Application of OsDSK2a protein or its encoding gene in regulating rice blast resistance
Knocking out the rice OsDSK2a gene through CRISPR technology solves the problem of short resistance cycle of rice blast disease, and achieves long-lasting enhancement of rice blast resistance, which is suitable for genetic engineering breeding of rice genes.
Patent Information
- Application Number
- CN202011449973.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2020-12-09
- Publication Date
- 2025-08-22
- Estimated Expiration
- 2040-12-09
AI Technical Summary
The existing rice varieties have short resistance cycles of rice blast, making it difficult to maintain rice blast resistance for a long time, affecting rice yield and economic benefits.
The OsDSK2a gene in rice was knocked out using CRISPR technology, and the expression of Os10g0542200 was reduced through Cas9-mediated gene editing vector, thereby increasing the rice blast resistance of rice.
The rice blast resistance of rice was significantly enhanced and did not affect the growth status and agronomic traits of the plant, providing a lasting improvement of rice blast resistance.
Smart Images

Figure CN112341532B_ABST
Abstract
Description
Technical field:
[0001] The present invention belongs to the field of crop genetic technology, and in particular relates to the application of OsDSK2a protein or its encoding gene in regulating rice blast resistance. Background technology:
[0002] Rice blast, caused by the fungus Magnaporthe grisea (Hebert) Barr, is one of the most devastating rice diseases in rice-growing areas worldwide, having a devastating impact on global rice cultivation. Blast can occur at any stage of the rice growth cycle, with leaf and panicle blast being the most damaging. Globally, rice blast causes annual yield losses of 11-30%, resulting in direct economic losses of approximately US$5 billion, and the lost grain is enough to feed 60 million people. In my country, rice blast occurs in every rice-growing region. Rice-growing areas in both the north and south are affected annually to varying degrees, with yield reductions typically ranging from 10-20% to as much as 40-50% in severe cases, and even complete crop failure in some fields.
[0003] Currently, breeding for rice blast resistance by leveraging cultivar resistance is considered the most economical, effective, and environmentally friendly approach to rice blast control. In recent years, breeders have developed numerous blast-resistant rice varieties using conventional breeding techniques. However, most resistant varieties lose their blast resistance within two to three years of introduction. For example, the highly blast-resistant variety "Zhaiyeqing 8" lost its resistance within less than three years of introduction, and the high-yield, resistant, and high-quality variety "Jingxian 89" also showed a significant decline in resistance within four years of introduction. This suggests that the short lifespan of rice blast resistance is a common and prominent problem in rice production. Extending the longevity of rice blast resistance has become a priority for rice improvement in my country and other rice-producing countries.
[0004] Rice blast can occur at any stage of rice growth, with leaf and panicle blast being the most common. Previous studies have shown that resistance to leaf and panicle blast in rice shares commonalities. Genetic analysis of the durable blast-resistant rice varieties Moroberekan, Gumei No. 2, and Sanhuangzhan No. 2 revealed that durable resistance to rice blast consists of two components: qualitative resistance (controlled by major genes) and quantitative resistance (controlled by minor genes). To date, at least 69 blast-resistance loci, encompassing a total of 84 major genes, have been reported internationally, and over 300 QTLs for quantitative blast resistance have been identified and mapped. However, research on the identification, cloning, and application of rice susceptibility genes is rare. Therefore, discovering, identifying, and utilizing blast-susceptibility genes is an important avenue for achieving breakthroughs in molecular breeding for blast resistance in rice. Summary of the invention:
[0005] The purpose of the present invention is to provide an application of OsDSK2a protein or its encoding gene in regulating rice blast resistance.
[0006] The present invention utilizes CRISPR technology to knock out the OsDSK2a gene (Os10g0542200) contained in rice, and then cultivates the transformed rice cells into plants to obtain transgenic rice with altered resistance to rice blast disease, wherein the resistance to rice blast disease is improved after the knockout of the Os10g0542200 gene.
[0007] Therefore, the present invention provides the use of OsDSK2a protein or its encoding gene - OsDSK2a gene in regulating rice blast resistance. The amino acid sequence of the OsDSK2a protein is shown in SEQ ID NO.2.
[0008] Preferably, the nucleotide sequence of the OsDSK2a gene is shown in SEQ ID NO.1.
[0009] Preferably, the OsDSK2a gene knocked out in rice is used to improve the blast resistance of rice.
[0010] The second object of the present invention is to provide a method for improving rice blast resistance, which is to knock out the OsDSK2a gene in rice, thereby improving rice blast resistance. The nucleotide sequence of the OsDSK2a gene is shown in SEQ ID NO.1.
[0011] Preferably, the OsDSK2a gene contained in rice cells is knocked out using CRISPR technology, and the transformed rice cells are then cultured into plants to obtain transgenic rice with improved resistance to rice blast.
[0012] Preferably, the OsDSK2a gene contained in rice is knocked out using CRISPR technology, and the nucleotide sequence of its specific editing site is shown in SEQ ID NO.3.
[0013] The third object of the present invention is to provide a specific editing site for specifically knocking out the OsDSK2a gene using Crispr / Cas9, the nucleotide sequence of which is shown in SEQ ID NO.3.
[0014] The fourth object of the present invention is to provide the use of the above-mentioned specific editing site in improving rice blast resistance, such as in the preparation of a drug for improving rice blast resistance.
[0015] The present invention also provides the gene editing target site of the above-mentioned OsDSK2a gene, sgRNA, and specific primer pairs; recombinant expression vectors, expression cassettes, transgenic cell lines or recombinant bacteria containing the target site sequence all fall within the scope of protection of the present invention.
[0016] The present invention has the following beneficial effects:
[0017] 1. This paper demonstrates for the first time that the rice DSK2a gene (Os10g0542200) is a functional gene that confers susceptibility to rice blast. The cloning and biological function verification of this gene are of great reference significance for the study of the molecular mechanism of rice blast resistance.
[0018] 2. The present invention provides a Cas9-mediated Os10g0542200 gene editing vector. This vector can significantly reduce the expression level of Os10g0542200 after transformation into rice. Along with the reduced expression level, the transformed plants are less susceptible to rice blast and significantly more resistant to it. Furthermore, the transgenic plants do not show significant changes in their growth state or agronomic traits. Therefore, the present invention's Cas9-mediated Os10g0542200 gene knockout technology can be applied to genetic engineering breeding of rice and can be applied in production practice to improve rice resistance to rice blast, thereby ensuring rice production safety under current climatic conditions where rice diseases are frequent. Description of the drawings:
[0019] Figure 1 The overexpression vector pYLCRISPR / Cas9P used in Example 1 ubi -H and pYLgRNA-OsU6b vector maps;
[0020] Figure 2 PCR identification and target site sequencing of transgenic plants obtained by knocking out the Os10g0542200 gene in Example 2, where OsDSK2aCas9-6, OsDSK2aCas9-14, and OsDSK2aCas9-17 are transgenic homozygous mutant seedlings with knockout of the Os10g0542200 gene. + indicates a positive control, and - indicates a negative control.
[0021] Figure 3 This figure shows the effect of knocking out the Os10g0542200 gene on the leaf blast resistance of rice plants in Example 3, where ** indicates a very significant difference compared with the control. OsDSK2aCas9-6, OsDSK2aCas9-14, and OsDSK2aCas9-17 are transgenic homozygous mutant seedlings with the Os10g0542200 gene knocked out, and Wildtype represents the wild type. Specific implementation method:
[0022] The following examples are provided to further illustrate the present invention, but are not intended to limit the present invention. Specific experimental conditions and methods are not specified in the following examples; the techniques employed are generally conventional methods known to those skilled in the art. The experimental materials used in the following examples, unless otherwise specified, can be purchased from conventional biochemical reagent companies.
[0023] Example 1 Selection of Os10g0542200 gene knockout target site and construction of knockout vector
[0024] 1. Selection of knockout target sites
[0025] A knockout target sequence was designed for the Os10g0542200 gene (nucleotide sequence shown in SEQ ID No. 1). A 20-bp specific target sequence was screened using E-CRISP (http: / / www.e-crisp.org / E-CRISP / ) for sgRNA generation. This sequence (nucleotide sequence shown in SEQ ID NO. 3) is located at bp 352-371 (5'-GCTTCAGCTGCTCCTAGCAG-3') within the 1728-bp CDS sequence (nucleotide sequence shown in SEQ ID NO. 1) in exon 2 of the Os10g0542200 gene. The amino acid sequence of the protein DSK2a encoded by the Os10g0542200 gene is shown in SEQ ID NO. 2.
[0026] 2. Construction of knockout vector pYLCRISPR / Cas9-OsDSK2a
[0027] (1) Bacterial activation and plasmid extraction and preparation: The plasmid pYLCRISPR / Cas9-H (Addgene ID 66187, the vector map of which is shown in Figure 5) from the laboratory of Academician Liu Yaoguang of South China Agricultural University was used. Figure 1 As shown in the table) of bacteria (TOP10F') and pYLgRNA-OsU6b (Addgene ID 66196, the vector map of which is ... Figure 1 Single colonies of the strain (DH10B) were streaked onto LB plates containing kanamycin (25 μg / ml) and ampicillin (50 μg / ml). 1 ml of seed culture medium was cultured from each colony and then expanded for plasmid extraction. The plasmid was then purified using the TIANGEN EndoFree Maxi Plasmid Kit and set aside.
[0028] (2) Construction of sgRNA expression cassette:
[0029] ① Take 2-5 ng of pYLgRNA-OsU6b plasmid as template and use four primers in a single reaction: 0.2 μM each of UF and gR-R, and 0.1 μM each of DSK6b-F and DSK6b-R. Incubate for 25-28 cycles: 94°C for 10 seconds, 58°C for 15 seconds, and 68°C for 20 seconds. During the initial amplification, UF / DSK6b-R amplifies the U6a promoter and DSK2a target site, while DSK6b-F / gR-R amplifies the DSK2a target site and sgRNA sequence. In later cycles, overlapping PCR is used to generate a combined sgRNA expression cassette fragment (containing the OsU6b promoter, DSK2a target site, and sgRNA sequence). PCR primers: UF: CTCCGTTTTACCTGTGGAATCG; gR-R: CGGAGGAAAATTCCATCCAC; DSK6b-F: CTGCTAGGAGCAGCTGAAGcaacacaagcggcagc; DSK6b-R: CTTCAGCTGCTCCTAGCAG gttttagagctagaaat.
[0030] ② Dilute 1 μl of the PCR product from round 1 (1) 10-fold with H₂O. Use 1 μl as template and add 0.15 μM each of Pps-GGL and Pgs-GG2 primers and an appropriate amount of high-fidelity KOD-Plus enzyme to a 50 μl PCR reaction. Amplify for 17-20 cycles: 95°C for 10 seconds, 58°C for 15 seconds, and 68°C for 20 seconds to obtain the sgRNA expression cassette. Perform electrophoresis on 2-3 μl of the sample and estimate the approximate concentration. PCR primers: Pps-GGL: TTCAGAggtctcTctcgACTAGTATGGAATCGGCAGCAAAGG; Pgs-GG2: AGCGTGggtctcGtcagggTCCATCCACTCCAAGCTC.
[0031] (3) Enzyme digestion-ligation reaction of binary vector pYLCRISPR / Cas9-H and sgRNA expression cassette:
[0032]
[0033]
[0034] The enzyme digestion and ligation were performed using a variable temperature cycle for about 10-15 cycles: 37°C for 5 min; 10°C for 5 min; 20°C for 5 min; and finally 37°C for 5 min to obtain the ligation product.
[0035] (4) Transformation of ligation product (electroporation): The ligation product of step (3) was dropped onto a Millipore VSWP04700 suspension dialysis membrane (pore size 0.025 μm) and dialyzed against 1 / 3xTE for 30 min for desalination. 1 μl of the ligation product was then electroporated and transformed into E. coli DH10B competent cells.
[0036] (5) Screening of positive clones: The plasmid was extracted using the conventional alkaline lysis method. Approximately 80–100 ng of the plasmid was excised using ~3U AscI (20 μl reaction) to excise the concatenated gRNA expression cassette fragments. Electrophoresis was performed to check whether the size met the expected value (the sum of the sizes of the gRNA expression cassette fragments). Positive clones were selected for sequencing verification, thereby obtaining the knockout vector pYLCRISPR / Cas9-OsDSK2a targeting the OsDSK2a gene. Sequencing primers: SP1: CCCGACATAGATGCAATAACTTC; SP2: GCGCGGTGTCATCTATGTTACT.
[0037] Example 2 Obtaining and Identifying Os10g0542200 Gene Knockout Transgenic Plants
[0038] The constructed knockout vector pYLCRISPR / Cas9-OsDSK2a was introduced into the normal japonica rice variety Nipponbare using Agrobacterium tumefaciens EHA105-mediated genetic transformation. The rice transformation work was commissioned by Wuhan Boyuan Biotechnology Co., Ltd. The transformation process is as follows: the pYLCRISPR / Cas9-OsDSK2a plasmid was extracted and transformed into Agrobacterium tumefaciens EHA105. Calli of the japonica rice variety Nipponbare were infected with Agrobacterium tumefaciens EHA105 containing the pYLCRISPR / Cas9-OsDSK2a plasmid. The calli were then cultured on a co-culture medium at 26°C in the dark for 2-4 days. After washing, the calli were transferred to a selective medium containing hygromycin for resistance screening. Resistant calli were then transferred to a predifferentiation medium for 10-14 days, then to a differentiation medium in the light. When the seedlings reached 2-4 cm in length, they were transferred to a rooting medium and grown for 3 weeks. After 3 days of hardening, the T0 seedlings were transplanted to soil and identified by PCR.
[0039] Using wild-type and T0 generation leaf genomic DNA as template, PCR amplification was performed with Hyg-F / Hyg-R (primers Hyg-F: AGCCTGACCTATTGCATCTCCC; Hyg-R: CTGCTCCATACAAGCCAACCAC), and plants with specific amplified bands were transgenic positive plants. Then, specific primers DSK2a-F and DSK2a-R (primer sequences DSK2a-F: TCTTTTCTTGCTTCTCACACTCC; DSK2a-R: TTGCCAGTAGAACCTGCCCG) were designed on both sides of the editing target sequence, and the PCR amplification products ( Figure 2 -A) sequencing was performed to detect the target sequence in the T0 generation. Using the wild type as the control, 20 transformed seedlings were identified in the T0 generation, of which 3 were homozygous mutant seedlings, namely OsDSK2aCas9-6, -14 and -17. The mutant sequences are as follows Figure 2 -B. OsDSK2aCas9-6 and OsDSK2aCas9-17 both had single-base insertions at the same site, resulting in a frameshift mutation that differed from the wild-type starting at the 124th amino acid at the N-terminus and terminated prematurely after the 186th amino acid. OsDSK2aCas9-14 had a four-base deletion that caused a frameshift mutation that differed from the wild-type starting at the 122nd amino acid at the N-terminus and terminated prematurely after the 164th amino acid.
[0040] Example 3 Identification of leaf blast phenotypes of Os10g0542200 gene knockout transgenic plants resistant to rice blast
[0041] The three homozygous knockout T0 lines (OsDSK2aCas9-6, OsDSK2aCas9-14, OsDSK2aCas9-17) and wild-type rice seeds in Example 2 were germinated at 32°C. After 2 days, the young shoots were moved to plastic trays filled with soil and sown. When the seedlings grew to the 3-4 leaf stage, they were transplanted into black plastic buckets (about 30 cm in diameter and about 45 cm in height). Four plants were planted in each bucket, and 16 plants were planted in each line. After 4 weeks, leaf blast resistance was identified by punching inoculation. A wound was punched on the second or third leaf of each plant, and 10 μl of 5×10 5 The inoculated plants were first incubated in a dark room for 24 hours, sprayed with water for 2 minutes every 2-3 hours to maintain humidity. After 24 hours, they were moved to a mesh room for normal photoperiod incubation, and continued to spray with water for 2 minutes every 2-3 hours to maintain humidity. The lesion size was measured after 7 days. Figure 3The results showed that the leaf blight resistance of Os10g0542200 gene knockout plants was significantly enhanced, and the diseased leaf area was significantly reduced compared with the wild type.
[0042] The above-described embodiments merely illustrate several implementations of the present invention, and while their descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, all of which fall within the scope of protection of the present invention. Therefore, the scope of protection of the present invention shall be determined by the appended claims. Sequence Listing <110> Agricultural Biological Gene Research Center of Guangdong Academy of Agricultural Sciences <120> Application of OsDSK2a protein or its encoding gene in regulating rice blast resistance <160> 3 <170> SIPOSequenceListing 1.0 <210> 1 <211> 1728 <212> DNA <213> Rice (Oryza sativa) <400> 1 atgggcggcg gaggaggcga ggccgggggc ggcgacggag gggagtcctc tcctgctgcg 60 gctgcggcgg cggcggtggc gggggccgcg gcgctgcaca tccggtgcgc gaacgggtcc 120 aagttcaccg tgcgggccga cctcgacgcc acggtggggg cgttcaagga ggtggtggcg 180 gggagctgcg acgtgccggc ggcgcagcag cgcctgatct acaagggccg gatcctcaag 240 gacgagcaaa ccctagaaag ctatggtgtt gaaacagatc ataccattca tatggtgcgt 300 ggcgctggtc ccccagccgg atcagctgca cctgctgcag ccagccccca agcttcagct 360 gctcctagca gcggcccaac agatggtctt ggaagtttgt ttcctggcct tggtggtaca 420 ggaactgctg gtaccaggcc atctggtctt tttgggtctg gatttccaga attggatcaa 480 atgcagcagc agttaagcca aaaccccaac ttaatgaggg aaataatgaa tatgccaatg 540 atgcagaatc tcatgaataa ccctgattta attcgtaaca tgatcatgaa caatcctcaa 600 atgcgtgata tcatcgaccg gaatccagat cttgctcatg ttctcaatga tccaagtgtt 660 ctccgccaga cccttgaagc agccagaaac cctgaaatca tgagggagat gatgcggaac 720 acagacagag caatgagcaa cattgagtct tctcctgaag ggtttaatat gctccgacgc 780 atgtatgaaa ctgtccagga gcctttccta aatgcgacaa caatgggtgg agaaggcaac 840 acagctccaa acccattctc agctcttctt ggaaatcagg gttctaacca accaagggat 900 cctgctacaa atgctccaaa tactggctca gagtctacaa caggaacccc tgctccaaac 960 actaatccac ttccaaatcc ttggagctcc aatgctggag gtgcgcaagg agcaacacgg 1020 gcaggttcta ctggcaatgc aagaaccggt gccactgggg gccttggagg gttggggtca 1080 gctgatctga gcagtttatt tggtggtctt gccggtaata caggaactgg tgctactggt 1140 ggtctaggag ggttgggttc agcagatttg ggaagtttgc ttggtggttc tcctgattct 1200 tcttccttga gccagatttt gcaaaaccct gttatgatgc agatgatgca gaatatcatg 1260 tctgatccac agtccatgaa ccagttgctt aacttcaacc caaatacacg caacctcatg 1320 gaatcaaaca ctcagttgag ggaaatgttc caaaatccag aatttattcg ccagcttaca 1380 tccccagaaa ctatgcagca attactctcg ttccagcaga cattattatc acagcttggt 1440 caaaatcaac ctaggcagga tggtagccaa ggaggcaatg cgacaggcat gcggggaaat 1500 gttagcctcg acaccttgat gggcatgctt agtgggcttg gtgctggagg tggcataggt 1560 gtacccaata catccaatgt tccaccggaa gaactgtatg caacacagct cactcagctc 1620 cgagagatgg gtttcatcga cactgcagag aacatccagg cgctagtcgc aactgctggg 1680 aatgtgaatg ctgcggtgga gcgtcttctt ggcaatcttg gccagtag 1728 <210> 2 <211> 575 <212> PRT <213> Rice (Oryza sativa) <400> 2 Met Gly Gly Gly Gly Gly Glu Ala Gly Gly Gly Asp Gly Gly Glu Ser 1 5 10 15 Ser Pro Ala Ala Ala Ala Ala Ala Ala Val Ala Gly Ala Ala Ala Leu 20 25 30 His Ile Arg Cys Ala Asn Gly Ser Lys Phe Thr Val Arg Ala Asp Leu 35 40 45 Asp Ala Thr Val Gly Ala Phe Lys Glu Val Val Ala Gly Ser Cys Asp 50 55 60 Val Pro Ala Ala Gln Gln Arg Leu Ile Tyr Lys Gly Arg Ile Leu Lys 65 70 75 80 Asp Glu Gln Thr Leu Glu Ser Tyr Gly Val Glu Thr Asp His Thr Ile 85 90 95 His Met Val Arg Gly Ala Gly Pro Pro Ala Gly Ser Ala Ala Pro Ala 100 105 110 Ala Ala Ser Pro Gln Ala Ser Ala Ala Pro Ser Ser Gly Pro Thr Asp 115 120 125 Gly Leu Gly Ser Leu Phe Pro Gly Leu Gly Gly Thr Gly Thr Ala Gly 130 135 140 Thr Arg Pro Ser Gly Leu Phe Gly Ser Gly Phe Pro Glu Leu Asp Gln 145 150 155 160 Met Gln Gln Gln Leu Ser Gln Asn Pro Asn Leu Met Arg Glu Ile Met 165 170 175 Asn Met Pro Met Met Gln Asn Leu Met Asn Asn Pro Asp Leu Ile Arg 180 185 190 Asn Met Ile Met Asn Asn Pro Gln Met Arg Asp Ile Ile Asp Arg Asn 195 200 205 Pro Asp Leu Ala His Val Leu Asn Asp Pro Ser Val Leu Arg Gln Thr 210 215 220 Leu Glu Ala Ala Arg Asn Pro Glu Ile Met Arg Glu Met Met Arg Asn 225 230 235 240 Thr Asp Arg Ala Met Ser Asn Ile Glu Ser Ser Pro Glu Gly Phe Asn 245 250 255 Met Leu Arg Arg Met Tyr Glu Thr Val Gln Glu Pro Phe Leu Asn Ala 260 265 270 Thr Thr Met Gly Gly Glu Gly Asn Thr Ala Pro Asn Pro Phe Ser Ala 275 280 285 Leu Leu Gly Asn Gln Gly Ser Asn Gln Pro Arg Asp Pro Ala Thr Asn 290 295 300 Ala Pro Asn Thr Gly Ser Glu Ser Thr Thr Gly Thr Pro Ala Pro Asn 305 310 315 320 Thr Asn Pro Leu Pro Asn Pro Trp Ser Ser Asn Ala Gly Gly Ala Gln 325 330 335 Gly Ala Thr Arg Ala Gly Ser Thr Gly Asn Ala Arg Thr Gly Ala Thr 340 345 350 Gly Gly Leu Gly Gly Leu Gly Ser Ala Asp Leu Ser Ser Leu Phe Gly 355 360 365 Gly Leu Ala Gly Asn Thr Gly Thr Gly Ala Thr Gly Gly Leu Gly Gly 370 375 380 Leu Gly Ser Ala Asp Leu Gly Ser Leu Leu Gly Gly Ser Pro Asp Ser 385 390 395 400 Ser Ser Leu Ser Gln Ile Leu Gln Asn Pro Val Met Met Gln Met Met 405 410 415 Gln Asn Ile Met Ser Asp Pro Gln Ser Met Asn Gln Leu Leu Asn Phe 420 425 430 Asn Pro Asn Thr Arg Asn Leu Met Glu Ser Asn Thr Gln Leu Arg Glu 435 440 445 Met Phe Gln Asn Pro Glu Phe Ile Arg Gln Leu Thr Ser Pro Glu Thr 450 455 460 Met Gln Gln Leu Leu Ser Phe Gln Gln Thr Leu Leu Ser Gln Leu Gly 465 470 475 480 Gln Asn Gln Pro Arg Gln Asp Gly Ser Gln Gly Gly Asn Ala Thr Gly 485 490 495 Met Arg Gly Asn Val Ser Leu Asp Thr Leu Met Gly Met Leu Ser Gly 500 505 510 Leu Gly Ala Gly Gly Gly Ile Gly Val Pro Asn Thr Ser Asn Val Pro 515 520 525 Pro Glu Glu Leu Tyr Ala Thr Gln Leu Thr Gln Leu Arg Glu Met Gly 530 535 540 Phe Ile Asp Thr Ala Glu Asn Ile Gln Ala Leu Val Ala Thr Ala Gly 545 550 555 560 Asn Val Asn Ala Ala Val Glu Arg Leu Leu Gly Asn Leu Gly Gln 565 570 575 <210> 3 <211> 20 <212> DNA <213> Rice (Oryza sativa) <400> 3 gcttcagctg ctcctagcag 20
Claims
1. Application of knocking out a gene having a nucleotide sequence as shown in SEQ ID NO. 1 in rice to improve resistance to rice blast.
2. A method for improving rice leaf blast resistance, characterized in that: The method is to knock out the gene with the nucleotide sequence shown in SEQ ID NO. 1 in rice, thereby improving the resistance of rice leaves to rice blast.
3. The method according to claim 2, characterized in that The method uses CRISPR technology to knock out the gene with a nucleotide sequence such as SEQ ID NO.1 in rice cells, and then cultivates the transformed rice cells into plants to obtain transgenic rice with improved resistance to leaf blast.
4. The method according to claim 3, characterized in that The CRISPR technology is used to knock out the gene in rice with a nucleotide sequence as shown in SEQ ID NO.1, and the nucleotide sequence of its specific editing site is shown in SEQ ID NO.
3.
5. The use of Crispr / Cas9 to specifically knock out a specific editing site of a gene with a nucleotide sequence as shown in SEQ ID NO.1 in improving rice leaf blast resistance, wherein the nucleotide sequence of the specific editing site is shown in SEQ ID NO.3.