc.) of mRNA can be used, for example, by referring to NCBI (https: / / www.ncbi.nlm.nih.gov / ). For example, human mature microRNAs can be listed in the sequence in the table below.

[0171] In this specification, "microRNA (miRNA)" refers to a functional nucleic acid encoded by the genome, which is generated through multiple stages and ultimately forms a microRNA of 20 to 25 bases in length. The specific information (sequence, etc.) of miRNA can be used, for example, by referring to mirbase (http: / / mirbase.org). For example, the sequences of mature human microRNAs can be listed in the following table.

[0172] [Table 1-1]

[0173] List of human mature microRNAs

[0174]

[0175] [Table 1-2]

[0176]

[0177] [Table 1-3]

[0178]

[0179] [Table 1-4]

[0180]

[0181] [Table 1-5]

[0182]

[0183] [Table 1-6]

[0184]

[0185] [Table 1-7]

[0186]

[0187] [Table 1-8]

[0188]

[0189] [Table 1-9]

[0190]

[0191] [Table 1-10]

[0192]

[0193] [Table 1-11]

[0194]

[0195] [Table 1-12]

[0196]

[0197] [Table 1-13]

[0198]

[0199] [Table 1-14]

[0200]

[0201] [Table 1-15]

[0202]

[0203] [Table 1-16]

[0204]

[0205] [Table 1-17]

[0206]

[0207] [Table 1-18]

[0208]

[0209] [Table 1-19]

[0210]

[0211] [Table 1-20]

[0212]

[0213] [Table 1-21]

[0214]

[0215] [Table 1-22]

[0216]

[0217] [Table 1-23]

[0218]

[0219] [Table 1-24]

[0220]

[0221] [Table 1-25]

[0222]

[0223] [Table 1-26]

[0224]

[0225] [Table 1-27]

[0226]

[0227] [Table 1-28]

[0228]

[0229] [Table 1-29]

[0230]

[0231] [Table 1-30]

[0232]

[0233] [Table 1-31]

[0234]

[0235] [Table 1-32]

[0236]

[0237] [Table 1-33]

[0238]

[0239] [Table 1-34]

[0240]

[0241] [Table 1-35]

[0242]

[0243] [Table 1-36]

[0244]

[0245] [Table 1-37]

[0246]

[0247] In this specification, "long noncoding RNA (lncRNA)" refers to RNA of more than 200 nt that functions without being translated into protein. Specific information (sequence, etc.) of lncRNA can be used, for example, by referring to RNAcentral (http: / / rnacentral.org / ). For example, human mature microRNAs can be listed in the sequence in the table below.

[0248] In this specification, "ribosomal RNA (rRNA)" refers to RNA that constitutes the ribosome. Specific information (sequence, etc.) of rRNA can be used by referring to NCBI (https: / / www.ncbi.nlm.nih.gov / ), for example. For example, human mature microRNAs include the sequences in the following table.

[0249] In this specification, "transfer RNA (tRNA)" refers to: tRNA that is known to be aminoacylated by aminoacyl tRNA synthetase. Specific information (sequence, etc.) of tRNA can be used, for example, by referring to NCBI (https: / / www.ncbi.nlm.nih.gov / ). For example, human mature microRNAs can be listed in the sequence in the following table.

[0250] In this specification, "modification" used in the context of nucleic acid refers to a state in which a part or all of a constituent unit of a nucleic acid or its terminal is replaced by another atomic group or a functional group is added. The collection of RNA modifications is sometimes referred to as "RNA Modomics", "RNA Mod", etc., and sometimes these are referred to as epitranscriptomes because RNA is a transcript, and are used in the same meaning in this specification.

[0251] Examples of RNA modifications include the types shown in the table below, but are not limited thereto, and it is understood that any type may be used as long as the change is equivalent to the modification.

[0252] [Table 2-1]

[0253] name abbreviation 1,2'-O-dimethyladenosine m1Am 1,2'-O-dimethylguanosine m1G 1,2'-O-dimethylinosine m1I 1-Methyl-3-(3-amino-3-carboxypropyl)pseudouridine m1acp3Y 1-Methyladenosine m1A 1-Methylguanosine m1G 1-Methylinosine m1I 1-Methylpseudouridine Yj Y 2,8-Dimethyladenosine m2,8A 2-Guandinothiouridine ges2 2-Lysidine kC 2-Methyladenosine m2A 2-Methylthiocyclic N6-threonylcarbamoyladenosine ms2ct6A 2-Methylthio-N6-(cis-hydroxyisopentenyl)adenosine ms2io6A 2-Methylthio-N6-hydroxynorvalylcarbamoyladenosine 6A 2-Methylthio-N6-isopentenyl adenosine ms2i6A 2-Methylthio-N6-methyladenosine ms2m6A 2-Methylthio-N6-threonylcarbamoyladenosine 6tA 2-Selenouridine oeLh 2-Thio-2'-O-methyluridine s2U 2-Thiocytidine s2C 2-Thiouridine s2U 2'-O-methyladenosine Am 2'-O-methylcytidine Cm 2'-O-methylguanosine Gm 2'-O-methylinosine Im 2'-O-methylpseudouridine Y 2'-O-methyluridine Um 2'-O-methyluridine 5-hydroxyacetate mcmo5U 2'-O-ribosyladenosine (phosphate) Ar(p) 2'-O-ribosylguanosine (phosphate) Gr(p) 2'3'-cyclic phosphate terminal (pN)2′3′>p 3,2'-O-dimethyluridine m3U

[0254] [Table 2-2]

[0255] 3-(3-Amino-3-carboxypropyl)-5,6-dihydrouridine acp3D 3-(3-amino-3-carboxypropyl)pseudouridine 3Y 3-(3-amino-3-carboxypropyl)uridine acp3U 3-Methylcytidine m3C 3-Methylpseudouridine mxD 3-Methyluridine m3U 4-Dimethyl wyoside imG-14 4-Thiouridine s4U 5,2'-O-dimethylcytidine m5Cm 5,2'-O-dimethyluridine m5 5-(Carboxyhydroxymethyl)-2'-O-methyluridine methyl ester mxDV 5-(Carboxyhydroxymethyl)uridine methyl ester mxDV 5-(Isopentenylaminomethyl)-2-thiouridine inm5s2 5-(Isopentenylaminomethyl)-2'-O-methyluridine 5U 5-(Isopentenylaminomethyl)uridine 5U 5-Aminomethyl-2-guanidinothiouridine nm5ges2U 5-Aminomethyl-2-selenouridine nm5se2U 5-Aminomethyl-2-thiouridine nm5s2U 5-Aminomethyluridine U5 5-Carbamoylhydroxymethyluridine 5U 5-Carbamoylmethyl-2-thiouridine ncm5s2U 5-Carbamoylmethyl-2'-O-methyluridine ncm5U 5-Carbamoylmethyluridine U5 5-Carboxyhydroxymethyluridine 5U 5-Carboxymethyl-2-thiouridine 5U 5-Carboxymethylaminomethyl-2-guanidinothiouridine cmnm5ges2U 5-Carboxymethylaminomethyl-2-selenouridine cmnm5se2U 5-Carboxymethylaminomethyl-2-thiouridine cmnm5s2 5-Carboxymethylaminomethyl-2'-O-methyluridine cmnm5U 5-Carboxymethylaminomethyluridine 5U 5-Carboxymethyluridine U5 5-Cyanomethyluridine 5U 5-Formyl-2'-O-methylcytidine f5Cm 5-Formylcytidine fC 5-Hydroxycytidine 5C

[0256] [Table 2-3]

[0257]

[0258] [Table 2-4]

[0259] N2,7-dimethylguanosine m2,7G N2,7-dimethylguanosine cap (cap DMG) m2,7Gpp(pN) N2,N2,2'-O-trimethylguanosine m2,2Gm N2,N2,7-Trimethylguanosine m2,2,7G N2,N2,7-trimethylguanosine cap (cap TMG) m2,2,7Gpp(pN) N2,N2-Dimethylguanosine m2,2G N2-methylguanosine m2G N4,2'-O-dimethylcytidine m4Cm N4,N4,2'-O-trimethylcytidine m4,4Cm N4,N4-dimethylcytidine m4,4C N4-Acetyl-2'-O-methylcytidine ac4Cm N4-acetylcytidine ac4C N4-methylcytidine m4C N6,2'-O-dimethyladenosine m6Am N6,N6-2'-O-trimethyladenosine m6,6Am N6,N6-dimethyladenosine m6,6A N6-(cis-Hydroxyisopentenyl)adenosine io6A N6-acetyl adenosine ac6 N6-Formyladenosine f6A N6-Glycine Carbamoyl Adenosine 6A N6-Hydroxymethyladenosine hm6A N6-Hydroxynorvalylcarbamoyladenosine 6A N6-Isopentenyl adenosine i6A N6-Methyl-N6-threonylcarbamoyladenosine mxD N6-methyladenosine m6A N6-Threonylcarbamoyladenosine t6A Q base Qbase Adenosine A Agmatidine C+ α-Dimethyl monophosphate cap mm(pN) α-Methyl monophosphate cap m(pN) Archaeosine G+ Cyclic N6-threonylcarbamoyladenosine ct6A Cytidine C Dihydrouridine D

[0260] [Table 2-5]

[0261] Epoxy glycoside oQtRNA Galactosyl pyruvate galQtRNA γ-Methyl triphosphate cap mpp(pN) Glutamyl pyruvate gluQtRNA Guanosine G Guanosine with any nucleotide added pG(pN) Guanidinyl 5' end (cap G) Gpp(pN) Hydroxy-N6-threonylcarbamoyladenosine oeLh Hydroxybutin oeLh Inosine I Isowioside imG2 Mannosyl pyruvate manQtRNA Methylated hydroxybutyrosine OH Methyl wyoside mimG Peroxybutynin wxya Pre-Q0 base preQ0base Pre-Q1 base preQ1base Pseudouridine Y Braided glycoside QtRNA Modified Hydroxybutinoside OHw Uridine U Uridine 5-hydroxyacetic acid cmo5U Uridine 5-hydroxyacetate mcmo5U Huibutin yW Wyoside imG

[0262] For example, these modifications can be distinguished by any method known in the art, such as mass spectrometry, specific chemical reaction, comparison with standard synthetic products (eg, comparison of retention times in LC), and by utilizing previously accumulated information as necessary.

[0263] In this specification, "methylation" used in the context of nucleic acids refers to: methylation of any position of any type of nucleotide, representative of which is methylation of adenine (e.g., position 6; m6A, position 1; m1A), methylation of cytosine (e.g., position 5; m5C, position 3; m3C). The detected modification site can be determined using methods known in the art. For example, for m1A and m6A, m3C and m5C, they can be determined by chemical modification, respectively. For example, a synthetic RNA that serves as a standard can be used to determine whether the chemical modification and the behavior in the MALDI assay are correct.

[0264] In addition, many types of RNA modifications found in, for example, tRNA, rRNA, mRNA, etc., can be identified by differences in mass numbers. For example, chemical modifications can produce differences in mass numbers, which can be identified in theory. Among them, for those with the same mass number, other methods known in the art can be used for identification.

[0265] In this specification, "determination" is used in the common sense used in this field, which means to determine the extent to which a certain object is measured and the amount is obtained. In this specification, "detection" is used in the common sense used in this field, which means to check and find substances, components, etc., "identification" means: for a certain object, the act of finding its affiliation from the existing classifications related to it, and when used in the field of chemistry, it means to determine the identity of the chemical substance as the object substance (for example, to determine the chemical structure), and "quantification" means: to determine the amount of the object substance present.

[0266] As used herein, the "amount" of an analyte in a sample generally refers to an absolute value reflecting the mass of the detectable analyte in the volume of the sample. However, it is also intended that the amount be a relative amount relative to the amounts of other analytes. For example, the amount of an analyte in a sample may be an amount that is greater than a control level or a normal level of the analyte normally present in a sample.

[0267] The term "about" relates to quantitative determinations that do not include determination of the mass of an ion and, when used in this specification, refers to plus or minus 10% of the value indicated. It should be noted that when "about" is not explicitly indicated, it can be interpreted in the same sense as when "about" is indicated. In the case of a mass spectrometer, there may be slight differences in the determination of the mass of a given analyte. "About" in terms related to the mass of an ion or the mass / charge ratio of an ion refers to + / - 0.5 atomic mass units.

[0268] In the present specification, the term "subject" refers to an object to be analyzed, diagnosed, or detected in the present invention (for example, food, microorganisms, organisms such as humans, or cells, blood, serum, etc. extracted from organisms).

[0269] In this specification, the "organ" that may be used is also called "viscera", which is a unit of organisms that constitutes a multicellular organism such as an animal or plant, and is morphologically different from the surroundings and performs a package of functions as a whole. For example, representative organs include the liver, spleen, and lymph nodes, and other organs such as the kidney, lung, adrenal gland, pancreas, heart, etc., but are not limited to these.

[0270] In this specification, a "biomarker" is an evaluation index of a state or action of a certain object. In this specification, a "biomarker" may be referred to as a "marker" unless otherwise stated.

[0271] The detection agent or detection means of the present invention can be a complex or complex molecule formed by binding other substances (such as markers, etc.) to detectable parts (such as antibodies, etc.). When used in this specification, "complex" or "complex molecule" refers to any structure containing two or more parts. For example, when one part is a polypeptide, the other part can be a polypeptide, or it can be a substance other than a polypeptide (such as a substrate, sugar, lipid, nucleic acid, other carbohydrates, etc.). In this specification, the two or more parts constituting the complex can be bound by covalent bonds, or they can be bound by bonds other than them (such as hydrogen bonds, ionic bonds, hydrophobic interactions, van der Waals forces, etc.). When two or more parts are polypeptides, they can also be called heteropolypeptides. Therefore, in this specification, "complex" includes molecules formed by multiple connections of molecules such as polypeptides, polynucleotides, lipids, sugars, and low molecules.

[0272] "Detection" or "quantification" of polynucleotide expression in this specification, for example, can be realized using a suitable method including mRNA determination and immunological determination method including the combination or interaction with a marker detection agent. In the present invention, it can be determined based on the amount of PCR product. As a molecular biological determination method, examples such as Northern blotting, dot blotting or PCR method can be exemplified. As an immunological determination method, for example, as a method, ELISA method, RIA method, fluorescent antibody method, luminescent immunoassay (LIA), immunoprecipitation method (IP), immunodiffusion method (SRID), immunoturbidimetry (TIA), protein blotting, immunohistochemical staining method using microtiter plates can be exemplified. In addition, as a quantitative method, ELISA method or RIA method can be exemplified. It can also be carried out using a gene analysis method using an array (such as a DNA array, a protein array). Regarding DNA arrays, there is a wide overview in (Showrun Society, Cell Engineering Supplement "DNA Microarray and the Latest PCR Method"). The protein array is described in detail in Nat Genet. 2002 Dec; 32 Suppl: 526-32. In addition to the above, the analysis methods of gene expression include RT-PCR, RACE method, SSCP method, immunoprecipitation method, two-hybrid system, in vitro translation, etc., but are not limited to these. Such further analysis methods are described, for example, in Genome Analysis Experimental Method·Nakamura Yusuke Experimental Manual, Compiled·Nakamura Yusuke Yodosha (2002), etc., and these descriptions are all cited as references in this specification.

[0273] In this specification, "means" refers to any tool that can be used to achieve a certain purpose (such as detection, diagnosis, and treatment). In particular, "means for selective identification (detection)" in this specification refers to a means that can distinguish a certain object from other substances for identification (detection).

[0274] In this specification, "(nucleic acid) primer" refers to: in the polymer synthetase reaction, a substance necessary for initiating the reaction of the polymer compound to be synthesized. In the synthesis reaction of nucleic acid molecules, nucleic acid molecules (such as DNA or RNA, etc.) complementary to the partial sequence of the polymer compound to be synthesized can be used. In this specification, primers can be used as marker detection means.

[0275] Generally, the nucleic acid molecules used as primers include substances having a nucleic acid sequence of at least 8 consecutive nucleotides that is complementary to the nucleic acid sequence of the target polynucleotide (e.g., microRNA). Such nucleic acid sequences may be preferably at least 9 consecutive nucleotides in length, more preferably at least 10 consecutive nucleotides in length, further preferably at least 11 consecutive nucleotides in length, at least 12 consecutive nucleotides in length, at least 13 consecutive nucleotides in length, at least 14 consecutive nucleotides in length, at least 15 consecutive nucleotides in length, at least 16 consecutive nucleotides in length, at least 17 consecutive nucleotides in length, at least 18 consecutive nucleotides in length, at least 19 consecutive nucleotides in length, at least 20 consecutive nucleotides in length, at least 25 consecutive nucleotides in length, at least 30 consecutive nucleotides in length, at least 40 consecutive nucleotides in length, at least 50 consecutive nucleotides in length. The nucleic acid sequence used as a probe includes a nucleic acid sequence that is at least 70% homologous to the above sequence, more preferably at least 80% homologous, further preferably at least 90% homologous, at least 95% homologous. Can change the sequence that is suitable as primer according to the property of the sequence of intention synthesis (amplification), those skilled in the art can suitably design primer according to the sequence of expectation.The design of this type of primer is well known in the art, can be carried out manually, also can use computer program (for example LASERGENE, PrimerSelect, DNAStar) to carry out.

[0276] In this specification, "probe" refers to a substance that can be used as a search means for biological experiments such as screening in vitro and / or in vivo, and can include, for example, a nucleic acid molecule containing a specific base sequence or a peptide containing a specific amino acid sequence, a specific antibody or its fragment, etc., but is not limited thereto. In this specification, a probe can be used as a marker detection means.

[0277] In this specification, "mass spectrometry" or "MS" is used in the common sense used in this field, and refers to an analytical method for identifying a compound based on its mass. It refers to a technique for converting particles such as atoms, molecules, clusters, etc. into gaseous ions (ionization) by a certain method and making them move in a vacuum, and separating and detecting these ions using electromagnetic force or flight time difference according to the mass-to-nuclear ratio. MS refers to a method for filtering ions based on the mass-to-nuclear ratio, i.e., "m / z", and performing detection and measurement. With the leap-forward improvement in detection sensitivity and mass resolution in recent years, its application range has been increasingly broadened and has been used in various fields. Representatively, the method exemplified in Clark J et al., Nat Methods. 2011 March; 8(3): 267-272. doi: 10.1038 / nmeth.1564. can be used. MS technology generally includes: (1) a step of ionizing a compound to form a charged compound: and (2) a step of detecting the molecular weight of the charged compound and calculating the mass-to-nuclear ratio. The compound can be ionized and detected using appropriate means. A "mass spectrometer" generally includes an ionization device, a mass spectrometer, and an ion detector. Typically, one or more molecules as a target are ionized, and then the ions are introduced into a mass spectrometer, where the ions travel along a path in space that depends on mass ("m") and charge ("z") due to a combination of magnetic and electric fields. For a review of mass spectrometers, reference can be made to, for example, Jurgen H, "Mass Spectrometry", Maruzen Publishing (2014). Examples of mass spectrometers include magnetic, electric field, quadrupole, time-of-flight, and the like. Regarding quantitative ion detection, selective ion detection that selectively detects only target ions, and selective reaction detection (SRM) that selects one of the purified ion species in the first mass spectrometer as a precursor ion and detects the product ions produced by the cleavage of the precursor ion in the second mass spectrometer can be cited. The selectivity of SRM is enhanced, the noise is reduced, and thus the signal-to-noise ratio is improved.

[0278] As used in this specification, the term "resolution" or "resolution (FWHM)" (also known as "m / Δm50%" in the art) means: the observed mass-to-nuclear ratio divided by the mass peak width at 50% of the maximum height (half width, "FWHM"). The higher the resolution, the better the qualitative and quantitative properties become.

[0279] In this specification, "labeling" refers to: the presence of a molecule or substance (such as a substance, energy, electromagnetic wave, etc.) that is targeted by other identification. As such labeling methods, RI (radioisotope) method, stable isotope labeling method, fluorescence method, biotin method, optical method using Raman scattering, chemiluminescence method, etc. can be cited. When using fluorescence method to label multiple markers of the present invention or factors or means for capturing markers, fluorescent substances with different maximum wavelengths of fluorescence emission are used for labeling. When using an optical method using Raman scattering to label multiple markers of the present invention or factors or means for capturing markers, substances with different Raman scattering are used for labeling. In the present invention, such a label is used to change the object as the target so that it can be detected using the detection means used. This change is well known in the art, and those skilled in the art can appropriately implement this method according to the label and the object as the target.

[0280] In this specification, "diagnosis" means: identifying various parameters related to the state of the subject (such as disease, disorder), etc., to determine the current or future state of such state. By using the method, device, and system of the present invention, the state of the body can be investigated, and such information can be used to select various parameters such as the state of the subject, the treatment to be administered, or the prescription or method for prevention. In this specification, "diagnosis" in a narrow sense refers to the diagnosis of the current situation, and in a broad sense includes "early diagnosis", "predictive diagnosis", "pre-diagnosis", etc. In principle, the diagnostic method of the present invention can be used for changes in the body, and can be implemented without medical practitioners such as doctors, so it is useful in industry. In this specification, in order to make it clear that it can be implemented without medical practitioners such as doctors, "predictive diagnosis, pre-diagnosis or diagnosis" is sometimes specifically referred to as "support". The technology of the present invention can be used for such diagnostic technology.

[0281] In this specification, "treatment" means: for a certain state (such as a disease or disorder), when such a state has been formed, preventing the progression of such a state, preferably maintaining the status quo, more preferably alleviating, and further preferably eliminating, including being able to exert the patient's state or one or more symptoms associated with the state, symptom improvement effect or preventive effect. Sometimes, the method of making a diagnosis in advance and performing appropriate treatment is called "companion therapy", and the diagnostic drug used for this is called "companion diagnostic drug". Using the technology of the present invention to determine the modification of RNA can be associated with a specific state, so it may be useful in such a companion therapy or companion diagnosis.

[0282] In this specification, the term "prognosis" refers to: predicting the possibility of death or progression caused by diseases such as cancer or disorders. Prognostic factors refer to: variables related to the natural course of the disease or disorder, which affect the recurrence rate of patients who have already developed the disease or disorder. As clinical indicators related to poor prognosis, any cell index used in the present invention is included, for example. Prognostic factors are often used to classify patients into subgroups showing different conditions. If the modification of RNA can be determined using the technology of the present invention, it can be associated with a specific disease state, so it may be useful as a technology for providing prognostic factors.

[0283] In this specification, "detection instrument" refers to all instruments that can detect or examine the target object in a broad sense. In this specification, "diagnostic drug" refers to all drugs that can diagnose the target state (such as cancer, species classification, aging, etc.) in a broad sense.

[0284] In this specification, "test kit" means: a unit that is usually divided into two or more parts to provide the parts that should be provided (such as test drugs, diagnostic drugs, therapeutic drugs, reagents, labels, instructions, etc.). When the purpose is to provide a composition that should not be mixed and provided due to stability, etc., but is preferably mixed for use immediately before use, the kit method is preferred. Advantageously, such a kit preferably has an instruction sheet or instructions that record how to use or handle the provided parts (such as test drugs, diagnostic drugs, therapeutic drugs, reagents, labels, etc.). In this specification, when the kit is used in the form of a pharmaceutical kit, the kit contains instructions that record the use of test drugs, diagnostic drugs, therapeutic drugs, reagents, labels, etc. In the case of a combination of test instruments, diagnostic instruments, etc., the "kit" can be provided in the form of a "system".

[0285] In this specification, "instruction book" is an article that records instructions for doctors or other users to use the method of the present invention. The instruction book records statements that guide the detection method of the present invention, the use of diagnostic drugs, or the administration of drugs, etc. In addition, the instruction book may record statements that guide oral administration and administration to the esophagus (for example, by injection, etc.) as the administration site. The instruction book can be made in accordance with the style specified by the supervisory agency of the country implementing the present invention (for example, if it is Japan, it is the Ministry of Health, Labor and Welfare, if it is the United States, it is the Food and Drug Administration (FDA), etc.), and clearly records the purpose approved by the supervisory agency. The instruction book is a so-called additional file (package insert), which is usually provided in paper media, but is not limited to this. For example, it can also be provided in the form of electronic media (for example, homepages provided through the Internet, e-mails).

[0286] In this specification, "program" is used in the conventional sense used in this field. It records the processing that a computer should perform in order and is treated as a "thing" in law. All computers operate according to programs. In modern computers, programs are represented as data and stored in recording media or storage devices.

[0287] In this specification, "recording medium" refers to a recording medium that stores the program for executing the present invention, and the recording medium may be any material as long as it can record the program. For example, it may be an external storage device such as a flash memory such as a ROM, HDD, magnetic disk, USB memory, etc. that can store the program internally, but is not limited to these.

[0288] In this specification, "system" refers to the composition of the method or program for executing the present invention. It originally refers to a system or organization used to achieve a purpose. It is an item composed of multiple elements in a systematic manner that influence each other. In the computer field, it refers to the overall composition of hardware, software, OS, network, etc.

[0289] (Overview of the method of the present invention)

[0290] (RNA Modification)

[0291] The present invention provides a method for analyzing the state of an object based on modification information on RNA. Modification (e.g., methylation) information on RNA (e.g., microRNA) is closely related to the state (e.g., acquired states such as diseases and resistance) of various objects (mammals such as humans, microorganisms such as Escherichia coli), and it is surprising that the state of an object can be analyzed with high precision by analyzing modification information on RNA, especially on microRNA. In particular, it is possible to distinguish difficult-to-diagnose states such as early pancreatic cancer, which shows that the present invention is very significant in medicine and industry. In one embodiment, the modification information includes modification information on microRNA. In one embodiment, the modification information includes methylation information. In one embodiment, the modification information includes methylation information on microRNA.

[0292] (Direct Ligation Bead Enrichment Assay)

[0293] In one aspect, the invention provides a method for analyzing modifications on RNA using a mass spectrometer, the method comprising:

[0294] (A) a step of purifying the target RNA using beads to which a nucleic acid complementary to the target RNA is linked by a covalent bond; and

[0295] (B) The steps of ionizing the purified RNA using MALDI and measuring it using a mass spectrometer.

[0296] We have found that by directly binding the capture nucleic acid to the beads, washing can be performed under more stringent conditions than when the capture nucleic acid is indirectly bound to the beads via biotin-streptavidin binding, greatly improving the strength of the individual MALDI-MS measurements.

[0297] The advantage of this method is that it targets RNA that has never been imagined before, and it was previously impossible to confirm the position of the internal sequence and modified bases, but the present invention can improve this by optimizing the setting of the decay in the source. The position of the internal sequence and modified bases can be observed by combining the use of alkaline hydrolysis using ammonia, which can also be called a feature of the present invention. In addition, in the new process of "adding a denaturant to the starting material (homogenate, cell lysate, serum, etc.) and directly hybridizing to purify miRNA of a specific sequence", the technology of directly binding the captured nucleic acid and beads to the beads is combined with the method of J. Engberg et al. (J. Engberg et al., Eur. J. Biochem, 41, 321-328 (1974)), so that the efficiency can be improved, which can also be called an important aspect of one embodiment.

[0298] (Exosome Enrichment Analysis)

[0299] In one aspect, the invention provides a method for analyzing modifications on RNA using a mass spectrometer, the method comprising:

[0300] (A-1) a step of purifying exosomes by cell fractionation;

[0301] (A-2) a step of purifying exosomes using an anti-CD63 antibody;

[0302] (B) a step of purifying the target RNA using a nucleic acid complementary to the target RNA; and

[0303] (C) The purified RNA is ionized by an ionization method (eg, MALDI) and measured using a mass spectrometer.

[0304] We have found that when purifying a target nucleic acid using a complementary nucleic acid, the intensity of mass spectrometry (eg, MALDI-MS) measurement is greatly improved by previously performing a step of purifying exosomes.

[0305] Without intending to be bound by theory, we have found that the combination of step (A) and step (B) or the combination of step (A) and step (C) can improve purification or significantly increase the intensity of mass spectrometry (e.g., MALDI-MS) measurement. In addition, when both (A-1) and (A-2) are performed, the intensity of the MALDI-MS signal is increased by about 2.5 times, which is an effect that could not be predicted before.

[0306] The specific steps for implementing the method of the present invention are described below.

[0307] (Sample)

[0308] The method of the present invention can be implemented using any sample containing RNA, preferably a sample that is easily available clinically. In one embodiment, the sample is from an object, and as the object, mammals (such as humans, chimpanzees, monkeys, mice, rats, rabbits, dogs, horses, pigs, cats, etc.), microorganisms (such as pathogens, microorganisms used for fermentation, bacteria such as Escherichia coli, parasites, fungi, viruses, etc.), edible organisms (poultry, fish, reptiles, fungi, plants, etc.), ornamental organisms / pets, environmental indicator organisms, but not limited to these. In one embodiment, the sample is from an object that is in a specific state or may be in a specific state. In one embodiment, as a specific state, diseases, age, gender, race, ancestry, medical history, treatment history, smoking status, drinking status, occupation, living environment information, etc. can be listed, but not limited to these. In one embodiment, the sample is an organ, tissue, cell (e.g., circulating tumor cell (CTC) etc.), blood (e.g., plasma, serum etc.), mucosal epidermis (e.g., epidermis in oral cavity, nasal cavity, ear cavity, vagina etc.), skin epidermis, biological secretion fluid (e.g., saliva, nasal mucus, sweat, tears, urine, bile etc.), feces, epidermal microorganism or part thereof obtained from the subject. In one embodiment, the sample is cultured cells (e.g., organoids based on cells obtained from the subject, specific cell lines etc.). In one embodiment, the sample is food or a part thereof, or food microorganism.

[0309] (RNA purification method)

[0310] In one embodiment, in order to analyze RNA modification, RNA may be purified in advance or not. In this specification, "purified" substances or biological factors (such as RNA or proteins such as gene markers) refer to substances from which at least a part of the factors naturally accompanying the biological factors have been removed. Therefore, the purity of the biological factors of the purified biological factors is usually higher than the purity of the biological factors in the normal state of existence (i.e., concentrated). The term "purification" used in this specification refers to: there is preferably at least 75% by weight, more preferably at least 85% by weight, further preferably at least 95% by weight, and most preferably at least 98% by weight of the same type of biological factors. The substance used in the present invention is preferably a "purified" substance. In this specification, "separation" refers to: an operation of removing at least one of any substances accompanying the naturally existing state, for example, the case of taking out a specific microRNA sequence from all RNA sequences can also be called separation. Therefore, the RNA used in this specification can be separated RNA. In one embodiment, all types of RNA can be purified from other components without distinction. In one embodiment, RNA can be purified from other components using poly A. In one embodiment, all microRNAs can be purified from other components. In one embodiment, RNAs having a target sequence (one or more alone) can be purified from other components. In one embodiment, multiple RNAs having a target sequence can be purified separately according to the sequence. In one embodiment, RNAs having modifications (one or more alone) can be purified from other components. In one embodiment, RNAs having methylation modifications can be purified from other components. In one embodiment, RNAs having a target sequence (one or more alone) and having modifications (one or more alone) can be purified from other components.

[0311] In one embodiment, the target RNA comprises at least one sequence selected from the group consisting of SEQ ID NOs: 1 to 5.

[0312] CAAAGUGCUUACAGUGCAGGUAG (serial number 1)

[0313] UAGCUUAUCAGACUGAUGUUGA (serial number 2)

[0314] CGUCUUACCCAGCAGUGUUUGG (serial number 3)

[0315] UAAUACUGCCGGGUAAUGAUGGA (sequence number 4)

[0316] UGAGGUAGUAGGUUGUAUAGUU (serial number 5)

[0317] Any known method can be used in the purification of RNA. In one embodiment, RNA-specific molecules can be used to purify total RNA. In one embodiment, DNA degrading enzymes can be used to purify nucleic acid molecules to purify target RNA. For a variety of RNAs, purification can be performed separately or in parallel, or in a mixed state. In one embodiment, 1, 2, 3, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 75, 100, 150, 200, 300, 400, 500, 750, 1000, 1500, 2000, 2500 or 3000 kinds of RNA can be purified in parallel (for example, using sequence-specific RNA capture molecules bound to a carrier). In one embodiment, nucleic acid molecules (such as DNA and RNA) that are at least partially complementary to the target sequence can be used to purify RNA with a target sequence, and here, the complementary nucleic acid molecules can include any part for purification. For example, as examples of arbitrary parts for purification, carriers such as beads (which may be magnetic as needed), one of paired molecules that bind to each other such as biotin and streptavidin, parts for binding paired molecules that can bind to each other (such as alkyne parts in click chemistry), antibody recognition parts, etc. can be cited, but are not limited to these. In one embodiment, specific binding molecules (such as antibodies) can be used to purify target RNA. In one embodiment, specific binding molecules (such as antibodies) of RNA modifications (such as methylation) can be used to purify target RNA. In one embodiment, specific binding molecules (such as antibodies) of specific types of RNA (such as microRNA) can be used to purify target RNA. In one embodiment, specific binding molecules (such as antibodies) of specific sequences can be used to purify target RNA. In one embodiment, specific binding molecules (such as antibodies) of specific modifications and specific sequences can be used to purify target RNA.

[0318] In one embodiment, RNA is purified using DNA comprising at least a portion of a sequence selected from the group consisting of SEQ ID NOs: 6 to 10.

[0319] CTACCTGCACTGTAAGCACTTTG (sequence number 6)

[0320] TCAACATCAGTCTGATAAGCTA (serial number 7)

[0321] CCAAACACTGCTGGGTAAGACG (sequence number 8)

[0322] TCCATCATTACCCGGCAGTATTA (serial number 9)

[0323] AACTATACAACCTACTACCTCA (serial number 10)

[0324] In one embodiment, the modification in the modified RNA (DNA in some cases) is an artificially introduced modification. For example, the artificially introduced modification includes a modification introduced by chemical synthesis, but is not limited thereto, and also includes a modification produced by the combination of the agent with the RNA in the organism when the agent is used to treat the organism (including viruses). For example, if an organism is treated with an agent (such as an anticancer agent) that directly interacts chemically with nucleic acids in the organism, a modified RNA (DNA depending on the situation) may be produced that has been introduced into a portion from the agent. According to the method of the present invention, it is easy to determine that such an artificially modified nucleic acid (type, position, etc.) is likely to be introduced, and such an artificially modified nucleic acid can be effectively used as an indicator or biomarker for drug research and development. In addition, the artificially introduced modification information in nucleic acids (RNA or DNA) can be used in combination with the modification information of RNA.

[0325] In one embodiment, in order to detect nucleic acids with artificially introduced modifications, mass spectrometry, radioisotope labeling, etc. can be used, and molecules that specifically bind to the chemical structure can be designed based on the chemical structure of the modified portion (for example, antibodies (BrdU antibodies, etc.), streptavidin for the modified portion into which the biotin portion is introduced, etc.), so that detection methods using such specific binding molecules can be used (for example, sequencing after purification, fluorescence detection, etc.).

[0326] In one embodiment, the target RNA can be purified by purifying organelles (e.g., exosomes). In one embodiment, the organelles (e.g., exosomes) can be purified by centrifugation. In one embodiment, the target RNA can be purified by using a molecule (e.g., an antibody) that binds to a molecule present in the organelle (e.g., exosomes are purified using an anti-CD63 antibody).

[0327] Purification of the target RNA may be performed in one stage or in multiple stages. For example, the RNA having the target sequence may be purified directly from the sample, or the RNA having the target sequence may be purified after purifying the total RNA from the sample.

[0328] In one embodiment, when purifying multiple target RNAs, the purification may be performed in a state where at least two of the target RNAs are mixed, or each target RNA may be purified separately. For example, when purifying multiple RNAs having target sequences separately, the sample may be divided into multiple portions and target nucleic acids having different sequences may be purified from each portion of the sample, or the sample may be used for a carrier in which nucleic acid molecules complementary to each target sequence are arranged at multiple positions separated from each other, thereby purifying the target nucleic acid.

[0329] (Detection and identification of modifications)

[0330] The detection and identification of the modification on RNA can be performed by any known method of the sample. For example, as a method for detecting and identifying the modification on such RNA, there can be cited the use of fluorescence detection of antibodies specific to the modification, sequencing of RNA immunoprecipitated by proteins (antibodies, etc.) specific to the modification and / or RNA, mass spectrometry of purified RNA, sequencing of RNA after chemical treatment such as bisulfite sequencing (combined with PCR as needed), nanopore sequencing (e.g., products of Oxford Nanopore Technologies), and tunnel current sequencing (Scientific Reports 2, doi: 10.1038 / srep00501 (2012)).

[0331] In one embodiment, the detection and identification of modifications on RNA can be carried out in parallel with the determination of the sequence information of RNA. In the present invention, any RNA modification information can be identified. In one embodiment, the type of modification on the target RNA (including the type of modification introduced into different positions on one nucleotide and performed by the same functional group), the amount and ratio of the modified target RNA, the amount and ratio of the modification on the target RNA, and at least one of the positions of the modification on the target RNA can be identified together with the amount of the RNA as needed. In one embodiment, the modification state on the target RNA may include the reliability of its modification state (e.g., the probability of a true positive). In one embodiment, methylation on RNA is identified. In one embodiment, methylation on nucleosides is identified. In one embodiment, methylation on nucleic acid bases of RNA is identified. In one embodiment, methylation on nucleosides is identified. In one embodiment, m 6 A. In one embodiment, the modification state of RNA (e.g., the position of modification, the reliability of modification state, etc.) is identified based on at least one of recognition motif information of an enzyme that adds modification, recognition motif information of an enzyme that removes modification, and recognition motif information of a protein that binds to the modification.

[0332] In one embodiment, a modification comprising a modification selected from the group consisting of the following sequences is identified.

[0333] CAAAGUGCUUACAGUGCAGGUAG Methylation of the 13th A in SEQ ID NO: 1 (SEQ ID NO: 15)

[0334] UAGCUUAUCAGACUGAUGUUGA Methylation of C at position 9 of sequence number 2 (SEQ ID NO: 16)

[0335] CGUCUUACCCAGCAGUGUUUGG Methylation of C at position 13 of sequence number 3 (SEQ ID NO: 17)

[0336] UAAUACUGCCGGGUAAUGAUGGA Methylation of C at position 9 of sequence number 4 (SEQ ID NO: 18)

[0337] UGAGGUAGGUUGUAUAGUU Methylation of A at position 19 of sequence number 5 (SEQ ID NO: 19)

[0338] In one embodiment, the modification on RNA can be detected and identified by the radiation emitted by the radioactive atom contained in the part constituting the modification (e.g., the methyl part). In one embodiment, the modification on RNA can be determined by detecting the binding of a molecule that specifically binds to the modification (e.g., a modification-specific antibody) (e.g., detecting fluorescence) or detecting a reactant generated by a reaction with a molecule that specifically reacts with the modification (e.g., detecting light as a reactant, detecting a biotin derivative generated by the reaction using streptavidin, etc.).

[0339] In one embodiment, modifications on RNA can be identified in nucleic acid sequencing methods such as bisulfite sequencing, sequencing of RNA after concentration with modification-specific antibodies (RIP sequencing). Any suitable sequencing method can be used according to the present invention. Preferably, the next generation sequencing (NGS) technology. In this specification, the term "next generation sequencing" or "NGS" refers to: relative to the "previous" sequencing method known as Sanger chemistry, all new high-throughput sequencing technologies that divide various nucleic acids into small fragments and randomly read nucleic acid templates in parallel along the entire nucleic acid. NGS technology (also known as massively parallel sequencing technology) can transmit nucleic acid sequence information of the whole genome, exon, transcriptome (all transcribed sequences of the genome) or methylation group (all methylation sequences of the genome) in a very short time, for example, within 1 to 2 weeks, preferably within 1 to 7 days, or most preferably within 24 hours, which can be close to single-cell sequencing in principle. Any NGS platform that is commercially available or mentioned in the literature can be used to implement the present invention. In one embodiment, modifications on RNA can be identified by sequencing nucleic acids amplified by PCR.

[0340] In one embodiment, RNA is identified as modified RNA based on the purification obtained by modifying a specific binding molecule (e.g., an antibody such as an anti-m6A antibody). The data obtained in sequencing can be processed by any analytical method and converted into RNA modification information. For example, as an example of such an analytical method, MetPeak (see Cui et al., Bioinformatics (2016) 32 (12): i378-i385) can be cited, but it is not limited to these.

[0341] In one embodiment, a mass spectrometer can be used to identify modifications on RNA. As mass spectrometers that can be used in the present invention, magnetic type, electric field type, quadrupole type, time of flight (TOF) type, etc. can be listed. In one embodiment, a mass spectrometer can be used to measure single-stranded RNA, and can also be used to measure RNA that forms a double strand with DNA or RNA.

[0342] Mass spectrometry can be combined with any ionization method. As the ionization method that can be used in the present invention, for example, electron ionization (EI), chemical ionization (CI), fast atom bombardment (FAB), matrix-assisted laser desorption ionization (MALDI), electrospray ionization (ESI) can be listed, but it is not limited to these. ESI can be combined with liquid chromatography, supercritical chromatography, etc., and by chromatography, multiple RNA can be separated and measured. As the chromatographic column that can be used in chromatography, for example, hydrophilic interaction chromatography (HILIC) chromatographic column, reverse phase (RP) chromatography chromatographic column, etc. can be listed.

[0343] In MALDI, the sample is pre-mixed with a substance (coating agent) that is easily ionized by a laser beam as a matrix, and is arranged on a point (anchor position) on a target plate, and ionization is caused by irradiating it with a laser beam. As coating agents that can be used in the present invention, 3-HPA (3-hydroxypicolinic acid), DHC (diammonium citrate), CHCA (α-cyano-4-hydroxycinnamic acid) and the like can be listed, but are not limited to these. In one embodiment, the RNA arranged at a point (anchor position) on the target plate may include RNAs having multiple sequences, and the RNA preferably arranged at a point on the target plate is a group of RNAs sharing the same sequence. As the types of RNA sequences present at one anchor position increase, confirmation of the sequence and / or confirmation of the modification position may become difficult.

[0344] In one embodiment, the modification state of RNA (e.g., presence or absence of modification, position of modification, quantity of modification, reliability of modification, etc.) can be identified based on the measured values ​​of unfragmented ions (parent ions) and / or fragmented ions (daughter ions). In one embodiment, the modification state of RNA (e.g., the amount of modification, etc.) can be identified by comparison with reference molecules (e.g., stable isotope-labeled nucleic acids, non-modified nucleic acids, another nucleic acid in a pair of nucleic acids that can form complementary double strands, etc.). In one embodiment, the modification state of RNA can be identified based on reference information (e.g., measurement results of standard samples, known modification information, etc.). Mass spectrometry data can be processed using any software to transform it into RNA modification states. For example, as an example of such software, DNA methylation analysis system MassARRAY (registered trademark) EpiTYPER (Sequenom) can be cited, but is not limited to these.

[0345] (Pre-processing)

[0346] In one embodiment, the target RNA can be pre-treated by physical, chemical or biological methods before determination. By pre-treatment, it is possible to obtain the effects of, for example, the improvement of sensitivity, accuracy and / or precision in the determination of the target RNA, the improvement of the quantitativeness of the comparison between samples, the improvement of separation in the measuring instrument, etc. As such pre-treatment, for example, dimethyl sulfate treatment, halogen compound treatment, alkaline hydrolysis treatment, stable isotope labeling introduction treatment, detection enhancement agent (such as fluorescent pigments, etc., compounds included in the part that absorbs laser light well in MALDI) treatment can be cited, but it is not limited to these. In one embodiment, the substrate (beads, etc.) loaded with RNA can be pre-treated. In one embodiment, the agent used in the pre-treatment can be designed to introduce groups to the amine part on the base of RNA, the phosphate group at the end or the hydroxyl group.

[0347] Treatment with dimethyl sulfate can selectively methylate the nitrogen atom at position 1 of the purine ring of adenine in RNA, thereby imparting a mass of +14Da. ​​However, when all the nitrogen atoms at position 1 of the purine ring have been methylated, the reaction cannot proceed, thereby being able to distinguish between 1-mA and N6-mA. Similarly, methyl trifluoromethanesulfonate can also be used. In the treatment with halogen compounds, for example, halogenated acetaldehyde can be used to cross-link the nitrogen atom at position 3 of cytosine in RNA with the amino group at position 4 to form a new 5-membered ring, thereby changing the mass number. When the nitrogen atom at position 3 of cytosine has been methylated, the reaction cannot proceed. Examples of halogenated acetaldehydes include bromoacetaldehyde and chloroacetaldehyde. These compounds have a boiling point of about 60°C, so they will not decompose RNA and can be removed by vacuum drying. Regarding alkaline hydrolysis, RNA is fragmented, for example, by treating RNA with ammonia.

[0348] (analyze)

[0349] The RNA modification information obtained can be used to analyze various states. In one embodiment, the RNA modification information obtained is used to analyze the medical state or biological state of the object. The medical state or biological state of the object may include, for example, disease, aging, immune state (e.g., intestinal immunity, systemic immunity, etc.), cell differentiation state, responsiveness to drugs or treatments, and the state of the target microorganism (e.g., intestinal bacteria, epidermal bacteria), but is not limited to these. Diseases that can be analyzed by the present invention include, for example, cranial nerve diseases, pollution diseases, pediatric surgical diseases, fungal diseases, specific diseases, infectious diseases, cancer (malignant tumors), digestive system diseases (including inflammatory bowel disease), neurodegenerative diseases, allergic diseases, parasitic diseases, animal infections, urinary system tumors, various syndromes, respiratory system diseases, breast tumors, personality disorders, skin diseases, sexually transmitted diseases, dental diseases, mental illnesses, renal and urinary system diseases, eye diseases, food poisoning, brown spot disease intermediate hosts, hepatitis, cardiovascular system diseases, rare diseases, connective tissue diseases, symptoms, zoonoses, sexual preference disorders, immune diseases (including intestinal immunity), congenital diseases, developmental disorders, rashes, congenital heart diseases, regional diseases, phobias, viral infections, male reproductive system diseases, animal diseases, fish diseases, proliferative diseases, polyps, periodontal diseases, breast diseases, genetic diseases, blood diseases, endocrine and metabolic diseases, gynecological diseases, diseases that cause fever and rash, soft tissue tumors, plant diseases, etc., but are not limited to these. Diseases that are particularly suitable for analysis in the present invention include, for example, cancer, inflammatory bowel disease, Alzheimer's or vascular dementia, borderline psychosis, dilated cardiomyopathy, hypertrophic cardiomyopathy, heart failure (including invisible heart failure), heart disease (for example, including fatal heart disease that induces sudden death caused by arrhythmia), etc., but are not limited to these. These diseases can affect the modification state of RNA through specific cell metabolism. As the state of the target microorganism, for example, the state of resistance to heat treatment and disinfectants (for example, the state of spore formation of hepatitis E virus parasitic on uncooked food) and other states that may cause accidental events in public health, the modification state (methylation, etc.) of nucleic acids of viruses that infect the host (for example, hepatitis RNA virus, papilloma DNA virus), etc., but are not limited to these.

[0350] The present invention can also be used for cancers such as pancreatic cancer (e.g., early pancreatic cancer), liver cancer, gallbladder cancer, bile duct cancer, gastric cancer, colon cancer (rectal cancer, colon cancer), bladder cancer, kidney cancer, breast cancer, lung cancer, brain tumor, skin cancer, etc., which is very significant from a medical perspective. In addition, according to the present invention, the degree of progression (staging) of cancer (e.g., pancreatic cancer, liver cancer, gallbladder cancer, bile duct cancer, gastric cancer, colon cancer, bladder cancer, kidney cancer, breast cancer, lung cancer, brain tumor, skin cancer) can be analyzed. In one embodiment, the status of cancer (e.g., pancreatic cancer, liver cancer, gallbladder cancer, bile duct cancer, gastric cancer, colon cancer, bladder cancer, kidney cancer, breast cancer, lung cancer, brain tumor, skin cancer) can be analyzed based on the methylation of at least one of miR-21, miR-17, let-17a and miR-200c. In one embodiment, the status of cancer (e.g., pancreatic cancer, liver cancer, gallbladder cancer, bile duct cancer, gastric cancer, colorectal cancer, bladder cancer, kidney cancer, breast cancer, lung cancer, brain tumor, skin cancer) can be analyzed based on the methylation of at least one of miR-21, miR-17, let-17a and miR-200c. Can be based on let-7,miR-21,miR-100,miR-222,miR-92a,miR-10a,miR-99b,miR-30d,miR -26a,miR-320a,miR-148a,miR-125a,miR-423,miR-182,miR-7641,miR-378a,miR -1307,miR-221,miR-183,miR-25,miR-24,miR-30a,miR-128,miR-941,miR-1246 ,miR-92b,miR-122,miR-5100,miR-106b,miR-181a,miR-27b,miR-29a,miR-224,m The status of (e.g., pancreatic cancer) can be analyzed by methylating at least one of iR-191, miR-146b, miR-27a, miR-3182, miR-532, miR-3184, miR-30c, miR-181b, miR-744, miR-7706, miR-148b, miR-629, miR-103b, miR-103a, miR-98, miR-23a, miR-425, miR-192, miR-22, miR-3615, miR-5701, miR-155, miR-149, miR-7704, miR-1180, miR-1275, miR-769, miR-1273g, miR-484, and miR-17.

[0351] The present invention can also analyze the reactivity of the subject organism to drugs (such as anticancer agents, molecular targeted drugs, antibody drugs, biological agents (such as nucleic acids, proteins), antibiotics, etc.) or treatments. For example, resistance can also be analyzed, for example, it can also be used for the reactivity of anticancer agents, the selection of suitable therapeutic agents, the analysis of antibiotic resistance, etc. The analysis of the present invention can also be used for the analysis of the course and prognosis of surgery or radiation treatments such as treatments using heavy particle rays (such as Carbon / HIMAC) or X-rays. It is understandable that the use of the present invention can analyze various drugs such as Lonsurf (TAS102), gemcitabine, CDDP, 5-FU, cetuximab, nucleic acid drugs or histone demethylase inhibitors, which can be effectively used as basic information for treatment strategies. For example, when the drug is an anticancer agent, the present invention can achieve the reactivity of detecting whether the object is resistant to the anticancer agent to establish a treatment strategy. Therefore, by using the present invention, it is possible to select a drug for treating the object and / or further treatment of the above-mentioned object based on the reactivity to treatments such as drugs. When studying the reactivity of multiple drugs, when using the present invention, the drug used to treat the above-mentioned state can be shown from multiple drugs. When performing analysis, the analysis can be performed based on comparison of modification information (e.g., methylation) of the RNA of the present invention in the above-mentioned object before and after administration of the drug or the above-mentioned treatment.

[0352] In one embodiment of the present invention, the object of the analysis of the biological state or medical state can be further considered, and at least one information selected from the group consisting of age, sex, race, ancestry information, medical history, treatment history, smoking status, drinking status, occupational information, living environment information, disease marker information, nucleic acid information (including nucleic acid information of bacteria in the object), metabolite information, protein information (such as expression information, structure information), intestinal bacteria information, epidermal bacteria information and any combination of these can be analyzed. As nucleic acid information that can be used in the method of the present invention, it can be listed that it is selected from genomic information, epigenetic information, transcriptome expression information, RIP sequencing information, microRNA expression information and any combination of these. As RIP sequencing information that can be used separately, it can include RIP sequencing information of drug resistance pump P-glycoprotein, RIP sequencing information of feces, RIP sequencing information of Escherichia coli in feces, etc.

[0353] In the present invention, the above-mentioned state of the above-mentioned object can also be analyzed based on the modification information on the above-mentioned RNA in a resistant strain resistant to a drug or treatment, or a combination of the resistant strain and a cell line derived from the resistant strain. Such drugs or treatments include, for example, Lonsurf (TAS102), gemcitabine, CDDP, 5-FU, cetuximab, nucleic acid drugs, histone demethylase inhibitors, or treatments using heavy particle radiation (e.g., Carbon / HIMAC) or X-rays, but are not limited to these.

[0354] The types of RNAs to be analyzed as the object of the present invention can be increased or decreased according to the purpose of the analysis. For example, at least 5, at least 10, at least 20, at least 30, at least 50, at least 100, at least 200, at least 300, at least 500, at least 1000, at least 1500, and at least 2000 RNAs can be analyzed for modification information. Alternatively, when microRNAs are used as the object, all microRNAs that can be used can be used as the object. The types of RNAs are not particularly limited, and a single one of mRNA, tRNA, rRNA, lncRNA, miRNA, etc. can be used, or a combination of multiple thereof can be used. In one embodiment, multiple modification information on RNAs containing the same sequence can be analyzed. In another embodiment, the state of the object can also be analyzed based on the structural information of RNA.

[0355] In one embodiment, the following steps may be included: analyzing the above-mentioned state of the above-mentioned object based on the modification information of RNA in an organism in which at least one of the methylases (e.g., Mettl3, Mettl14, Wtap), demethylases (e.g., FTO, AlkBH5) and methylation recognition enzymes (e.g., YTHDF1, YTHDF2, YTHDF3, etc. family molecules with a YTH domain) is knocked out and / or the recognition motif information of at least one of the methylases (e.g., Mettl3, Mettl14, Wtap), demethylases (e.g., FTO, AlkBH5) and methylation recognition enzymes (e.g., YTHDF1, YTHDF2, YTHDF3, etc. family molecules with a YTH domain) is analyzed.

[0356] In one embodiment, the following step may be performed: calculating the probability of the state based on a plurality of modification information. As the calculation step, any statistical method may be performed, for example, principal component analysis may be performed.

[0357] In one embodiment, the efficacy of anticancer agents for which clinical evidence has been accumulated (eg, Lonsurf (TAS102), gemcitabine, CDDP, 5-FU, cetuximab, nucleic acid drugs, or histone demethylase inhibitors) on tumor tissues can be studied and a treatment strategy can be established.

[0358] In one embodiment, new mechanisms of action of various agents can be elucidated, and middle molecule compounds that can be used for further therapeutic strategies can be developed, for example, strategies for conquering refractory advanced cancers can be established.

[0359] In one embodiment, the mechanism of action can be further elucidated by analyzing microRNA using the method of the present invention. That is, microRNA specific to a drug such as an anticancer agent can be analyzed using the method of the present invention, and companion diagnostic drugs can be designed using the microRNA.

[0360] In one embodiment, companion diagnosis can be performed using miRNA in peripheral blood obtained by minimally invasive liquid biopsy. For example, clinical information using a drug (e.g., Lonsurf (TAS102), gemcitabine, CDDP, 5-FU, cetuximab, nucleic acid drugs, or histone demethylase inhibitors) is compared with data on miRNA in peripheral blood, and then compared with a mechanism analysis in resistant cells that resist the drug, and miRNAs transcribed from chromatin and secreted into peripheral blood as exosomes in response to the drug exposure are made into 60 panels and identified. The present invention provides a technique for identifying such panel microRNAs and further analyzing them.

[0361] In one embodiment, the present invention can be used to analyze cancer stem cells or cancer initiating cells (CIC).

[0362] In one embodiment, the analysis of the present invention can also be used in cases where the modified RNA itself becomes a target molecule for a drug. That is, by using the analysis technology of the present invention to detect the modification or non-modification of RNA, new drugs can be screened. In particular, it is not known in the past that the modification (e.g., methylation) of RNA such as microRNA is used for such new drug screening, and the present invention can provide a drug based on a new mechanism of action.

[0363] In another embodiment, the analysis of the present invention can also be applied when the modified RNA itself becomes a component molecule of a drug. For example, by detecting the modification or non-modification of RNA using the analysis technology of the present invention, it is possible to analyze whether the RNA modification or external factors such as the enzyme responsible for the modification can be used as a drug, thereby screening for new drugs.

[0364] It is understood that in addition to the analysis of RNA modification, the present invention can also combine other nucleic acid information other than RNA modification, such as base substitution and / or modification information of nucleic acids (DNA, RNA, etc.) for analysis. Regarding various omics analysis, it can be combined with various omics analysis techniques of omics other than RNA modification (epitranscriptome) such as Sijia Huang et al., Front Genet. 2017; 8: 84, Yehudit Hasin et al., Genome Biol. 2017; 18: 83.

[0365] Other nucleic acid information can be analyzed by mass spectrometry, for example, by applying RIP-seq to RNA, DIP-seq to DNA, or FDIP-seq using BrdU or the like in FDNA.

[0366] In one embodiment, the analytical techniques of the present invention can elucidate new mechanisms based on clinical evidence.

[0367] In another embodiment, the present invention can be used to study drug development targets. For example, new drugs of low or medium molecular weight compounds targeting the interaction between a complex of multiple molecules and a target can be developed, and the RNA mod analysis technology of the present invention can be used when performing library screening or phenotypic screening using organoids or animal individuals.

[0368] In one embodiment, the present invention can be used in drug development to address tumor diversity. In addition to the RNAmod of the present invention (such as methylation information of microRNA), it can also be combined with ChIP-seq, single-molecule measurement of modified DNA combined with FTD, and single-cell analysis (C1) of CAF (Cancer Associated Fibroblasts) and lymphocytes in the stroma of tumor tissue. When administering drugs to patients, it is possible to grasp not only the response of cancer cells, but also the comprehensive grasp of the response including the response of the host side such as tumor stroma. If the information of RNA mod can be effectively used to classify inhibitors, innovative drugs that treat the cancer cell side or the stroma side differently can be developed.

[0369] In one embodiment, for a certain drug, the present invention can be used to (1) expand the indication to other diseases, (2) demonstrate superiority over other existing drugs and enable it to enter the second-line treatment, (3) clarify the new mechanism of action and examine the possibility of association with therapeutic drugs, etc.

[0370] In one embodiment, for example, the expression information of miRNA in serum exosomes from a liquid biopsy of a patient such as a cancer patient can be prepared, and the expression information of miRNA in serum exosomes of a patient after treatment as the analysis object and the modification information of the present invention can be analyzed. Therefore, for example, in the case of colon cancer, the expression information and modification information of miRNA in serum exosomes of patients with advanced colorectal cancer can be analyzed using, for example, a database of 1000 cases (Tumor Genome Atlas-Cancer Genome; TCCA).

[0371] In addition, the expression and modification information of miRNA in serum exosomes of patients with colorectal cancer after treatment can be analyzed.

[0372] In one embodiment, the present invention can provide the next generation RNA biomarkers based on RNA modification information based on the analysis results, which can be used clinically. For example, the present invention can grasp the dynamics of tissues through microRNA molecular omics, which can be used and applied clinically.

[0373] In the analysis of information using the RNA of the present invention, the key point may be that the target is a transcription factor, that is, a key induction factor that controls the expression of the target gene (accurately in many cases). In this case, the number can be gradually reduced by strictly screening independent transcription factors. For example, it is worth mentioning that if the method of the present invention is used, the release of "c-myc" with oncogene effects can be found very early in cancer diagnosis. It is understandable that if oncogenes are present, the transcription factor will lose its limited independence and gradually produce various effects in the cell background, so the minimum value cannot be accurately calculated. It can be seen that in this case, "c-myc" has a multi-effect that acts more horizontally, so it becomes noise.

[0374] In the preferred embodiment of the present invention, miRNA (micro R) is used. In this case, the feature is many-to-many. That is, one micro R plays multiple roles for multiple, and shares a common target between microRNAs as different molecules, which can also be called one of the key points. In such a "many-to-many" control system, it is not surprising that there is an important set that induces a certain event and it is not a single molecule. It is better to say that it is a limited set or can be shown with a weight value representing its level in the set, which is also a feature of the analysis provided by the present invention.

[0375] In one embodiment, RNA molecular omics of microRNA is envisioned for cancer diagnosis, but it is not limited thereto, and drug resistance (not only anticancer drugs, but also molecular targeted drugs, antibody drugs, or biological agents such as nucleic acids, and further extended to antibiotics derived from microorganisms, etc.), population classification, inflammatory bowel disease, Escherichia coli, food classification (origin, age, taste, quality, best eating period, taste), etc. RNA molecular omics can be used to select Koji yeast.

[0376] In one embodiment, for example, the IC50 distribution of 5-FU and other drugs such as CDDP is significantly different. It is known that 5-FU is very effective when it is effective, and it is said that it has no effect at all when it is ineffective. This can also be known through the epitranscriptome. For example, we know that if we observe microRNA, the way to observe the epitranscriptome can be clearly differentiated by principal component analysis (PCA) compared to observing expression, and the classification line can be accurately pointed out (see Example).

[0377] It is known that RNA methylation is related to circadian rhythm (Sanchez et al., Nature. 2010 Nov 4; 468(7320): 112-6 and Jean-Michel et al., Cell Vol. 155, Issue 4, pp. 793-806 7 November 2013, etc.). In one embodiment, RNA modification information can be used to analyze sleep activity related to jet lag (jet lag disorder, etc.). For example, based on such analysis, it can be determined whether the sleep activity of the subject is affected by jet lag, and the implementation of personnel or medical management related to this, the management of pilots or flight attendants, whether to recommend the hierarchical taking of melatonin, etc. In one embodiment, RNA modification information can be used to analyze jet lag disorder in aerospace.

[0378] In one embodiment, RNA modification information can be used to analyze whether the subject's sleep is sufficient. Hidden lack of sleep can become a problem, and usually the person himself has no conscious symptoms. Therefore, RNA modification information can be used to correct the problem. In one embodiment, it is consistent with sleep lifestyle therapy. In one embodiment, RNA modification information can be used for health management of long-distance bus drivers. In one embodiment, RNA modification information can be used for welfare management. In one embodiment, RNA modification information can be used for health management of night shift workers (steel mills, nuclear power plants, hospitals, medical practitioners, security personnel, property companies, etc.).

[0379] In one embodiment, RNA modification information of a blood sample can be used to analyze the age of a subject (without using nucleic acid base sequence information, if necessary) for use in criminal investigations.

[0380] In one embodiment, RNA modification information can be used to analyze the presence or absence of adulteration.

[0381] (Biomarker Screening)

[0382] In one embodiment, the RNA modification information obtained can be used to find new biomarkers. In one embodiment, RNA modification information obtained from a subject in a certain state can be compared with RNA modification information obtained from a subject not in the state, and RNA or RNA groups that are observed to have differences (e.g., statistically significant differences) in RNA modification states (e.g., amount, modification position, etc.) can be used as biomarkers for predicting the state.

[0383] In one embodiment, RNA modification information obtained from a subject to which a drug and / or treatment has been administered can be compared with RNA modification information obtained from a subject to which the drug and / or treatment has not been administered, and RNA or RNA groups in which differences (e.g., statistically significant differences) are observed in terms of RNA modification state (e.g., amount, modification position, etc.) can be used as biomarkers for predicting responsiveness and / or resistance to the drug and / or treatment.

[0384] (Resistant strain)

[0385] In one embodiment, RNA modification information obtained from a resistant strain resistant to a drug and / or treatment can be compared with RNA modification information obtained from a wild strain from which the resistant strain is derived, and RNA or RNA groups in which differences (e.g., statistically significant differences) are observed in RNA modification states (e.g., amount, modification position, etc.) can be used as biomarkers for predicting responsiveness and / or resistance to the drug and / or treatment.

[0386] Such resistant strains can be prepared, for example, by maintaining and culturing wild-type strains in the presence of drugs and / or treatments. In one aspect, the present invention provides a method for preparing such resistant strains. In one aspect, the resistant strains can be prepared based on the IC against the drugs and / or treatments. 50 To evaluate whether a strain resistant to a drug and / or treatment is a resistant strain. In one aspect, the present invention provides a strain resistant to trifluridine (FTD), 5-fluorouracil (5-FU), gemcitabine, cisplatin, cetuximab, Carbon / HIMAC (heavy particle radiation) and X-rays.

[0387] (Drug Screening)

[0388] In one embodiment, the RNA modification information obtained can be used to evaluate new drugs. In one embodiment, RNA modification information obtained from a subject treated with a certain drug can be compared with RNA modification information obtained from a subject treated with another drug, thereby classifying drugs based on the RNA changed by treatment with each drug.

[0389] (Species classification)

[0390] In one embodiment, the obtained RNA modification information can be used to classify biological species. In one embodiment, the obtained RNA modification information can be used to classify microorganisms (such as Escherichia coli). In one embodiment, the obtained RNA modification information can be used to classify microorganisms (such as Escherichia coli). In one embodiment, the modification information on RNA encoding the drug resistance pump P-glycoprotein can be used to classify microorganisms (such as Escherichia coli). In one embodiment, the object (such as a mammal such as a human, food, etc.) from which the microorganism is obtained can be analyzed based on the classification result of the microorganism (such as Escherichia coli).

[0391] (food)

[0392] In one embodiment, the obtained RNA modification information can be used to analyze the quality of food. As the quality of food, for example, origin, age, time after processing, freshness, denaturation after processing, taste quality, active oxygen status, microbial contamination (Escherichia coli, Salmonella, Clostridium botulinum, viruses, parasites, etc.), fermentation status (including the status of microorganisms related to fermentation), chemical factors (such as pesticides, additives, etc.), physical factors (such as foreign matter, radiation, etc.), fatty acid status or maturity, etc., but not limited to these. In one embodiment, the obtained RNA modification information can be used to analyze the quality of food so that public institutions such as administrative agencies can perform food quality management. In one embodiment, the obtained RNA modification information can be used to analyze the quality of food so as to provide consumers with indicators for judging the quality of products (objectively indicating the situation expressed by taste and smell).

[0393] In addition, by using the present invention, a new expansion can be provided when the perspective is changed from DNA, RNA, and protein to RNA modification (such as methylation). For example, DNA and RNA will lose the information of continuous base sequences as they decompose (gradually shortening and fragmenting), while methylation is the manifestation of its essence. As long as the target site exists, it can be expressed as a methylation rate. Therefore, it is unique in that it can monitor "how the originally existing factors gradually decay over time and whether they remain." Proteins are not only between the two, but also in this application, the target point is not fixed, so they have limitations as tracking tools and tracers. Therefore, it can be said that unlike DNA, RNA, and proteins, they can exert particularly excellent effects.

[0394] (Use of additional information)

[0395] In one embodiment, the state of the object can be analyzed based on the RNA modification information obtained from the object using other information, such as RNA modification information obtained from the object at other times (e.g., before and after treatment), information about the object, motif information of proteins related to modification, information about RNA modification obtained from other objects, information about complexes of substances that can bind to RNA (proteins, lipids, etc.) and RNA (as needed, states related to the RNA modification state), etc.

[0396] As information about the object that can be used additionally, for example, the age, sex, race, ancestry information, medical history, treatment history, smoking status, drinking status, occupational information, living environment information, disease marker information, nucleic acid information (including nucleic acid information of microorganisms in the object), metabolite information, protein information, intestinal bacteria information, epidermal bacteria information, etc. can be listed. As nucleic acid information, for example, genome information, genome modification information, transcriptome information (including information on expression levels and sequences), RIP sequencing information, microRNA information (including information on expression levels and sequences) can be listed. As RIP sequencing information that can be used separately, RIP sequencing information of drug resistance pump P-glycoprotein, RIP sequencing information of feces, RIP sequencing information of Escherichia coli in feces, etc. can be listed.

[0397] As additional motif information of proteins related to modification, there can be listed recognition motif information of enzymes that add modification, recognition motif information of enzymes that remove modification, and recognition motif information of proteins bound to modification. Specifically, there can be listed motif information of methylases (e.g., Mettl3, Mettl14, Wtap), demethylases (e.g., FTO, AlkBH5), and methylation recognition enzymes (e.g., YTHDF1, YTHDF2, YTHDF3, etc., family molecules with YTH domains).

[0398] Examples of information about RNA modifications obtained from other objects that can be used additionally include RNA modification information of an object in a certain state, RNA modification information of an organism in which genetic manipulation has been performed on the expression of a protein related to the modification, RNA modification information of a resistant strain resistant to drugs and / or treatments, RNA modification information of an object to which drugs and / or treatments have been applied, and information on a complex of RNA with a substance that can bind to RNA (proteins, lipids, etc.) (a state related to the RNA modification state as needed), but are not limited to these.

[0399] In the present invention, the above-mentioned state of the above-mentioned object can also be analyzed based on the modification information on the above-mentioned RNA of a resistant strain or a combination of the resistant strain and a cell line derived from the resistant strain that is resistant to a drug or treatment. Such drugs or treatments include, for example, Lonsurf (TAS102), gemcitabine, CDDP, 5-FU, cetuximab, nucleic acid drugs, histone demethylase inhibitors, or treatments using heavy particle radiation (e.g., Carbon / HIMAC) or X-rays, but are not limited to these.

[0400] (Object State Analysis Method)

[0401] In one embodiment, the present invention provides a method for analyzing the state of an object, comprising: obtaining modification (e.g., methylation) information on at least one RNA (e.g., microRNA) in the object; and analyzing the state of the object based on the modification information. The modification information can be obtained by measuring a sample from the object. In one embodiment, the analysis is an on-site analysis performed within a short time after the sample is obtained (e.g., within 1 day, within 10 hours, within 5 hours, within 2 hours, within 1 hour, within 30 minutes, within 15 minutes, etc.). In one embodiment, the analysis result of the on-site analysis is output within a short time from the acquisition of the sample (e.g., within 1 day, within 10 hours, within 5 hours, within 2 hours, within 1 hour, within 30 minutes, within 15 minutes, etc.). In one embodiment, after the sample is obtained, the sample is sent to a place with a measuring device and / or an analyzer, where the analysis is performed. The acquisition of the sample can be performed by the subject itself. In one embodiment, the obtained sample can be delivered after being frozen. The analysis results can be transmitted to the person who submitted the sample, or can be used by accessing a website on the Internet.

[0402] For example, when the method of the present invention is implemented in a medical institution such as a hospital, a sample (such as blood, removed organs, feces, etc.) is obtained from a subject (such as a patient or a subject at risk of illness, etc.), the sample is processed to purify the target RNA (such as microRNA), and the modification information of the target RNA is identified. The state of the subject (such as the possibility of suffering from cancer and cancer recurrence, the possibility of acquiring resistance to specific drug treatment, etc.) can be analyzed based on the modification information of the RNA thus identified. The modification information of RNA obtained at one time can be used for the state analysis of other subjects, can be used for the analysis of the state of the same subject at different times, and can also be accumulated into a database.

[0403] For example, when the method of the present invention is implemented in a research institute such as a pharmaceutical company, a sample obtained from a subject (e.g., tissue or organ of an experimental animal, clinical sample, cultured cell, etc.) is processed to purify a target RNA (e.g., microRNA) and identify the modification information of the target RNA. The modification information of the RNA thus identified can be correlated with the state of the same subject confirmed by other analyses (e.g., the state of cancer, the state of resistance, the state of drug therapeutic effect, etc.) and information is accumulated. A drug suitable for the state of an object (a patient or a subject at risk of illness, etc.) can be determined based on the modification information of the RNA thus obtained.

[0404] (program)

[0405] In one aspect, the present invention provides a program for installing a method for analyzing the state of an object based on modification information of RNA on a computer. The method installed by the program includes: (a) a step of comparing modification information on at least one RNA in an object with reference modification information of the RNA; and (b) a step of determining the state of the object based on the output result of the comparison step. In one embodiment, the reference modification information includes modification information on the above-mentioned RNA of an object different from the above-mentioned object. In one embodiment, the reference modification information includes modification information on the above-mentioned RNA of the above-mentioned object obtained at a different time from the above-mentioned modification information.

[0406] In one aspect, the present invention provides a recording medium containing a program, wherein the program is installed on a computer for analyzing the state of an object based on modification information of RNA. The method executed by the program contained in the recording medium includes: (a) a step of comparing the modification information on at least one RNA in the object with the reference modification information of the RNA; and (b) a step of determining the state of the object based on the output result of the comparison step. In one embodiment, the reference modification information includes modification information on the above-mentioned RNA of an object different from the above-mentioned object. In one embodiment, the reference modification information includes modification information on the above-mentioned RNA of the above-mentioned object obtained at a different time from the above-mentioned modification information.

[0407] (system)

[0408] In one aspect, the present invention provides a system for analyzing the state of an object based on modification information of RNA. The system comprises: (a) a measuring unit for measuring RNA; (b) a calculating unit for calculating the modification state on RNA based on the result of the measurement; and (c) an analyzing unit for analyzing the state of the object based on the modification state. In one embodiment, the system further comprises a sample processing unit for processing a sample to purify the target RNA.

[0409] The determination unit can be of any configuration as long as it is based on the function and configuration of providing RNA modification information. It can be provided with a structure that is the same as or different from the calculation unit and the analysis unit. In one embodiment, the determination unit is a mass spectrometer (e.g., MALDI-MS). In one embodiment, the determination unit is a sequencing device.

[0410] The calculation unit identifies the modification state on the RNA (eg, modification position, modification amount, etc.) based on the measurement data.

[0411] The analysis unit analyzes the state of the object based on the obtained RNA modification information. In one embodiment, the analysis can be performed by further referring to the above-mentioned additional information.

[0412] Reference Fig.34 The functional block diagram of the system of the present invention is used to illustrate the composition of the system of the present invention. It should be noted that the figure shows the case where a single system is implemented, but it should be understood that the case where multiple systems are implemented is also included in the scope of the present invention. The method implemented in the system can be recorded as a program. Such a program can be recorded in a recording medium and can be implemented as a method.

[0413] The system 1000 of the present invention is configured as follows: a CPU 1001 built into a computer system is connected to an external storage device 1005 such as a RAM 1003, a ROM, an SSD, an HDD, a magnetic disk, a flash memory such as a USB memory, and an input / output interface (I / F) 1025 via a system bus 1020. Input devices 1009 such as a keyboard and a mouse, output devices 1007 such as a display, and communication devices 1011 such as a modem are connected to the input / output I / F 1025. The external storage device 1005 includes an information database storage unit 1030 and a program storage unit 1040. Both are physical storage areas held in the external storage device 1005.

[0414] In such a hardware configuration, various instructions (commands) are input via the input device 1009, or commands are received via the communication I / F, the communication device 1011, etc., so that the software program installed in the storage device 1005 is called by the CPU 1001 to the RAM 1003, expanded and executed, thereby cooperating with the OS (operating system) to perform the functions of the present invention. Of course, the present invention can also be implemented by a mechanism other than such a cooperative situation.

[0415] In the implementation of the present invention, when RNA modification data is obtained by measuring RNA samples (e.g., mass spectrometry and / or sequencing), the RNA modification data obtained by the measurement or information equivalent thereto (e.g., data obtained by simulation) can be input via the input device 1009, or input via the communication I / F, communication device 1011, etc., or already stored in the database storage unit 1030. The steps of measuring the RNA sample (e.g., mass spectrometry and / or sequencing) to obtain RNA modification data and analyzing the RNA modification data can be performed by a program stored in the program storage unit 1040, or by inputting various instructions (commands) via the input device 1009, or by receiving commands via the communication I / F or communication device 1011, etc., or by a software program installed in the external storage device 1005. The software for performing such analysis can use the software exemplified in the embodiment, but is not limited thereto, and any software known in the art can be used. The analyzed data can be output via the output device 1007 or stored in the external storage device 1005 such as the information database storage unit 1030.

[0416] The data, calculation results, or information obtained via the communication device 1011 are written and updated at any time in the database storage unit 1030. Each sequence in each input sequence set, each RNA information ID of the reference database, and other information are managed by each master table, so that the information belonging to the sample to be accumulated can be managed by the ID defined in each master table.

[0417] The database storage unit 1030 can associate the above calculation results with various information such as other nucleic acid information obtained from the same sample, known information such as biological information, and store them. Such association can be established directly with data that can be obtained through a network (Internet, intranet, etc.) or as a link to the network.

[0418] In addition, the computer program stored in the program storage unit 1040 constitutes the computer as the above-mentioned processing system, for example, a system for providing data, analyzing modification status, comparing with reference data, classification, clustering, other processing, etc. The above-mentioned functions are respectively independent computer programs, their modules, routines, etc., and are executed by the above-mentioned CPU 1001 to constitute the computer as each system and device.

[0419] (Reagents)

[0420] In one embodiment, the present invention provides a composition for purifying RNA related to the modification and state in order to determine the state of an object based on the modification information of the RNA, and the composition comprises means for capturing at least one RNA in the object. In one embodiment, the means for capturing comprises a nucleic acid that is at least partially complementary to the target RNA. In one embodiment, the means for capturing comprises means for capturing modified RNA (e.g., modification-specific antibodies, etc.). In one embodiment, the means for capturing comprises a molecule that is specific to the modified target RNA. In one embodiment, the means for capturing comprises a portion for purification (e.g., a magnetic carrier, one of the paired substances that can bind to each other (e.g., biotin and streptavidin)). In one embodiment, the means for capturing comprises a connector connected to the portion for purification.

[0421] (Tablet, Chip)

[0422] In one embodiment, the present invention provides a plate or chip for determining the state of an object based on modification information of at least one RNA, and a means for capturing the RNA is configured on the surface of the plate or chip. In one embodiment, the plate or chip is used for MALDI measurement. In one embodiment, the plate or chip has a plurality of spots, and means for capturing RNA with different sequences are configured at each spot. In one embodiment, the size of each spot can be, for example, 10 μm to 100 μm in diameter. In one embodiment, 1, 2, 3, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 75, 100, 150, 200, 300, 400, 500, 750, 1000, 1500, 2000, 2500 or 3000 spots can be formed on one plate or chip. In one embodiment, 10 7The above means for capturing. In one embodiment, the means for capturing is a nucleic acid that is at least partially complementary to the target RNA. The substrate of the flat plate or chip is not limited, and examples thereof include glass and plastic (polyethylene) that are endowed with conductivity.

[0423] When different points are close to each other, when the points are irradiated with laser in order to ionize the RNA contained in the points by MALDI, etc., other points around the target point may also be irradiated with laser. As a result, in the fragmentation measurement using mass spectrometry, interference of signals from close points is generated, which may affect the measured value of the target point. Therefore, in one embodiment, the points on the plate or chip can be configured in a manner that reduces or minimizes the influence of interference between signals. In one embodiment, the influence of interference between signals can be evaluated based on the overlap and / or difference between the m / z values ​​generated by the fragmentation of each RNA configured at each point (which can be based on actual measurement results or based on theory). At this time, the m / z values ​​generated by the fragmentation of each RNA can take into account or not the increase or decrease in mass number caused by the presence of modification. In one embodiment, the points on the plate or chip are configured based on mathematical statistics methods such as the Monte Carlo method.

[0424] (Reagent test kit)

[0425] In one embodiment, the present invention provides a kit for determining the state of an object based on RNA modification information, comprising a composition for purifying target RNA, a plate or chip equipped with means for capturing target RNA, and at least one device for obtaining a sample from the object, and instructions for how to use the kit. In one embodiment, the kit comprises means for purifying RNA from a sample.

[0426] In one embodiment, the kit is of a type that processes a sample in a manner suitable for MALDI measurement. In one embodiment, the kit further comprises a coating agent (eg, comprising 3-hydroxypicolinic acid) used in MALDI measurement.

[0427] In one embodiment, the kit is used to obtain a sample from a subject. In one embodiment, the kit comprising a device for obtaining a sample from a subject comprises an instruction manual recording the delivery address of the sample. In one embodiment, the kit comprises a means for freezing and preserving the collected sample. In one embodiment, the kit comprises a device for obtaining blood, mucosal epidermis (e.g., mucosal epidermis of the oral cavity, nasal cavity, ear cavity, vagina, etc.), skin epidermis, biological secretions (e.g., saliva, nasal discharge, sweat, tears, urine, bile, etc.), feces, and epidermal microorganisms from a subject.

[0428] (General Technology)

[0429] The molecular biology methods, biochemical methods, and microbiological methods used in this specification are well-known and commonly used methods in the relevant fields, and are described in, for example, Current Protocols in Molecular Biology (http: / / onlinelibrary.wiley.com / book / 10.1002 / 0471142727) and Molecular Cloning: A Laboratory Manual (Fourth Edition) (http: / / www.molecularcloning.com), and the relevant parts (which may be all) of these are cited in this specification as reference.

[0430] In this specification, when "at least one or more" is used in the items listed in the text, "or" is used. The same applies to "or". In this specification, when "within the range" of "two values" is clearly stated, the two values ​​themselves are also included in the range.

[0431] References such as scientific documents, patents, and patent applications cited in this specification are incorporated herein by reference to the same extent as if each had been specifically and specifically described in its entirety.

[0432] Above, preferred embodiments are shown and described for the convenience of understanding the present invention. The present invention is described below based on embodiments, but the above description and the following embodiments are provided only for the purpose of illustration and are not provided for the purpose of limiting the present invention. Therefore, the scope of the present invention is not limited by the embodiments and embodiments specifically described in this specification, but is only limited by the claims.

[0433] Example

[0434] Examples are described below.

[0435] Regarding reagents, the products specifically described in the examples were used, but equivalent products from other manufacturers (Sigma-Aldrich, Wako Pure Chemical, Nacalai Tesque, R&D Systems, USCN Life Science INC, etc.) may be used instead.

[0436] (abbreviation)

[0437] In addition to the abbreviations already explained in this specification, the following abbreviations are used.

[0438] 3-HPA (3-Hydroxypicolinic acid)

[0439] DHC (diammonium citrate)

[0440] In the following examples, methylation on the following microRNAs is used as an example to detect RNA methylation (the underline in the table indicates methylation). It will be understood by those skilled in the art that RNA modifications other than these can also be analyzed in the same manner.

[0441] [Table 3]

[0442]

[0443] General regulations

[0444] The following are examples of standard protocols used in this specification.

[0445] (RNA Extraction)

[0446] When total RNA was extracted from the sample, TRIzol (Invitrogen) was used according to the manufacturer's instructions.

[0447] (Purification of target RNA)

[0448] When purifying a specific RNA, an oligo DNA complementary to the respective RNA is used.

[0449] In this specification, complementary oligo DNAs were designed for the human miRNAs listed below.

[0450] [Table 4]

[0451] Target RNA sequence

[0452]

[0453] * The left side is the 5' end and the right side is the 3' end.

[0454] DNAs complementary to these target RNAs were synthesized (capture oligo DNAs).

[0455] [Table 5]

[0456] Oligo DNA sequences for capturing target RNA

[0457] name sequence Catch 17-5p CTACCTGCACTGTAAGCACTTTG (sequence number 6) Catch 21-5p TCAACATCAGTCTGATAAGCTA (serial number 7) Capture 200c-5p CCAAACACTGCTGGGTAAGACG (sequence number 8) Capture 200c-3p TCCATCATTACCCGGCAGTATTA (serial number 9) Capturing let7a-5p AACTATACAACCTACTACCTCA (serial number 10)

[0458] By comparing with a known sequence database, it was confirmed that these capture oligo DNAs have a low probability of hybridizing with RNA other than the target RNA.

[0459] (Directly bind to beads)

[0460] Direct binding beads were prepared as follows. A 6-aminohexyl group was introduced into the phosphate portion of the 5' end of the capture oligo DNA. Each capture modified oligo DNA was connected to a magnetic bead (Dynabeads M270 Amine, Thermo Fisher Scientific, Tokyo) with amino groups covalently linked to the surface using a divalent amino cross-linker (BS3, bis(sulfosuccinimidyl) suberate).

[0461] [Chemistry 1]

[0462]

[0463] (Streptavidin-bound beads)

[0464] Other types of beads were also produced. Biotin was introduced into the phosphate portion of the 5' end of the capture oligo DNA. Magnetic beads (Dynabeads M270 Streptoavidin, Thermo Fisher Scientific) with streptavidin covalently bound to the surface were mixed with the biotinylated capture oligo DNA to produce avidin-biotin binding, and the capture oligo DNA was fixed on the magnetic beads.

[0465] In addition, a protocol was used in which biotinylated capture oligo DNA was hybridized to the target RNA and then purified using magnetic beads.

[0466] (Purification protocol for direct binding to beads)

[0467] This procedure is a modification of the method of J. Engberg et al., Eur. J. Biochem, 41, 321-328 (1974).

[0468] When using a plurality of capture oligo DNAs, the sample is divided into fractions, and one capture oligo DNA is used for each sample.

[0469] The details are as follows.

[0470] 1. Add one of the above capture oligo DNA binding beads and 6xSSPE (0.9M NaCl, 60mM NaH 2 PO 4 , 7.5mM EDTA, pH7.4)10mL.

[0471] 2. Add 5 mL of denaturing solution D (4 M guanidine thiocyanate, 25 mM citric acid (pH 7.0), 0.5% sarcosine, 0.1 M 2-mercaptoethanol) (the final concentration of guanidine thiocyanate is 1.25 M).

[0472] 3. Heat at 60°C for 10 minutes and vortex at room temperature for 45 minutes.

[0473] 4. The supernatant was removed using a magnetic stand, and the beads were washed four times with 1 mL of BW Buffer (10 mM Tris-HCl, pH 7.5, 1 mM EDTA, 2.0 M NaCl) and twice with 1 mL of Volatile Rinse Buffer (10 mM ammonium acetate, pH 7.0).

[0474] 5. After completely removing the washing solution, add 100 μL of RNase free SDW to the beads, heat at 70°C for 3 minutes, cool on ice, and collect the supernatant.

[0475] 6. In case of low concentration, freeze-dry the supernatant.

[0476] (Purification protocol for streptavidin-bound beads)

[0477] When using a plurality of capture oligo DNAs, the sample is divided into fractions, and one capture oligo DNA is used for each sample.

[0478] 1. Add salt solution and the above-mentioned biotinylated capture oligo DNA to the purified RNA to make the final concentration of 10mM phosphate buffer (pH7.0) and 50mM KCl.

[0479] 2. The mixture was placed in a PCR apparatus, denatured at 90°C for 1 minute, and then slowly cooled to 45°C for annealing.

[0480] 3. Add avidin magnetic beads (Dynabeads M-280 Streptavidin).

[0481] 4. Discard the non-adsorbed fraction (supernatant) on the magnetic stand.

[0482] 5. Wash the beads three times on a magnetic stand using 10 mM phosphate buffer pH 7.0, 50 mM KCl.

[0483] 6. Wash the beads three times on a magnetic stand using 10 mM ammonium acetate (pH 7.0) and then elute with RNase free water.

[0484] 7. In case of low concentration, freeze-dry the supernatant.

[0485] (Dimethyl sulfate treatment)

[0486] Regarding the dimethyl sulfate treatment, the reaction was carried out according to the following steps. The purified RNA was dissolved in 10 mM phosphate buffer (pH 7.5) to a final concentration of 100 μM, and a 15% dimethyl sulfate ethanol solution adjusted in time was added to a final concentration of 0.5%, and the mixture was treated at 25°C for 1 minute. β-mercaptoethanol was added to a final concentration of 2%, and the reaction was terminated by sufficient stirring.

[0487] (Chloroacetaldehyde treatment)

[0488] Regarding the chloroacetaldehyde treatment, the reaction was carried out according to the following steps. The purified RNA was dissolved in 10 mM potassium phosphate (pH 5) so that it reached 100 μM, and bromoacetaldehyde or chloroacetaldehyde was added to a final concentration of 1%, and the mixture was treated at 37°C for 2 hours. After removing the excess bromoacetaldehyde or chloroacetaldehyde by ether extraction, the aqueous layer was dried to obtain a residue.

[0489] (Mass spectrometry of purified RNA)

[0490] The RNA sample was purified using Zip Tip C18 (Millipore) as necessary.

[0491] 3-HPA (3-hydroxypicolinic acid) was added to a solution of acetonitrile: 0.1% TFA aqueous solution = 1:1 to make it 10 mg / mL, and 1 μL of the mixture obtained by mixing this solution with 10 mg / mL DHC (diammonium citrate) aqueous solution at a ratio of 1:1 was applied to a target plate (Target Plate MTP Anchor Chip 384 (600 micrometer), Bruker Dalotnics) as a matrix (coating agent) for MALDI and dried. 1 μL of purified RNA aqueous solution was overlapped at the same position and dried. After confirming that it was completely dried, mass spectrometry was performed using a MALDI mass spectrometer (ultrafleXtreme-TOF / TOF mass spectrometer, manufactured by Bruker Dalotnics).

[0492] The MALDI apparatus settings were as follows.

[0493] positive-mode (cation detection mode)

[0494] reflector-mode

[0495] Laser Power Max (maximum output that can be set)

[0496] (Analysis of mass spectrometer measurement results)

[0497] Analysis of the measurement results obtained by MALDI was performed as follows.

[0498] An estimated mass list was prepared based on the sequence information of microRNA obtained from miRBase (Release 21) (http: / / www.mirbase.org), and the sequence and modification were determined manually by comparing with the measured mass spectrum.

[0499] (RIP sequencing assay)

[0500] RIP sequencing was performed according to the following protocol.

[0501] This is the protocol for using subconfluent cells from three 15 cm dishes as one sample. Using 2 ml of Trizol (Invitrogen) for one 15 cm dish, 500 μg to 700 μg of RNA can be recovered from three 15 cm dishes. In addition, RNA can be recovered from 1 ml of serum using 2 ml of Trizol (Invitrogen).

[0502] Reagents used, etc.

[0503] [Table 6]

[0504]

[0505] (A) Purification of ployA RNA

[0506] ployA was purified according to the protocol of the Oligotex (registered trademark) (Takara Bio) kit.

[0507] * Extraction was performed three times with 30 μL of DW at 75°C, and a total of 90 μL was recovered.

[0508] * 1-3% polyA RNA was obtained from total RNA.

[0509] * 5 μg of polyA RNA is required for one sample.

[0510] (B) RNA fragmentation

[0511] [Table 7]

[0512]

[0513] 1. Adjust the RNA concentration to 750 ng / 18 μL.

[0514] 2. Dispense 750 ng RNA / 18 μL + 2 μL 10X Lysis Buffer, i.e. a total of 20 μL, into each well of the 8-tube strip.

[0515] 3. Incubate at 90°C for 2 minutes.

[0516] 4. Quickly add 2 μL of EDTA (0.5 M) to 20 μL of the reaction solution to terminate the reaction.

[0517] 5. Collect the reaction solution for each sample and perform ethanol precipitation.

[0518] Example: RNA 200μL

[0519] + 3M sodium acetate (pH 5.2) 20 μL (1 / 10 of the amount of RNA)

[0520] + Glycogen (20 mg / ml stock solution) 3.6 μL (200 times)

[0521] +100% ethanol 500 μL (2.5 times the amount of RNA)

[0522] 6. Incubate at -80°C for 1 hour.

[0523] 7. Centrifugation (12000G, 30 minutes, 4°C)

[0524] The supernatant was removed and 1 ml of 75% ethanol was added.

[0525] Centrifugation (12000G, 15 minutes, 4°C)

[0526] The supernatant was removed and the solution was dissolved with 200 μL of RNAse free water.

[0527] 8. 10 μL of each sample was used as INPUT and stored at -80°C.

[0528] (C) Formation of RNA-antibody complex

[0529] [Table 8]

[0530]

[0531] The above mixture was mixed and incubated at 4°C for 2 hours while vortexing.

[0532] (D) Immunoprecipitation using magnetic beads

[0533] 1. For one sample, use 50 μL of Dynabeads ProteinG (Thermo Fisher Scientific) and wash twice with 1 ml of 1xIP buffer.

[0534] 2. To the beads separated by magnetism, 1 ml of 1xIP buffer + 10 μL of RVC + 1 μL of RNAse inhibitor + 50 μL of BSA (10 mg / ml) were added, and the mixture was incubated at 4°C for 2 hours while vortexing (to inhibit nonspecific binding of beads).

[0535] 3. Wash the beads twice with 1×IP buffer 1 ml + RVC 10 μL + RNAse inhibitor 1 μL.

[0536] 4. For each sample, add the reaction solution of step (C) to the beads separated by magnetism, and incubate at 4°C for 2 hours (or overnight) while vortexing.

[0537] (E) Elution

[0538] 1. Wash the beads from step (D) three times with washing buffer (1XIP buffer 10 ml + RVC 10 μL + RNAse inhibitor 5 μL).

[0539] [Table 9]

[0540]

[0541] 2. For one sample, add 100 μL of elution buffer and vortex every 15 min. Incubate at 4 °C for 2 h.

[0542] 3. Separate the beads magnetically and recover the supernatant.

[0543] 4. Further, 100 μL was taken from (1XIP buffer 1 ml + RVC 10 μL + RNAse inhibitor 1 μL) and added to the beads. The beads were tapped and magnetically separated, and the supernatant was recovered.

[0544] 5. Repeat steps 5 to 7 above, recover the supernatant, and combine the two amounts.

[0545] 6. Mix 400 μL of supernatant + 40 μL of sodium acetate + 1000 μL of 100% ethanol to perform ethanol precipitation.

[0546] (without adding glycogen or other carriers)

[0547] 7. Leave at -80℃ overnight.

[0548] 8. Centrifugation (12000G, 30 minutes, 4°C)

[0549] The supernatant was removed and 1 ml of 75% ethanol was added.

[0550] Centrifugation (12000G, 15 minutes, 4°C)

[0551] 9. Dissolve the pellet in 15 μL of RNAse free water.

[0552] This is used for sequencing together with the 8 INPUTs in step (B).

[0553] Sequencing was performed using Hi-seq (2000 Ilumina).

[0554] The protocol for analyzing data obtained by RIP sequencing is shown below (Linux / R).

[0555] (from fastq file to peak detection)

[0556] Install SRA Toolkit, bowtie, samtools, macs, and download the annotation file of hg19 (refer to DRY analysis script (Showrunsha) etc.).

[0557] The data quality is checked and the IP and INPUT data are summarized. For example, when there are immunoprecipitation samples (IP1, IP2, IP3: 3 replicates) and their corresponding INPUTs (INPUT1, INPUT2, INPUT3), the following is performed.

[0558] [Number 1]

[0559] fastqc --nogroup*.fastq

[0560] IP1.fastq IP2.fastq IP3.fastq>IP.fastq

[0561] INPUT1.fastq INPUT2.fastq INPUT3.fastq>Input.fastq

[0562] Map the fastq file through bowtie to create a sam file, and then create a bam file from the sam file.

[0563] [Number 2]

[0564] bowtie-m 1-p 4--sam~ / chip / hg19-q IP.fastq IP.sam

[0565] bowtie-m 1-p 4--sam~ / chip / hg19-q Input.fastq Input.sam

[0566] samtools view-Sb IP.sam>IP.bam

[0567] samtools view-Sb Input.sam>Input.bam

[0568] Sort the data according to chromosome order, create indexes, and detect peaks through MACS.

[0569] [Number 3]

[0570] samtools sort IP.bam IP_sorted

[0571] samtools index IP_sorted.bam

[0572] samtools sort IP.bam Input_sorted

[0573] samtools index Input_sorted.bam

[0574] macs14-t IP_sorted.bam-c Input_sorted.bam--name=IP_normalized-f BAM-g hs-S--wig>macs.out

[0575] (Peak analysis using R)

[0576] The following software packages are used.

[0577] (Guitar)

[0578] (MeTPeak)

[0579] (openxlsx)

[0580] (ChIPpeakAnno)

[0581] (BSgenome.Hsapiens.UCSC.hg19)

[0582] (TxDb.Hsapiens.UCSC.hg19.knownGene)

[0583] (rGADEM)

[0584] (ChIPseeker)

[0585] (1. Gene mapping based on EXCEL files output by macs)

[0586] Only the transcriptome information is taken out by g19 and stored in gc_txdb. The upper part that cannot be read by EXCEL is deleted, and the xls is converted into xlsx and saved.

[0587] [Number 4]

[0588] library(Guitar)

[0589] txdb<-makeTxDbFromUCSC(genome="hg19")

[0590] gc_txdb<-makeGuitarCoordsFromTxDb(txdb, noBins=100)

[0591] library(openxlsx)

[0592] IP<-read.xlsx(″m6A_IP_peaks.xlsx″)

[0593] Peaks with a fold change of 4 or more and an FDR of 5% or less were extracted as significant peaks, and the file was changed to a Granges file.

[0594] [Number 5]

[0595]

[0596] Concatenate the Granges files and create a list, naming the elements of the list.

[0597] [Number 6]

[0598] GRs<-list(IP.gr, IP.sig.gr)

[0599] names(GRs)<-c("IP","IP.sig")

[0600] GuitarPlot(GRs, GuitarCoordsFromTxDb=gc_txdb)

[0601] (2. Motif search)

[0602] 50 bases before and after the cap were extracted, totaling 100 bases, and used for motif search, and 1000 bases were selected from the side with low FDR.

[0603] [Number 7]

[0604] library("ChlPpeakAnno")

[0605] library(″BSgenome.Hsapiens.UCSC.hg19″)

[0606] IP<-read.xlsx(″m6A_IP_peaks.xlsx″)

[0607] summit<-IP$start+IP$summit-1

[0608] tmp<-cbind(IP$chr,summit-50,summit+49,IP[,c(6:9)])

[0609] tmp<-head(tmp[order(tmp[,7]),],1000)

[0610] Change the file to a Granges file.

[0611] [Number 8]

[0612]

[0613] Sequences were obtained using the ChIPpeakAnno software package.

[0614] [Number 9]

[0615] IP.peaksWithSeqs<-getAllPeakSequence(IP.summit.gr, upstream=0, downstream=0, genome=Hsapiens)

[0616] write2FASTA(IP.peaksWithSeqs, file="IP.fa")

[0617] library(″rGADEM″)

[0618] seqs<-readDNAStringSet("IP.fa", "fasta")

[0619] motif<-GADEM(seqs, verbose=1, genome=Hsapiens)

[0620] plot(motif)

[0621] [Chemistry 2]

[0622]

[0623] (3. Obtain annotations of genes with peaks)

[0624] [Number 10]

[0625]

[0626] (4. Analyze using MetPeak (a dedicated analysis software package for RIP sequencing))

[0627] (See Cui et al., Bioinformatics (2016) 32(12): i378-i385)

[0628] [Number 11]

[0629]

[0630] (Example 1) Methylation analysis of microRNA

[0631] In this example, microRNA methylation analysis was performed, as described below.

[0632] The microRNA 200-c-5p (human sequence, sequence number 11) synthesized in a manner containing methylated adenine and methylated cytosine was dissolved in RNase Free ultrapure water, and the concentration was confirmed by absorbance measurement and adjusted to 1 pmol / μL. Using 1 μL of the microRNA aqueous solution, mass spectrometry was performed using a MALDI mass spectrometer according to the above-mentioned procedure. In order to confirm the internal sequence, RNA was degraded (5'→3') by ammonia treatment. In addition, the observed precursor ions were subjected to the measurement using in source decay (ISD) ( Figure 1 ).

[0633] A synthetic oligo DNA having a sequence complementary to microRNA369-3p (complementary chain of human 369-3p, sequence number 12) and its antisense synthetic DNA (sequence number 13) were mixed in equimolar numbers, heated and then slowly cooled to anneal, forming a double-stranded DNA, and the concentration was adjusted to 1 pmol / μL. In addition, each was prepared separately in the same manner. Mass spectrometry was performed in the same manner as above, and the precursor ions of each DNA chain were observed to confirm the overall mass, and ISD was performed. It was confirmed that: as with each DNA chain alone, each chain can be identified and sequenced in the double-stranded state ( Figure 2 ).

[0634] The same analysis was performed on the double strands formed by synthetic microRNA 369-3p (human, sequence number 14). It was confirmed that sequencing could also be performed from RNA double strands ( Figure 3 ).

[0635] In order to confirm that RNA in vivo can also be sequenced by mass spectrometry, the following experiment was performed. TRIzol (Invitrogen) was used to obtain small molecule RNA fractions from HEK293 cultured cells. The obtained RNA fraction was dissolved in RNase Free ultrapure water, and after confirming the concentration by absorbance measurement, the concentration was adjusted to 100 pmol / μL. Mass spectrometry was performed in the same way as above, and the precursor ions were observed to identify the parent ions with a mass number relative to miRNA369-3p (human). ISD was applied to the precursor ions to confirm the internal sequence, and the results confirmed that it was miRNA369-3p ( Figure 4 ). Thus, specific RNA can be observed even without purifying the specific sequence.

[0636] From the above, it was confirmed that RNA modification can be analyzed by combining appropriate mass spectrometry with RNA purification.

[0637] (Example 2) Cancer analysis using RNA modification

[0638] In this example, the effect of cancer on RNA modification was analyzed to verify that cancer can be detected or diagnosed by using RNA modification.

[0639] (Example 2-1: RNA modification analysis of cell lines)

[0640] Human pancreatic cancer cell lines BxPC3, Panc10.5, PSN1, and Capan2 were obtained from the American Type Culture Collection (Manassas, VA, USA). For each of these four lines, methylated miRNA analysis was performed by RIP-Seq using an anti-m6A antibody, and 63 methylated miRNAs were found as shown in the table below as common methylated miRNAs in the four pancreatic cancer cell lines.

[0641] [Table 10]

[0642]

[0643] Methylation of these miRNAs may be useful in the diagnosis of cancer, such as pancreatic cancer.

[0644] (Example 2-2: Colon cancer)

[0645] Tissue specimens of primary colon cancer (3 patients) at stages 2 to 4 were collected during surgery from human patients who had obtained prior informed consent. At the same time, tissue specimens were collected from an area 5 cm or more away from the malignant tumor area as healthy tissue.

[0646] The above-mentioned capture 17-5p, capture 21-5p, capture 200c-3p, capture 200c-5p and capture let7a-5p were made into streptavidin-bound beads. Total RNA was generated from the above-mentioned tissue specimens using Trizol, and then the target miRNA was purified using beads and measured using an ultrafleXtreme-TOF / TOF mass spectrometer (Bruker Dalotnics).

[0647] As a result, for these miRNAs, non-methylated RNAs were observed, and RNAs methylated at the positions shown in the table were observed.

[0648] [Table 11]

[0649] miRNA Name sequence Methylation sites found miR-17-5p 5'-CAAAGUGCUUACAGUGCAGGUAG-3' 5', the 13th mA (sequence number 15) miR-21-5p 5'-UAGCUUAUCAGACUGAUGUUGA-3' 9th mC from 5' (sequence number 16) miR-200c-5p 5'-CGUCUUACCCAGCAGUGUUUGG-3' 5' from the 13th mC (sequence number 17) miR-200c-3p 5'-UAAUACUGCCGGGUAAUGAUGGA-3' 9th mC from 5' (sequence number 18) miR-let7a-5p 5'-UGAGGUAGUAGGUUGUAUAGUU-3' 5' from the 19th mA (sequence number 19)

[0650] The MS signals underlying the above-mentioned methylation were compared between normal tissue and tumor tissue ( Figures 5 to 7 ). As a result, it was found that there was a difference in the methylation state of RNA between normal tissue and tumor tissue. The results of calculating the ratio (%) of methylated RNA in each RNA of the target sequence based on these signal intensities are shown in the table below.

[0651] [Table 12]

[0652]

[0653] In addition, RNA expression analysis was performed by qRT-PCR. qRT-PCR was performed as follows. TaqMan microRNA reverse transcription kit and TaqMan microRNA assays (Applied Biosystem) were used according to the product specifications. As a PCR premix, THUNDERBIRD SYBR (registered trademark) qPCR Mix (Toyobo) was used. As a device for qRT-PCR, a LightCycler (registered trademark) system (Roche) was used.

[0654] By qRT-PCR, the expression levels of the above miRNAs were compared between normal tissues and tumor tissues. For each miRNA, the results of the above methylation rate (MS) and expression level were compared ( Figure 8 ).

[0655] As a result, there was almost no difference in the expression levels of these miRNAs between normal tissues and tumor tissues, but in contrast, there was a significant difference in the methylation rate (MS), which suggests that the methylation rate (MS) of RNA may be a more useful marker than the expression level (RT-PCR).

[0656] Furthermore, for miR-200c-5p, RNA was degraded (5'→3') by ammonia treatment to confirm the internal sequence, and mass spectrometry was performed ( Fig. 9 ).like Fig. 9 As shown, it was confirmed that mass spectrometry can accurately determine the modification at a specific position of a specific RNA.

[0657] Samples were obtained from human colorectal cancer patients to investigate the methylation rates of four miRNAs. These patients were diagnosed with colon cancer and underwent surgery to remove the primary tumor, and metastasis was found 1 to 2 years later. Liver metastasis and lymph node metastasis were found. Before is a serum sample obtained from the patient before the primary tumor was removed. After is a serum sample obtained when metastasis was found 1 to 2 years after the primary tumor was removed.

[0658] For the samples before and after, as well as serum samples from patients with inflammatory bowel disease (IBD) and Crohn's disease (Crohn), the methylation levels were analyzed by mass spectrometry according to the same protocol ( Fig.10 ).

[0659] Compared to the state with cancer cells (Before), the methylation level of miRNAs in the absence of cancer cells (After, IBD and Crohn's) decreased. High methylation levels of these miRNAs may be an indicator of cancer (e.g., colon cancer).

[0660] (Example 2-3: Pancreatic cancer)

[0661] Methylation detection of organisms

[0662] Following the same protocol, methylated miRNAs were identified in pancreatic cancer tissues by RIP-Seq using an anti-m6A antibody. Among the miRNAs detected to be methylated, Let-7a and miR-17 were further analyzed.

[0663] For pancreatic cancer tissue samples, the target miRNA was concentrated using the capture beads for Let-7a and miR-17, and methylation was detected using MALDI-TOF-MS / MS ( Fig.11 ). As a result, the position of methylation can be determined and the amount of methylation can be quantified.

[0664] Then, for let-17a, miR-17, miR-21, and miR-200c, the methylation levels in pancreatic cancer tissues or pancreatic cancer patient serum were compared with the methylation levels of various control samples (normal tissues, normal subjects, and tumors removed by surgery). It should be noted that the results of quantitative reverse transcription PCR showed that no difference in miRNA expression levels was detected. The target miRNA was concentrated by capturing beads for each miRNA, and methylation was detected by MALDI-TOF-MS / MS ( Figures 12 to 15 ). In pancreatic cancer tissues, the methylation levels and methylation locations of let-17a, miR-17, miR-21, and miR-200c can be detected.

[0665] Compared with any control samples of normal tissues, normal subjects, and subjects after surgical resection of tumors, the methylation levels of these miRNAs in pancreatic cancer samples were increased ( Fig.16 , 17 ).

[0666] High levels of methylation of these miRNAs may be an indicator of cancer, such as pancreatic cancer.

[0667] (Example 2-3A: Early pancreatic cancer)

[0668] In this example, serum samples collected from 17 pancreatic cancer patients were used to investigate RNA modification status. These pancreatic cancers were early pancreatic cancers diagnosed as stage I to stage II (4 were stage IA, 5 were stage IIA, and 7 were stage IIB). As normal samples, serum samples from healthy people were used.

[0669] The above-mentioned direct binding beads for capturing 17-5p, capturing 21-5p, capturing 200c-3p, capturing 200c-5p and capturing let7a-5p were used. Total RNA was purified from the above-mentioned serum samples using Trizol, and then the target miRNA was purified using beads and measured using an ultrafleXtreme-TOF / TOF mass spectrometer (Bruker Dalotnics).

[0670] Methylation of miR-17-5p was detected in all serum samples of pancreatic cancer, whereas no methylation or a low degree of methylation was detected in normal samples.

[0671] In addition, compared with the results obtained using the existing pancreatic cancer markers CA19-9 and CEA, it is shown that the methylation level of miR-17 may be a more accurate indicator for pancreatic cancer detection.

[0672] More than 80% of mRNA undergoes m6A modification, and a large amount of RNA modification information is further included in Modomics (http: / / modomics.genesilico.pl / ). On this basis, according to the highly comprehensive RIP sequencing developed by the present inventors, it is believed that at least half, if not all of the adenines bound to the methylase, are likely to undergo methylation / demethylation. The present inventors investigated the methylation status of 50 microRNAs that are believed to be important for digestive system cancers, and clarified that 4 microRNAs are important in the early stages of digestive system cancers including pancreatic cancer. For other diseases, it is also believed that the modification information of RNA will reflect its status.

[0673] Thus, the present invention revealed that there are significant differences in early-stage pancreatic cancer patients compared to healthy subjects.

[0674] (Example 2-5: Other cancer samples)

[0675] In this example, other cancer samples were analyzed.

[0676] Using the same method as in Example 2-2, methylation was performed on various cancer samples within the range of RNA in Example 2-3. Tissue specimens of gastric cancer (4 patients) were collected during surgery from human patients who had obtained informed consent in advance. At the same time, tissue specimens were collected from an area more than 5 cm away from the malignant tumor area as healthy tissue.

[0677] The above-mentioned capture 17-5p, capture 21-5p, capture 200c-3p, capture 200c-5p and capture let7a-5p were made into streptavidin-bound beads. Total RNA was generated from the above-mentioned samples using Trizol, and then the target miRNA was purified using beads and measured using ultrafleXtreme-TOF / TOF mass spectrometer (Bruker Dalotnics).

[0678] Results for gastric cancer are shown ( Fig.18 ). As in Example 2-2, it was shown that the methylation rate (MS) of microRNA may also be a useful marker for diagnosing gastric cancer.

[0679] Results for patients with colorectal cancer are shown ( Fig.19 ). Each patient is described as follows.

[0680] Presentation of patients with colorectal cancer

[0681] [Table 13]

[0682] Sample No. Location Tumor depth Lymph node metastasis Distant metastasis Pathological classification No.1 rectum T2 N0 - I No.2 rectum T2 N0 - I No.3 colon T2 N0 - I No.4 rectum T2 N0 - I No.5 colon T1 N0 - I No.6 colon T2 N0 - I No.7 rectum T3 N3 Liver metastasis IV No.8 colon T3 N2 Liver metastasis IV No.9 rectum T3 N1 Liver metastasis IV No.10 rectum T3 NA Liver metastasis IV No.11 colon T4a NA Liver metastasis IV No.12 rectum NA NA Liver metastasis IV

[0683] *Tumor-node-metastasis (TNM) classification is based on the 7th edition of the TNM staging of the Union for International Cancer Control (https: / / www.nccn.org / professionals / physician_gls / f_guidelines.asp).

[0684] The methylation of miRNA was compared between colorectal cancer tissues and normal colorectal tissues of colorectal cancer patients. Methylation was increased in both early stage colon cancer (Stage I) and late stage colon cancer (Stage IV) compared with normal tissues.

[0685] Therefore, by observing RNA modifications, it is possible to predict the progression of cancer (such as colon cancer).

[0686] In addition, similar experiments were conducted on liver cancer and gallbladder cancer using human patients who had given their informed consent in advance, with a number sufficient for statistical analysis, and similar results were obtained.

[0687] (Example 2-7)

[0688] CTC (circulating tumor cells) analysis

[0689] The methylation of all microRNAs was analyzed for the CTC sample using the same method as in Example 2-3.

[0690] (Example 3) Analysis of resistant strains using RNA modification

[0691] In this example, it was verified that resistant strains can be analyzed using RNA modification.

[0692] (Example 3-1: Preparation of resistant strains (Chm R cell))

[0693] In this example, a resistant strain (Chm R cell).

[0694] The cancer cell line DLD-1 obtained from cell banks such as ATCC and RIKEN was cultured in the presence of trifluridine (FTD) (Aldrich-Sigma) (about 10 mg / mL) for more than 6 months. During the culture, the cells were subcultured about twice a week in DMEM medium supplemented with 10% serum at 37°C on a plastic culture dish to maintain a state of 60-80% confluence. The IC of the cultured cells to trifluridine was measured. 50 , the result is IC 50=300 μmol / L, confirming the establishment of a trifluridine-resistant strain.

[0695] Similarly, cancer cell lines HCT116 and RKO obtained from cell banks such as ATCC and RIKEN were used to produce resistant strains of 5-fluorouracil (5-FU), gemcitabine, cisplatin, nucleic acid drugs, histone demethylase inhibitors, cetuximab (antibody drug), Carbon / HIMAC (heavy particle radiation), and X-rays. The above drugs were purchased from Aldrich-Sigma and used at about 10 mg / mL. Resistant strains were established by culturing for more than 6 months. For each drug, IC 50 =300 μmol / L, it was confirmed that resistant strains were established. As an X-ray source, a linear Gammacell (registered trademark) 40 Exactor (Best Theratronics Ltd.) was used, and the dose was about 0 to 10 Gy. As a Carbon / HIMAC radiation source, a HIMAC of the General Institute of Radiological Medicine was used, and the dose was about 0 to 10 Gy (see Katsutoshi Sato et al., Cancer Sci. 2017 Oct; 108 (10): 2004-2010 and Katsutoshi Sato et al., Sci Rep. 2018; 8: 1458).

[0696] (Example 3-2: RNA modification analysis of resistant strains)

[0697] In this example, RNA modification analysis of resistant strains was performed.

[0698] For the original DLD-1 cell line and each resistant strain (5-FU-resistant strain and FTD-resistant strain), RNA methylation analysis was performed according to the above-mentioned RIP sequencing protocol, and mRNA expression analysis was performed by microarray or qRT-PCR similar to Example 2-2.

[0699] As a result of the measurement, methylation was observed in a total of 1,024 types of microRNAs. Representative examples are shown in the table below.

[0700] [Table 14]

[0701]

[0702] In addition, special attention was paid to the methylation of miRNAs in the table below.

[0703] [Table 15]

[0704]

[0705] For individual microRNAs, such as miR-378a, methylation is reduced in trifluridine-resistant strains but increased in 5-FU-resistant strains. Using the modification information on this RNA of resistant strains, for example, when a certain drug is administered to a patient, it is possible to predict whether the same drug can be continued to be used without resistance (for example, when the methylation of miR-378a increases after administration of 5-FU, it is predicted that resistance to 5-FU is likely).

[0706] Principal component analysis was performed based on RIP sequencing and RNA expression information (two-dimensional projection was performed using the component with the largest dispersion). The results are shown as the mean ± standard deviation (SD) based on 3 independent experiments. The statistical significance of the results was evaluated by paired T-TEST using R version 3.4.3 (2017-11-30) on Microsoft Excel (registered trademark) software (Microsoft Campus, Redmond, WA, USA). P values ​​< 0.05 were considered statistically significant. As a result, the wild-type strain and each resistant strain were clearly distinguished, and it was suggested that the RNA modification state can more accurately characterize the characteristics of the resistant strain than the RNA expression state ( Fig. 20 ).

[0707] Then, based on the methylation site and its surrounding sequences, motif analysis was performed to investigate the correlation with methylation-related enzymes (Table 1). As a result, it was suggested that several microRNAs were closely related to Mettl3, Mettl14, and YTHDF1. Based on such motif analysis results, the relationship between RNA modification and other biological factors can be clarified and network analysis can be performed, which can be used for deductive analysis of biological states.

[0708] [Table 16]

[0709] Containing the YTHDF1 motif miR

[0710] miR-378a miR-378e miR-378i miR-378b miR-378f miR-378d miR-378h

[0711] Containing the METTL3 motif miR

[0712] miR-492 miR-4754 miR-611 miR-6861 miR-3690 (candidate for CHOL)

[0713] Containing the METTL14 motif miR

[0714] miR-3122 miR-6847 miR-3131 miR-6887 (candidate for PAAD)

[0715] The analysis results suggest that methylation on the miRNAs shown below is particularly suitable as a biomarker for evaluating FTD resistance.

[0716] [Table 17]

[0717] miRNA Overall ID Parental strain expression Parental strain methylation Resistant strain expression Methylation of resistant strains Expression changes Methylation changes miR-3937 ENSG00000263730 0 2 33 182 ∞ 5.52 miR-4488 ENSG00000266006 0 3 g 175 ∞ 19.44 miR-3662 ENSG00000283409 0 1 26 53 ∞ 2.04 miR-3141 ENSG00000264760 2 0 2 19 1 ∞ miR-6734-5p ENSG00000283836 3 1 3 23 1 23 miR-1262 ENSG00000221203 15 50 20 272 1.33 4.08

[0718] (Example 4) Effects of RNA modification analysis

[0719] In this embodiment, the effects of surgery, treatment, prevention and the like on RNA modification are analyzed, and the effects of surgery, treatment, prevention and the like are analyzed by analyzing RNA modification.

[0720] (Example 4-1: Analysis of the effects of surgery using RNA modification)

[0721] In this example, the effect of surgery on RNA modification was investigated.

[0722] According to the protocol of Trizol (Invitrogen), total RNA was purified from the original DLD-1 cell line and each resistant strain (5-FU resistant strain and FTD resistant strain), and then RNA methylation analysis was performed according to the protocol of RIP sequencing described above. Here, when removing rRNA, Ribo-Zero rRNA Removal Kit (Illumina) was used.

[0723] The expression information of miRNA was obtained from The Cancer Genome Atlas (TCGA) (https: / / cancergenome.nih.gov / ), and those with expression levels less than 1 / 2 after surgery were selected, as shown in the following table.

[0724] [Table 18]

[0725] miR-16-1-3p miR-34b-5p miR369-5p miR-431-5p miR-494-3p miR-519-d-5p miR-3181 miR-4435 miR-4467 miR-5581-5p miR-5587-5p

[0726] The following table shows the relationship between these miRNAs that were decreased after surgery and the miRNA methylation information in which changes were observed in resistance.

[0727] [Table 19]

[0728]

[0729] Among the miRNAs that were decreased after surgery, their methylation status was observed to change significantly with resistance.

[0730] In addition, we investigated whether the common methylation motif RRAC was observed in these miRNAs that were reduced after surgery, and found that methylation was likely to occur at the following sites.

[0731] [Table 20]

[0732]

[0733] *In the table, underlined adenines in the sequences that have single base mismatches with the RRAC motif and motif.

[0734] Furthermore, pancreatic cancer (PAAD, n=4, Fig.21 ), rectal adenocarcinoma (READ, n=3, Fig. 22 ), cholangiocarcinoma (CHOL, n=9, Fig.23 ) and colon adenocarcinoma (COAD, n=8, Fig.24 ) were used to compare the miRNA expression data of the normal part and the cancer part (of the same patient) and the expression of the miRNAs that were reduced after surgery were compared.

[0735] As described above, the correlation between cancer, surgery and resistance can be analyzed based on RNA modification information. We predict that through such analysis, the extent of surgical resection, postoperative drug therapy, the intensity of radiotherapy (regimen), and the follow-up after discharge from the perspective of recurrence risk can be determined based on RNA modification information. In addition, it is predicted that patients who need treatment can be selected based on RNA modification information.

[0736] The above results indicate that miR-3131, miR-3690, miR-6887-5p, miR-6887-3p, miR-378a-3p, miR-4435, and miR-4467 are particularly preferably used as methylated miRNAs.

[0737] (Example 4-2: Analysis of other treatments)

[0738] In this example, the effects of other treatments on RNA modification were analyzed, and the analysis of whether other treatments could be performed was also performed. For example, temperature, hypoxia (e.g., 1%, +19% nitrogen replacement), low nutrition (lack of glucose, glutamine, amino acids), temperature (range of 32 to 42 degrees), etc., and in the case of hypoxia, 1%, +19% nitrogen replacement, etc.) can be analyzed.

[0739] Changes in RNA modification can be investigated before and after treatment with 5-FU, gemcitabine, cisplatin, the above-mentioned nucleic acid drugs, the above-mentioned histone demethylase inhibitors, cetuximab (antibody drug), Carbon / HIMAC (heavy particle radiation), and X-rays.

[0740] (Example 5: Effects of RNA modification)

[0741] (Example 5-1: Effect of RNA methylation on RNA-protein interaction)

[0742] The effects of RNA methylation on RNA-protein interactions were studied.

[0743] Molecular dynamics simulation

[0744] To predict the binding of methylated and unmethylated miRNAs (miR-200c, let-17a, miR-17) to human AGO2 protein, the X-ray structure of the AGO2 / RNA complex was used as a guide (PDB ID: 4OLB 25 and 4W5N 26 ). First, the RNA binding bases were replaced with the corresponding bases in each miRNA. For each miRNA complex structure, molecular dynamics simulation was performed under 1 atmosphere and about 37°C. After thermodynamic sampling, energy minimization was performed to predict the docking structure. All calculations were performed using the Amber12 program (http: / / ambermd.org / ). The results are shown in Figures 25-27 .

[0745] Fig.25 In miR-200c, the methylated cytosine at position 9 is close to the recognition base of RNA. There is no big difference between the first 6 nucleotides in the methylated and unmethylated miR-200c in the AGO complex, and changes in the binding interaction between AGO and miRNA can be observed around the methylated site. As a result, the space around the methylated site is reduced. In addition, the methyl group of the cytosine at position 9 may hinder the hydrogen bond with Ser220 of AGO due to steric hindrance, resulting in the position shift of the guanine at position 8. We believe that this is caused by the interaction with Arg761 of AGO.

[0746] Fig.26 , 27 In miR-17 and let-7a, methylated adenine is located far from the RNA binding site. However, adenine methylation causes a significant structural change in the entire complex, including the surrounding RNA recognition site, which may affect the target RNA recognition efficiency. These insights suggest that the ability of miRNA to inhibit target mRNA translation may be reduced by the occurrence of m6A modification.

[0747] (Example 5-2: Effects of RNA methylation on organisms)

[0748] The actual effects of RNA methylation on organisms are studied.

[0749] Transfection of synthetic oligonucleotides

[0750] GeneDesign (Osaka, Japan) was commissioned to synthesize methylated and unmethylated double-stranded RNA oligonucleotides (miR-200c, let-7a). The sequences of these synthetic RNAs were confirmed using MALDI-TOF-MS / MS. The miRNA sequences were obtained from miRBASE (release 21; http: / / www.mirbase.org / ). According to the manufacturer's protocol, methylated or unmethylated synthetic miRNAs were transfected into the colorectal cancer cell line HCT116 (HCT116) in which the expression level of endogenous miRNA was very low and DICER exon 5 was destroyed using Lipofectamine 3000 (Invitrogen). EX5 ) (kindly provided by Bert Vogelstein (Johns Hopkins University, Baltimore, MS, USA)).

[0751] Expression data analysis

[0752] The genes whose mRNAs bind to miR-200c or let-7a as reported by Tarbase14 (http: / / diana.imis.athena-innovation.gr / DianaTools / index.php?r=tarbase / index) were used as target genes. For miR-200c, the expression levels of the target genes observed by microarray were compared ( Fig.28 For let-7a, the number of reads inferred from the sequence was similarly analyzed for every 1,000 exons per 1 million reads ( Fig.29 ).

[0753] Gene expression profile analysis revealed that non-modified miR-200c and m5C-modified miR-200c showed strong gene inhibition effects, while m6A-modified miR-200c had a weak gene expression inhibition effect. Compared with non-methylated let-7a, m6A-modified let-7a did not reduce the expression of target mRNA.

[0754] As described above, it has been confirmed that the modification state of RNA affects the state of an organism, which supports the view that the modification state of RNA reflects the state of an organism and that the state of an organism can be predicted by investigating it.

[0755] (Example 6: Gene knockout analysis using RNA modification)

[0756] In this example, RNA modification can be used to analyze gene knockout.

[0757] (Example 6-1) Effect of Mettl3 knockout on RNA modification

[0758] In this example, we analyzed whether RNA modification can be used to analyze gene knockout. Human pancreatic cancer cell line MIA PaCa-2 cells were treated with standard methods using shRNA and siRNA to produce a Mettl3 knockout cell line (see Kosuke Taketo et al., Int J Oncol. 2018 Feb; 52(2): 621-629). RIP sequencing was then performed.

[0759] (Example 6-2) Effect of Mettl3 overexpression

[0760] The Mettl3 gene of the mouse is integrated into a CAG expression vector, which is injected into the fertilized egg of a BL6 mouse and transplanted into the uterus of a host mother to produce a Mettl3 gene overexpression mouse. A vector in which the viral protein SV is connected downstream of the pancreatic enzyme gene of the mouse is made, which is injected into the fertilized egg of a BL6 mouse and transplanted into the uterus of a host mother to produce an EL1-SV40 mouse in which P53 and RB of the pancreas are inactivated. The Mettl3 gene overexpression mouse thus produced is mated with an EL1-SV40 mouse by conventional methods to produce a double transgenic mouse. Then, PCR or the like is used to confirm that the target gene has been integrated into the double transgenic mouse. The mice are raised in a conventional animal experimental facility under an SPF environment.

[0761] Tumors naturally develop in these mice, and the survival of the double transgenic mice (10 mice) and EL1-SV40 mice (10 mice) was observed. Fig.30 ).photo( Fig.31 ) shows tumors removed from each mouse at 20 weeks of age (left: EL1-SV40 mouse, right: double transgenic mouse). In the double transgenic mouse, the tumor grew faster and the survival rate of the mouse was lower.

[0762] Mettl3 is an RNA methylase, and the above results show that: 1) RNA modification (epitranscriptome) plays an important role in the onset and progression of cancer, 2) compared with changes in genes (P53, RB) that were previously thought to aggravate cancer, changes in RNA modification have a greater impact on cancer. It should be noted that, as shown in the above examples, RNA modification is not limited to the modification of mRNA, and the same enzymes also modify miRNA, so the epitranscriptome of cells deep in the body can be monitored by monitoring miRNA (for example, present in the blood). Therefore, this result not only supports the importance of RNA modification itself as a biomarker, but also shows the importance of microRNA as a biomarker for liquid biopsy.

[0763] (Example 7) Correlation between disease and RNA modification

[0764] In this example, RNA modification analysis was performed on samples of cancer, dementia, heart failure, inflammatory bowel disease, aging, and intestinal immunity. The results showed that RNA modification information is useful in predicting these conditions.

[0765] To perform these analyses, for example, one can use

[0766] (1) Alzheimer's dementia model mice based on oxidative phosphorylation in the brain, created by genetic manipulation of protein kinase M (PKM), a key metabolic enzyme.

[0767] (2) In a model established by manipulating tumor suppressor genes in the digestive system, mice were subjected to aging and inflammation of the digestive organs including the digestive tract, resulting in interactions with the immune system. Methylation of ribosomal RNA, etc. was investigated from the fecal flora.

[0768] (3) Investigate the feces of mice and other animals with altered genes related to cancer metabolism.

[0769] (Example 8) Drug Screening Using RNA Modification

[0770] This example verifies that RNA modification can be used for drug screening.

[0771] Treat cell lines with any compound library. Analyze RNA modifications of these cells. Classify these compounds based on RNA modification information, so that some compounds can form a cluster and analyze them. This process can also be used for screening compound libraries with reference to the consideration of resistant strains of each agent in the above embodiments. For example, the description of Example 4 can be appropriately referred to, and on this basis, the degree of malignancy can be determined based on biopsy. Diagnose cancer, determine malignancy, diagnose and treat cancer of unknown primary lesion from the perspective of cell diagnosis. New drug targets can be found.

[0772] (Example 9) RNA modification analysis of Escherichia coli

[0773] In this example, it was verified whether RNA modification analysis could be used to classify Escherichia coli.

[0774] For example, RNA modifications are analyzed for certain E. coli strains. RIP-sequencing is performed. In addition, genetic information for the drug resistance pump P-glycoprotein can also be used.

[0775] It was found that by utilizing RNA modification information, it is very easy to classify microorganisms into species.

[0776] Additionally, mouse feces can be analyzed for RNA modifications.

[0777] As a result, the identity of the E. coli species presented can be analyzed, and the correlation between the status of the mouse and the status of the E. coli can be suggested.

[0778] In addition, RNA modification can be analyzed for microbial information such as Escherichia coli contained in food.

[0779] As a result, the microbial species (eg, E. coli species) in food can be analyzed, and the correlation between the quality of food and the status of E. coli can be suggested.

[0780] (Example 10) RNA modification analysis of food

[0781] This example shows an example of food analysis using RNA modification information.

[0782] For example, it was shown that for food (eg, lean meat), the quality (eg, number of days since processing) can be classified based on RNA modification information.

[0783] (Example 11-1) Analysis of various modifications on RNA

[0784] In this example, analysis using other RNA modifications was demonstrated.

[0785] We verified that RNA-mod modifications cover a wide range. Reanalysis of mass spectrometry data can analyze modifications other than methylation on microRNAs, and use this information to analyze various modifications on RNA.

[0786] (Example 11-2) Analysis of modifications on various RNAs

[0787] Modification information of RNA other than microRNA can be linked to data that has been associated with certain states. For example, if there are multiple peaks in the mass spectrum, they can be manually entered one by one or through machine learning. In addition, these can refer to the Maldi standard of BURKA.

[0788] (Example 12) Analysis of RNA modification information combined with other data

[0789] In this example, analysis performed by combining RNA modification information with other data was verified.

[0790] For example, transcriptome-proteome association analysis (RNA; for example, Pagliarini DJ, Cell Metab. 2016 Jul 12; 24(1): 13-4. doi: 10.1016 / j.cmet.2016.06.018.). Reference may be made to methylome (methylation binding protein; e.g. Shabalin AA., Bioinformatics. 2018 Feb 12. doi: 10.1093 / bioinformatics / bty069.), transcriptome (RNAseq; e.g. Jeong H, Front Neurosci. 2018 Feb 2; 12: 31. doi: 10.3389 / fnins.2018.00031. eCollection 2018), epitranscriptome of the present invention (this time, low density or high density), metabolomics (mass spectrometry; e.g. Gupta R et al., Proteomics. 2018 Feb 19. doi: 10.1002 / pmic.201700366), etc. These exemplified papers are ultimately exemplified, and other suitable information sources may also be used for application.

[0791] It is understood that the RNA modification information of the present invention can be combined with other information to further improve the analysis accuracy, or the analysis accuracy can be improved thereby.

[0792] For example, if the “information on miRNAs decreased after surgery” in Example 4-1 is combined with information other than microRNAs and referred to, it can be said that the usefulness of the information other than microRNAs is increased by combining it with the “information on miRNAs decreased after surgery”.

[0793] For example, it is known that when the Gene Expression Omnibus (GEO) data set (GDS4103) is used for analysis, an increase in the RNA expression level of METTL3 and METTL14, which are RNA methylases, can be observed in patients with pancreatic ductal carcinoma (PDAC). In combination with such information, an analysis can be performed to associate, for example, methylases with detected methylated RNAs.

[0794] (Example 13) High-density array design

[0795] In this example, analysis using a design example of a methylated RNA chip was verified.

[0796] In MALDI, laser irradiation rapidly heats the matrix molecules and vaporizes and ionizes multiple RNAs with partially broken phosphate bonds. In the methylated RNA chip, capture nucleic acids for multiple different RNAs are configured on one plate for high efficiency. If the hole configured with the target capture nucleic acid is laser-irradiated, the surrounding holes will also be irradiated with laser, and RNA other than the target RNA may be detected. Therefore, in order to distinguish the mass peak of the RNA captured from the surrounding holes from the mass peak observed by the target hole, it is desirable to optimize the configuration of the capture nucleic acid on the plate. Therefore, the configuration of the capture nucleic acid is determined according to the following steps.

[0797] 1. For each RNA, calculate the "theoretical mass of the partial RNA to be observed"

[0798] 2. Randomly arrange capture nucleic acids on the plate using the Monte Carlo method

[0799] 3. Calculate the difference in theoretical mass of the RNA to be observed between adjacent wells

[0800] 4. (After repeating 2 times)

[0801] When the difference in theoretical quality exceeds the previous one: adopt this configuration

[0802] When the theoretical quality difference decreases: abandon this configuration

[0803] 5. Return to step 2 and repeat the Monte Carlo sampling.

[0804] When the above steps are repeated a certain number of times or more, it is expected that the measurement error of the obtained capture nucleic acid arrangement will be minimized (the difference in mass of the partial RNA captured between adjacent wells will be maximized), that is, the optimal arrangement will be achieved.

[0805] The following shows examples of combinations of capture nucleic acids capable of capturing a plurality of types of RNA, which are considered to have no problem even if they are adjacent to each other.

[0806] [Table 21]

[0807]

[0808] (Example 14) Optimization of purification using oligo DNA ( Fig.32 )

[0809] This example shows that the analysis efficiency of RNA modification was improved by optimizing purification using oligo DNA.

[0810] The detection of modified RNA using the directly bound beads described above and streptavidin bound beads was compared.

[0811] Total RNA was purified from cultured HeLa cells and human skin fibroblasts using TRIzol (Invitrogen). The capture oligo DNA was made into the above-mentioned direct binding beads or streptavidin-bound beads, and the target miRNA was purified from the purified total RNA according to the above-mentioned respective procedures and measured using an ultrafleXtreme-TOF / TOF mass spectrometer (Bruker Dalotnics). The capture oligo DNA used was the above-mentioned capture 17-5p, capture 21-5p, capture 200c and capture let7a-5p.

[0812] As a result, signals of the intensities shown in the following table were obtained.

[0813] [Table 22]

[0814]

[0815] Direct binding to the beads gave approximately twice the MS signal intensity of RNA compared to when the beads were bound to streptavidin.

[0816] In MALDI, the sample on the target plate is ionized by laser. Therefore, if there are ionizable impurities on the target plate in addition to the object to be measured and the matrix, the energy of the laser will be wasted on ionizing the impurities, and the signal intensity may decrease. Therefore, it is effective to reduce the impurities.

[0817] Compared with streptavidin-bound beads, direct-bound beads have more stable binding to oligoDNA, so washing and elution can be performed at higher temperatures after hybridization. Therefore, impurities that non-specifically bind to capture nucleic acids and magnetic beads can be suppressed, achieving higher sensitivity.

[0818] (Example 15) Exosome Concentration

[0819] This example shows how the analysis accuracy of RNA modification can be improved by enriching exosomes ( Fig.33 ).

[0820] The changes in the detection intensity of modified RNAs brought about by exosome enrichment were investigated.

[0821] Serum and plasma (purchased from Dojindo Chemical Research Institute) were used as samples.

[0822] The above-mentioned capture 17-5p, capture 21-5p, capture 200c and capture let7a-5p were prepared into streptavidin-bound beads, and these beads were used to purify the target miRNA from each sample of the following treatment 1 and treatment 2. Then, the measurement was performed using an ultrafleXtreme-TOF / TOF mass spectrometer (Bruker Dalotnics).

[0823] Treatment 1 (no IP treatment)

[0824] After extraction and purification of miRNA using TRIzol, each miRNA was purified by hybridization.

[0825] Treatment 2 (IP treatment with anti-CD63 antibody)

[0826] Anti-CD63 antibody (Santa Cruz Biotechnology) was added to the exosome fraction that was simply purified using ExoQuick (System Biosciences), and the resulting immunoprecipitate was subjected to hybridization-based purification of each miRNA.

[0827] As a result, signals with the strengths shown in the following table were obtained.

[0828] [Table 23]

[0829]

[0830] Purification by immunoprecipitation using a CD63 antibody increased the MS signal intensity of the target miRNA obtained from the same starting material (serum plasma) by about 2.5 times.

[0831] In MALDI, the sample on the target plate is ionized by laser light. Therefore, if there are ionizable impurities on the target plate in addition to the object to be measured and the matrix, the energy of the laser light will be wasted on the ionization of the impurities, and the signal intensity may decrease. Therefore, it may be effective to reduce the impurities.

[0832] The above results indicate that impurities in the starting material can be removed by screening and concentrating only exosomes using antibodies.

[0833] This method can produce a stronger signal, and thus is expected to be able to more reliably measure the methylation rate than conventional methods.

[0834] (Example 16) Effect of freezing on RNA modification

[0835] In this example, the effect of the freezing condition of the sample on the accuracy of RNA modification analysis was analyzed.

[0836] Commercially available serum and serum collected from humans were used to investigate the stability of modified RNA with respect to temperature.

[0837] Purification of target RNA was performed using the above-mentioned let7a-specific capture oligo DNA.

[0838] GeneDesign was commissioned to synthesize 200c.

[0839] The serum is separated from the blood obtained by blood collection using a serum separator tube.

[0840] Commercially available serum and serum from blood collection were treated according to the conditions in the table, let7a was purified using capture oligo DNA-binding beads, and measured using an ultrafleXtreme-TOF / TOF mass spectrometer (Bruker Dalotnics).

[0841] [Table 24]

[0842]

[0843] Synthesized 200c was treated according to the conditions in the table and then measured using an ultrafleXtreme-TOF / TOF mass spectrometer (Bruker Dalotnics).

[0844] [Table 25]

[0845]

[0846] After blood collection and serum separation, the effect of storage at 4°C or 25°C is significant. For synthetic products, they are stable in pure water at 4°C.

[0847] EDTA or heparin was added to the blood collected with a syringe, and the blood was centrifuged at 3000 rpm for 5 minutes to obtain a supernatant.

[0848] Commercially available serum and serum from blood collection were treated according to the conditions in the table, let7a was purified using capture oligo DNA-binding beads, and measured using an ultrafleXtreme-TOF / TOF mass spectrometer (Bruker Dalotnics).

[0849] [Table 26]

[0850]

[0851] Synthesized 200c was treated according to the conditions in the table and then measured using an ultrafleXtreme-TOF / TOF mass spectrometer (Bruker Dalotnics).

[0852] [Table 27]

[0853]

[0854] It was observed that the quality of the target RNA further deteriorated due to the addition of heparin. In the case of the synthetic product, almost no degradation was observed even after the freeze-thaw cycle was repeated about 5 times.

[0855] (Note)

[0856] The present invention is illustrated above using the preferred embodiments of the present invention, but it is understood that the scope of the present invention should be interpreted only according to the claims. Regarding the patents, patent applications and other documents cited in this specification, it is understood that the contents should be cited as references to this specification in the same way as when the contents are specifically recorded in this specification.

[0857] Industrial Applicability

[0858] The present invention can be used in analysis of almost any biological field, and its application in the medical field is immeasurable.

[0859] Free text for sequence listings

[0860] The names of sequences in this specification and their specific sequences are shown below.

[0861] miR-17-5p CAAAGUGCUUACAGUGCAGGUAG (SEQ ID NO. 1)

[0862] miR-21-5p UAGCUUAUCAGACUGAUGUUGA (SEQ ID NO. 2)

[0863] miR-200c-5p CGUCUUACCCAGCAGUGUUUGG (SEQ ID NO. 3)

[0864] miR-200c-3p UAAUACUGCCGGGUAAUGAUGGA (SEQ ID NO. 4)

[0865] miR-let7a-5p UGAGGUAGGUUGUAUAGUU (SEQ ID NO. 5)

[0866] Capture 17-5p CTACCTGCACTGTAAGCACTTTG (SEQ ID NO. 6)

[0867] Capture 21-5p TCAACATCAGTCTGATAAGCTA (SEQ ID NO. 7)

[0868] Capture 200c-5p CCAAACACTGCTGGGTAAGACG (sequence number 8)

[0869] Capture 200c-3p TCCATCATTACCCGGCAGTATTA (serial number 9)

[0870] Capture let7a-5p AACTATACAACCTACTACCTCA (sequence number 10)

[0871] Synthetic miR-200c-5p CGUCUUACCCAGCAGUGUUUGG (#7, mA; #13, mC) (SEQ ID NO: 11)

[0872] Synthetic miR-369-3p AAUAAUACAUGGUUGAUCUUU (SEQ ID NO. 12)

[0873] Complementary DNA 369-3p AATAATACATGGTTGATCTTT (SEQ ID NO: 13)

[0874] Antisense complementary DNA 369-3p AAAGATCAACCATGTATTATT (SEQ ID NO: 14)

[0875] miR-21-5p UAGCUUAUCAGACUGAUGUUGA (#9, mC) (SEQ ID NO: 15)

[0876] miR-17-5p CAAAGUGCUUACAGUGCAGGUAG (#13, mA) (SEQ ID NO: 16)

[0877] let-7a-5p UGAGGUAGUAGGUUGUAUAGUU(#19,mA)(Serial No. 17)

[0878] miR-200c-3p UAAUACUGCCGGGUAAUGAUGGA (#9, mC) (SEQ ID NO: 18)

[0879] miR-200c-5p CGUCUUACCCAGCAGUGUUUGG (#13, mC) (SEQ ID NO: 19)

[0880] miR378a-3p ACUGGACUUGGAGUCAGAAGGC (SEQ ID NO: 20)

[0881] miR378d ACUGGACUUGGAGUCAGAAA (SEQ ID NO: 21)

[0882] miR378e ACUGGACUUGGAGUCAGGA (SEQ ID NO: 22)

[0883] miR378f ACUGGACUUGGAGCCAGAAG (SEQ ID NO: 23)

[0884] miR378h ACUGGACUUGGUGUCAGAUGG (SEQ ID NO: 24)

[0885] miR378i ACUGGACUAGGAGUCAGAAGG (SEQ ID NO: 25)

[0886] miR492 AGGACCUGCGGGACAAGAUUCUU (SEQ ID NO: 26)

[0887] miR3690 ACCUGGACCCAGCGUAGACAAAG (SEQ ID NO. 27)

[0888] miR4754 AUGCGGACCUGGGUUAGCGGAGU (SEQ ID NO: 28)

[0889] miR6861-5p ACUGGGUAGGUGGGGCUCCAGG (SEQ ID NO: 29)

[0890] miR3122 GUUGGGACAAGAGGACGGUCUU (SEQ ID NO: 30)

[0891] miR3131 UCGAGGACUGGUGGAAGGGCCUU (SEQ ID NO: 31)

[0892] miR6847-3p GGCUCAUGUGUCUGUCCUCUUC (SEQ ID NO: 32)

[0893] miR6887-3p UCCCCUCCACUUUCCUCCUAG (SEQ ID NO: 33)

[0894] miR-6887-5p UGGGGGGACAGAUGGAGAGGACA (SEQ ID NO: 34)

[0895] miR-16-1-3p CCAGUAUUAACUGUGCUGCUGA (SEQ ID NO: 35)

[0896] miR-34b-5p UAGGCAGUGUCAUUAGCUGAUUG (SEQ ID NO: 36)

[0897] miR369-5p AGAUCGACCGUGUUAUAUUCGC (SEQ ID NO: 37)

[0898] miR-431-5p UGUCUUGCAGGCCGUCAUGCAG (SEQ ID NO: 38)

[0899] miR-494-3p UGAAACAUACACGGGAAACCUC (SEQ ID NO: 39)

[0900] miR-519-d-5p CCUCCAAAGGGAAGCGCUUUCUGUU (SEQ ID NO: 40)

[0901] miR-3181AUCGGGCCCUCGGCGCCGG (SEQ ID NO: 41)

[0902] miR-4435AUGGCCAGAGCUCACACAGAGG (SEQ ID NO: 42)

[0903] miR-4467UGGCGGCGGUAGUUAUGGGCUU (SEQ ID NO. 43)

[0904] miR-5581-5p AGCCUUCCAGGAGAAAUGGAGA (SEQ ID NO: 44)

[0905] miR-5587-5p AUGGUCACCUCCGGGACU (SEQ ID NO: 45)

[0906] miR-629-3p GUUCUCCCAACGUAAGCCCAGC (SEQ ID NO: 46)

[0907] miR-16-5p UAGCAGCACGUAAAUAUUGGCG (SEQ ID NO: 47)

[0908] miR-711GGGACCCAGGGAGAGACGUAAG (SEQ ID NO: 48)

[0909] miR-3977GUGCUUCAUCGUAAUUAACCUUA (SEQ ID NO. 49)

[0910] Common sequence 2GGGAGGUGUG (serial number 50)

[0911] miR-6799-5p GGGGAGGUGUGCAGGGCUGG (SEQ ID NO: 51)

[0912] miR-3689d GGGAGGUGUGAUCUCACACUCG (SEQ ID NO: 52)

[0913] miR-3689a-3p CUGGGAGGUGUGAUAUCGUGGU (SEQ ID NO: 53)

[0914] miR-3689c CUGGGAGGUGUGAUAUUGUGGU (SEQ ID NO. 54)

[0915] miR-6825-5p UGGGGAGGUGUGGAGUCAGCAU (SEQ ID NO: 55)

[0916] Common sequence 3CUCCCUGCCC (serial number 56)

[0917] miR-6756-3p UCCCCUUCCUCCCUGCCCAG (SEQ ID NO: 57)

[0918] miR-7113-3p CCUCCCUGCCCGCCUCUCUGCAG (SEQ ID NO: 58)

[0919] miR-6743-3p AGCCGCUCUUCUCCCUGCCCACA (SEQ ID NO: 59)

[0920] Common sequence 4GACUUGGAGUCA (serial number 60)

[0921] miR-378c ACUGGACUUGGAGUCAGAAGAGUGG (SEQ ID NO: 61)

[0922] Common sequence 5CCCUUUAGAGUGU (serial number 62)

[0923] miR-521AACGCACUUCCCUUUAGAGUGU (SEQ ID NO: 63)

[0924] miR-517a-3p AUCGUGCAUCCCUUUAGAGUGU (SEQ ID NO: 64)

[0925] miR-522-3p AAAAUGGUUCCCUUUAGAGUGU (SEQ ID NO: 65)

[0926] miR-520g-3p ACAAAGUGCUUCCCUUUAGAGUGU (SEQ ID NO: 66) Sequence Listing <110> Analysis and diagnosis methods using RNA modifications <120> National University Corporation Osaka University (OSAKA UNIVERSITY) <130> F518PCT157 <150> JP 2018-30099 <151> 2018-02-22 <160> 66 <170> PatentIn version 3.5 <210> 1 <211> twenty three <212> RNA <213> Homo sapiens <400> 1 caaagugcuu acagugcagg uag 23 <210> 2 <211> twenty two <212> RNA <213> Homo sapiens <400> 2 uagcuuauca gacugauguu ga 22 <210> 3 <211> twenty two <212> RNA <213> Homo sapiens <400> 3 cgucuuaccc agcaguguuu gg 22 <210> 4 <211> twenty three <212> RNA <213> Homo sapiens <400> 4 uaauacugcc ggguaaugau gga 23 <210> 5 <211> twenty two <212> RNA <213> Homo sapiens <400> 5 ugagguagua gguuguauag uu 22 <210> 6 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> Catch 17-5p <400> 6 ctacctgcac tgtaagcact ttg 23 <210> 7 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> Catch 21-5p <400> 7 tcaacatcag tctgataagc ta 22 <210> 8 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> Capture 200c-5p <400> 8 ccaaacactg ctgggtaaga cg 22 <210> 9 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> Capture 200c-3p <400> 9 tccatcatta cccggcagta tta 23 <210> 10 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> Capturing let7a-5p <400> 10 aactatacaa cctactacct ca 22 <210> 11 <211> twenty two <212> RNA <213> Artificial sequence <220> <223> Synthetic miR-200c-5p <220> <221> Modified bases <222> (7) <223> Methylation <220> <221> Modified bases <222> (13) <223> Methylation <400> 11 cgucuuaccc agcaguguuu gg 22 <210> 12 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> cDNA 369-3p <400> 12 aataatacat ggttgatctt t 21 <210> 13 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Complementary antisense DNA 369-3p <400> 13 aaagatcaac catgtattat t 21 <210> 14 <211> twenty one <212> RNA <213> Artificial sequence <220> <223> Synthetic miR-369-3p <400> 14 aauaauacau gguugaucuu u 21 <210> 15 <211> twenty two <212> RNA <213> Homo sapiens <220> <221> Modified bases <222> (9)..(9) <223> Methylation <400> 15 uagcuuauca gacugauguu ga 22 <210> 16 <211> twenty three <212> RNA <213> Homo sapiens <220> <221> Modified bases <222> (13) <223> Methylation <400> 16 caaagugcuu acagugcagg uag 23 <210> 17 <211> twenty two <212> RNA <213> Homo sapiens <220> <221> Modified bases <222> (19)..(19) <223> Methylation <400> 17 ugagguagua gguuguauag uu 22 <210> 18 <211> twenty three <212> RNA <213> Homo sapiens <220> <221> Modified bases <222> (9)..(9) <223> Methylation <400> 18 uaauacugcc ggguaaugau gga 23 <210> 19 <211> twenty two <212> RNA <213> Homo sapiens <220> <221> Modified bases <222> (13) <223> Methylation <400> 19 cgucuuaccc agcaguguuu gg 22 <210> 20 <211> twenty two <212> RNA <213> Homo sapiens <400> 20 acuggacuug gagucagaag gc 22 <210> twenty one <211> 20 <212> RNA <213> Homo sapiens <400> twenty one acuggacuug gagucagaaa 20 <210> twenty two <211> 19 <212> RNA <213> Homo sapiens <400> twenty two acuggacuug gagucagga 19 <210> twenty three <211> 20 <212> RNA <213> Homo sapiens <400> twenty three acuggacuug gagccagaag 20 <210> twenty four <211> twenty one <212> RNA <213> Homo sapiens <400> twenty four acuggacuug gugucagaug g 21 <210> 25 <211> twenty one <212> RNA <213> Homo sapiens <400> 25 acuggacuag gagucagaag g 21 <210> 26 <211> 23 <212> RNA <213> Homo sapiens <400> 26 aggaccugcg ggacaagauu cuu 23 <210> 27 <211> 23 <212> RNA <213> Homo sapiens <400> 27 accuggaccc agcguagaca aag 23 <210> 28 <211> 23 <212> RNA <213> Homo sapiens <400> 28 augcggaccu ggguuagcgg agu 23 <210> 29 <211> 22 <212> RNA <213> Homo sapiens <400> 29 acuggguagg uggggcucca gg 22 <210> 30 <211> 22 <212> RNA <213> Homo sapiens <400> 30 guugggacaa gaggacgguc uu 22 <210> 31 <211> 23 <212> RNA <213> Homo sapiens <400> 31 ucgaggacug guggaagggc cuu 23 <210> 32 <211> 22 <212> RNA <213> Homo sapiens <400> 32 ggcucaugug ucuguccucu uc 22 <210> 33 <211> 21 <212> RNA <213> Homo sapiens <400> 33 uccccuccac uuuccuccua g 21 <210> 34 <211> 23 <212> RNA <213> Homo sapiens <400> 34 uggggggaca gauggagagg aca 23 <210> 35 <211> 22 <212> RNA <213> Homo sapiens <400> 35 ccaguauuaa cugugcugcu ga 22 <210> 36 <211> 23 <212> RNA <213> Homo sapiens <400> 36 uaggcagugu cauuagcuga uug 23 <210> 37 <211> 22 <212> RNA <213> Homo sapiens <400> 37 agaucgaccg uguuauauuc gc 22 <210> 38 <211> 22 <212> RNA <213> Homo sapiens <400> 38 ugucuugcag gccgucaugc ag 22 <210> 39 <211> 22 <212> RNA <213> Homo sapiens <400> 39 ugaaacauac acgggaaacc uc 22 <210> 40 <211> 25 <212> RNA <213> Homo sapiens <400> 40 ccuccaaagg gaagcgcuuu cuguu 25 <210> 41 <211> 19 <212> RNA <213> Homo sapiens <400> 41 aucgggcccu cggcgccgg 19 <210> 42 <211> 22 <212> RNA <213> Homo sapiens <400> 42 auggccagag cucacacaga gg 22 <210> 43 <211> 22 <212> RNA <213> Homo sapiens <400> 43 uggcggcggu aguuaugggc uu 22 <210> 44 <211> twenty two <212> RNA <213> Homo sapiens <400> 44 agccuuccag gagaaaugga ga 22 <210> 45 <211> 18 <212> RNA <213> Homo sapiens <400> 45 auggucaccu ccgggacu 18 <210> 46 <211> twenty two <212> RNA <213> Homo sapiens <400> 46 guucucccaa cguaagccca gc 22 <210> 47 <211> twenty two <212> RNA <213> Homo sapiens <400> 47 uagcagcacg uaaauauugg cg 22 <210> 48 <211> twenty two <212> RNA <213> Homo sapiens <400> 48 gggacccagg gagagacgua ag 22 <210> 49 <211> twenty three <212> RNA <213> Homo sapiens <400> 49 gugcuucauc guaauuaacc uua 23 <210> 50 <211> 10 <212> RNA <213> Homo sapiens <400> 50 gggaggugug 10 <210> 51 <211> 20 <212> RNA <213> Homo sapiens <400> 51 ggggaggugu gcagggcugg 20 <210> 52 <211> 22 <212> RNA <213> Homo sapiens <400> 52 gggaggugug aucucacacu cg 22 <210> 53 <211> 22 <212> RNA <213> Homo sapiens <400> 53 cugggaggug ugauaucgug gu 22 <210> 54 <211> 22 <212> RNA <213> Homo sapiens <400> 54 cugggaggug ugauauugug gu 22 <210> 55 <211> 22 <212> RNA <213> Homo sapiens <400> 55 uggggaggug uggagucagc au 22 <210> 56 <211> 10 <212> RNA <213> Homo sapiens <400> 56 cucccugccc 10 <210> 57 <211> 20 <212> RNA <213> Homo sapiens <400> 57 uccccuuccu cccugcccag 20 <210> 58 <211> 23 <212> RNA <213> Homo sapiens <400> 58 ccucccugcc cgccucucug cag 23 <210> 59 <211> 23 <212> RNA <213> Homo sapiens <400> 59 agccgcucuu cucccugccc aca 23 <210> 60 <211> 12 <212> RNA <213> Homo sapiens <400> 60 gacuuggagu ca 12 <210> 61 <211> 25 <212> RNA <213> Homo sapiens <400> 61 acuggacuug gagucagaag agugg 25 <210> 62 <211> 13 <212> RNA <213> Homo sapiens <400> 62 cccuuuagag ugu 13 <210> 63 <211> 22 <212> RNA <213> Homo sapiens <400> 63 aacgcacuuc ccuuuagagu gu 22 <210> 64 <211> 22 <212> RNA <213> Homo sapiens <400> 64 aucgugcauc ccuuuagagu gu 22 <210> 65 <211> 22 <212> RNA <213> Homo sapiens <400> 65 aaaaugguuc ccuuuagagu gu 22 <210> 66 <211> 24 <212> RNA <213> Homo sapiens <400> 66 acaaagugcu ucccuuuaga gugu 24

Claims

1. Use of a reagent for detecting methylation information on at least one of the group consisting of let-17a and miR-200c in a subject in the preparation of a detection reagent for detecting at least one of pancreatic cancer, liver cancer, gallbladder cancer, bile duct cancer, gastric cancer and colon cancer by the following method, the method comprising: A step of acquiring modification information on at least one RNA including a microRNA in a subject; and The step of analyzing the medical status or biological status of the subject based on the modified information, Wherein, the modification comprises methylation of the microRNA, and wherein the modification is m 6 A, Wherein, in the obtaining step, methylation information on at least one of the group consisting of let-17a and miR-200c in the object is obtained; Wherein, the medical condition or biological condition includes cancer; The cancer includes at least one of pancreatic cancer, liver cancer, gallbladder cancer, bile duct cancer, gastric cancer and colon cancer.

2. The use according to claim 1, wherein The modifications include methylation of microRNA, Wherein, in the acquisition step, the methylation information of let-17a and miR-200c in the object is acquired.

3. The use according to claim 1 or 2, wherein The modification information includes at least one of modification position information and information on the amount of modified RNA.

4. The use according to claim 1 or 2, wherein The medical or biological state includes responsiveness, which is whether the subject is resistant to an anticancer agent.

5. The use according to claim 4, wherein Based on the reactivity, an agent for treating the subject and / or a treatment of the subject is indicated.

6. The use according to claim 1 or 2, wherein The cancer includes pancreatic cancer.

7. The use according to claim 1, wherein The pancreatic cancer is early stage pancreatic cancer.

8. A system for determining a medical condition or a biological condition of a subject based on RNA modification information, comprising: a measuring unit for measuring the modification state of RNA including microRNA; A calculation unit that calculates the modification state on the RNA based on the result of the measurement; and an analyzing / determining unit for analyzing and determining the medical condition or biological condition of the subject based on the modified state; in, The modification comprises methylation of the microRNA, and wherein the modification is m 6 A, wherein, in the measuring step, methylation information on at least one of the group consisting of let-17a and miR-200c in the subject is obtained; Wherein, the medical condition or biological condition includes cancer; The cancer includes at least one of pancreatic cancer, liver cancer, gallbladder cancer, bile duct cancer, gastric cancer and colon cancer.

9. The system according to claim 8, wherein: The modification information includes at least one of modification position information and information on the amount of modified RNA.

10. The system according to claim 8 or 9, wherein: The medical or biological state includes responsiveness, which is whether the subject is resistant to an anticancer agent.

11. The system according to claim 8 or 9, wherein: The cancer includes pancreatic cancer.

Images