A group of nucleotide sequences for reducing uricase gene expression and their applications

Abstract

The present invention discloses a set of RNA sequences that reduce uricase gene expression, DNA sequences corresponding to the set of sequences, modified nucleotide sequences, double-stranded nucleotide sequences, delivery vectors containing the above nucleotide sequences, and methods for constructing a hyperuricemia mouse model using the above nucleotide sequences or delivery vectors. The advantages of the present invention are: the present invention discloses a set of novel nucleotide sequences that inhibit uricase gene expression, and hyperuricemia mice constructed using the nucleotide sequences disclosed in the present invention or delivery vectors containing the same have relatively stable elevated uric acid levels, similar pathogenesis to that of humans, long mouse survival time, and a relatively short cycle for constructing the animal model and easy operation, thereby providing a better animal model for subsequent evaluation of drugs for treating hyperuricemia and related diseases such as gout.

Description

Technical Field

[0001] The present invention relates to the field of gene therapy, and in particular to a group of nucleotide sequences for reducing uricase gene expression and applications thereof. Background Art

[0002] Hyperuricemia is a disease caused by purine metabolism disorders or reduced uric acid excretion, which leads to high serum uric acid levels. It refers to fasting blood uric acid levels exceeding 420μmol / L for men and 360μmol / L for women on two different days under a normal purine diet. Hyperuricemia is an important pathogenic factor for gout, renal damage and various cardiovascular diseases. In recent years, the prevalence of hyperuricemia and gout has been increasing. As one of the many metabolic disorders, hyperuricemia is often closely related to the development of diseases such as hypertension, diabetes, obesity, and atherosclerosis, and is a major disease that threatens human health. Controlling hyperuricemia has a good preventive and therapeutic effect on these diseases.

[0003] Current medications for treating hyperuricemia can be categorized by their mechanisms of action: those that inhibit uric acid production; those that promote uric acid excretion; and those that promote uric acid breakdown. Common examples include allopurinol, febuxostat, probenecid, and benzbromarone. However, most of these medications have significant side effects, causing damage to liver, kidney, and myocardial function. Patients are prone to adverse reactions such as skin allergies, diarrhea, and abnormal liver function. There is an urgent need to identify safe and cost-effective uric acid-lowering drugs with minimal side effects. However, the screening and development of such drugs relies on appropriate hyperuricemia animal models. Therefore, establishing an efficient hyperuricemia animal model for drug screening is crucial.

[0004] There are three main methods for modeling hyperuricemia animal models commonly used. The first is to have animals directly ingest uric acid, high-purine foods, or uric acid precursors, such as xanthine or hypoxanthine, to promote the formation of uric acid and form a hyperuricemia model. The second is to inhibit uric acid excretion by administering drugs, increase blood uric acid concentration, and form hyperuricemia. Commonly used drugs are adenine, nicotinic acid, etc. The third is to inhibit the activity of uricase (urate oxidase, Uox). Commonly used uricase inhibitors are oxonic acid, etc. At present, most hyperuricemia models use two or three modeling substances simultaneously to obtain a stable and lasting hyperuricemia model. However, the blood uric acid levels in the hyperuricemia animal models induced by the above methods fluctuate, and there are inconsistencies with the pathogenesis of human hyperuricemia.

[0005] Uricase breaks down uric acid into the more water-soluble small molecule allantoin for excretion. This is the primary pathway for many lower animals, including mice, to maintain uric acid homeostasis. However, due to a genetic mutation during human evolution, this gene cannot express uricase, which is the primary cause of human susceptibility to hyperuricemia. Therefore, some studies have used the uricase gene knockout method to create a hyperuricemia mouse model. However, this method results in significantly elevated blood uric acid levels in these animals, reaching lethal levels. Few mice survive to maturity, and the experimental period is relatively long.

[0006] Based on the above problems, there is an urgent need to develop a method to effectively construct a stable and long-term effective hyperuricemia model animal.

[0007] RNA interference (RNAi) is a gene silencing phenomenon induced by double-stranded RNA (dsRNA). When double-stranded RNA homologous to the coding region of endogenous mRNA is introduced into cells, the mRNA is degraded, resulting in gene silencing. RNA interference is a powerful gene silencing tool and is widely used in fields such as microbiology and the study of gene expression regulation mechanisms. When exogenous dsRNA enters the cell, it can be recognized by the Dicer enzyme and processed into a short RNA chain of 21-23 nucleotides, namely small interfering RNA (siRNA). After entering the cell, siRNA can form an RNA-induced silencing nucleic acid protein complex (RISC) with proteins in the cytoplasm, bind to the target mRNA with complementary sequence, cleave the mRNA, and block the translation of the corresponding protein. siRNA is specific and highly efficient, and is a powerful method for specifically inhibiting gene expression.

[0008] However, siRNA chemically synthesized in vitro is easily and rapidly degraded by nucleases in vivo, resulting in weak transcellular membrane transport, short half-life, and low gene silencing efficiency in vivo. Currently, many studies are attempting to enhance the stability of siRNA by chemically modifying the polynucleotide chains that constitute siRNA. Modification methods include: terminal modifications, such as 5'-terminal modifications (phosphorylation, conjugation, reverse linkage) or 3'-terminal modifications (conjugation, DNA nucleotides, reverse linkage, etc.); base modifications, such as the use of stable bases, destabilizing bases, or base substitutions that pair with the bases of the target expansion region, the exclusion of bases (abasic nucleotides), or conjugation of bases; sugar modifications (e.g., at the 2'-position or 4'-position) or replacement of sugars; and / or backbone modifications, including modification or replacement of phosphodiester linkages. However, such modifications generally result in reduced interference activity of siRNA.

[0009] Compared to direct siRNA expression, vector-mediated shRNA expression in vivo offers certain advantages. The corresponding dsRNA sequence is cloned into a corresponding vector containing an RNA polymerase III-dependent promoter, such as the U6, 7SK, or H1 promoter, with a well-defined transcription start site and a transcription termination signal consisting of five consecutive thymines (T5). A specific pair of oligonucleotides is derived from a unique 19-21 base sequence in the target gene's mRNA. When the forward and reverse DNA oligonucleotides are annealed and cloned between two restriction endonuclease sites in the vector, the forward DNA oligonucleotide is precisely positioned downstream of the H1 promoter. The transcript of the recombinant vector, a small hairpin RNA (shRNA), folds onto itself and pairs to form a 19-21 base stem-loop structure. This stem-loop precursor is rapidly cleaved within the cell to form a functional siRNA. The cleaved siRNA expressed from this vector exhibits stable expression and long-lasting efficacy, resulting in long-term, effective inhibition of target gene expression.

[0010] Commonly used vectors include adeno-associated virus (AAV), retroviruses, and lentiviruses. Compared to the latter two, AAV offers significant advantages in terms of safety, low immunogenicity, a broad host range, long-term stable expression of the transfected genes it carries, and both in vitro and in vivo applications. Its availability in multiple serotypes allows it to meet the transfection requirements of diverse tissues, offering a broad range of applications and promising prospects.

[0011] There are currently no reports on the use of RNA interference technology to construct a hyperuricemia model mouse. Therefore, we are looking for a specific RNA interference sequence targeting the uricase gene and constructing this interference sequence into an adeno-associated virus vector. The viral vector enters the body, thereby inhibiting the expression of uricase. This provides a new idea for effectively constructing a hyperuricemia model animal. Summary of the Invention

[0012] The purpose of the present invention is to provide a group of nucleotide sequences for reducing the expression of uricase gene, including ribonucleic acid (RNA) and deoxyribonucleic acid (DNA).

[0013] Another object of the present invention is to provide an application of the above nucleotide sequence, using the above nucleotide sequence to inhibit the expression of uricase through RNA interference technology.

[0014] In order to achieve the above-mentioned object of the invention, the present invention adopts the following design scheme:

[0015] An RNA sequence that reduces uricase gene expression, wherein the RNA sequence is selected from:

[0016] 1) AUACCACAGCAUCAAAGAGGU (SEQ ID NO: 1);

[0017] 2)AAGUGUACUGCAAGUGGCGCU (SEQ ID NO: 2);

[0018] 3)CAGACACCAUCAAGAACACUG (SEQ ID NO: 3) or

[0019] 4) CAGACACCAUCAAGAACACAG (SEQ ID NO: 4).

[0020] The double-stranded RNA sequence formed by hybridization of the RNA sequence and its reverse complementary sequence has RNA interference activity and can degrade specific mRNA.

[0021] The RNA sequence and the reverse complementary sequence are covalently linked via an intermediate non-complementary linking sequence to form an RNA sequence having a hairpin-like structure.

[0022] The double-stranded RNA sequence formed by hybridization of the RNA sequence capable of forming a hairpin-like structure and its reverse complementary sequence can express the hairpin-like double strand in cells through a vector, has interfering RNA activity, and promotes the degradation of specific mRNA.

[0023] The sequence is obtained by modifying the 5' and / or 3' ends of the RNA sequence. Such modification may be by adding a UU modification to the 3' and / or 5' ends of the synthetic RNA.

[0024] A DNA sequence corresponding to the aforementioned RNA sequence for reducing uricase gene expression, wherein the DNA sequence is selected from:

[0025] 1) ATACCACAGCATCAAAGAGGT (SEQ ID NO: 5);

[0026] 2)AAGTGTACTGCAAGTGGCGCT (SEQ ID NO: 6);

[0027] 3) CAGACACCATCAAGAACACTG (SEQ ID NO: 7) or

[0028] 4) CAGACACCATCAAGAACACAG (SEQ ID NO: 8).

[0029] The double-stranded DNA sequence is formed by hybridization of the DNA sequence and its reverse complementary sequence.

[0030] The DNA sequence and the reverse complementary sequence are covalently linked via an intermediate non-complementary linking sequence to form a DNA sequence that can form a hairpin-like structure.

[0031] The DNA sequence capable of forming a hairpin-like structure hybridizes with a reverse complementary sequence to form a double-stranded DNA sequence.

[0032] A sequence obtained by modifying the 5' and / or 3' ends of a DNA sequence. Its use is, for example, to add enzyme cleavage sites at both ends of DNA.

[0033] A delivery vector comprising the aforementioned RNA sequence or DNA sequence, wherein the delivery vector is selected from a viral vector and a non-viral vector. Preferably, the non-viral vector is selected from the group consisting of liposomes, plasmid vectors, and phage vectors. Preferably, the viral vector is selected from the group consisting of an adenoviral vector, an adeno-associated viral vector, a lentiviral vector, and a hybrid viral vector. More preferably, the viral vector is selected from an adeno-associated viral vector.

[0034] A method for constructing a hyperuricemia model animal comprises the following steps: using the aforementioned sequence or the aforementioned delivery vector to reduce the expression of the uricase gene (Uox) in the target animal; the obtained animal with reduced uricase expression is the hyperuricemia model animal.

[0035] A shRNA specifically reduces uricase gene expression, having a base sequence as shown in SEQ ID NO: 13. The target sequence is positions 108-128 of the uricase gene as shown in SEQ ID NO: 5. The shRNA is transcribed from a DNA oligonucleotide as shown in SEQ ID NO: 21. Alternatively, the shRNA is transcribed from a plasmid containing the DNA oligonucleotide as shown in SEQ ID NO: 21. The shRNA can be cleaved to form a sense strand and an antisense strand of the siRNA as shown in SEQ ID NO: 1 and SEQ ID NO: 9.

[0036] A DNA sequence corresponding to the aforementioned shRNA, whose base sequence is shown in SEQ ID NO: 21.

[0037] The double-stranded DNA sequence is formed by hybridization of the DNA sequence and its reverse complementary sequence.

[0038] A vector comprising the aforementioned shRNA or corresponding DNA sequence for specifically reducing the expression of the uricase gene.

[0039] Use of the aforementioned shRNA or corresponding DNA sequence that specifically reduces uricase gene expression, or a vector comprising the aforementioned shRNA or corresponding DNA sequence, in the preparation of an animal model for treating hyperuricemia.

[0040] A method for constructing a hyperuricemia model animal comprises using the aforementioned shRNA or corresponding DNA sequence that specifically reduces uricase gene expression, or a vector comprising the aforementioned shRNA or corresponding DNA sequence, to reduce the expression of the uricase gene (Uox) in a target animal, thereby obtaining an animal with reduced uricase expression, which is a hyperuricemia model animal.

[0041] Compared with the prior art, the present invention has the following advantages:

[0042] 1) Compared with the existing hyperuricemia animal model induced by chemical reagents, the hyperuricemia model animal constructed using the nucleotide sequence and method of the present invention has a relatively stable and long-lasting increase in uric acid levels, which provides strong support for the subsequent activity evaluation of drugs at the animal level.

[0043] 2) Compared with transgenic mice with complete uricase knockout, the model animals produced by the present invention have a longer survival time, and the time period for constructing the model animals is relatively short, and the operation is convenient.

[0044] The present disclosure is further described below with reference to the accompanying drawings and specific embodiments, but is not intended to limit the present disclosure. Any equivalent replacement in the field made in accordance with the disclosure of this patent application shall fall within the scope of protection of this patent. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Figure 1 The figure shows the different fragments produced by double-digestion of the T vector with BglII and HindIII, where M1 is a 15K DNA marker and M2 is a 2K DNA marker.

[0046] Figure 2 The figure shows the company's self-constructed plasmid pSC-H1-shRNA-HPRT intron2 double-digested with BglII and HindIII, wherein M1 is a 15K DNA marker and M2 is a 2K DNA marker.

[0047] Figure 3 The expression levels of Uox protein in different interference groups are shown. Figure 3 A represents protein WB results, Figure 3 B represents the protein WB grayscale scanning results, and the control group is the PBS injection group.

[0048] Figure 4 The blood uric acid level at 2 weeks after the rAAV-shRNA#1 interference group was shown, and the control group was the PBS injection group.

[0049] Figure 5The blood uric acid level of the rAAV-shRNA#1 interference group at 5 weeks is shown, and the control group is the PBS injection group.

[0050] Figure 6 The blood uric acid levels at 2 and 5 weeks after the rAAV-shRNA#1 interference group are shown, and the control group is the PBS injection group.

[0051] Figure 7 The figure shows the survival rate of mice in the rAAV-shRNA#1 interference group, and the control group was the PBS injection group. DETAILED DESCRIPTION

[0052] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0053] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0054] The following examples are merely illustrative and are not intended to limit the present invention.

[0055] Example 1 Vector Construction

[0056] According to the mouse uricase gene (Uox) sequence (Genebank: NM_009474.5), the RNA interference fragment targeting the mouse uricase gene was designed using the website https: / / www.sigmaaldrich.com / life-science / functional-genomics-and-rnai / sirna / mission-predesigned-sirna.html. The specific sequence is shown in Table 1.

[0057] Table 1

[0058] name Target sequence (SEQ ID NO: 5-8) Sense strand (5'-3') (SEQ ID NO: 1-4) Antisense strand (5'-3') (SEQ ID NO:9-12) siRNA#1 ATACCACAGCATCAAAGAGGT AUACCACAGCAUCAAAGAGGU ACCUCUUUGAUGCUGUGGUAU siRNA#2 AAGTGTACTGCAAGTGGCGCT AAGUGUACUGCAAGUGGCGCU AGCGCCACUUGCAGUACACUU siRNA#3 CAGACACCATCAAGAACACTG CAGACACCAUCAAGAACACUG CAGUGUUCUUGAUGGUGUCUG siRNA#4 CAGACACCATCAAGAACACAG CAGACACCAUCAAGAACACAG CUGUGUUCUUGAUGGUGUCUG

[0059] The above RNA interference fragments were designed to form a hairpin structure as shown in Table 2. The corresponding DNA sequences are shown in Table 3. Five consecutive Ts were added to the 3' end of the shRNA transcription termination signal, and BglII and HindIII restriction sites were added to both ends. The sequence was synthesized and inserted into a T vector (Promega, A1360).

[0060] Table 2

[0061]

[0062] Table 3

[0063]

[0064] The T vectors containing the DNA sequences corresponding to the above different shRNA sequences were named T1-T4, and T1 was double-digested with BglII and HindIII. The digestion results were as follows: Figure 1 As shown, small fragments were recovered from the gel; the same operation was used for T2-T4 vectors. The vector pSC-H1-shRNA-HPRT intron (the company's own vector) was also digested with BglII and HindIII. The digestion results are shown in Figure 2 As shown, the large vector fragment was recovered; the recovered small fragment was ligated to the large vector fragment, transformed, and sequenced. The shuttle plasmid required for AAV packaging carrying the exogenous gene shRNA was successfully constructed and used for subsequent AAV virus packaging.

[0065] Example 2 Virus packaging and genome titer detection

[0066] In this example, HEK293T cells (purchased from ATCC, numbered CRL-11268) were used as the production cell line and a conventional three-plasmid packaging system was used to produce recombinant AAV viral vectors. All experimental methods used were conventional methods in the art (see Xiao Xiao, Juan Li, and Richard Jude Samulski. Production of high-titer recombinant Adeno-associated virus vectors in the absence of helper Adenovirus. J. Virol. 1998, 72(3): 2224).

[0067] Take an appropriate amount of purified AAV sample and prepare DNase I digestion reaction mixture, incubate at 37°C for 30 minutes and incubate at 75°C for 10 minutes to inactivate DNase I.

[0068] After the treated purified AAV sample is diluted to an appropriate multiple, the Q-PCR reaction system is configured according to the table below (Table 4), and the detection is performed according to the following procedure.

[0069] Table 4

[0070]

[0071] The primers used are shown in the following table (Table 5):

[0072] Table 5

[0073] Upstream primer (5'-3') ACCCGCTCCAAGGAATCG Downstream primer (5'-3') AAATATTGCAGGGCGCCAC

[0074] The packaging output results are shown in the following table (Table 6):

[0075] Table 6

[0076] viral vectors Genome titer (vg / ml) rAAV-shRNA#1 2E+12 rAAV-shRNA#2 1E+12 rAAV-shRNA#3 4E+12 rAAV-shRNA#4 5E+11

[0077] Example 3 Detection of the efficiency of recombinant viruses containing different interfering fragments in reducing uricase gene expression in mice

[0078] C57 mice aged 6-8 weeks were selected and divided into 5 groups, 4 drug-treated groups (rAAV-shRNA#1, rAAV-shRNA#2, rAAV-shRNA#3, rAAV-shRNA#4) and a PBS blank control group. The mice were injected into the tail vein, and each drug-treated group was set as a specific interference group. The injection dose of the 4 drug-treated groups was 1×10 12 vg / kg, and the blank control group was injected with 200 μl of PBS. The rats were killed 2 weeks after injection, and serum and liver tissues were collected for the detection of blood uric acid and Uox protein.

[0079] First, the serum was separated by centrifugation (4,000 rpm, 4°C, 5 minutes), and then the blood uric acid levels in different groups were detected using the Uric Acid Assay Kit (Sigma, MAK077). The specific operation was referred to the kit instructions. First, the standard sample and reaction system were prepared and the standard curve was drawn. Fluorescence was used to detect blood uric acid, and the blood uric acid value of each group was calculated according to the standard curve. The test results are shown in Table 7. From Table 7, it can be seen that after injection of the rAAV-shRNA#1 recombinant virus, the blood uric acid level of the mice was significantly higher than that of the control group by about 50 μM.

[0080] Table 7 Blood uric acid levels in different interference groups

[0081]

[0082] Mouse liver tissue protein was extracted using RIPA lysis buffer (Prilep, C1053). The specific extraction method was described in the reagent instructions. First, 100 mg of liver tissue was cut into pieces on ice, washed twice with pre-chilled PBS, centrifuged, and the PBS discarded. Then, 0.5 mL of pre-chilled RIPA lysis buffer was added and homogenized on ice using a glass homogenizer until 95% of the cells were disrupted. Finally, centrifugation was performed (12,000 g, 4°C, 10 minutes). The supernatant was the total liver tissue protein.

[0083] Then, the content of uricase was detected by Western-Blot. The specific method is as follows: After the extracted protein was quantified using the BCA protein quantification kit (Thermo Scientific, 23225), the concentration of each group of samples was uniformly adjusted to 30 mg / mL with RIPA lysis buffer. After the samples were prepared, SDS-PAGE electrophoresis was performed. After the electrophoresis was completed, the mold was transferred, blocked, washed, and incubated with the primary antibody overnight (anti-UOX antibody, Santa Cruze, sc-166214; anti-actin antibody, proteintech, 66009-1-Ig), and washed. The next day, goat anti-mouse IgG (Biyuntian, A0216) was incubated, washed, and exposed to color. The results are shown in the figure. Figure 3 A. Image J software was used to analyze the grayscale of WB results. Figure 3 As shown in B. Figure 3 A and Figure 3 As shown in B, rAAV-shRNA#1 has the best interference effect, which is about 90%.

[0084] Example 4 Establishment and Evaluation of Hyperuricemia Animal Model

[0085] Based on the above experimental results, we selected rAAV-shRNA#1 for animal model creation experiments. Six- to eight-week-old C57 mice were selected and divided into a treatment group and a blank control group, with 10 mice in each group, and the mice were injected into the tail vein. The treatment group was injected with rAAV-shRNA#1 virus at a dose of 1×10 12 vg / kg, and the blank control group was injected with an equal volume of PBS. Blood was collected from the canthus of the mice at 2 weeks and 5 weeks after injection, and the uric acid content in the blood was detected using the Uric Acid Assay Kit (Sigma, MAK077). The specific method is shown in Example 3, and the test results are shown in Figure 4 and Figure 5 The comparison results of blood uric acid levels at different time points are shown in Figure 6 shown.

[0086] from Figure 4 、 Figure 5 and Figure 6 The results show that the blood uric acid level in the rAAV-shRNA#1 injection group was significantly higher than that in the control group (PBS group), and there was a significant statistical difference (P<0.01), and the high blood uric acid level remained at a high level for 6 weeks during the experiment.

[0087] In addition, the survival rates of mice in different groups were tested, and the results are shown in Figure 7As shown, the mice in the drug-treated group and the control group could survive normally during the 6-week experimental period, which is fully capable of meeting the in vivo activity evaluation of hyperuricemia and gout drugs.

[0088] From the above experiments, it can be seen that the hyperuricemia animal model constructed using the nucleic acid sequence and method of the present invention is long-term effective and has stable effects, and can be used for subsequent activity evaluation of hyperuricemia and gout drugs. Sequence Listing <110> Shutaishen (Beijing) Biopharmaceutical Co., Ltd. <120> A group of nucleotide sequences for reducing uricase gene expression and their applications <160> 28 <170> SIPOSequenceListing 1.0 <210> 1 <211> twenty one <212> RNA <213> Artificial Sequence <400> 1 auaccacagc aucaaagagg u 21 <210> 2 <211> twenty one <212> RNA <213> Artificial Sequence <400> 2 aaguguacug caaguggcgc u 21 <210> 3 <211> twenty one <212> RNA <213> Artificial Sequence <400> 3 cagacaccau caagaacacu g 21 <210> 4 <211> twenty one <212> RNA <213> Artificial Sequence <400> 4 cagacaccau caagaacaca g 21 <210> 5 <211> twenty one <212> DNA <213> Artificial Sequence <400> 5 ataccacagc atcaaagagg t 21 <210> 6 <211> twenty one <212> DNA <213> Artificial Sequence <400> 6 aagtgtactg caagtggcgc t 21 <210> 7 <211> twenty one <212> DNA <213> Artificial Sequence <400> 7 cagacaccat caagaacact g 21 <210> 8 <211> twenty one <212> DNA <213> Artificial Sequence <400> 8 cagacaccat caagaacaca g 21 <210> 9 <211> twenty one <212> RNA <213> Artificial Sequence <400> 9 accucuuuga ugcuguggua u 21 <210> 10 <211> twenty one <212> RNA <213> Artificial Sequence <400> 10 agcgccacuu gcaguacacu u 21 <210> 11 <211> twenty one <212> RNA <213> Artificial Sequence <400> 11 caguguucuu gauggugucu g 21 <210> 12 <211> twenty one <212> RNA <213> Artificial Sequence <400> 12 cuguguucuu gauggugucu g 21 <210> 13 <211> 51 <212> RNA <213> Artificial Sequence <400> 13 auaccacagc aucaaagagg uuucaagaga accucuuuga ugcuguggua u 51 <210> 14 <211> 51 <212> RNA <213> Artificial Sequence <400> 14 auaccacagc aucaaagagg uucucuugaa accucuuuga ugcuguggua u 51 <210> 15 <211> 51 <212> RNA <213> Artificial Sequence <400> 15 aaguguacug caaguggcgc uuucaagaga agcgccacuu gcaguacacu u 51 <210> 16 <211> 51 <212> RNA <213> Artificial Sequence <400> 16 aaguguacug caaguggcgc uucucuugaa agcgccacuu gcaguacacu u 51 <210> 17 <211> 51 <212> RNA <213> Artificial Sequence <400> 17 cagacaccau caagaacacu guucaagaga caguguucuu gauggugucu g 51 <210> 18 <211> 51 <212> RNA <213> Artificial Sequence <400> 18 cagacaccau caagaacacu gucucuugaa caguguucuu gauggugucu g 51 <210> 19 <211> 51 <212> RNA <213> Artificial Sequence <400> 19 cagacaccau caagaacaca guucaagaga cuguguucuu gauggugucu g 51 <210> 20 <211> 51 <212> RNA <213> Artificial Sequence <400> 20 cagacaccau caagaacaca gucucuugaa cuguguucuu gauggugucu g 51 <210> 21 <211> 51 <212> DNA <213> Artificial Sequence <400> twenty one ataccacagc atcaaagagg tttcaagaga acctctttga tgctgtggta t 51 <210> twenty two <211> 51 <212> DNA <213> Artificial Sequence <400> twenty two ataccacagc atcaaagagg ttctcttgaa acctctttga tgctgtggta t 51 <210> twenty three <211> 51 <212> DNA <213> Artificial Sequence <400> twenty three aagtgtactg caagtggcgc tttcaagaga agcgccactt gcagtacact t 51 <210> twenty four <211> 51 <212> DNA <213> Artificial Sequence <400> twenty four aagtgtactg caagtggcgc ttctcttgaa agcgccactt gcagtacact t 51 <210> 25 <211> 51 <212> DNA <213> Artificial Sequence <400> 25 cagacaccat caagaacact gttcaagaga cagtgttctt gatggtgtct g 51 <210> 26 <211> 51 <212> DNA <213> Artificial Sequence <400> 26 cagacaccat caagaacact gtctcttgaa cagtgttctt gatggtgtct g 51 <210> 27 <211> 51 <212> DNA <213> Artificial Sequence <400> 27 cagacaccat caagaacaca gttcaagaga ctgtgttctt gatggtgtct g 51 <210> 28 <211> 51 <212> DNA <213> Artificial Sequence <400> 28 cagacaccat caagaacaca gtctcttgaa ctgtgttctt gatggtgtct g 51

Claims

1. An RNA sequence for reducing uricase gene expression, characterized in that: The RNA sequence is: AUACCACAGCAUCAAAGAGGU (SEQ ID NO: 1).

2. A double-stranded RNA sequence formed by hybridization of the RNA sequence according to claim 1 and a reverse complementary sequence thereto.

3. An RNA sequence capable of forming a hairpin-like structure, obtained by covalently linking the RNA sequence according to claim 1 and a reverse complementary sequence thereof via an intermediate non-complementary linker sequence.

4. A double-stranded RNA sequence formed by hybridization of the RNA sequence capable of forming a hairpin-like structure according to claim 3 and a reverse complementary sequence thereof.

5. A sequence obtained by modifying the 5' end and / or 3' end of the RNA sequence according to claim 1 or 2.

6. A DNA sequence corresponding to the RNA sequence for reducing uricase gene expression according to claim 1, characterized in that: The DNA sequence is: ATACCACAGCATCAAAGAGGT (SEQ ID NO: 5).

7. A double-stranded DNA sequence formed by hybridization of the DNA sequence according to claim 6 and a reverse complementary sequence thereof.

8. A DNA sequence capable of forming a hairpin-like structure, obtained by covalently linking the DNA sequence according to claim 6 and a reverse complementary sequence thereof via an intermediate non-complementary linker sequence.

9. A double-stranded DNA sequence formed by hybridization of the DNA sequence capable of forming a hairpin-like structure according to claim 8 and a reverse complementary sequence thereof.

10. A sequence obtained by modifying the 5' end and / or 3' end of the DNA sequence according to any one of claims 6 to 9.

11. A delivery vector comprising the RNA sequence of any one of claims 1-5 or the DNA sequence of any one of claims 6-10.

12. The delivery vector according to claim 11, characterized in that The delivery vector is selected from viral vectors and non-viral vectors.

13. The delivery vector according to claim 12, characterized in that The non-viral vector is selected from the group consisting of liposomes, plasmid vectors, and phage vectors.

14. The delivery vector according to claim 12, characterized in that The viral vector is selected from the group consisting of an adenoviral vector, an adeno-associated viral vector, a lentiviral vector and a hybrid viral vector.

15. The delivery vector according to claim 12, characterized in that The viral vector is selected from adeno-associated viral vectors.

16. A method for constructing a hyperuricemia model animal, comprising the steps of: using the sequence of any one of claims 1-10 or the delivery vector of any one of claims 11-15 to reduce the expression of the uricase gene in a target animal, wherein the obtained animal with reduced uricase expression is the hyperuricemia model animal.

17. A shRNA that specifically reduces uricase gene expression, characterized in that The base sequence is shown in SEQ ID NO:

13.

18. The shRNA for specifically reducing uricase gene expression according to claim 17, characterized in that The target sequence is positions 108-128 of the uricase encoding gene, as shown in SEQ ID NO:

5.

19. The shRNA for specifically reducing uricase gene expression according to claim 17, characterized in that The shRNA is transcribed from the DNA oligonucleotide chain shown in SEQ ID NO: 21 or a plasmid containing the DNA oligonucleotide chain shown in SEQ ID NO:

21.

20. The shRNA for specifically reducing uricase gene expression according to claim 17, characterized in that The shRNA can be cleaved to form siRNA sense and antisense strands as shown in SEQ ID NO: 1 and SEQ ID NO:

9.

21. A DNA sequence corresponding to the shRNA according to claim 17, characterized in that The base sequence is shown in SEQ ID NO:

21.

22. A double-stranded DNA sequence formed by hybridization of the DNA sequence according to claim 21 and a reverse complementary sequence thereto.

23. A vector comprising the shRNA for specifically reducing uricase gene expression according to any one of claims 17 to 20 or the DNA sequence according to any one of claims 21 to 22.

24. Use of the shRNA for specifically reducing uricase gene expression according to any one of claims 17 to 20, or the DNA sequence according to any one of claims 21 to 22, or the vector comprising the shRNA or DNA sequence according to claim 23 in preparing a model animal for treating hyperuricemia.

25. A method for constructing a hyperuricemia model animal, comprising reducing uricase gene expression in a target animal using the shRNA that specifically reduces uricase gene expression according to any one of claims 17 to 20, the DNA sequence according to any one of claims 21 to 22, or the vector comprising the shRNA or DNA sequence according to claim 23, wherein the obtained animal with reduced uricase expression is a hyperuricemia model.

Images