Application of a class of small RNA molecules and their analogues in anti-aging

Abstract

This invention discloses the application of a class of small RNA molecules and their analogues in anti-aging. Specifically, this invention provides the use of microRNAs of the miR-302 family, which are prepared into pharmaceutical compositions or formulations that can be used for (i) delaying or reversing the aging of normal somatic cells; (ii) promoting the in vitro expansion of normal somatic cells, and many other applications. Experiments show that the anti-aging effects do not depend on pluripotent cell reprogramming and do not increase the risk of carcinogenesis. Therefore, miR-302 is a class of highly effective and safe anti-aging drugs that do not induce pluripotent cell reprogramming and are non-carcinogenic.

Description

Technical Field

[0001] This invention belongs to the field of metabolic disease treatment. Specifically, it relates to the anti-aging effects of a class of small RNA molecules and their analogues. Background Technology

[0002] Resisting or reversing aging has been one of humanity's ultimate dreams since ancient times. Previous studies have found that treatments such as metabolic interventions, clearance of senescent cells, stem cell or fluid reinfusion can slow down or improve aging phenotypes in mammals to some extent. However, the goal of safely and effectively combating or reversing human aging remains a long way off. [1] .

[0003] In recent years, studies have found that overexpression of four transcription factors (Oct4, Sox2, Klf4, and c-Myc) in mice, which can reprogram somatic cells into pluripotent stem cells, can significantly increase the lifespan of mice with premature aging and, to some extent, improve the aging phenotype of senescent cells in normal aging mice and humans. [2] This suggests that cell reprogramming guided by pluripotent stem cell fate (pluripotency reprogramming) may be an effective anti-aging pathway. However, pluripotency reprogramming technology can also severely impair the function of normal adult tissues and has a strong potential for carcinogenesis. [2] Its safety profile is unsatisfactory, making it difficult to apply clinically in anti-aging treatments.

[0004] Therefore, there is an urgent need in this field to develop new, safe, and effective anti-aging methods and pharmaceutical compositions. Summary of the Invention

[0005] The object of this invention is to provide a safe and effective method and pharmaceutical composition for anti-aging. A first aspect of this invention provides the use of an active ingredient selected from the group consisting of:

[0006] (a) MicroRNAs of the miR-302 family, including: miR-302 or a modified miR-302 derivative; or microRNAs or modified miRNA derivatives with a core sequence of 5'-AAGUGCU-3', a length of 16-28 nt, and functions that are the same as or substantially the same as miR-302.

[0007] (b) A precursor miRNA, wherein the precursor miRNA can be processed in the host into miR-302 as described in (a);

[0008] (c) A polynucleotide, wherein the polynucleotide can be transcribed by the host to form the precursor miRNA described in (b) and processed to form the microRNA described in (a);

[0009] (d) An expression vector containing miR-302 as described in (a), or a precursor miRNA as described in (b), or a polynucleotide as described in (c);

[0010] (e).Agonists of microRNAs as described in (a);

[0011] The active ingredient is used to prepare a pharmaceutical composition or formulation, the pharmaceutical composition or formulation being used for one or more applications selected from the group consisting of:

[0012] (i) Delaying or reversing the aging of normal somatic cells;

[0013] (ii) Promote the in vitro and / or in vivo expansion of normal somatic cells;

[0014] (iii) Inhibit the expression and / or activity of SA-β-Gal;

[0015] (iv) Promote the expression and / or activity of H3K9me3;

[0016] (v) Inhibit the expression and / or activity of P16 protein;

[0017] (vi) Promote the expression and / or activity of type III collagen COL3A1;

[0018] (vii) Inhibit the expression and / or activity of PAI-1.

[0019] In another preferred embodiment, the anti-aging process does not rely on pluripotent cell reprogramming, nor does it increase the risk of cancer.

[0020] In another preferred embodiment, the pharmaceutical composition or formulation is also used to inhibit tumor cells.

[0021] In another preferred embodiment, the preparation includes dietary supplements, food additives, and test reagents.

[0022] In another preferred embodiment, the pharmaceutical composition comprises the active ingredient and a pharmaceutically acceptable carrier.

[0023] In another preferred embodiment, the core sequence described in (a) is located within the first 8 nt of the 5' end of the microRNA (e.g., positions 1-7 or 2-8).

[0024] In another preferred embodiment, the microRNA is 16-28 nt in length and its sequence characteristics satisfy the following formula: 5'-(N)AAGUGCUN…-3', where N represents any nucleotide and (N) represents 1 or 0 N.

[0025] In another preferred embodiment, the microRNA is 18-26 nt in length.

[0026] In another preferred embodiment, the phrase "functionally the same as or substantially the same as miR-302" means retaining ≥40% and ≤500% of the anti-aging function of miR-302 (e.g., hsa-miR-302c-3p).

[0027] In another preferred embodiment, the anti-aging function includes one or more functions selected from the group consisting of:

[0028] Promotes the in vitro and / or in vivo expansion of normal somatic cells;

[0029] Inhibit the expression and / or activity of SA-β-Gal;

[0030] Promotes the expression and / or activity of H3K9me3;

[0031] Inhibit the expression and / or activity of P16 protein; and

[0032] Promotes the expression and / or activity of type III collagen COL3A1.

[0033] In another preferred embodiment, the sequence of miR-302 is shown in SEQ ID NO.:1 (UAAGUGCUUCCAUGUUUCAGUG).

[0034] In another preferred embodiment, the miR-302 is derived from mammals, preferably from humans, rats, or mice.

[0035] In another preferred embodiment, the microRNA is UAAGUGCUUCCUACAAAGUCAC (SEQ ID No.: 11, i.e., mut1).

[0036] In another preferred embodiment, the pharmaceutical composition further includes additional anti-aging active ingredients.

[0037] In another preferred embodiment, the modified miRNA derivative is modified in one or more forms selected from the group consisting of: glycosyl modification of nucleotides, modification of the linkage between nucleotides, cholesterol modification, locked nucleotide modification, peptide modification, lipid modification, halogen modification, hydrocarbon modification, and nucleic acid modification.

[0038] In another preferred embodiment, the glycosyl modification of the nucleotide includes 2-O-methyl glycosyl modification, 2-O-methoxyethyl glycosyl modification, 2-O-alkyl glycosyl modification, 2-fluoro glycosyl modification, sugar ring modification, locked nucleotide modification; and / or

[0039] The modifications to the linkage between the nucleotides include thiophosphate modification, phosphorylation modification; and / or

[0040] The nucleic acid modifications mentioned include "TT" modifications.

[0041] In another preferred embodiment, the modified miRNA derivative described in (a) is a monomeric compound or a polymer thereof having the structure shown in Formula I:

[0042] (X)n-(Y)m

[0043] Formula I

[0044] In equation I,

[0045] Each X is a microRNA as described in (a);

[0046] Each Y is an independent modifier that promotes the stability of microRNA drug administration;

[0047] Y connects to the left, right, or middle of X;

[0048] n is a positive integer from 1 to 100 (preferably 1 to 20) (preferably n is 1, 2, 3, 4 or 5);

[0049] m is a positive integer from 1 to 1000 (preferably from 1 to 200);

[0050] Each "-" indicates a linker, chemical bond, or covalent bond.

[0051] In another preferred embodiment, the adapter is a nucleic acid sequence of 1-10 bases in length.

[0052] In another preferred embodiment, Y includes (but is not limited to) cholesterol, steroids, sterols, alcohols, organic acids, fatty acids, esters, monosaccharides, polysaccharides, amino acids, polypeptides, mononucleotides, and polynucleotides.

[0053] In another preferred embodiment, the polynucleotide described in (c) has the structure shown in Formula II:

[0054] Seq 正向 -X-Seq 反向

[0055] Formula II

[0056] In formula II,

[0057] Seq positive indicates that the microRNA nucleotide sequence can be processed in the host;

[0058] The reverse Seq sequence is a nucleotide sequence that is substantially or completely complementary to the forward Seq sequence.

[0059] X is an interval sequence located between the forward and reverse directions of Seq, and the interval sequence is not complementary to the forward and reverse directions of Seq;

[0060] Furthermore, the structure shown in Formula II, after being transferred into the host cell, forms the secondary structure shown in Formula III:

[0061]

[0062] In Equation III, the definitions of Seq forward, Seq backward, and X are as described above.

[0063] || indicates the complementary base pairing relationship formed between the forward and reverse sides of Seq.

[0064] In another preferred embodiment, the polynucleotide described in (c) has the amino acid sequence shown in SEQ ID No:3 or 6:

[0065]

[0066] In another preferred embodiment, the expression vector described in (d) includes: viral vectors and non-viral vectors.

[0067] In another preferred embodiment, the miR-302 agonist described in (e) is selected from the group consisting of substances that promote miR-302 expression, substances that enhance miR-302 activity, or combinations thereof.

[0068] In another preferred embodiment, the pharmaceutically acceptable carrier is selected from the group consisting of water, saline, liposomes, lipids, proteins, protein-antibody conjugates, peptides, cellulose, nanogels, or combinations thereof.

[0069] In a second aspect of the invention, a pharmaceutical composition is provided, the pharmaceutical composition comprising an active ingredient and a pharmaceutically acceptable carrier, wherein the active ingredient is selected from:

[0070] (a) MicroRNAs of the miR-302 family, including: miR-302 or a modified miR-302 derivative; or microRNAs or modified miRNA derivatives with a core sequence of 5'-AAGUGCU-3', a length of 16-28 nt, and functions that are the same as or substantially the same as miR-302.

[0071] (b) A precursor miRNA, wherein the precursor miRNA can be processed in the host into miR-302 as described in (a);

[0072] (c) A polynucleotide, wherein the polynucleotide can be transcribed by the host to form the precursor miRNA described in (b) and processed to form the microRNA described in (a);

[0073] (d) An expression vector containing miR-302 as described in (a), or a precursor miRNA as described in (b), or a polynucleotide as described in (c).

[0074] In a third aspect of the invention, a method for screening candidate compounds that promote miR-302 is provided, comprising the steps of:

[0075] (a) The cell culture system with the test compound added was used as the experimental group; the cell culture system without the test compound added was used as the control group;

[0076] (b) Test the expression levels and / or activity of SA-β-Gal protein and / or P16 protein in the experimental and control groups; test the expression levels and / or activity of H3K9me3 protein and / or type III collagen COL3A1 in the experimental and control groups;

[0077] Specifically, if the expression levels and / or activities of SA-β-Gal protein and / or P16 protein in the test group are lower than those in the control group and higher than those in the control group, and the expression levels and / or activities of H3K9me3 protein and / or type III collagen COL3A1 are significantly higher than those in the control group, then the test compound is considered a candidate compound for promoting miR-302.

[0078] In another preferred embodiment, step (b) further includes:

[0079] For the obtained candidate compounds, the effect of the candidate compounds on the production of miR-302 in cells in the experimental group and the control group was further tested;

[0080] When the number of miR-302 in the experimental group is significantly higher than that in the control group, it indicates that the candidate compound is a promoter of miR-302.

[0081] In another preferred embodiment, the cell is a somatic cell.

[0082] In another preferred embodiment, the cells are selected from the group consisting of fibroblasts, vascular endothelial cells, mesenchymal stem cells, epithelial cells (including skin epithelial cells), liver cells, or combinations thereof.

[0083] In a fourth aspect of the invention, a method is provided for in vitro non-therapeutic inhibition of the expression and / or activity of SA-β-Gal protein and / or P16 protein; promotion of the expression and / or activity of H3K9me3 protein and / or type III collagen COL3A1; and / or inhibition of the expression and / or activity of PAI-1, the method comprising the steps of:

[0084] Adding the pharmaceutical composition or miR-302 active ingredient described in the second aspect of the present invention to the cell culture system thereby inhibiting the expression and / or activity of SA-β-Gal protein and / or P16 protein; and / or promoting the expression and / or activity of H3K9me3 protein and / or type III collagen COL3A1.

[0085] In a fifth aspect of the invention, a method for promoting the proliferation of normal somatic cells in vitro without therapeutic application is provided, comprising the steps of:

[0086] In the presence of the miR-302 active ingredient and under suitable growth conditions, a normal somatic cell is cultured to promote the proliferation of the normal somatic cell, wherein the miR-302 active ingredient is the active ingredient as described in the first aspect of the present invention.

[0087] In another preferred embodiment, the cell is a eukaryotic cell, preferably a human or non-human mammal cell.

[0088] In another preferred embodiment, the cell is a somatic cell.

[0089] In another preferred embodiment, the cells are selected from the group consisting of normal cells and tumor cells.

[0090] In a sixth aspect, the present invention provides a method for inhibiting the expression and / or activity of SA-β-Gal protein and / or P16 protein, and / or promoting the expression and / or activity of H3K9me3 protein and / or type III collagen COL3A1, and / or for anti-aging, comprising the steps of:

[0091] Applying the pharmaceutical composition or miR-302 active ingredient described in the second aspect of the invention to the desired object thereby inhibiting the expression and / or activity of SA-β-Gal protein and / or P16 protein, and / or promoting the expression and / or activity of H3K9me3 protein and / or type III collagen COL3A1, and / or anti-aging.

[0092] In another preferred embodiment, the desired object is a mammal, preferably a human or non-human mammal (e.g., a mouse or a rat).

[0093] It should be understood that, within the scope of this invention, the above-described technical features of this invention and the technical features specifically described below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be described in detail here. Attached Figure Description

[0094] Figure 1 This study demonstrates that overexpression of miR-302 family miRNAs via transgenic methods can reverse human cellular senescence.

[0095] AQ-RT-PCR was used to detect the expression level of hsa-miR-302c-3p in HFF1-scr and HFF1-302 cells. **: P<0.01, n=3, two-tailed t-test.

[0096] B. Left side: Representative β-galactosidase staining images of HFF1-scr and HFF1-302 cells (top image, blue indicates SA-β-Gal staining positivity) and H3K9me3 immunofluorescence staining images (bottom image, green fluorescence indicates H3K9me3 staining positivity). Right side: Quantitative statistical results of the two types of staining on the left side. **: P<0.01, n=5, two-tailed t-test.

[0097] CQ-RT-PCR was used to detect the mRNA expression levels of p16 and Col3a1 genes in HFF1-scr and HFF1-302 cells. **: P < 0.01, n = 3, two-tailed t-test.

[0098] D. Quantitatively analyze the short-term proliferation rates of HFF1-scr and HFF1-302 cells. Cell proliferation was detected using the CCK-8 assay. The vertical axis represents the cell proliferation rate relative to day 1, and the horizontal axis represents the number of days. **: P < 0.01, n = 3, two-tailed t-test.

[0099] E. Quantitatively analyze the long-term proliferative capacity of HFF1-scr and HFF1-302 cells. Cell count was used. The vertical axis represents the relative fold increase of the total number of cells in each generation relative to the initial total number of cells. The horizontal axis represents the number of cell passages. **: P<0.01, n=3, two-tailed t-test.

[0100] Immunoblot Western blotting results of total protein samples from F.HFF1-scr and HFF1-302 cells. Each column (lane) represents an independent replicate, with three replicates for each cell type, as marked in the figure. Additionally, the H1 column represents the total protein sample from the human pluripotent stem cell H1 line. Each row represents a target protein detected here, with the name of the target protein labeled on the left.

[0101] GQ-RT-PCR was used to detect the expression level of hsa-miR-302c-3p in HFF1-Tonscr and HFF1-Ton302 cells. DOX- represents cells under normal culture conditions without DOX induction. DOX+ represents cells 48 hours after DOX induction. **: P<0.01, n=3, two-tailed t-test.

[0102] H. Quantitative statistical analysis of β-galactosidase staining results in HFF1-Tonscr and HFF1-Ton302 cells at different time points after DOX induction. The vertical axis represents the percentage of positive cells. The horizontal axis represents the number of days after the start of DOX induction. **: P<0.01, n=9, two-tailed t-test.

[0103] I. Quantitatively analyze the immunofluorescence staining results of H3K9me3 in HFF1-Tonscr and HFF1-Ton302 cells at different time points after DOX induction. The vertical axis represents the percentage of positive cells. The horizontal axis represents the number of days after the start of DOX induction. **: P<0.01, n=5, two-tailed t-test.

[0104] Figure 2 This demonstrates that artificially synthesized miR-302 family miRNA analogs can reverse human cellular senescence.

[0105] A. Quantitative statistical analysis of β-galactosidase staining (SA-β-Gal, n=9) and H3K9me3 immunofluorescence staining (H3K9me3, n=4) results of HFF1 cells after transfection with hsa-miR-302c-3p mimic (+302mimic) and Scramblemimic (+scr mimic). The transfection concentration of both mimics was 200 nM. Staining was performed on day 8 post-transfection. The vertical axis represents the percentage of positively stained cells. **: P<0.01, two-tailed t-test.

[0106] BQ-RT-PCR was used to detect the mRNA expression level of the p16 gene in the two transfected cells described in A above. **: P < 0.01, n = 3, two-tailed t-test.

[0107] C. Quantitative statistical analysis of β-galactosidase staining (SA-β-Gal, n=10) and H3K9me3 immunofluorescence staining (H3K9me3, n=4) results of HFF1 cells on day 8 after transfection with different concentrations of hsa-miR-302c-3p mimic (+302mimic) and Scramble mimic (+scr mimic). The vertical axis represents the percentage of positively stained cells. The horizontal axis represents the transfection concentration. ** indicates the difference between 200 nM and 0 nM data points for each staining series (P<0.01, two-tailed t-test).

[0108] D. Quantitatively analyze the short-term proliferation rate of HFF1 cells after transfection with hsa-miR-302c-3p mimic (+302mimic) and Scramblemimic (+scr mimic). Cell proliferation was detected using the CCK-8 assay. The vertical axis represents the cell proliferation rate relative to day 1, and the horizontal axis represents the number of days. **: P < 0.01, n = 3, two-tailed t-test. The transfection concentration of both mimics was 200 nM.

[0109] Figure 3 This demonstrates that miR-302 family miRNAs possess broad-spectrum anticancer functions.

[0110] A. Schematic diagram of the principle of the dual-color fluorescent cell growth competition assay. Target cells are infected with either a GFP-labeled lentivirus overexpressing a Scramble (Scr) control or an iRFP-labeled lentivirus overexpressing a candidate miRNA (miR), and then mixed in equal proportions (starting point). The mixed cells are then passaged continuously (end point). Finally, FACS analysis is used to quantitatively compare the relative enrichment rate of the iRFP / GFP cell ratio at the end point relative to the starting point.

[0111] B. Statistical summary of the above two-color fluorescence cell growth competition experiments performed in different human cells using Scramble (Scr) control or has-miR-302c-3p(302) as candidate miRs. Vertical axis: Relative enrichment rate of candidate miRs. Horizontal axis: Different cell lines. The curly braces indicate various human tumor cell lines. **: P<0.01, n=3, two-tailed t-test.

[0112] Statistical results of growth curves of subcutaneous xenografts of C.Cal27-Scr and Cal27-302 cells in nude mice. Tumor volume = tumor long diameter × tumor short diameter. 2 / 2. **: P<0.01, n=5, two-tailed t-test.

[0113] Figure 4 This demonstrates the establishment of a passaged aging model of human endothelial cells.

[0114] A. Left side: Representative β-galactosidase (SA-β-Gal) staining images of HUVEC cells (top image, blue indicates positive staining) and representative PAI-1 immunofluorescence staining images (bottom image, red fluorescence indicates positive staining, blue fluorescence indicates staining of all cell nuclei). Right side: Quantitative statistical results of the two types of staining on the left side, calculated as the percentage of positive staining in all cells. **: P<0.01, two-tailed t-test, n=7 and n=3 on the top and bottom sides of the left side, respectively. HUVEC-Y: HUVEC cells from early passages; HUVEC-O: HUVEC cells after passage and senescence, the same applies below.

[0115] B. Left side: Representative H3K9me3 immunostaining images (top) and representative Ki67 immunofluorescence staining images (bottom) of HUVEC-Y and HUVEC-O cells. In both images, green fluorescence represents positive staining, and blue fluorescence represents nuclear staining of all cells. Right side: Quantitative statistical results of the two staining types on the left side. **: P<0.01, two-tailed t-test, n=5 and n=6 in the top and bottom images on the left side, respectively.

[0116] Figure 5 This demonstrates that miR-302 family miRNAs effectively reverse human endothelial cell senescence.

[0117] A. Statistical analysis of the positive rates of senescence marker β-galactosidase (SA-β-Gal) staining and endothelial cell senescence marker PAI-1 immunofluorescence staining in transgenic HUVEC-O cells, calculated as the percentage of positive staining among all cells. **: P<0.01, two-tailed t-test, n=10 for SA-β-Gal staining, n=7 for PAI-1 immunofluorescence staining. HUVEC-O-302: HUVEC-O cells overexpressing miR-302; HUVEC-O-SCR: HUVEC-O cells overexpressing SCR as a control.

[0118] B. Statistical analysis of the positive percentages of immunofluorescence staining for H3K9me3 (a marker of young cells) and Ki67 (a marker of cell proliferation) in transgenic HUVEC-O cells, calculated as the percentage of positive staining in all cells. **: P<0.01, two-tailed t-test, n=7 for H3K9me3 staining, n=8 for Ki67 immunofluorescence staining.

[0119] C. Statistical analysis of the positive rates of senescence marker β-galactosidase (SA-β-Gal) staining and senescence marker PAI-1 immunofluorescence staining in HUVEC-O cells transfected with miRNA analogs, calculated as the percentage of positive staining in all cells. **: P<0.01, two-tailed t-test, n=11 for SA-β-Gal staining, n=10 for PAI-1 immunofluorescence staining. mimic-302: HUVEC-O cells transfected with miR-302 analog; mimic-SCR: HUVEC-O cells transfected with SCR control analog. The same applies below.

[0120] The percentage of positive immunofluorescence staining for H3K9me3 (a marker of young cells) and Ki67 (a marker of cell proliferation) in HUVEC-O cells transfected with D. miRNA analogs was calculated as the percentage of positive staining in all cells. **: P < 0.01, two-tailed t-test, n = 10 for H3K9me3 staining, n = 10 for Ki67 immunofluorescence staining.

[0121] Figure 6 The aging antagonistic effect of miR-302 was shown to be highly dependent on its 5' seed sequence.

[0122] RNA sequences of A. miR-302c-3p(302c) and its mutants. SCR is the scramble negative control. Red indicates the seed sequence at the 5' end, 2-8 nt. Blue underlined sequences represent the mutated sequences.

[0123] B. Summary of statistical results of testing the anti-aging effects of the above miR-302c series mutants in passaged senescent HFF-1 cells using a two-color fluorescence cell growth competition assay. **: P<0.01, two-tailed t-test, n=3. The vertical axis represents the Log2 proliferation rate (FC) of cells introduced with the 302 mutant relative to control cells. The same applies below.

[0124] C. Summary of statistical results on the anti-aging effects of the above miR-302c series mutants in HUVEC-O cells using a two-color fluorescence cell growth competition assay. **: P<0.01, two-tailed t-test, n=3.

[0125] D. Summary table of relative anti-aging efficiencies (%Eff) for each miR-302 mutant calculated based on the data in B and C above. Calculation method: %Eff = (FC - 100%) / (FC of 302c). The column headers in the table represent cell types, and the row headers represent miR-302 mutant names. The left side of the ± sign represents the mean, and the right side represents the standard error.

[0126] Figure 1-6The error bar in the image represents the standard error. Detailed Implementation

[0127] Through extensive and in-depth research, the inventors unexpectedly discovered for the first time that miR-302 can effectively delay or reverse the aging process of normal somatic cells, thereby possessing anti-aging functions. Furthermore, this anti-aging effect does not lead to pluripotent reprogramming and is therefore unrelated to it. Further experiments have also demonstrated that miR-302 not only does not increase the carcinogenic risk of normal somatic cells, but on the contrary, it can inhibit the growth of various tumor cells. Therefore, miR-302 is an extremely safe and effective anti-aging active ingredient. Based on this, the present invention was completed.

[0128] the term

[0129] As used herein, “miR-302”, “miRNA-302”, “miRNA of the present invention”, “microRNA of the present invention”, etc. are used interchangeably and refer to miR-302 family miRNAs, which are small RNA molecules with a total length of 16-28 nt and a 5' end (N)AAGUGCU feature (where N represents any nucleotide (A, U, C, G), and (N) represents 1 or 0 N).

[0130] As used in this article, the term "H3K9me3" refers to histone H3 lysine 9 trimethylation (H3K9me3).

[0131] As used in this article, the term "SA-β-gal" refers to senescence-associated β-galactosidase.

[0132] As used in this article, the term "P16 protein" refers to the protein expression product of the CDKN2A gene, which is a marker of cellular senescence.

[0133] Aging and Anti-aging

[0134] As used herein, "aging" refers to the loss and degeneration of an organism's constituent substances, tissue structure, and physiological functions over time. In this invention, aging refers to biological aging.

[0135] As used in this article, "anti-aging" refers to delaying, blocking, reducing, stopping, and / or reversing the effects or process of aging.

[0136] Cellular senescence is a phenomenon in which individual cells cease to divide, eventually stopping after a few divisions. To detect cellular senescence, cell staining assays are typically used to detect senescence-related markers (such as β-galactosidase activity). Senescent cells can interfere with vital functions throughout the organism and lead to various impairments. The aging of the entire organism is accompanied by an increased risk of certain impairments, such as diseases, complications, and symptoms.

[0137] Some representative markers or signs of aging cells include (but are not limited to): SA-β-galactosidase [9] (Increased expression levels indicate increased aging), P16

[11] (Increased expression of this substance indicates increased aging), and cell proliferation capacity (decreased expression of this substance indicates increased aging).

[0138] Some representative markers of young cells include (but are not limited to): H3K9me3

[10] (High expression levels indicate low aging), type III collagen gene COL3A1 [12,13] (For dermal fibroblasts, high expression levels indicate low aging).

[0139] miRNA and its precursors

[0140] MicroRNAs (miRNAs) are endogenous, non-coding, single-stranded small RNAs, approximately 22 nucleotides in length, discovered in recent years in eukaryotes such as nematodes, fruit flies, plants, and mammals. They exhibit tissue- and time-specific expression, negatively regulating gene expression at the post-transcriptional level through complementary base pairing with target mRNAs, leading to mRNA degradation or translational repression. They are important regulatory molecules for regulating the expression of other functional genes. Increasing evidence suggests that although miRNAs are small, they play a crucial role in various life processes by forming complete or incomplete unpaired pairs with target mRNAs. As used herein, "miRNA" refers to a class of RNA molecules derived from transcripts that can form miRNA precursors. Mature miRNAs typically have 18-26 nucleotides (nt) (more specifically, about 19-22 nt), but miRNAs with other numbers of nucleotides are also possible. miRNAs can usually be detected by Northern blotting.

[0141] Human-derived miRNAs can be isolated from human cells. As used herein, "isolated" means that the substance has been isolated from its native environment (or, in the case of a native substance, the native environment). Polynucleotides and polypeptides in their native state within living cells are not isolated and purified, but the same polynucleotides or polypeptides are isolated and purified if they are separated from other substances present in their native state.

[0142] miRNAs can be processed from precursor miRNAs (pre-miRNAs), which fold into a stable stem-loop (hairpin) structure. The stem-loop structure is typically 50-100 bp in length or longer. The precursor miRNA folds into a stable stem-loop structure, with two substantially complementary sequences on either side of the stem. The precursor miRNA can be natural or synthetically produced.

[0143] Precursor miRNAs can be cleaved to generate miRNAs that are substantially complementary to at least a portion of the sequence of the mRNA encoding the gene. As used herein, “substantially complementary” means that the nucleotide sequences are sufficiently complementary to interact in a predictable manner, such as forming secondary structures (e.g., stem-loop structures). Typically, two “substantially complementary” nucleotide sequences have at least 70% complementary nucleotides to each other; preferably, at least 80%; more preferably, at least 90%; and even more preferably, at least 95%; such as 98%, 99%, or 100%. Generally, two sufficiently complementary molecules may have up to 40 mismatched nucleotides; preferably, up to 30; more preferably, up to 20; and even more preferably, up to 10, such as 1, 2, 3, 4, 5, 8, or 11 mismatched nucleotides.

[0144] As used herein, a "stem-loop" structure, also known as a "hairpin" structure, refers to a nucleotide molecule that can form a secondary structure including a double-stranded region (stem) formed by two regions of the nucleotide molecule (located on the same molecule), positioned on either side of the double-stranded portion; it also includes at least one "loop" structure, comprising a non-complementary nucleotide molecule, i.e., a single-stranded region. Even if the two regions of the nucleotide molecule are not perfectly complementary, the double-stranded portion of the nucleotide can remain double-stranded. For example, insertions, deletions, substitutions, etc., can lead to a small region becoming non-complementary or that small region itself forming a stem-loop structure or other forms of secondary structure; however, the two regions can still be substantially complementary and interact in a predictable manner to form a double-stranded region of a stem-loop structure. Stem-loop structures are well known to those skilled in the art, and typically, after obtaining a nucleic acid with a nucleotide sequence having a primary structure, those skilled in the art can determine whether the nucleic acid can form a stem-loop structure.

[0145] The miRNA mentioned in this invention refers to the microRNA-302 (miR-302) family, which includes miR-302 or modified miR-302 derivatives, and whose functions are the same or substantially the same as miR-302.

[0146] In another preferred embodiment, the microRNA is derived from humans or non-human mammals; preferably, the non-human mammals are rats or mice, and the miR-302 family sequences of mice and humans are completely identical. The phrase "functionally identical or substantially identical to miR-302" means retaining ≥40%, ≥50%, ≥60%, ≥70%, ≥80%, or ≥90% of the anti-aging function of miR-302c-3p (e.g., inhibiting the expression and / or activity of SA-β-Gal protein).

[0147] This invention also includes miRNA variants and derivatives. Furthermore, miRNA derivatives in a broader sense may also include miRNA variants. Those skilled in the art can modify miR-302 using common methods, including (but not limited to): methylation, hydrocarbon modification, glycosylation (such as 2-methoxy-glycosylation, hydrocarbon-glycosylation, glycan ring modification, etc.), nucleic acid modification, peptide modification, lipid modification, halogen modification, nucleic acid modification (such as "TT" modification), etc.

[0148] A preferred class of miRNA molecules is the miRNA molecules listed in Table 1.

[0149] A particularly preferred example of miR-302 is hsa-miR-302c-3p (mirbaseAccession=MIMAT0000717).

[0150] Its RNA sequence is 5'-UAAGUGCUUCCAUGUUUCAGUG-3' (SEQ ID No:1)

[0151] The corresponding DNA sequence is: 5'-TAAGTGCTTCCATGTTTCAGTG-3' (SEQ ID No:2)

[0152] In this invention, other suitable miR-302 sequences can be found in public databases, such as... http: / / www.mirbase.org / cgi-bin / mirna_summary.pl?fam=MIPF0000071 Information on some representative miR-302 and its precursors is listed in Tables 1 and 22 below.

[0153] Table 1

[0154]

[0155]

[0156] Table 2

[0157]

[0158]

[0159] Polynucleotide constructs

[0160] Based on the miRNA sequence provided by this invention, polynucleotide constructs that, upon introduction, can be designed to process miRNAs into miRNAs that can affect the expression of the corresponding mRNAs, i.e., the polynucleotide constructs can upregulate the amount of the corresponding miRNAs in vivo. Therefore, this invention provides an isolated polynucleotide (construct), which can be transcribed into a precursor miRNA by human cells, and the precursor miRNA can be cleaved and expressed into the miRNA by human cells.

[0161] In a preferred embodiment of the present invention, the polynucleotide construct contains the structure shown in Formula II:

[0162] Seq 正向 -X-Seq 反向

[0163] Formula II

[0164] In formula II,

[0165] Seq 正向 To obtain the nucleotide sequence that can be expressed in cells as miRNA-27b, Seq 反向 To be with Seq 正向 Essentially complementary nucleotide sequences; or, Seq反向 Seq provides the nucleotide sequence that can be expressed as the miRNA in cells. 正向 To be with Seq 正向 Essentially complementary nucleotide sequences; X is located in Seq 正向 and Seq 反向 The interval sequence between, and the interval sequence with Seq 正向 and Seq 反向 Not complementary;

[0166] The structure shown in Formula I, after being transfected into cells, forms the secondary structure shown in Formula III:

[0167]

[0168] In Equation III, Seq 正向 Seq 反向 The definitions of X and X are as described above;

[0169] || indicates that in Seq 正向 and Seq 反向 The complementary base pairing relationship formed between them.

[0170] Typically, the polynucleotide construct is located on an expression vector. Therefore, the present invention also includes a vector containing the miRNA or the polynucleotide construct. The expression vector typically also contains a promoter, a replication origin, and / or a marker gene. Methods well known to those skilled in the art can be used to construct the expression vectors required by the present invention. These methods include in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombination technology, etc. The expression vector preferably contains one or more selective marker genes to provide phenotypic traits for selecting transformed host cells, such as resistance to kanamycin, gentamicin, hygromycin, and ampicillin.

[0171] In this invention, the promoter may be constitutive, inductive, or a combination thereof.

[0172] Pharmaceutical Composition and Administration

[0173] As used herein, the term "active ingredient" or "miR-302 active ingredient" refers to miR-302, miR-302 derivatives or their precursor sequences that can be used in this invention, or expression vectors containing them. Preferably, the active ingredient is selected from the group consisting of:

[0174] (a) MicroRNAs of the miR-302 family, including: miR-302 or modified miR-302 derivatives; or microRNAs or modified miRNA derivatives with a core sequence of 5'-AAGUGCU-3', a length of 16-28 nt, and functions that are the same as or substantially the same as miR-302 (a preferred type of microRNA is a microRNA with a total length of 16-28 nt and whose sequence characteristics satisfy the following formula: 5'-(N)AAGUGCUN…-3', where N represents any nucleotide (A / U / C / G), and (N) represents 1 or 0 N);

[0175] (b) A precursor miRNA, wherein the precursor miRNA can be processed in the host into miR-302 as described in (a);

[0176] (c) A polynucleotide, wherein the polynucleotide can be transcribed by the host to form the precursor miRNA described in (b) and processed to form the microRNA described in (a);

[0177] (d) An expression vector containing miR-302 as described in (a), or a precursor miRNA as described in (b), or a polynucleotide as described in (c).

[0178] As used herein, the term “effective amount” or “effective dose” means an amount that is functional or active in humans and / or animals and is acceptable to humans and / or animals.

[0179] As used herein, the term "pharmaceuticalally acceptable" refers to a substance suitable for human and / or mammalian use without excessive adverse side effects (such as toxicity, irritation, and allergic reactions), i.e., a reasonable benefit / risk ratio. The term "pharmaceuticalally acceptable carrier" refers to a carrier used for the administration of a therapeutic agent, including various excipients and diluents.

[0180] The pharmaceutical compositions of the present invention contain a safe and effective amount of the active ingredient of the present invention and a pharmaceutically acceptable carrier. Such carriers include (but are not limited to): saline, buffer solutions, glucose, water, glycerol, ethanol, and combinations thereof. Generally, pharmaceutical formulations should be matched to the route of administration; the dosage forms of the pharmaceutical compositions of the present invention are injections, oral formulations (tablets, capsules, oral liquids), transdermal formulations, and sustained-release formulations. They are prepared, for example, using physiological saline or an aqueous solution containing glucose and other excipients by conventional methods. The pharmaceutical compositions are preferably manufactured under aseptic conditions.

[0181] The effective amount of the active ingredient described in this invention can vary depending on the administration method and the severity of the disease to be treated. A preferred effective amount can be determined by those skilled in the art based on various factors (e.g., through clinical trials). These factors include, but are not limited to: pharmacokinetic parameters of the active ingredient, such as bioavailability, metabolism, and half-life; the severity of the disease to be treated, the patient's weight, the patient's immune status, and the route of administration. Generally, satisfactory results are obtained when the active ingredient of this invention is administered daily at a dose of approximately 0.00001 mg to 50 mg / kg animal body weight (preferably 0.0001 mg to 10 mg / kg animal body weight). For example, due to the urgency of the treatment condition, several separate doses may be administered daily, or the dose may be reduced proportionally.

[0182] The pharmaceutically acceptable carriers described in this invention include (but are not limited to): water, saline, liposomes, lipids, proteins, protein-antibody conjugates, peptides, cellulose, nanogels, or combinations thereof. The choice of carrier should be matched to the route of administration, as is well known to those skilled in the art.

[0183] In vitro anti-aging methods

[0184] This invention provides an in vitro non-therapeutic anti-aging method, as well as a method for inhibiting the expression and / or activity of SA-β-Gal protein and / or P16 protein and / or promoting the expression and / or activity of H3K9me3 protein and / or type III collagen COL3A1.

[0185] Typically, the method includes: adding the pharmaceutical composition of the present invention or the active ingredient of the present invention to a cultured cell system to delay and / or reverse the aging process of the cells; inhibiting the expression and / or activity of SA-β-Gal protein and / or P16 protein; and / or promoting the expression and / or activity of H3K9me3 protein and / or type III collagen COL3A1.

[0186] In another preferred embodiment, the cells are somatic cells, especially normal somatic cells.

[0187] The main advantages of this invention include:

[0188] (a) This invention unexpectedly discovers for the first time that miR-302 is an active ingredient for anti-aging that can be applied to normal somatic cells.

[0189] (b) The anti-aging effects of miR-302 do not lead to the appearance of pluripotent stem cell characteristics, and are therefore unrelated to pluripotency reprogramming. This also avoids the risk of disrupting the normal function of target somatic cells and causing them to become carcinogenic by causing pluripotency reprogramming.

[0190] (c) miR-302 not only does not increase the risk of cancer in normal somatic cells, but it can also inhibit the growth of a variety of different tumor cells.

[0191] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer. Unless otherwise stated, percentages and parts are weight percentages and parts by weight.

[0192] Materials and general methods

[0193] In this embodiment, miR-302 used is hsa-miR-302c-3p, whose RNA sequence is 5'-UAAGUGCUUCCAUGUUUCAGUG-3' (SEQ ID No:1); the corresponding DNA sequence is 5'-TAAGTGCTTCCATGTTTCAGTG-3' (SEQ ID No:2).

[0194] 1) Plasmid construction

[0195] To construct an accurate miRNA overexpression vector, the SA-miR (smallaccurate-miR) design method previously published by the inventors was adopted. [8] The principle behind this method is to insert the corresponding DNA sequence of the target miRNA to be expressed into a SAmiR backbone sequence that ensures precise 5' end formation, thereby achieving accurate expression of the target miRNA.

[0196] The following SAmiR expression sequence was directly synthesized: (All DNA sequences are assumed to have the 5' end on the left and the 3' end on the right).

[0197] SA-miR302c: (Expresses hsa-miR-302c-3p; the bold part is the DNA sequence corresponding to hsa-miR-302c-3p)

[0198]

[0199] SA-SCR: (Expresses scramble control miRNA; the bold part is its corresponding DNA sequence)

[0200]

[0201] Using standard molecular cloning methods, the SA-miR302c and SA-SCR were cloned into the constitutive lentiviral expression vector plko.1-puro and the doxycycline (Dox)-inducible lentiviral expression vector pLVX-TetOne-Puro, as well as into a lentiviral vector carrying a fluorescent label.

[0202] The carrier construction methods include:

[0203] 1.1 Expression plasmid based on constitutive lentiviral expression vector plko.1-puro

[0204] This is a universal small RNA expression vector from Addgene (available from Addgene; https: / / www.addgene.org / 8453 / ). SA-miR302c and SA-SCR were cloned between their AgeI+EcoRI sites (the AgeI site was disrupted after insertion), located after the U6 promoter. This yielded two constitutive lentiviral expression plasmids: plko1-SA-miR302c and plko1-SA-SCR.

[0205] 1.2 Expression plasmid based on Dox-inducible lentiviral expression vector pLVX-TetOne-Puro

[0206] The inducible lentiviral vector pLVX-TetOne-Puro was purchased from Youbio Biotechnology Co., Ltd. (Catalog No. VT9002, http: / / www.youbio.cn / product / vt9002). This vector is a tetracycline-inducible vector that integrates regulatory and response functions.

[0207] The SA-miR302c and SA-SCR sequences and some surrounding sequences were amplified by PCR and cloned into the EcoRI+BamHI space of the multiple cloning site of this vector, resulting in two Dox-inducible lentiviral expression plasmids, pTeton-SA-miR302c and pTeton-SA-SCR.

[0208] 1.3 Plasmids plko1-SA-SCR-GFP, plko1-SA-SCR-iRFP, and plko1-SA-miR302c-iRFP based on fluorescently labeled constitutive lentiviral vectors

[0209] The constitutive lentiviral expression vector plko1-GFP carrying the H2BGFP green fluorescent label was derived from Addgene (addgene, Plasmid#25999). Similar to Method 1.1, the synthesized SA-miR302c and SA-SCR were cloned between their AgeI+EcoRI sites (the AgeI site was disrupted after insertion). This yielded plko1-SA-SCR-GFP and plko1-SA-miR302c-GFP.

[0210] The constitutive lentiviral expression vector plko1-RFP carrying the H2BRFP green fluorescent label was derived from Addgene (addgene, Plasmid#26001). Similar to Method 1.1, the synthesized SA-miR302c and SA-SCR were cloned between their AgeI+EcoRI sites (the AgeI site was disrupted after insertion). This yielded plko1-SA-SCR-RFP and plko1-SA-miR302c-RFP.

[0211] To facilitate flow cytometry detection, the far-red fluorescent protein iRFP expression sequence from pmiRFP670-N1 (addgene, Plasmid#79987) was amplified by PCR and inserted between the AgeI+XbaI sites in the two plasmids mentioned above to replace the RFP expression sequence. This yielded plko1-SA-SCR-iRFP and plko1-SA-miR302c-iRFP.

[0212] 2) Cell Culture

[0213] HFF-1 human skin fibroblasts were purchased from the Stem Cell Bank of the Chinese Academy of Sciences (Cell No.: SCSP-109). The cells were passaged for an extended period to mimic the cellular senescence phenotype.

[0214] Other cell sources are as follows (all cell cultures were performed according to the standard procedures given in the manufacturer's instructions):

[0215] Cal27 human tongue squamous cell carcinoma, Zhong Qiao Xinzhou (ZQ0606).

[0216] SCC9 human tongue squamous cell carcinoma, ATCC(CRL-1629)

[0217] SCC25 human tongue squamous cell carcinoma, ATCC (CRL-1628)

[0218] MEWO human melanoma cells, ATCC (HTB-65)

[0219] A431 human squamous cell carcinoma cells of the skin, ATCC (CRL-1555)

[0220] 786-0 human renal clear cell adenocarcinoma cells, Chinese Academy of Sciences Stem Cell Bank (TCHu186)

[0221] PC3 human prostate cancer cells, Chinese Academy of Sciences Stem Cell Bank (TCHu158)

[0222] Bladder cancer cells from 5637 individuals, Chinese Academy of Sciences Stem Cell Bank (TCHu 1).

[0223] PANC-1 human pancreatic cancer cells, Chinese Academy of Sciences Stem Cell Bank (TCHu 98)

[0224] 3) Lentiviral packaging and cell infection

[0225] 3.1 Lentiviral Packaging

[0226] Viral packaging was performed using a standard 293T packaging cell transfection method combined with PEI plasmids: First, the viral packaging plasmid psPAX2 (Addgene: 12260), the viral envelope plasmid pMD2.G (Addgene: 12259), and the lentiviral expression plasmid were mixed at a DNA mass ratio of 4:2:1 to prepare packaging DNA. Then, a transfection solution was prepared by mixing 200 μL of serum-free DMEM, 3 μg of packaging DNA, and 9 μg of PEI (polyetherimide). After incubation at room temperature for 15 minutes, the transfection solution was added to 293T cell culture medium for cell transfection. Forty-eight hours after transfection, the virus-containing cell culture supernatant was collected. The supernatant was filtered through a 0.45 μm filter to obtain the viral suspension.

[0227] 3.2 Lentiviral transfection of target cells

[0228] Add 30% (v / v) of viral suspension and 0.1% (v / v) of the gene transfection enhancer Polybrene to the target cell culture medium under normal growth conditions, mix well, and start timing. After 24 hours, replace with normal culture medium. After 48 hours, add puromycin (1 μg / ml) drug screening. Cells that can stably survive under drug screening conditions are considered stably transfected with lentivirus (all lentiviral vectors used in this study were puro-resistant).

[0229] 4) Total RNA extraction

[0230] Total RNA extraction from cells and animal tissues was performed using Trizol lysis buffer and the Zymo Direct-zol RNA MiniPrepPlus kit (R2070). The procedure was performed strictly according to the manufacturer's instructions.

[0231] 5) Q-RT-PCR

[0232] The qRT-PCR of mRNA was performed according to standard procedures. First, the total RNA sample was reverse transcribed to obtain cDNA using SuperScript II I Reverse Transcriptase (ThermoFisher, 18080093). Then, quantitative PCR was performed using BrightGreen 2X qPCR MasterMix-ROX (abm, MasterMix-R).

[0233] For the Q-RT-PCR of miRNA, the total RNA sample was first reverse transcribed to obtain cDNA using the miScript II RT Kitqigen (Qiagen, 218161), and then quantitative PCR was performed using the miScript SYBR Green PCR Kit (Qiagen, 218073). All procedures were performed according to the manufacturer's instructions.

[0234] 6) CCK8 assay for cell proliferation

[0235] 1000 cells were seeded in each well of a 96-well plate. Cell viability was then measured daily using the Cell Counting Kit-8 (CCK8, product number C0038) purchased from Beyotime Biotechnology, following the manufacturer's instructions.

[0236] 7) Cell count determination

[0237] The target cells were digested into a suspension using the standard trypsin method, and Teparin was added to distinguish dead cells. The number of live cells was then counted under a microscope using a hemocytometer.

[0238] 8) Analysis of SA-β-Gal cell staining and counting as a marker of aging

[0239] Cell Senescence β-Galactosidase Staining Kit (40754ES60) purchased from Yisheng Biotechnology Co., Ltd. was used. Target cells were stained overnight according to the manufacturer's instructions. Images were then taken under a microscope. Nine fields of view were randomly selected from each group, and the number and relative proportion of positive cells were calculated.

[0240] 9) Immunofluorescence analysis of the young cell marker H3K9me3

[0241] Cells were first fixed with 4% paraformaldehyde. Then, staining analysis was performed according to standard immunofluorescence staining procedures. The antibodies used were: primary antibody: H3K9me3 antibody (abcam, ab8898); secondary antibody: Alexa. 488 fluorescent secondary antibody (abcam, ab150077)

[0242] 10) Cell transfection with miRNA analogs (miRNAmimic)

[0243] The miRNA analogue was miRNA mimic, purchased from Shanghai Gemma Pharmaceutical Technology Co., Ltd. This miRNA was developed by the company based on data from the Sanger miRNA database (…). http: / / microrna.sanger.ac.uk / sequences )design.

[0244] Cell transfection was performed using Beyotime's Lipo8000. TM Transfection reagent (product number: C0533-0.5ml). Follow the instructions. The specific transfection concentration is 50-200 nM.

[0245] 11) Western blot of proteins

[0246] Cellular proteins were extracted using a column-based animal tissue / cell total protein extraction kit (Yaxin, PC201) and quantified using a BCA protein quantification kit (Yaxin, ZJ101). Proteins were then denatured using SDS-PAGE protein loading buffer (5×, Yaxin, LT101). Omni-PAGE was then performed. TM Electrophoresis was performed on precast Hepes gels (10%, 15 wells, YARN, LK209). Transfer was performed using a 0.45 μm PVDF membrane (YARN, WJ002S) and rapid transfer buffer (YARN, PS101S). The membrane was then blocked with protein-free rapid blocking buffer (YARN, PS108) at room temperature for 15 min, incubated overnight at 4°C with primary antibodies OCT3 / 4 (Santacruz, SC-5279), NANOG (CST, 3580S), and GAPDH (YARN, LF206), and then incubated with HRP-labeled secondary antibody (YARN, LF102) at room temperature for 1 h. Finally, Omni-ECL was used. TM Development was performed using an ultrasensitive chemiluminescence detection kit (Yamei, SQ201). All procedures were performed according to the manufacturer's instructions.

[0247] 12) Subcutaneous transplantation experiment of human tumor cells in nude mice

[0248] 100 μL of tumor cell suspension was injected subcutaneously into the axillary region of 5-week-old nude mice, with each mouse receiving 1 × 10 μL. 7 Cal27 cells were collected, and tumor size and volume (mm) were measured weekly starting from day 7. 3 = Tumor long diameter × Tumor short diameter 2 / 2.

[0249] Example 1: Overexpression of miR-302 family miRNAs via transgenic methods can reverse the aging of normal human cells.

[0250] In this embodiment, in order to demonstrate that overexpression of miR-302 family miRNAs in cells can reverse human cellular senescence, constitutive lentiviral expression plasmids plko1-SA-miR302c and plko1-SA-SCR, which can continuously overexpress hsa-miR-302c-3p (miR-302c-3p for short), were constructed.

[0251] After being packaged into lentiviruses, these cells were used to infect passaged, senescent human fibroblasts (HFF-1). Stable cell lines HFF1-302 and HFF1-SCR were obtained through puromycin screening. Q-RT-PCR analysis confirmed that the expression level of miR-302c-3p in HFF1-302 cells was significantly upregulated compared to the control HFF1-SCR cells. Figure 1 A).

[0252] Compared with control cells, the senescence phenomenon was significantly reversed in miR-302c-3p overexpressing cells, specifically manifested in the reduction of the senescence marker β-galactosidase. [9] The proportion of positive staining for H3K9me3 in young cells decreased significantly.

[10] The proportion of positive staining increased significantly. Figure 1 B), P16, an aging marker gene

[11] The expression level of type III collagen gene COL3A1, which is associated with the young fibroblast state, was significantly decreased. [12,13] The expression level of was significantly increased ( Figure 1 C), cell proliferation capacity is greatly enhanced ( Figure 1 DE).

[0253] Surprisingly, no human pluripotent stem cell marker proteins, OCT3 / 4 and NANOG, were detected in these HFF1-302 cells.

[14] Signs of upregulation ( Figure 1 F), which proves that the anti-aging effect of miR-302 family miRNAs is not related to pluripotent reprogramming.

[0254] Example 2

[0255] The anti-aging effects of miR-302 are rapid and cumulative.

[0256] To determine the required time for miR-302c-3p to reverse cellular senescence, a Dox-induced miR-302c-3p overexpression lentiviral vector, pTeton-SA-miR302c, and a control vector, pTeton-SA-SCR, were constructed. These lentiviruses were packaged into lentiviruses and stably infected with HFF-1 human fibroblasts, respectively. Drug screening yielded the corresponding stable cell lines HFF1-Ton302 and HFF1-TonSCR.

[0257] Q-RT-PCR showed that tightly controlled miR-302c-3p overexpression could be achieved in these cells using Dox induction. Figure 1 G). The results obtained using these cells indicate that miR-302c-3p overexpression can produce a significant reversal effect on cellular senescence in as little as 4 days, and this effect is continuously enhanced with the extension of miR-302c-3p overexpression time. Figure 1 (HI). These data suggest that the anti-aging effects of miR-302c-3p are rapid and cumulative.

[0258] Example 3

[0259] Artificially synthesized miR-302 family miRNA analogs can reverse human cellular senescence.

[0260] miRNA therapeutics that enter clinical use typically exist in the form of miRNA mimics. miRNA mimics are synthetically produced nucleic acid molecules or nucleic acid analogs that mimic the sequence structure of a mature target miRNA or its precursor. Their mechanism of action involves being taken up by the cell and converted into a mature target miRNA or a target miRNA mimic within the cell to exert the same or similar effects as the target RNA.

[0261] In this embodiment, to demonstrate that artificially synthesized miR-302 family miRNA analogs can be used as anti-aging agents, commercially available artificially synthesized miR-302c-3p analogs or control analogs were transfected into passaged senescent human fibroblasts HFF1 using a nanotransfection reagent.

[0262] The results showed that, compared with the control analog, transfection with the miR-302c-3p analog significantly reversed cellular senescence. The positive rate of staining for the senescent cell marker β-galactosidase significantly decreased, while the positive rate of staining for the young cell marker H3K9me3 significantly increased. Figure 2 A) The expression level of the aging marker gene P16 decreased significantly. Figure 2B), cell proliferation capacity was significantly enhanced (Fig 2D). Simultaneously, within a certain concentration range, the cell senescence reversal effect of miR-302c-3p analogs exhibited a dose-dependent effect. Figure 2 C) Similar to typical drug effects, this further suggests the anti-aging medicinal potential of miR-302 family miRNA analogs.

[0263] Example 4

[0264] The anti-aging effects of miR-302 do not lead to an increased risk of cancer.

[0265] Previous reports have found that miRNAs miRNA-372 and miRNA-373, belonging to the miR-302 family, can specifically inhibit oncogene-induced senescence caused by Ras gene mutants, leading to the inference that these miRNAs may be carcinogenic.

[15] .

[0266] In this embodiment, to assess the potential oncogenicity of miR-302 family miRNAs, a two-color fluorescence growth competition experiment was conducted (see schematic diagram). Figure 3 A) This study systematically evaluated the specific effects of miR-302 family miRNAs on the growth of various human tumor cells.

[0267] In stark contrast to the aforementioned literature reports, the results of this invention clearly demonstrate that miR-302 family miRNAs possess strong and broad-spectrum anticancer activity. On the one hand, they significantly promote the growth of senescent human fibroblasts; on the other hand, they strongly inhibit the growth of all 10 different types of human tumor cells tested. Figure 3 B).

[0268] An in vivo transplantation experiment was conducted on one type of tumor cell (Cal27) in nude mice. The results showed that miR-302 family miRNAs also strongly inhibited tumor growth in animals. Figure 3 C).

[0269] Therefore, these in vitro and in vivo experimental results demonstrate that miR-302 family miRNAs are broad-spectrum anticancer factors in human cells with good safety profiles. This further illustrates that the function of miR-302 in reversing normal human cellular senescence is significantly different from the two previously reported oncogenic functions (promoting pluripotent cell reprogramming and blocking oncogene-induced cellular senescence).

[0270] Example 5: miR-302 can effectively antagonize human endothelial cell senescence.

[0271] The anti-aging effect of miR-302 has been demonstrated in HFF-1 cells from the human dermis (mesoderm). In this example, we further examined whether this anti-aging effect is applicable to different tissue / cell types. HUVEC cells (human umbilical vein endothelial cells) derived from human endothelial tissue (endoderm) were selected as a model. HUVEC cells were cultured using PromoCell (C-22011) endothelial cell growth medium. Culture, passage, and cryopreservation were all performed according to standard procedures.

[16] The PAI-1 antibody used in the experiment was purchased from Santa Cruz (sc-5297). Cell counting was performed using a hemocytometer.

[0272] 5.1 Establishment of a senescence model of HUVEC cells

[0273] A senescence model of HUVEC cells was established using a passage senescence method. Early passage HUVEC cells (named HUVEC-Y) were continuously passaged until approximately 26 cell doublings (102). 8 After multiplying by 100%, senescent HUVEC cells (named HUVEC-O) were obtained.

[0274] The results showed that, compared with HUVEC-Y, HUVEC-O cells exhibited a classic cellular senescence phenotype, specifically manifested as follows:

[0275] 1) Senescence cell markers β-galactosidase and known senescence marker PAI-1 [17,18] The proportion of positive staining increased significantly. Figure 4 A);

[0276] 2) The positive rate of staining for the young cell marker H3K9me3 was significantly downregulated. Figure 4 B);

[0277] 3) The positive rate of Ki67 staining, a cell proliferation marker, was significantly downregulated. Figure 4 B).

[0278] These data demonstrate that HUVEC-O is a successful model of endothelial cell senescence.

[0279] 5.2 miR-302 has anti-aging effects in HUVEC cells.

[0280] Similarly, plko1-SA-miR302c and control plko1-SA-SCR lentiviruses were introduced into HUVEC- cells, and stable cell lines HUVEC-O-302 and HUVEC-O-SCR were obtained through drug screening.

[0281] The results showed that, compared with control cells, the senescence phenomenon was significantly reversed in HUVEC-O cells overexpressing miR-302c-3p, specifically manifested as: 1) a significant decrease in the positive staining ratios of senescence cell markers β-galactosidase and senescence marker PAI-1 ( ). Figure 5 A); 2) The positive rate of staining for the young cell marker H3K9me3 increased significantly ( Figure 5 B); 3) The positive rate of Ki67 staining, a cell proliferation marker, increased significantly. Figure 5 B).

[0282] 5.3 miR-302 family miRNA analogs have anti-aging effects in endothelial cells.

[0283] To demonstrate that synthetic miR-302 family miRNA analogs can also exert anti-aging effects in endothelial cells, synthetic miR-302c-3p analogs (mimic-302) or control analogs (mimic-SCR) were transfected into HUVEC-O cells.

[0284] Compared with the mimic-SCR control, mimic-302 transfection significantly reversed endothelial cell senescence, specifically as follows:

[0285] 1) The positive rates of staining for the senescence cell marker β-galactosidase and the known senescence marker PAI-1 decreased significantly. Figure 5 C);

[0286] 2) The positive rate of staining for the young cell marker H3K9me3 increased significantly. Figure 5 D);

[0287] 3) The proportion of positive staining for the cell proliferation marker Ki67 increased significantly. Figure 5 D).

[0288] Example 6: The aging antagonistic effect of miR-302 is highly dependent on its 5' seed sequence.

[0289] It is known that the function of miRNAs is generally highly dependent on their 5' end 2-8 nt seed sequence. To confirm whether the senescence antagonistic function of miR-302 family miRNAs depends on their 5' end seed sequence, in this embodiment, a series of mutant miRNAs were constructed based on hsa-miR-302c-3p(302c). Figure 6 A).

[0290] Using the previously described two-color fluorescence cell growth competition assay, the potential growth-promoting ability of these mutant miRNAs in passaged senescent HFF-1 and HUVEC cells was systematically tested. The methods are as follows:

[0291] The dual-color fluorescence cell growth competition experiment was the same as in Example 4. Expression of the miR-302c mutant was achieved by constructing the SAmiR expression vector plko1-SA-miRNA-iRFP. The specific synthesized SAmiR expression sequence is as follows (all sequences are 5' ends on the left):

[0292] mut0: (Expresses mut0; the bold part is the DNA sequence corresponding to mut0)

[0293]

[0294] mut 1: (Expresses mut1; the bold part is the DNA sequence corresponding to mut1)

[0295]

[0296] mut2: (Expresses mut2; the bold part is the DNA sequence corresponding to mut2)

[0297]

[0298] mut3: (Expresses mut3; the bold part is the DNA sequence corresponding to mut3)

[0299]

[0300] mut5: (Expresses mut5; the bold part is the DNA sequence corresponding to mut5)

[0301]

[0302]

[0303] mut6: (Expresses mut6; the bold part is the DNA sequence corresponding to mut6)

[0304]

[0305] result

[0306] like Figure 6 As shown in B, 6C, and 6D, the original 302c cell exhibited significant growth-promoting capacity in both types of senescent cells compared to the scramble control (SCR), accurately reflecting its senescence-antagonistic function.

[0307] Mutations occurring after the 5' end (2-9 nt) of the entire seed sequence (mut0) completely eliminate this senescence-antagonistic function. Mutations of only three bases at the 2-4 nt position (mut6) or the 7-9 nt position (mut5) are also sufficient to disrupt most of its senescence-antagonistic function. Mutations of the entire sequence at the 12-22 nt position have no significant effect on its senescence-antagonistic function (mut1). The effects of mutations at the 10-22 nt (mut2) and 9-22 nt (mut3) positions are cell type specific, significantly weakening senescence-antagonistic function in HFF-1 cells but having little effect in HUVEC cells.

[0308] Therefore, the above results confirm that the aging antagonistic function of miR-302 family miRNAs is highly dependent on their 5' seed sequence, consistent with the classic miRNA functional characteristics.

[0309] Example 7: Enhancing the in vivo transplantation capacity and cell therapy efficacy of exogenous cells using miR-302

[0310] Previous studies have shown that introducing genes expressing aging antagonistic proteins into the genome can significantly improve the survival and cellular efficacy of exogenous cells after transplantation into animals.

[19] However, this technology requires inserting DNA fragments into the target cells, which carries the risk of damaging the genome and makes it difficult to meet clinical safety requirements. miRNAs and their analogues, as small RNA molecules, can be introduced into cells through simple physicochemical methods and maintain their function for a longer period. They do not carry the risk of inducing genomic mutations through DNA insertion, and small RNAs themselves do not pose a risk of genome integration, thus exhibiting good clinical safety.

[0311] Based on the significant anti-aging ability of miR-302, this embodiment proposes that pre-introducing miR-302 or its analogues is a safe and effective new technology to enhance the in vivo transplantation capacity of exogenous cells and the effect of cell therapy.

[0312] One method includes the steps of transfecting exogenous cells with miR-302 or its analogues in vitro (as in Examples 1-6) before transplanting them into the body, and then transplanting the transfected cells into the body. The effectiveness may be evaluated if necessary.

[0313] Taking mesenchymal stem cells (MSCs), a commonly used cell therapy, as an example, methods for evaluating the effectiveness of the technology may include:

[0314] 1) Fluorescently labeled MSCs were transfected with miR-302 or its analogues and control analogues, then transplanted into the body and their survival time and therapeutic effect were measured.

[0315] 2) MSCs were labeled with two different colors of fluorescent markers and transfected with miR-302 analog or control analog respectively. Then, equal amounts of the two different colored MSCs were mixed and injected into the body, and the change of the ratio of the two colors over time was observed.

[0316] discuss

[0317] microRNAs (miRNAs) are a class of small RNA molecules, approximately 22 nucleotides in size, that primarily regulate the expression levels of other genes in the post-transcriptional process. The function of miRNAs heavily depends on their 5' seed sequence of approximately 8 nucleotides. A group of different miRNAs sharing the same seed sequence is called a miRNA family. miRNAs belonging to the same family are generally considered to have highly similar functions. [3] .

[0318] The miR-302 family of miRNAs is a conserved family of miRNAs with AAGUGCU as the seed sequence. Their sequence characteristics can be summarized as RNA molecules with a total length of 16-28 nt and 5' end (N)AAGUGCU characteristics (where N represents any nucleotide and (N) represents 1 or 0 N), or their structural analogues.

[0319] Endogenous miR-302 family miRNAs are specifically highly expressed in pluripotent stem cells in both humans and mice, but rarely expressed in adult tissues / cells. [3] .

[0320] Previous studies have shown that the miR-302 family plays a role in assisting somatic pluripotency reprogramming, and their overexpression in somatic cells can significantly promote the efficiency of pluripotency reprogramming mediated by transcription factors or other miRNAs. [4-6] However, overexpression of the miR-302 family alone can only induce the expression of some pluripotent stem cell characteristic genes in somatic cells under specific conditions. [7] Earlier studies also reported that miRNA-372 and miRNA-373, belonging to the miR-302 family, can specifically inhibit oncogene-induced senescence caused by Ras gene mutants, and therefore possess oncogenic functions.

[15] However, this conclusion contradicts several recent publications and patents that have indicated the anticancer effects of miR-302 family miRNAs. Currently, there are no reports on whether miR-302 plays a regulatory role in normal cellular senescence.

[0321] In this invention, overexpression of miR-302 family miRNAs in cells via transgenic means can significantly reverse the aging of normal human cells without inducing pluripotency reprogramming. This indicates that miR-302 family miRNAs have anti-aging effects independent of pluripotency reprogramming.

[0322] Meanwhile, through in vitro and in vivo testing of a large number of human tumor cells of different types and origins, the results clearly showed that miR-302 family miRNAs have strong and broad-spectrum anti-cancer functions, further demonstrating that the role of these miRNAs in human cells is non-carcinogenic.

[0323] Furthermore, the results also showed that the introduction of artificially synthesized miR-302 family miRNA analogs into human cells can also produce significant aging reversal effects.

[0324] Therefore, miR-302 family miRNAs and their analogues are a class of highly effective and safe anti-aging drugs that do not cause pluripotency reprogramming and are non-carcinogenic. They have broad application value in the prevention / reversal of human aging, the extension of human lifespan, the treatment of aging-related human diseases, and the in vitro passage of human cells to resist aging.

[0325] All documents mentioned in this invention are incorporated herein by reference as if each document were individually incorporated by reference. Furthermore, it should be understood that after reading the foregoing teachings of this invention, those skilled in the art can make various alterations or modifications to this invention, and these equivalent forms also fall within the scope defined by the appended claims.

[0326] References

[0327] 1. Shetty AK, Kodali M, Upadhya R et al. Emerging Anti-Aging Strategies-Scientific Basis and Efficacy. Aging Dis 2018;9:1165-1184.

[0328] 2.Ocampo A,Reddy P,Martinez-Redondo P et al.In Vivo Amelioration ofAge-Associated Hallmarks by Partial Reprogramming.Cell 2016;167:1719-1733e1712.

[0329] 3.Suh MR,Lee Y,Kim JY et al.Human embryonic stem cells express aunique set of microRNAs.Dev Biol 2004;270:488-498.

[0330] 4.Judson RL,Babiarz JE,Venere M et al.Embryonic stem cell-specificmicroRNAs promote induced pluripotency.Nat Biotechnol 2009;27:459-461.

[0331] 5.Anokye-Danso F,Trivedi CM,Juhr D et al.Highly efficient miRNA-mediated reprogramming of mouse and human somatic cells to pluripotency.CellStem Cell 2011;8:376-388.

[0332] 6.Sandmaier SE,Telugu BP.MicroRNA-Mediated Reprogramming of SomaticCells into Induced Pluripotent Stem Cells.Methods Mol Biol 2015;1330:29-36.

[0333] 7.Lin SL,Chang DC,Lin CH et al.Regulation of somatic cellreprogramming through inducible mir-302expression.Nucleic Acids Res 2011;39:1054-1065.

[0334] 8.Ge Y,Zhang L,Nikolova M et al.Strand-specific in vivo screen ofcancer-associated miRNAs unveils a role for miR-21(*)in SCC progression.NatCell Biol 2016;18:111-121.

[0335] 9.Debacq-Chainiaux F,Erusalimsky JD,Campisi J et al.Protocols todetect senescence-associated beta-galactosidase(SA-betagal)activity,abiomarker of senescent cells in culture and in vivo.Nat Protoc 2009;4:1798-1806.

[0336] 10.Liu B,Wang Z,Zhang L et al.Depleting the methyltransferase Suv39h1improves DNA repair and extends lifespan in a progeria mouse model.Nat Commun2013;4:1868.

[0337] 11.Rodier F,Campisi J.Four faces of cellular senescence.J CellBiol2011;192:547-556.

[0338] 12.Surazynski A,Jarzabek K,Haczynski J et al.Differential effects ofestradiol and raloxifene on collagen biosynthesis in cultured human skinfibroblasts.Int J Mol Med 2003;12:803-809.

[0339] 13.Affinito P,Palomba S,Sorrentino C et al.Effects of postmenopausalhypoestrogenism on skin collagen.Maturitas 1999;33:239-247.

[0340] 14.Lin SL,Chang DC,Chang-Lin S et al.Mir-302reprograms human skincancer cells into a pluripotent ES-cell-like state.RNA 2008;14:2115-2124.

[0341] 15.Voorhoeve PM,le Sage C,Schrier M et al.A genetic screen implicatesmiRNA-372and miRNA-373as oncogenes in testicular germ cell tumors.Cell 2006;124:1169-1181.

[0342] 16.Zhao,W.,et al.,Endothelial CDS2 deficiency causes VEGFA-mediatedvascular regression and tumor inhibition.Cell Res,2019.29(11):p.895-910.

[0343] 17.Douglas E.Vaughan et al,Plasminogen Activator Inhibitor-1Is aMarker and a Mediator of Senescence,Arteriosclerosis,Thrombosis,and VascularBiology.2017;37:1446–1452;

[0344] 18.Koji Yamamoto et al,Plasminogen activator inhibitor-1is a majorstress-regulated gene:Implications for stress-induced thrombosi s in agedindividuals,PNAS January 22,2002 99(2)890-895.

[0345] 19. Yan, P., et al., FOXO3-Engineered Human ESC-Derived Vascular CellsPromote Vascular Protection and Regeneration. Cell Stem Cell, 2019.24(3):p.447-461 e8. sequence list <110> Shanghai Institute of Nutrition and Health, Chinese Academy of Sciences <120> Application of a class of small RNA molecules and their analogues in anti-aging <130> P2020-0180 <150> CN2019107918411 <151> 2019-08-26 <160> 11 <170> SIPOSequenceListing 1.0 <210> 1 <211> twenty two <212> RNA <213> Homo sapiens <400> 1 uaagugcuuc cauguuucag ug 22 <210> 2 <211> twenty two <212> DNA <213> Homo sapiens <400> 2 taagtgcttc catgtttcag tg 22 <210> 3 <211> 142 <212> DNA <213> Artificial Sequence <400> 3 ccggctgtct caagaaagaa tgaaggaatc gtgttgcgct agcctcagta agtgcttcca 60 tgtttcagtg cttcctgtca gacactgaaa catggttgca ctatctgcgg cacgtgcctt 120 tgcatctcga caggaacttt tt 142 <210> 4 <211> 142 <212> DNA <213> Artificial Sequence <400> 4 ccggctgtct caagaaagaa tgaaggaatc gtgttgcgct agcctcagca acaagatgaa 60 gagcaccaat cttcctgtca gaattggtgc tcttctactt gtatctgcgg cacgtgcctt 120 tgcatctcga caggaacttt tt 142 <210> 5 <211> 142 <212> DNA <213> Artificial Sequence() <400> 5 ccggctgtct caagaaagaa tgaaggaatc gtgttgcgct agcctcagtt tcacgaacca 60 tgtttcagtg cttcctgtca gacactgaaa catggaacgt gattctgcgg cacgtgcctt 120 tgcatctcga caggaacttt tt 142 <210> 6 <211> 142 <212> DNA <213> Artificial Sequence() <400> 6 ccggctgtct caagaaagaa tgaaggaatc gtgttgcgct agcctcagta agtgcttcct 60 acaaagtcac cttcctgtca gagtgacttt gtaggttgca ctatctgcgg cacgtgcctt 120 tgcatctcga caggaacttt tt 142 <210> 7 <211> 142 <212> DNA <213> Artificial sequence () <400> 7 ccggctgtct caagaaagaa tgaaggaatc gtgttgcgct agcctcagta agtgcttggt 60 acaaagtcac cttcctgtca gagtgacttt gtaccttgca ctatctgcgg cacgtgcctt 120 tgcatctcga caggaacttt tt 142 <210> 8 <211> 142 <212> DNA <213> Artificial sequence () <400> 8 ccggctgtct caagaaagaa tgaaggaatc gtgttgcgct agcctcagta agtgctaggt 60 acaaagtcac cttcctgtca gagtgacttt gttccttgca ctatctgcgg cacgtgcctt 120 tgcatctcga caggaacttt tt 142 <210> 9 <211> 142 <212> DNA <213> Artificial sequence () <400> 9 ccggctgtct caagaaagaa tgaaggaatc gtgttgcgct agcctcagta agtggaacca 60 tgtttcagtg cttcctgtca gacactgaaa catggaacca ctatctgcgg cacgtgcctt 120 tgcatctcga caggaacttt tt 142 <210> 10 <211> 142 <212> DNA <213> Artificial sequence () <400> 10 ccggctgtct caagaaagaa tgaaggaatc gtgttgcgct agcctcagtt tctgcttcca 60 tgtttcagtg cttcctgtca gacactgaaa catggttgca gattctgcgg cacgtgcctt 120 tgcatctcga caggaacttt tt 142 <210> 11 <211> 22 <212> RNA <213> Artificial sequence () <400> 11 uaagugcuuc cuacaaaguc ac 22

Claims

1. The use of an active ingredient, characterized in that, The active ingredients are selected from the following group: (a) MicroRNAs of the miR-302 family, wherein the microRNAs of the miR-302 family include miR-302; wherein the sequence of miR-302 is as shown in SEQ ID NO: 1: UAAGUGCUUCCAUGUUUCAGUG; (b) Precursor miRNA, wherein the precursor miRNA can be processed within the host into microRNAs of the miR-302 family described in (a); (c) A polynucleotide, wherein the polynucleotide can be transcribed by the host to form the precursor miRNA described in (b) and processed to form the microRNA described in (a); (d) An expression vector containing a microRNA of the miR-302 family described in (a), or a precursor miRNA described in (b), or a polynucleotide described in (c); The active ingredient is used to prepare a pharmaceutical composition or formulation, which is administered to healthy individuals and is used for: The cellular senescence of normal somatic cells in a normal human body is delayed or reversed, and the "delay or reversal of cellular senescence of normal somatic cells in a normal human body" does not promote cell reprogramming of pluripotent stem cell fate, and the cellular senescence is not oncogene-induced cellular senescence; wherein the somatic cells are selected from the group consisting of fibroblasts, vascular endothelial cells, mesenchymal stem cells, or combinations thereof.

2. The use as described in claim 1, characterized in that, The pharmaceutical composition or formulation is also used in one or more applications selected from the group consisting of: (i) Inhibit the expression and / or activity of SA-β-Gal; (ii) Promotes the expression and / or activity of H3K9me3; (iii) Inhibit the expression and / or activity of P16 protein; (iv) Promote the expression and / or activity of type III collagen COL3A1; (v) Inhibit the expression and / or activity of PAI-1.

3. The use as described in claim 1, characterized in that, The somatic cells mentioned therein are selected from fibroblasts or vascular endothelial cells.

4. The use as described in claim 1, characterized in that, The somatic cells mentioned above are vascular endothelial cells.

5. The use as described in claim 1, characterized in that, The pharmaceutical composition also includes additional anti-aging active ingredients.

6. The use as described in claim 1, characterized in that, The polynucleotide described in (c) has the structure shown in Formula II: Seq 正向 -X-Seq 反向 Formula II In formula II, Seq 正向 A nucleotide sequence that can be processed into the aforementioned microRNA in the host; Seq 反向 To be with Seq 正向 Nucleotide sequences that are essentially complementary or completely complementary; X is located at Seq 正向 and Seq 反向 The interval sequence between, and the interval sequence with Seq 正向 and Seq 反向 Not complementary; Furthermore, the structure shown in Formula II, after being transferred into the host cell, forms the secondary structure shown in Formula III: Formula III In Equation III, Seq 正向 Seq 反向 The definitions of X and X are as described above. || indicates that in Seq 正向 and Seq 反向 The complementary base pairing relationship formed between them.

7. The use as described in claim 1, characterized in that, The sequence of the polynucleotide described in (c) is shown in SEQ ID No:3: CCGGCTGTCTCAAGAAAGAATGAaggaatcgtgtTgcgctagcctcagTAAGTGCTTCCATGTTTCAGTGcttcctgtcagaCACTGAAACATGGTTGCACTatctgcggcacgtgcctttgcatctcgacaggaacttttt.

8. The use as described in claim 1, characterized in that, The expression vectors mentioned in (d) include viral vectors and non-viral vectors.

9. A method for screening candidate compounds that promote miR-302, characterized in that, Including the following steps: (a) The cell culture system with the test compound added is used as the experimental group; the cell culture system without the test compound added is used as the control group; wherein the cells are normal somatic cells, not tumor cells, and the somatic cells are selected from the group consisting of fibroblasts, vascular endothelial cells, mesenchymal stem cells, or combinations thereof. (b) Test the expression levels and / or activity of SA-β-Gal protein and / or P16 protein in the experimental and control groups; test the expression levels and / or activity of H3K9me3 protein and / or type III collagen COL3A1 in the experimental and control groups; Specifically, if the expression levels and / or activities of SA-β-Gal and / or P16 proteins in the test group are lower than those in the control group, and the expression levels and / or activities of H3K9me3 protein and / or type III collagen COL3A1 are significantly higher than those in the control group, then the test compound is considered a candidate compound for promoting miR-302. The candidate compounds that promote miR-302 are used to prepare pharmaceutical compositions or formulations, which are administered to normal individuals and are used to delay or reverse cellular senescence of normal somatic cells in normal individuals, and the "delay or reversal of cellular senescence of normal somatic cells in normal individuals" does not promote cell reprogramming of pluripotent stem cell fate, and the cellular senescence is not oncogene-induced cellular senescence, wherein the somatic cells are selected from the group consisting of fibroblasts, vascular endothelial cells, mesenchymal stem cells, or combinations thereof. The sequence of miR-302 is shown in SEQ ID NO: 1: UAAGUGCUUCCAUGUUUCAGUG.

10. The method as described in claim 9, characterized in that, Step (b) also includes: For the obtained candidate compounds, the effect of the candidate compounds on the production of miR-302 in cells in the experimental group and the control group was further tested; When the number of miR-302 in the experimental group is significantly higher than that in the control group, it indicates that the candidate compound is a promoter of miR-302.

11. The method of claim 9, wherein the cells are selected from fibroblasts or vascular endothelial cells.

Images