Chimeric carrier

Abstract

A live chimeric non-human single-stranded retroviral vector is disclosed, which allows cells to express at least one protein from at least one human pathogen. In addition, according to embodiments of the present invention, a composition comprising the vector, a method and a kit for eliciting an immune response in a host, and a method for preparing the vector are disclosed.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This patent application claims the benefit of co-pending U.S. Provisional Patent Application No. 62 / 661,320, filed on April 23, 2018, which is incorporated herein by reference in its entirety.

[0003] STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH AND DEVELOPMENT

[0004] This invention was made with government support through the National Institute of Allergy and Infectious Diseases of the National Institutes of Health under Grant No. 1ZIA000372-33. The government has certain rights in this application.

[0005] Electronically Submitted Materials Incorporated by Reference

[0006] Incorporated herein by reference in its entirety is a computer-readable nucleotide / amino acid sequence listing filed concurrently with this document and identified as follows: a 153,440-byte ASCII (text) file named "742179_ST25.txt" and dated April 5, 2019. Background of the Invention

[0008] Human pathogens are a significant health problem. Despite ongoing research, there remains a need for improved methods of preventing and treating infection by pathogens, particularly from viruses such as human respiratory syncytial virus ("RSV").

[0009] Brief description of the invention

[0010] Embodiments of the present invention provide live chimeric non-human Mononegavirales vectors that allow cells to express at least one protein from at least one human pathogen.

[0011] Another embodiment of the present invention provides a composition comprising the vector of the present invention and a pharmaceutically acceptable carrier.

[0012] Another embodiment of the present invention provides a method of eliciting an immune response to at least one human pathogen, comprising administering to a human a non-human single-stranded retroviral vector of the present invention, or a composition of the present invention.

[0013] Another embodiment of the present invention provides a method for preparing a live, chimeric non-human single-stranded retroviral vector that allows a cell to express at least one protein from at least one human pathogen, the method comprising (a) inserting a non-native gene encoding at least one protein from at least one human pathogen into the non-human single-stranded retroviral vector.

[0014] Another embodiment of the present invention provides a kit for eliciting an immune response, the kit comprising (a) a composition of the present invention, and (b) at least one container for containing the composition.

[0015] Surprisingly, as discussed herein, the murine pneumovirus (MPV) genome is an ideal vector for providing host protection against non-MPV viruses, with several advantages over other types of vectors.

[0016] One advantage of the MPV genome is that it is relatively small (<15 kb) and can be easily manipulated by reverse genetics. Specifically, changes can be introduced into cloned cDNA of the viral genome by standard recombinant DNA methods, and the resulting modified virus can be recovered in transfected tissue culture cells. In particular, one or more additional genes expressing one or more heterologous antigens, such as protective antigens from heterologous pathogens, can be introduced into the MPV genome.

[0017] Another unexpected advantage of the MPV genome is that the non-natural inserts in the MPV genome are relatively stable during in vitro and in vivo replication. For example, the MPV vector into which the RSV F protein is inserted is very stable, and despite ongoing research, the inventors have not observed the deletion of the F protein sequence from the MPV genome. This is unexpected because sequences inserted in some types of vectors can be deleted after some (or several) replications. In addition, the inserted sequences in the vector usually accumulate point mutations during replication, silencing their expression; however, this only occurs occasionally in the MPV genome.

[0018] In addition, several features of MPV biology make it safe to use as a vector, especially in humans. For example, MPV is a pneumovirus that replicates in the superficial epithelial cells of the respiratory mucosa and is therefore not a highly invasive or systemic virus. In addition, MPV is a cytoplasmic RNA virus and does not integrate into or otherwise interfere with the host genome. The infection is acute, and there is no known long-term infection. In addition, this type of virus (non-segmented negative-strand RNA virus) has a very low incidence of recombination between viral genomes (Spann et al., J. Virol., 77: 11201-11211 (2003) (incorporated herein by reference in its entirety)).

[0019] In addition, MPV is likely naturally attenuated in humans by host range restriction, just as it is in non-human primates. Rodents are the natural hosts of MPV, and due to host range restriction, the virus is highly attenuated in non-human primates, and therefore presumably also highly attenuated in humans. Attenuation of paramyxoviruses or pneumoviruses by host range restriction is considered to be polygenic and stable, as exemplified by host range restriction of bovine parainfluenza virus type 3 in non-human primates and humans (Skiadopoulos et al., J. Virol., 77: 1141-1148 (2003) (incorporated herein by reference in its entirety)).

[0020] In addition, there is no evidence that MPV infects humans, and humans lack acquired immunity to the virus (Brock et al., J. Virol., 86:5829-5843 (2012) (incorporated herein by reference in its entirety)). Although there is 10-60% amino acid sequence identity between the proteins of MPV and RSV (the latter being the most closely related human pathogen to MPV), RSV-specific immunity cannot cross-neutralize MPV or cross-protect against MPV (tested in a mouse model). Therefore, it is expected that the use of MPV-based vectors of embodiments of the present invention in humans should not be limited by existing immunity, particularly immunity against RSV.

[0021] Another advantage is that MPV replicates in the respiratory mucosa and induces local immunity in the respiratory tract as well as systemic immunity. Therefore, MPV vectors are expected to be particularly effective against respiratory pathogens.

[0022] Brief description of several views in the accompanying drawings

[0023] Figure 1 Figures of rMPV antigenomes containing RSV F genes added as extra genes at the first (F1), third (F3) or fourth (F4) gene positions are described. The MPV gene is shown as an unfilled rectangle, and the RSV F gene is shown as a shaded rectangle. The MPV gene start ("GS") and gene termination ("GE") transcription signals are represented by unfilled and filled bars, respectively, and each gene including the extra RSV F gene is present on the side. The nucleotide sequence of RSV F ORF is shown on the side under each gene map, and the following features are identified: RSV F ORF (represented by a shaded box), GS and GE transcription signals (shown in bold), intergenic region ("IG"), and "Kozak" sequence (shown with double underscores, SEQ ID NO:63) to promote efficient translation is presented upstream of RSV F ORF.

[0024] Figure 2Described are the results of a double staining plaque assay, which illustrates the stability of the rMPV vector expressing RSV F. Briefly, Vero cells were inoculated with serial dilutions of the P1 virus stock and incubated for 4 days under a 0.8% methylcellulose cover. The monolayer was fixed and RSV F and MPV antigens were detected using specific antibodies followed by corresponding infrared dye-conjugated secondary antibodies. RSV F and MPV antigens appear green and red, respectively, and appear yellow when merged. One image representing the results from four independent experiments was selected. In the upper row of plates labeled "MPV Antigen", grayscale indicates red. In the middle plate labeled "RSV F", grayscale indicates green. In the bottom row of plates labeled "Merged", in the plates in the "RMPV-F1", "RMPV-F4" and "RMPV-F3" columns, grayscale indicates yellow. In the bottom row of plates labeled "Merged", in the plates in the "rMPV-Empty Vector" column, grayscale indicates red.

[0025] Figure 3 Depicted are multi-cycle growth kinetics of rMPV-RSV-F vectors in human A549 lung epithelial cells. Replicate cultures of A549 cells were infected with rMPV-F1 (dashed line with triangles), rMPV-F3 (dashed line with open circles), rMPV-F4 (solid line with Xs), or rMPV-empty vector (solid line with solid black circles) at a multiplicity of infection ("MOI") of 0.1 plaque forming units ("PFU", a measure of the number of infectious viral particles) / cell. At 24 hour intervals, both cultures / viruses / cell lines were harvested by scraping and vortexing, and clear supernatants were prepared and flash frozen. Viral titers were subsequently determined in duplicate by plaque assay. Days post infection are on the x-axis, log 10 PFU / ml is on the y-axis. Data are shown as mean and standard error of the mean, although in many cases the error bars are obscured by symbols to account for the small margin of error. The limit of detection is 0.7 log 10 PFU / mL (dashed line).

[0026] Figure 4 Describes the multi-cycle growth kinetics of rMPV-RSV-F vectors in Vero cells. Replicate cultures of Vero cells were infected with rMPV-F1 (dashed line with triangles), rMPV-F3 (dashed line with open circles), rMPV-F4 (solid line with Xs), or rMPV-empty vector (solid line with solid black circles) at an MOI of 0.1 PFU / cell. At 24 hour intervals, two cultures / viruses / cell lines were harvested by scraping and vortexing, and clear supernatants were prepared and flash frozen. Virus titers were subsequently determined in duplicate by plaque assay. Days post infection are on the x-axis, log 10PFU / ml is on the y-axis. Data are shown as mean and standard error of the mean, although in many cases the error bars are obscured by symbols to account for the small margin of error. The limit of detection is 0.7 log 10 PFU / mL (dashed line).

[0027] Figure 5 Cytopathic effects when Vero cells are infected with rMPV-RSV-F vectors are described. Vero cell monolayers were infected with the indicated rMPV-RSV-F vectors, empty vector, or wt rRSV at an MOI of 10 PFU / cell or mock infected. The cultures were incubated at 32°C for 96 hours and light microscopy was performed at 200X magnification. The images shown are representative of two independent experiments. Mock-infected and rMPV-empty vector-infected cells did not show any signs of infection, while wt RSV, rMPV-F1, rMPV-F3, and rMPV-F4-infected cells showed clear signs of viral infection.

[0028] Figure 6 Describes the results of Western blots used to evaluate the expression of RSV F protein and rMPV protein in infected cells. 96 hours post-inoculation ("hpi"), using Figure 5 Cell lysates were prepared from infected cells for the experiments shown in . Denatured and reduced lysates were subjected to Western blot analysis. Figure 6 As shown, rMPV-F1, rMPV-F3 and rMPV-F4 (lanes 1, 2 and 3) all contain RSV F protein (whereas rMPV-empty vector [lane 4] and wt rMPV [lane 5] do not contain RSV F protein).

[0029] Figure 7 Figure 3 shows the level of RSV F protein expression in infected cells. RSV F protein was detected using a mouse monoclonal antibody. Quantification of protein bands from Figure 6 Western blot analysis is shown and is representative of three independent experiments. Relative RSV F protein expression is on the y-axis and vectors are listed on the x-axis. Standard errors are shown. Figure 7 As shown, rMPV-F1, rMPV-F3, rMPV-F4 and wt rRSV all expressed high levels of RSV F protein.

[0030] Figure 8The levels of rMPV G, N, P, F, NS1, and NS2 protein expression in infected cells are depicted. MPV G, N, and P proteins were detected using hyperimmune sera raised against sucrose gradient purified rMPV virions. MPV F protein was detected using rabbit polyclonal antiserum raised against a recombinant vaccinia virus expressing only MPV F protein. MPV NS1 and NS2 proteins were detected using separate rabbit hyperimmune sera raised against synthetic peptides derived from the respective proteins. Tubulin was probed as a loading control and used to normalize each sample. Quantification of protein bands is from Figure 5 The same experiment shown is representative of three independent experiments. The relative expression of each protein is shown on the y-axis and the vector is listed on the x-axis. The standard error is shown. Asterisks indicate statistical significance (p value less than 0.05). Figure 8 Infected cells expressed each of the proteins tested as indicated. DETAILED DESCRIPTION OF THE INVENTION

[0032] Embodiments of the present invention provide live chimeric non-human single-stranded retroviral vectors that allow cells to express at least one protein from at least one human pathogen.

[0033] Carrier

[0034] As used herein, a "chimeric" vector is a vector that contains non-native genetic information. For example, a non-human single-stranded retroviral vector that contains genetic information or material from a human pathogen (e.g., a rodent vector that contains genetic information or material from a human pathogen or an MPV vector that contains genetic information from RSV).

[0035] As used herein, a "non-human serovar vector" is a serovar vector whose natural host is not human.

[0036] The vectors described herein are attenuated when provided to humans. Attenuated vectors are capable of replicating in vivo but have low or no toxicity in human hosts. Vector attenuation may be due to any of a variety of factors that may reduce vector replication and / or toxicity, including but not limited to infection with non-natural hosts (host range restriction), the presence of one or more amino acid and / or nucleotide substitutions, the addition of heterologous genes, or the removal of part or all of the vector genes. For example, MPV vectors are attenuated in humans in part due to host range restriction.

[0037] Non-human single stranded retroviral vector

[0038] The non-human Monoclonal virus vector of the present invention can be from any member of the Monoclonal virus order, as long as the natural host of the virus is a non-human animal. In an embodiment, the natural host of the virus is a non-human animal. Preferably, the natural host of the virus is a non-human mammal. Preferably, the natural host of the virus is in the order Rodentia. Preferably, the natural host of the virus is in the family Muridae. Preferably, the natural host of the virus is in the subfamily Murinae. Preferably, the natural host of the virus is a mouse.

[0039] The virus is a member of the order SSRV, if its genome is linear, usually non-segmented, single-stranded, non-infectious, negative polarity RNA, which in infected cells and virions is tightly enclosed in a nucleocapsid; has reverse complementary 3' and 5' ends; is not covalently linked to proteins; its genome has a characteristic gene order 3'-UTR-core protein gene-envelope protein gene-RNA-dependent RNA polymerase gene-5'-UTR (3'-NPMGL-5'); it produces 5-10 different mRNAs from its genome via polar sequential transcription from a single promoter located at the 3' end of the genome; the mRNA is 5' capped and polyadenylated; it replicates by synthesizing a complete positive-sense copy of the genome (called the antigenome); it forms an infectious helical ribonucleocapsid as a template for the synthesis of mRNA, antigenome and genome; it encodes an RNA-dependent RNA polymerase (RdRp, L); and / or it usually produces enveloped virions.

[0040] Non-human single-stranded retroviridae vectors can be from the families Pneumoviridae, Bornaviridae, Filoviridae, Paramyxovirdae, Rhabdoviridae, and those not currently assigned to a family.

[0041] In an embodiment, the non-human single stranded retroviral vector is from the Pneumoviridae family. Non-human single stranded retroviral vectors from the Pneumoviridae family can include those from the genus Metapneumovirus, such as avian metapneumovirus species. Avian metapneumovirus species include avian metapneumovirus ("AMPV").

[0042] Non-human single-stranded retrovirales vectors from the Pneumoviridae family can also include those from the genus Orthopneumovirus, such as bovine orthopneumovirus species and murine orthopneumovirus species. Bovine orthopneumovirus species include bovine respiratory syncytial virus ("BRSV"). Murine orthopneumovirus species include murine pneumonia virus ("MPV", also previously known as mouse pneumonia virus, PVM). Preferably, the non-human vector of the present embodiments is MPV.

[0043] Non-human monoviridae vectors from the family Bornaviridae can include those from the genus Bornavirus, for example, the following species: Elapid 1 bonavirus, Mammalian 1 bonavirus, Mammalian 2 bonavirus, Passeriform 1 bonavirus, Passeriform 2 bonavirus, Psittaciform 1 bornavirus, Psittaciform 2 bornavirus, and Waterbird 1 bornavirus.

[0044] Non-human single-stranded retroviridae vectors from the Filoviridae family may include the species Lloviu cuevavirus from the genus Cuevairus.

[0045] Non-human single-stranded retrovirales vectors from the family Paramyxoviridae can include those from the genus Avulavirus, such as Avian Avulavirus 1-Avian Avulavirus 13; those from the genus Henipavirus, such as Cedar henipavirus species, Ghanaian bat henipavirus species, Hendrahenipavirus species, Mojiang henipavirus species, and Nipah heniparus species (e.g., Nipah virus); those from the genus Morbillivirus; those from the genus Rubulavirus, such as the species Achimoto mumps virus 1, Achimoto mumps virus 2, Batmumps rubulavirus, Canine mumps virus; rubulavirus, Mapuera rubulavirus, Menangly mumps virus, Porcine rubulavirus, Simian rubulavirus, Sosuga mumps virus, Teviot mumps virus, Tioman rubulavirus, Tuhoko mumps virus 1, Tuhoko mumps virus 2, Tuhoko mumps virus 3, and parainfluenza virus 5.

[0046] Non-human single-stranded retroviral vectors from the family Rhabdoviridae can include those from the genus Ephemerovirus, such as Bovine fever ephemerovirus; those from the genus Hapavirus; those from the genus Ledantevirus; and those from the genus Lyssavirus, such as European bat 1 lyssavirus, European bat 2 lyssavirus, Lagos bat lyssavirus, Rabieslyssavirus, Shimoni bat lyssavirus, and West Caucasian bat lyssavirus.

[0047] In addition, the vectors of the present invention may be derived from a virus of the order single-stranded retroviridae currently unknown to those skilled in the art (ie, those that exist in nature but have not yet been discovered or those that have not yet been produced by natural or artificial methods).

[0048] In embodiments, the non-human single-stranded retroviral vector is a paramyxovirus Sendai virus, and the human pathogen is not Ebola virus or respiratory syncytial virus. In embodiments, the human pathogen is Ebola virus or respiratory syncytial virus, and the non-human single-stranded retroviral vector is not a paramyxovirus Sendai virus.

[0049] In one embodiment, the non-human single-stranded retroviral vector is a paramyxovirus parainfluenza virus 5, and the human pathogen is not RSV, influenza virus, or rabies virus. In one embodiment, the human pathogen is RSV, influenza virus, or rabies virus, and the non-human single-stranded retroviral vector is not a paramyxovirus parainfluenza virus 5.

[0050] In embodiments, the non-human single-stranded retroviral vector is a rhabdovirus vesicular stomatitis virus ("VSV"), and the human pathogen is not Ebola virus or Marburg virus. In embodiments, the human pathogen is Ebola virus or Marburg virus, and the non-human single-stranded retroviral vector is not a paramyxovirus rhabdovirus vesicular stomatitis virus.

[0051] In embodiments, the non-human single stranded retroviral vector is Newcastle disease virus, and the human pathogen is not influenza virus. In embodiments, the human pathogen is influenza virus, and the non-human single stranded retroviral vector is not Newcastle disease virus.

[0052] In an embodiment, the non-human single-stranded retroviral vector is from the Pneumoviridae family. Preferably, the non-human single-stranded retroviral vector is from the genus Murine Orthopneumovirus. Preferably, the non-human single-stranded retroviral vector is MPV.

[0053] Preferably, the non-human single stranded retroviral vector is a vector that infects the respiratory tract. Preferably, the non-human single stranded retroviral vector is from the Pneumoviridae family and infects the respiratory tract.

[0054] In an embodiment, the non-human single-stranded retroviral vector is derived from wild-type MPV (GenBank Accession No. AY729016). In an embodiment, mutations can be introduced into the MPV coding sequence of the reverse genetics system to generate unique restriction enzyme sites for cloning (see Krempl et al., J. Virol., 81(17):9490-501(2007) (incorporated herein by reference in its entirety)). In an embodiment, the restriction enzyme sites can include AgeI and BstBI at genomic nucleotide positions 4509 and 8461, respectively. In an embodiment, the L polymerase ORF can be partially modified by codon pair optimization, with the aim of increasing the expression of the L protein.

[0055] In an embodiment, the MPV vector has a genomic promoter that is at least 85% (i.e., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identical to ACGCGAAAAAATGCATAACAAAACTATCAACCTGAAAAAAGTT (SEQ ID NO: 1).

[0056] In an embodiment, the MPV vector has an antigenomic promoter that is at least 85% (i.e., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identical to TTGATATCTCACAGGTTGTAAACATAGTTCTTTTATAATTATTGTTAGTTAAACTATTGTGTTTGACTTCCTTTGGGTATTTTTTTCCCGT (SEQ ID NO:2).

[0057] In an embodiment, the intergenic regions between the SH and G genes and between the M2 and L genes can be modified by introducing unique restriction enzyme sites (e.g., AgeI and BstBI) as shown above to produce a reverse genetics system, and the modified sequences are shown for these regions as shown in Table 1 below.

[0058] Table 1. MPV transcription signals

[0059]

[0060] In an embodiment, the MPV vector has a transcription signal that is at least 95% (i.e., 96%, 97%, 98%, 99% or 100%) identical to SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30 and / or SEQ ID NO:31.

[0061] In an embodiment, the MPV vector comprises a nucleotide sequence encoding (listed in 3' to 5' gene order): nonstructural protein 1 ("NS1"), nonstructural protein 2 ("NS2"), nucleoprotein ("N protein"), phosphoprotein ("P protein"), matrix protein ("M protein"), small hydrophobic protein ("SH protein"), attachment protein (G protein), fusion protein (F protein), M2-1 and M2-2 proteins, and polymerase protein ("L protein").

[0062] In embodiments, the MPV vector has a sequence of NS1 that is at least 85% (i.e., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identical to SEQ ID NO:32 (e.g., GenBank Accession No. AY729016).

[0063] In embodiments, the MPV vector allows cells to produce a protein NS1 that is at least 85% (i.e., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to SEQ ID NO:33.

[0064] In embodiments, the MPV vector has a sequence of NS2 that is at least 85% (i.e., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to SEQ ID NO:34 (e.g., GenBank Accession No. AY729016).

[0065] In an embodiment, the MPV vector allows cells to produce a protein NS2 that is at least 85% (i.e., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to SEQ ID NO:35.

[0066] In embodiments, the MPV vector has a sequence of N that is at least 85% (i.e., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to SEQ ID NO:36.

[0067] In embodiments, the MPV vector allows cells to produce a protein N that is at least 85% (i.e., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to SEQ ID NO:37.

[0068] In embodiments, the MPV vector has a sequence of P that is at least 85% (i.e., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to SEQ ID NO:38.

[0069] In embodiments, the MPV vector allows cells to produce a protein P that is at least 85% (i.e., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to SEQ ID NO:39.

[0070] In embodiments, the MPV vector has a sequence of M that is at least 85% (i.e., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to SEQ ID NO:40.

[0071] In embodiments, the MPV vector allows cells to produce a protein M that is at least 85% (i.e., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to SEQ ID NO:41.

[0072] In an embodiment, the MPV vector has a sequence of SH that is at least 85% (i.e., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to SEQ ID NO:42.

[0073] In an embodiment, the MPV vector allows cells to produce a protein SH that is at least 85% (i.e., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to SEQ ID NO:43.

[0074] In embodiments, the MPV vector has a sequence of G that is at least 85% (i.e., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to SEQ ID NO:44.

[0075] In embodiments, the MPV vector allows cells to produce protein G that is at least 85% (i.e., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identical to SEQ ID NO:45.

[0076] In embodiments, the MPV vector has a sequence of F that is at least 85% (i.e., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to SEQ ID NO:46.

[0077] In embodiments, the MPV vector allows cells to produce an F protein that is at least 85% (i.e., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identical to SEQ ID NO:47.

[0078] In embodiments, the MPV vector has a sequence of M2-1 that is at least 85% (i.e., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identical to SEQ ID NO:48.

[0079] In embodiments, the MPV vector allows cells to produce a protein M2-1 that is at least 85% (i.e., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to SEQ ID NO:49.

[0080] In embodiments, the MPV vector has a sequence of M2-2 that is at least 85% (i.e., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identical to SEQ ID NO:50.

[0081] In embodiments, the MPV vector allows cells to produce protein M2-2 that is at least 85% (i.e., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to SEQ ID NO:51.

[0082] In embodiments, the MPV vector has a codon pair optimized sequence of L that is at least 85% (i.e., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to SEQ ID NO:52.

[0083] In embodiments, the MPV vector allows cells to produce a protein L that is at least 85% (i.e., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to SEQ ID NO:53.

[0084] In some embodiments, the "Kozak" sequence (GCCGCCACC (SEQ ID NO: 63)) is upstream of the AUG start codon. The "Kozak" sequence can provide an effective environment for translation initiation. Other sequences are known to those skilled in the art and can be used to improve translation efficiency.

[0085] Human pathogens

[0086] The vectors of the present invention can express proteins from any human pathogen. As used herein, "human pathogen" is a pathogen that can cause infection in humans. Human pathogens can include viruses, bacteria, protozoa, prions and fungi.

[0087] Pathogenic bacteria include those from the following species: Actinomyces israelii, Bacillus anthracis, Bacteroides fragilis, Bordetella pertussis, Borrelia, Brucella, Campylobacter jejuni, Chlamydia, Chlamydophilapsittaci, Clostridium, Corynebacterium diphtheriae, Ehrlichia, Enterococcus, Escherichia, Francisella tularensis, Haemophilus influenzae, Helicobacter pylori, Klebsiella pneumoniae, Legionella pneumophila, pneumophila, Leptospira, Listeria monocytogenes, Mycobacterium, Mycoplasma pneumoniae, Neisseria, Pseudomonas aeruginosa, Nocardia asteroides, Rickettsia rickettsii, Salmonella, Shigella, Staphylococcus, Streptococcus, Treponema pallidum, Vibrio cholerae, and Yersinia pestis.

[0088] Pathogenic fungi include those from the following species: Candida, Aspergillus, Cryptococcus, Histoplasma, Pneumocystis, and Stachybotrys.

[0089] Pathogenic protozoa include those that cause malaria (caused by Plasmodium), amebiasis, giardiasis, toxoplasmosis, cryptosporidiosis, trichomoniasis, Chagas disease, leishmaniasis, African trypanosomiasis, amoebic dysentery, Acanthamoeba keratitis, and primary amebic meningoencephalitis (Nagismiasis).

[0090] Pathogenic prions include those that cause the following diseases: Creutzfeldt-Jakob disease, iatrogenic Creutzfeldt-Jakob disease, variant Creutzfeldt-Jakob disease, familial Creutzfeldt-Jakob disease, sporadic Creutzfeldt-Jakob disease, Gerstmann– – Scheinker syndrome, fatal familial insomnia, kuru, familial spongiform encephalopathy, and multiple system atrophy.

[0091] Pathogenic viruses include those from the following families (or orders): Paramyxoviridae, which includes human parainfluenza virus serotypes 1, 2, and 3 (HPIV1, 2, 3) and measles virus; Henipaviridae family, which includes Hendra virus and Nipah virus; Orthomyxoviridae, which includes avian influenza A virus; Coronaviridae, which includes severe acute respiratory syndrome (SARS), coronavirus, and Middle East respiratory syndrome (MERS) coronavirus; Filoviridae, which includes Ebola virus and Marburg virus; Arenaviridae, which includes Lassa virus; Bunyavirales order (formerly known as Bunyaviridae), which includes Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, and Hantavirus; Flaviviridae and Togaviridae, which include West Nile virus, dengue virus, Zika virus, and chikungunya virus; and Pneumoviridae, which includes human respiratory syncytial virus (RSV) and human metapneumovirus.

[0092] Preferably, the human pathogen is a virus. Preferably, the human pathogen is a virus of the family Pneumoviridae.

[0093] Preferably, the human pathogen is RSV. RSV is an enveloped single-stranded negative-sense RNA virus. RSV has 10 genes encoding 11 proteins. Fusion F ("F protein") and attachment G ("G protein") surface glycoproteins are two viral neutralizing antigens and are the main protective antigens. RSV F is a type I transmembrane envelope glycoprotein that mediates the fusion of the virion envelope with the host cell membrane during entry.

[0094] Proteins from human pathogens

[0095] The at least one protein from at least one human pathogen expressed by cells infected by the vectors of the present invention may include any protein that allows the host to mount an immune response to the human pathogen.

[0096] In an embodiment, the protein is a fusion protein (F) and a hemagglutinin (H) or hemagglutinin-neuraminidase (HN) protein of the Paramyxoviridae family, as exemplified by human parainfluenza virus serotypes 1, 2, and 3 (HPIV1, 2, 3) and measles virus.

[0097] In an embodiment, the proteins are the fusion (F) and attachment (G) proteins of the family Henipaviridae, as exemplified by Hendra virus and Nipah virus.

[0098] In an embodiment, the proteins are the hemagglutinin (HA) and neuraminidase (NA) proteins of the Orthomyxoviridae family, as exemplified by the highly pathogenic avian influenza A virus.

[0099] In an embodiment, the protein is a spike (S) protein of the Coronaviridae family, as exemplified by the Severe Acute Respiratory Syndrome (SARS) coronavirus and the Middle East Respiratory Syndrome (MERS) coronavirus.

[0100] In an embodiment, the protein is a GP protein of a member of the Filoviridae family, as exemplified by Ebola virus and Marburg virus.

[0101] In embodiments, the proteins are the GP1 and GP2 proteins (expressed as precursor GPC) of the Arenaviridae family, as exemplified by Lassa virus.

[0102] In an embodiment, the proteins are the Gn (GP1) and Gc (GP2) proteins of members of the Bunyavirales (formerly known as Bunyaviridae), as exemplified by Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, and Hantavirus.

[0103] In an embodiment, the protein is a glycoprotein species of a member of the Flaviviridae and Togaviridae families, as exemplified by West Nile virus, Dengue virus, Zika virus, and Chikungunya virus.

[0104] Preferably, the protein is a fusion protein (F) or glycoprotein (G) of the Pneumoviridae family, as exemplified by respiratory syncytial virus (RSV) and metapneumovirus (MPV).

[0105] Fusion protein (F) of Pneumoviridae

[0106] There are two wild types of the protein (A and B, or A1 and B2) and many natural variants thereof. In addition, the open reading frame of the nucleotide sequence can be modified by codon optimization to enhance the expression of the protein. In addition, the nucleotide sequence can be modified to contain two HEK amino acid distributions identical to those present in the wild type (66E and 101P, see SEQ ID NO: 54). Moreover, the sequence can have mutations, deletions and insertions, as long as they do not significantly affect the ability of the expressed protein to elicit a desired immune response.

[0107] In embodiments, the non-human single-stranded retroviral vector has a sequence of an F protein (from RSV A2) that is at least 85% (i.e., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to SEQ ID NO:54.

[0108] In embodiments, the non-human single-stranded retroviral vector allows cells to produce an F protein (from RSV A2) that is at least 85% (i.e., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to SEQ ID NO:55.

[0109] In embodiments, the non-human single-stranded retroviral vector has a sequence of an F protein (from RSV A2) that is at least 85% (i.e., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to SEQ ID NO:56.

[0110] In embodiments, the non-human single-stranded retroviral vector allows cells to produce an F protein (from RSV A2) that is at least 85% (i.e., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to SEQ ID NO:57.

[0111] In an embodiment, the non-human single-stranded retroviral vector has a sequence of an F protein (from RSV B1) that is at least 85% (i.e., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to SEQ ID NO:58.

[0112] In embodiments, the non-human single-stranded retroviral vector allows cells to produce an F protein (from RSV B1) that is at least 85% (i.e., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to SEQ ID NO:59.

[0113] Preferably, RSV F protein is maintained in its pre-fusion form, which allows enhanced immune response compared to the fusion form. By introducing a mutation or cavity filling mutation that causes disulfide bond formation in its globular head, RSV F protein can be stabilized in a pre-fusion form. Stable RSV F protein is unlikely to unfold (especially required when it contacts a host cell) (see McLellan et al., Science, 340: 1113-1117 (2013); McLellan et al., Science, 342: 592-598 (2013); and Joyce et al., Nature Structural and Molecular Biology, doi: 10.1038 / nsmb.3267 (2016); each of which is incorporated herein by reference in its entirety).

[0114] In an embodiment, the non-human single stranded retroviridae vector is an MPV vector and allows cells to express the F protein (of the Pneumoviridae family). The sequence encoding the F protein can be in any suitable position in the MPV vector genome so that the F protein is expressed, and provided that it does not disrupt the vector genes. For example, the sequence encoding the F protein can be as follows Figure 1 The sequence encoding the F protein should be flanked by a vector gene start sequence and a gene end sequence. There may be some or up to 200 nucleotides on either side of the open reading frame. Preferably, there are about 10-20 nucleotides before the sequence encoding the F protein begins to allow ribosome loading, thereby effectively expressing the protein.

[0115] In an embodiment, the non-human single-stranded retroviridae vector is an MPV vector, allows cells to express the F protein (of the Pneumoviridae family), and comprises a sequence that is at least 85% (i.e., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to SEQ ID NO:60 (rMPV-F1).

[0116] In an embodiment, the non-human single-stranded retroviridae vector is an MPV vector, allows cells to express the F protein (of the Pneumoviridae family), and comprises a sequence that is at least 85% (i.e., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to SEQ ID NO:61 (rMPV-F3).

[0117] In an embodiment, the non-human single-stranded retroviridae vector is an MPV vector, allows cells to express the F protein (of the Pneumoviridae family), and comprises a sequence that is at least 85% (i.e., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to SEQ ID NO:62 (rMPV-F4).

[0118] In embodiments, the cell expressing at least one protein from at least one human pathogen is a human cell.

[0119] Carrier composition

[0120] Embodiments of the present invention provide compositions comprising a vector of embodiments of the present invention and a pharmaceutically acceptable carrier.

[0121] The composition may be suitable for administration to a subject in need. In an embodiment, the carrier composition is suitable for administration to a mammal. In an embodiment, the carrier is substantially free of endotoxins or exotoxins. Endotoxins may include pyrogens, such as lipopolysaccharide ("LPS") molecules. The carrier may also be substantially free of inactive protein fragments that may cause fever or other side effects. In an embodiment, the composition contains less than about 1%, less than about 0.1%, less than about 0.01%, less than about 0.001% or less than about 0.0001% of endotoxins, exotoxins and / or inactive protein fragments. In some embodiments, the carrier composition has a lower level of pyrogens than industrial water, tap water or distilled water. Other carrier composition components may be purified using methods known in the art, such as ion exchange chromatography, ultrafiltration or distillation. In other embodiments, pyrogens may be inactivated or destroyed before administration to a patient. The raw materials of the carrier composition, such as water, buffer, salts and other chemicals may also be screened and depyrogens. All materials in the carrier composition may be sterile, and the sterility of each batch of carrier composition may be tested.

[0122] In embodiments, the carrier composition comprises less than about 50%, less than about 20%, less than about 10% or less than about 5% (by dry weight) of contaminating proteins. In embodiments, the polysaccharide capsule protein is present in the absence of other biomacromolecules, such as other proteins (particularly other proteins that can substantially mask, reduce, confuse or change the characteristics of the component proteins as purified preparations or in the subject reconstituted mixture). In some embodiments, relative to the amount of purified subunits, the carrier composition comprising the purified subunit protein contains less than about 5%, less than about 2%, less than about 1%, less than about 0.5%, less than about 0.2%, less than about 0.1% of proteins from the host cell expressing the subunit protein.

[0123] In some embodiments, the vector has low or no toxicity to the host. In certain embodiments, the vector composition comprises a concentration less than the LD50 of the vaccinated animal. 50 Components of the measured value. LD 50 The measured values ​​can be obtained in mice or other experimental model systems and extrapolated to humans and other animals. It is used to estimate the LD50 of compounds in humans and other animals. 50 Methods of administering the drug are well known in the art. The carrier composition may contain any component therein and may have an LD50 value in rats of greater than about 100 g / kg, greater than about 50 g / kg, greater than about 20 g / kg, greater than about 10 g / kg, greater than about 5 g / kg, greater than about 2 g / kg, greater than about 1 g / kg, greater than about 500 mg / kg, greater than about 200 mg / kg, greater than about 100 mg / kg, greater than about 50 mg / kg, greater than about 20 mg / kg, or greater than about 10 mg / kg.

[0124] Compositions suitable for incorporation into carriers vary depending on the route of administration. Compositions suitable for intranasal administration, such as, for example, aerosol solutions (e.g., they can be "nebulized") and drop solutions, both of which can include sugars, suspending agents, solubilizers, thickeners, stabilizers, salt buffers, and preservatives.

[0125] In an embodiment, the composition comprising the vector of the present embodiments comprises a monosaccharide and / or a disaccharide. In another embodiment, the composition comprising the vector of the present embodiments comprises glucose, sucrose and / or fructose as sugar.

[0126] In an embodiment, the composition comprising the carrier of the embodiments of the present invention comprises a pharmaceutically acceptable buffer sufficient to adjust and maintain the pH of the composition of the embodiments at about 4.0 to about 8.0, preferably about 5.5 to about 7.0. Suitable buffers may include citrate, phosphate and glycine.

[0127] The carrier alone or in combination with other suitable components can be formulated into an aerosol formulation for administration via inhalation. The aerosol formulation can be placed in a pressurized acceptable propellant, such as dichlorodifluoromethane, propane, nitrogen, etc. The aerosol formulation can be delivered to the nasal passage or mouth.

[0128] Compositions suitable for parenteral administration, such as, for example, by intraarticular (in a joint), intravenous, intramuscular, intradermal, intraperitoneal, intranasal and subcutaneous routes, include aqueous and non-aqueous isotonic sterile injection solutions, which may contain antioxidants, buffers, bacteriostats and solutes that make the formulation isotonic with the blood of the intended recipient; and general aqueous and non-aqueous sterile suspensions, which may contain suspending agents, solubilizers, thickeners, stabilizers and preservatives. The composition may be present in unit dose or multi-dose sealed containers, such as ampoules and vials.

[0129] Solutions and suspensions for injection can be prepared from sterile powders, granules and tablets. Compositions suitable for oral administration can be composed of: (a) liquid solutions, such as an effective amount of polysaccharide capsules suspended in diluents (such as water, saline or PEG400); (b) capsules, sachets or tablets, each containing a predetermined amount of active ingredients in liquid, solid, granules or gelatin; (c) suspensions in appropriate liquids; and (d) suitable emulsions. Tablet forms can contain lactose, sucrose, mannitol, sorbitol, calcium phosphate, corn starch, potato starch, tragacanth, microcrystalline cellulose, gum arabic, gelatin, colloidal silicon dioxide, cross-linked sodium carboxymethylcellulose, talc, magnesium stearate, stearic acid and other excipients, colorants, fillers, binders, diluents, buffers, wetting agents, preservatives, flavorings, dyes, disintegrants and pharmaceutically compatible carriers One or more. Lozenge forms may comprise the carrier in a flavoring agent, usually sucrose and acacia or tragacanth, as well as lozenges comprising the carrier in an inert matrix such as gelatin and glycerin or sucrose and acacia emulsions, gels, etc., in addition to the carriers known in the art. The carrier composition may be encapsulated, for example, in liposomes, or in a composition that provides for slow release of the carrier.

[0130] Vector administration

[0131] The carrier according to the embodiments of the present invention can be delivered to an individual by administration, usually by systemic administration (e.g., intranasal route, intravenous route, intraperitoneal route, intramuscular route, intradermal route, subcutaneous route, subdermal route, transdermal route, intracranial route, mucosal route, anal route, vaginal route, oral route, buccal route or they can be inhaled), or they can be applied by topical application. In embodiments, the route of administration is intranasal (e.g., nasal spray or drops). In embodiments, the route of administration is intramuscular. In other embodiments, the route of administration is subcutaneous. In other embodiments, the route of administration is mucosal. In certain embodiments, the route of administration is transdermal or intradermal.

[0132] Methods for eliciting an immune response

[0133] Embodiments of the present invention provide methods for eliciting an immune response to at least one human pathogen, comprising administering a non-human single-stranded retroviral vector of an embodiment of the present invention, or a composition comprising a non-human single-stranded retroviral vector of an embodiment of the present invention to a human.

[0134] Embodiments of the present invention provide methods for eliciting an immune response to at least one human pathogen, comprising administering a non-human single-stranded retroviral vector of an embodiment of the present invention, or a composition comprising a non-human single-stranded retroviral vector of an embodiment of the present invention to a human, wherein at the time of administration, the human is not suffering from a Pneumoviridae virus infection. In this case, a vector of an embodiment of the present invention or a composition comprising a vector of an embodiment of the present invention is administered to a human to induce an immune response, which can, for example, help prevent the establishment of a human Pneumoviridae virus by preventing infection (the first and necessary step in the disease). Therefore, in some aspects, the method inhibits infection of uninfected humans with the human Pneumoviridae family. On the other hand, the method can reduce the duration of infection in an already infected human.

[0135] In certain embodiments, the vector or a composition containing the vector of the present invention confers protective immunity, allowing the vaccinated individual to exhibit a delayed onset of symptoms or sequelae, or to reduce the severity of symptoms or sequelae, as a result of his or her exposure to the vector. In a specific embodiment, the vaccinated individual may not exhibit symptoms or sequelae when in contact with the human pneumovirus family, may not be infected by the human pneumovirus family, or both. Protective immunity is generally achieved through one or more of the following mechanisms: mucosal, humoral or cellular immunity. Mucosal immunity is primarily the result of secretory IgA (sIGA) antibodies on the mucosal surfaces of the respiratory, gastrointestinal and urogenital tracts. sIGA antibodies are produced after a series of events mediated by antigen-processing cells, B lymphocytes and T lymphocytes, which result in B lymphocytes producing sIGA on the mucosa-lined tissues of the body. Humoral immunity is generally the result of IgG antibodies and IgM antibodies in the serum. Cellular immunity can be achieved without antibodies by cytotoxic T lymphocytes or by delayed-type hypersensitivity reactions involving dendritic cells, macrophages and T lymphocytes, as well as other mechanisms involving T cells. H1 or T H17 Cell mediated.

[0136] dose

[0137] The dosage of the vector of the present invention or the dosage of the composition comprising the vector of the present invention is an effective amount, which induces the preventive response as described above in a single dose or multiple doses. Preferably, the dosage is selected to minimize adverse side effects. Such an amount will vary depending on the specific vector used. In some embodiments, the dosage comprises about 10 8.0 In some embodiments, a dose of the composition comprises about 10 7.0 In some embodiments, a single dose of the composition comprises about 10 6.0 In some embodiments, a single dose of the composition comprises about 10 5.0 In some embodiments, a single dose of the composition comprises about 10 4.0 In some embodiments, a single dose of the composition comprises about 10 3.0 In some embodiments, a single dose of the composition comprises about 10 2.0 Infectious units (PFU) of vector particles. In some embodiments, a single dose of the composition comprises about 10 or even fewer infectious units (PFU) of vector particles.

[0138] In some embodiments, a dose comprises about 10 8.0 Infectious units (50% tissue culture infectious units, TCID 50 ) carrier particles. In some embodiments, the dosage of the composition comprises about 10 7.0 Infectious Unit (TCID 50 ) carrier particles. In some embodiments, a single dose of the composition comprises about 10 6.0 In some embodiments, a single dose of the composition comprises about 10 5.0 (TCID 50 ) infectious units of vector particles. In some embodiments, a single dose of the composition comprises about 10 4.0 (TCID 50 ) infectious units of vector particles. In some embodiments, a single dose of the composition comprises about 10 3.0 (TCID 50 ) infectious units of vector particles. In some embodiments, a single dose of the composition comprises about 10 2.0 (TCID 50 ) infectious units of vector particles. In some embodiments, a single dose of the composition comprises about 10 or even fewer infectious units (TCID 50 ) carrier particles.

[0139] The appropriate amount of vector to be delivered will depend on the age, weight and health (eg, immunocompromised state) of the subject. When present, the adjuvant is typically present in an amount of 1-250 μg, such as 50-150 μg, 75-125 μg, or 100 μg per dose.

[0140] In embodiments, a dose of a vector of an embodiment of the present invention or a composition comprising a vector of an embodiment of the present invention is administered to achieve the above results. In other embodiments, after the initial vaccination, the subject receives one or more booster vaccinations, twice, three times, four times or five times in total. Booster vaccinations can be administered, for example, about 1 month, 2 months, 4 months, 6 months or 12 months after the initial vaccination, so that a vaccination regimen involves administration at 0, 0.5-2, 4-8 and 12 months. It can be advantageous to administer a vaccine in separate doses, which can be administered by the same or different routes.

[0141] In some embodiments, the vector of the present invention embodiments or a composition comprising the vector of any embodiment of the present invention will be administered in an increasing dose manner such that a subsequent administration of the vector contains a higher concentration of the vector than the previous administration. In embodiments, the vector will be administered in a manner such that a subsequent administration of the vector contains a lower concentration of the vector than the previous administration.

[0142] In one embodiment, an effective amount is an amount that provides infection in at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or even 100% of recipients (as defined by shedding of the vaccine virus).

[0143] In one embodiment, an effective amount is an amount that provides infection in at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or even 100% of recipients (as defined by a ≥4-fold increase in serum antibody titers against the vector).

[0144] In one embodiment, an effective amount is an amount that provides infection in at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or even 100% of recipients (as defined by a ≥4-fold increase in serum antibody titers against the expressed exogenous antigen).

[0145] Preparation and storage of vector compositions

[0146] The vectors and compositions described herein can be prepared using a variety of techniques. An embodiment of the present invention provides a method for preparing a live chimeric non-human single-stranded retrovirus vector that allows a cell to express at least one protein from at least one human pathogen, the method comprising inserting a non-natural gene encoding at least one protein from at least one human pathogen into a non-human single-stranded retrovirus vector. In an embodiment, the gene encoding the non-natural protein from at least one human pathogen is downstream of the non-human single-stranded retrovirus vector gene start site. In an embodiment, the gene encoding the non-natural protein from at least one human pathogen is upstream of the vector gene termination site. As used herein, "downstream of the vector gene start site" means inserting a gene encoding a protein from at least one human pathogen into a position downstream of the non-human single-stranded retrovirus vector gene start site, so that the gene start site allows the viral polymerase L protein to transcribe the gene. As used herein, "upstream of the non-human single-stranded retrovirus vector gene termination site" means inserting a gene encoding a protein from at least one human pathogen into a position upstream of the non-human single-stranded retrovirus vector gene termination site, so that the gene termination site allows the non-human single-stranded retrovirus vector polymerase protein to terminate the transcription of the gene at the appropriate position.

[0147] In embodiments, methods for preparing a vector may include mixing one or more proteins or immunogenic fragments or variants thereof with a carrier and / or an adjuvant.

[0148] Kits and Components

[0149] Embodiments of the present invention provide a kit for eliciting an immune response. The kit may include a composition of an embodiment of the present invention and at least one container for containing the composition. The kit optionally but preferably contains instructions for using the kit to administer the composition of an embodiment of the present invention to a human subject. The kit optionally contains components (e.g., a syringe, needle, nebulizer, sprayer or dropper) required for administering the composition.

[0150] The embodiments of the inventive subject matter described herein may be beneficial when alone or in combination with one or more other embodiments. Without limiting the foregoing description, certain non-limiting embodiments of the present disclosure numbered (1)-(25) are provided below. It will be apparent to those skilled in the art upon reading this disclosure that each individually numbered embodiment may be used or combined with any of the preceding or following individually numbered embodiments. This is intended to provide support for all of these combinations of embodiments and is not limited to the combinations of embodiments explicitly provided below:

[0151] (1) A live chimeric non-human single-stranded retroviral vector that allows cells to express at least one protein from at least one human pathogen.

[0152] (2) A non-human single-stranded retroviral vector as described in embodiment (1), wherein the natural host of the non-human single-stranded retroviral vector is a non-human animal.

[0153] (3) A non-human single-stranded retroviral vector as described in embodiment (1) or (2), wherein the natural host of the non-human single-stranded retroviral vector is from Rodentia.

[0154] (4) A non-human single-stranded retroviral vector as described in any one of embodiments (1) to (3), wherein the non-human single-stranded retroviral vector is murine pneumonia virus (MPV).

[0155] (5) A non-human single-stranded retroviral vector as described in any one of embodiments (1) to (4), wherein the at least one human pathogen is a bacterium or a virus.

[0156] (6) A non-human single-stranded retroviral vector as described in any one of embodiments (1) to (5), wherein the at least one human pathogen is a virus.

[0157] (7) The non-human single-stranded retroviral vector of any one of embodiments (1) to (6), wherein the at least one human pathogen is a human pneumoviridae virus.

[0158] (8) The non-human single-stranded retroviral vector of any one of embodiments (1) to (7), wherein the at least one human pathogen is an orthopenmunivirus.

[0159] (9) A non-human single-stranded retroviral vector as described in any one of embodiments (1) to (8), wherein the at least one pathogen is human respiratory syncytial virus (RSV).

[0160] (10) The non-human single-stranded retroviral vector of any one of embodiments (1) to (9), wherein the at least one protein is RSV F protein.

[0161] (11) A non-human single-stranded retroviral vector as described in any one of embodiments (1) to (10), wherein the non-human single-stranded retroviral vector comprises a sequence having at least 90% sequence identity with SEQ ID NO.56.

[0162] (12) A non-human single-stranded retroviral vector as described in any one of embodiments (1) to (10), wherein the non-human single-stranded retroviral vector comprises a sequence having at least 90% sequence identity with SEQ ID NO.58.

[0163] (13) A non-human single-stranded retroviral vector as described in any one of embodiments (1) to (9), wherein the at least one protein is RSV G protein.

[0164] (14) The non-human single-stranded retroviral vector of any one of embodiments (1) to (13), comprising a sequence having at least 90% sequence identity with SEQ ID NO:60.

[0165] (15) The non-human single-stranded retroviral vector of any one of embodiments (1) to (13), comprising a sequence having at least 90% sequence identity with SEQ ID NO:61.

[0166] (16) The non-human single-stranded retroviral vector of any one of embodiments (1) to (13), comprising a sequence having at least 90% sequence identity with SEQ ID NO:62.

[0167] (17) A composition comprising the non-human single-stranded retroviral vector according to any one of embodiments (1) to (16) and a pharmaceutically acceptable carrier.

[0168] (18) The composition according to embodiment (17), wherein the composition is formulated for intranasal administration.

[0169] (19) A method for eliciting an immune response to at least one human pathogen, comprising administering to a human a non-human single-stranded retroviral vector as described in any one of embodiments (1) to (16) or a composition as described in embodiments (17) or (18).

[0170] (20) The method of embodiment (19), wherein at the time of administration, the human is not suffering from a human pneumoviridae virus infection.

[0171] (21) The method of embodiment (19) or (20), wherein at the time of administration, the human is not suffering from human respiratory syncytial virus (RSV) infection.

[0172] (22) A method as described in any one of embodiments (19)-(21), wherein the non-human single-stranded retroviral vector is murine pneumovirus (MPV).

[0173] (23) A method for preparing a live chimeric non-human single-stranded retroviral vector that allows a cell to express at least one protein from at least one human pathogen, the method comprising:

[0174] (a) inserting a non-native gene encoding at least one protein from at least one human pathogen into a non-human single-stranded retroviral vector.

[0175] (24) A kit for eliciting an immune response, the kit comprising:

[0176] (a) the composition of embodiment (17) or (18); and

[0177] (b) at least one container for containing the composition.

[0178] (25) A live chimeric non-human single-stranded retroviral vector that allows cells to express at least one protein from at least one human pathogen.

[0179] (26) A non-human single-stranded retroviral vector as described in embodiment (25), wherein the natural host of the non-human single-stranded retroviral vector is a non-human animal.

[0180] (27) A non-human single-stranded retroviral vector as described in embodiment (25), wherein the natural host of the non-human single-stranded retroviral vector is from Rodentia.

[0181] (28) A non-human single-stranded retroviral vector as described in embodiment (25), wherein the non-human single-stranded retroviral vector is murine pneumonia virus (MPV).

[0182] (29) A non-human single-stranded retroviral vector as described in embodiment (25), wherein the at least one human pathogen is a bacterium or a virus.

[0183] (30) A non-human single-stranded retroviral vector as described in embodiment (25), wherein at least one human pathogen is a virus.

[0184] (31) A non-human single-stranded retroviral vector as described in embodiment (25), wherein the at least one human pathogen is a human pneumoviridae virus.

[0185] (32) A non-human single-stranded retroviral vector as described in embodiment (25), wherein at least one human pathogen is an orthopenmunivirus.

[0186] (33) A non-human single-stranded retroviral vector as described in embodiment (25), wherein at least one pathogen is human respiratory syncytial virus (RSV).

[0187] (34) The non-human single-stranded retroviral vector of embodiment (25), wherein the at least one protein is RSV F protein.

[0188] (35) A non-human single-stranded retroviral vector as described in embodiment (25), wherein the non-human single-stranded retroviral vector comprises a sequence having at least 90% sequence identity with SEQ ID NO.56.

[0189] (36) A non-human single-stranded retroviral vector as described in embodiment (25), wherein the non-human single-stranded retroviral vector comprises a sequence having at least 90% sequence identity with SEQ ID NO.58.

[0190] (37) A non-human single-stranded retroviral vector as described in embodiment (25), wherein the at least one protein is RSV G protein.

[0191] (38) The non-human single-stranded retroviral vector of embodiment (25), comprising a sequence having at least 90% sequence identity with SEQ ID NO:60.

[0192] (39) The non-human single-stranded retroviral vector of embodiment (25), comprising a sequence having at least 90% sequence identity with SEQ ID NO:61.

[0193] (40) The non-human single-stranded retroviral vector of embodiment (25), comprising a sequence having at least 90% sequence identity with SEQ ID NO:62.

[0194] (41) A composition comprising the non-human single-stranded retroviral vector described in embodiment (25) and a pharmaceutically acceptable carrier.

[0195] (42) The composition of embodiment (25), wherein the composition is formulated for intranasal administration.

[0196] (43) A method for eliciting an immune response to at least one human pathogen, comprising administering the non-human single-stranded retroviral vector of embodiment (25) to a human.

[0197] (44) A method as described in embodiment (43), wherein at the time of administration, the human does not suffer from a human pneumoviridae virus infection.

[0198] (45) The method of embodiment (43), wherein at the time of administration, the human is not suffering from human respiratory syncytial virus (RSV) infection.

[0199] (46) A method as described in embodiment (43), wherein the non-human single-stranded retroviral vector is murine pneumovirus (MPV).

[0200] (47) A method for preparing a live chimeric non-human single-stranded retroviral vector that allows a cell to express at least one protein from at least one human pathogen, the method comprising:

[0201] (a) inserting a non-native gene encoding at least one protein from at least one human pathogen into a non-human single-stranded retroviral vector.

[0202] (48) A kit for eliciting an immune response, the kit comprising:

[0203] (a) the composition of embodiment (42); and

[0204] (B) at least one container for containing the composition.

[0205] The following examples further illustrate the invention but, of course, should not be construed as limiting its scope in any way. Example

[0206] Example 1

[0207] This example shows how to prepare a vector according to an embodiment of the present invention.

[0208] The rMPV-RSV-F vector was constructed using a reverse genetics system as described by Kremp et al. ("Identification of a novel virulence factor in recombinant pneumonia virus of mice," J. Virol., (81): 9490-9501 (2007) (incorporated herein by reference in its entirety). The rMPV vector backbone used to express RSV F was derived from MPV (formerly known as PVM) strain 15 cloned in a pBluescript plasmid vector ("pBS"), which contained two introduced restriction sites (Agel and BstBI) not present in the parental strain 15, and also contained a partially modified L ORF. The downstream 67% of the L ORF was codon pair optimized ("CPO") to contain synonymous changes that increased the content of codon pairs associated with efficient expression in humans while retaining overall codon usage and the encoded amino acid sequence. RSV F from strain A2 was modified for human codon usage. The ORF (Genscript, Piscataway, NJ) was codon optimized to obtain more protein expression. RSV F also carries two previously described HEK amino acid assignments, 66E and 101P, which make the encoded F protein amino acid sequence identical to that of wt strain A2 and early passages of clinical isolates.

[0209] Three MPV vector constructs were designed in which the RSV F insert was placed in the first gene position, upstream of the NS1 gene (RMPV-F1); the third gene position, between the NS2 and N genes (RMPV-F3); or the fourth gene position, between the N and P genes (RMPV-F4) (see Figure 1 ). The RSV F insert was positioned so that the RSV F ORF was flanked by the MPV gene start (GS) and gene end (GE) transcription signals to allow RSV F to be transcribed as a separate mRNA. The Kozak consensus sequence GCCGCCACC (SEQ ID NO: 63) was placed upstream of the RSV F AUG start codon to provide an efficient environment for translation initiation. Commercially synthesized RSV F inserts (Genscript) were constructed as long genomic segments designed to use an XmaI restriction site in the plasmid (pBS) sequence upstream of the leader and either a downstream KpnI site (rMPV-F1 and rMPV-F3) or a KpnI and BmtI site (rMPV-F4) as indicated (see Figure 1) was inserted into the rMPV antigenome plasmid. The final construct rMPV-F1 contained 1768 additional nucleotides immediately after nucleotide position 67 (upstream of NS1), rMPV-F3 contained 1775 additional nucleotides immediately after nucleotide position 981 (between NS2 and N), and rMPV-F4 contained 1771 additional nucleotides immediately after nucleotide position 2276 of the MPV genome (between N and P).

[0210] rMPV vectors were recovered from cDNA in BHK BSR-T7 / 5 cells constitutively expressing T7 RNA polymerase (for exemplary methods, see Krempl et al., supra). Cells were transfected with MPV antigenomic plasmids and supporting plasmids expressing MPV N, P, M2-1 and L proteins. After 24 hours, the cells were scraped, vortexed, and the cell suspension was co-cultured with a Vero cell monolayer for approximately two weeks to produce a P1 virus stock. It was confirmed that the P1 virus stock did not contain any foreign mutations introduced during the recovery process. Specifically, viral RNA was isolated and Sanger sequence analysis of the complete viral genome was performed using uncloned overlapping RT-PCR fragments. The control RT-PCR reaction lacking reverse transcriptase did not produce an amplification product, confirming that the PCR product was amplified from viral RNA rather than from the cDNA used for viral rescue. The titer of the virus stock was determined by plaque assay and immunostaining.

[0211] Example 2

[0212] This example demonstrates the in vitro stability of a vector according to an embodiment of the present invention.

[0213] Vero, human lung epithelial cells, and baby hamster kidney cells were used in his studies. Vero cells (African green monkey kidney cells, CCL-81, ATCC, Manassas, VA) were maintained in OPTIPRO medium supplemented with 4 mM L-glutamine (Thermo Fisher Scientific, Waltham, MA) and 10% fetal bovine serum ("FBS") (Hyclone, Logan, UT). TMCulture medium. Human lung epithelial A549 (CCL-185; ATCC, Manassas, VA) cells were maintained in F-12K medium (ATCC) supplemented with 4 mM L-glutamine. BHK BSR T7 / 5 cells are BHK-21 (baby hamster kidney 21) cells maintained in Glasgow's MEM medium (ThermoFisher Scientific) supplemented with 3% FBS. Geneticin (ThermoFisher Scientific) was included in the culture medium for every other passage to ensure selection of cells expressing T7 RNA polymerase.

[0214] Recombinant (r) wt RSV strain A2 was used as a control. Unless otherwise stated, all in vitro tissue culture experiments were performed at 37°C. rMPV and rMPV-RSV-F vectors were propagated on Vero cells by infection with a multiplicity of infection ("MOI") of 0.1. Virus stock was harvested approximately two weeks after infection, when the cytopathic effect destroyed the monolayer. rMPV titers were determined by plaque assay of Vero cells under 0.8% methylcellulose coverage as described. Plaques were visualized by immunostaining with rabbit hyperimmune serum produced against MPV purified by sucrose gradients and then with horseradish peroxidase-labeled goat anti-rabbit IgG secondary antibodies (KPL, Gaithersburg, MD). The bound secondary antibodies were detected by incubation with a peroxidase substrate (KPL). Each sample was tested in duplicate, and the average value was reported.

[0215] In order to evaluate the stability of RSV F protein expression after in vitro replication, four independent virus recoveries of each rMPV-RSV-F construct were analyzed by double staining plaque assay to determine the stability of RSV F expression. Plaque assays were established as previously described by Brock et al. ("Evaluation of pneumonia virus of mice as a possible humanpathogen," J.Virol., 86:5829-5843 (2012) (incorporated herein by reference in its entirety)), and cells were fixed with 80% methanol on the 4th day after infection. In order to identify MPV protein, the above-mentioned rabbit anti-rMPV polyclonal primary antibody was used at 1:5,000 and detected by goat anti-rabbit 680LT antibody (Li-Cor; Lincoln, NE). A mixture of three RSV F-specific mouse monoclonal antibodies (1129, 1243 and 1269) each at 1:200 was used, followed by goat anti-mouse 800CW secondary antibody (Li-Cor) detection of RSV F. Two secondary antibodies were used at a dilution of 1:800. The plate was scanned on an Odyssey infrared imager (Li-Cor) and the images were analyzed to determine the percentage of PFUs co-expressing RSV F and rMPV antigens. For MPV and RSV F antigens, plaque images were false-colored to appear red and green, respectively. When the two channels were merged, rMPV plaques co-expressing RSV F would appear yellow, while rMPV plaques lacking RSV F expression would appear red. Figure 2 As shown, rMPV-empty vector has no RSV F expression, as the plaques are red. In contrast, rMPV-F1, rMPV-F3, and rMPV-F4 are yellow when the channels are combined.

[0216] Figure 3 Multicycle growth kinetics of rMPV-RSV-F vector in human A549 lung epithelial cells are shown. Figure 4 Multicycle growth kinetics of rMPV-RSV-F vector in Vero cells are shown.

[0217] Example 3

[0218] This example demonstrates the in vivo stability of a vector according to an embodiment of the present invention.

[0219] To evaluate the expression stability of RSV F protein after in vivo replication, nasopharyngeal swab and tracheal lavage samples from the following rhesus monkey study were analyzed by plaque assay followed by fixation and double stain plaque assay (as described above).

[0220] To evaluate multi-cycle replication kinetics, each virus was inoculated into replicate monolayer cultures of Vero cells and A549 cells in T25 flasks at an MOI of 0.1 PFU / cell and incubated at 32°C. The virus inoculum was adsorbed for 3 hours, after which the monolayer was washed twice and replenished with fresh medium. For A549, two cell monolayers of each virus and each cell type were scraped into supernatant on days 1 to 6 and 8 and 10, and for Vero cells on days 1 to 6 and 8, vortexed, clarified by centrifugation, and frozen. Virus titers were determined by plaque assay on Vero cells.

[0221] Then, the expression of RSV F and MPV vector proteins was evaluated. Vero cell monolayers in 12-well plates were infected with rMPV-RSV-F vector, empty vector, wt rMPV, wt RSV at an MOI of 10 PFU / cell, or mock infected. At 96 hours after infection, images of infected cells were collected and cell lysates were prepared to detect viral protein expression by Western blotting. Cells were washed twice with 1X PBS and stained with 1X NUPAGE TM LDS sample buffer (ThermoFisher Scientific), 1XComplete TMULTRA protease inhibitor (Roche, Basel, Switzerland) and 200 μL cell lysis buffer without protease water were lysed. Each lysate was rotated by QIAshredder spin column (Qiagen, Valencia, CA) and quickly frozen on dry ice. 90 μL of each lysate was combined with 10 μL of 10X reducing agent (ThermoFisher Scientific), denatured and reduced at 70°C for 10 min. 25 μL of each lane was loaded, followed by SDS-PAGE and Western blot analysis. rMPV G, N and P proteins were detected with hyperimmune serum produced for MPV virions purified by sucrose gradient. MPV F protein was detected with rabbit polyclonal antiserum produced for recombinant vaccinia virus expressing MPV F protein. NS1 and NS2 were detected with rabbit hyperimmune serum produced separately for synthetic peptides TNFDRSDLET (SEQ ID NO: 64) and SDSEESGDEA (SEQ ID NO: 65) derived from the corresponding proteins. RSV F was probed with a monoclonal antibody as described by Liang et al. ("Chimeric bovine / human parainfluenza virus type 3 expressing respiratory syncytial virus (RSV) F protein: effect of insert position on expression, replication, immunogenicity, stability, and protection against RSV infection," J. Virol. (88): 4237-4250 (2014) (incorporated herein by reference in its entirety)). Tubulin was detected as a loading control using a mouse monoclonal anti-tubulin antibody (Thermo Fisher Scientific, catalog number A-11126). The primary antibody was detected using a corresponding species-specific secondary antibody conjugated to an infrared dye (Li-Cor). The membrane was scanned on an Odyssey infrared imaging system. The images were acquired using IMAGESTUDIO TM Band signal values ​​were obtained using ELISA Lite, version 5.2.5 (Li-Cor) and corrected for background.

[0222] like Figure 5 As shown, cells infected with wt RSV, rMPV-F1, rMPV-F3, and rMPV-F4 showed clear signs of viral infection. Mock-infected and rMPV empty vector-infected cells did not show any signs of infection.

[0223] Figure 6Western blot analysis is shown, and in particular, it can be seen that rMPV-F1, rMPV-F3 and rMPV-F4 (lanes 1, 2 and 3) all contain RSV F protein (while rMPV-empty vector [lane 4] and wt MPV [lane 5] do not contain RSV F protein). Figure 7 The levels of RSV F protein expression in infected cells are described. Figure 7 As shown, rMPV-F1, rMPV-F3, rMPV-F4 and wtRRSV all expressed high levels of RSV F protein. Figure 8 The levels of rMPV G, N, P, F, NS1, and NS2 expression in infected cells are described. Figure 8 As shown, infected cells expressed each of the proteins tested, some of which were downstream of the F protein insertion. These results indicate a stable insertion.

[0224] Example 4

[0225] This example shows that vectors according to embodiments of the present invention effectively attenuate MPV in rhesus monkeys.

[0226] The nonhuman primate experiments described in this article were approved by the Animal Care and Use Committee of the National Institute of Allergy and Infectious Diseases of NIH and were performed in accordance with the recommendations of the Guide for the Care and Use of Laboratory Animals (The National Academies Press, Washington, DC (2011)). Eight early adult rhesus monkeys (Macaca mulatta) were tested to determine the presence of PRNT in a single 60 They were seronegative for both RSV and MPV as determined by the assay. Two groups of four rhesus monkeys were inoculated by a combined intranasal and intratracheal route with 1.0 mL of inoculum / site containing 10 6 In a separate study, four rhesus macaques from the same cohort as those used for the rMPV vectors were inoculated with 7.0 log 10PFU / site of recombinant wt RSV strain A2. All 4 animals were pre-screened as RSV seronegative. Clinical observations were performed daily. Nasopharyngeal ("NP") swabs were collected on days 0-10, 12, 14, 21 and 28. After infection, tracheal lavage ("TL") samples were collected on days 2, 4, 6, 8, 10, 12, 14, 21 and 28. NP and TL samples were analyzed by plaque assay as described above to quantify viral shedding. To assess immunogenicity, serum was collected on days 0, 14, 21 and 28 after immunization and compared by PRNT. 60 Analysis of RSV- and MPV-neutralizing antibodies.

[0227] PRNT was performed as follows 60 (60% plaque reduction neutralization test). Vero cells were subjected to PRNT using RSV-GFP and MPV-GFP, respectively. 60 Determination, analysis of RSV- and MPV-neutralizing antibody titers of serum samples. Sera from all 12 animals immunized with rMPV-F1, -F3 or wtRSV were analyzed in parallel for RSV neutralizing antibody levels in the same experiment. Before use, serum samples were incubated at 56°C for 30 minutes to inactivate serum complement. Serial dilutions of serum were then mixed with an equal volume of diluted RSV-GFP or MPV-GFP and incubated at 37°C for 30 minutes. RSV neutralization assays were performed in the presence of 10% guinea pig complement (Lonza, Walkersville, MD). Complement was excluded from the MPV neutralization assay because it inactivates the virus. On day 6 after infection, images of RSV-GFP and MPV-GFP plaques were obtained by scanning on a Typhoon imager (Lonza, Walkersville, MD), and PRNT was calculated. 60 Each sample was tested in duplicate and the mean value was reported as Log2 PRNT 60 .

[0228] Table 2. Virus titers from nasopharyngeal swab samples of the upper respiratory tract of rhesus macaques inoculated with the indicated rMPV-RSV F vectors or with wt RSV

[0229]

[0230] There was no detectable virus at time points after day 10 and is not shown. The lower limit of detection was 0.7 log 10 PFU / mL. Samples without any detectable virus are indicated as "---". "Shedding Days" indicates the period from the first to the last day when virus was detected, including negative days in between (if any).

[0231] Table 3. Virus titers from tracheal lavage samples of the lower respiratory tract of rhesus monkeys inoculated with the indicated rMPV-RSV F vectors or with wt RSV

[0232]

[0233] There was no detectable virus at time points after day 8 and is not shown. Samples without any detectable virus are indicated as "---". The lower limit of detection was 0.7 log 10 PFU / mL. "# of Shedding Days" represents the period from the first to the last day that virus was detected, including negative days in between, if any.

[0234] Table 4. Percentage of plaque forming units (PFU) expressing RSV F in samples collected from the upper and lower respiratory tracts of rhesus monkeys inoculated with rMPV vectors

[0235]

[0236] The nasopharyngeal swab and tracheal lavage samples collected on the designated days after intranasal immunization were analyzed by fluorescent double staining plaque assay on Vero cells to determine the percentage of viral PFUs that co-express RSV F and MPV antigens during in vivo viral replication. These percentage values ​​are determined by approximately 100 plaques per sample. Samples without any detectable virus are indicated as "---". The days when samples were not collected are indicated with "nc".

[0237] Table 5. RSV 60% plaque reduction neutralization titers (PRNT) from serum samples from rhesus monkeys immunized with rMPV-RSV-F vector or with wt RSV 60 )

[0238]

[0239] RSV PRNT 60 The detection limit of the assay was 3.3 (log2 60% titer). 60 RSV serum samples with values ​​≥5.3 were considered positive.

[0240] Table 6. MPV 60% plaque reduction neutralization titers (PRNT) of serum samples from rhesus monkeys immunized with rMPV-RSV-F vectors 60 )

[0241]

[0242] (PRNT 60) The detection limit of the assay was 3.3 (log2 60% titer). log2 PRNT 60 MPV serum samples with values ​​≥5.3 were considered positive.

[0243] As shown in Tables 2-6, both viruses (rMPV-F1 and rMPV-F1) replicated at low levels in the upper and lower respiratory tracts, maintained stable RSV F expression, and induced high levels of RSV neutralizing serum antibodies, similar to the levels induced by wt RSV that replicated to 5-25-fold higher titers. This study shows that rMPV provides a highly attenuated but immunogenic vector for the expression of RSV F protein in RSV-naive (RSV- ) and RSV-experienced populations.

[0244] All references, including publications, patent applications, and patents, cited herein are hereby incorporated by reference to the same extent as if each reference was individually and specifically indicated to be incorporated by reference and was set forth in its entirety herein.

[0245] The terms "a", "an", "said", at least one and similar references used in the context of describing the present invention (especially in the context of the following claims) should be interpreted as covering the singular and the plural, unless otherwise specified herein or clearly contradictory to the context. The use of one or more enumerations (e.g., "at least one of A and B") after the term "at least one" should be interpreted as meaning one (A or B) selected from the listed items or a combination of two or more listed items (A and B), unless otherwise specified herein or clearly contradictory to the context. The terms "comprising", "having", "including" and "containing" should be interpreted as open-ended terms (i.e., meaning "including, but not limited to"), unless otherwise specified. The range of values ​​narrated herein is intended only as a shorthand method for referring to each individual value falling within the range separately, unless otherwise specified herein, and each individual value is incorporated into this specification as if it is narrated separately herein. All methods described herein can be performed in any suitable order, unless otherwise specified herein or clearly contradictory to the context. Any and all examples or exemplary language (e.g., "such as") provided herein are intended only to better illustrate the invention and do not limit the scope of the invention unless otherwise stated. No language in this specification should be construed as indicating that any non-claimed element is essential to the practice of the invention.

[0246] Preferred embodiments of the present invention are described herein, including the best mode of implementing the present invention known to the inventor. By reading the foregoing description, the changes of these preferred embodiments are obvious to those of ordinary skill in the art. The inventor expects that the technician will appropriately use such variations, and the inventor intends to implement the present invention in a manner different from that specifically described herein. Therefore, as permitted by applicable law, the present invention includes all variations and equivalents of the subject matter recited in the appended claims. In addition, the present invention encompasses any combination of the above-mentioned elements with all possible variant forms thereof, unless otherwise indicated herein or clearly contradictory to the context. Sequence Listing <110> The United States Department of Health and Human Services SECRETARY, DEPARTMENT OF HEALTH AND HUMAN SERVICES) <120> Chimeric vector <130> 742179 <150> US 62 / 661,320 <151> 2018-04-23 <160> 73 <170> PatentIn version 3.5 <210> 1 <211> 43 <212> DNA <213> Pneumonia virus of mice <400> 1 acgcgaaaaa atgcataaca aaactatcaa cctgaaaaaa gtt 43 <210> 2 <211> 91 <212> DNA <213> Pneumonia virus of mice <400> 2 ttgatatctc acaggttgta aacatagttc ttttataatt attgttagtt aaactattgt 60 gtttgacttc ctttgggtat ttttttcccg t 91 <210> 3 <211> 10 <212> DNA <213> Pneumonia virus of mice <400> 3 aggacaagtg 10 <210> 4 <211> 13 <212> DNA <213> Pneumonia virus of mice <400> 4 tagttaatta aaa 13 <210> 5 <211> 8 <212> DNA <213> Pneumonia virus of mice <400> 5 caaagggt 8 <210> 6 <211> 10 <212> DNA <213> Pneumonia virus of mice <400> 6 aggacaagtc 10 <210> 7 <211> 14 <212> DNA <213> Pneumonia virus of mice <400> 7 tagttataga aaaa 14 <210> 8 <211> 4 <212> DNA <213> Pneumonia virus of mice <400> 8 catt 4 <210> 9 <211> 10 <212> DNA <213> Pneumonia virus of mice <400> 9 aggataaata 10 <210> 10 <211> 13 <212> DNA <213> Pneumonia virus of mice <400> 10 tatttaatta aaa 13 <210> 11 <211> 11 <212> DNA <213> Pneumonia virus of mice <400> 11 ctggaaaatg t 11 <210> 12 <211> 10 <212> DNA <213> Pneumonia virus of mice <400> 12 aggataaata 10 <210> 13 <211> 13 <212> DNA <213> Pneumonia virus of mice <400> 13 tagttaatta aaa 13 <210> 14 <211> 7 <212> DNA <213> Pneumonia virus of mice <400> 14 taacaac 7 <210> 15 <211> 10 <212> DNA <213> Pneumonia virus of mice <400> 15 aggacaaata 10 <210> 16 <211> 13 <212> DNA <213> Pneumonia virus of mice <400> 16 tagttaaata aaa 13 <210> 17 <211> 2 <212> DNA <213> Pneumonia virus of mice <400> 17 tc 2 <210> 18 <211> 10 <212> DNA <213> Pneumonia virus of mice <400> 18 aggataaata 10 <210> 19 <211> 14 <212> DNA <213> Pneumonia virus of mice <400> 19 tagttaacaa aaaa 14 <210> 20 <211> 5 <212> DNA <213> Pneumonia virus of mice <400> 20 ccggt 5 <210> twenty one <211> 15 <212> DNA <213> Pneumonia virus of mice <400> twenty one aggataagta ctatc 15 <210> twenty two <211> 13 <212> DNA <213> Pneumonia virus of mice <400> twenty two tagttaatga aaa 13 <210> twenty three <211> 17 <212> DNA <213> Pneumonia virus of mice <400> twenty three ctaagctttg atataat 17 <210> twenty four <211> 10 <212> DNA <213> Pneumonia virus of mice <400> twenty four aggacaaata 10 <210> 25 <211> 14 <212> DNA <213> Pneumonia virus of mice <400> 25 tagttaatta aaaa 14 <210> 26 <211> 3 <212> DNA <213> Pneumonia virus of mice <400> 26 ctt 3 <210> 27 <211> 11 <212> DNA <213> Pneumonia virus of mice <400> 27 aggataagtg a 11 <210> 28 <211> 16 <212> DNA <213> Pneumonia virus of mice <400> 28 tagttatata aaaaaa 16 <210> 29 <211> 10 <212> DNA <213> Pneumonia virus of mice <400> 29 tattcgaatt 10 <210> 30 <211> 10 <212> DNA <213> Pneumonia virus of mice <400> 30 aggatcaata 10 <210> 31 <211> 14 <212> DNA <213> Pneumonia virus of mice <400> 31 tagttaacaa aaaa 14 <210> 32 <211> 342 <212> DNA <213> Pneumonia virus of mice <400> 32 atgggctgta atgtgatgat ggagcttgat tatggtggac gagctgcatg gctggcattc 60 cacataacca actttgatag gtcagatttg gaaactatcc taagaggtgc tagggtgtgc 120 aatacatggc aagatcagag actctccgtg taccttgtgg gaagggattg caatttgtta 180 agaccatttg tgcaagctgc caaatttatc cataatacta ggagaggcca aacattaaca 240 cattggttca caaaaaatat cgtgtttagt tctacagggc aagagacaga gcctcccatt 300 gaccccacat gtgagctgtt ggtagagctg atcagtggtt aa 342 <210> 33 <211> 113 <212> PRT <213> Pneumonia virus of mice <400> 33 Met Gly Cys Asn Val Met Met Glu Leu Asp Tyr Gly Gly Arg Ala Ala 1 5 10 15 Trp Leu Ala Phe His Ile Thr Asn Phe Asp Arg Ser Asp Leu Glu Thr 20 25 30 Ile Leu Arg Gly Ala Arg Val Cys Asn Thr Trp Gln Asp Gln Arg Leu 35 40 45 Ser Val Tyr Leu Val Gly Arg Asp Cys Asn Leu Leu Arg Pro Phe Val 50 55 60 Gln Ala Ala Lys Phe Ile His Asn Thr Arg Arg Gly Gln Thr Leu Thr 65 70 75 80 His Trp Phe Thr Lys Asn Ile Val Phe Ser Ser Thr Gly Gln Glu Thr 85 90 95 Glu Pro Pro Ile Asp Pro Thr Cys Glu Leu Leu Val Glu Leu Ile Ser 100 105 110 Gly <210> 34 <211> 471 <212> DNA <213> Pneumonia virus of mice <400> 34 atgtccacag ctatgaacaa gttcactcag accatctcta aacctgccac tatcttgaat 60 atttcagaca gtgaagagtc gggcgatgag gcaggggtgg gcaaggtgtc ccgtaccaca 120 cagagctcag agaggtggct tgattgctc attgaaaagt tccagccgag cctacaaaac 180 atcactagat acatcaactg gaacttcatc agatctgca atgataggct taaaaaagaa 240 aaaatggggt acattgaggc caagcaatat gtggaagaca tggcttggat ggtgatagca 300 tctgaggcag acagcattga gtggaagtgc ataaggaggc aggagaaagt gactggggtg 360 aatacccaa agttcttctt tgtacaacac aaagaggact ggattgagtg cacaggatgc 420 attccgtacc caggccatga cttgatctat gatgaggatg atgatgactg a 471 <210> 35 <211> 156 <212> PRT <213> Pneumonia virus of mice <400> 35 Met Ser Thr Ala Met Asn Lys Phe Thr Gln Thr Ile Ser Lys Pro Ala 1 5 10 15 Thr Ile Leu Asn Ile Ser Asp Ser Glu Glu Ser Gly Asp Glu Ala Gly 20 25 30 Val Gly Lys Val Ser Arg Thr Thr Gln Ser Ser Glu Arg Trp Leu Asp 35 40 45 Leu Leu Ile Glu Lys Phe Gln Pro Ser Leu Gln Asn Ile Thr Arg Tyr 50 55 60 Ile Asn Trp Asn Phe Ile Arg Ile Cys Asn Asp Arg Leu Lys Lys Glu 65 70 75 80 Lys Met Gly Tyr Ile Glu Ala Lys Gln Tyr Val Glu Asp Met Ala Trp 85 90 95 Met Val Ile Ala Ser Glu Ala Asp Ser Ile Glu Trp Lys Cys Ile Arg 100 105 110 Arg Gln Glu Lys Val Thr Gly Val Lys Tyr Pro Lys Phe Phe Phe Val 115 120 125 Gln His Lys Glu Asp Trp Ile Glu Cys Thr Gly Cys Ile Pro Tyr Pro 130 135 140 Gly His Asp Leu Ile Tyr Asp Glu Asp Asp Asp Asp 145 150 155 <210> 36 <211> 1182 <212> DNA <213> Pneumonia virus of mice <400> 36 atgtctctag acagattgaa gctcaatgat gtctcaaaca aggatagcct gctgtccaac 60 tgcaaataca gtgttaccag atccacaggc gatgtaacca gtgtgtctgg tcatgctatg 120 cagaaagccc ttgcaaggac actcggcatg ttcttactta ctgccttcaa ccgttgcgaa 180 gaagtggcag aatagggct caatatgcc atgtccttgc taggcagaga tgatagcatc 240 aagatattaa gagaagccgg ctacaatgta aaatgtgtgg acacacagct caaggacttt 300 acaatcaaat tacaaggaaa ggaatacaaa atacaagtcc tagatatagt gggaatagat 360 gcagccaatt tagctgatct agagatacaa gccagaggag tggtagcaaa agaactcaaa 420 acaggagcca ggctacctga caatcggagg catgatgcac cagattgtgg tgtgatagtt 480 ctctgtattg cagcattagt tgtttccaaa ttagctgcag gggacagggg aggacttgat 540 gctgtggaaa gaagggcttt aaatgtgctg aaagccgaga aagccaggta cccacatg 600 gaggtcaagc agatagctga aagtttat gatctgtttg aaggaagcc ttattacatt 660 gatgtcttca tcactttgg cctggcccag tctagtgtca agggaggcag caaagttgag 720 gggctgtttt caggtctctt catgaatgca tacggggcag gandagttat gctgaggtgg 780 ggtttactgg caaatctgt caaacatc atgctaggcc atgctagtgt acagctgag 840 aggacagg tggttgaggt ttacgaatt gctcagaagc aggagggg ggcaggattc 900 tatcacatca gaaataatcc aaagcttca cttctctt tgaccaattg tcctaatttc 960 accagtgttg tgcttgcaa tgtgcaggt taggtcata taggtcata 1020 cctaggaata gagaactctt tgatgctgcc aagattatg cagaagatt aaaggacaac 1080 aatgtaatta actacagtgc attackaacttg actgcagaag aaagagagct gatcagccag 1140 cagctgaaca ttgttgatga cactcctgat gatgatattt aa 1182 <210> 37 <211> 393 <212> PRT <213> Pneumonia virus of mice <400> 37 Met Ser Leu Asp Arg Leu Lys Leu Asn Asp Val Ser Asn Lys Asp Ser 1 5 10 15 Leu Leu Ser Asn Cys Lys Tyr Ser Val Thr Arg Ser Thr Gly Asp Val 20 25 30 Thr Ser Val Ser Gly His Ala Met Gln Lys Ala Leu Ala Arg Thr Leu 35 40 45 Gly Met Phe Leu Leu Thr Ala Phe Asn Arg Cys Glu Glu Val Ala Glu 50 55 60 Ile Gly Leu Gln Tyr Ala Met Ser Leu Leu Gly Arg Asp Asp Ser Ile 65 70 75 80 Lys Ile Leu Arg Glu Ala Gly Tyr Asn Val Lys Cys Val Asp Thr Gln 85 90 95 Leu Lys Asp Phe Thr Ile Lys Leu Gln Gly Lys Glu Tyr Lys Ile Gln 100 105 110 Val Leu Asp Ile Val Gly Ile Asp Ala Ala Asn Leu Ala Asp Leu Glu 115 120 125 Ile Gln Ala Arg Gly Val Val Ala Lys Glu Leu Lys Thr Gly Ala Arg 130 135 140 Leu Pro Asp Asn Arg Arg His Asp Ala Pro Asp Cys Gly Val Ile Val 145 150 155 160 Leu Cys Ile Ala Ala Leu Val Val Ser Lys Leu Ala Ala Gly Asp Arg 165 170 175 Gly Gly Leu Asp Ala Val Glu Arg Arg Ala Leu Asn Val Leu Lys Ala 180 185 190 Glu Lys Ala Arg Tyr Pro Asn Met Glu Val Lys Gln Ile Ala Glu Ser 195 200 205 Phe Tyr Asp Leu Phe Glu Arg Lys Pro Tyr Tyr Ile Asp Val Phe Ile 210 215 220 Thr Phe Gly Leu Ala Gln Ser Ser Val Lys Gly Gly Ser Lys Val Glu 225 230 235 240 Gly Leu Phe Ser Gly Leu Phe Met Asn Ala Tyr Gly Ala Gly Gln Val 245 250 255 Met Leu Arg Trp Gly Leu Leu Ala Lys Ser Val Lys Asn Ile Met Leu 260 265 270 Gly His Ala Ser Val Gln Ala Glu Met Glu Gln Val Val Glu Val Tyr 275 280 285 Glu Tyr Ala Gln Lys Gln Gly Gly Glu Ala Gly Phe Tyr His Ile Arg 290 295 300 Asn Asn Pro Lys Ala Ser Leu Leu Ser Leu Thr Asn Cys Pro Asn Phe 305 310 315 320 Thr Ser Val Val Leu Gly Asn Ala Ala Gly Leu Gly Ile Ile Gly Ser 325 330 335 Tyr Lys Gly Ala Pro Arg Asn Arg Glu Leu Phe Asp Ala Ala Lys Asp 340 345 350 Tyr Ala Glu Arg Leu Lys Asp Asn Asn Val Ile Asn Tyr Ser Ala Leu 355 360 365 Asn Leu Thr Ala Glu Glu Arg Glu Leu Ile Ser Gln Gln Leu Asn Ile 370 375 380 Val Asp Asp Thr Pro Asp Asp Asp Ile 385 390 <210> 38 <211> 888 <212> DNA <213> Pneumonia virus of mice <400> 38 atggagaaat tcgcccccga atttgttggc gaggatgcta acaagaaggc agaggagttt 60 ctcaaacata gatccttccc ttcggaaaaa ccactagctg gtataccgaa cactgccact 120 catgtcacca aatataacat gccccctata ttgcgtagct cattcaaact cccttccccg 180 agagttgctg caaatcttac tgaaccctct gctccccta ccactccacc acccacacct 240 ccccagaaca aggaagagca gcccaaagag tctgatgttg acattgagac tatgcatgtc 300 tgtaaggttc ctgacaatcc ggaacacagc aagaagccat gctgctcaga tgataccgat 360 actaagaaaa ctaggaagcc gatggtcacc tttgtggaac ccgaggagaa atttgtcgga 420 ttgggagcta gcttgtacag ggagaccatg cagacctttg ctgctgatgg ttatgatgaa 480 gaaagcaacc tatcgtttga ggagactaac caagagccgg gttcttcatc tgtagaacaa 540 agactagata gaatagagga gaaattgtcc tacataatag gccttttaaa caccataatg 600 gtagcgactg ctggacctac cactgctaga gatgagatta gagatgccct tataggcact 660 agagaagaac ttattgagat gatcaagtct gacatcttga ctgtcaatga cagaatagtg 720 gccatggaga agctcagaga tgaggaatgc tccagagctg acactgatga tggatcagcc 780 tgttatttaa cagacagagc aaggatacta gataagatag tgtccagcaa tgctgaagag 840 gctaaggaag atttggatgt tgatgacatc atgggcatta atttttag 888 <210> 39 <211> 295 <212> PRT <213> Pneumonia virus of mice <400> 39 Met Glu Lys Phe Ala Pro Glu Phe Val Gly Glu Asp Ala Asn Lys Lys 1 5 10 15 Ala Glu Glu Phe Leu Lys His Arg Ser Phe Pro Ser Glu Lys Pro Leu 20 25 30 Ala Gly Ile Pro Asn Thr Ala Thr His Val Thr Lys Tyr Asn Met Pro 35 40 45 Pro Ile Leu Arg Ser Ser Phe Lys Leu Pro Ser Pro Arg Val Ala Ala 50 55 60 Asn Leu Thr Glu Pro Ser Ala Pro Pro Thr Thr Pro Pro Pro Thr Pro 65 70 75 80 Pro Gln Asn Lys Glu Glu Gln Pro Lys Glu Ser Asp Val Asp Ile Glu 85 90 95 Thr Met His Val Cys Lys Val Pro Asp Asn Pro Glu His Ser Lys Lys 100 105 110 Pro Cys Cys Ser Asp Asp Thr Asp Thr Lys Lys Thr Arg Lys Pro Met 115 120 125 Val Thr Phe Val Glu Pro Glu Glu Lys Phe Val Gly Leu Gly Ala Ser 130 135 140 Leu Tyr Arg Glu Thr Met Gln Thr Phe Ala Ala Asp Gly Tyr Asp Glu 145 150 155 160 Glu Ser Asn Leu Ser Phe Glu Glu Thr Asn Gln Glu Pro Gly Ser Ser 165 170 175 Ser Val Glu Gln Arg Leu Asp Arg Ile Glu Glu Lys Leu Ser Tyr Ile 180 185 190 Ile Gly Leu Leu Asn Thr Ile Met Val Ala Thr Ala Gly Pro Thr Thr 195 200 205 Ala Arg Asp Glu Ile Arg Asp Ala Leu Ile Gly Thr Arg Glu Glu Leu 210 215 220 Ile Glu Met Ile Lys Ser Asp Ile Leu Thr Val Asn Asp Arg Ile Val 225 230 235 240 Ala Met Glu Lys Leu Arg Asp Glu Glu Cys Ser Arg Ala Asp Thr Asp 245 250 255 Asp Gly Ser Ala Cys Tyr Leu Thr Asp Arg Ala Arg Ile Leu Asp Lys 260 265 270 Island Val Ser Ser Asn Ala Glu Glu Ala Lys Glu Asp Leu Asp Val Asp 275 280 285 Asp Island Met Gly Island Asn Phe 290 295 <210> 40 <211> 774 <212> DNA <213> Pneumonia virus of mice <400> 40 atggaggcct acttggtaga gatgtaccat ggtgtcccat atacagctgc agtacagcta 60 aacttggttg aaaaacattc agccaacata tcactaactg tgtggatacc gatgtttcaa 120 acatctctac caaagaactc cgttatggac ctgctacatg atgttacagt catttgtaca 180 cagatatcaa cagtgcatgg tcccatgatc aaggtagatc tgagctcttc caatgcaggt 240 ttagctacca tgccaaggca attcttgata aatgctatca tagctttgga tgactggggc 300 aacatggatt acgaagtgcc tgttgctttt gataaaaaga gcttctgtgt gacaattctt 360 aagcctaaaa acatgcttta cactgtaccc agcattactc ccactaatcg acctactcat 420 gagctgatag ctgtctgctc tttccataac agggtaacat taaagtcatt caatatacct 480 gtcttcatca gagcactgtc tatcagacag caggaccttg atagtgtgga gcaggctata 540 agctccgatg tggaccatgc tataacaaca gctagggtgg ctccctatgc agggcttaca 600 cttgtgatca acatcacatc caccaaagga gcattcaaac tgctaaaggc aggtagtcag 660 attcttgcag aactgggtcc ctatctgacg caggtgagcc tacatgatgt gattatgaac 720 tggaaacata caggcacttc ctacatactc aagagctcct caacaagtgg atga 774 <210> 41 <211> 257 <212> PRT <213> Pneumonia virus of mice <400> 41 Met Glu Ala Tyr Leu Val Glu Met Tyr His Gly Val Pro Tyr Thr Ala 1 5 10 15 Ala Val Gln Leu Asn Leu Val Glu Lys His Ser Ala Asn Ile Ser Leu 20 25 30 Thr Val Trp Ile Pro Met Phe Gln Thr Ser Leu Pro Lys Asn Ser Val 35 40 45 Met Asp Leu Leu His Asp Val Thr Val Ile Cys Thr Gln Ile Ser Thr 50 55 60 Val His Gly Pro Met Ile Lys Val Asp Leu Ser Ser Ser Asn Ala Gly 65 70 75 80 Leu Ala Thr Met Pro Arg Gln Phe Leu Ile Asn Ala Ile Ile Ala Leu 85 90 95 Asp Asp Trp Gly Asn Met Asp Tyr Glu Val Pro Val Ala Phe Asp Lys 100 105 110 Lys Ser Phe Cys Val Thr Ile Leu Lys Pro Lys Asn Met Leu Tyr Thr 115 120 125 Val Pro Ser Ile Thr Pro Thr Asn Arg Pro Thr His Glu Leu Ile Ala 130 135 140 Val Cys Ser Phe His Asn Arg Val Thr Leu Lys Ser Phe Asn Ile Pro 145 150 155 160 Val Phe Ile Arg Ala Leu Ser Ile Arg Gln Gln Asp Leu Asp Ser Val 165 170 175 Glu Gln Ala Ile Ser Ser Asp Val Asp His Ala Ile Thr Thr Ala Arg 180 185 190 Val Ala Pro Tyr Ala Gly Leu Thr Leu Val Ile Asn Ile Thr Ser Thr 195 200 205 Lys Gly Ala Phe Lys Leu Leu Lys Ala Gly Ser Gln Ile Leu Ala Glu 210 215 220 Leu Gly Pro Tyr Leu Thr Gln Val Ser Leu His Asp Val Ile Met Asn 225 230 235 240 Trp Lys His Thr Gly Thr Ser Tyr Ile Leu Lys Ser Ser Ser Thr Ser 245 250 255 Gly <210> 42 <211> 279 <212> DNA <213> Pneumonia virus of mice <400> 42 atggatccta acatgacctc acaccagatc accctcgaga tcaacatgac cagcagccgt 60 attggcacat acactacacc agccccaaca gctcttctcc ttgcatgtgc cgtcatcaac 120 acagtgtgtg cgctgataat ggcctgcagc agtagaagca ctgccacatc aggcattgtc 180 agcagccaat gcacagttca tcccaatcac cctccaccaa gttatggcgt caatgtaact 240 ggtctgccgg gtaacctata ctcaaggaac actacataa 279 <210> 43 <211> 92 <212> PRT <213> Pneumonia virus of mice <400> 43 Met Asp Pro Asn Met Thr Ser His Gln Ile Thr Leu Glu Ile Asn Met 1 5 10 15 Thr Ser Ser Arg Ile Gly Thr Tyr Thr Thr Pro Ala Pro Thr Ala Leu 20 25 30 Leu Leu Ala Cys Ala Val Ile Asn Thr Val Cys Ala Leu Ile Met Ala 35 40 45 Cys Ser Ser Arg Ser Thr Ala Thr Ser Gly Ile Val Ser Ser Gln Cys 50 55 60 Thr Val His Pro Asn His Pro Pro Pro Ser Tyr Gly Val Asn Val Thr 65 70 75 80 Gly Leu Pro Gly Asn Leu Tyr Ser Arg Asn Thr Thr 85 90 <210> 44 <211> 1191 <212> DNA <213> Pneumonia virus of mice <400> 44 atgggaagga acttagaagt gagtggcagc attaccaatt tgaactttga gagaactcag 60 catcctgaca catttaggac tgttgtaaaa gtgaaccaaa tgtgtaagct tattgcaggt 120 gtgctcacaa gtgctgctgt ggcagtttgt gtgggggtca taatgtattc tgttttcaca 180 tcaaaccaca aggccaactc cacgcagaat gccacgaccc ggaacagcac atccacccct 240 ccccaaccaa ccgccggtct gcccaccaca gagcaaggga ccatccccag attcaccaaa 300 ccccccacca aaaccgccac ccaccatgag atcacagagc ccgtcaaaat ggcaacacct 360 tcagaggatc cctaccaatg ctccagcaat ggttatttgg accgacctga tttacctgaa 420 aatttcaaac tcgtattgga tgttatatgc aagcctccag gtcctgaaca tcacaacacc 480 agctgtttatg agaaacgtga aatcaaccca ggaagtgttt gccctgatct tgtaacaatg 540 aaggcaaaca tgggcttaaa caatggtggt gggaggatg ctgcacctta tatagaggtt 600 accacccttt ctacgtactc caacaaaagg gcaatgtgtg tccacaatgg gtgtgatcaa 660 ggcttctgtt tcttcctttc tggtttaagc actgatcagg agagagctgt gctagagctt 720 ggaggtcaac aggctatcat ggagttgcat tatgattcct actggaaaca ctattggagt 780 aactctaatt gtgttgttcc cagaacaaac tgcaacctga cagaccaaac tgagattttg 840 tttcctaggt ttaacaacaa gaatcagtct cagtgtacca cctgtgcaga ttcagctggc 900 ctagataaca aattttatct cacatgtgat gggcttttaa gaaccctccc tctagttgga 960 ctacccagcc taagtcctca ggcttacaaa gctctaccca cacaaactac aggcaccacc 1020 acggcaccaa catcagagac gaggcaccca acccctgcac ccaggaggtc caaacctctc 1080 agtcggaaga agagagcttt atgtggtgta gactcaagca gagaacccaa accaacaatg 1140 ccttactggt gtcctatgct ccaattattt ccaaggaggt ctaattctta a 1191 <210> 45 <211> 396 <212> PRT <213> Pneumonia virus of mice <400> 45 Met Gly Arg Asn Leu Glu Val Ser Gly Ser Ile Thr Asn Leu Asn Phe 1 5 10 15 Glu Arg Thr Gln His Pro Asp Thr Phe Arg Thr Val Val Lys Val Asn 20 25 30 Gln Met Cys Lys Leu Ile Ala Gly Val Leu Thr Ser Ala Ala Val Ala 35 40 45 Val Cys Val Gly Val Ile Met Tyr Ser Val Phe Thr Ser Asn His Lys 50 55 60 Ala Asn Ser Thr Gln Asn Ala Thr Thr Arg Asn Ser Thr Ser Thr Pro 65 70 75 80 Pro Gln Pro Thr Ala Gly Leu Pro Thr Thr Glu Gln Gly Thr Ile Pro 85 90 95 Arg Phe Thr Lys Pro Pro Thr Lys Thr Ala Thr His His Glu Ile Thr 100 105 110 Glu Pro Val Lys Met Ala Thr Pro Ser Glu Asp Pro Tyr Gln Cys Ser 115 120 125 Ser Asn Gly Tyr Leu Asp Arg Pro Asp Leu Pro Glu Asn Phe Lys Leu 130 135 140 Val Leu Asp Val Ile Cys Lys Pro Pro Gly Pro Glu His His Asn Thr 145 150 155 160 Ser Cys Tyr Glu Lys Arg Glu Ile Asn Pro Gly Ser Val Cys Pro Asp 165 170 175 Leu Val Thr Met Lys Ala Asn Met Gly Leu Asn Asn Gly Gly Gly Glu 180 185 190 Asp Ala Ala Pro Tyr Ile Glu Val Thr Thr Leu Ser Thr Tyr Ser Asn 195 200 205 Lys Arg Ala Met Cys Val His Asn Gly Cys Asp Gln Gly Phe Cys Phe 210 215 220 Phe Leu Ser Gly Leu Ser Thr Asp Gln Glu Arg Ala Val Leu Glu Leu 225 230 235 240 Gly Gly Gln Gln Ala Ile Met Glu Leu His Tyr Asp Ser Tyr Trp Lys 245 250 255 His Tyr Trp Ser Asn Ser Asn Cys Val Val Pro Arg Thr Asn Cys Asn 260 265 270 Leu Thr Asp Gln Thr Glu Ile Leu Phe Pro Arg Phe Asn Asn Lys Asn 275 280 285 Gln Ser Gln Cys Thr Thr Cys Ala Asp Ser Ala Gly Leu Asp Asn Lys 290 295 300 Phe Tyr Leu Thr Cys Asp Gly Leu Leu Arg Thr Leu Pro Leu Val Gly 305 310 315 320 Leu Pro Ser Leu Ser Pro Gln Ala Tyr Lys Ala Val Pro Thr Gln Thr 325 330 335 Thr Gly Thr Thr Thr Ala Pro Thr Ser Glu Thr Arg His Pro Thr Pro 340 345 350 Ala Pro Arg Arg Ser Lys Pro Leu Ser Arg Lys Lys Arg Ala Leu Cys 355 360 365 Gly Val Asp Ser Ser Arg Glu Pro Lys Pro Thr Met Pro Tyr Trp Cys 370 375 380 Pro Met Leu Gln Leu Phe Pro Arg Arg Ser Donkey Ser 385 390 395 <210> 46 <211> 1614 <212> DNA <213> Pneumonia virus of mice <400> 46 atgattcctg gcaggatctt tctagtcctt ctggtgatct tcaacaccaa gccaattcac 60 ccaaatacat taacagaaaa attctatgag tccacatgta gtgttgagac tgcaggttat 120 aagagtgcccc ttagaacagg ttggcatatg acagttatgt caattaagtt gtctcaaata 180 aatattgagt catgcaagag cagcaactcg ttatggctc atgagcttgc aatctatagt 240 agtgcagtgg atgaattgag aacgttatca tccaatgcct tgaagtccaa aaaggaagaag 300 aggttcctcg gtttgattct tggtctcgga gctccagtca ctgccggggt ggctttagcc 360 420 gaggctgttg ttagcctaac caacggcatg tcagtgttgg ctaaagtggt ggatgatttg 480 aaaaacttca tatctaaaga attactccca aaaataaacc gagtctcttg tgatgtgcac 540 gacatcactg ccgtcattag attccaacag ctcaacaaaa gacttttgga agtatctcgt 600 gaattttcat ctaatgcagg attaacacac actgtttcat cttttatgtt aacagaccgg 660 gaactcacct ccattgtagg cggcatggct gtttcagcag gccaaaaaaga gataatgcta 720 tctagcaaag ctataatgag aagaaatggg ttagcaatat taagttcagt caacgctgac 780 acactggttt atgtaataca actcccatta tttggtgtta tggacacaga ttgttgggta 840 900 gataatggct ggtattgtca caatgctggc tcattatcat acttcccgtc gccaacggat 960 tgtgagatcc acatgggta tgctttctgt gatacctaa aaagtctaac tgtacctgta 1020 acatcacgag aatgcaactc aaacatgtat accactact acgattgtaa gatttccaca 1080 agtaaaactt atgtgagtac agcggtactg actacaatgg gttgcttggt atcttgttat 1140 ggtcataaca gttgcacagt catcaataat ggaaggta taataggac tctgccagat 1200 ggttgccact acatctccaa caaggtgtg gataggttc aagtaggtaa cactgtttac 1260 tatcttagca agaagttgg caagtcaat gttgtcagag gggaaccatt ggtcttgaaa 1320 tatgaccctt tgagttccc tgacgataaa tttgatgttg ctataagaga tgtggagcat 1380 agcatcaatc agacacgcac attcttgaag gcctctgatc agttattgga cttaagtgaa 1440 aacagagaga aaaaattt aaacaagtca tatatactaa caacctgct cttcgttgta 1500 atgcttatta taataatggc tgtcatagggg ttcattctgt aataggtatt gaaaatgatc 1560 agagacaaca agttgaatc caaagtaca cctggccctca cagttttatc atga 1614 <210> 47 <211> 537 <212> PRT <213> Mice's pneumonia virus (Pneumonia virus of mice) <400> 47 Met Ile Pro Gly Arg Ile Phe Leu Val Leu Leu Val Ile Phe Asn Thr 1 5 10 15 Lys Pro Ile His Pro Asn Thr Leu Thr Glu Lys Phe Tyr Glu Ser Thr 20 25 30 Cys Ser Val Glu Thr Ala Gly Tyr Lys Ser Ala Leu Arg Thr Gly Trp 35 40 45 His Met Thr Val Met Ser Ile Lys Leu Ser Gln Ile Asn Ile Glu Ser 50 55 60 Cys Lys Ser Ser Asn Ser Leu Leu Ala His Glu Leu Ala Ile Tyr Ser 65 70 75 80 Ser Ala Val Asp Glu Leu Arg Thr Leu Ser Ser Asn Ala Leu Lys Ser 85 90 95 Lys Arg Lys Lys Arg Phe Leu Gly Leu Ile Leu Gly Leu Gly Ala Ala 100 105 110 Val Thr Ala Gly Val Ala Leu Ala Lys Thr Val Gln Leu Glu Ser Glu 115 120 125 Ile Ala Leu Ile Arg Asp Ala Val Arg Asn Thr Asn Glu Ala Val Val 130 135 140 Ser Leu Thr Asn Gly Met Ser Val Leu Ala Lys Val Val Asp Asp Leu 145 150 155 160 Lys Asn Phe Ile Ser Lys Glu Leu Leu Pro Lys Ile Asn Arg Val Ser 165 170 175 Cys Asp Val His Asp Ile Thr Ala Val Ile Arg Phe Gln Gln Leu Asn 180 185 190 Lys Arg Leu Leu Glu Val Ser Arg Glu Phe Ser Ser Asn Ala Gly Leu 195 200 205 Thr His Thr Val Ser Ser Phe Met Leu Thr Asp Arg Glu Leu Thr Ser 210 215 220 Ile Val Gly Gly Met Ala Val Ser Ala Gly Gln Lys Glu Ile Met Leu 225 230 235 240 Ser Ser Lys Ala Ile Met Arg Arg Asn Gly Leu Ala Ile Leu Ser Ser 245 250 255 Val Asn Ala Asp Thr Leu Val Tyr Val Ile Gln Leu Pro Leu Phe Gly 260 265 270 Val Met Asp Thr Asp Cys Trp Val Ile Arg Ser Ser Ile Asp Cys His 275 280 285 Asn Ile Ala Asp Lys Tyr Ala Cys Leu Ala Arg Ala Asp Asn Gly Trp 290 295 300 Tyr Cys His Asn Ala Gly Ser Leu Ser Tyr Phe Pro Ser Pro Thr Asp 305 310 315 320 Cys Glu Ile His Asn Gly Tyr Ala Phe Cys Asp Thr Leu Lys Ser Leu 325 330 335 Thr Val Pro Val Thr Ser Arg Glu Cys Asn Ser Asn Met Tyr Thr Thr 340 345 350 Asn Tyr Asp Cys Lys Ile Ser Thr Ser Lys Thr Tyr Val Ser Thr Ala 355 360 365 Val Leu Thr Thr Met Gly Cys Leu Val Ser Cys Tyr Gly His Asn Ser 370 375 380 Cys Thr Val Ile Asn Asn Asp Lys Gly Ile Ile Arg Thr Leu Pro Asp 385 390 395 400 Gly Cys His Tyr Ile Ser Asn Lys Gly Val Asp Arg Val Gln Val Gly 405 410 415 Asn Thr Val Tyr Tyr Leu Ser Lys Glu Val Gly Lys Ser Ile Val Val 420 425 430 Arg Gly Glu Pro Leu Val Leu Lys Tyr Asp Pro Leu Ser Phe Pro Asp 435 440 445 Asp Lys Phe Asp Val Ala Ile Arg Asp Val Glu His Ser Ile Asn Gln 450 455 460 Thr Arg Thr Phe Leu Lys From Asp Ser To Gln To Asp To Glu Ser 465 470 475 480 Asn Arg Glu Asn Lys Asn Leu Asn Lys Ser Tyr Ile Leu Thr Thr Leu 485,490,495 Leu Phe Val Val Met Leu Ile Ile Ile Met Ala Val Ile Gly Phe Ile 500 505 510 Your Tyr Lys Your Lys Met Ile Arg Asp Your Lys Your Lys Ser Lys 515,520,525 Ser Thr Pro Gly Leu Thr Val Leu Ser 530,535 <210> 48 <211> 531 <212> DNA <213> Pneumonia virus of mice <400> 48 atgagtgtga gaccttgcaa atttgaggtt caagggtttt gttccagagg gaggaattgc 60 aagtatagtc ataatattg ggaatggcct ttgaaaactc ttatgctcag gcagaactac 120 atgcttaata ggatttatag gttcctcgac accacac atgcaatgtc agatgtcagc 180 ggatttgatg caccacaag gactgctgag tatgccttgg gaaccatagg tgtgctgaaa 240 agttacctgg aaaaaactaa aaatcaatag cttgtggcag ttgatcact 300 gtattgcaga acttggatgt tggtctagta atacaagcaa gagatagcaa cactgaggac 360 accaattact tgagttg storm ctgtcttta tgagat thunderstorm 420 agacaaatta ttcacattct caaagactg ccagtaggag tactatgcaa tctgatccaa 480 tctgtcatct ccatcgagga gagataaat tcttctga aacagaatg a 531 <210> 49 <211> 176 <212> PRT <213> Pneumonia virus of mice <400> 49 Met Ser Val Arg Pro Cys Lys Phe Glu Val Gln Gly Phe Cys Ser Arg 1 5 10 15 Gly Arg Asn Cys Tyr Ser His Lys Tyr Trp Glu Trp Pro Leu Lys 20 25 30 Thr Leu Met Leu Arg Gln Asn Tyr Met Leu Asn Arg And Tyr Arg Phe 35 40 45 Leu Asp Thr Asn Thr Asp Ala Met Ser Asp Val Ser Gly Phe Asp Ala 50 55 60 Pro Gln Arg Thr Ala Glu Tyr Ala Leu Gly Thr Ile Gly Val Leu Lys 65 70 75 80 Tyr Leu Glu Gly Served Thr Lys Gly 85 90 95 Ser Lion Island Thr Valley Lion Gln Asn Lion Asp Valley Lion Valley Gln 100 105 110 Only Arg Asp Ser Asn Thr Glu Asp Thr Asn Tyr Leu Arg Ser Cys Asn 115 120 125 Thr Ileu Ser Tyr Ile Asp Lys Ile His Lys Lys Arg Gln Ile 130 135 140 His Lys Arg Pro Val Gly Val Cys Asn Lyu Gln 145 150 155 160 Being Val Is Being Is Glu Glu Lys Is Asn Being Met Lys Thr Glu 165 170 175 <210> 50 <211> 297 <212> DNA <213> Pneumonia virus of mice <400> 50 atgcaatctg atccaatctg tcatctccat cgaggagaag ataaattctt ctatgaaaac 60 agaatgataa ggctgcctaa attackatcca gccatactgc ataagatgta tattattaga 120 gtaaatagaa acctcactta cgatgggtct ggaccatcca caatataga tgcaggaag 180 tctgtggtgt ggaatcgtgt tgatgtgata gcttgtgtga aagaggcctt gtgctgcata 240 gattcagct ggaataacca agtgatcata gactttgatt atagccaggc cagatga 297 <210> 51 <211> 98 <212> PRT <213> Pneumonia virus of mice <400> 51 Met Gln Ser Asp Pro Ile Cys Leu His Arg Gly Glu Asp Lys Phe 1 5 10 15 Phe Tyr Glu Asn Arg Met Ile Arg Leu Pro Lys Tyr Pro Ala Ile 20 25 30 Leu His Lys Met Tyr Ile Ile Arg Val Asn Arg Asn Leu Thr Tyr Asp 35 40 45 Gly Ser Gly Pro Ser Thr Ile Ile Asp Ala Gly Lys Ser Val Val Trp 50 55 60 Asn Arg Val Asp Val Ile Ala Cys Val Lys Glu Ala Leu Cys Cys Ile 65 70 75 80 Glu Phe Ser Trp Asn Asn Gln Val Ile Asp Phe Asp Tyr Ser Gln 85 90 95 Only Arg <210> 52 <211> 6123 <212> DNA <213> Pneumonia virus of mice <400> 52 atggatccta ttgatgaaca agaagttaat gtgtacttgc cggatagcta cttaaagggt 60 gttatatctt ttagtgaaac taatgctctt ggcagctgta tcattggtag acctttcttg 120 aaggatgact ttactgccac tacttcaatc cgtaaccccc taattgaaca taaaagaata 180 agggacacta aattagtaaa aaatattgtt tcaaaccctc atataggtt agtggagcct 240 ctccaaatgc agcatgagct cttgagtgta ctatcgccca atttcatatt gcacactgcc 300 aacttaagga aaattataca aagaagtgtt gacataacag ataaaaagtt gaaccccatt 360 ttgcacattt tgaatcttaa ttctcctaac caagagggta aggtgtcgga acggctaact 420 aggcaatta agaaacatct ctctcacata ctaattggg taagcagctg gtacaatata 480 tgggtcaatc ttaacaactt actgcaggag taccgttcaa aggaagttat agaccataac 540 tgtgttctga ctaggcaatt gtctggaagt ttcatacatg tggtcatgag tcaatatgga 600 gttgtgataa ttagcaaaaa aagtaaaaga tatacaatgt gtacttataa ccaattccta 660 acctggaagg accttgcctt gagcagattt aatgccaatt atgtggtctg gctaagtaat 720 gtgttaaaca cactcaacga ggggttggga ttaaggtga gattaaaagg tcatctgctc 780 agtaagttgt acatttccac tgacatcttt ttatcttcaa catctaatga attttataat 840 gtggtcaagg aatttgaggg cttcatcatg tcactgatat tgaaaaac tgaggaagcc 900 ttattagca caaggtttta taataacatg ttgaacaact taattgatgc cattgatagg 960 gctcgactag agtatctggc ccgctgtgcc aattcagctg ccaggattaa tttacctagt 1020 acagatgtta tgatagcatc attgggtgat atcttatctt tgataaacgt tttaggtgaa 1080 tccaacctta acaacttaag tgagttatat tttatcttca ggatatttgg tcaccctatg 1140 gttgatgaga ggaaggccat ggatgcagtc aagataact gttgtgaaac aaagtttctg 1200 1260 gtagcaaatt ataacaggtg gccttacata aaaactagag tttgccttac accaacatgg 1320 attaactatc ttgacaccaa ttcatgtccc tcatttag agatgacaga agatgatttt 1380 attgtgttag ctggagtgca ctttataaga gaattccaca tcccaaagct aactgatctg 1440 gagattatat taaatgacaa ggccatatct cctccaaaat cactcatttg gtcatgcttt 1500 ccaaaaaact acatacctca ggttatacaa gatgagtatg cccggaggta ttgtagagct 1560 aaagcacctt tgaagacaag acgtgtcttg gagttctact tacaggacaa ggatttcaag 1620 ttggatcagc tccatagagt agtagtgaac caggactacc ttaatgataa agaacatata 1680 atttctttaa caggaaaaga aagagagttg ggtgttggta ggatgtttgc catgcaacct 1740 gggaagcaga ggcaagtcca aattttagca gagaagctgt tggctgataa catcctgcaa 1800 ttctttccgg agacactgac tagatacggt gatttggagc tgcaaaagat actagagtta 1860 aaagctggac tttcaaataa aaatgacaga tctaaagact cctacaataa ttatataagt 1920 aggtgctcat taattactga tttaagtaaa tttaaccaag cttttaggta cgagtcatcc 1980 tgtgtgtgta gtgatctttt agatgagcta catgggactc aaagcttatt ctcttggctg 2040 catttaacag taccactgac tactataatg tgtacatata ggcatgcgcc gccggacact 2100 ggaaacaact ataatgtaga tgatattgct gagcagagtg gactctaccg ctaccacatg 2160 ggcgggattg agggctggtg ccagaagctc tggacaacag aggccattgc tttgctagat 2220 actgtagctg tgaagggccg tttccagcta acttcattaa taaatggcga caaccaaagt 2280 attgatattt caaaaccaac aaggctgggg accaggactc aaagtgaagc agattatgat 2340 ttggcaataa attctttaag attaatatca gcagcttata aaggcattgg acataaatta 2400 aaagaaggtg agacctactt gtcacgtgac atgcagttca tgagtaaaac aatacaacat 2460 gaaggggtct actacccggc ctccatcaag aaaatattaa gagttggtcc ctggatcaac 2520 acaatattag atgatataaa aacttcaaca gaaagtattg gttctctaac tcaagaacta 2580 gaatataaag gtgaaagttt aatgagcagc ctgctgctga ggaacttctg gctctacaga 2640 ttatattcag tggatttaaa agatcattct ttgtgtggaa agcagctcta cagatcctta 2700 ataaaagtgt taaaacattt gaagaggtgc ttcaacctgg agaaccttgg ggaatgtttg 2760 gaattatttt taaatgtgcc catgcagttt ggaggtgctg acccaaatgt catctacagg 2820 agcttctaca gagaactcc agatttcta acagaaagta taaccatct catcctcatt 2880 ttaaaacatt ttagagaga tttggaattc aaaaagata atgtctccaa agctgttctt 2940 tctttgctag agttcaccaa gatgattct gcagaatttg taactgat gagagatcct 3000 caagcaattg gtagtgagag gcaggccaag atcactcag acatcacag aacagctgta 3060 acttcagtgt tatcaatgc tccaatgaa atatttagaa cttcagctct tcattacagc 3120 agcacagaaa atgaattaaa tggaatagca agtggagtttt ctcctgttta tcctcatggt 3180 cttcgagtttt tatatgaaag tttacctttt tataaagcag agagattgt caacatggtt 3240 tctgggacca agtccatcac cacatactg gagagacat cagccatctc ctacacagat 3300 atattcgag ccacacat gatggtggag aacctcactt tgctaacaag addaatgaaa 3360 ccaggtgctg acacatcttt ggatcctgac acatagtaa taacaatatt atcaaaata 3420 ataagagata aatcctggga tgttggtgat atattggtg tcactcccc atctcctgtc 3480 tcctgcttca aggtggtcta cacatcaact ctacaaaata attcagtagt atagaaaga 3540 tacacacag acacctac agaggtaag agaggcccca ccaagccctg ggtgggcagc 3600 agcacacagg agagaagtc catgcctgtc tacacagac aagttttaac agaggaaa 3660 agagatcaa tagaaaat agcaaagctg gagtgggtgt ttctcagt agcaatatt 3720 gattctttgc taaatgagct cagcaccatg actttgggtc tttctctaag gaaatgtaga 3780 caacttttc caacatattt aagtttaaac ttcctgcaca ggctttctgt cagcagcagg 3840 cccagagaat atccttcttc tcttcctgcc tacaggacaa caattttca tttgatact 3900 ggaccaataa aaagtgtt aacagaaaga tttggagatg aagatataa ttttggtattt 3960 caaaatgcaa tatcatatgg tctttccacc atgtctttgg tggagcagtt tactggtgtc 4020 tgtccaaata aagttttgct ggtgcccaag ctacaagaaa tacaactaat gaaagttcca 4080 atatttcaag gtggcttca cctacaaagt atattcca taataggca gcagcacacatg 4140 ttcctgccca accacatcac tccagcccag tatattgaat tattctttc ttcaaaacaa 4200 tttcattca gataaattt aaaacacac aacagattta aaacttgtttt aaaaagat 4260 tattttaatg gggagaacat gatagaact ttgtccacct gttggcagg ccactggatc 4320 atcattttga tgctaatgaa ggagagtcag gggatatttg acaggagtg gtatgatggt 4380 tttgtacag accacatgtt cctggacctg cagctctcc tctccttcctt caacacattt 4440 ctaactgtct tcaactttgc ttatttaaaa gttggttca atagaga ataacagga 4500 aatcaagcca acctgctgga gctgctggac ctgggctact ggaagaacat gtataaagta 4560 tttcagaga ccaaggtgcg gctggctttg ctaaaacaag atttatcatt taattctgtg 4620 aagaacagca gcagcttccg gcactggttt aataattctc tacagaagt acatgtact 4680 tctgtgcctt gggtgtaaa tgtaacaaga atccaacc atttaaaagg tgttctacag 4740 tacatgaga tgatagaag tggcatt caagttatt cagcaat tcttcagtt 4800 ttaagtatcc catatatta tccagacatg gcgcacatga tgacaaaat atagaaat 4860 cgaggccaca tgtcctatga ttttaccaag atgagaaaa gttttaacttt ctccatgaca 4920 gatagagtg acagctacat gctcaacctc ttcccaag tagaatgttc ttacatgagt 4980 ggttattgg aaactaga tgatactcta siactctaa agaacctcc tgttggaaga 5040 aaagttcctt ctgtggctt gccctggcac cactgcaca gatacactt tgtcttcagc 5100 agcacaggct gcaagtttc tgtcattgac atgcttcca aacattccg aagagtaat 5160 ttaaaagtaa tatgttttat tggaaggg gcgggcaacc tcatgctaag agctgttttg 5220 gaagttggtg gaataataa attatatat agatccttaa aagatcctga tgatcatcat 5280 gttcctgtag aatttctag atttaaacct tgttatcctt atatgatac tggtggcagt 5340 ttatctttgg cttcacaga tgccaccac aaggcccact gggattatt acatcttcac 5400 tggacagatc ctttaaattt atagtagt gatgcagaaa taagtggtgt gaagcactgg 5460 ctaaaaattc ttcacaggtg gtatgagcac atgactcct gcaagcactg tttaaaatca 5520 gaacatgata atatttaat aaaaaat catgctcaag atgatttaat agatcttccct 5580 catggtgtca ggctactaaa atgctacatc tgcctgggct ccaactaag tggcagtgag 5640 agctacctgc tcattggtct tggtctttca aaaacttc ctgtctacag tgaagttctt 5700 cattcaaaac ttctttggc agaatgtcat cagtttcatc atccaaaata tttggatgtt 5760 tctggaataa atacaaatat aaaatcctta ataccaatgt tggattatcc aataacttac 5820 aacaagatca ccactttgct agaaagtgtg cgggagcttt cttcaaataa aaacaagaac 5880 accatgtgga ttggaagaaa tcctgtctac cataataaat ggctaaagag gaaatatttc 5940 aacatttaa aatggctaaa atactgtata gaacttcctg ccttcaggat ggattataat 6000 tcatttgaga gaatagaaat gctttatcca aatttaagag atttggtaga ttctgtttct 6060 acttcagagc tgaagaaagt aataaaagta acaggcatcc tcttcaggag caacaccatg 6120 is 6123 <210> 53 <211> 2040 <212> PRT <213> Pneumonia virus of mice <400> 53 Met Asp Pro Ile Asp Glu Gln Glu Val Asn Val Tyr Leu Pro Asp Ser 1 5 10 15 Tyr Leu Lys Gly Val Ile Ser Phe Ser Glu Thr Asn Ala Leu Gly Ser 20 25 30 Cys Ile Ile Gly Arg Pro Phe Leu Lys Asp Asp Phe Thr Ala Thr Thr 35 40 45 Ser Ile Arg Asn Pro Leu Ile Glu His Lys Arg Ile Arg Asp Thr Lys 50 55 60 Leu Val Lys Asn Ile Val Ser Asn Pro Gln Tyr Arg Leu Val Glu Pro 65 70 75 80 Leu Gln Met Gln His Glu Leu Leu Ser Val Leu Ser Pro Asn Phe Ile 85 90 95 Leu His Thr Ala Asn Leu Arg Lys Ile Ile Gln Arg Ser Val Asp Ile 100 105 110 Thr Asp Lys Lys Leu Asn Pro Ile Leu His Ile Leu Asn Leu Asn Ser 115 120 125 Pro Asn Gln Glu Gly Lys Val Ser Glu Arg Leu Thr Arg Leu Ile Lys 130 135 140 Lys His Leu Ser His Ile Pro Asn Trp Val Ser Ser Trp Tyr Asn Ile 145 150 155 160 Trp Val Asn Leu Asn Asn Leu Leu Gln Glu Tyr Arg Ser Lys Glu Val 165 170 175 Ile Asp His Asn Cys Val Leu Thr Arg Gln Leu Ser Gly Ser Phe Ile 180 185 190 His Val Val Met Ser Gln Tyr Gly Val Val Ile Ile Ser Lys Lys Ser 195 200 205 Lys Arg Tyr Thr Met Cys Thr Tyr Asn Gln Phe Leu Thr Trp Lys Asp 210 215 220 Leu Ala Leu Ser Arg Phe Asn Ala Asn Tyr Val Val Trp Leu Ser Asn 225 230 235 240 Val Leu Asn Thr Leu Asn Glu Gly Leu Gly Leu Arg Cys Arg Leu Lys 245 250 255 Gly His Leu Leu Ser Lys Leu Tyr Ile Ser Thr Asp Ile Phe Leu Ser 260 265 270 Ser Thr Ser Asn Glu Phe Tyr Asn Val Val Lys Glu Phe Glu Gly Phe 275 280 285 Ile Met Ser Leu Ile Leu Lys Gln Thr Glu Glu Ala Leu Phe Ser Thr 290 295 300 Arg Phe Tyr Asn Asn Met Leu Asn Asn Leu Ile Asp Ala Ile Asp Arg 305 310 315 320 Ala Arg Leu Glu Tyr Leu Ala Arg Cys Ala Asn Ser Ala Ala Arg Ile 325 330 335 Asn Leu Pro Ser Thr Asp Val Met Ile Ala Ser Leu Gly Asp Ile Leu 340 345 350 Ser Leu Ile Asn Val Leu Gly Glu Ser Asn Leu Asn Asn Leu Ser Glu 355 360 365 Leu Tyr Phe Ile Phe Arg Ile Phe Gly His Pro Met Val Asp Glu Arg 370 375 380 Lys Ala Met Asp Ala Val Arg Asp Asn Cys Cys Glu Thr Lys Phe Leu 385 390 395 400 Thr Ala Lys Asn Leu Ala Ser Leu Arg Gly Ala Tyr Val Tyr Arg Ile 405 410 415 Ile Lys Gly Phe Val Ala Asn Tyr Asn Arg Trp Pro Tyr Ile Lys Thr 420 425 430 Arg Val Cys Leu Thr Pro Thr Trp Ile Asn Tyr Leu Asp Thr Asn Ser 435 440 445 Cys Pro Ser Leu Leu Glu Met Thr Glu Asp Asp Phe Ile Val Leu Ala 450 455 460 Gly Val His Phe Ile Arg Glu Phe His Ile Pro Lys Leu Thr Asp Leu 465 470 475 480 Glu Ile Ile Leu Asn Asp Lys Ala Ile Ser Pro Pro Lys Ser Leu Ile 485 490 495 Trp Ser Cys Phe Pro Lys Asn Tyr Ile Pro Gln Val Ile Gln Asp Glu 500 505 510 Tyr Ala Arg Arg Tyr Cys Arg Ala Lys Ala Pro Leu Lys Thr Arg Arg 515 520 525 Val Leu Glu Phe Tyr Leu Gln Asp Lys Asp Phe Lys Leu Asp Gln Leu 530 535 540 His Arg Val Val Val Asn Gln Asp Tyr Leu Asn Asp Lys Glu His Ile 545 550 555 560 Ile Ser Leu Thr Gly Lys Glu Arg Glu Leu Gly Val Gly Arg Met Phe 565 570 575 Ala Met Gln Pro Gly Lys Gln Arg Gln Val Gln Ile Leu Ala Glu Lys 580 585 590 Leu Leu Ala Asp Asn Ile Leu Gln Phe Phe Pro Glu Thr Leu Thr Arg 595 600 605 Tyr Gly Asp Leu Glu Leu Gln Lys Ile Leu Glu Leu Lys Ala Gly Leu 610 615 620 Ser Asn Lys Asn Asp Arg Ser Lys Asp Ser Tyr Asn Asn Tyr Ile Ser 625 630 635 640 Arg Cys Ser Leu Ile Thr Asp Leu Ser Lys Phe Asn Gln Ala Phe Arg 645 650 655 Tyr Glu Ser Ser Cys Val Cys Ser Asp Leu Leu Asp Glu Leu His Gly 660 665 670 Thr Gln Ser Leu Phe Ser Trp Leu His Leu Thr Val Pro Leu Thr Thr 675 680 685 Ile Met Cys Thr Tyr Arg His Ala Pro Pro Asp Thr Gly Asn Asn Tyr 690 695 700 Asn Val Asp Asp Ile Ala Glu Gln Ser Gly Leu Tyr Arg Tyr His Met 705 710 715 720 Gly Gly Ile Glu Gly Trp Cys Gln Lys Leu Trp Thr Thr Glu Ala Ile 725 730 735 Ala Leu Leu Asp Thr Val Ala Val Lys Gly Arg Phe Gln Leu Thr Ser 740 745 750 Leu Ile Asn Gly Asp Asn Gln Ser Ile Asp Ile Ser Lys Pro Thr Arg 755 760 765 Leu Gly Thr Arg Thr Gln Ser Glu Ala Asp Tyr Asp Leu Ala Ile Asn 770 775 780 Ser Leu Arg Leu Ile Ser Ala Ala Tyr Lys Gly Ile Gly His Lys Leu 785 790 795 800 Lys Glu Gly Glu Thr Tyr Leu Ser Arg Asp Met Gln Phe Met Ser Lys 805 810 815 Thr Ile Gln His Glu Gly Val Tyr Tyr Pro Ala Ser Ile Lys Lys Ile 820 825 830 Leu Arg Val Gly Pro Trp Ile Asn Thr Ile Leu Asp Asp Ile Lys Thr 835 840 845 Ser Thr Glu Ser Ile Gly Ser Leu Thr Gln Glu Leu Glu Tyr Lys Gly 850 855 860 Glu Ser Leu Met Ser Ser Leu Leu Leu Arg Asn Phe Trp Leu Tyr Arg 865 870 875 880 Leu Tyr Ser Val Asp Leu Lys Asp His Ser Leu Cys Gly Lys Gln Leu 885 890 895 Tyr Arg Ser Leu Ile Lys Val Leu Lys His Leu Lys Arg Cys Phe Asn 900 905 910 Leu Glu Asn Leu Gly Glu Cys Leu Glu Leu Phe Leu Asn Val Pro Met 915 920 925 Gln Phe Gly Gly Ala Asp Pro Asn Val Ile Tyr Arg Ser Phe Tyr Arg 930 935 940 Arg Thr Pro Asp Phe Leu Thr Glu Ser Ile Thr His Leu Ile Leu Ile 945 950 955 960 Leu Lys His Phe Arg Arg Asp Leu Glu Phe Asn Lys Asp Asn Val Ser 965 970 975 Lys Ala Val Leu Ser Leu Leu Glu Phe Thr Lys Asn Asp Ser Ala Glu 980 985 990 Phe Val Thr Leu Met Arg Asp Pro Gln Ala Ile Gly Ser Glu Arg Gln 995 1000 1005 Ala Lys Ile Thr Ser Asp Ile Asn Arg Thr Ala Val Thr Ser Val 1010 1015 1020 Leu Ser Asn Ala Pro Asn Glu Ile Phe Arg Thr Ser Ala Leu His 1025 1030 1035 Tyr Ser Ser Thr Glu Asn Glu Leu Asn Gly Ile Ala Ser Gly Val 1040 1045 1050 Ser Pro Val Tyr Pro His Gly Leu Arg Val Leu Tyr Glu Ser Leu 1055 1060 1065 Pro Phe Tyr Lys Ala Glu Lys Ile Val Asn Met Val Ser Gly Thr 1070 1075 1080 Lys Ser Ile Thr Asn Ile Leu Glu Lys Thr Ser Ala Ile Ser Tyr 1085 1090 1095 Thr Asp Ile Ile Arg Ala Thr Asn Met Met Val Glu Asn Leu Thr 1100 1105 1110 Leu Leu Thr Arg Ile Met Lys Pro Gly Ala Asp Thr Ser Leu Asp 1115 1120 1125 Pro Asp Thr Ile Val Ile Thr Ile Leu Ser Lys Ile Ile Arg Asp 1130 1135 1140 Lys Ser Trp Asp Val Gly Asp Ile Ile Gly Val Thr Ser Pro Ser 1145 1150 1155 Pro Val Ser Cys Phe Lys Val Val Tyr Thr Ser Thr Leu Gln Asn 1160 1165 1170 Asn Ser Val Val Ile Glu Arg Tyr Thr Thr Asp Thr Tyr Thr Arg 1175 1180 1185 Gly Lys Arg Gly Pro Thr Lys Pro Trp Val Gly Ser Ser Thr Gln 1190 1195 1200 Glu Lys Lys Ser Met Pro Val Tyr Asn Arg Gln Val Leu Thr Arg 1205 1210 1215 Gly Gln Arg Asp Gln Ile Glu Asn Ile Ala Lys Leu Glu Trp Val 1220 1225 1230 Phe Ser Ser Val Ala Asn Ile Asp Ser Leu Leu Asn Glu Leu Ser 1235 1240 1245 Thr Met Thr Leu Gly Leu Ser Leu Arg Lys Cys Arg Gln Leu Phe 1250 1255 1260 Pro Thr Tyr Leu Ser Leu Asn Phe Leu His Arg Leu Ser Val Ser 1265 1270 1275 Ser Arg Pro Arg Glu Tyr Pro Ser Ser Leu Pro Ala Tyr Arg Thr 1280 1285 1290 Thr Asn Phe His Phe Asp Thr Gly Pro Ile Asn Lys Val Leu Thr 1295 1300 1305 Glu Arg Phe Gly Asp Glu Asp Ile Asn Leu Val Phe Gln Asn Ala 1310 1315 1320 Ile Ser Tyr Gly Leu Ser Thr Met Ser Leu Val Glu Gln Phe Thr 1325 1330 1335 Gly Val Cys Pro Asn Lys Val Leu Leu Val Pro Lys Leu Gln Glu 1340 1345 1350 Ile Gln Leu Met Lys Val Pro Ile Phe Gln Gly Gly Phe Asn Leu 1355 1360 1365 Gln Ser Ile Ile Pro Ile Ile Arg Gln Gln His Met Phe Leu Pro 1370 1375 1380 Asn His Ile Thr Pro Ala Gln Tyr Ile Glu Leu Phe Leu Ser Ser 1385 1390 1395 Lys Gln Phe His Ser Arg Ile Asn Leu Lys His Asn Asn Arg Phe 1400 1405 1410 Lys Leu Val Leu Gln Lys Asp Tyr Phe Asn Gly Glu Asn Met Ile 1415 1420 1425 Glu Thr Leu Ser Thr Cys Leu Ala Gly His Trp Ile Ile Ile Leu 1430 1435 1440 Met Leu Met Lys Glu Ser Gln Gly Ile Phe Asp Lys Glu Trp Tyr 1445 1450 1455 Asp Gly Phe Val Thr Asp His Met Phe Leu Asp Leu Gln Leu Phe 1460 1465 1470 Leu Ser Ser Phe Lys Thr Phe Leu Thr Val Phe Asn Phe Ala Tyr 1475 1480 1485 Leu Lys Val Gly Ser Asn Ile Glu Glu Ile Thr Gly Asn Gln Ala 1490 1495 1500 Asn Leu Leu Glu Leu Leu Asp Leu Gly Tyr Trp Lys Asn Met Tyr 1505 1510 1515 Lys Val Phe Ser Glu Thr Lys Val Arg Leu Ala Leu Leu Lys Gln 1520 1525 1530 Asp Leu Ser Phe Asn Ser Val Lys Asn Ser Ser Ser Phe Arg His 1535 1540 1545 Trp Phe Ile Asn Ser Leu Gln Glu Val Gln Cys Thr Ser Val Pro 1550 1555 1560 Trp Val Val Asn Val Thr Arg Asn Pro Thr His Leu Lys Gly Val 1565 1570 1575 Leu Gln Tyr Met Lys Met Ile Glu Ser Gly Met Ile Gln Gly Tyr 1580 1585 1590 Ser Ala Asn Ile Ser Ser Val Leu Ser Ile Pro Tyr Asn Tyr Pro 1595 1600 1605 Asp Met Ala His Met Met Thr Lys Ile Ile Arg Asn Arg Gly His 1610 1615 1620 Met Ser Tyr Asp Tyr Pro Lys Met Lys Lys Ser Leu Thr Phe Ser 1625 1630 1635 Met Thr Asp Met Ser Asp Ser Tyr Met Leu Asn Leu Phe Pro Lys 1640 1645 1650 Val Glu Cys Ser Tyr Met Ser Gly Tyr Leu Asp Lys Leu Asp Asp 1655 1660 1665 Thr Leu Gln Leu Leu Lys Lys Pro Pro Val Gly Arg Lys Val Pro 1670 1675 1680 Ser Val Ala Leu Pro Trp His His Cys Asn Arg Tyr Asn Phe Val 1685 1690 1695 Phe Ser Ser Thr Gly Cys Lys Val Ser Val Ile Asp Met Leu Pro 1700 1705 1710 Lys His Phe Arg Arg Ser Asn Leu Lys Val Ile Cys Phe Ile Gly 1715 1720 1725 Glu Gly Ala Gly Asn Leu Met Leu Arg Ala Val Leu Glu Val Gly 1730 1735 1740 Gly Asn Ile Lys Leu Ile Tyr Arg Ser Leu Lys Asp Pro Asp Asp 1745 1750 1755 His His Val Pro Val Glu Phe Leu Arg Leu Lys Pro Cys Tyr Pro 1760 1765 1770 Tyr Ile Asp Thr Gly Gly Ser Leu Ser Leu Ala Ser Thr Asp Ala 1775 1780 1785 Thr Asn Lys Ala His Trp Asp Tyr Leu His Leu His Trp Thr Asp 1790 1795 1800 Pro Leu Asn Leu Ile Val Cys Asp Ala Glu Ile Ser Gly Val Lys 1805 1810 1815 His Trp Leu Lys Ile Leu His Arg Trp Tyr Glu His Met Thr Ser 1820 1825 1830 Cys Lys His Cys Leu Lys Ser Glu His Asp Lys Tyr Leu Ile Ile 1835 1840 1845 Lys Tyr His Ala Gln Asp Asp Leu Ile Asp Leu Pro His Gly Val 1850 1855 1860 Arg Leu Leu Lys Cys Asn Ile Cys Leu Gly Ser Lys Leu Ser Gly 1865 1870 1875 Ser Glu Ser Tyr Leu Leu Ile Gly Leu Gly Leu Ser Asn Lys Leu 1880 1885 1890 Pro Val Tyr Ser Glu Val Leu His Ser Lys Leu Leu Leu Ala Glu 1895 1900 1905 Cys His Gln Phe His His Pro Lys Tyr Leu Asp Val Ser Gly Ile 1910 1915 1920 Asn Thr Asn Ile Lys Ser Leu Ile Pro Met Leu Asp Tyr Pro Ile 1925 1930 1935 Thr Tyr Asn Lys Ile Thr Thr Leu Leu Glu Ser Val Arg Glu Leu 1940 1945 1950 Ser Ser Asn Lys Asn Lys Asn Thr Met Trp Ile Gly Arg Asn Pro 1955 1960 1965 Val Tyr His Asn Lys Trp Leu Lys Arg Lys Tyr Phe Asn Ile Leu 1970 1975 1980 Lys Trp Leu Lys Tyr Cys Ile Glu Leu Pro Ala Phe Arg Met Asp 1985 1990 1995 Tyr Asn Ser Phe Glu Arg Ile Glu Met Leu Tyr Pro Asn Leu Arg 2000 2005 2010 Asp Leu Val Asp Ser Val Ser Thr Ser Glu Leu Lys Lys Val Ile 2015 2020 2025 Lys Val Thr Gly Ile Leu Phe Arg Ser Asn Thr Met 2030 2035 2040 <210> 54 <211> 1728 <212> DNA <213> Human respiratory syncytial virus <400> 54 atggaactgc tgatcctgaa agccaacgct attactacta tcctgaccgc cgtgacattt 60 tgcttcgcat ctggacagaa cattactgag gaattctacc agtcaacatg cagcgccgtg 120 tccaaaggat acctgagcgc cctgcggacc ggctggtata catcagtgat tactatcgag 180 ctgtccaaca tcaaggaaaa caaatgtaat gggaccgacg caaaggtgaa actgatcaag 240 caggagctgg ataagtacaa aaatgccgtg acagaactgc agctgctgat gcagtccaca 300 ccagcaacta acaatcgcgc ccggagagag ctgccccggt tcatgaacta taccctgaac 360 aatgctaaga aaaccaatgt gacactgtcc aagaaacgca agaggcgctt cctgggattt 420 ctgctgggcg tggggtctgc catcgctagt ggagtggccg tctctaaagt cctgcacctg 480 gagggcgaag tgaacaagat caaaagcgcc ctgctgtcca ctaacaaggc agtggtcagt 540 ctgtcaaatg gcgtgtccgt cctgacctct aaggtgctgg acctgaaaaa ttatattgat 600 aagcagctgc tgcctatcgt caacaaacag agctgctcca tttctaatat cgagacagtg 660 atcgaattcc agcagaagaa caatagactg ctggagatta ccagagagtt cagcgtgaac 720 gccggcgtca ccacacccgt gtccacctac atgctgacaa atagtgagct gctgtcactg 780 attaacgaca tgcctatcac caatgatcag aagaaactga tgtccaacaa tgtgcagatc 840 gtcagacagc agagttactc aatcatgtct atcattaagg aggaagtcct ggcctacgtg 900 gtccagctgc cactgtatgg cgtgatcgac accccctgct ggaaactgca tacatctcct 960 ctgtgcacta ccaacacaaa ggaaggaagt aatatctgcc tgactcgaac cgaccgggga 1020 tggtactgtg ataacgcagg cagcgtgtcc ttctttccac aggccgagac ctgcaaggtc 1080 cagagcaaca gggtgttctg tgacactatg aatagcctga ccctgccttc cgaagtcaac 1140 ctgtgcaatg tggacatctt taatccaaag tacgattgta agatcatgac tagcaagacc 1200 gatgtcagct cctctgtgat tacttctctg ggggccatcg tgagttgcta cggaaagaca 1260 aaatgtactg ccagcaacaa aaatcgcggc atcattaaga ccttctccaa cgggtgcgac 1320 tatgtctcta acaagggcgt ggatacagtg agtgtcggga acactctgta ctatgtcaat 1380 aagcaggagg gaaaaagcct gtacgtgaag ggcgaaccca tcattaactt ctatgacccc 1440 ctggtgttcc cttccgacga gtttgatgca tctattagtc aggtgaacga aaaaatcaat 1500 cagagtctgg cctttattcg gaagtcagat gagctgctgc acaacgtgaa tgctggcaaa 1560 tctacaacta acatcatgat caccacaatc atcatcgtga ttatcgtcat tctgctgtca 1620 ctgatcgctg tggggctgct gctgtactgt aaggcaagaa gcaccccagt cactctgtca 1680 aaagaccagc tgtcagggat taacaacatt gccttcagta actgatag 1728 <210> 55 <211> 574 <212> PRT <213> Human respiratory syncytial virus <400> 55 Put Glu Leu Leu Ile Leu Lys Ala Asn Ala Ile Thr Thr Ile Leu Thr 1 5 10 15 Ala Val Thr Phe Cys Phe Ala Ser Gly Gln Asn Ile Thr Glu Glu Phe 20 25 30 Tyr Gln Ser Thr Cys Ser Ala Val Ser Lys Gly Tyr Leu Ser Ala Leu 35 40 45 Arg Thr Gly Trp Tyr Thr Ser Val Ile Thr Ile Glu Leu Ser Asn Ile 50 55 60 Lys Glu Asn Lys Cys Asn Gly Thr Asp Ala Lys Val Lys Leu Ile Lys 65 70 75 80 Gln Glu Leu Asp Lys Tyr Lys Asn Ala Val Thr Glu Leu Gln Leu Leu 85 90 95 Met Gln Ser Thr Pro Ala Thr Asn Asn Arg Ala Arg Arg Glu Leu Pro 100 105 110 Arg Phe Met Asn Tyr Thr Leu Asn Asn Ala Lys Lys Thr Asn Val Thr 115 120 125 Leu Ser Lys Lys Arg Lys Arg Arg Phe Leu Gly Phe Leu Leu Gly Val 130 135 140 Gly Ser Ala Ile Ala Ser Gly Val Ala Val Ser Lys Val Leu His Leu 145 150 155 160 Glu Gly Glu Val Asn Lys Ile Lys Ser Ala Leu Leu Ser Thr Asn Lys 165 170 175 Ala Val Val Ser Leu Ser Asn Gly Val Ser Val Leu Thr Ser Lys Val 180 185 190 Leu Asp Leu Lys Asn Tyr Ile Asp Lys Gln Leu Leu Pro Ile Val Asn 195 200 205 Lys Gln Ser Cys Ser Ile Ser Asn Ile Glu Thr Val Ile Glu Phe Gln 210 215 220 Gln Lys Asn Asn Arg Leu Leu Glu Ile Thr Arg Glu Phe Ser Val Asn 225 230 235 240 Ala Gly Val Thr Thr Pro Val Ser Thr Tyr Met Leu Thr Asn Ser Glu 245 250 255 Leu Leu Ser Leu Ile Asn Asp Met Pro Ile Thr Asn Asp Gln Lys Lys 260 265 270 Leu Met Ser Asn Asn Val Gln Ile Val Arg Gln Gln Ser Tyr Ser Ile 275 280 285 Met Ser Ile Ile Lys Glu Glu Val Leu Ala Tyr Val Val Gln Leu Pro 290 295 300 Leu Tyr Gly Val Ile Asp Thr Pro Cys Trp Lys Leu His Thr Ser Pro 305 310 315 320 Leu Cys Thr Thr Asn Thr Lys Glu Gly Ser Asn Ile Cys Leu Thr Arg 325 330 335 Thr Asp Arg Gly Trp Tyr Cys Asp Asn Ala Gly Ser Val Ser Phe Phe 340 345 350 Pro Gln Ala Glu Thr Cys Lys Val Gln Ser Asn Arg Val Phe Cys Asp 355 360 365 Thr Met Asn Ser Leu Thr Leu Pro Ser Glu Val Asn Leu Cys Asn Val 370 375 380 Asp Ile Phe Asn Pro Lys Tyr Asp Cys Lys Ile Met Thr Ser Lys Thr 385 390 395 400 Asp Val Ser Ser Ser Val Ile Thr Ser Leu Gly Ala Ile Val Ser Cys 405 410 415 Tyr Gly Lys Thr Lys Cys Thr Ala Ser Asn Lys Asn Arg Gly Ile Ile 420 425 430 Lys Thr Phe Ser Asn Gly Cys Asp Tyr Val Ser Asn Lys Gly Val Asp 435 440 445 Thr Val Ser Val Gly Asn Thr Leu Tyr Tyr Val Asn Lys Gln Glu Gly 450 455 460 Lys Ser Leu Tyr Val Lys Gly Glu Pro Ile Ile Asn Phe Tyr Asp Pro 465 470 475 480 Leu Val Phe Pro Ser Asp Glu Phe Asp Ala Ser Ile Ser Gln Val Asn 485 490 495 Glu Lys Ile Asn Gln Ser Leu Ala Phe Ile Arg Lys Ser Asp Glu Leu 500 505 510 Leu His Asn Val Asn Ala Gly Lys Ser Thr Thr Asn Ile Met Ile Thr 515 520 525 Thr Ile Ile Ile Val Ile Ile Val Ile Leu Leu Ser Leu Ile Ala Val 530 535 540 Gly Leu Leu Leu Tyr Cys Lys Ala Arg Ser Thr Pro Val Thr Leu Ser 545,550,555,560 Lys Asp Gln Leu Ser Gly Ile Asn Asn Ile Ala Phe Ser Asn 565 570 <210> 56 <211> 1725 <212> DNA <213> Human respiratory syncytial virus <400> 56 atggagttgc taatcctcaa agcaaatgca attaccacaa tcctcactgc agtcacattt 60 tgttttgctt ctggtcaaaa catcactgaa gaattttatc aatcaacatg cagtgcagtt 120 agcaaaggct atcttagtgc tctgagaact ggttggtata ccagtggtat aactatagaa 180 ttaagtaata tcaagaaaaa taagtgtaat ggaacagatg ctaaggtaaa attgataaaaa 240 caagaattag ataataataa aaatgctgta acagaattgc agttgctcat gcaaagcaca 300 caagcaacaa acaatcgagc cagaagagaa ctaccaaggt ttatgaatta tacactcaac 360 aatgccaaaa aaaccaatgt aacattaagc aagaaaagga aaagaagatt tcttggtttt 420 ttgttaggtg ttggatctgc aatcgccagt ggcgttgctg tatctaaggt cctgcaccta 480 gaaggggaag tgaacaagat caaaagtgct ctactatcca caaacaaggc tgtagtcagc 540 ttatcaaatg gagttagtgt tttaaccagc aaagtgttag acctcaaaaa ctatatagat 600 aaacaattgt tacctattgt gaacaagcaa agctgcagca tatcaaatat agaaactgtg 660 atagagttcc aacaaaagaa caacagacta ctagagatta ccagggaatt tagtgttaat 720 gcaggcgtaa ctacacctgt aagcacttac atgttaacta atagtgaatt attgtcatta 780 atcaatgata tgcctataac aaatgatcag aaaaagttaa tgtccaacaa tgttcaaata 840 gttagacagc aaagttactc tatcatgtcc ataataaaag aggaagtctt agcatatgta 900 gtacaattac cactatatgg tgttatagat acaccctgtt ggaaactaca cacatcccct 960 ctatgtacaa ccaacacaaa agaagggtcc aacatctgtt taacaagaac tgacagagga 1020 tggtactgtg acatgcagg atcagtatct ttctcccac aagctgaaac atgtaagtt 1080 caatcaatc gagtatttg tgacacaatg aacagtttaa cattaccaag tgagtaat 1140 ctctgcaatg ttgacatatt caacccaaa tatgattgta aaattatgac ttcaaaaca 1200 gatgtaagca gctccgttat cacatctcta ggagccattg tgtcatgcta tggcaaact 1260 aaatgtacag catccaataa aaatcgtgga atcataaga cattttctaa cgggtgcgat 1320 tatgtatcaa ataaggggt ggacactgtg tctgtaggta acacattata ttatgtaaat 1380 aagcaagaag gtaaaagtct ctatgtaaaa ggtgaaccaa tataaattt ctatgaccca 1440 ttagtattcc cctctgatga atttgatgca tcaatctc aagtcaacga gagattaac 1500 cagagcctag catttattcg taatccgat gatttattac atatgtaaa tgctggtaaa 1560 tccaccacaa attcatgat aactactata attatagtga ttatagtaat attgttatca 1620 ttaattgctg ttggactgct cttatactgt aaggccagaa gcacaccagt cacactaagc 1680 aagatcac tgagtggtat aaatatatt gcatttagta actaa 1725 <210> 57 <211> 574 <212> PRT <213> Human respiratory syncytial virus <400> 57 Met Glu Leu Leu Ile Leu Lys Ala Asn Ala Ile Thr Thr Ile Leu Thr 1 5 10 15 Ala Val Thr Phe Cys Phe Ala Ser Gly Gln Asn Ile Thr Glu Glu Phe 20 25 30 Tyr Gln Ser Thr Cys Ser Ala Val Ser Lys Gly Tyr Leu Ser Ala Leu 35 40 45 Arg Thr Gly Trp Tyr Thr Ser Val Ile Thr Ile Glu Leu Ser Asn Ile 50 55 60 Lys Lys Asn Lys Cys Asn Gly Thr Asp Ala Lys Val Lys Leu Ile Lys 65 70 75 80 Gln Glu Leu Asp Lys Tyr Lys Asn Ala Val Thr Glu Leu Gln Leu Leu 85 90 95 Met Gln Ser Thr Gln Ala Thr Asn Asn Arg Ala Arg Arg Glu Leu Pro 100 105 110 Arg Phe Met Asn Tyr Thr Leu Asn Asn Ala Lys Lys Thr Asn Val Thr 115 120 125 Leu Ser Lys Lys Arg Lys Arg Arg Phe Leu Gly Phe Leu Leu Gly Val 130 135 140 Gly Ser Ala Ile Ala Ser Gly Val Ala Val Ser Lys Val Leu His Leu 145 150 155 160 Glu Gly Glu Val Asn Lys Ile Lys Ser Ala Leu Leu Ser Thr Asn Lys 165 170 175 Ala Val Val Ser Leu Ser Asn Gly Val Ser Val Leu Thr Ser Lys Val 180 185 190 Leu Asp Leu Lys Asn Tyr Ile Asp Lys Gln Leu Leu Pro Ile Val Asn 195 200 205 Lys Gln Ser Cys Ser Ile Ser Asn Ile Glu Thr Val Ile Glu Phe Gln 210 215 220 Gln Lys Asn Asn Arg Leu Leu Glu Ile Thr Arg Glu Phe Ser Val Asn 225 230 235 240 Ala Gly Val Thr Thr Pro Val Ser Thr Tyr Met Leu Thr Asn Ser Glu 245 250 255 Leu Leu Ser Leu Ile Asn Asp Met Pro Ile Thr Asn Asp Gln Lys Lys 260 265 270 Leu Met Ser Asn Asn Val Gln Ile Val Arg Gln Gln Ser Tyr Ser Ile 275 280 285 Met Ser Ile Ile Lys Glu Glu Val Leu Ala Tyr Val Val Gln Leu Pro 290 295 300 Leu Tyr Gly Val Ile Asp Thr Pro Cys Trp Lys Leu His Thr Ser Pro 305 310 315 320 Leu Cys Thr Thr Asn Thr Lys Glu Gly Ser Asn Ile Cys Leu Thr Arg 325 330 335 Thr Asp Arg Gly Trp Tyr Cys Asp Asn Ala Gly Ser Val Ser Phe Phe 340 345 350 Pro Gln Ala Glu Thr Cys Lys Val Gln Ser Asn Arg Val Phe Cys Asp 355 360 365 Thr Met Asn Ser Leu Thr Leu Pro Ser Glu Val Asn Leu Cys Asn Val 370 375 380 Asp Ile Phe Asn Pro Lys Tyr Asp Cys Lys Ile Met Thr Ser Lys Thr 385 390 395 400 Asp Val Ser Ser Ser Val Ile Thr Ser Leu Gly Ala Ile Val Ser Cys 405 410 415 Tyr Gly Lys Thr Lys Cys Thr Ala Ser Asn Lys Asn Arg Gly Ile Ile 420 425 430 Lys Thr Phe Ser Asn Gly Cys Asp Tyr Val Ser Asn Lys Gly Val Asp 435 440 445 Thr Val Ser Val Gly Asn Thr Leu Tyr Tyr Val Asn Lys Gln Glu Gly 450 455 460 Lys Ser Leu Tyr Val Lys Gly Glu Pro Ile Ile Asn Phe Tyr Asp Pro 465 470 475 480 Leu Val Phe Pro Ser Asp Glu Phe Asp Ala Ser Ile Ser Gln Val Asn 485,490,495 Glu Lys With Asn Gln Ser Leu Ala Phe With Arg Lys Ser Asp Glu Leu 500 505 510 Leu His Asn Val Asn Ala Gly Lys Ser Thr Thr Asn Ile Met Ile Thr 515,520,525 Thr Country To Val Country To Val Could Be Country Country Val 530 535 540 Gly Leu Leu Tyr Cys Ala Arg Server Thr Pro Val Thr Leu Ser 545 550 555 560 Lys Asp Gln Leu Served Gly Ile Asn Ile Ala Phe Served Asn 565,570 <210> 58 <211> 1725 <212> DNA <213> Human respiratory syncytial virus <400> 58 atggagctgc tgatccacag gttaagtgca atcttcctaa ctcttgctat taatgcattg 60 tacctcacct caagtcagaa catactgag gagttttacc aatcgacatg tagtgcagtt 120 agcagaggtt attttagtgc tttagaaca ggttggtata ccagtgtcat aacaatagaa 180 ttaagtaata taaaagaaac aaatgcaat ggaactgaca ctaagtaa acttaaaa 240 acattag atagtataa gatgcagtg acaattac agctactt gcaaaaca 300 ccagctgcca acaacggggc cagagagaa gcaccacagt attgaacta tacaatcaat 360 accactaaaacctaaatgt atcaataagc agagagga aacgaagatt tctgggcttc 420 ttgttaggtg taggatctgc atagcaagt ggtatagctg tatccaagt tctacacctt 480 gaaggagaag tgaacagat caaaatgct ttgttatcta caaaaagc tgtagtcagt 540 ctatcaaatg gggtcagtgt ttaccagc aaagtgttag atctcaagaa ttacataaat 600 aaccaattat taccatagt aaatcacag agctgtcgca tctccacat tgaacagtt 660 atagaatttcc agcagaagaa cagcagattg ttggaatca acagagaatt cagtgtcaat 720 gcaggtgtaa caaccttt aagcacttac atgttaacaa acagtgagtt actatcattg 780 atcaatgata tgcctataac aaatgatcag aaaaaattaa tgtcaagcaa tgttcagata 840 gtaaggcaac aaagttattc tatcatgtct ataataaagg aagaagtcct tgcatatgtt 900 gtacagctac ctatctatgg tgtaatagat acaccttgct ggaaattaca cacatcacct 960 ctatgcacca ccaacatcaa agaaggatca aatatttgtt taacaaggac tgatagagga 1020 tggtattgtg ataatgcagg atcagtatcc ttctttccac aggctgacac ttgtaaagta 1080 cagtccaatc gagtattttg tgacactatg aacagtttga cattaccaag tgaagtcagc 1140 cttgtaaca ctgacatatt caattccaag tatgactgca aaattatgac atcaaaaaca 1200 gacataagca gctcagtaat tacttctctt ggagctatag tgtcatgcta tggtaaaact 1260 aaatgcactg catccaacaa aaatcgtggg attataaaga cattttctaa tggttgtgac 1320 tatgtgtcaa acaaaggagt agatactgtg tcagtgggca acactttata ctatgtaaac 1380 aagctggaag gcaagaacct ttatgtaaaa ggggaaccta tataaatta ctatgaccct 1440 ctagtgtttc cttctgatga gtttgatgca tcaatatctc aagtcaatga aaaaatcaat 1500 caagtttag cttttattcg tagactgat gattactac atatgtaaa tactggcaaa 1560 tctacacaa atttatgat actacaatt atttagta tcattgtagt attgttatca 1620 ttaatagcta ttggtttgct gttgtattgc aaagccaaa accaccagt tacactaagc 1680 aagaccaac tagtgt caatatt gcattcagca atag 1725 <210> 59 <211> 574 <212> PRT <213> Human respiratory syncytial virus <400> 59 Met Glu Leu Leu Ile His Arg Leu Ser Ala Ile Phe Leu Leu Thr Leu Ala 1 5 10 15 Gln Asn with Tyr and Three Ser Ser Gln Asn with Glu Glu Phe 20 25 30 Tyr Gln Ser Thr Cys Ser Ala Val Ser Arg Gly Tyr Phe Ser Ala Leu 35 40 45 Arg Thr Gly Trp Tyr Thr Ser Val Ile Thr Ile Glu Leu Ser Asn Ile 50 55 60 Lys Glu Thr Lys Cys Asn Gly Thr Asp Thr Lys Val Lys Leu Ile Lys 65 70 75 80 Gln Glu Leu Asp Lys Tyr Lys Asn Ala Val Thr Glu Leu Gln Leu Leu 85 90 95 Met Gln Asn Thr Pro Ala Ala Asn Asn Arg Ala Arg Arg Glu Ala Pro 100 105 110 Gln Tyr Met Asn Tyr Thr Ile Asn Thr Thr Lys Asn Leu Asn Val Ser 115 120 125 Ile Ser Lys Lys Arg Lys Arg Arg Phe Leu Gly Phe Leu Leu Gly Val 130 135 140 Gly Ser Ala Ile Ala Ser Gly Ile Ala Val Ser Lys Val Leu His Leu 145 150 155 160 Glu Gly Glu Val Asn Lys Ile Lys Asn Ala Leu Leu Ser Thr Asn Lys 165 170 175 Ala Val Val Ser Leu Ser Asn Gly Val Ser Val Leu Thr Ser Lys Val 180 185 190 Leu Asp Leu Lys Asn Tyr Ile Asn Asn Gln Leu Leu Pro Ile Val Asn 195 200 205 Gln Gln Ser Cys Arg Ile Ser Asn Ile Glu Thr Val Ile Glu Phe Gln 210 215 220 Gln Lys Asn Ser Arg Leu Leu Glu Ile Asn Arg Glu Phe Ser Val Asn 225 230 235 240 Ala Gly Val Thr Thr Pro Leu Ser Thr Tyr Met Leu Thr Asn Ser Glu 245 250 255 Leu Leu Ser Leu Ile Asn Asp Met Pro Ile Thr Asn Asp Gln Lys Lys 260 265 270 Leu Met Ser Ser Asn Val Gln Ile Val Arg Gln Gln Ser Tyr Ser Ile 275 280 285 Met Ser Ile Ile Lys Glu Glu Val Leu Ala Tyr Val Val Gln Leu Pro 290 295 300 Ile Tyr Gly Val Ile Asp Thr Pro Cys Trp Lys Leu His Thr Ser Pro 305 310 315 320 Leu Cys Thr Thr Asn Ile Lys Glu Gly Ser Asn Ile Cys Leu Thr Arg 325 330 335 Thr Asp Arg Gly Trp Tyr Cys Asp Asn Ala Gly Ser Val Ser Phe Phe 340 345 350 Pro Gln Ala Asp Thr Cys Lys Val Gln Ser Asn Arg Val Phe Cys Asp 355 360 365 Thr Met Asn Ser Leu Thr Leu Pro Ser Glu Val Ser Leu Cys Asn Thr 370 375 380 Asp Ile Phe Asn Ser Lys Tyr Asp Cys Lys Ile Met Thr Ser Lys Thr 385 390 395 400 Asp Ile Ser Ser Ser Val Ile Thr Ser Leu Gly Ala Ile Val Ser Cys 405 410 415 Tyr Gly Lys Thr Lys Cys Thr Ala Ser Asn Lys Asn Arg Gly Ile Ile 420 425 430 Lys Thr Phe Ser Asn Gly Cys Asp Tyr Val Ser Asn Lys Gly Val Asp 435 440 445 Thr Val Ser Val Gly Asn Thr Leu Tyr Tyr Val Asn Lys Leu Glu Gly 450 455 460 Lys Asn Leu Tyr Val Lys Gly Glu Pro Ile Ile Asn Tyr Tyr Asp Pro 465 470 475 480 Leu Val Phe Pro Ser Asp Glu Phe Asp Ala Ser Ile Ser Gln Val Asn 485 490 495 Glu Lys Ile Asn Gln Ser Leu Ala Phe Ile Arg Arg Ser Asp Glu Leu 500 505 510 Leu His Asn Val Asn Thr Gly Lys Ser Thr Thr Asn Ile Met Ile Thr 515 520 525 Thr Ile Ile Ile Val Ile Ile Val Val Leu Leu Ser Leu Ile Ala Ile 530 535 540 Gly Leu Leu Leu Tyr Cys Lys Ala Lys Asn Thr Pro Val Thr Leu Ser 545 550 555 560 Lys Asp Gln Leu Ser Gly Ile Asn Asn Ile Ala Phe Ser Lys 565 570 <210> 60 <211> 16658 <212> DNA <213> Artificial Sequence <220> <223> Chimeric vector <400> 60 acgcgaaaaa atgcataaca aaactatcaa cctgaaaaaa gttaggacaa gtgaagattg 60 ctagtccgcc gccaccatgg aactgctgat cctgaaagcc aacgctatta ctactatcct 120 gaccgccgtg acattttgct tcgcatctgg acagaacatt actgaggaat tctaccagtc 180 aacatgcagc gccgtgtcca aaggatacct gagcgccctg cggaccggct ggtatacatc 240 agtgattact atcgagctgt ccaacatcaa ggaaaacaaa tgtaatggga ccgacgcaaa 300 ggtgaaactg atcaagcagg agctggataa gtacaaaaat gccgtgacag aactgcagct 360 gctgatgcag tccacaccag caactaacaa tcgcgcccgg agagagctgc cccggttcat 420 gaactatacc ctgaacaatg ctaagaaaac caatgtgaca ctgtccaaga aacgcaagag 480 gcgcttcctg ggatttctgc tgggcgtggg gtctgccatc gctagtggag tggccgtctc 540 600 caagcagtg gtcagtctgt caaatggcgt gtccgtcctg acctctaagg tgctggacct 660 gaaaattat attgataagc agctgctgcc tatcgtcaac aaacagagct gctccatttc 720 tatatcgag acagtgatcg aattccagca gaagaacaat agactgctgg agattaccag 780 agagttcagc gtgaacgccg gcgtcaccac acccgtgtcc acctacatgc tgaaatag 840 tgagctgctg tcactgatta acgacatgcc tatcaccaat gatcaaga aactgatgtc 900 960 agtcctggcc tacgtggtcc agctgccact gtatggcgtg atcgacaccc cctgctggaa 1020 actgcataca tctcctctgt gcactaccaa caaaaaa ggagaataa tctgcctgac 1080 tcgaaccgac cggggatggt actgtgataa cgcaggcagc gtgtccttct ttccacaggc 1140 cgagacctgc aaggtccaga gcaacagggt gttctgtgac actatgaata gcctgaccct 1200 gccttccgaa gtcaacctgt gcaatgtgga catctttaat ccaaagtacg attgtaagat catgactagc aagaccgatg tcagctcctc tgtgattact tctctggggg ccatcgtgag ttgctacgga aagacaaaat gtactgccag caacaaaaat cgcggcatca ttaagacctt ctccaacggg tgcgactatg tctctaacaa gggcgtggat acagtgagtg tcgggaacac tctgtactat gtcaataagc aggggaaa aagcctgtac gtgaaggggcg aacccatcat taacttctat gaccccctgg tgttcccttc cgacgagttt gatgcatcta ttagtcaggt gacgaaaaa atcaatcaga gtctggcctt tattcggaag tcagatgagc tgctgcacaa cgtgaatgct ggcaaatcta caactaacat catgatcacc acaatcatca tcgtgattat cgtcattctg ctgtcactga tcgctgtggg gctgctgctg tactgtaagg caagaagcac cccagtcact ctgtcaaaag accagctgtc agggattaac aacattgcct tcagtaactg 1860. 1860. 1860. 1860. 1860. 1860. 1860. 1860. 1860. 1860. 1860. 1860 tgtgatgatg gagcttgatt atggtggacg agctgcatgg ctggcattcc acataaccaa ctttgatagg tcagatttgg aaactatcct aagaggtgct agggtgtgca atacatggca 1980 agatcagaga ctctccgtgt accttgtggg aagggattgc aatttgttaa gaccattgtgt 2040 gcaagctgcc aaatttatcc ataatactag gagaggccaa acattaacac attggttcac 2100 aaaaaattc gtgtttagtt ctacagggca agagacagag cctcccattg accccacatg 2160 tgagctgttg gtagagctga tcagtggtta agatgacagc acattatgta gttaattaaa 2220 acaaagggta ggacaagtcc taatgtccac agctatgaac aagttcactc agaccatctc 2280 taaacctgcc actatcttga atattcaga cagtgaagag tcgggcgatg aggcaggggt 2340 gggcaaggtg tcccgtacca cacagagctc agagaggtgg cttgatttgc tcattgaaaa 2400 gttccagccg agcctacaaa acatcactag atacatcaac tggaacttca tcaggatctg 2460 caatgatagg cttaaaaaag aaaaaatggg gtacattgag gccaagcaat atgtggaaga 2520 catggcttgg atggtgatag catctgaggc agacagcatt gagtggaagt gcataaggag 2580 gcaggagaaa gtgactgggg tgaaataccc aaagttcttc tttgtacaac acaaagagga 2640 ctggattgag tgcacaggat gcattccgta cccaggccat gacttgatct atgatgagga 2700 tgatgatgac tgagctgact cagatcactc caaccagcag agagatccac cacctatagc 2760 aagtgatgta gtatttagtc tatgattagt tatagaaaaa cattaggata aatacacatc 2820 ctaggccggg ccaaaatgtc tctagacaga ttgaagctca atgatgtctc aaacaaggat 2880 agcctgctgt ccaactgcaa atacagtgtt accagatcca caggcgatgt aaccagtgtg 2940 tctggtcatg ctatgcagaa agcccttgca aggacactcg gcatgttctt acttactgcc 3000 ttcaaccgtt gcgaagaagt ggcagaaata gggctccaat atgccatgtc cttgctaggc 3060 agagatgata gcatcaagat attaagagaa gccggctaca atgtaaaatg tgtggacaca 3120 cagctcaagg actttacaat caaattacaa ggaaaggaat acaaaataca agtcctagat 3180 atagtgggaa tagatgcagc caatttagct gatctagaga tacaagccag aggagtggta 3240 gcaaaagaac tcaaaacagg agccaggcta cctgacaatc ggaggcatga tgcaccagat 3300 tgtggtgtga tagttctctg tattgcagca ttagttgttt ccaaattagc tgcaggggac 3360 aggggaggac ttgatgctgt ggaaagaagg gctttaaatg tgctgaaagc cgagaaagcc 3420 aggtacccca acatggaggt caagcagata gctgaaagtt tttatgatct gtttgaaagg 3480 aagccttatt acattgatgt cttcatcact tttggcctgg cccagtctag tgtcaaggga 3540 ggcagcaaag ttgaggggct gttttcaggt ctcttcatga atgcatacgg ggcaggacaa 3600 gttatgctga ggtggggtt actggcaaaa tctgtcaaga acatcatgct aggccatgct 3660 agtgtacaag ctgagatgga acaggtggtt gaggtttacg aatatgctca gaagcaagga 3720 ggggaggcag gattctatca catcagaaat aatccaaaag cttcacttct ctctttgacc 3780 aattgtccta atttcaccag tgttgtgctt ggcaatgctg caggtttagg catcataggg 3840 tcatataagg gtgctcctag gaatagagaa ctctttgatg ctgccaaaga ttatgcagaa 3900 agattaaagg acaacaatgt aattaactac agtgcattaa acttgactgc agaagaaaga 3960 gagctgatca gccagcagct gaacattgtt gatgacactc ctgatgatga tatttaatta 4020 aaactggaaa atgtaggata aatatggaga aattcgcccc cgaatttgtt ggcgaggatg 4080 ctaacaagaa ggcagaggag ttctcaac atagatcctt cccttcggaa aaaccactag 4140 ctggtatacc gaacactgcc actcatgtca ccaaatata catgccccct atattgcgta 4200 gctcattcaa actcccttcc ccgagagttg ctgcaatct tactgaaccc tctgctcccc 4260 ctaccactcc accaccaca cctccccaga ashaggaga gcagcccaaa gagtctgatg 4320 ttgacattga gactatgcat gtctgtagg ttcctgacaa tccgacac agcagaagc 4380 catgctgctc agatgatacc gatactaaga aaactaggaa gccgatgtc acctttgtgg 4440 aacccgagga gaatttgtc ggattgggag ctagcttgta cagggacc atgcagacct 4500 ttgctgctga tggttatgat gagaaagca acctacgtt tgaggact aaccaagagc 4560 cggggttcttc atctgtagaa caagactag atagataga ggagaattg tcctacataa 4620 taggcctttt aaacaccata atggtagcga ctgctggacc taccactgct agagatgaga 4680 ttagagatgc ccttataggc actagagaag aacttattga gatgatcaag tctgacatct 4740 tgactgtcaa tgacagaata gtggccatgg agaagctcag agatgaggaa tgctccagag 4800 ctgacactga tgatggatca gcctgttat taacagacag agcaaggata ctagataaga 4860 tagtgtccag caatgctgaa gaggctaagg aagatttgga tgttgatgac atcatgggca 4920 ttaattttta gttaattaaa ataacaacag gacaaataat ggaggcctac ttggtagaga 4980 tgtaccatgg tgtcccatat acagctgcag tacagctaaaa cttggttgaa aaacattcag 5040 ccaacatatc actaactgtg tggataccga tgtttcaaac atctctacca aagaactccg 5100 ttatggacct gctacatgat gttacagtca tttgtacaca gatatcaaca gtgcatggtc 5160 ccatgatcaa ggtagatctg agctcttcca atgcaggttt agctaccatg ccaaggcaat 5220 tcttgataaa tgctatcata gctttggatg actggggcaa catggattac gaagtgcctg 5280 ttgcttttga taaaaagagc ttctgtgtga caattcttaa gcctaaaaac atgctttaca 5340 ctgtacccag cattactccc actaatcgac ctactcatga gctgatagct gtctgctctt 5400 tccataacag ggtaacatta aagtcattca atatacctgt cttcatcaga gcactgtcta 5460 tcagacagca ggaccttgat agtgtggagc aggctataag ctccgatgtg gaccatgcta 5520 taacaacagc tagggtggct ccctatgcag ggcttacact tgtgatcaac atcacatcca 5580 ccaaaggagc attcaaactg ctaaaggcag gtagtcagat tcttgcagaa ctgggtccct 5640 atctgacgca ggtgagccta catgatgtga ttatgaactg gaaacataca ggcacttcct 5700 acatactcaa gagctcctca acaagtggat gaaaaagaga aagtcaccat tgatcagctc 5760 aatccacaac tacaacccca cgatttcaca cagcacaaca accaccgcca ccaacatcca 5820 catgacaacc acacatacac acccacatac atatatacac atatcttagt taaataaaat 5880 caggataaat aatggatcct aacatgacct cacaccagat caccctcgag atcaacatga 5940 ccagcagccg tattggcaca tacactacac cagccccaac agctcttctc cttgcatgtg 6000 ccgtcatcaa cacagtgtgt gcgctgataa tggcctgcag cagtagaagc actgccacat 6060 caggcattgt cagcagccaa tgcacagttc atcccaatca ccctccacca agttatggcg 6120 tcaatgtaac tggtctgccg ggtaacctat actcaaggaa cactacataa cattataaat 6180 aacagaaatt atccttcaat aaaccccagg ccagacagct ttaccctgct agacgattca 6240 atcagccctt gcagtatgtc gtctagttaa caaaaaaccg gtaggataag tactatccta 6300 ttggaaccaa acgagacctg tagagcagct cacacaagag aaccacaagc tgacttcacc 6360 tagtatggga aggaacttag aagtgagtgg cagcattacc aatttgaact ttgagagaac 6420 tcagcatcct gacacattta ggactgttgt aaaagtgaac caaatgtgta agcttattgc 6480 aggtgtgctc acaagtgctg ctgtggcagt ttgtgtgggg gtcataatgt attctgtttt 6540 cacatcaaac cacaaggcca actccacgca gaatgccacg acccggaaca gcacatccac 6600 ccctccccaa ccaaccgccg gtctgcccac cacagagcaa gggaccatcc ccagattcac 6660 caaacccccc accaaaaccg ccacccacca tgagatcaca gagcccgtca aaatggcaac 6720 accttcagag gatccctacc aatgctccag caatggttat ttggaccgac ctgatttacc 6780 tgaaaatttc aaactcgtat tggatgttat atgcaagcct ccaggtcctg aacatcacaa 6840 caccagctgt tatgagaaac gtgaaatcaa cccaggaagt gtttgccctg atcttgtaac 6900 aatgaaggca aacatgggct taaacaatgg tggtggggag gatgctgcac cttatataga 6960 ggttaccacc ctttctacgt actccaacaa aagggcaatg tgtgtccaca atgggtgtga tcaaggcttc tgtttcttcc tttctggttt aagcactgat caggagagag ctgtgctaga 7080. gcttggaggt caacaggcta tcatggagtt gcattatgat tcctactgga aacactattg gagtaactct aattgtgttg ttcccagaac aaactgcaac ctgacagacc aaactgagat tttgtttcct aggtttaaca acaagaatca gtctcagtgt accacctgtg cagattcagc tggcctagat aacaaatttt atctcacatg tgatgggctt ttaagaaccc tccctctagt tggactaccc agcctaagtc ctcaggctta caaagctgta cccacacaaa ctacaggcac 7440. s.c.s.s.s.s.s.s.s.s.s.s.s.s.s.s.s.s cons tctcagtcgg aagagagag ctttatgtgg tgtagactca agcagagaac ccaaaccaac aatgccttac tggtgtccta tgctccaatt atttccaagg aggtctaatt cttaagtgac ctattcctga attack attack caaccttatc attack attack ctttgatata ataggacaaa ttgattcct ggcaggatct ttctagtcct tctggtgatc ttcaacacca agccaattca cccaaataca ttaacagaaa aattctatga gtccacatgt 7740 agtgttgaga ctgcaggtta taagagtgcc cttagaacag gttggcatat gacagttatg 7800 tcaattaagt tgtctcaaat aaatattgag tcatgcaaga gcagcaactc gttatggct 7860 catgagcttg caatctatag tagtgcagtg gatgaattga gaacgttatc atccaatgcc 7920 ttgaagtcca your area gaggttcctc ggtttgattc ttggtctcgg agctgcagtc 7980 actgccgggg tggctttagc caagacagtg caacttgaaa gtgagattgc attgattaga 8040 gatgcagtga gaataaaa tgaggctgtt gttagcctaa ccaacggcat gtcagtgttg 8100 gctaaagtgg tggatgattt gaaaaacttc atatctaaag aattactccc aaaaaaaaac 8160 cgagtctctt gtgatgtgca cgacatcact gccgtcatta gattccaaca gctcaacaaa 8220 agacttttgg aagtatctcg tgaattttca tctaatgcag gattaacaca cactgtttca 8280 tcttttatgt taacagaccg ggaactcacc tccattgtag gcggcatggc tgtttcagca 8340 ggccaaaaag agataatgct atctagcaaa gctataatga gaagaaatgg gttagcaata 8400 ttaagttcag tcaacgctga cacactggtt tatgtaatac aactcccatt atttggtgtt 8460 atggacacag attgttgggt aataagaagt tctagaact gtcataacat agcagacaag 8520 tatgcttgtt tggctagagc tgataatggc tggtattgtc acaatgctgg ctcattatca 8580 tacttccgt cgccaacgga ttgtgagatc cacaatgggt atgctttctg tgacactcta 8640 aaaagtctaa ctgtacctgt aacatcacga gaatgcaact caaacatgta taccactaac 8700 tacgattgta agatttccac aagtaaaaact tatgtgagta cagcggtact gactacaatg 8760 ggttgcttgg tatcttgtta tggtcataac agttgcacag tcatcaataa tgacaaaggt 8820 முக்குக்குக்கு ctctgccaga tggttgccac tacatctcca acaaaggtgt ggacagggtt 8880 caagtaggta acactgttta ctatcttagc aaagaagttg gcaagtcaat tgttgtcaga 8940 ggggaaccat tggtcttgaa atatgaccct ttgagtttcc ctgacgataa atttgatgtt 9000 gctataagag atgtggagca tagcatcaat cagacacgca cattcttgaa ggcctctgat 9060 cagttattgg acttaagtga aaacagagag aataaaaatt taaacaagtc atatatacta 9120 acaactctgc tcttcgttgt aatgcttatt ataataatgg ctgtcatagg gttcattctg 9180 tataaggtat tgaaaatgat cagagacaac aagttgaat ccaaagtac acctggccctc 9240 acagttttat catgacaatt gtaccaacc atattgagt tagttatta aaacttagg 9300 ataagtgaca atccagaccc aacaccctt tcaacctca aggataggt aggatgagtg 9360 tgagaccttg caatttgag gttcaagggt ttgttccag agggaggat tgcaagtata 9420 gtcataaata ttgggaatgg ccttgaaa ctcttatgct caggcagaac tacatgctta 9480 ataggatttta taggttccctc gacaccaca cagatgcaat gtcagatgtc agcggatttg 9540 atgcaccaca aaggactgct gagtatgcct tgggaaccat aggtgtgctg aaagttacc 9600 tggaaaaaac taacaacatc actaaatcaa tagcttgtgg cagtttgatc actgtattgc 9660 agaacttgga tgttggtcta gtatacaag cagagatag acacactgag vakacaatt 9720 acttgagaag ttgcaacact atactgtctt atatagacaa gatcacaag aagagacaa 9780 ttattcacat tctcaaaga ctgccagtag gagtactatg caatctgatc caatctgtca 9840 tctccatcga ggagaagata aattcttcta tgaaaacaga atgataaggc tgcctaaata 9900 ctatccagcc atactgcata agatgtatat tattagagta aatagaaacc tcacttacga 9960 tgggtctgga ccatccacaa taatagatgc aggaaagtct gtggtgtgga atcgtgttga 10020 tgtgatagct tgtgtgaaag aggccttgtg ctgcatagaa ttcagctgga ataaccaagt 10080 gatcatagac tttgattata gccaggccag atgatgtgga ctgtattcct ttttttgtca 10140 gtaatcagtt attaacccaa aattgttaat tatgtagact ttaagttaac taacttcatg 10200 ttaattcaat agttatataa aaaaatattc gaattaggat caatatggat cctattgatg 10260 aacaagaagt taatgtgtac ttgccggata gctacttaaa gggtgttata tcttttagtg 10320 aaactaatgc tcttggcagc tgtatcattg gtagaccttt cttgaaggat gactttactg 10380 ccactacttc aatccgtaac cccctaattg aacataaaag aataagggac actaaattag 10440 taaaaaatat tgtttcaaac cctcaatata ggttagtgga gcctctccaa atgcagcatg 10500 agctcttgag tgtactatcg cccaatttca tattgcacac tgccaactta aggaaaatta 10560 tacaagaag tgttgacata acagataaa agttgaaccc cattttgcac attttgaatc 10620 ttaatttcc taaccagag ggtaggtgt cggaacggct aactaggcta attagaac 10680 atctctctca catacctaat tgggtaagca gctggtacaa tatatgggtc atctttaca 10740 acttactgca ggagtaccgt tcaaggag ttatagacca taactgtgtt ctgactaggc 10800 aattgtctgg aagttcata catgtggtca tgagtcaata tggattgtg atattagca 10860 aaaaagtaa agatataca atgtgtactt ataccaatt cctaacctgg aaggaccttg 10920 ccttgagcag atttaatgcc aattatgtgg tctggctaag taatgtgtta aacacactca 10980 acgaggggtt gggattaagg tgtagatta aggtcatct gctcagtaag tgtacattt 11040 cat eat cat eat cat atgaatttta taatgtgtc aggaatttg 11100 agggcttcat catgtcactg atttgaac aactgagga agccttattt agcacaaggt 11160 tttataata catgttgaac aacttaattg atgccattga tagggctcga ctagagtatc 11220 tggcccgctg tgccaattca gctgccagga ttaatttacc tagtacagat gttatgatag 11280 catcattggg tgatatctta tctttgataa acgttttagg tgaatccaac cttaacaact 11340 taagtgagtt atattttatc ttcaggatat ttggtcaccc tatggttgat gagaggaagg 11400 ccatggatgc agtcagagat aactgttgtg aaacaaagtt tctgacggct aagaaccttg 11460 catcgttaag aggagcatat gtttatagaa tttcaaagg attcgtagca aattataaca 11520 ggtggcctta cataaaaact agagtttgcc ttacaccaac atggattaac tatcttgaca 11580 ccaattcatg tccctcatta ttagagatga cagaagatga ttttattgtg ttagctggag 11640 tgcactttat aagagaattc cacatcccaa agctaactga tctggagatt atattaaatg 11700 acaaggccat atctcctcca aaatcactca tttggtcatg ctttccaaaa aactacatac 11760 ctcaggttat acaagatgag tatgcccgga ggtattgtag agctaaagca cctttgaaga 11820 caagacgtgt cttggagttc tacttacagg acaaggattt caagttggat cagctccata 11880 gagtagtagt gaaccaggac taccttaatg ataaagaaca tataatttct ttaacaggaa 11940 aagaaagaga gttgggtgtt ggtaggatgt ttgccatgca acctgggaag cagaggcaag 12000 tccaatttt agcagagaag ctgttggctg atacatcct gcaatcttt ccggagacac 12060 tgactagata cggtgatttg gagctgcaa agatactaga gttaaagct ggactttcaa 12120 aaaaatga cagatctaa gactcctaca atattatat aagtaggtgc tcattaatta 12180 ctgatttaag taaatttaac caagcttta ggtacgagtc atcctgtgtg tgtagtgatc 12240 ttttagatga gctacatggg acctcaagct tattctctg gctgcattta acagtaccac 12300 tgactactat aatgtgtaca tataggcatg cgccgccgga cactggaac aactataatg 12360 taggatat tgctgagcag agtggactct accgctacca catggggcggg attgaggct 12420 gctgccagaa gctctggaca acagaggcca ttgctttgct agatactgta gctgtgaagg 12480 gccgtttcca gctaacttca ttaataaatg gcgacaacca aagtattgat atttcaaac 12540 caacaggct ggggaccagg actcaagtg aagcagatta tgatttggca ataaatttctt 12600 window atcagcagct tataaaggca ttggacata atttaaagaa ggtgagacct 12660 acttgtcacg tgacatgcag ttcatgagta aaacaataca acatgaaggg gtctactacc 12720 cggcctccat siacaata ttagagttg gtccctggat siacaata ttagatgata 12780 taaaaacttc aacagaaagt attggttctc taactcaaga actagaatat aaggtgaaa 12840 gtttaatgag cagcctgctg ctgaggact tctggctcta cagattatat tcagtgtt 12900 taaaagatca ttcttgtgt ggaaagcagc tctacagatc cttataaaa gtgttaaaac 12960 atttgaagag gtgcttcaac ctggagaacc ttgggaatg tttggaatta ttttaatg 13020 tgcccatgca gtttggaggt gctgacccaa atgtcatcta caggagcttc tacagagaa 13080 ctccagattt tctaacagaa agtataacc atctcatcct cattttaaaa cattttagaa 13140 gagatttgga attcaacaaa gatagtct ccaagctgt tctttctttg ctagagttca 13200 ccaagaatga ttctgcagaa ttgtaactt tgatgagaga tcctcaagca attggtagtg 13260 agaggcaggc aagatcact tcagacatca acagaacagc tgtacttca gtgttatca 13320 atgctccaaa tgaaatattt agaacttcag ctctcatta cagcagcaca gaaatgaat 13380 taaatggaat agcaagtgga gtttctcctg tttatcctca tggtcttcga gttttatatg 13440 aaagtttacc ttttattaaa gcagagaga ttgtcacat ggtttctggg accaagtcca 13500 tcaccacat actggagaag acatcagcca tctcctacac agatatatt cgagccacca 13560 acatgatggt ggagaacctc actttgctaa caagaataat gaaaccaggt gctgacacat 13620 ctttggatcc tgacacaata gtataacaa tattacaaaataataga gataaatcct 13680 gggatgttgg tgattatatt gttgtcactt cccatctcc tgtctcctgc ttcaggtgg 13740 tctacacatc aactctacaa ataattcag tagtataga agatacaca acagacacct 13800 acacagagg tagagaggc cccaccaagc cctgggtggg cagcagcaca caggagaga 13860 agtccatgcc tgtctacaac agacaagtttt taacaagagg aaagagat acatagaaa 13920 atagcaaa gctggagtgg gtgttttctt cagtagcaaa tattgatct ttgctaaatg 13980 agctcagcac catgacttg ggtctttctc taaggaatg tagacaactt tttccacat 14040 atttaagttt aaacttccttg cacaggcttt ctgtcagcag caggcccaga gatatcctt 14100 cttctcttcc tgcctacagg acaaattt ttcattttga tactgacca aataag 14160 tgttaacaga aagatttgga gatgagata taatttggt atttcaaat gcaatcat 14220 atggtctttc caccatgtct ttggtggagc agtttactgg tgtctgtcca aaaagttt 14280 tgctggtgcc caagctacaa gaatacaac taatgaagt tccaattt caagtggct 14340 tcaacctaca aagtataatt ccaataata ggcagcagca catgttcctg cccaccaca 14400 tcactccagc ccagtatatt gattatttc ttctcaaa acatttcat tcaagaataa 14460 atttaaaaca siaacaga tttaaacttg ttttacaaa agattattt aatggggaga 14520 acatgataga aactttgtcc acctgttttgg caggccactg gatcatcatt ttgatgctaa 14580 tgaggagag tcagggata ttgacagg agtggtatga tggttgta acagaccaca 14640 tgttcctgga cctgcagctc ttcctcct ccttcagac atttctact gtctcagct 14700 ttgcttattt aaaagttggt tcaaatatag aagaaataac aggaaatcaa gccaacctgc 14760 tggagctgct ggacctgggc tactggaaga acatgtataa agtattttca gagaccaagg 14820 tgcggctggc tttgctaaaa caagatttat catttaattc tgtgaagaac agcagcagct 14880 tccggcactg gtttataaat tctctacaag aagtacaatg tacttctgtg ccttgggtgg 14940 taaatgtaac aagaaatcca actcatttaa aaggtgttct acagtacatg aagatgatag 15000 aaagtggcat gattcaaggt tattcagcaa atatttcttc agttttaagt atcccatata 15060 attatccaga catggcgcac atgatgacaa aaataataag aaatcgaggc cacatgtcct 15120 atgattatcc aaagatgaag aaaagtttaa ctttctccat gacagacatg agtgacagct 15180 acatgctcaa cctcttcccc aaagtagaat gttcttacat gagtggttat ttggataaac 15240 tagatgatac tctacaactt ctaaagaaac ctcctgttgg aagaaaagtt ccttctgtgg 15300 ctttgccctg gcaccactgc aacagataca actttgtctt cagcagcaca ggctgcaaag 15360 tttctgtcat tgacatgctt ccaaaacatt tccgagaag taatttaaaa gtatatgtt 15420 ttattggaga aggggggggc aacctcatgc taagagctgt ttggaagtt ggtggaata 15480 taaaattaat atatagatcc ttaaagatc ctgatgatca tcatgttcct gtagaatttc 15540 taagattaaa accttgttat ccttatattg atactggtgg cagtttatct ttggctcaa 15600 cagatgccac caaaggcc cactgggatt atttacatct tcactggaca gatcctttaa 15660 atttaatagt atgtgatgca gaaataagtg gtgtgaagca ctggctaaaa attcttcaca 15720 ggtggtatga gcacatgact tcctgcaagc actgtttaa atcagaacat gataaatatt 15780 taataataa atatcatgct taatagatt tcctcatggt gtcaggctac 15840 taaaatgtaa catctgctg gggctccaac taagtggcag tgagagctac ctgctcattg 15900 gtcttggtct ttcaataaa cttcctgtct acagtgaagt tcttcattca aaacttcttt 15960 tggcagaatg tcatcagttt catcatccaa atatttgga tgtttctgga ataaatacaa 16020 atataaaatc cttaatacca atgttggatt atcaatac ttacacaag atcaccactt 16080 tgctagaaag tgtgcgggag ctttcttcaa ataaaaacaa gaacaccatg tggattggaa 16140 gaaatcctgt ctaccataat aaatggctaa agaggaaata tttcaacatt ttaaaatggc 16200 taaaatactg tatagaactt cctgccttca ggatggatta taattcattt gagagaatag 16260 aaatgcttta tccaaattta agagatttgg tagattctgt ttctacttca gagctgaaga 16320 aagtaataaa agtaacaggc atcctcttca ggagcaacac catgtgaatt aatatgccaa 16380 tgctaacatg tcatccccac tacttttttt gttcaatcac tctcagtcta gacatgtgag 16440 aagatcccaa acccaactgc acccctccca ctcgaaatca gttgtagcct cagcagctcc 16500 atctgccatg atctctgacc agcagcaaat gtattattat tttaatttgt ctatagttaa 16560 caaaaaattg atatctcaca ggttgtaaac atagttcttt tataattatt gttagttaaa 16620 ctattgtgtt tgacttcctt tgggtatttt tttcccgt 16658 <210> 61 <211> 16655 <212> DNA <213> Artificial Sequence <220> <223> Chimeric vector <400> 61 acgcgaaaaa atgcataca aaactatcaa cctgaaaaaa gttaggacaa gtgaagattg 60 ctagtcccaa agaccagaat catgggctgt atgtgatga tggagcttga ttatggtgga 120 cgagctgcat ggctggcatt ccacatacc aactttgata ggtcagattt ggaaactatc 180 ctaagaggtg ctagggtgtg caatacatgg CAATCAGA gactctccgt gtaccttgtg 240 ggaagggatt gcaatttgtt aagaccattt gtgcaagctg ccaatttat ccataatact 300 aggagaggcc aacattaac acatggttc aaaaaata tcgtgtttag ttctacaggg 360 caagagacag agcctcccat tgaccccaca tgtgagctgt tggtagagct gatcagtggt 420 tagatgaca gcacattatg tagttatta aaaaaaggg taggacagt cctaatgtcc 480 acagctatga acagttcac tcagaccatc tctaacctg ccactatct gatatttca 540 gabagtgaag agtcggggcga tgaggcaggg gtggggcagg tgtcccgtac cacacagagc 600 tcagagaggt ggctgattt gctcattgaa aagttccagc cgagcctaca aaacatcact 660 agatacatca actggaactt catcaggatc tgcaatgata ggcttaaaaa agaaaaaatg 720 gggtacattg aggccaagca atatgtggaa gacatggctt ggatggtgat agcatctgag 780 gcagacagca ttgagtggaa gtgcataagg aggcaggaga aagtgactgg ggtgaaatac ccaaagttct tctttgtaca acaaagag gactggattg agtgcacagg atgcattccg tacccaggcc atgacttgat ctatgatgag gatgatgatg actgagctga ctcagatcac tccaaccagc agagagatcc atagttatag aaaaacatta ggataaatac acatcctagg ccgccaccat ggaactgctg atcctgaaag ccaacgctat tactactatc ctgaccgccg tgacattttg cttcgcatct ggacagaaca ttactgagga attctaccag tcaacatgca gcgccgtgtc caaaggatac ctgagcgccc tgcggaccgg ctggtataca tcagtgatta ctatcgagct gtccaacatc aaggaaaca aatgtaatgg gaccgacgca aaggtgaaac tgatcaagca ggagctggat aagtacaaaa atgccgtgac agaactgcag ctgctgatgc agtccacacc agcaact aatcgcgccc ggagagagct gccccggttc atgaactata ccctgaacaa tgctaagaaa accaatgtga cactgtccaa gaaacgcaag aggcgcttcc tgggatttct gctgggcgtg gggtctgcca tcgctagtgg agtggccgtc tctaaagtcc 1500 1560 tggtcagtct gtcaaatggc gtgtccgtcc tgacctctaa ggtgctggac ctgaaaaatt 1620 atattgataa gcagctgctg cctatcgtca aaaacagag ctgctccatt tctaatatcg 1680 agacagtgat cgaattccag cagaaaca atagactgct ggagattacc agagagttca 1740 gcgtgaacgc cggcgtcacc acacccgtgt ccacctacat gctgacaaat agtgagctgc 1800 1860 1920 cctacgtggt ccagctgcca ctgtatggcg tgatcgacac cccctgctgg aaactgcata 1980 catctcctct gtgcactacc aacacaaagg aaagaagtaa tatctgcctg actcgaaccg 2040 accggggatg gtactgtgat aacgcaggca gcgtgtcctt ctttccacag gccgagacct 2100 gcaaggtcca gcaacagg gtgttctgtg acactatgaa tagcctgacc ctgccttccg 2160 aagtcaacct gtgcaatgtg gacatcttta atccaaagta cgattgtaag atcatgacta 2220 gcaagaccga tgtcagctcc tctgtgatta cttctctggg ggccatcgtg agttgctacg 2280 gaaagacaaa atgtactgcc agcaacaaaa atcgcggcat cattaagacc ttctccaacg 2340 ggtgcgacta tgtctctaac aagggcgtgg atacagtgag tgtcgggaac actctgtact 2400 atgtcaataa gcaggaggga aaaagcctgt acgtgaaggg cgaacccatc attaacttct 2460 atgaccccct ggtgttccct tccgacgagt ttgatgcatc tattagtcag gtgaacgaaa 2520 aaatcaatca gagtctggcc tttattcgga agtcagatga gctgctgcac aacgtgaatg 2580 ctggcaaatc tacaactaac atcatgatca ccacaatcat catcgtgatt atcgtcattc 2640 tgctgtcact gatcgctgtg gggctgctgc tgtactgtaa ggcaagaagc accccagtca 2700 ctctgtcaaa agaccagctg tcagggatta acaacattgc cttcagtaac tgatagccac 2760 ctatagcaag tgatgtagta tttagtctat gattaggtat agaaaaacat taggataaat 2820 agccgggcca aaatgtctct agacagattg aagctcaatg atgtctcaaa caaggatagc 2880 ctgctgtcca actgcaaata cagtgttacc agatccacag gcgatgtaac cagtgtgtct 2940 ggtcatgcta tgcagaaagc ccttgcaagg acactcggca tgttcttact tactgccttc 3000 aaccgttgcg aagaagtggc agaaataggg ctccaatatg ccatgtcctt gctaggcaga 3060 gatgatagca tcaagatatt aagagaagcc ggctacaatg taaaatgtgt ggacacacag 3120 ctcaaggact ttacaatcaa attacaagga aaggaataca aaatacaagt cctagatata 3180 gtgggaatag atgcagccaa tttagctgat ctagagatac aagccagagg agtggtagca 3240 aaagaactca aaacaggagc caggctacct gacaatcgga ggcatgatgc accagattgt 3300 ggtgtgatag ttctctgtat tgcagcatta gttgtttcca aattagctgc aggggacagg 3360 ggaggacttg atgctgtgga aagaagggct ttaaatgtgc tgaaagccga gaaagccagg 3420 taccccaaca tggaggtcaa gcagatagct gaaagttttt atgatctgtt tgaaaggaag 3480 ccttattaca ttgatgtctt catcacttttt ggcctggccc agtctagtgt caagggaggc 3540 agcaaagttg aggggctgtt ttcaggtctc ttcatgaatg catacggggc aggacaagtt 3600 atgctgaggt gggtttact ggcaaatct gtcaagaaca tcatgctagg ccatgctagt 3660 gtacaagctg agatggaaca gtggttgag gtttacgaat atgctcagaa gcaaggaggg 3720 gaggcaggat tctatcacat cagaaataat ccaaagctt cactctctc tttgaccaat 3780 tgtcctaatt tcaccagtgt tgtgcttggc aatgctgcag gtttaggcat catagggtca 3840 tataagggtg ctcctaggaa tagagaactc tttgatgctg ccaagatta tgcagaaaga 3900 ttaaaggaca acaatgtaat taactacagt gcattaact tgactgcaga agaagagag 3960 ctgatcagcc agcagctgaa cattgttgat gataccctg atgatgat ttattaaaa 4020 ctggaaaatg taggataat atggaat tcgcccccga atttgttggc gaggatgcta 4080 acaagaaggc agaggagttt ctcaacata gatccttccc ttcggaaaa ccactagctg 4140 gtataccgaa cactgccact catgtcacca atatacat gcccctata ttgcgtagct 4200 cattcaact cccttccccg agagttgctg caatcttac tgaacctct gctcccccta 4260 ccactccacc accacacct ccccagaaca aggagagca gcccaagag tctgatgttg 4320 acattgagac tatgcatgtc tgtaaggttc ctgacaatcc ggaacacagc aagaagccat 4380 gctgctcaga tgataccgat actaagaaaa ctaggaagcc gatggtcacc tttgtggaac 4440 ccgaggagaa atttgtcgga ttgggagcta gcttgtacag ggagaccatg cagacctttg 4500 ctgctgatgg ttatgatgaa gaaagcaacc tatcgtttga ggagactaac caagagccgg 4560 gttcttcatc tgtagaacaa agactagata gaatagagga gaaattgtcc tacataatag 4620 gccttttaaa caccataatg gtagcgactg ctggacctac cactgctaga gatgagatta 4680 gagatgccct tataggcact agagaagaac ttattgagat gatcaagtct gacatcttga 4740 ctgtcaatga cagaatagtg gccatggaga agctcagaga tgaggaatgc tccagagctg 4800 acactgatga tggatcagcc tgttatttaa cagacagagc aaggatacta gataagatag 4860 tgtccagcaa tgctgaagag gctaaggaag atttggatgt tgatgacatc atgggcatta 4920 attttagtt attaaaata acaacaggac aataatgga ggcctacttg gtagagatgt 4980 accatggtgt cccatataca gctgcagtac agctaaactt ggttgaaaaa cattcagcca 5040 acatatcact aactgtgtgg ataccgatgt ttcaaacatc tctaccaaag aactccgtta 5100 tggacctgct acatgatgtt acagtcattt gtacacagat atcaacagtg catggtccca 5160 tgatcaaggt agatctgagc tcttccaatg caggtttagc taccatgcca aggcaattct 5220 tgataaatgc tatcatagct ttggatgact ggggcaacat ggattacgaa gtgcctgttg 5280 cttttgataa aaagagcttc tgtgtgacaa ttcttaagcc taaaaacatg ctttacactg 5340 tacccagcat tactcccact aatcgaccta ctcatgagct gatagctgtc tgctctttcc 5400 ataacagggt aacattaaag tcattcaata tacctgtctt catcagagca ctgtctatca 5460 gacagcagga ccttgatagt gtggagcagg ctataagctc cgatgtggac catgctataa 5520 caacagctag ggtggctccc tatgcagggc ttacacttgt gatcaacatc acatccacca 5580 aaggagcatt caaactgcta aaggcaggta gtcagattct tgcagaactg ggtccctatc 5640 tgacgcaggt gagcctacat gatgtgatta tgaactggaa acatacaggc acttcctaca 5700 tactcaagag ctcctcaaca agtggatgaa aaagagaaag tcaccattga tcagctcaat 5760 ccacaacac aaccccacga ttcacacag cacacaacc accgccacca acatccacat 5820 crackle crackle crackle crackle tcttagttaa ataaatcag 5880 gataaataat ggatcctaac atgacctcac accagatcac cctcgagatc aacatgacca 5940 gcagccgtat tggcacatac actacaccag cccacagc tctctcctt gcatgtgccg 6000 tcatcacac agtgtgtgcg ctgataatgg cctgcagcag tagagcact gccacatcag 6060 gcattgtcag cagccaatgc acagttcatc ccaatcaccc tccaccagt tatggcgtca 6120 atgtaactgg tctgccggggt aacctatact caggaacac tacatacat tataaatac 6180 agaaattatc cttcaataaa ccccaggcca ccagcttta ccctgctaga cgattcaatc 6240 agcccttgca gtatgtcgtc tagttaacaa aaaccggta ggataagtac tatcctattg 6300 gaaccaacg agacctgtag agcagctcac ahagagaac cacaagctga cttcacctag 6360 tatgggagg aacttagaag tgagtggcag cattaccaat tgacttg agagaactca 6420 gcatcctgac acatttagga ctgttgtaaa agtgaaccaa atgtgtaagc ttattgcagg 6480 tgtgctcaca agtgctgctg tggcagtttg tgtgggggtc ataatgtatt ctgttttcac 6540 atcaaaccac aaggccaact ccacgcagaa tgccacgacc cggaacagca catccacccc 6600 tccccaacca accgccggtc tgcccaccac agagcaaggg accatcccca gattcaccaa 6660 accccccacc aaaaccgcca cccaccatga gatcacagag cccgtcaaaa tggcaacacc 6720 ttcagaggat ccctaccaat gctccagcaa tggttatttg gaccgacctg atttacctga 6780 aaatttcaaa ctcgtattgg atgttatatg caagcctcca ggtcctgaac atcacaacac 6840 cagctgttat gagaaacgtg aaatcaaccc aggaagtgtt tgccctgatc ttgtaacaat 6900 gaaggcaaac atgggcttaa acaatggtgg tggggaggat gctgcacctt atatagaggt 6960 taccaccctt tctacgtact ccaacaaaag ggcaatgtgt gtccacaatg ggtgtgatca 7020 aggcttctgt ttcttccttt ctggtttaag cactgatcag gagagagctg tgctagagct 7080 tggaggtcaa caggctatca tggagttgca ttatgattcc tactggaaac actattggag 7140 taactctaat tgtgttgttc ccagaacaaa ctgcaacctg acagaccaaa ctgagatttt 7200 gtttcctagg tttaacaaca agaatcagtc tcagtgtacc acctgtgcag attcagctgg 7260 cctagataac aaattttatc tcacatgtga tgggctttta agaaccctcc ctctagttgg 7320 actacccagc ctaagtcctc aggcttacaa agctctaccc acaaacta caggcaccac 7380 cacggcacca acatcagaga cgaggcaccc aaccccttgca cccaggaggt ccaaacctct 7440 cagtcggaag aagagagctt tatgtggtgt agactcaagc agagaaccca aaccaacaat 7500 gccttactgg tgtcctatgc tccaattatt tccaaggagg tctaattctt aagtgaccta 7560 ttcctgaatt aacttcagaa tagtaccaa ccttatcagt agttaatgaa aactaagctt 7620 tgatataata ggacaaatat gattcctggc aggatctttc tagtccttct ggtgatcttc 7680 aacaccaagc caattcaccc aaatacatta aagaaaaat tctatgagtc cacatgttagt 7740 gttgagactg caggttataa gagtgccctt agaacaggtt ggcatatgac agttatgtca 7800 attaagttgt ctcaataaa tattgagtca tgcaagagca gcaactcgtt attggctcat 7860 gagcttgcaa tctatagtag tgcagtggat gaattgagaa cgttatcatc caatgccttg 7920 aagtccaaaa ggaagaagag gttcctcggt ttgattcttg gtctcggagc tgcagtcact 7980 gccggggtgg ctttagccaa gacagtgcaa cttgaaagtg agattgcatt gattagagat 8040 gcagtgagaa atacaaatga ggctgttgtt agcctaacca acggcatgtc agtgttggct 8100 aaagtggtgg atgatttgaa aaacttcata tctaaagaat tactcccaaa aataaaccga 8160 gtctcttgtg atgtgcacga catcactgcc gtcattagat tccaacagct caacaaaaga 8220 cttttggaag tatctcgtga atttcatct aatgcaggat taacacacac tgtttcatct 8280 tttatgttaa cagaccggga actcacctcc attgtaggcg gcatggctgt ttcagcaggc 8340 caaaaagaga taatgctatc tagcaaagct ataatgagaa gaaatgggtt agcaatatta 8400 agttcagtca acgctgacac actggtttat gtaatacaac tcccattatt tggtgttatg 8460 gacacagatt gttgggtaat aagaagttct atagactgtc ataacatagc agacaagtat 8520 gcttgtttgg ctagagctga taatggctgg tattgtcaca atgctggctc attatcatac 8580 ttcccgtcgc caacggattg tgagatccac aatgggtatg ctttctgtga cactctaaaa 8640 agtctaactg tacctgtaac atcacgagaa tgcaactcaa acatgtatac cactaactac 8700 gattgtaaga tttccacaag taaaacttat gtgagtacag cggtactgac tacaatgggt 8760 tgcttggtat cttgttatgg tcataacagt tgcacagtca tcaataatga caaaggtata 8820 ataaggactc tgccagatgg ttgccactac atctccaaca aaggtgtgga cagggttcaa 8880 gtaggtaaca ctgtttacta tcttagcaaa gaagttggca agtcaattgt tgtcagaggg 8940 gaaccattgg tcttgaaata tgaccctttg agtttccctg acgataaatt tgatgttgct 9000 ataagagatg tggagcatag catcaatcag acacgcacat tcttgaaggc ctctgatcag 9060 ttattggact taagtgaaaa cagagagaat aaaaatttaa acaagtcata tatactaaca 9120 actctgctct tcgttgtaat gcttattata ataatggctg tcatagggtt cattctgtat 9180 aaggtattga aaatgatcag agacaacaag ttgaaatcca aaagtacacc tggcctcaca 9240 gttttatcat gacaattgta ccaaaccata attgagttag ttaattaaaa acttaggata 9300 agtgacaatc cagacccaac acctctttca actctcaagg ataaggtagg atgagtgtga 9360 gaccttgcaa atttgaggtt caagggtttt gttccagagg gaggattgc aagtatagtc 9420 aataatattg ggaatggcct ttgaaaactc ttatgctcag gcagaactac atgcttaata 9480 ggatttatag gttcctcgac accacag atgcaatgtc agatgtcagc ggatttgatg 9540 caccacaag gactgctgag tatgccttgg gaaccatagg tgtgctgaaa agttacctgg 9600 aaaaaactaa aaatcaatcact aaatcaatag cttgtggcag ttgatcact gtattgcaga 9660 acttggatgt tggtctagta atacaagca gagatagca cactgaggac accaattact 9720 tgagagttg tornado ctgtcttta window ahahaag agahaatta 9780 ttcacattct caaagactg ccagtaggag tactatgcaa tctgatccaa tctgtcatct 9840 ccatcgagga gagaataat tcttctatga aacagaatg ataggctgc ctaatacta 9900 tccagccata ctgcataaga tgtatattat tagagtaat agaaacctca cttacgatgg 9960 gtctggacca tccacataa tagatgcagg aaagtctgtg gtgtggaatc gtgttgatgt 10020 gatagcttgt gtgaaagagg ccttgtgctg catagaattc agctggaata accaagtgat 10080 catagacttt gattatagcc agccagatg atgtggactg tattcctttt ttgtcagta 10140 atcagttatt aacccaaat tgttaattat gtagacttta agttaacta cttcatgtta 10200 attcaatagt tataaaaa atattcgaa taggatca tatggatcct attgatgaac 10260 aagaagttaa tgtgtacttg ccggatagct acttaaaggg tgttatatct tttagtgaaa 10320 ctaatgctct tggcagctgt atcattgta gacctttctt gaaggatgac tttactgcca 10380 ctacttcaat ccgtaacccc ctattgac aaaaagaat aagggacact aattagtaa 10440 aaatattgt ttcaaccct caataggt tagtggagcc tctcaatg cagcatgagc 10500 tcttgagtgt actatcgccc aatttcatat tgcacactgc caacttagg aaattatac 10560 aaagaagtgt tgacataca gataaaaagt tgaacccat ttgcacatt ttgaatctta 10620 attctcctaa ccagagggt aaggtgtcgg aacggctaac taggtatt aagaaacatc 10680 tctctcacat acctaattgg gtaagcagct gtacaatat atggtcaat cttaacaact 10740 tactgcagga gtaccgttca aaggaagtta tagaccataa ctgtgttctg actaggcaat 10800 tgtctggaag tttcatacat gtggtcatga gtcaatatgg agttgtgata attagcaaaa 10860 aaagtaaaag atatacaatg tgtacttata accaattcct aacctggaag gaccttgcct 10920 tgagcagatt taatgccaat tatgtggtct ggctaagtaa tgtgttaaac acactcaacg 10980 aggggttggg attaaggtgt agattaaaag gtcatctgct cagtaagttg tacatttcca 11040 ctgacatctt tttatcttca acatctaatg aattttataa tgtggtcaag gaatttgagg 11100 gcttcatcat gtcactgata ttgaaacaaa ctgaggaagc cttatttagc acaaggtttt 11160 ataataacat gttgaacaac ttaattgatg ccattgatag ggctcgacta gagtatctgg 11220 cccgctgtgc caattcagct gccaggatta atttacctag tacagatgtt atgatagcat 11280 cattgggtga tatcttatct ttgataaacg ttttaggtga atccaacctt aacaacttaa 11340 gtgagtata tttatcttc aggatatttg gtcaccctat ggttgatgag aggaaggcca 11400 tggatgcagt cagagataac tgttgtgaaa caaagttttct gacggctaag aaccttgcat 11460 cgttaagagg agcatatgtt father tcaaaggatt cgtagcaaat fathercaggt ggccttacat aaaaactaga gtttgcctta caccaacatg gattaactat cttgacacca attcatgtcc ctcattatta gagatgacag aagatgattt tattgtgtta gctggagtgc actttataag agaattccac atcccaaagc taactgatct ggagattata ttaaatgaca aggccatatc tcctccaaaa tcactcattt ggtcatgctt tccaaaaaac tacatacctc aggttaca aggtagtat gcccggaggt attgtaggc taaagcacct ttgaagacaa gacgtgtctt ggagttctac ttacaggaca aggatttcaa gttggatcag ctccatagag tagtagtgaa ccaggactac cttaatgata aagaacatat aatttcttta acaggaaaag aaagagagtt gggtgttggt aggatgtttg ccatgcaacc tgggaagcag aggcaagtcc aaattttagc aagaagctg ttggctgata acatcctgca attctttccg gagacactga ctagatacgg tgatttggag ctgcaaaaga tactagagtt aaaagctgga ctttcaaata aaaatgacag atctaaagac tcctacaata attack tagtgctca ttaattactg attack attack gcttttaggt acgagtcatc ctgtgtgtgt agtgatcttt 12300. 12300. 12300. 12300. 12300. 12300. 12300. 12300 ctactataat gtgtacatat aggcatgcgc cgccggacac tggaaacaac fathergtag atgatattgc tgagcagagt ggactctacc gctaccacat gggcgggatt gagggctggt gccagaagct ctggacaaca gaggccattg ctttgctaga tactgtagct gtgaaggggcc gtttccagct aacttcatta ataaatggcg acaaccaaag tattgatatt tcaaaaccaa 12600. 12600. 12600. 12600. 12600. 12600. 12600. 12600. 12600. 12600. 12600 gattaatc agcagcttat aaaggcattg gacataatt aaaagaggt gagacctact tgtcacgtga catgcagttc atgagtaaaa caatacaaca tgaaggggtc tactacccgg cctccatcaa gaatatta agagttggtc cctggatcaa cacaatatta gatgatata aaacttcaac agaaagtatt ggttctctaa ctcaagaact agaatataaa ggtgaaagtt taatgagcag cctgctgctg aggaacttct ggctctacag attatattca gtggatttaa 12900 aagatcattc tttgtgtgga aagcagctct acgatcctt aaaaagtg ttaaaacatt 12960 tgaagaggtg cttcaacctg gagaaccttg gggaatgtttt ggaattattt ttaaatgtgc 13020 ccatgcagtt tggaggtgct gacccaatg tcatctacag gagcttac agaagaactc 13080 cagattttct aacagaaagt atactcatc tcatcctcat ttaaacat tttagagag 13140 atttggaatt cacaagat aatgtctcca aagctgttct ttcttgcta gagttcacca 13200 agaatgattc tgcagaattt gtaactttga tgagagatcc tcaagcatt ggtagtgaga 13260 ggcaggccaa gatcacttca gatcaca gaacagctgt aacttcagtg ttcaatg 13320 ctccaaatga atatttaga acttcagctc ttcattacag cagcacagaa atgaattaa 13380 atggaatagc aagtggagtt tctcctgtttt atcctcatgg tcttcgagtt ttatatgaaa 13440 gtttaccttt ttataagca gagaagattg tcacatggt ttctgggacc aagtccatca 13500 ccacatact ggagagaca tcagccatct ccacacaca tataattcga gccaccaca 13560 tgatggtgga gaacctcact ttgctaacaa gaatatgaa accaggtgct gacacatctt 13620 tggatcctga cacaatagta ataacaatat tatcaaaaat aataagagat aaatcctggg 13680 atgttggtga tataattggt gtcacttccc catctcctgt ctcctgcttc aaggtggtct 13740 acacatcaac tctacaaaat aattcagtag taatagaaag atacacaaca gacacctaca 13800 caagaggtaa gagaggcccc accaagccct gggtgggcag cagcacacag gagaaagt 13860 ccatgcctgt ctacaacaga caagttttaa caaggaca aagagatcaa atagaaaata 13920 tagcaaagct ggagtgggtg ttttcttcag tagcaaatat tgattctttg ctaaatgagc 13980 tcagcaccat gactttgggt ctttctctaa ggaaatgtag acaacttttt ccaacatatt 14040 taagtttaaa cttcctgcac aggctttctg tcagcagcag gcccagagaa tatccttctt 14100 ctcttcctgc ctacaggaca acaaattttc attttgatac tggaccaata ataaaggtgt 14160 taaaaaag atttggagat gaagatataa atttggtatt tcaaaatgca atatcatatg 14220 gtctttccac catgtctttg gtggagcagt ttactgtgt ctgtccaaat aaagttttgc 14280 tggtgcccaa gctacaagaa atacactaa tgaagttcc atatttca ggtggcttca 14340 acctacaaag tataattcca ataataggc agcagcacat gttcctgccc aaccacatca 14400 ctccagccca gtatattgaa ttattcttt ctcaaaca atttcattca agaataaatt 14460 taaaaacacaacagattt aaacttgtttt taaaaaaa ttttaat ggggagaaca 14520 tgatagaaac ttgtccacc tgtttggcag gccactggat catcattttg atgctaatga 14580 aggagtca ggggatattt zgaaggagt ggtatgatgg tttgtaaca gaccacatgt 14640 tcctggacct gcagctctc ctctcct tcagacatt tctactgtc ttcacttg 14700 cttatttaa agttggttca atatagaag aaatacagg aaatcaagcc aacctgctgg 14760 agctgctgga cctgggctac tggagaaca tgtataaagt atttcag accaaggtgc 14820 ggctggcttt gctaaaaaca gatttatcat ttaattctgt gagaacagc agcagcttcc 14880 ggcactggtt tataaatttct ctacaagaag tacaatgtac ttctgctt tgggtggtaa 14940 atgtaacaag aaatccaact catttaaaag gtgttctaca gtacatgaag atgatagaaa 15000 gtggcatgat tcaaggttat tcagcaaata tttcttcagt tttaagtatc ccatataatt 15060 atccagacat ggcgcacatg atgacaaaaa tataagaaa tcgaggccac atgtcctatg 15120 attatccaaa gatgaagaaa agtttaactt tctccatgac agacatgagt gacagctaca 15180 tgctcaacct cttccccaaa gtagaatgtt cttacatgag tggttattg gataaactag 15240 atgatactct acaacttcta aagaaacctc ctgttggaag aaaagttcct tctgtggctt 15300 tgccctggca ccactgcaac agatacaact ttgtcttcag cagcacaggc tgcaaagtttt 15360 ctgtcattga catgcttcca aaacatttcc gaagaagtaa tttaaaagta atatgtttta 15420 ttggagaagg ggcgggcaac ctcatgctaa gagctgtttt ggaagttggt ggaaatataa 15480 attaatata tagatcctta aaagatcctg atgatcatca tgttcctgta gaatttctaa 15540 gattaaaacc ttgttatcct tatattgata ctggtggcag tttatctttg gcttcaacag 15600 atgccacca caaggcccac tgggattatt tacatcttca ctggacagat cctttaatt father tgatgcagaa father tgaagcactg gctaaaaatt cttcacaggt ggtatgagca catgacttcc tgcaagcact gtttaaaatc aagaacatgat aaatatttaa father tcatgctcaa gatgatttaa tagatcttcc tcatggtgtc aggctacta aatgtaacat ctgcctgggc tccaaacta gtggcagtga gagctacctg ctcattggtc ttggtctttc aaataaactt cctgtctaca gtgaagttct tcattcaaaa cttctttttgg cagaatgtca tcagtttcat catccaaaat atttggatgt ttctggaata aatacaaata taaaatcctt father ttggattatc accactttgc accactttgc tagaaagtgt gcgggagctt tcttcaaata aaaacaaaga caccatgtgg attggaaga atcctgtcta ccataataa tggctaaaga ggaaatattt cacatttta aaatggctaa aatactgtat agaacttcct gccttcagga tggattataa ttcatttgag agaatagaaa tgctttatcc aaatttaaga gattttggtag attctgtttc tacttcagag ctgaagaaag taataaaagt aacaggcatc ctcttcagga gcaacaccat gtgaattaat atgccaatgc 16380 taacatgtca tccccactac tttttttgtt caatcactct cagtctagac atgtgagaag 16440 atcccaaacc caactgcacc cctcccactc gaaatcagtt gtagcctcag cagctccatc 16500 tgccatgatc tctgaccagc agcaaatgta ttattatttt aatttgtcta tagttaacaa 16560 aaaattgata tctcacaggt tgtaaacata gttcttttat aattattgtt agttaaacta 16620 ttgtgtttga cttcctttgg gtattttttt cccgt 16655 <210> 62 <211> 16661 <212> DNA <213> Artificial Sequence <220> <223> Chimeric vector <400> 62 acgcgaaaaa atgcataaca aaactatcaa cctgaaaaaa gttaggacaa gtgaagattg 60 ctagtcccaa agaccagaat catgggctgt aatgtgatga tggagcttga ttatggtgga 120 cgagctgcat ggctggcatt ccacataacc aactttgata ggtcagattt ggaaactatc 180 ctaagaggtg ctagggtgtg caatacatgg caagatcaga gactctccgt gtaccttgtg 240 ggaagggatt gcaatttgtt aagaccattt gtgcaagctg ccaatttat ccataatact 300 aggagaggcc aacattaac acatggttc aaaaaata tcgtgtttag ttctacaggg 360 caagagacag agcctcccat tgaccccaca tgtgagctgt tggtagagct gatcagtggt 420 tagatgaca gcacattatg tagttatta aaaaaaggg taggacagt cctaatgtcc 480 acagctatga acagttcac tcagaccatc tctaacctg ccactatct gatatttca 540 gabagtgaag agtcggggcga tgaggcaggg gtggggcagg tgtcccgtac cacacagagc 600 tcagagaggt ggctgattt gctcattgaa aagttccagc cgagcctaca aaacatcact 660 agatacatca actggaactt catcaggatc tgcaatgata ggcttaaaaa agaaaaaatg 720 gggtacattg aggccaagca attgtggaa gataggctt ggatggtgat agcatctgag 780 gcagacagca tgagtggaa gtgcataagg aggcaggaga aagtgactgg ggtgaaatac 840 ccaaagttct tctttgtaca achaagag gactggattg agtgcacagg atgcattccg 900 tacccaggcc atgacttgat ctatgatgag gatgatgatg actgagctga ctcagatcac 960 tccaaccagc agagagatcc accacctata gcaagtgatg tagtatttag tctatgatta 1020 gttatagaaa aacattagga taaatacaca tcctaggccg ggccaaatg tcttagaca 1080 gattgaagct caatgatgtc tcaacagg atagcctgct gtccaactgc aaatacagtg 1140 ttaccagatc cacaggcgat gtaccagtg tgtctgtca tgctatgcag aaagcccttg 1200 caggacact cggcatgttc ttacttactg ccttcaccg tgcgagaa gtggcagaaa 1260 taggctcca atatgccatg tccttgctag gcagagatga tagcatcag atttaagag 1320 aagccggcta caatgtaaaa tgtgtggaca cacagctca ggactttaca atcaattac 1380 aaggaaagga atacaaata caagtcctag atagtggg atagatgca gccaatttag 1440 ctgatctaga gatcaagcc agaggagtgg tagcaaaga actcaaaca ggaggccaggc 1500 tacctgacaa tcggaggcat gatgcaccag attgtggtgt gatagttctc tgtattgcag 1560 cattagttgt ttccaatta gctgcagggg acaggggagg acttgatgct gtggaaagaa 1620 gggctttaaa tgtgctgaaa gccgagaaag ccaggtacc ccacatggag gtcaagcaga 1680 tagctgaaag tttttatgat ctgtttgaaa ggaagcctta ttacattgat gtcttcatca 1740 cttttggcct ggcccagtct agtgtcaagg gaggcagcaa agttgagggg ctgttttcag 1800 gtctcttcat gaatgcatac ggggcaggac aagttatgct gaggtggggt ttactggcaa 1860 aatctgtcaa gaacatcatg ctaggccatg ctagtgtaca agctgagatg gaacaggtgg 1920 ttgaggttta cgaatatgct cagaagcaag gaggggaggc aggattctat cacatcagaa 1980 ataatccaaa agcttcactt ctctctttga ccaattgtcc taatttcacc agtgttgtgc 2040 ttggcaatgc tgcaggttta ggcatcatag ggtcatataa gggtgctcct aggaatagag 2100 aactctttga tgctgccaaa gattatgcag aaagattaaa ggacaacaat gtaattaact 2160 acagtgcatt aaacttgact gcagaagaaa gagagctgat cagccagcag ctgaacattg 2220 ttgatgacac tcctgatgat gatatttaat taaaactgga aaatgtagga taaatagccg 2280 ccaccatgga actgctgatc ctgaaagcca acgctattac tactatcctg accgccgtga 2340 cattttgctt cgcatctgga cagaacatta ctgaggaatt ctaccagtca acatgcagcg 2400 ccgtgtccaa aggatactg agcgccctgc ggaccggctg gtatacatca gtgattacta 2460 tcgagctgtc caacatcaag gaaaacaat gtaatgggac cgacgcaag gtgaactga 2520 tcaagcagga gctggataag tcaaaatg ccgtgacaga actgcagctg ctgatgcagt 2580 ccacaccagc aactacaat cgcgcccgga gagagctgcc ccggttcatg aactataccc 2640 tgaacaatgc taagaaaacc aatgtgacac tgtccaagaa acgcaagagg cgcttcctgg 2700 gatttctgct gggcgtgggg tctgccatcg ctagtggagt ggccgtctct aaagtcctgc 2760 acctggaggg cgaagtgaac aagatcaaa gcgccctgct gtccactaac aaggcagtgg 2820 tcagtctgtc aaatggcgtg tccgtcctga cctctaggt gctggacctg aaaaattata 2880 ttgataagca gctgctgcct atcgtcaaca aacagagctg ctccattctct atatcgaga 2940 cagtgatcga attccagcag aagaacaata gactgctgga gattaccaga gagttcagcg 3000 tgaacgccgg cgtcaccaca cccgtgtcca cctacatgct gandaatagt gagctgctgt 3060 cactgattaa cgacatgcct atcaccaatg atcagaagaa actgatgtcc aacaatgtgc 3120 agatcgtcag acagcagagt tactcaatca tgtctatcat taaggaggaa gtcctggcct 3180 acgtggtcca gctgccactg tatggcgtga tcgacacccc ctgctggaaa ctgcatacat 3240 ctcctctgtg cactaccaac acaaaggaag gaagtaatat ctgcctgact cgaaccgacc 3300 ggggatggta ctgtgataac gcaggcagcg tgtccttctt tccacaggcc gagacctgca 3360 aggtccagag caacagggtg ttctgtgaca ctatgaatag cctgaccctg ccttccgaag 3420 tcaacctgtg caatgtggac atctttaatc caaagtacga ttgtaagatc atgactagca 3480 agaccgatgt cagctcctct gtgattactt ctctggggc catcgtgagt tgctacggaa 3540 agacaaaatg tactgccagc aacaaaaatc gcggcatcat taagaccttc tccaacgggt 3600 gcgactatgt ctctaacaag ggcgtggata cagtgagtgt cgggaacact ctgtactatg 3660 tcaataagca ggagggaaaa agcctgtacg tgaagggcga acccatcatt aacttctatg 3720 accccctggt gttcccttcc gacgagtttg atgcatctat tagtcaggtg aacgaaaaaa 3780 tcaatcagag tctggccttt attcggaagt cagatgagct gctgcacaac gtgaatgctg 3840 gcaaatctac aactaacatc atgatcacca caatcatcat cgtgattatc gtcattctgc 3900 tgtcactgat cgctgtgggg ctgctgctgt actgtaaggc aagaagcacc ccagtcactc 3960 tgtcaaaaga ccagctgtca gggattaaca acattgcctt cagtaactga tagtatttaa 4020 ttaaaactgg aaaatgtagg ataaatatgg agaaattcgc ccccgaattt gttggcgagg 4080 atgctaacaa gaaggcagag gagtttctca aacatagatc cttcccttcg gaaaaaccac 4140 tagctggtat accgaacact gccactcatg tcaccaaata taacatgccc cctatattgc 4200 gtagctcatt caaactccct tcccgagag ttgctgcaaa tcttactgaa ccctctgctc 4260 cccctaccac tccaccaccc acacctcccc agaacaagga agagcagccc aaagagtctg 4320 atgttgacat tgagactatg catgtctgta aggttcctga caatccggaa cacagcaaga 4380 agccatgctg ctcagatgat accgatacta agaaaactag gaagccgatg gtcacctttg 4440 tggaacccga ggagaaattt gtcggattgg gagctagctt gtacagggag accatgcaga 4500 cctttgctgc tgatggttat gatgaagaaa gcaacctatc gtttgaggag actaaccaag 4560 agccggggttc ttcatctgta gaacaagac tagatagaat agaggaaa ttgtcctaca 4620 taataggcct tttaaacacc ataatggtag cgactgctgg acctaccact gctagagatg 4680 agattagaga tgcccttata ggcactagag agaacttat tgagatgatc aagtctctgaca 4740 tcttgactgt caatgacaga atagtggcca tggagaagct cagagatgag gatgctcca 4800 gagctgacac tgatgatgga tcagcctgtt atttacaga cagagcagg attackagata 4860 agatagtgtc cagcaatgct gagaggcta aggaggttt ggatgttgat gacatcatgg 4920 gcattaattt ttagttaatt aaaataaca caggacaaat atggaggcc tacttggtag 4980 agatgtacca tggtgtccca tatacagctg cagtacagct aaacttggtt gaaaaacatt 5040 cagccacat atcactact gtgtggatac cgatgtttca aacatctcta ccaagaact 5100 ccgttatgga cctgctacat gatgttacag tcatttgtac acagatatca acagtgcatg 5160 gtcccatgat caagtagat ctgagctctt ccaatgcagg tttagctacc atgccaggc 5220 aattcttgat aaatgctatc atagctttgg atgactgggg cacatggat tacgagtgc 5280 ctgttgcttt tgataaaag agctctgtg tgacaattct taagcctaa aacatgcttt 5340 acactgtacc cagcattact cccactaatc gacctactca tgagctgata gctgtctgct 5400 ctttccataa cagggtaca ttaagtcat tcaatacc tgtctcatc agagcactgt 5460 ctatcagaca gcaggacctt gatagtgtg agcaggctat aagctccgat gtggaccatg 5520 ctataacaac agctagggtg gctcctag cagggctac acttgtgatc aacatcacat 5580 ccaccaaagg agcattcaa ctgctaaagg caggtagtca gattcttgca gaactgggtc 5640 cctatctgac gcaggtgagc ctacatgatg tgattgaa ctggaaacat acagcactt 5700 cctacatact cattcagctcc tcacaagtg cattgaaaag agaagtcac cattgatcag 5760 ctcaatccac aactacaacc ccacgatttc acacaccaca ctcaatccac ccaccacc 5820 lizard lizard lizard lizard tacatatata lizardctt agttaaataa 5880 aatcaggata atatggat cctaacatga cctcacacca gatcaccctc gagatcaca 5940 tgaccagcag ccgtattggc acatacacta caccagcccc aacagctt ctccttgcat 6000 gtgccgtcat caacacagtg tgtgcgctga taatggcctg cagcagtaga agcactgcca 6060 catcaggcat tgtcagcagc caatgcacag ttcatcccaa tcaccctcca ccaagttatg 6120 gcgtcaatgt aactggtctg ccgggtaacc tatactcaag gaacactaca taacattata 6180 aataacagaa attatcctt aataaacccc aggccagaca gctttaccct gctagacgat 6240 tcaatcagcc cttgcagtat gtcgtctagt taacaaaaaa ccggtaggat aagtactatc 6300 ctattggaac caaacgagac ctgtagagca gctcacacaa gagaacca agctgacttc 6360 acctagtatg ggaaggaact tagaagtgag tggcagcatt accaatttga actttgagag 6420 aactcagcat cctgacacat ttaggactgt tgtaaaagtg aaccaaatgt gtaagcttat 6480 tgcaggtgtg ctcacaagtg ctgctgtggc agtttgtgtg ggggtcataa tgtattctgt 6540 tttcacatca aaccacaagg ccaactccac gcagaatgcc acgacccgga acagcacatc 6600 cacccctccc caaccaaccg ccggtctgcc caccacagag caagggacca tccccagatt 6660 caccaaaccc cccaccaaaa ccgccaccca ccatgagatc acagagcccg tcaaaatggc 6720 aacaccttca gaggatccct accaatgctc cagcaatggt tatttggacc gacctgattt 6780 acctgaaaat ttcaaactcg tattggatgt tatatgcaag cctccaggtc ctgaacatca 6840 caacaccagc tgttatgaga aacgtgaaat caacccagga agtgtttgcc ctgatcttgt 6900 aacaatgaag gcaaacatgg gcttaaacaa tggtggtggg gaggatgctg caccttatat 6960 agaggttacc accctttcta cgtactccaa caaaagggca atgtgtgtcc acaatgggtg 7020 tgatcaaggc ttctgtttct tcctttctgg tttaagcact gatcaggaga gagctgtgct 7080 agagcttgga ggtcaacagg ctatcatgga gttgcattat gattcctact ggaaacacta 7140 ttggagtaac tctaattgtg ttgttcccag aacaaactgc aacctgacag accaaactga 7200 gattttgttt cctaggttta acaacaagaa tcagtctcag tgtaccacct gtgcagattc 7260 agctggccta gataacaaat tttatctcac atgtgatggg cttttaagaa ccctccctct 7320 agttggacta cccagcctaa gtcctcaggc ttacaaagct gtacccacac aaactacagg 7380 caccaccacg gcaccaacat cagagacgag gcacccaacc cctgcaccca ggaggtccaa 7440 acctctcagt cggaagaaga gagctttatg tggtgtagtc tcaagcagag aacccaaacc aacaatgcct tactggtgtc ctatgctcca attatttcca aggaggtcta attcttaagt gacctattcc tgaattaact tcagaataag taccaacctt atcagtagtt aatgaaaact aagctttgat ataataggac aaatatgatt cctggcagga tctttctagt ccttctggtg atcttcaaca ccaagccaat tcacccaat acattaacag aaaaattcta tgagtccaca tgtagtgttg agactgcagg ttataagagt gcccttagaa caggttggca tatgacagtt atgtcaatta agttgtctca aataaatatt gagtcatgca agagcagcaa ctcgttattg gctcatgagc ttgcaatcta tagtagtgca gtggatgaat tgagaacgtt atcatccaat gccttgaagt ccaaaagga gaagaggttc ctcggtttga ttcttggtct cggagctgca gtcactgccg gggtggcttt agccaagaca gtgcaacttg aaagtgagat tgcattgatt aagagatgcag tgagaaatac aaatgaggct gttgttagcc taaccaacgg catgtcagtg ttggctaaag tggtggatga tttgaaaaac ttcatatcta aagaattact cccaaaaata aaccgagtct cttgtgatgt gcacgacatc actgccgtca ttagattcca acagctcaac 8220 aaaagacttt tggaagtatc tcgtgaattt tcatctaatg caggattaac acacactgtt 8280 tcatctttta tgttaacaga ccgggaactc acctccattg taggcggcat ggctgtttca 8340 gcaggccaaa aagagataat gctatctagc aaagctataa tgagaagaaa tgggttagca 8400 atattaagtt cagtcaacgc tgacacactg gtttatgtaa tacaactccc attatttggt 8460 gttatggaca cagattgttg ggtaataaga agttctatag actgtcataa catagcagac 8520 aagtatgctt gtttggctag agctgataat ggctggtatt gtcacaatgc tggctcatta 8580 tcatacttcc cgtcgccaac ggattgtgag atccacaatg ggtatgcttt ctgtgacact 8640 ctaaaaagtc taactgtacc tgtaacatca cgagaatgca actcaaacat gtataccact 8700 aactacgatt gtaagatttc cacaagtaaa acttatgtga gtacagcggt actgactaca 8760 atgggttgct tggtatcttg ttatggtcat aacagttgca cagtcatcaa taatgacaaa 8820 ggtataataa ggactctgcc agatggttgc cactacatct ccaacaaagg tgtggacagg 8880 gttcaagtag gtaacactgt ttactactt agcaaag ttggcaagtc aattgttgtc 8940 agagggaac cattggtctt gaaattgac ccttgagtt tccctgacga taatttgat 9000 gttgcttaa gagatgtgga gcatagcatc aatcagacac gcacattctt gaaggccctct 9060 gatcagttat tggacttag tgaaacaga gagaataaaaaaaaa gtcatatata 9120 ctaacaactc tgctcttcgt tgtaatgctt atataataa tggctgtcat agggttcatt 9180 ctgtataagg tattgaaat gatcagagac aacaagttga atccaaag tacacctggc 9240 ctcacagtttt tatcatgaca attgtaccaa accatattg agttagttaa ttaaaaactt 9300 aggataagtg acatccaga cccaacct ctttcactc tcaagtaa ggtaggatga 9360 gtgtgagacc ttgcaattt gaggttcaag ggttttgttc cagagggagg aattgcaagt 9420 atagtcataa atattgggaa tggcctttga aactcttat gctcaggcag aactacatgc 9480 ttaataggat ttataggttc ctcgacacca accacagatgc atgtcagat gtcagcggat 9540 ttgatgcacc acaaggact gctgagtatg ccttgggaac cataggtgtg ctgaaaagtt 9600 acctggaaaa actacaac atcactaat caatagcttg tggcagtttg atcactgtat 9660 tgcagaactt ggatgttggt ctagtaatac aagcaaga tagcacact gaggacacca 9720 attacktgag aagttgcac actatactgt cttatataga caagatacac aaagagac 9780 aaattattca cattctcaa agactgccag taggagtact atgcaatctg atccaatctg 9840 tcatctccat cgaggagaag ataaattctt ctatgaaac agaatgataa ggctgcctaa 9900 atactatcca gccatactgc ataagatgta tattattaga gtaaatagaa acccactta 9960 cgatgggtct ggaccatcca caataataga tgcaggaag tctgtggtgt ggaatcgtgt 10020 tgatgtgata gcttgtgtga aagaggcctt gtgctgcata gattcagct ggaataacca 10080 agtgatcata gactttgatt atagccaggc cagatgatgt ggactgtatt cctttttg 10140 tcagtaatca gttattacc caaattgtt attatgtag acttaagtt aactaactc 10200 atgttaattc atagttata taaaaaaata ttcgaattag gatcaattg gatcctattg 10260 atgaacaaga agttaatgtg tacttgccgg atagctactt aaagggtgtt atatctttta 10320 gtgaaactaa tgctcttggc agctgtatca ttggtagacc tttcttgaag gatgacttta 10380 ctgccactac ttcaatccgt aaccccctaa ttgaacataa aagaataagg gacactaaat 10440 tagtaaaaaa tattgtttca aaccctcaat ataggttagt ggagcctctc caaatgcagc 10500 atgagctctt gagtgtacta tcgcccaatt tcatattgca cactgccaac ttaaggaaaa 10560 ttatacaaag aagtgttgac ataacagata aaaagttgaa ccccattttg cacattttga 10620 atcttaattc tcctaaccaa gagggtaagg tgtcggaacg gctaactagg ctaattaaga 10680 aacatctctc tcacatacct aattgggtaa gcagctggta caatatatgg gtcaatctta 10740 acaacttact gcaggagtac cgttcaaagg aagttataga ccataactgt gttctgacta 10800 ggcaattgtc tggaagtttc atacatgtgg tcatgagtca atatggagtt gtgataatta 10860 gcaaaaaaag taaaagatat acaatgtgta cttataacca attcctaacc tggaagggacc 10920 ttgccttgag cagatttaat gccaattatg tggtctggct aagtaatgtg ttaaacacac 10980 tcaacgagg gttgggatta aggtgtagat taaaaggtca tctgctcagt aagttgtaca 11040 tttccactga catctttta tcttcaacat ctaatgaatt ttataatgtg gtcaaggaat 11100 ttgaggctt catcatgtca ctgatattga aaaactga ggaagcctta tttagcacaa 11160 ggttttataa taacatgttg aacaacttaa ttgatgccat tgatagggct cgactagagt 11220 atctggcccg ctgtgccaat tcagctgcca ggattaattt acctagtaca gatgttatga 11280 tagcatcatt gggtgatatc ttatctttga taaacgtttt aggtgaatcc aaccttaaca 11340 acttaagtga gttatatttt atcttcagga tatttggtca ccctatggtt gatgagagga 11400 aggccatgga tgcagtcaga gataactgtt gtgaaaaa gtttctgacg gtaagaacc 11460 ttgcatcgtt aagaggagca tatgtttata gaattatcaa aggattcgta ccaaattata 11520 acaggtggcc ttacataaaa actagagttt gccttacacc aacatggatt aactatcttg 11580 acaccaattc atgtccctca ttattagaga tgacagaaga tgattttatt gtgttagctg 11640 11700 atgacaaggc catatctcct ccaaaatcac tcatttggtc atgctttcca aaaaactaca 11760 tacctcaggt tatacaagat gagtatgccc ggaggtattg tagagctaaa gcacctttga 11820 agacaagacg tgtcttggag ttctacttac aggacaagga tttcaagttg gatcagctcc 11880 atagagtagt agtgaaccag gactacctta atgataaaga acatataatt tctttaacag 11940 gaaaagaaag agagttgggt gttggtagga tgtttgccat gcaacctggg aagcagaggc 12000 aagtccaaat tttagcagag aagctgttgg ctgataacat cctgcaattc tttccggaga 12060 cactgactag atacggtgat ttggagctgc aaaagatact agagttaaaa gctggacttt 12120 caaataaaaa tgacagatct aaagactcct acaataatta tataagtagg tgctcattaa 12180 ttactgattt aagtaaattt aaccaagctt ttaggtacga gtcatcctgt gtgtgtagtg 12240 atcttttaga tgagctacat gggactcaaa gcttattctc ttggctgcat ttaacagtac 12300 cactgactac tataatgtgt acatataggc atgcgccgcc ggacactgga aaacata 12360 atgtagatga tattgctgag cagagtggac tctaccgcta ccacatgggc gggattgagg 12420 gctggtgcca gaagctctgg acaacagagg ccattgcttt gctagatact gtagctgtga 12480 agggccgttt ccagctaact tcattaataa atggcgacaa ccaaagtatt gatatttcaa 12540 aaccaacaag gctggggacc aggactcaaa gtgaagcaga ttatgatttg gcaataaatt 12600 ctttaagatt aatatcagca gcttataaag gcattggaca taaattaaaa gaaggtgaga 12660 cctacttgtc acgtgacatg cagttcatga gtaaaacaat acaacatgaa ggggtctact 12720 acccggcctc catcaagaaa atattaagag ttggtccctg gatcaacaca atattagatg 12780 atataaaaac ttcaacagaa agtattggtt ctctaactca agaactagaa tataaaggtg 12840 aaagtttaat gagcagcctg ctgctgagga acttctggct ctacagatta tattcagtgg 12900 atttaaaaga tcattctttg tgtggaaagc agctctacag atccttaata aaagtgttaa 12960 aacatttgaa gaggtgcttc aacctggaga accttgggga atgtttggaa ttatttttaa 13020 atgtgcccat gcagtttgga ggtgctgacc caaatgtcat ctacaggagc ttctacagaa 13080 gaactccaga ttttctaaca gaaagtataa ctcatctcat cctcatttta aaacatttta 13140 gaagagattt ggaattcaac aaagataatg tctccaaagc tgttctttct ttgctagagt 13200 tcaccaagaa tgattctgca gaatttgtaa cttgatgag agatcctcaa gcaattggta 13260 gtgagaggca ggccaagatc acttcagaca tcaacagaac agctgtaact tcagtgttat 13320 caaatgctcc aaatgaaata tttagaactt cagctcttca ttacagcagc acagaaaatg 13380 aattaaatgg atagcaagt ggagtttctc ctgtttatcc tcatggtctt cgagttttat 13440 atgaaagttt acctttttat aaagcagaga agattgtcaa catggtttct gggaccaagt 13500 ccatcaccaa catactggag aagacatcag ccatctccta cacagatata attcgagcca 13560 ccaacatgat ggtggagaac ctcactttgc taacaagaat aatgaaacca ggtgctgaca 13620 catctttgga tcctgacaca atagtaataa caatattatc aaaaataata agagataaat 13680 cctgggatgt tggtgatata attggtgtca cttccccatc tcctgtctcc tgcttcaagg 13740 tggtctacac atcaactcta caaaataatt cagtagtaat agaaagatac acaacagaca 13800 cctacacaag aggtaagaga ggccccacca agccctgggt gggcagcagc acacaggaga 13860 agaagtccat gcctgtctac aacagacaag ttttaacaag agcaaaga gatcaaatag 13920 aaaatatagc aaagctgggag tgggtgtttt cttcagtagc aaatattgat tctttgctaa 13980 atgagctcag caccatgact ttgggtcttt ctctaaggaa atgtagaacaa ctttttccaa 14040 catatttaag tttaaacttc ctgcacaggc tttctgtcag cagcaggccc agagaatatc 14100 cttcttctct tcctgcctac aggaacaaa attttcattt tgatactgga ccaataata 14160 aagtgttaac agaaagattt ggagatgaag atataaattt ggtatttcaa aatgcaatat 14220 catatggtct ttccaccatg tctttggtgg agcagtttac tggtgtctgt ccaataaag 14280 ttttgctggt gcccaagcta caagaaaatac aactatgaa agttccaata tttcaaggtg 14340 gcttcaacct acaagtata attccaataa taaggcagca gcacatgttc ctgcccaacc 14400 acatcactcc agcccagtat attgaattat ttctttcttt aaaacaattt cattcaagaa 14460 taaatttaaa acacaacaac agatttaaac ttgttttaca aaaagattat tttaatgggg 14520 agaacatgat agaaactttg tccacctgtt tggcaggcca ctggatcatc atttgatgc 14580 taatgaagga gagtcagggg atatttgaca aggagtggta tgatggtttt gtaacagacc 14640 acatgttcct ggacctgcag cctctcctct cctccttcaa gacatttcta actgtcttca 14700 actttgctta tttaaaagtt ggttcaaata tagaagaaat aacaggaaat caagccaacc 14760 tgctggagct gctggacctg ggctactgga agaacatgta taaagtattt tcagagacca 14820 aggtgcggct ggctttgcta aaacaagatt tatcatttaa ttctgtgaag aacagcagca 14880 gcttccggca ctggtttata aattctctac aagaagtaca atgtacttct gtgccttggg 14940 tggtaaatgt aacaagaaat ccaactcatt taaaaggtgt tctacagtac atgaagatga 15000 tagaaagtgg catgattcaa ggttattcag caaatatttc ttcagtttta agtatcccat 15060 ataattatcc agacatggcg cacatgatga caaaaatat aagaaatcga ggccacatgt 15120 cctatgatta tccaaagatg aagaaaagtt taactttctc catgacagac atgagtgaca 15180 gctacatgct caacctcttc cccaaagtag aatgttctta catgagtggt tatttggata 15240 aactagatga tactctacaa cttctaaaga aacctcctgt tggaagaaaa gttccttctg 15300 tggctttgcc ctggcaccac tgcaacagat acaactttgt cttcagcagc acaggctgca 15360 aagtttctgt cattgacatg cttccaaaac atttccgaag aagtaattta aaagtaatat 15420 gttttattgg agaaggggcg ggcaacctca tgctaagagc tgttttggaa gttggtggaa 15480 atataaatt aatatataga tccttaaaag atcctgatga tcatcatgtt cctgtagaat 15540 ttctaagatt aaaaccttgt tatccttata ttgatactgg tggcagttta tctttggctt 15600 caacagatgc caccaacaag gccactggg attatttaca tcttcactgg acagatcctt 15660 taaatttaat agtatgtgat gcagaaataa gtggtgtgaa gcactggcta aaaattcttc 15720 acaggtggta tgagcacatg acttcctgca agcactgttt aaaatcagaa catgataaat 15780 atttaataat aaaatatcat gctcaagatg atttaataga tcttcctcat ggtgtcaggc 15840 tactaaaatg taacatctgc ctgggctcca aactaagtgg cagtgagagc tacctgctca 15900 ttggtcttgg tctttcaaat aaacttcctg tctacagtga agttcttcat tcaaaacttc 15960 ttttggcaga atgtcatcag tttcatcatc caaaatattt ggatgtttct ggaataaata 16020 caaatataaa atccttaata ccaatgttgg attatccaat aacttacaac aagatcacca 16080 ctttgctaga aagtgtgcgg gagctttctt caaataaaaa caagaacacc atgtggattg 16140 gaagaaatcc tgtctaccat aataaatggc taaagaggaa atatttcaac attttaaaat 16200 ggctaaaata ctgtatagaa cttcctgcct tcaggatgga ttataattca tttgagagaaa 16260 tagaaatgct ttatccaaat ttaagagatt tggtagattc tgtttctact tcagagctga 16320 agaaagtaat aaaagtaaca ggcatcctct tcaggagcaa caccatgtga attaatatgc 16380 caatgctaac atgtcatccc cactactttt tttgttcaat cactctcagt ctagacatgt 16440 gagaagatcc caaacccaac tgcacccctc ccactcgaaa tcagttgtag cctcagcagc 16500 tccatctgcc atgatctctg accagcagca aatgtattat tattttaatt tgtctatagt 16560 taacaaaaaa ttgatatctc acaggttgta aacatagttc ttttataatt attgttagtt 16620 aaactattgt gtttgacttc ctttgggtat ttttttcccg t 16661 <210> 63 <211> 9 <212> DNA <213> Pneumonia virus of mice <400> 63 gccgccacc 9 <210> 64 <211> 10 <212> PRT <213> Pneumonia virus of mice <400> 64 Thr Asn Phe Asp Arg Ser Asp Leu Glu Thr 1 5 10 <210> 65 <211> 10 <212> PRT <213> Pneumonia virus of mice <400> 65 Ser Asp Ser Glu Glu Ser Gly Asp Glu Ala 1 5 10 <210> 66 <211> 14 <212> DNA <213> Pneumonia virus of mice <400> 66 aagattgcta gtcc 14 <210> 67 <211> 17 <212> DNA <213> Pneumonia virus of mice <400> 67 caaagaccag aatcatg 17 <210> 68 <211> 6 <212> DNA <213> Pneumonia virus of mice <400> 68 tgagct 6 <210> 69 <211> 6 <212> DNA <213> Pneumonia virus of mice <400> 69 gatcca 6 <210> 70 <211> 10 <212> DNA <213> Pneumonia virus of mice <400> 70 cacatcctag 10 <210> 71 <211> 6 <212> DNA <213> Pneumonia virus of mice <400> 71 ccacct 6 <210> 72 <211> 9 <212> DNA <213> Pneumonia virus of mice <400> 72 tagttatag 9 <210> 73 <211> 3 <212> DNA <213> Pneumonia virus of mice <400> 73 tgg 3

Claims

1. A live chimeric non-human single-stranded retroviral vector consisting of SEQ ID NO:60, SEQ ID NO:61 or SEQ ID NO:

62.

2. The non-human single-stranded retroviral vector of claim 1, which consists of SEQ ID NO:

60.

3. The non-human single-stranded retroviral vector of claim 1, which consists of SEQ ID NO:

61.

4. The non-human single-stranded retroviral vector of claim 1, which consists of SEQ ID NO:

62.

5. A composition comprising the non-human single-stranded retroviral vector according to any one of claims 1 to 4 and a pharmaceutically acceptable carrier.

6. The composition of claim 5, wherein the composition is formulated for intranasal administration.

7. The composition of claim 5, wherein the composition is used to elicit an immune response to human respiratory syncytial virus (RSV).

8. Use of the non-human single-stranded retroviral vector according to any one of claims 1 to 4 in the preparation of a medicament for eliciting an immune response to RSV in a human not suffering from RSV infection.

9. A method for preparing the non-human single-stranded retroviral vector according to any one of claims 1 to 4, the method comprising: A non-natural RSV F gene consisting of SEQ ID NO: 46 was inserted into a non-human single-stranded retroviral vector.

10. A kit for eliciting an immune response, the kit comprising: (a) the composition of claim 5; and (b) at least one container for containing the composition.

Images