Use of actrt1 as a target in the detection and treatment of headless spermatozoa

Abstract

The application discloses application of ACTRT1 as a target to detection and treatment of headless sperm. In the application, ACTRT1 gene mutation causes deletion of ACTRT1 functional protein, may affect connection of sperm head and tail, and finally induces headless sperm.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to the application of ACTRT1 as a target in the detection and treatment of azoospermia. Background Technology

[0002] In recent years, infertility among new families in my country has become increasingly serious, causing severe psychological and demographic pressures on families and society, and hindering the sustainable development of Chinese society in the long run. Currently, the infertility rate in my country is approximately 15%, with about half of these cases attributed to male factors. The testes, as important male reproductive organs, are responsible for sperm development and the secretion of male sex hormones. Many factors contribute to male infertility, with spermatogenesis disorders being a significant cause, including but not limited to azoospermia, oligospermia, asthenospermia, teratospermia, and combinations thereof. According to the latest 2010 World Health Organization standards, teratospermia is defined as having less than 4% normally morphologically formed sperm. Severe teratospermia has become a research hotspot in recent years, especially the following single types of teratospermia: globozpermia, macrozoospermia, acephalic spermatozoa (AS), and multiple morphological abnormalities of the spermflagella. For single types of sperm head abnormalities, genetic factors are more likely to be the cause.

[0003] Human cephalospermia, also known as pinhead or decapitated spermatozoa, is defined as the absence of the head of 80-100% of sperm in the semen, or the presence of a small number of loosely motile sperm heads. However, the percentage of headless sperm in the semen is less than 80%, which is not clinically defined or described; here it is defined as partial acephalic spermatozoa (PAS). Cephalospermia is a subtype of teratospermia, previously receiving little attention or being missed, and understanding of this condition was very limited. In 1981, Perotti et al. first reported a case of infertility where all sperm showed separation of the head and tail at the proximal centriole, and termed this phenotype "decapitated spermatozoa." Subsequently, five similar cases were reported, including familial inheritance, and the term "cephalospermia" was introduced to describe this type of disease. Chemes et al. classified cephalospermia into three types: Type I (… Figure 1a) At the tip of the flagellum, there are one or two centrioles, each surrounded by a small droplet of residual cytoplasm. This residual cytoplasm also contains a small number of scattered mitochondria, which are not neatly arranged around the mid-tail; Type II ( Figure 1 b) The middle section of the tail and the head-tail junction are neatly arranged and simultaneously enveloped by a large droplet of cytoplasmic remnant; Type III ( Figure 1 c) The sperm head is present, but it is abnormally connected to the midpiece of the tail, lacking a head-tail junction, and the nucleus forms a 90-180 degree angle with the midpiece. Some patients have type I or type II as the main type, some have a mixed type of type I and type II in equal proportions, and some have a comprehensive mixed type of all three.

[0004] Previous studies have suggested that the inability of centrioles to migrate and attach normally to the nuclear pore at the tail of sperm can lead to headless sperm. Figure 1 a&b) or abnormal connection between the head and the middle section of the tail ( Figure 1 c). Although researchers have described the morphology of headless sperm in great detail using scanning electron microscopy and transmission electron microscopy, the cause of headless spermia in humans remains unknown. Many research groups believe that the disease is related to genetic factors, especially when two brothers in a family have similar phenotypes.

[0005] Until 2016, Zhu et al. discovered that mutations in the SUN5 gene cause headless spermia in humans. Subsequent studies have also found that SUN5 gene mutations cause ankylosing spondylitis (AS), and further revealed the important role of the SUN5 protein in anchoring the sperm head and tail through mouse genetics and molecular biology. Later, our researchers used whole-exome sequencing to discover a rare homozygous mutation (c.2783G>A; p.G928D) in a sperm-specific gene BRDT in AS patients from a consanguineous family. Further cellular and molecular biological studies revealed that this mutant protein significantly alters the expression of 899 genes compared to wild-type BRDT protein. Gene annotation analysis further revealed that this mutation mainly affects intracellular transport, RNA splicing, cell cycle, and DNA metabolism, suggesting that these processes may be related to the underlying mechanisms of AS. Recently, researchers located a novel AS-related gene, TSGA10, in another consanguineous family. TSGA10 is a testis-specific gene, and immunofluorescence staining has revealed that this protein is located at the head-to-tail junction of sperm. Unlike asthenospermia (AS) caused by SUN5 mutations, the head-to-tail breakage region in TSGA10-induced azoospermia is located in the midpiece of the sperm tail, not in the head-to-tail junction neck region as shown in SUN5 mutation studies. Therefore, the molecular mechanism of TSGA10-induced AS may be different. In 2018, Zhu F et al. discovered that PMFBP1 encodes a sperm tail-associated protein located at the head-to-tail junction (HTCA), and a homozygous nonsense mutation in PMFBP1 (p.gln802*) leads to azoospermia by inhibiting HTCA development. In 2019, researchers again discovered two families with centrosome protein CEP112 mutations, resulting in azoospermia. In the above-mentioned existing technology reports, SUN5 and PMFBP1 gene mutations do not affect IVF assisted reproductive outcomes, while TSGA10, BRDT, and CEP112 gene mutations may affect IVF assisted reproductive outcomes. In summary, 112 genes associated with azoospermia have been identified to date, including SUN5, BRDT, PMFBP1, TSGA10, and CEP1. Among these, SUN5 gene mutations may account for 30-50% of all AS patients, meaning that many more genetic pathogenic factors for AS remain undiscovered. Summary of the Invention

[0006] The purpose of this invention is to overcome the shortcomings of the prior art and provide the application of ACTRT1 as a target in the detection and treatment of azoospermia.

[0007] The full name of the ACTRT1 gene is Actin Related Protein T1, located on human chromosome X, region Xq25. It consists of one exon, with a coding region of 1260 bp, encoding a protein of 376 amino acids. Previous human genetic studies have found an association between ACTRT1 mutations and basal cell carcinoma, but no link has been found between the ACTRT1 gene and other human diseases. The function of ACTRT1 homologs in other model organisms such as mice, rats, zebrafish, fruit flies, and African clawed frogs is also rarely reported. Therefore, the function of the ACTRT1 gene and its relationship with disease remain unknown.

[0008] The technical solution of the present invention is as follows:

[0009] Application of ACTRT1 as a detection target in the preparation of a kit for diagnosing azoospermia.

[0010] Application of ACTRT1 as a therapeutic target in the preparation of kits for the treatment of azoospermia.

[0011] Application of ACTRT1 mutation antagonists in the preparation of drugs for the prevention and treatment of azoospermia.

[0012] A diagnostic kit for azoospermia includes reagents capable of detecting whether ACTRT1 is mutated.

[0013] In a preferred embodiment of the present invention, the reagent capable of detecting whether ACTRT1 is mutated includes a reagent for PCR detection of whether ACTRT1 is mutated.

[0014] A kit for treating azoospermia includes a reagent capable of treating ACTRT1 mutations.

[0015] In a preferred embodiment of the invention, the agent capable of treating ACTRT1 mutations includes an antagonist of ACTRT1 mutations.

[0016] A drug for the prevention and treatment of azoospermia, the active ingredient of which includes an antagonist of ACTRT1 mutation.

[0017] In a preferred embodiment of the present invention, the active ingredient is an antagonistic substance against ACTRT1 mutation.

[0018] Further preferred options include pharmaceutically acceptable excipients.

[0019] The beneficial effects of this invention are: In this invention, mutation of the ACTRT1 gene causes loss of ACTRT1 functional protein, which may affect the connection between the head and tail of sperm, and ultimately induce aheaded sperm syndrome. Attached Figure Description

[0020] Figure 1 The images shown are scanning electron microscope images of three different phenotypes of headless sperm in the background of this invention (Chemes et al., 1999). (a) Type I, the break point is located in the middle of the tail, resulting in disordered mitochondrial arrangement; (b) Type II, the break point is located at the junction of the head and tail, and the middle mitochondrial arrangement is neat; (c) Type III, the head and tail do not break, but form an angle of 90-180 degrees.

[0021] Figure 2 This is a pedigree chart of patients with azoospermia in Embodiment 1 of the present invention.

[0022] Figure 3 This is a Papanicolaou staining image of headless sperm from a patient with azoospermia in Example 1 of the present invention.

[0023] Figure 4 This is a diagram showing the results of co-segregation of mutation sites within the family of azoospermia patients in Example 1 of the present invention.

[0024] Figure 5 This is a map showing the expression and localization of ACTRT1 protein in sperm in Example 1 of the present invention. The image shows immunofluorescence staining of ACTRT1 protein (red) and mitochondrial-specific expressed protein COXIV (green) in healthy control sperm (Cotrol). Patient represents sperm from patients where ACTRT1 is not expressed.

[0025] Figure 6 This is a schematic diagram of gRNA design in Embodiment 1 of the present invention.

[0026] Figure 7 This is an electrophoretic detection image of the PCR products in Example 1 of the present invention.

[0027] Figure 8 This is a microscope image showing the characteristics of the testes of the Actrt1 gene knockout mouse in Example 1 of the present invention.

[0028] Figure 9 This is a photograph of the sperm phenotype of the Actrt1 gene knockout mouse in Example 1 of the present invention. Detailed Implementation

[0029] The technical solution of the present invention will be further explained and described below with reference to specific embodiments and accompanying drawings.

[0030] Example 1

[0031] 1) Establish a sample bank for headless sperm abnormalities, with sufficient sample sources.

[0032] Over the course of 13 years, we have collected blood samples from more than 100 patients with teratospermia, including some or all headless sperm, some or all short-tailed sperm, and round-headed sperm (sample numbers LYZ20061001-LSK201901016115), among which 25 samples were headless sperm.

[0033] 2) Clinical data from an independent family with headless sperm disease identified in the early stages.

[0034] One independent, non-consanguine core family sample with azoospermia was identified (sample number SXX2019092101) (see...) Figure 2 Specifically, the patient (II:1), 33 years old, presented with a history of normal sexual intercourse with her husband, 2-3 times per week, and her wife had experienced one miscarriage. She had a regular lifestyle, no bad habits, no history of trauma or surgery, and no history of exposure to toxins. Her parents were not consanguineous and had one child. The child was 177cm tall and weighed 76kg. No abnormalities were found in the external genitalia, both testes were of normal size, and both epididymis and spermatic cords were normal. Three semen analyses showed: all were pale yellow, 3-3.5ml, liquefying in 20-30 minutes, with sperm concentrations of 19.6-36×10⁻⁶. 6 / ml, progressively motile sperm 17.9-28.6%, modified Papanicolaou staining showed 2% of sperm with normal morphology, of which 40-50% were headless sperm. Figure 3 Left image is a normal comparison. Figure 3 The patient in the right image (arrow indicates headless sperm) had normal blood sex hormone levels. Chromosomal karyotype analysis (G-banding) showed a 46,XY chromosome. Y chromosome microdeletion testing revealed the presence of six STS loci in the three regions AZFa, AZFb, and AZFc.

[0035] For patients with azoospermia who had been ruled out for genetic issues such as chromosomal karyotype and AZF region deletion, whole-exome sequencing was performed. Considering the rarity of azoospermia, potential pathogenic mutations should be rare variants. Therefore, bioinformatics analysis was used to screen for homozygous and compound heterozygous variants with a mutation frequency of less than 1% in patients (referencing variant databases such as ExAC, gnomAD, 1000Genomes, dbSNP, and ESP6500), including missense mutations, frameshift mutations, nonsense mutations, and splice site mutations. Then, bioinformatics analysis was used to screen for genes specifically expressed or highly expressed in the testes, and pathogenicity prediction analysis (using online variant prediction software such as SIFT, Polyphen2, PROVEAN, Mutation Taster, and FATHMM-MKL) was combined to screen for potential pathogenic genes in patients with azoospermia. Subsequently, Sanger sequencing was performed to verify the potential pathogenic gene mutation sites in patients and their families.

[0036] 3) Perform exome sequencing, mutation screening, and identification of pathogenic genes and mutation sites in family pedigrees.

[0037] Having ruled out genetic issues such as chromosomal karyotype and AZF region deletions, whole-exome sequencing was performed on patients with azoospermia in the family. Considering the rarity of azoospermia, this embodiment assumed that the pathogenic mutation should be a rare variant. Family analysis revealed that the patient's gene mutation was likely an autosomal recessive compound heterozygous mutation or an X-linked recessive mutation. Therefore, through bioinformatics analysis, this embodiment screened for homozygous variants with a frequency of less than 1% (referencing variant databases such as ExAC, gnomAD, 1000Genomes, dbSNP, and ESP6500), including missense mutations, frameshift mutations, nonsense mutations, and splice site mutations. Then, through bioinformatics analysis, genes specifically or highly expressed in the testes were screened out, and combined with pathogenicity prediction analysis of mutations (online variant prediction software such as SIFT, Polyphen2, PROVEAN, Mutation Taster, FATHMM-MKL, etc.), it was found that only X-linked ACTRT1 gene mutations (ACTRT1: NM138289: exon1) were found. ： c.A662G: p.Y221C) meets all screening criteria. Figure 2 Subsequently, Sanger sequencing was performed on two mutation sites in the ACTRT1 gene of the patient and their parents to verify the mutations, which were found to be inherited from the mother. Figure 4 Therefore, the mutation carried by the patient is an X chromosome mutation that co-segregates within the family.

[0038] In summary, the two patients with azoospermia identified in this embodiment each carried a homozygous ACTRT1 mutation. Further expansion of the sample size is planned to verify the mutation rate of this gene in some patients with azoospermia. So far, only the ACTRT1 mutation (c.A662G: p.Y221C) has been found. This mutation was predicted to be a harmful mutation using the Mutation Taster and SIFT_score databases. Subsequent analysis of the frequency of these two mutations in the population revealed that the allele frequency of c.A662G in both EXAC and GnomAD East Asian populations was 0 (see Table 1), a frequency that matches the rarity of azoospermia.

[0039] Table 1. Bioinformatics analysis of pathogenicity of ACTRT1 mutations

[0040]

[0041] 4) Analysis of the expression and localization of ACTRT1 protein in headless sperm samples from patients.

[0042] Next, this example analyzes the expression level and localization of ACTRT1 protein in headless sperm from patients with ACTRT1 gene mutations. Immunofluorescence staining was used to investigate the localization of ACTRT1 protein, revealing that in normal sperm, ACTRT1 protein is located in the neck region (connecting piece) between the sperm head and the mid-tail. Figure 5 , cotrol (see arrow), however, no red fluorescent signal of ACTRT1 antibody was found in the headless sperm of patients in the family ( Figure 5 (patient, see arrow).

[0043] 5) Construct Actrt1 gene knockout mice and identify them.

[0044] (1) Design and test gRNA efficiency:

[0045] ① gRNA design: Actrtl has only one exon. gRNAs were designed using the website http: / / crispr.mit.edu / , and the three highest-scoring gRNAs were selected, such as... Figure 6 As shown, the sequence is as follows:

[0046] gRNA-1:5'-cctattgagcgtggactggtaac-3' (SEQ ID NO.01)

[0047] gRNA-2:5'-cagacagatgttattcggcttgg-3' (SEQ ID NO.02)

[0048] gRNA-4:5'-ctgcaagatctaatcggaaaagg-3' (SEQ ID NO.03)

[0049] ② Design a test for gRNA efficiency:

[0050] A suitable Cas9 gRNA plasmid with appropriate resistance was constructed and transfected into cells. Transfected and untransfected cells were killed with a resistant drug. After the untransfected cells died, the cells transfected with Cas9 gRNA were harvested, and their genomes were extracted. Primers 300 bp before and after the gRNA cleavage site were designed. PCR was performed, the cells were recovered, ligated into a vector, plated, and 16 bacterial strains were selected for sequencing. The proportion of knockout (KO) strains among the 16 strains was counted, and strains with a knockout efficiency higher than 50% were selected for the next step of the experiment. In this experiment, gRNA-1 and gRNA-2 were selected.

[0051] (2) Ordering gRNA:

[0052] Primers for 2OD were ordered from Thermo Fisher Scientific. The sequence is as follows:

[0053] gRNA-1:

[0054] 5-gaaattaatacgactcactataggcctattgagcgtggactggtaacgttttagagctagaaatagc-3' (SEQ ID NO.04)

[0055] gRNA-2:

[0056] 5-gaaattaatacgactcactataggcagacagatgttattcggcttgggttttagagctagaaatagc-3' (SEQ ID NO.05)

[0057] (3) Ordering PCR primers for Cas9:

[0058] The primer sequence is: Cas9-F: 5'-caccgactgagctccttaag-3' (SEQ ID NO.06)

[0059] Cas9-R: 5'-tagtcaagcttccatggctcga-3' (SEQ ID NO.07)

[0060] (4) In vitro transcription of gRNA and Cas9

[0061] ① sgRNA template PCR Phusion enzyme amplification system and conditions

[0062] 20μL / reaction*10reactions

[0063]

[0064] *: To reduce non-specific bands, the plasmid was diluted to 0.5 pg / μL.

[0065] ② Cas9 template PCR Phusion enzyme amplification system and conditions

[0066] 20ul / reaction * 10reactions

[0067]

[0068] *: To reduce non-specific bands, the plasmid was diluted to 0.5 ng / μL.

[0069] (5) Injection into the cytoplasm:

[0070] A mixture of Cas9 100 ng / μL and gRNA 50 ng / μL was administered via microinjection into fertilized eggs 0.5 days after conception. A total of 240 fertilized eggs were injected, and 6 ICR pseudopregnant mice were transplanted, resulting in 39 pups 19 days later.

[0071] (6) Identification of mice:

[0072] PCR primers were designed based on the location of the gRNA. The primer sequences were: Actrtl(H8-1+2)-F1: 5'-gactaggaacaactgaggtgc-3' (SEQ ID NO.08) and Actrtl(H8-1+2)-R1: 5'-tgtgtccctcagcatccaaa-3' (SEQ ID NO.09). The resulting wild-type PCR product was 1505 bp. PCR gel electrophoresis and sequencing were used to detect whether the mouse genome contained deletions (large deletion fragments can be directly observed from banding changes, while small deletion fragments can only be detected through sequencing). Figure 7 As shown, 22 of them had sequences that were significantly different from the wild type (see arrow). The PCR products of the genomes of these 22 mice were sent for sequencing. After analyzing the results, one homozygous male mouse was selected for breeding to obtain F1 generation heterozygous Actrt1 knockout mice that could be stably inherited. The F1 generation mice were paired to obtain F2 generation wild-type mice and Actrt1 knockout homozygous mice.

[0073] 6) Sperm phenotype characteristics of Actrt1 gene knockout mice

[0074] In this embodiment, after obtaining Actrt1 gene knockout mice, the spermatogenesis process of these homozygous knockout mice was analyzed in detail. Figure 8 It can be seen that the steps before the development of round sperm in Actrt1 knockout mice are no different from those in normal controls. However, after modified Papanicolaou staining of mature sperm in the epididymis of mice, it was found that the sperm of Actrt1 knockout mice exhibited a distinct headless sperm phenotype (indicated by the arrow). Figure 9 ).

[0075] In summary, this embodiment preliminarily demonstrates that the ACTRT1 gene may play a role in the head-to-tail connection of human and mouse sperm.

[0076] The above description is merely a preferred embodiment of the present invention, and therefore should not be construed as limiting the scope of the present invention. All equivalent changes and modifications made in accordance with the scope of the patent and the contents of the specification should still fall within the scope of the present invention. sequence list <110> The First Affiliated Hospital of Jinzhou Medical University <120> Application of ACTRT1 as a target in the detection and treatment of azoospermia <160> 9 <170> SIPOSequenceListing 1.0 <210> 1 <211> twenty three <212> DNA / RNA <213> Artificial Sequence <400> 1 cctattgagc gtggactggt aac 23 <210> 2 <211> twenty three <212> DNA / RNA <213> Artificial Sequence <400> 2 cagacagatg ttattcggct tgg 23 <210> 3 <211> twenty three <212> DNA / RNA <213> Artificial Sequence <400> 3 ctgcaagatc taatcggaaa agg 23 <210> 4 <211> 67 <212> DNA / RNA <213> Artificial Sequence <400> 4 gaaattaata cgactcacta taggcctatt gagcgtggac tggtaacgtt ttagagctag 60 aaatagc 67 <210> 5 <211> 67 <212> DNA / RNA <213> Artificial Sequence <400> 5 gaaattaata cgactcacta taggcagaca gatgttatattc ggcttgggttttagagctag 60 aaatagc 67 <210> 6 <211> 20 <212> DNA / RNA <213> Artificial Sequence <400> 6 caccgactga gctccttaag 20 <210> 7 <211> twenty two <212> DNA / RNA <213> Artificial Sequence <400> 7 tagtcaagct tccatggctc ga 22 <210> 8 <211> twenty one <212> DNA / RNA <213> Artificial Sequence <400> 8 gactaggaac aactgaggtg c 21 <210> 9 <211> 20 <212> DNA / RNA <213> Artificial Sequence <400> 9 tgtgtccctc agcatccaaa 20

Claims

1. Use of an agent for detecting the expression of ACTRT1 protein in sperm for the preparation of a kit for the diagnosis of globozoospermia, characterized in that: The agent is an ACTRT1 antibody, which is not expressed in the sperm of patients with ahspermia.

Images