Tumor treatment by combination of oncolytic adenovirus and CDK4 / 6 inhibitor

Abstract

The present invention relates to adenovirus and CDK4 / inhibitor combinations.

Description

[0001] The present invention relates to a combination of an oncolytic virus and a CDK4 / inhibitor; the use of such a combination in treating diseases such as tumors; an oncolytic virus, preferably an oncolytic adenovirus, for treating diseases such as tumors together with a CDK4 / 6 inhibitor; and a CDK4 / 6 inhibitor, preferably an oncolytic adenovirus, for treating diseases such as tumors together with an oncolytic virus.

[0002] Many therapeutic concepts are currently used in the treatment of tumors. In addition to the use of surgery, chemotherapy and radiotherapy are mainly used. However, all these techniques have considerable side effects. The use of replication-selective oncolytic viruses provides a new platform for the treatment of tumors. In connection with this, selective intratumoral replication of viral agents is initiated, which leads to viral replication, lysis of infected tumor cells and spread of the virus to adjacent tumor cells. Since the replication capacity of the virus is limited to tumor cells, normal tissue replication can be avoided and thus lysis by the virus.

[0003] The problem underlying the present invention is to provide means to improve the efficacy of tumor treatments based on oncolytic viruses and in particular adenoviruses.

[0004] These and other problems are solved by the subject-matter of the attached independent claims. Preferred embodiments can be taken from the attached dependent claims.

[0005] In a first aspect, the problem on which the present invention is based is also solved by a combination comprising an adenovirus and a CDK4 / 6 inhibitor, which is also a first embodiment of this first aspect.

[0006] In the following, further embodiments of the first aspect are disclosed.

[0007] Embodiment 2: A combination of Embodiment 1, wherein the adenovirus is an oncolytic adenovirus.

[0008] Embodiment 3: A combination of any one of embodiments 1 and 2, wherein the adenovirus replicates in a YB-1 dependent manner.

[0009] Embodiment 4: A combination of Embodiment 3, wherein the adenovirus is replication-defective in cells lacking YB-1 in the nucleus, but replicates in cells having YB-1 in the nucleus.

[0010] Embodiment 5: A combination of any one of Embodiments 2 to 4, wherein the adenovirus encodes an oncogene protein, wherein the oncogene protein transactivates at least one adenoviral gene, wherein the adenoviral gene is selected from the group consisting of E1B55kDa, E4orf6, E4orf3 and E3ADP.

[0011] Embodiment 6: A combination of Embodiment 5, wherein the oncogene protein is E1A protein.

[0012] Embodiment 7: A combination of Embodiment 6, wherein the E1A protein is capable of binding a functional Rb tumor suppressor gene product.

[0013] Embodiment 8: A combination of embodiment 6, wherein the E1A protein is incapable of binding a functional Rb tumor suppressor gene product.

[0014] Embodiment 9: A combination of any one of embodiments 6 to 8, wherein the E1A protein does not induce the localization of YB-1 into the nucleus.

[0015] Embodiment 10: A combination of any one of embodiments 5 to 9, wherein the oncogene protein exhibits one or several mutations or deletions compared to the wild-type oncogene protein E1A.

[0016] Embodiment 11: A combination of embodiment 10, wherein the deletion is selected from one of the group consisting of a deletion of CR3 stretches, a deletion of the N-terminus, and a deletion of the C-terminus.

[0017] Embodiment 12: A combination of any one of embodiments 6 to 11, wherein the E1A protein is capable of binding Rb.

[0018] Embodiment 13: A combination of any one of embodiments 6 to 12, wherein the E1A protein comprises one or more mutations or deletions compared to the wild-type oncogene protein, wherein the deletion is preferably a deletion in the CR1 region and / or the CR2 region.

[0019] Embodiment 14: A combination of Embodiment 13, wherein the E1A protein is incapable of binding Rb.

[0020] Embodiment 15: The combination of any one of Embodiments 1 to 14, wherein the virus is an adenovirus expressing the E1A12S protein.

[0021] Embodiment 16: The combination of any one of Embodiments 1 to 15, wherein the virus is an adenovirus lacking expression of the E1A13S protein.

[0022] Embodiment 17: A combination of any one of Embodiments 1 to 16, wherein the virus is an adenovirus lacking a functionally active adenoviral E3 region.

[0023] Embodiment 18: The combination of any one of Embodiments 1 to 17, wherein the virus is an adenovirus lacking expression of the E1B 19 kDa protein.

[0024] Embodiment 19: A combination of any one of embodiments 1 to 18, wherein the virus is an adenovirus expressing an RGD motif on the tail fiber.

[0025] Embodiment 20: A combination of any one of Embodiments 1 to 19, wherein the virus is adenovirus serotype 5.

[0026] Embodiment 21: A combination of any one of Embodiments 1 to 20, wherein the adenovirus is selected from the group comprising: XVir-N-31, dl520, AdΔ24, AdΔ24-RGD, dl922-947, E1Ad / 01 / 07, dl1119 / 1131, CB016, VCN-01, E1Adl1107, E1Adl1101, ORCA-010, Enadenotucirev and a virus lacking an expressed viral oncogene that is capable of binding a functional Rb tumor suppressor gene product.

[0027] Embodiment 22: The combination of Embodiment 21, wherein the adenovirus is XVir-N-31.

[0028] Embodiment 23: A combination of Embodiment 21, wherein the adenovirus is dl520, wherein the adenovirus E3 region is functionally inactivated.

[0029] Embodiment 24: The combination of any one of Embodiments 21 to 23, wherein the adenovirus is d1520, wherein d1520 lacks expression of the E1B 19 kDa protein.

[0030] Embodiment 25: A combination of any one of Embodiments 21 to 24, wherein the adenovirus is d1520 expressing the RGD motif on the tail fiber.

[0031] Embodiment 26: A combination of any one of Embodiments 1 to 25, wherein the virus encodes YB-1.

[0032] Embodiment 27: A combination of Embodiment 26, wherein the gene encoding YB-1 is under the control of a tissue-specific promoter, a tumor-specific promoter and / or a YB-1-dependent promoter.

[0033] Embodiment 28: A combination of Embodiment 27, wherein the YB-1 dependent promoter is an adenovirus E2 late promoter.

[0034] Embodiment 29: A combination according to any one of embodiments 1 to 28, wherein the CDK4 / 6 inhibitor is a compound that decreases Rb phosphorylation in cells, preferably tumor cells.

[0035] Embodiment 30: A combination according to any one of embodiments 1 to 29, wherein the CDK4 / 6 inhibitor is a compound that reduces the expression of Rb in cells, preferably tumor cells.

[0036] Embodiment 31: A combination of any one of Embodiments 1 to 30, wherein the CDK4 / 6 inhibitor is selected from the group comprising: palbociclib, which is also known as PD 0332991; abemaciclib, which is also known as LY-2835219; ribociclib, which is also known as LEE011; Trilaciclib, which is also known as G1T28; and Dinaciclib.

[0037] Embodiment 32: A combination of any one of Embodiments 1 to 31, wherein the CDK4 / 6 inhibitor causes G1 arrest in cells and inhibits E2F1.

[0038] Embodiment 33: A combination of any one of Embodiments 1 to 32, wherein the composition further comprises a PARP inhibitor.

[0039] Embodiment 34: The combination of Embodiment 33, wherein the PARP inhibitor is selected from the group comprising olaparib, veliparib, rucaparib and BMN673.

[0040] Embodiment 35: A combination of any one of Embodiments 1 to 32, wherein the composition further comprises a bromodomain inhibitor.

[0041] Embodiment 36: The combination of Embodiment 35, wherein the bromodomain inhibitor is selected from the group comprising JQ1, OTX-015, I-BET151, CPI-0610, I-BET762, CPI203, PFI-1 and MS 436.

[0042] Embodiment 37: The combination according to any one of Embodiments 1 to 36, wherein the components of the combination are for separate administration.

[0043] The problem of the present invention is also solved in a second aspect, which is also a first embodiment of this second aspect, by the combination comprising an adenovirus and a CDK4 / 6 inhibitor according to the first aspect, including any embodiment thereof, for use in treating a disease, more preferably for treating a tumor or cancer.

[0044] In the following, further embodiments of this second aspect are disclosed.

[0045] Embodiment 1: A combination comprising an adenovirus and a CDK4 / 6 inhibitor for use in a method for treating and / or preventing a disease, preferably a tumor or cancer.

[0046] Embodiment 2: Use of the combination of Embodiment 1, wherein the adenovirus is an oncolytic adenovirus.

[0047] Embodiment 3: Use of the combination of any one of embodiments 1 and 2, wherein the adenovirus replicates in a YB-1 dependent manner.

[0048] Embodiment 4: Use of the combination of embodiment 3, wherein the adenovirus is replication-defective in cells lacking YB-1 in the nucleus, but replicates in cells having YB-1 in the nucleus.

[0049] Embodiment 5: Use of a combination of any one of Embodiments 2 to 4, wherein the adenovirus encodes an oncogene protein, wherein the oncogene protein transactivates at least one adenoviral gene, wherein the adenoviral gene is selected from the group comprising E1B55kDa, E4orf6, E4orf3 and E3ADP.

[0050] Embodiment 6: Use of the combination of Embodiment 5, wherein the oncogene protein is E1A protein.

[0051] Embodiment 7: Use of the combination of embodiment 6, wherein the E1A protein is capable of binding to a functional Rb tumor suppressor gene product.

[0052] Embodiment 8: Use of the combination of embodiment 6, wherein the E1A protein is unable to bind to a functional Rb tumor suppressor gene product.

[0053] Embodiment 9: Use of the combination of any one of embodiments 6 to 8, wherein the E1A protein does not induce the localization of YB-1 into the nucleus.

[0054] Embodiment 10: Use of the combination according to any one of embodiments 5 to 9, wherein the oncogene protein exhibits one or several mutations or deletions compared to the wild-type oncogene protein E1A.

[0055] Embodiment 11: Use of the combination of Embodiment 10, wherein the deletion is selected from one of the group consisting of a deletion of the CR3 fragment, a deletion of the N-terminus, and a deletion of the C-terminus.

[0056] Embodiment 12: Use of the combination of any one of embodiments 6 to 11, wherein the E1A protein is capable of binding to Rb.

[0057] Embodiment 13: Use of the combination of any one of embodiments 6 to 12, wherein the E1A protein comprises one or more mutations or deletions compared to the wild-type oncogene protein, wherein the deletion is preferably a deletion in the CR1 region and / or the CR2 region.

[0058] Embodiment 14: Use of the combination of Embodiment 13, wherein the E1A protein is unable to bind to Rb.

[0059] Embodiment 15: Use of the combination of any one of embodiments 1 to 14, wherein the virus is an adenovirus expressing the E1A12S protein.

[0060] Embodiment 16: Use of the combination of any one of embodiments 1 to 15, wherein the virus is an adenovirus lacking expression of the E1A13S protein.

[0061] Embodiment 17: Use of the combination of any one of embodiments 1 to 16, wherein the virus is an adenovirus lacking a functionally active adenoviral E3 region.

[0062] Embodiment 18: Use of the combination of any one of embodiments 1 to 17, wherein the virus is an adenovirus lacking expression of the E1B19 kDa protein.

[0063] Embodiment 19: Use of the combination according to any one of embodiments 1 to 18, wherein the virus is an adenovirus expressing the RGD motif on the tail fiber.

[0064] Embodiment 20: Use of the combination of any one of embodiments 1 to 19, wherein the virus is adenovirus serotype 5.

[0065] Embodiment 21: Use of a combination of any one of embodiments 1 to 20, wherein the adenovirus is selected from the group comprising: XVir-N-31, dl520, AdΔ24, AdΔ24-RGD, dl922-947, E1Ad / 01 / 07, dl1119 / 1131, CB 016, VCN-01, E1Adl1107, E1Adl1101, ORCA-010, Enadenotucirev and a virus lacking an expressed viral oncogene that is capable of binding a functional Rb tumor suppressor gene product.

[0066] Embodiment 22: Use of the combination of Embodiment 21, wherein the adenovirus is XVir-N-31.

[0067] Embodiment 23: Use of the combination of Embodiment 21, wherein the adenovirus is d1520, wherein the adenovirus E3 region is functionally inactivated.

[0068] Embodiment 24: Use of the combination of any one of Embodiments 21 to 23, wherein the adenovirus is d1520, wherein d1520 lacks expression of the E1B 19 kDa protein.

[0069] Embodiment 25: Use of the combination of any one of embodiments 21 to 24, wherein the adenovirus is d1520 expressing the RGD motif on the tail fiber.

[0070] Embodiment 26: Use of the combination of any one of Embodiments 1 to 25, wherein the virus encodes YB-1.

[0071] Embodiment 27: Use of the combination of Embodiment 26, wherein the gene encoding YB-1 is under the control of a tissue-specific promoter, a tumor-specific promoter and / or a YB-1-dependent promoter.

[0072] Embodiment 28: Use of the combination of Embodiment 27, wherein the YB-1 dependent promoter is the adenovirus E2 late promoter.

[0073] Embodiment 29: Use of the combination of any one of embodiments 1 to 28, wherein the CDK4 / 6 inhibitor is a compound that decreases Rb phosphorylation in cells, preferably tumor cells.

[0074] Embodiment 30: Use of the combination of any one of embodiments 1 to 29, wherein the CDK4 / 6 inhibitor is a compound that reduces the expression of Rb in cells, preferably tumor cells.

[0075] Embodiment 31: Use of a combination of any one of Embodiments 1 to 30, wherein the CDK4 / 6 inhibitor is selected from the group comprising: palbociclib, which is also known as PD 0332991; abemaciclib, which is also known as LY-2835219; ribociclib, which is also known as LEE011; Trilaciclib, which is also known as G1T28; and Dinaciclib.

[0076] Embodiment 32: Use of a combination according to any one of embodiments 1 to 31, wherein the CDK4 / 6 inhibitor causes G1 arrest in cells and inhibits E2F1.

[0077] Embodiment 33: Use of a combination according to any one of Embodiments 1 to 32, wherein the composition further comprises a PARP inhibitor.

[0078] Embodiment 34: Use of the combination of Embodiment 33, wherein the PARP inhibitor is selected from the group comprising olaparib, veliparib, rucaparib and BMN673.

[0079] Embodiment 35: Use of a combination according to any one of Embodiments 1 to 32, wherein the composition further comprises a bromodomain inhibitor.

[0080] Embodiment 36: Use of the combination of Embodiment 35, wherein the bromodomain inhibitor is selected from the group comprising JQ1, OTX-015, I-BET151, CPI-0610, I-BET762, CPI203, PFI-1 and MS 436.

[0081] Embodiment 37: Use of a combination according to any one of Embodiments 1 to 36, wherein the components of the combination are for separate administration.

[0082] Embodiment 38: Use of the combination of any one of embodiments 1 to 37, wherein the cells of the tumor have a disruption of the CDK4 / 6 signaling pathway.

[0083] Embodiment 39: Use of the combination of any one of Embodiments 1 to 38, wherein the cells of the tumor have an uncontrolled G1-S transition of the cell cycle.

[0084] Embodiment 40: Use of the combination of any one of Embodiments 1 to 38, wherein the cells of the tumor have a loss-of-function mutation or deletion in a gene selected from the group comprising RB1 gene, CDKN2A gene and CDKN2B gene.

[0085] Embodiment 41: Use of the combination of any one of Embodiments 1 to 38, wherein the cells of the tumor have amplification of a gene and / or an activating mutation in a gene.

[0086] Embodiment 42: Use of the combination of Embodiment 41, wherein the gene is selected from the group comprising CCND1, E2F1, E2F2, E2F3, CDK4 and CDK6.

[0087] Embodiment 43: Use of the combination of Embodiment 41, wherein the gene is a gene encoding a component of a mitotic signaling pathway.

[0088] Embodiment 44: Use of the combination of Embodiment 43, wherein the mitotic signaling pathway is selected from the group comprising the PI3K pathway and the MAPK pathway.

[0089] Embodiment 45: Use of the combination according to any one of embodiments 1 to 44, wherein the cells of the tumor cells are resistant or insensitive to one or several pharmaceutically active agents and / or radiation.

[0090] Embodiment 46: Use of the combination of Embodiment 45, wherein the pharmaceutically active agent is a cytostatic agent.

[0091] Embodiment 47: Use of the combination of claim 46, wherein the resistance is mediated by an ABC transporter.

[0092] Embodiment 48: Use of the combination according to claim 47, wherein the ABC transporter is selected from the group comprising MRP and MDR, in particular MDR-1.

[0093] Embodiment 49: Use of the combination according to any one of embodiments 45 to 48, wherein the resistance is multi-resistance or multi-resistance, in particular multi-resistance or multi-resistance to cytostatics and / or radiation.

[0094] Embodiment 50: Use of the combination of any one of Embodiments 1 to 49, wherein the cells of the tumor are Rb positive.

[0095] Embodiment 51: Use of the combination of any one of Embodiments 1 to 50, wherein the cells of the tumor have YB-1 in the nucleus.

[0096] Embodiment 52: Use of the combination of any one of Embodiments 1 to 51, wherein the cells of the tumor have YB-1 in the nucleus after induction.

[0097] Embodiment 53: Use of the combination of Embodiment 52, wherein the transport of YB-1 into the cell nucleus is triggered by at least one measure selected from the group consisting of radiation, administration of cytostatics, and hyperthermia.

[0098] Embodiment 54: Use of the combination of Embodiment 53, wherein the measures are applied to a cell, an organ or an organism, preferably an organism in need thereof, more preferably an organism suffering from a tumor.

[0099] Embodiment 55: Use of the combination of any one of claims 1 to 54, wherein the tumor is selected from the group comprising bladder cancer, breast cancer, metastatic breast cancer (mBC), melanoma, glioma, pancreatic cancer, hepatocellular carcinoma, lung adenocarcinoma, sarcoma, ovarian cancer, kidney cancer, prostate cancer and leukemia.

[0100] The problem of the present invention is also solved in the third aspect by using an adenovirus for treating and / or preventing a disease, more preferably a tumor or cancer, in a subject, wherein the method comprises administering an adenovirus and a CDK4 / 6 inhibitor to the subject, which is also the first embodiment of the third aspect.

[0101] In the following, further embodiments of this third aspect are disclosed.

[0102] Embodiment 2: The adenovirus for use according to embodiment 1, wherein the adenovirus is an oncolytic adenovirus.

[0103] Embodiment 3: The adenovirus for use according to any one of embodiments 1 and 2, wherein the adenovirus replicates in a YB-1-dependent manner.

[0104] Embodiment 4: The adenovirus for use according to embodiment 3, wherein the adenovirus is replication-defective in cells lacking YB-1 in the nucleus, but replicates in cells having YB-1 in the nucleus.

[0105] Embodiment 5: An adenovirus for use according to any one of embodiments 2 to 4, wherein the adenovirus encodes an oncogene protein, wherein the oncogene protein transactivates at least one adenoviral gene, wherein the adenoviral gene is selected from the group consisting of E1B55kDa, E4orf6, E4orf3 and E3ADP.

[0106] Embodiment 6: The adenovirus for use according to Embodiment 5, wherein the oncogene protein is E1A protein.

[0107] Embodiment 7: The adenovirus for use according to embodiment 6, wherein the E1A protein is capable of binding to a functional Rb tumor suppressor gene product.

[0108] Embodiment 8: The adenovirus for use according to embodiment 6, wherein the E1A protein is unable to bind to a functional Rb tumor suppressor gene product.

[0109] Embodiment 9: The adenovirus for use according to any one of embodiments 6 to 8, wherein the E1A protein does not induce the localization of YB-1 into the nucleus.

[0110] Embodiment 10: The adenovirus for use according to any one of embodiments 5 to 9, wherein the oncogene protein exhibits one or several mutations or deletions compared to the wild-type oncogene protein E1A.

[0111] Embodiment 11: The adenovirus for use according to Embodiment 10, wherein the deletion is selected from the group consisting of a deletion of the CR3 fragment, a deletion of the N-terminus, and a deletion of the C-terminus.

[0112] Embodiment 12: The adenovirus for use according to any one of embodiments 6 to 11, wherein the E1A protein is capable of binding to Rb.

[0113] Embodiment 13: The adenovirus for use according to any one of Embodiments 6 to 12, wherein the E1A protein comprises one or more mutations or deletions compared to the wild-type oncogene protein, wherein the deletion is preferably a deletion in the CR1 region and / or the CR2 region.

[0114] Embodiment 14: The adenovirus for use according to Embodiment 13, wherein the E1A protein is unable to bind to Rb.

[0115] Embodiment 15: The adenovirus for use according to any one of embodiments 1 to 14, wherein the virus is an adenovirus expressing the E1A12S protein.

[0116] Embodiment 16: The adenovirus for use according to any one of embodiments 1 to 15, wherein the virus is an adenovirus lacking expression of the E1A13S protein.

[0117] Embodiment 17: An adenovirus for use according to any one of embodiments 1 to 16, wherein the virus is an adenovirus lacking a functionally active adenovirus E3 region.

[0118] Embodiment 18: The adenovirus for use according to any one of embodiments 1 to 17, wherein the virus is an adenovirus lacking expression of the E1B19 kDa protein.

[0119] Embodiment 19: The adenovirus for use according to any one of embodiments 1 to 18, wherein the virus is an adenovirus expressing the RGD motif on the tail fiber.

[0120] Embodiment 20: An adenovirus for use according to any one of embodiments 1 to 19, wherein the virus is adenovirus serotype 5.

[0121] Embodiment 21: An adenovirus for use according to any one of embodiments 1 to 20, wherein the adenovirus is selected from the group comprising XVir-N-31, dl520, AdΔ24, AdΔ24-RGD, dl922-947, E1Ad / 01 / 07, dl1119 / 1131, CB 016, VCN-01, E1Adl1107, E1Adl1101, ORCA-010, Enadenotucirev and a virus lacking an expressed viral oncogene capable of binding a functional Rb tumor suppressor gene product.

[0122] Embodiment 22: The adenovirus for use according to Embodiment 21, wherein the adenovirus is XVir-N-31.

[0123] Embodiment 23: The adenovirus for use of Embodiment 21, wherein the adenovirus is d1520, wherein the adenovirus E3 region is functionally inactivated.

[0124] Embodiment 24: The adenovirus for use according to any one of Embodiments 21 to 23, wherein the adenovirus is d1520, wherein d1520 lacks expression of the E1B 19 kDa protein.

[0125] Embodiment 25: The adenovirus for use according to any one of Embodiments 21 to 24, wherein the adenovirus is d1520 expressing the RGD motif on the tail fiber.

[0126] Embodiment 26: An adenovirus for use according to any one of embodiments 1 to 25, wherein the virus encodes YB-1.

[0127] Embodiment 27: The adenovirus for use according to Embodiment 26, wherein the gene encoding YB-1 is under the control of a tissue-specific promoter, a tumor-specific promoter and / or a YB-1-dependent promoter.

[0128] Embodiment 28: The adenovirus for use according to Embodiment 27, wherein the YB-1-dependent promoter is the adenovirus E2 late promoter.

[0129] Embodiment 29: The adenovirus for use according to any one of embodiments 1 to 28, wherein the CDK4 / 6 inhibitor is a compound that reduces Rb phosphorylation in cells, preferably tumor cells.

[0130] Embodiment 30: The adenovirus for use according to any one of embodiments 1 to 29, wherein the CDK4 / 6 inhibitor is a compound that reduces the expression of Rb in cells, preferably tumor cells.

[0131] Embodiment 31: An adenovirus for use according to any one of Embodiments 1 to 30, wherein the CDK4 / 6 inhibitor is selected from the group comprising: palbociclib, which is also known as PD 0332991; abemaciclib, which is also known as LY-2835219; ribociclib, which is also known as LEE011; Trilaciclib, which is also known as G1T28; and Dinaciclib.

[0132] Embodiment 32: The adenovirus for use according to any one of embodiments 1 to 31, wherein the CDK4 / 6 inhibitor causes G1 arrest in cells and inhibits E2F1.

[0133] Embodiment 33: The adenovirus for use according to any one of Embodiments 1 to 32, wherein the method further comprises administering a PARP inhibitor to the subject.

[0134] Embodiment 34: The adenovirus for use according to Embodiment 33, wherein the PARP inhibitor is selected from the group consisting of olaparib, veliparib, rucaparib and BMN673.

[0135] Embodiment 35: The adenovirus for use according to any one of Embodiments 1 to 32, wherein the composition further comprises administering a bromodomain inhibitor to the subject.

[0136] Embodiment 36: The adenovirus for use of Embodiment 35, wherein the bromodomain inhibitor is selected from the group consisting of JQ1, OTX-015, I-BET151, CPI-0610, I-BET762, CPI203, PFI-1 and MS 436.

[0137] Embodiment 37: The adenovirus for use according to any one of Embodiments 1 to 36, wherein the adenovirus, the CDK4 / 6 inhibitor, the PARP inhibitor and / or the bromodomain inhibitor are administered to a subject separately or in any combination.

[0138] Embodiment 38: The adenovirus for use according to any one of embodiments 1 to 37, wherein the cells of the tumor have a disruption of the CDK4 / 6 signaling pathway.

[0139] Embodiment 39: The adenovirus for use according to any one of Embodiments 1 to 38, wherein the cells of the tumor have an uncontrolled G1-S transition of the cell cycle.

[0140] Embodiment 40: The adenovirus for use according to any one of Embodiments 1 to 38, wherein the cells of the tumor have a loss-of-function mutation or deletion in a gene selected from the group consisting of the RB1 gene, the CDKN2A gene and the CDKN2B gene.

[0141] Embodiment 41: The adenovirus for use according to any one of Embodiments 1 to 38, wherein the cells of the tumor have amplification of the gene and / or an activating mutation in the gene.

[0142] Embodiment 42: The adenovirus for use according to Embodiment 41, wherein the gene is selected from the group consisting of CCND1, E2F1, E2F2, E2F3, CDK4 and CDK6.

[0143] Embodiment 43: The adenovirus for use according to Embodiment 41, wherein the gene is a gene encoding a component of a mitotic signaling pathway.

[0144] Embodiment 44: The adenovirus for use according to Embodiment 43, wherein the mitotic signaling pathway is selected from the group consisting of the PI3K pathway and the MAPK pathway.

[0145] Embodiment 45: The adenovirus for use according to any one of embodiments 1 to 44, wherein the cells of the tumor cells are resistant or insensitive to one or several pharmaceutically active agents and / or radiation.

[0146] Embodiment 46: The adenovirus for use according to Embodiment 45, wherein the pharmaceutically active agent is a cytostatic agent.

[0147] Embodiment 47: The adenovirus for use according to claim 46, wherein the resistance is mediated by an ABC transporter.

[0148] Embodiment 48: The adenovirus for use according to claim 47, wherein the ABC transporter is selected from the group comprising MRP and MDR, in particular MDR-1.

[0149] Embodiment 49: Adenovirus for use according to any one of embodiments 45 to 48, wherein the resistance is multiple resistance or multiresistance, in particular multiple resistance or multiresistance to cytostatics and / or radiation.

[0150] Embodiment 50: The adenovirus for use according to any one of Embodiments 1 to 49, wherein the cells of the tumor are Rb positive.

[0151] Embodiment 51: The adenovirus for use according to any one of Embodiments 1 to 50, wherein the cells of the tumor have YB-1 in the nucleus.

[0152] Embodiment 52: The adenovirus for use according to any one of Embodiments 1 to 51, wherein the cells of the tumor have YB-1 in the nucleus after induction.

[0153] Embodiment 53: The adenovirus for use according to Embodiment 52, wherein the transport of YB-1 into the cell nucleus is triggered by at least one measure selected from the group consisting of radiation, administration of cytostatics and hyperthermia.

[0154] Embodiment 54: The adenovirus for use according to embodiment 53, wherein said measure is applied to a cell, an organ or an organism, preferably an organism in need thereof, more preferably an organism suffering from a tumor.

[0155] Embodiment 55: An adenovirus for use according to any one of claims 1 to 54, wherein the tumor is selected from the group comprising bladder cancer, breast cancer, metastatic breast cancer (mBC), melanoma, glioma, pancreatic cancer, hepatocellular carcinoma, lung adenocarcinoma, sarcoma, ovarian cancer, kidney cancer, prostate cancer and leukemia.

[0156] The problem of the present invention is also solved in a fourth aspect by a CDK4 / 6 inhibitor for treating and / or preventing a disease, more preferably a tumor or cancer, in a subject, wherein the method comprises administering an adenovirus and a CDK4 / 6 inhibitor to the subject, which is also a first embodiment of the fourth aspect.

[0157] In the following, further embodiments of the fourth aspect are disclosed.

[0158] Embodiment 2: The CDK4 / 6 inhibitor for use according to embodiment 1, wherein the adenovirus is an oncolytic adenovirus.

[0159] Embodiment 3: A CDK4 / 6 inhibitor for use according to any one of embodiments 1 and 2, wherein the adenovirus replicates in a YB-1-dependent manner.

[0160] Embodiment 4: A CDK4 / 6 inhibitor for use according to embodiment 3, wherein the adenovirus is replication-defective in cells lacking YB-1 in the nucleus but replicates in cells having YB-1 in the nucleus.

[0161] Embodiment 5: A CDK4 / 6 inhibitor for use according to any one of Embodiments 2 to 4, wherein the adenovirus encodes an oncogene protein, wherein the oncogene protein transactivates at least one adenoviral gene, wherein the adenoviral gene is selected from the group consisting of E1B55kDa, E4orf6, E4orf3 and E3ADP.

[0162] Embodiment 6: The CDK4 / 6 inhibitor for use according to Embodiment 5, wherein the oncogene protein is E1A protein.

[0163] Embodiment 7: The CDK4 / 6 inhibitor for use according to embodiment 6, wherein the E1A protein is capable of binding to a functional Rb tumor suppressor gene product.

[0164] Embodiment 8: The CDK4 / 6 inhibitor for use according to embodiment 6, wherein the E1A protein is unable to bind to a functional Rb tumor suppressor gene product.

[0165] Embodiment 9: The CDK4 / 6 inhibitor for use according to any one of embodiments 6 to 8, wherein the E1A protein does not induce the localization of YB-1 into the nucleus.

[0166] Embodiment 10: A CDK4 / 6 inhibitor for use according to any one of embodiments 5 to 9, wherein the oncogene protein exhibits one or several mutations or deletions compared to the wild-type oncogene protein E1A.

[0167] Embodiment 11: The CDK4 / 6 inhibitor for use according to Embodiment 10, wherein the deletion is one selected from the group consisting of a deletion of the CR3 fragment, a deletion of the N-terminus, and a deletion of the C-terminus.

[0168] Embodiment 12: A CDK4 / 6 inhibitor for use according to any one of embodiments 6 to 11, wherein the E1A protein is capable of binding to Rb.

[0169] Embodiment 13: A CDK4 / 6 inhibitor for use according to any one of Embodiments 6 to 12, wherein the E1A protein comprises one or more mutations or deletions compared to the wild-type oncogene protein, wherein the deletion is preferably a deletion in the CR1 region and / or the CR2 region.

[0170] Embodiment 14: The CDK4 / 6 inhibitor for use according to embodiment 13, wherein the E1A protein is unable to bind to Rb.

[0171] Embodiment 15: A CDK4 / 6 inhibitor for use according to any one of embodiments 1 to 14, wherein the virus is an adenovirus expressing the E1A12S protein.

[0172] Embodiment 16: A CDK4 / 6 inhibitor for use according to any one of embodiments 1 to 15, wherein the virus is an adenovirus lacking expression of the E1A13S protein.

[0173] Embodiment 17: A CDK4 / 6 inhibitor for use according to any one of embodiments 1 to 16, wherein the virus is an adenovirus lacking a functionally active adenovirus E3 region.

[0174] Embodiment 18: A CDK4 / 6 inhibitor for use according to any one of embodiments 1 to 17, wherein the virus is an adenovirus lacking expression of the E1B 19 kDa protein.

[0175] Embodiment 19: A CDK4 / 6 inhibitor for use according to any one of embodiments 1 to 18, wherein the virus is an adenovirus expressing an RGD motif on the tail fiber.

[0176] Embodiment 20: A CDK4 / 6 inhibitor for use according to any one of embodiments 1 to 19, wherein the virus is adenovirus serotype 5.

[0177] Embodiment 21: A CDK4 / 6 inhibitor for use according to any one of Embodiments 1 to 20, wherein the adenovirus is selected from the group comprising: XVir-N-31, dl520, AdΔ24, AdΔ24-RGD, dl922-947, E1Ad / 01 / 07, dl1119 / 1131, CB 016, VCN-01, E1Adl1107, E1Adl1101, ORCA-010, Enadenotucirev and a virus lacking an expressed viral oncogene capable of binding a functional Rb tumor suppressor gene product.

[0178] Embodiment 22: The CDK4 / 6 inhibitor for use according to Embodiment 21, wherein the adenovirus is XVir-N-31.

[0179] Embodiment 23: The CDK4 / 6 inhibitor for use according to Embodiment 21, wherein the adenovirus is d1520, wherein the adenovirus E3 region is functionally inactive.

[0180] Embodiment 24: A CDK4 / 6 inhibitor for use according to any one of Embodiments 21 to 23, wherein the adenovirus is d1520, wherein d1520 lacks expression of the E1B 19 kDa protein.

[0181] Embodiment 25: A CDK4 / 6 inhibitor for use according to any one of Embodiments 21 to 24, wherein the adenovirus is d1520 expressing the RGD motif on the tail fiber.

[0182] Embodiment 26: A CDK4 / 6 inhibitor for use according to any one of embodiments 1 to 25, wherein the virus encodes YB-1.

[0183] Embodiment 27: The CDK4 / 6 inhibitor for use according to Embodiment 26, wherein the gene encoding YB-1 is under the control of a tissue-specific promoter, a tumor-specific promoter and / or a YB-1-dependent promoter.

[0184] Embodiment 28: The CDK4 / 6 inhibitor for use according to Embodiment 27, wherein the YB-1-dependent promoter is an adenovirus E2 late promoter.

[0185] Embodiment 29: A CDK4 / 6 inhibitor for use according to any one of embodiments 1 to 28, wherein the CDK4 / 6 inhibitor is a compound that decreases Rb phosphorylation in cells, preferably tumor cells.

[0186] Embodiment 30: A CDK4 / 6 inhibitor for use according to any one of embodiments 1 to 29, wherein the CDK4 / 6 inhibitor is a compound that reduces the expression of Rb in cells, preferably tumor cells.

[0187] Embodiment 31: A CDK4 / 6 inhibitor for use according to any one of Embodiments 1 to 30, wherein the CDK4 / 6 inhibitor is selected from the group comprising: palbociclib, which is also known as PD 0332991; abemaciclib, which is also known as LY-2835219; ribociclib, which is also known as LEE011; Trilaciclib, which is also known as G1T28; and Dinaciclib.

[0188] Embodiment 32: A CDK4 / 6 inhibitor for use according to any one of embodiments 1 to 31, wherein the CDK4 / 6 inhibitor causes G1 arrest in cells and inhibits E2F1.

[0189] Embodiment 33: A CDK4 / 6 inhibitor for use according to any one of Embodiments 1 to 32, wherein the method further comprises administering a PARP inhibitor to the subject.

[0190] Embodiment 34: The CDK4 / 6 inhibitor for use according to Embodiment 33, wherein the PARP inhibitor is selected from the group comprising olaparib, veliparib, rucaparib and BMN673.

[0191] Embodiment 35: A CDK4 / 6 inhibitor for use according to any one of Embodiments 1 to 32, wherein the method further comprises administering a bromodomain inhibitor to the subject.

[0192] Embodiment 36: The CDK4 / 6 inhibitor for use according to Embodiment 35, wherein the bromodomain inhibitor is selected from the group consisting of JQ1, OTX-015, I-BET151, CPI-0610, I-BET762, CPI203, PFI-1 and MS 436.

[0193] Embodiment 37: A CDK4 / 6 inhibitor for use according to any one of Embodiments 1 to 36, wherein the adenovirus, the CDK4 / 6 inhibitor, the PARP inhibitor and / or the bromodomain inhibitor are administered to the subject separately or in any combination.

[0194] Embodiment 38: A CDK4 / 6 inhibitor for use according to any one of embodiments 1 to 37, wherein the cells of the tumor have a disruption of the CDK4 / 6 signaling pathway.

[0195] Embodiment 39: A CDK4 / 6 inhibitor for use according to any one of Embodiments 1 to 38, wherein the cells of the tumor have an uncontrolled G1-S transition of the cell cycle.

[0196] Embodiment 40: A CDK4 / 6 inhibitor for use according to any one of Embodiments 1 to 38, wherein the cells of the tumor have a loss-of-function mutation or deletion in a gene selected from the group comprising the RB1 gene, the CDKN2A gene and the CDKN2B gene.

[0197] Embodiment 41: A CDK4 / 6 inhibitor for use according to any one of Embodiments 1 to 38, wherein the cells of the tumor have amplification of the gene and / or an activating mutation in the gene.

[0198] Embodiment 42: The CDK4 / 6 inhibitor for use according to Embodiment 41, wherein the gene is selected from the group consisting of CCND1, E2F1, E2F2, E2F3, CDK4 and CDK6.

[0199] Embodiment 43: The CDK4 / 6 inhibitor for use according to Embodiment 41, wherein the gene is a gene encoding a component of a mitotic signaling pathway.

[0200] Embodiment 44: The CDK4 / 6 inhibitor for use according to Embodiment 43, wherein the mitotic signaling pathway is selected from the group comprising the PI3K pathway and the MAPK pathway.

[0201] Embodiment 45: A CDK4 / 6 inhibitor for use according to any one of embodiments 1 to 44, wherein the tumor cells are resistant or insensitive to one or several pharmaceutically active agents and / or radiation.

[0202] Embodiment 46: A CDK4 / 6 inhibitor for use according to Embodiment 45, wherein the pharmaceutically active agent is a cytostatic agent.

[0203] Embodiment 47: A CDK4 / 6 inhibitor for use according to claim 46, wherein the resistance is mediated by an ABC transporter.

[0204] Embodiment 48: A CDK4 / 6 inhibitor for use according to claim 47, wherein the ABC transporter is selected from the group comprising MRP and MDR, in particular MDR-1.

[0205] Embodiment 49: A CDK4 / 6 inhibitor for use according to any one of embodiments 45 to 48, wherein the resistance is multi-resistance or multi-resistance, in particular multi-resistance or multi-resistance to cytostatics and / or radiation.

[0206] Embodiment 50: A CDK4 / 6 inhibitor for use according to any one of Embodiments 1 to 49, wherein the cells of the tumor are Rb positive.

[0207] Embodiment 51: A CDK4 / 6 inhibitor for use according to any one of Embodiments 1 to 50, wherein the cells of the tumor have YB-1 in the nucleus.

[0208] Embodiment 52: A CDK4 / 6 inhibitor for use according to any one of Embodiments 1 to 51, wherein the cells of the tumor have YB-1 in the nucleus after induction.

[0209] Embodiment 53: The CDK4 / 6 inhibitor for use according to Embodiment 52, wherein the transport of YB-1 into the cell nucleus is triggered by at least one measure selected from the group consisting of radiation, administration of cytostatics, and hyperthermia.

[0210] Embodiment 54: A CDK4 / 6 inhibitor for use according to Embodiment 53, wherein said measure is applied to a cell, an organ or an organism, preferably an organism in need thereof, more preferably an organism suffering from a tumor.

[0211] Embodiment 55: A CDK4 / 6 inhibitor for use according to any one of claims 1 to 54, wherein the tumor is selected from the group comprising bladder cancer, breast cancer, metastatic breast cancer (mBC), melanoma, glioma, pancreatic cancer, hepatocellular carcinoma, lung adenocarcinoma, sarcoma, ovarian cancer, kidney cancer, prostate cancer and leukemia.

[0212] The fifth aspect also solves the problem of the present invention by using a PARP inhibitor to treat and / or prevent a disease in a subject, more preferably a tumor or cancer, wherein the method comprises administering an adenovirus, a CDK4 / 6 inhibitor and a PARP inhibitor to the subject, which is also the first embodiment of the fifth aspect.

[0213] In the following, further embodiments of this fifth aspect are disclosed.

[0214] Embodiment 2: The PARP inhibitor for use according to embodiment 1, wherein the adenovirus is an oncolytic adenovirus.

[0215] Embodiment 3: A PARP inhibitor for use according to any one of embodiments 1 and 2, wherein the adenovirus replicates in a YB-1-dependent manner.

[0216] Embodiment 4: A PARP inhibitor for use according to embodiment 3, wherein the adenovirus is replication-defective in cells lacking YB-1 in the nucleus, but replicates in cells having YB-1 in the nucleus.

[0217] Embodiment 5: A PARP inhibitor for use according to any one of Embodiments 2 to 4, wherein the adenovirus encodes an oncogene protein, wherein the oncogene protein transactivates at least one adenoviral gene, wherein the adenoviral gene is selected from the group consisting of E1B55kDa, E4orf6, E4orf3 and E3ADP.

[0218] Embodiment 6: The PARP inhibitor for use according to Embodiment 5, wherein the oncogene protein is E1A protein.

[0219] Embodiment 7: The PARP inhibitor for use according to embodiment 6, wherein the E1A protein is capable of binding to a functional Rb tumor suppressor gene product.

[0220] Embodiment 8: The PARP inhibitor for use according to embodiment 6, wherein the E1A protein is unable to bind to a functional Rb tumor suppressor gene product.

[0221] Embodiment 9: The PARP inhibitor for use according to any one of embodiments 6 to 8, wherein the E1A protein does not induce the localization of YB-1 into the nucleus.

[0222] Embodiment 10: A PARP inhibitor for use according to any one of embodiments 5 to 9, wherein the oncogene protein exhibits one or several mutations or deletions compared to the wild-type oncogene protein E1A.

[0223] Embodiment 11: The PARP inhibitor for use according to Embodiment 10, wherein the deletion is selected from the group consisting of a deletion of the CR3 fragment, a deletion of the N-terminus, and a deletion of the C-terminus.

[0224] Embodiment 12: The PARP inhibitor according to any one of Embodiments 6 to 11, wherein the E1A protein is capable of binding to Rb.

[0225] Embodiment 13: The PARP inhibitor for use according to any one of Embodiments 6 to 12, wherein the E1A protein comprises one or more mutations or deletions compared to the wild-type oncogene protein, wherein the deletion is preferably a deletion in the CR1 region and / or the CR2 region.

[0226] Embodiment 14: The PARP inhibitor for use according to embodiment 13, wherein the E1A protein is unable to bind to Rb.

[0227] Embodiment 15: The PARP inhibitor for use according to any one of embodiments 1 to 14, wherein the virus is an adenovirus expressing the E1A12S protein.

[0228] Embodiment 16: The PARP inhibitor for use according to any one of embodiments 1 to 15, wherein the virus is an adenovirus lacking expression of the E1A13S protein.

[0229] Embodiment 17: A PARP inhibitor for use according to any one of embodiments 1 to 16, wherein the virus is an adenovirus lacking a functionally active adenoviral E3 region.

[0230] Embodiment 18: A PARP inhibitor for use according to any one of embodiments 1 to 17, wherein the virus is an adenovirus lacking expression of the E1B 19 kDa protein.

[0231] Embodiment 19: A PARP inhibitor for use according to any one of embodiments 1 to 18, wherein the virus is an adenovirus expressing an RGD motif on the tail fiber.

[0232] Embodiment 20: A PARP inhibitor for use according to any one of embodiments 1 to 19, wherein the virus is adenovirus serotype 5.

[0233] Embodiment 21: A PARP inhibitor for use according to any one of Embodiments 1 to 20, wherein the adenovirus is selected from the group comprising: XVir-N-31, dl520, AdΔ24, AdΔ24-RGD, dl922-947, E1Ad / 01 / 07, dl1119 / 1131, CB 016, VCN-01, E1Adl1107, E1Adl1101, ORCA-010, Enadenotucirev and a virus lacking an expressed viral oncogene capable of binding a functional Rb tumor suppressor gene product.

[0234] Embodiment 22: The PARP inhibitor for use according to embodiment 21, wherein the adenovirus is XVir-N-31.

[0235] Embodiment 23: The PARP inhibitor for use according to Embodiment 21, wherein the adenovirus is d1520, wherein the adenovirus E3 region is functionally inactive.

[0236] Embodiment 24: A PARP inhibitor for use according to any one of Embodiments 21 to 23, wherein the adenovirus is d1520, wherein d1520 lacks expression of the E1B 19 kDa protein.

[0237] Embodiment 25: A PARP inhibitor for use according to any one of Embodiments 21 to 24, wherein the adenovirus is d1520 expressing the RGD motif on the tail fiber.

[0238] Embodiment 26: A PARP inhibitor for use according to any one of embodiments 1 to 25, wherein the virus encodes YB-1.

[0239] Embodiment 27: The PARP inhibitor for use according to Embodiment 26, wherein the gene encoding YB-1 is under the control of a tissue-specific promoter, a tumor-specific promoter and / or a YB-1-dependent promoter.

[0240] Embodiment 28: The PARP inhibitor for use according to Embodiment 27, wherein the YB-1 dependent promoter is an adenovirus E2 late promoter.

[0241] Embodiment 29: A PARP inhibitor for use according to any one of embodiments 1 to 28, wherein the CDK4 / 6 inhibitor is a compound that decreases Rb phosphorylation in cells, preferably tumor cells.

[0242] Embodiment 30: A PARP inhibitor for use according to any one of embodiments 1 to 29, wherein the CDK4 / 6 inhibitor is a compound that reduces the expression of Rb in cells, preferably tumor cells.

[0243] Embodiment 31: A PARP inhibitor for use according to any one of Embodiments 1 to 30, wherein the CDK4 / 6 inhibitor is selected from the group comprising: palbociclib, which is also known as PD 0332991; abemaciclib, which is also known as LY-2835219; ribociclib, which is also known as LEE011; Trilaciclib, which is also known as G1T28; and Dinaciclib.

[0244] Embodiment 32: A PARP inhibitor for use according to any one of embodiments 1 to 31, wherein the CDK4 / 6 inhibitor causes G1 arrest in cells and inhibits E2F1.

[0245] Embodiment 33: A PARP inhibitor for use according to any one of Embodiments 1 to 32, wherein the method further comprises administering the PARP inhibitor to the subject.

[0246] Embodiment 34: The PARP inhibitor for use according to Embodiment 33, wherein the PARP inhibitor is selected from the group comprising olaparib, veliparib, rucaparib and BMN673.

[0247] Embodiment 35: A PARP inhibitor for use according to any one of Embodiments 1 to 32, wherein the composition further comprises administering a bromodomain inhibitor to the subject.

[0248] Embodiment 36: The PARP inhibitor for use according to Embodiment 35, wherein the bromodomain inhibitor is selected from the group consisting of JQ1, OTX-015, I-BET151, CPI-0610, I-BET762, CPI203, PFI-1 and MS 436.

[0249] Embodiment 37: A PARP inhibitor for use according to any one of Embodiments 1 to 36, wherein the adenovirus, the CDK4 / 6 inhibitor, the PARP inhibitor and / or the bromodomain inhibitor are administered to the subject separately or in any combination.

[0250] Embodiment 38: A PARP inhibitor for use according to any one of embodiments 1 to 37, wherein the cells of the tumor have a disruption of the CDK4 / 6 signaling pathway.

[0251] Embodiment 39: A PARP inhibitor for use according to any one of Embodiments 1 to 38, wherein the cells of the tumor have an uncontrolled G1-S transition of the cell cycle.

[0252] Embodiment 40: The PARP inhibitor for use according to any one of Embodiments 1 to 38, wherein the cells of the tumor have a loss-of-function mutation or deletion in a gene selected from the group comprising the RB1 gene, the CDKN2A gene and the CDKN2B gene.

[0253] Embodiment 41: A PARP inhibitor for use according to any one of Embodiments 1 to 38, wherein the cells of the tumor have an amplification of the gene and / or an activating mutation in the gene.

[0254] Embodiment 42: The PARP inhibitor for use according to Embodiment 41, wherein the gene is selected from the group consisting of CCND1, E2F1, E2F2, E2F3, CDK4 and CDK6.

[0255] Embodiment 43: The PARP inhibitor for use according to Embodiment 41, wherein the gene is a gene encoding a component of a mitotic signaling pathway.

[0256] Embodiment 44: The PARP inhibitor for use according to Embodiment 43, wherein the mitotic signaling pathway is selected from the group comprising the PI3K pathway and the MAPK pathway.

[0257] Embodiment 45: A PARP inhibitor for use according to any one of embodiments 1 to 44, wherein the cells of the tumor cell are resistant or insensitive to one or several pharmaceutically active agents and / or radiation.

[0258] Embodiment 46: A PARP inhibitor for use according to Embodiment 45, wherein the pharmaceutically active agent is a cytostatic.

[0259] Embodiment 47: A PARP inhibitor for use according to claim 46, wherein the resistance is mediated by an ABC transporter.

[0260] Embodiment 48: A PARP inhibitor for use according to claim 47, wherein the ABC transporter is selected from the group comprising MRP and MDR, in particular MDR-1.

[0261] Embodiment 49: A PARP inhibitor for use according to any one of embodiments 45 to 48, wherein the resistance is multi-resistance or multi-resistance, in particular multi-resistance or multi-resistance to cytostatics and / or radiation.

[0262] Embodiment 50: A PARP inhibitor for use according to any one of Embodiments 1 to 49, wherein the cells of the tumor are Rb positive.

[0263] Embodiment 51: A PARP inhibitor for use according to any one of Embodiments 1 to 50, wherein the cells of the tumor have YB-1 in the nucleus.

[0264] Embodiment 52: A PARP inhibitor for use according to any one of Embodiments 1 to 51, wherein the cells of the tumor have YB-1 in the nucleus after induction.

[0265] Embodiment 53: The PARP inhibitor for use according to Embodiment 52, wherein the transport of YB-1 into the nucleus is triggered by at least one measure selected from the group consisting of radiation, administration of cytostatics, and hyperthermia.

[0266] Embodiment 54: A PARP inhibitor for use according to embodiment 53, wherein said measure is applied to a cell, an organ or an organism, preferably an organism in need thereof, more preferably an organism suffering from a tumor.

[0267] Embodiment 55: A PARP inhibitor for use according to any one of claims 1 to 54, wherein the tumor is selected from the group comprising bladder cancer, breast cancer, metastatic breast cancer (mBC), melanoma, glioma, pancreatic cancer, hepatocellular carcinoma, lung adenocarcinoma, sarcoma, ovarian cancer, kidney cancer, prostate cancer and leukemia.

[0268] The problem of the present invention is solved in the sixth aspect by using a bromodomain inhibitor to treat and / or prevent a disease in a subject, more preferably a tumor or cancer, wherein the method comprises administering an adenovirus, a CDK4 / 6 inhibitor and a bromodomain inhibitor to the subject, which is also the first embodiment of the sixth aspect.

[0269] In the following, further embodiments of this sixth aspect are disclosed.

[0270] Embodiment 2: A bromodomain inhibitor for the use of Embodiment 1, wherein the adenovirus is an oncolytic adenovirus.

[0271] Embodiment 3: A bromodomain inhibitor for use according to any one of embodiments 1 and 2, wherein the adenovirus replicates in a YB-1-dependent manner.

[0272] Embodiment 4: A bromodomain inhibitor for the use of embodiment 3, wherein the adenovirus is replication-defective in cells lacking YB-1 in the nucleus, but replicates in cells having YB-1 in the nucleus.

[0273] Embodiment 5: A bromodomain inhibitor for use according to any one of Embodiments 2 to 4, wherein the adenovirus encodes an oncogene protein, wherein the oncogene protein transactivates at least one adenoviral gene, wherein the adenoviral gene is selected from the group consisting of E1B55kDa, E4orf6, E4orf3 and E3ADP.

[0274] Embodiment 6: The bromodomain inhibitor for the use of Embodiment 5, wherein the oncogene protein is E1A protein.

[0275] Embodiment 7: A bromodomain inhibitor for the use of embodiment 6, wherein the E1A protein is capable of binding to a functional Rb tumor suppressor gene product.

[0276] Embodiment 8: A bromodomain inhibitor for the use of embodiment 6, wherein the E1A protein is unable to bind to a functional Rb tumor suppressor gene product.

[0277] Embodiment 9: The bromodomain inhibitor for use according to any one of Embodiments 6 to 8, wherein the E1A protein does not induce the localization of YB-1 into the nucleus.

[0278] Embodiment 10: A bromodomain inhibitor for use according to any one of embodiments 5 to 9, wherein the oncogene protein exhibits one or several mutations or deletions compared to the wild-type oncogene protein E1A.

[0279] Embodiment 11: The bromodomain inhibitor for the use of Embodiment 10, wherein the deletion is selected from the group consisting of a deletion of the CR3 fragment, a deletion of the N-terminus, and a deletion of the C-terminus.

[0280] Embodiment 12: A bromodomain inhibitor for use according to any one of Embodiments 6 to 11, wherein the E1A protein is capable of binding to Rb.

[0281] Embodiment 13: A bromodomain inhibitor for the use of any one of Embodiments 6 to 12, wherein the E1A protein comprises one or more mutations or deletions compared to the wild-type oncogene protein, wherein the deletion is preferably a deletion in the CR1 region and / or the CR2 region.

[0282] Embodiment 14: The bromodomain inhibitor for the use of embodiment 13, wherein the E1A protein is unable to bind to Rb.

[0283] Embodiment 15: A bromodomain inhibitor for use according to any one of Embodiments 1 to 14, wherein the virus is an adenovirus expressing the E1A12S protein.

[0284] Embodiment 16: A bromodomain inhibitor for use according to any one of Embodiments 1 to 15, wherein the virus is an adenovirus lacking expression of the E1A13S protein.

[0285] Embodiment 17: A bromodomain inhibitor for use according to any one of Embodiments 1 to 16, wherein the virus is an adenovirus lacking a functionally active adenovirus E3 region.

[0286] Embodiment 18: A bromodomain inhibitor for use according to any one of embodiments 1 to 17, wherein the virus is an adenovirus lacking expression of the E1B 19 kDa protein.

[0287] Embodiment 19: A bromodomain inhibitor for use according to any one of embodiments 1 to 18, wherein the virus is an adenovirus expressing an RGD motif on the tail fiber.

[0288] Embodiment 20: A bromodomain inhibitor for use according to any one of Embodiments 1 to 19, wherein the virus is adenovirus serotype 5.

[0289] Embodiment 21: A bromodomain inhibitor for use according to any one of Embodiments 1 to 20, wherein the adenovirus is selected from the group comprising: XVir-N-31, dl520, AdΔ24, AdΔ24-RGD, dl922-947, E1Ad / 01 / 07, dl1119 / 1131, CB 016, VCN-01, E1Adl1107, E1Adl1101, ORCA-010, Enadenotucirev and a virus lacking an expressed viral oncogene capable of binding a functional Rb tumor suppressor gene product.

[0290] Embodiment 22: The bromodomain inhibitor for use according to embodiment 21, wherein the adenovirus is XVir-N-31.

[0291] Embodiment 23: A bromodomain inhibitor for the use of Embodiment 21, wherein the adenovirus is dl520, wherein the adenovirus E3 region is functionally inactive.

[0292] Embodiment 24: A bromodomain inhibitor for use according to any one of Embodiments 21 to 23, wherein the adenovirus is dl520, wherein dl520 lacks expression of the E1B 19 kDa protein.

[0293] Embodiment 25: A bromodomain inhibitor for use according to any one of Embodiments 21 to 24, wherein the adenovirus is dl520 expressing the RGD motif on the tail fiber.

[0294] Embodiment 26: A bromodomain inhibitor for the use of any one of Embodiments 1 to 25, wherein the virus encodes YB-1.

[0295] Embodiment 27: The bromodomain inhibitor for the use of Embodiment 26, wherein the gene encoding YB-1 is under the control of a tissue-specific promoter, a tumor-specific promoter and / or a YB-1-dependent promoter.

[0296] Embodiment 28: The bromodomain inhibitor for the use of Embodiment 27, wherein the YB-1 dependent promoter is an adenovirus E2 late promoter.

[0297] Embodiment 29: A bromodomain inhibitor for the use according to any one of Embodiments 1 to 28, wherein the CDK4 / 6 inhibitor is a compound that reduces Rb phosphorylation in cells, preferably tumor cells.

[0298] Embodiment 30: A bromodomain inhibitor for the use according to any one of Embodiments 1 to 29, wherein the CDK4 / 6 inhibitor is a compound that reduces the expression of Rb in cells, preferably tumor cells.

[0299] Embodiment 31: A bromodomain inhibitor for the use of any one of Embodiments 1 to 30, wherein the CDK4 / 6 inhibitor is selected from the group comprising: palbociclib, which is also known as PD 0332991; abemaciclib, which is also known as LY-2835219; ribociclib, which is also known as LEE011; Trilaciclib, which is also known as G1T28; and Dinaciclib.

[0300] Embodiment 32: A bromodomain inhibitor for the use of any one of Embodiments 1 to 31, wherein the CDK4 / 6 inhibitor causes G1 arrest in cells and inhibits E2F1.

[0301] Embodiment 33: A bromodomain inhibitor for use according to any one of Embodiments 1 to 32, wherein the method further comprises administering a PARP inhibitor to the subject.

[0302] Embodiment 34: The bromodomain inhibitor for the use of Embodiment 33, wherein the PARP inhibitor is selected from the group comprising olaparib, veliparib, rucaparib and BMN673.

[0303] Embodiment 35: A bromodomain inhibitor for use according to any one of Embodiments 1 to 32, wherein the composition further comprises administering the bromodomain inhibitor to the subject.

[0304] Embodiment 36: A bromodomain inhibitor for the use of Embodiment 35, wherein the bromodomain inhibitor is selected from the group consisting of JQ1, OTX-015, I-BET151, CPI-0610, I-BET762, CPI203, PFI-1 and MS 436.

[0305] Embodiment 37: A bromodomain inhibitor for the use of any one of Embodiments 1 to 36, wherein the adenovirus, the CDK4 / 6 inhibitor, the PARP inhibitor and / or the bromodomain inhibitor are administered to the subject separately or in any combination.

[0306] Embodiment 38: A bromodomain inhibitor for the use of any one of Embodiments 1 to 37, wherein the tumor cells have a disruption in the CDK4 / 6 signaling pathway.

[0307] Embodiment 39: A bromodomain inhibitor for the use of any one of Embodiments 1 to 38, wherein the cells of the tumor have an uncontrolled G1-S transition of the cell cycle.

[0308] Embodiment 40: A bromodomain inhibitor for use according to any one of Embodiments 1 to 38, wherein the cells of the tumor have a loss-of-function mutation or deletion in a gene selected from the group consisting of the RB1 gene, the CDKN2A gene and the CDKN2B gene.

[0309] Embodiment 41: A bromodomain inhibitor for the use of any one of Embodiments 1 to 38, wherein the cells of the tumor have amplification of the gene and / or an activating mutation in the gene.

[0310] Embodiment 42: A bromodomain inhibitor for the use of Embodiment 41, wherein the gene is selected from the group consisting of CCND1, E2F1, E2F2, E2F3, CDK4 and CDK6.

[0311] Embodiment 43: The bromodomain inhibitor for the use of Embodiment 41, wherein the gene is a gene encoding a component of a mitotic signaling pathway.

[0312] Embodiment 44: A bromodomain inhibitor for the use of Embodiment 43, wherein the mitotic signaling pathway is selected from the group consisting of a PI3K pathway and a MAPK pathway.

[0313] Embodiment 45: A bromodomain inhibitor for use according to any one of Embodiments 1 to 44, wherein the tumor cell is resistant or insensitive to one or more pharmaceutically active agents and / or radiation.

[0314] Embodiment 46: A bromodomain inhibitor for the use of Embodiment 45, wherein the pharmaceutically active agent is a cytostatic agent.

[0315] Embodiment 47: A bromodomain inhibitor for use according to claim 46, wherein the resistance is mediated by an ABC transporter.

[0316] Embodiment 48: A bromodomain inhibitor for use according to claim 47, wherein the ABC transporter is selected from the group comprising MRP and MDR, in particular MDR-1.

[0317] Embodiment 49: A bromodomain inhibitor for use according to any one of Embodiments 45 to 48, wherein the resistance is multi-resistance or multi-resistance, in particular multi-resistance or multi-resistance to cytostatics and / or radiation.

[0318] Embodiment 50: A bromodomain inhibitor for the use according to any one of Embodiments 1 to 49, wherein the cells of the tumor are Rb positive.

[0319] Embodiment 51: A bromodomain inhibitor for the use of any one of Embodiments 1 to 50, wherein the cells of the tumor have YB-1 in the nucleus.

[0320] Embodiment 52: A bromodomain inhibitor for the use of any one of Embodiments 1 to 51, wherein the cells of the tumor have YB-1 in the nucleus after induction.

[0321] Embodiment 53: A bromodomain inhibitor for the use of Embodiment 52, wherein the transport of YB-1 into the cell nucleus is triggered by at least one measure selected from the group consisting of radiation, administration of cytostatics, and hyperthermia.

[0322] Embodiment 54: A bromodomain inhibitor for the use of Embodiment 53, wherein said measure is applied to a cell, an organ or an organism, preferably an organism in need thereof, more preferably an organism suffering from a tumor.

[0323] Embodiment 55: A bromodomain inhibitor for use according to any one of claims 1 to 54, wherein the tumor is selected from the group comprising bladder cancer, breast cancer, metastatic breast cancer (mBC), melanoma, glioma, pancreatic cancer, hepatocellular carcinoma, lung adenocarcinoma, sarcoma, ovarian cancer, kidney cancer, prostate cancer and leukemia.

[0324] The problem of the present invention is solved in a seventh aspect, which is also a first embodiment of the seventh aspect, by a method for treating and / or preventing a disease, more preferably a tumor or cancer, in a subject, wherein the method comprises administering to the subject an adenovirus and a CDK4 / 6 inhibitor.

[0325] In the following, other embodiments of the seventh aspect are disclosed.

[0326] Embodiment 2: The method of Embodiment 1, wherein the adenovirus is an oncolytic adenovirus.

[0327] Embodiment 3: The method of any one of Embodiments 1 and 2, wherein the adenovirus replicates in a YB-1-dependent manner.

[0328] Embodiment 4: The method of Embodiment 3, wherein the adenovirus is replication-defective in cells lacking YB-1 in the nucleus, but replicates in cells having YB-1 in the nucleus.

[0329] Embodiment 5: The method of any one of Embodiments 2 to 4, wherein the adenovirus encodes an oncogene protein, wherein the oncogene protein transactivates at least one adenoviral gene, wherein the adenoviral gene is selected from the group consisting of E1B55kDa, E4orf6, E4orf3 and E3ADP.

[0330] Embodiment 6: The method of Embodiment 5, wherein the oncogene protein is E1A protein.

[0331] Embodiment 7: The method of embodiment 6, wherein the E1A protein is capable of binding to a functional Rb tumor suppressor gene product.

[0332] Embodiment 8: The method of embodiment 6, wherein the E1A protein is incapable of binding a functional Rb tumor suppressor gene product.

[0333] Embodiment 9: The method of any one of Embodiments 6 to 8, wherein the E1A protein does not induce the localization of YB-1 into the nucleus.

[0334] Embodiment 10: The method according to any one of embodiments 5 to 9, wherein the oncogene protein exhibits one or several mutations or deletions compared to the wild-type oncogene protein E1A.

[0335] Embodiment 11: The method of embodiment 10, wherein the deletion is selected from one of the group consisting of a deletion of the CR3 fragment, a deletion of the N-terminus, and a deletion of the C-terminus.

[0336] Embodiment 12: The method of any one of Embodiments 6 to 11, wherein the E1A protein is capable of binding to Rb.

[0337] Embodiment 13: The method according to any one of embodiments 6 to 12, wherein the E1A protein comprises one or more mutations or deletions compared to the wild-type oncogene protein, wherein the deletion is preferably a deletion in the CR1 region and / or the CR2 region.

[0338] Embodiment 14: The method of Embodiment 13, wherein the E1A protein is unable to bind Rb.

[0339] Embodiment 15: The method of any one of Embodiments 1 to 14, wherein the virus is an adenovirus expressing the E1A12S protein.

[0340] Embodiment 16: The method of any one of Embodiments 1 to 15, wherein the virus is an adenovirus lacking expression of the E1A13S protein.

[0341] Embodiment 17: The method of any one of Embodiments 1 to 16, wherein the virus is an adenovirus lacking a functionally active adenoviral E3 region.

[0342] Embodiment 18: The method of any one of Embodiments 1 to 17, wherein the virus is an adenovirus lacking expression of the E1B 19 kDa protein.

[0343] Embodiment 19: The method of any one of Embodiments 1 to 18, wherein the virus is an adenovirus expressing an RGD motif on the tail fiber.

[0344] Embodiment 20: The method of any one of Embodiments 1 to 19, wherein the virus is adenovirus serotype 5.

[0345] Embodiment 21: The method of any one of Embodiments 1 to 20, wherein the adenovirus is selected from the group comprising: XVir-N-31, dl520, AdΔ24, AdΔ24-RGD, dl922-947, E1Ad / 01 / 07, dl1119 / 1131, CB016, VCN-01, E1Adl1107, E1Adl1101, ORCA-010, Enadenotucirev and a virus lacking an expressed viral oncogene capable of binding a functional Rb tumor suppressor gene product.

[0346] Embodiment 22: The method of Embodiment 21, wherein the adenovirus is XVir-N-31.

[0347] Embodiment 23: The method of Embodiment 21, wherein the adenovirus is d1520, wherein the adenovirus E3 region is functionally inactivated.

[0348] Embodiment 24: The method of any one of Embodiments 21 to 23, wherein the adenovirus is d1520, wherein d1520 lacks expression of the E1B 19 kDa protein.

[0349] Embodiment 25: The method of any one of Embodiments 21 to 24, wherein the adenovirus is d1520 expressing the RGD motif on the tail fiber.

[0350] Embodiment 26: The method of any one of Embodiments 1 to 25, wherein the virus encodes YB-1.

[0351] Embodiment 27: The method of Embodiment 26, wherein the gene encoding YB-1 is under the control of a tissue-specific promoter, a tumor-specific promoter and / or a YB-1-dependent promoter.

[0352] Embodiment 28: The method of Embodiment 27, wherein the YB-1 dependent promoter is an adenovirus E2 late promoter.

[0353] Embodiment 29: The method of any one of Embodiments 1 to 28, wherein the CDK4 / 6 inhibitor is a compound that decreases Rb phosphorylation in cells, preferably tumor cells.

[0354] Embodiment 30: The method of any one of Embodiments 1 to 29, wherein the CDK4 / 6 inhibitor is a compound that reduces Rb expression in cells, preferably tumor cells.

[0355] Embodiment 31: The method of any one of Embodiments 1 to 30, wherein the CDK4 / 6 inhibitor is selected from the group comprising: palbociclib, which is also known as PD 0332991; abemaciclib, which is also known as LY-2835219; ribociclib, which is also known as LEE011; Trilaciclib, which is also known as G1T28; and Dinaciclib.

[0356] Embodiment 32: The method of any one of Embodiments 1 to 31, wherein the CDK4 / 6 inhibitor causes G1 arrest in the cell and inhibits E2F1.

[0357] Embodiment 33: The method of any one of Embodiments 1 to 32, wherein the method further comprises administering to the subject a PARP inhibitor.

[0358] Embodiment 34: The method of Embodiment 33, wherein the PARP inhibitor is selected from the group comprising olaparib, veliparib, rucaparib and BMN673.

[0359] Embodiment 35: The method of any one of Embodiments 1 to 32, wherein the composition further comprises administering a bromodomain inhibitor to the subject.

[0360] Embodiment 36: The method of Embodiment 35, wherein the bromodomain inhibitor is selected from the group consisting of JQ1, OTX-015, I-BET151, CPI-0610, I-BET762, CPI203, PFI-1 and MS 436.

[0361] Embodiment 37: The method of any one of Embodiments 1 to 36, wherein the adenovirus, the CDK4 / 6 inhibitor, the PARP inhibitor and / or the bromodomain inhibitor are administered to the subject separately or in any combination.

[0362] Embodiment 38: The method of any one of Embodiments 1 to 37, wherein the cells of the tumor have a disruption of the CDK4 / 6 signaling pathway.

[0363] Embodiment 39: The method of any one of Embodiments 1 to 38, wherein the cells of the tumor have an uncontrolled G1-S transition of the cell cycle.

[0364] Embodiment 40: The method of any one of Embodiments 1 to 38, wherein the cells of the tumor have a loss-of-function mutation or deletion in a gene selected from the group comprising the RB1 gene, the CDKN2A gene, and the CDKN2B gene.

[0365] Embodiment 41: The method of any one of Embodiments 1 to 38, wherein the cells of the tumor have amplification of a gene and / or an activating mutation in a gene.

[0366] Embodiment 42: The method of Embodiment 41, wherein the gene is selected from the group consisting of CCND1, E2F1, E2F2, E2F3, CDK4 and CDK6.

[0367] Embodiment 43: The method of Embodiment 41, wherein the gene is a gene encoding a component of a mitotic signaling pathway.

[0368] Embodiment 44: The method of Embodiment 43, wherein the mitotic signaling pathway is selected from the group comprising the PI3K pathway and the MAPK pathway.

[0369] Embodiment 45: The method according to any one of Embodiments 1 to 44, wherein the cells of the tumor cells are resistant or insensitive to one or more pharmaceutically active agents and / or radiation.

[0370] Embodiment 46: The method of Embodiment 45, wherein the pharmaceutically active agent is a cytostatic agent.

[0371] Embodiment 47: The method of claim 46, wherein said resistance is mediated by an ABC transporter.

[0372] Embodiment 48: The method of claim 47, wherein the ABC transporter is selected from the group comprising MRP and MDR, in particular MDR-1.

[0373] Embodiment 49: The method according to any one of Embodiments 45 to 48, wherein the resistance is multi-resistance or multi-resistance, in particular multi-resistance or multi-resistance to cytostatics and / or radiation.

[0374] Embodiment 50: The method of any one of Embodiments 1 to 49, wherein the cells of the tumor are Rb positive.

[0375] Embodiment 51: The method of any one of Embodiments 1 to 50, wherein the cells of the tumor have YB-1 in the nucleus.

[0376] Embodiment 52: The method of any one of Embodiments 1 to 51, wherein the cells of the tumor have YB-1 in the nucleus after induction.

[0377] Embodiment 53: The method of Embodiment 52, wherein the transport of YB-1 into the nucleus is triggered by at least one measure selected from the group consisting of radiation, administration of cytostatics, and hyperthermia.

[0378] Embodiment 54: The method of embodiment 53, wherein said measures are applied to a cell, an organ or an organism, preferably an organism in need thereof, more preferably an organism suffering from a tumor.

[0379] Embodiment 55: The method of any one of claims 1 to 54, wherein the tumor is selected from the group comprising bladder cancer, breast cancer, metastatic breast cancer (mBC), melanoma, glioma, pancreatic cancer, hepatocellular carcinoma, lung adenocarcinoma, sarcoma, ovarian cancer, kidney cancer, prostate cancer and leukemia.

[0380] In an eighth aspect, the present invention also relates to the use of a composition in the preparation of a medicament, wherein the composition is a composition disclosed in combination with the first aspect of the present invention, including any embodiment thereof, and the medicament is used to treat and / or prevent a disease specified in combination with the second aspect of the present invention, including any embodiment thereof.

[0381] In the ninth aspect, the present invention also relates to the use of an adenovirus in the preparation of a medicament, wherein the adenovirus is the adenovirus disclosed in combination with the third aspect of the present invention, including any embodiment thereof, and the medicament is used to treat and / or prevent the diseases specified in combination with the third aspect of the present invention, including any embodiment thereof.

[0382] In the tenth aspect, the present invention also relates to the use of a CDK4 / 6 inhibitor in the preparation of a medicament, wherein the CDK4 / 6 inhibitor is a CDK4 / 6 inhibitor disclosed in combination with the fourth aspect of the present invention, including any embodiment thereof, and the medicament is used to treat and / or prevent the disease specified in combination with the fourth aspect of the present invention, including any embodiment thereof.

[0383] In the eleventh aspect, the present invention also relates to the use of a PARP inhibitor in the preparation of a medicament, wherein the PARP inhibitor is the PARP inhibitor disclosed in combination with the fifth aspect of the present invention, including any embodiment thereof, and the medicament is used to treat and / or prevent the diseases specified in combination with the fifth aspect of the present invention, including any embodiment thereof.

[0384] In the twelfth aspect, the present invention also relates to the use of a bromodomain inhibitor in the preparation of a medicament, wherein the bromodomain inhibitor is a bromodomain inhibitor disclosed in combination with the sixth aspect of the present invention, including any embodiment thereof, and the medicament is used to treat and / or prevent the disease specified in combination with the sixth aspect of the present invention, including any embodiment thereof.

[0385] One skilled in the art will recognize that each and any embodiment of one aspect of the present invention is also an embodiment of each and any other aspect of the present invention, including any embodiments thereof.

[0386] Without wishing to be bound by any theory, the inventors surprisingly found that combining an oncolytic virus, preferably an oncolytic adenovirus, with a CDK4 / 6 inhibitor improves the efficacy of tumor treatment based on such an oncolytic adenovirus. More specifically, it is assumed that CDK4 / 6 inhibitors inhibit E2F-1, thereby reducing its effective concentration, preferably reducing its concentration in tumor cells, and synchronizing the G1 arrest of cells. Therefore, more infected cells can complete the entire viral life cycle.

[0387] Based on the evidence and insights provided herein, one skilled in the art will appreciate that any mutant adenovirus is suitable for the practice of the present invention, which allows at least 10%, 20% or 30% wild-type expression and activity of E1B55K and E4orf6 to be achieved by such adenovirus. One skilled in the art will appreciate that such mutant adenoviruses can be generated by modifying E1A. Exemplary mutant adenoviruses are adenovirus XVir-N-31, d1520, AdΔ24, AdΔ24-RGD, d1922-947, E1Ad / 01 / 07, dl1119 / 1131, CB 016, VCN-01, E1Adl1107, E1Adl1101, ORCA-010, Enadenotucirev and viruses lacking expressed viral oncogenes that are capable of binding a functional Rb tumor suppressor gene product.

[0388] Adenovirus is named because Wallace P. Rowe and Robert J. Huebner first isolated the virus in human tonsil and adenoid tissue in 1953 (Rowe et al., 1953). The Adenoviridae family includes five genera, namely mammalian adenovirus genus (Mastadenoviruses), avian adenovirus (Aviadenoviruses), sialidase homologous adenovirus genus (Siadenoviruses), adenine-thymine-rich adenovirus genus (Atadenoviruses) and fish adenovirus genus (Ichtadenoviruses) (Modrow, 2013). Due to their carcinogenicity in newborn rodents, they can be divided into 7 subtypes HAdV-A to HAdV-G (Boulanger and Blair, 1991), with a total of 62 serotypes. Therefore, the research on oncolytic virus therapy mainly focuses on mammalian adenovirus type C serotype 5.

[0389] The uncoated icosahedral capsid, which is 80 to 110 nm in size, includes 252 capsomers, which are composed of 12 pentons (which are assembled by pentons as the basis and spike-like protein structures (called tail fibers)) on the vertices of the capsid and 249 faces called hexons (Modrow, 2013). The entire life cycle of adenovirus can be subdivided into an early stage with cell entry, nuclear transport of the viral genome, transcription and translation of early genes, and a late stage with transcription and translation of late genes. Therefore, late proteins are mainly responsible for the assembly of structural proteins and the maturation of virions (Russell, 2000). In permissive cells, the early stage takes about 6-8 hours, and the subsequent late stage takes about 4-6 hours. At least for adenoviruses HADV-A, -C, -E and -F, attachment occurs through the interaction of spherical structures present at each end of the tail fiber structure with receptors on target cells. Since the receptor was detected to be the same as the receptor that causes the adsorption of Coxsackie B virus, the receptor was called the Coxsackie virus and adenovirus receptor (CAR) (Bergelson, 1997). In addition, the binding on the surface of the target cell is supported by a "bridge molecule", which is a soluble protein in body fluids, such as coagulation factors VII and X, which mediate the binding of the tail fiber protein of certain adenovirus types (Modrow, 2013). After this adsorption step, the RGD-motif (arginine-glycine-aspartic acid) in the penton base interacts with the heterodimeric integrin αvβ3 or αvβ5, which acts as a co-receptor in this process. This interaction leads to the internalization of the virus (Wickham et al., 1993). Subsequently, endocytosis occurs in the cytoplasmic membrane through clathrin-mediated internalization, and then the virus appears in the endosome. After the endocytic vesicle is acidified, the viral tail fiber protein changes its conformation, thereby destroying the endosomal membrane (Greber et al., 1996). The viral particles are now free in the cytoplasm. The viral genome is transferred to the nucleus by binding the remaining particles to the motor proteins of the microtubules (Modrow, 2013).

[0390] The genome of adenovirus consists of double-stranded linear DNA with a length of 36-38 kb. Through the interaction of two terminal protein (TP) molecules covalently linked to the 5' end, a quasi-circular state is formed (Modrow, 2013). Generally, the five coding regions of the adenovirus genome can be subdivided into early genes E1-E4 (mainly active in the early stages of infection) and late genes (L1-L5), the latter of which encode proteins mainly required for the formation of viral particles (Modrow, 2013).

[0391] Adenovirus replication is particularly dependent on the expression of the early viral gene E2, which is strongly induced by the large E1A protein (E1A13S). The first viral gene to be transcribed after infection is the early 1A region (E1A). The major E1A transcript is processed by differential splicing to produce five different messages with sedimentation coefficients of 13S, 12S, 11S, 10S, and 9S. The 13S and 12S mRNAs are most abundant early during infection, while the 9S mRNA is most abundant late. The 11S and 10S mRNAs are minority species that become more abundant later after infection. The 13S, 12S, 11S, 10S, and 9S E1A mRNAs encode 289 residues (R), 243R, 217R, 171R, and 55R proteins, respectively, all of which can be detected in vivo, with only the 9S product being detected in vitro. In general, adenovirus gene expression is highly regulated during infection and has a high degree of complexity. Thus, transcription of the E2 gene is under the control of two promoters, the E2-early and the E2-late promoter, whose products encode the viral DNA polymerase and other proteins necessary for efficient viral replication.

[0392] Due to its two overlapping transcription control regions, the E2-early promoter can be subdivided into a major promoter starting at position +1 and a minor promoter starting at position -26, both of which contain TATA motifs (Swaminathan and Thimmapaya, 1996). These motifs serve as binding sites for TATA box binding protein (TBP). In addition, an activating transcription factor (ATF) binding site between positions -68 and -77 and two E2F / DP-1 binding sites (TTTCGCGC) arranged inversely to each other are located at positions -35 and -63 of the major E2 early promoter (Swaminathan and Thimmapaya, 1996). The activation of the E2 early promoter by E1A depends mainly on the two E2F binding sites located in the major promoter part.

[0393] In the middle stage of infection, about 6 hpi (hours post infection), the expression of the E2 gene is controlled by the E2-late promoter. At nt-33 to -22 of its 157 bp sequence, there is a TATA box that can be bound and activated by cellular TBP (Swaminathan and Thimpaya, 1996). In addition, two SP1 recognition sites and three CCAAT boxes are the characteristics of the E2-late promoter.

[0394] Since it was shown that the cytokine YB-1 is able to bind to the inverted CCAAT box, the interaction between the Y-box binding protein 1 (YB-1) and the E2-late promoter was investigated. Holm et al. showed in 2002 that YB-1 specifically interacts with the Y-box (inverted CCAAT-box) present in the E2-late promoter and has the ability to control the activity of this promoter (Holm et al., 2002). In order to exert its transactivation activity, YB-1 must be transferred to the nucleus by the adenovirus complex E1B-55k / E4-orf6. These early viral genes are expressed after transactivation by E1A-13S (Frisch and Mymryk, 2002).

[0395] The cytokine YB-1, encoded by the YBX1 gene, is a cold shock domain-bearing DNA-binding protein with multiple functions in transcription, splicing, translation control, and DNA damage repair (Kohno et al., 2003). In addition, it plays an important role in drug resistance because it activates the MDR1 and MRP1 genes involved in the development of the multidrug resistance phenotype of cancer cells (Mantwill et al., 2006). YB-1 expression can be induced by exposure to external stressors such as adenoviral infection, chemotherapy, or ultraviolet radiation, followed by nuclear translocation (Mantwill et al., 2006).

[0396] Transcriptional activation of adenovirus early and late genes is essential for the viral life cycle. In short, the viral life cycle is initiated by the activation of E1A transcription, followed by a cascade of activation of E2, E3, and E4 genes. Finally, the major late promoter (MLP) is activated to coordinate the expression of capsid and accessory proteins that are primarily involved in genome encapsidation (Turner et al., 2015). To overcome the obstacles to viral DNA replication present in non-proliferating cells, the virus expresses the early 1A proteins (E1A). These immediate early proteins drive cells into S phase and induce the expression of all other viral early genes. During infection, several E1A isoforms are expressed, among which there are proteins of 289, 243, 217, 171, and 55 residues of human adenovirus type 5. In the case of infection, the main driver of viral gene expression is the large E1A289R protein (Radko et al., 2015).

[0397] Following infection, expression of the adenoviral E1A protein promotes cell cycle progression from G0 / G1 to S phase and promotes viral replication, even in terminally differentiated epithelial cells (the primary target of human adenoviruses). This process is considered essential for the adenoviral life cycle.

[0398] Adenoviruses have been designed to infect, replicate and kill cancer cells while retaining normal cells. After infection and replication in tumor cells, oncolytic viruses kill cells and release virions for subsequent amplification cycles. In order to achieve replication only in tumor cells, two genetic modifications have been performed, resulting in the design of three subclasses of oncolytic adenoviruses (also referred to herein as CRAd), all of which can be used to implement the present invention. In addition, WO2003 / 099859 specifically describes oncolytic adenoviruses suitable for implementing the present invention.

[0399] Type I CRAds are characterized by mutations or deletions in the E1 region of the genome, interfering with the inactivation of cell cycle regulators such as p53 and retinoblastoma protein (Rb). As a result, type I CRAds replicate in actively dividing tumor cells. For example, Onyx-015 (also known as dl1520) is unable to express the E1B-55kDa protein, unable to inactivate p53 and avoid p53-induced cell cycle arrest. Several studies attributed the molecular basis of Onyx-015 selectivity to the loss of expression of p53 or one of the p53 pathway-related genes. However, O'Shea et al. showed that late viral RNA export rather than p53 inactivation determined the selectivity of the Onyx-015 virus. Other type I CRAds with deletions in the E1A region are unable to bind to Rb and trigger S phase entry. For example, dl922-947 and Δ24 contain 24 nucleotide deletions in the CR2 domain of the E1A region, abolishing the E1A-Rb interaction. As a result, these viruses replicate primarily in tumor cells, where free, unbound E2F is available.

[0400] Another way to restrict adenoviral replication to tumor cells is to regulate the transcription of viral genes required for viral replication. In type II CRAd, the genome is under the control of tumor-specific promoters. These promoters are from genes known to be preferentially expressed in certain tumors compared to normal tissues (e.g., telomerase or cyclooxygenase II); or genes that are overexpressed in tumors compared to normal tissues (e.g., prostate-specific antigen, PSA or alpha-fetoprotein, AFP). In type III CRAd, for example, XVir-N-31 (Ad-Delo3-RGD) is characterized by the deletion of the transactivation domain CR3 in the E1A13S protein. XVir-N-31 is a replication-deficient adenovirus in normal cells. XVir-N-31 restores its replication capacity through the cell multifunctional protein YB-1 present in the nucleus. Therefore, CRAd can only replicate in tumor cells and eventually lyse them. Neither p53 mutations, ras nor RB mutations can effectively compensate for the replication defect of XVir-N-31. XVir-N-31 lacks E1A13S and therefore does not express E1B55k and E4orf6 proteins. This defect can be compensated by the presence of YB-1 in the nucleus of tumor cells, which can trigger the expression of E1B55k and E4orf6 independently of E1A13S. Once induced by the presence of YB-1 in the nucleus, E1B55k and E4orf6 further translocate cellular YB-1 into the nucleus, thereby promoting viral replication.

[0401] The cell cycle progresses sequentially through the Gap 1 (G1), Synthesis (S), Gap 2 (G2), and Mitosis (M) phases. This progression is regulated by a complex signaling network. The CDK (cyclin-dependent kinase) proteins CDK1, CDK2, CDK4, and CDK6 are master regulators of cell cycle progression when complexed with specific cyclins. Constitutive expression of CDKs and temporal control of various cyclins allow regulation of specific cell cycle phases by different cyclin-CDK complexes. CDK activity is negatively regulated by several inhibitory proteins. Various aspects of CDK biology and function have been comprehensively reviewed previously.

[0402] CDK4 and CDK6, which share structural and functional homology, regulate the transition of quiescent cells in G1 phase to S phase when complexed with cyclin D proteins. Cyclin D proteins have three isoforms, cyclin D1-3, and accumulate in response to mitotic stimulation. Negative regulators of CDK4 / 6 include the CDK4 (INK4) protein inhibitors p16INK4A, p15INK4B, p18INK4C, and p19INK4D, which can inhibit the activity of CDK4 / 6 by reducing their binding to cyclin D1 or directly occupying its catalytic domain.

[0403] The kinase activity of CDK4 / 6 leads to phosphorylation of members of the retinoblastoma (Rb) protein family (including Rb, p107 and p130), resulting in their functional inactivation. In quiescent cells, active hypophosphorylated Rb binds to members of the E2F transcription factor family and inhibits E2F function (Rubin et al., 2005), which form a complex with DP-1 / 2 and other co-repressors. After phosphorylation, Rb dissociates from the complex and allows transcription of E2F target genes, including cyclin A, cyclin E and DHFR, which are required for the transition of the cell cycle to the S phase. Therefore, inhibition of CDK4 / 6 activity leads to Rb dephosphorylation and inhibition of E2F activity, thereby promoting G0 / G1 arrest. This has promoted the development of CDK4 / 6 inhibitors as targeted therapies for cancer cells.

[0404] Disruption of the CDK4 / 6-Rb signaling pathway and uncontrolled G1-S transition of the cell cycle are common features of cancer cells. This can occur due to various molecular changes, including loss of function mutations or deletion of the RB1 gene (encoding Rb), CDKN2A (encoding p16INK4A and p14ARF), or CDKN2B (encoding p15INK4B). This dysregulation can also be caused by amplification or activating mutations in CCND1 (encoding cyclin D1), E2F1-3, CDK4, CDK6, or components of various mitogenic signaling pathways, such as the PI3K or MAPK pathways.

[0405] Several ATP-competitive small molecule CDK inhibitors have been developed. However, first-generation inhibitors such as flavopiridol are non-selective and can inhibit multiple CDKs, which may result in limited efficacy and high toxicity. The next generation of CDK4 / 6 inhibitors show high selectivity and include palbociclib (PD-0332991 from Pfizer), abemaciclib (LY-2835219 from Eli Lilly), ribociclib (LEE011 from Novartis), and trilaciclib (G1T28). These CDK4 / 6 inhibitors have been preclinically tested in in vitro and in vivo models of multiple cancer entities, including leukemia, breast cancer, melanoma, glioma, pancreatic cancer, hepatocellular carcinoma, lung adenocarcinoma, sarcoma, ovarian cancer, renal cancer, prostate cancer, and metastatic breast cancer (mBC). In most studies, they have shown consistent molecular and functional phenotypes, with a dose-dependent decrease in Rb phosphorylation, protein expression, and transcription of E2F target genes, which correlated with G0 / G1 arrest and inhibition of cell proliferation. Moreover, all these reports indicate that Rb expression is a prerequisite for sensitivity to these inhibitors.

[0406] CDK4 / 6 inhibitors (e.g., PD-0332991) resulted in a dose-dependent decrease in total Rb protein, which was associated with a decrease in phosphorylated Rb. The decrease in total Rb was partially associated with a decrease in RB1 transcript levels and a decrease in the transcription of E2F target genes CCNA2 and CCNE2. Similarly, E2F expression levels were significantly downregulated.

[0407] exist Fig.25 CDK4 / 6 inhibitors suitable for practicing the present invention are disclosed in.

[0408] As is apparent from the Examples, any CDK4 / 6 inhibitor is suitable for use in combination with a virus, preferably an adenovirus, more preferably an oncolytic adenovirus, such that the CDK4 / 6 inhibitor can cause G1 cell arrest and inhibit E2F1, more specifically E2F1 activity.

[0409] One skilled in the art will recognize that any CDK4 / 6 inhibitor is used at a therapeutically effective concentration.

[0410] PARP1 is a protein that is important for repairing single-strand breaks ("gaps" in DNA). In mammals, 17 members of the PARP family have been discovered, of which only 6 synthesize poly ADP-ribose (pADPr). PARP1, PARP2, and PARP3 play a role in DNA repair. PARP1 binds DNA that has suffered single-strand breaks (SSBs) and double-strand breaks (DSBs). PARP1 then undergoes a conformational change that aligns key amino acid residues in the active site, increasing its activity. Once PARP1 is activated, it synthesizes pADPr, which binds to proteins and alters their function. pADPr glycohydrolase rapidly degrades pADPr to ensure that the level of pADPr present reflects the DNA damage and that the response to pADPr is terminated after DNA repair.

[0411] By inhibiting the DNA repair pathway, PARP1 inhibitors lead to an increase in single-strand breaks in DNA. This DNA damage is not repaired and is carried into daughter cells after replication because BER no longer occurs. This leads to an increase in DSBs in tumors with BRCA1 and BRCA2 mutations (Scott et al., 2015, J Clin Oncol., 33(12): 1397-140). The chemical structures of PARP inhibitors, including PARP candidate drugs rucaparib, veliparib, and olaparib, are shown in Figure 1. Fig.26As shown and described in Antolin and Mestres 2014, Oncotarget, 30;5(10):3023-8, all PARP inhibitor structures are characterized including the benzamide portion.

[0412] In addition, it has been determined that YB-1 enhances PARP activity and reduces the efficacy of PARP1 inhibitors (Alemasova et al., 2018, Oncotarget, 34, 23349-65), suggesting that YB-1-dependent oncolytic adenovirus combined with CDK4 / 6 inhibitors and PARP inhibitors can synergistically kill cancer cells. Olaparib and BMN673 (Talazolarib developed by Pfizer, USA, Clin Cancer Res. 2013, 15; 19(18): 5003-15) are examples of PARP inhibitors.

[0413] Those skilled in the art will appreciate that any PARP inhibitor is used at a therapeutically effective concentration.

[0414] exist Fig.25 CDK4 / 6 inhibitors suitable for practicing the present invention are disclosed in.

[0415] Abnormalities in the epigenetic landscape are hallmarks of cancer, and acetylation of lysine residues is a post-translational modification that is widely associated with cell signaling and disease biology. Enzymes that "write" (histone acetyltransferases, HATs) and "erase" (histone deacetylases, HDACs) acetylation sites are areas of extensive research in current drug development. Protein recruitment to macromolecular complexes via acetylated lysine residues is mediated by bromodomains (BRDs), which are evolutionarily highly conserved protein interaction modules that recognize ε-N-lysine acetylation motifs. The conserved BRD fold contains a deep, predominantly hydrophobic acetyl-lysine binding site that represents an attractive pocket for the development of small pharmacologically active molecules. Proteins containing BRDs are associated with the development of a variety of diseases.

[0416] Recently, two highly effective selective inhibitors targeting BET (Bromo domain and extra-terminal) family BRDs have provided convincing data to support the targeting of these BRDs to cancer. The BET (Bromo domain and extra-terminal domain) subfamily of bromo domain proteins composed of BRD2, BRD3, BRD4 and BRDT plays a variety of roles in the regulation and transcription of RNA polymerase II (POLII) and is an exciting new epigenetic drug target. These proteins promote the initiation and extension phases of transcription by binding to activated chromatin at acetylated lysine residues. The recognition of activated chromatin by these so-called epigenetic "readers" promotes the recruitment of RNA polymerase II complexes to active transcription sites. The BRD4 / P-TEFb interaction is important for the rapid transcription restart after mitosis (Muller et al., 2011, Expert Rev. Mol. Medicine, 13, e19). Using an in vitro transcription system derived from Drosophila cells, P-TEFb was identified and purified as a factor required for the generation of long run-off transcripts. It is a cyclin-dependent kinase in Drosophila that contains a catalytic subunit, Cdk9, and a regulatory subunit, cyclin T. In humans, there are multiple forms of P-TEFb that contain Cdk9 and one of several cyclin subunits (cyclin T1, T2, and K). P-TEFb associates with other factors, including the bromodomain protein BRD4, and is found in association with a large protein complex called the super-elongation complex (Yang Z et al., 2005. Mol Cell; 19: 535-45; Fu et al., 1999, J Biol Chem., 274: 34527-30).

[0417] JQ1((Thieno-triazolo-1,4-diazepine )thieno-triazolo-1-4-diazepine) is a potent inhibitor of the BET family of bromodomain proteins, which includes BRD2, BRD3, and BRD4 (Filippakopoulos et al., 2010 Nature 468, 1067-1073). JQ1 prevents the interaction between the bromodomain and the acetyl group, resulting in downregulation of certain genes. Other BET bromodomain inhibitors have been described, including OTOX15, BAY1238097, GSK2820151, I-BET762, and PLX51107 (Perez-Salvia and Esteller 2017, EPIGENETICS, 12, 323-339; Brandt et al., 2015 ACS Chem.Biol., 10, 22-39). JQ-1 is structurally similar to benzodiazepines. The molecular formula is C23H25ClN4O2S.

[0418] Recently, it has been shown that the BET inhibitor JQ1 promotes adenoviral infection and adenoviral vector-mediated gene delivery. Treatment of cells with JQ1 induces increased binding of BRD4 to CDK9, a subunit of P-TEFb for transcriptional elongation. However, as described herein, further studies are needed to elucidate the mechanism by which BED4 regulates adenoviral infection and transgene expression (Baojie Lv et al., 2018, Scientific report, 8, 11554). Importantly, viral replication and viral transcription have not been studied. However, it is known that CDK9 stimulates the release of paused polymerases and activates transcription by increasing the number of transcription polymerases and thereby increasing the amount of mRNA synthesis per unit time (Gressel et al., 2017, eLife, 6, e29736). In addition, it has been shown that CDK4 / 6 inhibitors can overcome BET inhibitor resistance (Jin et al., 2018, Mol Cell; 71(4): 592-605). Recently, it was demonstrated that from late mitosis to early G1 phase of the cell cycle, P-TEFb-Brd4 interaction increased significantly and P-TEFb was actively recruited to chromosomes, followed by the initiation of key gene transcription to promote G1 progression. Importantly, depletion of Brd4 abolished the entire process by reducing the transcription of essential G1 genes, leading to G1 cell cycle arrest and apoptosis (Yang et al., 2008, Mol Cell Biol., 28: 967-976, Kohoutek, 2009, Cell Division, 4.19).

[0419] However, nothing is known about the combination of YB-1-dependent oncolytic adenovirus with CDK 4 / 6 inhibitors and BET inhibitors.

[0420] It will be understood and within the present invention that other bromodomain inhibitors will also be suitable for use in triple therapy using a virus (preferably an adenovirus, more preferably an oncolytic adenovirus such as XVir-N-31) and a CDK4 / 6 inhibitor.

[0421] One skilled in the art will recognize that any bromodomain (Bet) inhibitor is used at a therapeutically effective concentration.

[0422] exist Fig. 27 Bromodomain inhibitors suitable for practicing the present invention are disclosed in the literature.

[0423] Tumors that can be treated in particular by viruses and therefore the combinations of the invention described herein are preferably those selected from the group comprising: tumors of the nervous system, eye tumors, skin tumors, soft tissue tumors, gastrointestinal tumors, respiratory system tumors, bone tumors, endocrine system tumors, female reproductive system tumors, breast tumors, male reproductive system tumors, urinary outflow system tumors, hematopoietic system tumors including mixed and embryonic tumors, and leukemias. Within the scope of the present invention, these tumors are in particular resistant tumors as specifically defined herein.

[0424] The nervous system tumor group preferably includes:

[0425] 1. Skull and brain (intracranial) tumors, preferably astrocytomas, oligodendrogliomas, meningiomas, neuroblastomas, ganglioneuromas, ependymomas, schwannomas, neurofibromas, hemangioblastomas, lipomas, craniopharyngiomas, teratomas and chordomas;

[0426] 2. Spinal cord and spinal canal tumors, preferably glioblastoma, meningioma, neuroblastoma, neurofibroma, osteosarcoma, chondrosarcoma, angiosarcoma, fibrosarcoma and multiple myeloma; and

[0427] 3. Peripheral nerve tumors, preferably neurothecoma, neurofibroma, neurofibrosarcoma and perineural fibroblastoma.

[0428] The ocular tumor group preferably includes:

[0429] 1. Eyelid and eyelid gland tumors, preferably adenoma, adenocarcinoma, papilloma, histiocytoma, mastocytoma, basal cell tumor, melanoma, squamous cell carcinoma, fibroma and fibrosarcoma;

[0430] 2. Tumors of the conjunctiva and nictitating membrane, preferably squamous cell carcinoma, hemangioma, angiosarcoma, adenoma, adenocarcinoma, fibrosarcoma, melanoma and papilloma; and

[0431] 3. Tumors of the orbit, optic nerve and eyeball, preferably retinoblastoma, osteosarcoma, mastocytoma, meningioma, reticular cell tumor, glioma, schwannoma, chondroma, adenocarcinoma, squamous cell carcinoma, plasmacytoma, lymphoma, rhabdomyosarcoma and melanoma.

[0432] Skin tumor group preferably includes:

[0433] Histiocytoma, lipoma, fibrosarcoma, fibroma, mast cell tumor, malignant melanoma, papilloma, basal cell tumor, keratoacanthoma, hemangiopericytoma, hair follicle tumor, sweat gland tumor, sebaceous gland tumor, hemangioma, angiosarcoma, lipoma, liposarcoma, malignant fibrous histiocytoma, plasma cell tumor and lymphangioma.

[0434] The soft tissue tumor group preferably includes:

[0435] Alveolar soft tissue sarcoma, epithelioid cell sarcoma, soft tissue chondrosarcoma, soft tissue osteosarcoma, Ewing's sarcoma of soft tissue, primitive neuroectodermal tumor (PNET), fibrosarcoma, fibroma, leiomyosarcoma, leiomyoma, liposarcoma, malignant fibrous histiocytoma, malignant hemangiopericytoma, malignant hemangioma, hemangioma, angiosarcoma, malignant stromal tumor, malignant peripheral nerve sheath tumor (MPNST), malignant nerve sheath tumor, malignant melanocytic nerve sheath tumor, rhabdomyosarcoma, synovial sarcoma, lymphangioma, and lymphangiosarcoma.

[0436] The gastrointestinal tumor group preferably includes:

[0437] 1. Tumors of the oral cavity and tongue, preferably squamous cell carcinoma, fibrosarcoma, Merkel cell tumor, inducible ameloblastoma, fibroma, fibrosarcoma, viral papillomatosis, idiopathic papillomatosis, nasopharyngeal polyps, leiomyosarcoma, myoblastoma and mastocytoma;

[0438] 2. Salivary gland tumors, preferably adenocarcinoma;

[0439] 3. Esophageal tumors, preferably squamous cell carcinoma, leiomyosarcoma, fibrosarcoma, osteosarcoma, Barrett's carcinoma and paraesophageal tumors;

[0440] 4. Exocrine pancreatic tumors, preferably adenocarcinoma; and

[0441] 5. Gastric tumors, preferably adenocarcinoma, leiomyoma, leiomyosarcoma and fibrosarcoma.

[0442] The respiratory system tumor group preferably includes:

[0443] 1. Tumors of the nose and nasal cavity, larynx and trachea, preferably squamous cell carcinoma, fibrosarcoma, fibroma, lymphosarcoma, lymphoma, hemangioma, angiosarcoma, melanoma, mastocytoma, osteosarcoma, chondrosarcoma, oncocytic adenoma (rhabdoid tumor), adenocarcinoma and myoblastoma; and

[0444] 2. Lung tumors, preferably squamous cell carcinoma, fibrosarcoma, fibroma, lymphosarcoma, lymphoma, hemangioma, angiosarcoma, melanoma, mastocytoma, osteosarcoma, chondrosarcoma, eosinophilic adenoma (rhabdoid tumor), adenocarcinoma, myoblastoma, small cell carcinoma, non-small cell carcinoma, bronchial adenocarcinoma, bronchoalveolar adenocarcinoma and alveolar adenocarcinoma.

[0445] The bone tumor group preferably includes:

[0446] Osteosarcoma, chondrosarcoma, parosteal osteosarcoma, angiosarcoma, synovial cell sarcoma, angiomatous sarcoma, fibrosarcoma, malignant mesenchymal tumor, giant cell tumor, osteoma and multilobar osteoma.

[0447] The endocrine system tumor group preferably includes:

[0448] 1. Thyroid / parathyroid tumors, preferably adenoma and adenocarcinoma;

[0449] 2. Adrenal tumors, preferably adenoma, adenocarcinoma and pheochromocytoma (adrenal medullary tumor);

[0450] 3. Hypothalamic / pituitary tumors, preferably adenomas and adenocarcinomas;

[0451] 4. Endocrine pancreatic tumors, preferably insulinoma (β-cell tumor, APUDom) and Zollinger-Ellison syndrome (gastrin-secreting tumor of pancreatic δ cells); and

[0452] 5. Multiple endocrine neoplasia (MEN) and chemoreceptor tumors.

[0453] Tumor groups of female sexual system tumors preferably include:

[0454] 1. Ovarian tumors, preferably adenoma, adenocarcinoma, cystadenoma and undifferentiated carcinoma;

[0455] 2. Uterine tumors, preferably leiomyoma, leiomyosarcoma, adenoma, adenocarcinoma, fibroma, fibrosarcoma and lipoma;

[0456] 3. Cervical tumors, preferably adenocarcinoma, adenoma, leiomyosarcoma and leiomyoma;

[0457] 4. Vaginal and vulvar tumors, preferably leiomyoma, leiomyosarcoma, fibroleiomyomas, fibromas, fibrosarcomas, polyps and squamous cell carcinomas.

[0458] The breast tumor group preferably includes:

[0459] Fibroadenoma, adenoma, adenocarcinoma, stromal tumor, carcinoma, carcinosarcoma.

[0460] The group of tumors of the male sexual system preferably includes:

[0461] 1. Testicular tumors, preferably seminoma, Leydig cell tumor and Sertoli cell tumor;

[0462] 2. Prostate tumors, preferably adenocarcinoma, undifferentiated carcinoma, squamous cell carcinoma, leiomyosarcoma and transitional cell carcinoma; and

[0463] 3. Penile and external genitalia tumors, preferably mast cell tumors and squamous cell carcinomas.

[0464] The group of tumors of the urinary outflow system preferably includes:

[0465] 1. Kidney tumors, preferably adenocarcinoma, transitional cell carcinoma (epithelial cell tumor), fibrosarcoma, chondrosarcoma (stromal tumor), Wilm's tumor, nephroblastoma and embryonal nephroblastoma (embryo pluripotent blastoma);

[0466] 2. Ureteral tumors, preferably leiomyoma, leiomyosarcoma, fibropapillary tumor, and transitional cell carcinoma;

[0467] 3. Bladder tumors, preferably transitional cell carcinoma, squamous cell carcinoma, adenocarcinoma, botryoid (embryonal rhabdomyosarcoma), fibroma, fibrosarcoma, leiomyoma, leiomyosarcoma, papilloma and angiosarcoma; and

[0468] 4. Urethral tumors, preferably transitional cell carcinoma, squamous cell carcinoma and leiomyosarcoma.

[0469] The group of tumors of the hematopoietic system preferably includes:

[0470] 1. Lymphoma, lymphoid leukemia, non-lymphoid leukemia, myeloproliferative leukemia, Hodgkin's lymphoma, non-Hodgkin's lymphoma.

[0471] Mixed and embryonal tumor groups preferably include:

[0472] Angiosarcoma, thymoma and mesothelioma.

[0473] Preferably, these tumors are selected from breast cancer, ovarian cancer, prostate cancer, osteosarcoma, glioblastoma, melanoma, small cell lung cancer and colorectal cancer. Additional tumors are those resistant tumors as described herein, preferably those multi-resistant tumors, in particular those tumors of the above group.

[0474] Within the present invention, subjects to be administered the combination of the present invention are identified and screened, respectively.Such identification of patients who may benefit from the present invention in its various aspects is based on the detection of YB-1 in the nuclei of the subject's sample.

[0475] In one embodiment, the inspection of tumor tissue is carried out by using a reagent selected from the group comprising the following: an antibody against YB-1, an aptamer for YB-1, a spiegelmer for YB-1, and anticaline for YB-1. Basically, the same means can be produced for the corresponding marker and used accordingly. The preparation of antibodies, particularly monoclonal antibodies, is known to those skilled in the art. Another means for specific detection of YB-1 or the marker is a peptide with high affinity binding to the target structure (in the present case, YB-1 or the marker). In the prior art, it is known that the method of phage display is to produce such peptides. Usually, starting from a peptide library, the length of each peptide is 8 to 20 amino acids, and the size of the library is about 102 to 1018, preferably 108 to 1015 different peptides. A special form of target molecule binding polypeptide is so-called anticalines, which is described in German patent application DE 197 42 706, for example.

[0476] Another means for specifically binding to YB-1 or the corresponding marker disclosed herein and therefore for detecting the cell cycle-independent localization of YB-1 in the nucleus is a so-called aptamer, i.e., a D-nucleic acid, which exists in the form of RNA or DNA, single-stranded or double-stranded, and can specifically bind to a target molecule. The production of aptamers is described, for example, in European Patent EP 0 533 838. A special form of aptamer is a so-called aptazyme, which is described, for example, by Piganeau, N. et al. (2000), Angew.Chem.Int.Ed., 39, no.29, pp. 4369-4373. These are special embodiments of aptamers because they also include a ribozyme portion in addition to the aptamer portion, and have catalytic activity and cleave nucleic acid substrates when binding or releasing a target molecule bound to the aptamer portion, which is accompanied by the generation of a signal.

[0477] Another form of aptamers are so-called spiegelmers, ie target-binding nucleic acids made of L-nucleic acids. Methods for preparing such spiegelmers are described, for example, in WO 98 / 08856.

[0478] Samples of tumor tissue can be obtained by puncture or surgery. Often by using microscopic techniques and / or immunohistochemical analysis, preferably using antibodies or any other aforementioned means, to assess whether YB-1 is located in the nucleus independently of the cell cycle. Other means for detecting YB-1 in the nucleus, particularly for detecting that YB-1 is located in the nucleus independently of the cell cycle, are known to those skilled in the art. For example, when screening stained tissue sections, the location of YB-1 therein can be easily detected. The frequency of occurrence of YB-1 in the nucleus has shown that the location is independent of the cell cycle. Another option for independent detection of the cell cycle of YB-1 in the nucleus is to dye YB-1, and detect whether YB-1 is located in the nucleus and determine the stage of the cell. The detection of YB-1 can also be performed by using the above-mentioned means for YB-1. The detection of means is completed by methods known to those skilled in the art. By the specific binding of the reagent to YB-1 without binding to any other structure in the sample to be analyzed (particularly cells), their location can be detected, and due to their specific binding to YB-1, the location of YB-1 can also be detected and determined by appropriate means marking. Methods for labeling such means are known to those skilled in the art.

[0479] In the following, the invention will be further explained with reference to the drawings and examples, from which new features, embodiments and advantages can be derived.

[0480] Figure 1 a is a bar graph showing the relative absorbance as an indicator of cell viability of XVir-N-31 (XVir), wild-type adenovirus (WT), and control (Ctrl) when used in combination with CDK4 / 6 inhibitors LY (LY-2835219), PD (PD-032991), or LEE (LEE011).

[0481] Figure 1 b is a bar graph showing the viral titers of XVir-N-31 (XVir) and wild-type adenovirus (WT) when used in combination with CDK4 / 6 inhibitors LY (LY-2835219), PD (PD-032991), or LEE (LEE011).

[0482] Figure 1 c is a bar graph showing the relative fiber DNA of XVir-N-31 (XVir) and wild-type adenovirus (WT) when used in combination with the CDK4 / 6 inhibitors LY (LY-2835219), PD (PD-032991), or LEE (LEE011).

[0483] Figure 2 The results of Western blot analysis are depicted.

[0484] Figure 3 ad is a bar graph.

[0485] Figure 4 ad is a bar graph.

[0486] Figure 5 It is a bar chart.

[0487] Figure 6 It is a series of micrographs.

[0488] Figure 7 are fluorescent microscopic images of T24 cells infected with E1-deleted adenovirus expressing GFP with and without palbociclib treatment.

[0489] Figure 8 is a bar graph showing viral DNA replication of adenovirus dl703 after 48 hours of treatment with compounds Nutlin 3a, Lee, Cl1040 and Roscovertine.

[0490] Fig. 9A -C shows the expression of Nutlin-3a and LEE011 (ribociclib) at the indicated concentrations ( Fig. 9A ), roscovitine( Fig. 9B ) and CI-1040( Fig. 9C ) treated with UMUC cells; Rb indicates retinoblastoma protein; phRB refers to phosphorylated retinoblastoma protein; E2F-1 refers to transcription factor E2F-1; GAPDH was used as a loading control.

[0491] Fig.10 is a bar graph showing cell cycle distribution in UMUC3 cells measured 48 hours after treatment with the following concentrations of CDK4 / 6 inhibitors: Roscovetine: 10 μM, CI-1040: 1 μM, Nutlin-3a: 10 μM, and LEE011: 10 μM.

[0492] Fig.11 are microscopic images showing adenoviral hexon gene expression with and without palbociclib treatment.

[0493] Fig.12 is a bar graph showing the results of potency assays of T24 cells exposed to XVir-N-31 alone, containing 15 nM PARP inhibitor PARPi, 500 nM PD (palbociclib), or a combination of 15 nM PARPi and 500 nM PD, expressed as percentage of cell survival, where cells were uninfected (left column), infected at 10 MOI (middle column) or 50 MOI (right column).

[0494] Fig.13 is a set of images showing SRB-stained T24 cell cultures treated with XVir-N-31 (20 MOI), XVir-N-31 and 15 nM PARPi, XVir-N-31 and 500 nM PD, XVir-N-31, 15 nM PARPi and 500 nM PD at 1 dpi, 2 dpi, 3 dpi, 4 dpi, 5 dpi and 6 dpi.

[0495] Fig.14 is a set of images showing SRB-stained UMUC cell cultures treated with XVir-N-31 (10 MOI), XVir-N-31 and 160 nM PARPi, XVir-N-31 and 400 nM PD, XVir-N-31, 160 nM PARPi and 400 nM PD at 1 dpi, 2 dpi, 3 dpi, 4 dpi, 5 dpi and 6 dpi.

[0496] Fig.15 is a bar graph showing the results of potency assays in T24 cells 5 days after infection with XVir-N-31, the CDK 4 / 6 inhibitor palbociclib and the bromodomain inhibitor JQ-1. Y axis: cell viability in %.

[0497] Fig.16 is a bar graph showing the results of potency assays in SK-N-MC cells, expressed as percentage of cell survival, after exposure to XVir-N-31 alone, a combination containing 200 nM abemaciclib, 500 nM JQ1, or 200 nM abemaciclib and 500 nM JQ1, where cells were uninfected, infected at an MOI of 5, 10, or 20.

[0498] Fig.17 Shown are the results of Western blot analysis of SK-N-MC cells treated with the indicated concentrations of the CDK 4 / 6 inhibitor LY-2835219 (Abemaciclib) and the Wee inhibitor MK-1775 (Adavosertib) for 24 and 48 hours; Rb refers to retinoblastoma protein; phRB refers to phosphorylated retinoblastoma protein; E2F-1 refers to transcription factor E2F-1; GAPDH serves as a loading control.

[0499] Fig.18 Shown are the results of potency assays on SK-N-MC cells 5 days after infection with XVir-N-31, the CDK 4 / 6 inhibitor Abemaciclib and Adavosertib (Wee inhibitor MK-1775), expressed as the percentage of surviving cells.

[0500] Fig.19 Shown are the cell cycle distributions of SK-N-MC cells after treatment with the indicated inhibitors.

[0501] Fig. 20 is a bar graph showing the effect of siRNA against E2F1 on E2F1 expression in various cell lines. Y axis: E2F1 expression normalized to actin, expressed as % of siCTRL transfected cells.

[0502] Fig.21 is a bar graph showing that E2F1 inhibition results in increased E2 early expression in T24 cells treated with siRNA-E2F-1. Y axis: adenoviral gene expression normalized to actin (expressed as % of siCTRL).

[0503] Fig. 22 is a schematic diagram showing the locations of primers used to determine adenovirus E2-early expression.

[0504] Fig.23 Nucleotide sequence representation of the wild-type E2 early promoter adenovirus (top) and a mutant E2 early promoter having a mutation in the E2F binding site (bottom).

[0505] Fig.24 is a bar graph showing RNA expression in T24 cells infected with AdWT-RGD and AdE2Fm (also containing the RGD motif in the tail fibers) obtained by RT-qPCR 24 hours after infection; AD-WT gene expression was set to 100%.

[0506] Fig.25 Various CDK4 / 6 inhibitors suitable for use in the present invention are shown.

[0507] Fig.26 Various PARP inhibitors suitable for use in the present invention are shown.

[0508] Fig. 27 Various Bet inhibitors suitable for use in the present invention are shown.

[0509] Fig.28 Shown are the structures of WT-Ad5 and adenovirus d1520, which is an oncolytic adenovirus expressing only the E1A12 protein by deleting the CR3 domain of the E1A gene.

[0510] Fig.29 The structure of XVir-N-31 is shown, which is characterized by the deletion of the E1B19K protein, the deletion of 2 kb in the E3 region, the deletion of the E1A13S protein, and the introduction of the RGD motif into the tail fiber protein.

[0511] Fig.30The structures of Ad-Δ24 and Ad-Δ24-RGD are shown, which are also described by Kleijn et al. (Kleijn et al., PLoS One. 2014;9(5):e97495), characterized by a deletion of the CR2 domain of the E1A gene; it replicates only in tumor cells with a dysregulated retinoblastoma pathway (Rb). As shown for XVir-N-31, Ad-Δ24-RGD also contains an RGD motif in the tail bulb. Note that the oncolytic adenovirus dl922-947 is similar to Δ24, as the deletion of this virus is also located in the E1A-CR2 domain and affects RB binding (retinoblastoma protein).

[0512] Fig.31 The structure of VCN-01 is shown, which is a replication-competent adenovirus that is specifically engineered to replicate in RB pathway-deficient tumors, exhibits enhanced infectivity through modified tail fibers, and exhibits improved distribution by expressing soluble hyaluronidase (Pascual-Pasto et al., Sci Transl Med. 2019, 11 476). The deletion in E1A in VCN-01 is similar to the deletion in Δ24 (deletion of the CR2 domain in E1A). In addition, the expression of the E1A protein is regulated by introducing an E2F binding site in the E1A promoter. In addition, it contains an RGD motif in the tail fiber ball and expresses a soluble hyaluronidase (Martínez-Vélez et al., 2016, Clin Cancer Res. 1; 22 (9): 2217-25. The Oncolytic Adenovirus VCN-01as Therapeutic Approach Against Pediatric Osteosarcoma).

[0513] Fig.32 The structures of E1Adl1107 and E1Adl1101 are shown, in which the deletion of these two oncolytic adenoviruses affects the binding to p300 (histone acetyltransferase p300, also known as p300 HAT or E1A-associated protein p300) or pRb (retinoblastoma protein) (Howe et al., MOLECULAR THERAPY 2000, 2, 485-495)

[0514] Fig.33The structure of the oncolytic adenovirus CB016 (and one of the wild-type adenovirus 5 (WT-Ad5)) is shown, in which the deletion in the E1A-CR2 domain is similar to that in Ad-Δ24. In addition, CB016 contains a deletion in the CR1 domain. In addition, it contains an RGD motif in the tail fiber or in the tail fiber from serotype 3 (LaRocca et al., Oral Oncol. 2016, 56, 25-31).

[0515] Fig.34 The structure of adenovirus ORCA-010 is shown, which contains the E1AΔ24 deletion in the E1A CR2 domain, the potency-enhancing T1 mutation in the E3 / 19K protein, and the infectivity-enhancing RGD modification of the tail fiber (Dong et al., Hum Gene Ther. 2014 Oct 1; 25(10):897-904).

[0516] Example 1 :Materials and methods

[0517] Cell culture

[0518] Human bladder cancer cell lines were cultured at subconfluent conditions in RPMI or DMEM medium (Biochrom AG) supplemented with 10% FBS (Biochrom AG) and 1% NEA (Biochrom AG) at 5% or 10% CO2. Depending on the cell line and experimental conditions, 0.2-1x10 cells were seeded in 10 cm, 6-well, 12-well, and 96-well formats. 6 , 0.5-1x10 5 , 0.25-0.5x10 5 and 500-700 cells.

[0519] Cell lines

[0520] HeLaP

[0521] HeLa P cells (ATCC CCL-2) are epithelial cells from cervical adenocarcinoma named after the patient Henrietta Lacks. This cell line is the most widespread and oldest cell line (Rahbari et al., 2009) as it was the first permanent cell line established in 1951 (Gey et al., 1952). Culture was performed in DMEM (10% FBS, 1% PS) at 37°C with 10% CO2.

[0522] HeLaRDB

[0523] HeLaRDB is a subcell line of the HeLaP cell line, which is resistant to daunorubicin based on the overexpression of glycoprotein P. The resistance is obtained by culturing with a culture medium containing the anthracycline. This cell inhibitor is inserted into the double-stranded DNA sequence and inhibits the transcription and replication of the cell (Mizuno et al., 1975). As a result of the stress response caused by daunorubicin treatment, the cytokine YB-1 shows a higher nuclear localization compared to the parental cell line (Holm et al., 2004). In order to maintain resistance to daunorubicin, cells were cultured in DMEM (10% FBS, 1% PS) containing 0.25 μg / ml daunorubicin at 10% CO2 conditions at 37°C every 14 days.

[0524] A549

[0525] A549 cells (ATCC CCL-185) were isolated from human alveolar basement adenocarcinoma in 1972 (Giard et al., 1973). They were cultured in Dulbecco's MEM (10% FBS and 1% PS) at 37°C and 10% CO2.

[0526] T24

[0527] T24 cells (ATCC HTB-4) were derived from a primary human bladder cancer in 1970 (Bubenik, Baresovà et al., 1973). Due to a point mutation in the HRAS gene (Reddy et al., 1982), the MAPK and PI3K pathways are activated. In addition, another mutation in the locus of the tumor suppressor gene p53 is present in this cell line (Pinto-Leite et al., 2014). The cells were cultured in RPMI containing 10% FCS, 1% PS and 1% non-essential amino acids at 37°C with 5% CO2.

[0528] HEK293

[0529] HEK293 cells (ATCC CRL-1573) are human embryonic kidney cells isolated in 1973. This cell line is used for the production of E1-defective adenovirus and for the measurement of viral titers due to the stable transfection of a 4.5 kb portion of the genome of adenovirus serotype 5, which includes the entire E1 region (Graham and Smiley, 1977).

[0530] Table 1: Primers

[0531]

[0532]

[0533] Virus characteristics

[0534] Ad-WT+AdWT-RGD Wild-type mammalian adenovirus, type C, serotype 5 and AdWT with an additional RGD-tail motif

[0535] AdWT-E2Fmut. Mammalian adenovirus, type C, serotype 5, with mutations in both E2F binding sites of the E2-early promoter, an additional RGD-tail fiber motif, and a 2.7 kb deletion in the E3 region (ΔE3)

[0536] XVir-N-31 mammalian adenovirus, type C, serotype 5, with deletions in the E1B region (1.716-1915, 200 bp), the E3 region (28.132-30.813), and a 12-base deletion in the E1A region. In cancer cells, the replica showed only nuclear YB-1 expression.

[0537] XVir-N-31 / E2FM mammalian adenovirus, type C, serotype 5, with deletions in the E1B region (1.716-1915, 200 bp), in the E3 region (28.132-30.813), and a 12-base deletion in the E1A region. In cancer cells, the replica showed only nuclear YB-1 expression. There are mutations in both E2F binding sites of the E2 early promoter, with an additional RGD tail fiber motif, and a 2.7 kb deletion in the E3 region (ΔE3)

[0538]

[0539] method

[0540] siRNA transfection

[0541] Downregulation of certain genes was performed using siRNA transfection. Thus, 5 μl of Lipofectamin RNAiMAX (Thermo Fischer) reagent was added to 150 μl of Opti-MEM in one tube, and 36 pmol of siRNA was combined with 150 μl of Opti-MEM in another tube. After combining the contents of the two tubes and briefly vortexing, the solution was incubated at room temperature for 5 minutes. Then 250 μl of siRNA-lipid complexes were added to 250,000-1,000,000 cells that were seeded into 6-well plates the day before without changing the medium, and the final concentration of siRNA reached 30 pmol / well. After incubation for 48 hours at 37°C under 10% CO2, infection or lysis occurred.

[0542] RNA Quantification of Combination siRNA

[0543] RNA was also quantified in cells where virus was combined with siRNA transfection. Therefore, 125,000 cells were seeded the next day and transfected with 30 pmol of siRNA constructs of Ctrl-, YB-1- and E2F1-siRNA. After 48 h of incubation, infection occurred and lysis occurred 24 h after infection. Lysates were stored at -20 °C.

[0544] RNA Isolation

[0545] The cells were rinsed with PBS, lysed with lysis buffer (mirVana miRNA isolation kit, Life Technologies), and transferred to a 1.5 ml reaction tube. 50 μl of homogenate additive (mirVana miRNA isolation kit, Life Technologies) was added to the lysate, resuspended and incubated on ice for 10 minutes. 500 μl of acid-phenol-chloroform was added, vortexed for about 30 seconds, and incubated on ice for 2 minutes. After centrifugation at 14,000g for 5 minutes at room temperature, the aqueous phase and the organic phase were separated. The upper aqueous phase was transferred to a new snap cap tube (snap cap), combined with an equal amount of isopropanol and inverted. After incubation at room temperature for 10 minutes, the sample was centrifuged at 4 ° C and 14,000g for 30 minutes. The supernatant was then removed and the RNA precipitate was washed with 1 ml 75% ethanol. The sample was briefly centrifuged at 7500g for 5 minutes at 4 ° C. After removing the supernatant, the air-dried precipitate was dissolved in 20 μl of nuclease-free water and incubated in a thermomixer at 55°C and 500 rpm for 10 minutes. Subsequently, the RNA concentration was measured by spectrophotometry. In order to avoid the amplification of DNA tracks, DNAse digestion was performed. Therefore, deoxyribonuclease I, Invitrogen amplification grade kit of Life Technologies, was used. 1 μl 10x DNAse I reaction buffer and 1 μl DNAse I were added to 1 μg RNA, and filled to a final volume of 10 μl with DEPC-treated water, and incubated accurately at room temperature for 15 minutes. DNase I was inactivated by adding 1 μl 25mM EDTA solution, thereby terminating the DNAse digestion process. The sample was incubated at 65°C for 10 minutes and then used for reverse transcription.

[0546] Reverse transcription

[0547] To rewrite RNA into cDNA, a High capacity cDNA Reverse Transcription Kit (Thermo Scientific) was used. 2 μg RNA of the DNA-digested samples were added to a Mastermix in a PCR hose containing transcription buffer, 100 mM dNTPs and RNAse inhibitors. Therefore, it must be taken into account that RNA transcribed by the E2-early and E2-late promoters cannot be rewritten by random primers commonly used for reverse transcription, because these random primers bind to both strands of the double-stranded adenoviral genome. Therefore, samples for E2 early and E2 late quantification were rewritten from RNA to cDNA using specific E2 early reverse primers (Table 1). For the housekeeping gene actin used to normalize the results, random primers were used.

[0548] DNA replication analysis

[0549] To study viral replication in infected cells, DNA replication analysis was performed. 125,000 cells were seeded in 6-well plates and infected with 10-20 MOI. Lysis occurred 2, 8, 12, 24, 36, and 48 hours after infection, respectively. Thus, the culture medium was removed and the adherent cells were washed with 1 ml PBS. After adding 200 μl DNA lysis buffer, the adherent cells were separated from the plate using a cell scraper. The lysate was then transferred to a snap-top tube. 3 μl of proteinase K was added and incubated overnight on a thermomixer at 56 ° C and 550 rpm. On the second day, DNA isolation was performed.

[0550] DNA Isolation

[0551] To purify the DNA, 200 μl of phenol-chloroform-isoamyl alcohol was added to the lysate. After vortexing and subsequent incubation on ice for 5 minutes, phase separation was achieved by centrifugation at 16430 g for 3 minutes at 4 ° C. The upper aqueous phase was transferred to a new snap-top tube containing 200 μl chloroform and 20 μl cresol red dissolved in 10 mM TrisCl to better show the phases. After vortexing and incubation on ice for 5 minutes, centrifugation was performed at 16430 g for 3 minutes at 4 ° C. The upper aqueous phase was combined again with 800 μl ethanol and 50 μl 3M sodium acetate solution. 2 μl glycogen was added to achieve better precipitation. After the tube was briefly inverted, the solution was centrifuged at 16430 g for 30 minutes at 4 ° C. Subsequently, the DNA precipitate was covered with 400 μl 70% ethanol and incubated at room temperature for 10 minutes. After centrifugation at 4760g for 7 minutes at room temperature, the DNA precipitate was dried at 37°C for about 5-10 minutes. Subsequently, the precipitate was dissolved in 100 μl of 0.1xTE buffer and shaken at 400 rpm for about 3 hours at 40°C. When the DNA was completely dissolved, the DNA concentration was measured by a spectrophotometer using 2 μl of DNA solution and 0.1xTE-buffer as a blank solution. The DNA was then stored at 4°C.

[0552] qPCR

[0553] For further quantification, real-time quantitative PCR was used. 5 μl template DNA and cDNA were used at a final concentration of 10 ng / μl, respectively. qPCR was performed using 10 μl Mastermix GoTaq qPCR (Promega Corporation) (7.5 μl Mastermix, 1.5 μl primers, 1 μl H2O) and 5 μl DNA templates pipetted in duplicate in a 96-well plate. Relative quantification was performed using a comparative CT method with two standardized genes. The plate was sealed with foil and centrifuged at 220 g for 2 minutes at room temperature. The plate was then incubated in a thermal cycler according to a certain temperature-time program. Table 1 lists the primers used. The reaction was performed on a CFX96 real-time PCR detection system (Bio-Rad Laboratories).

[0554] qPCR cycling conditions

[0555] Tail: 94°C for 2 min, 94°C for 15 sec, 60°C for 15 sec and 72°C for 15 sec, 45 cycles

[0556] Other viral genes: 94°C for 1.5 min, 94°C for 15 sec, 58°C for 15 sec and 72°C for 15 sec, 45 cycles

[0557] Rb: 94 °C for 2 min, 94 °C for 15 sec, 60 °C for 30 sec and 72 °C for 1 min, 44 cycles in total

[0558] E2F: 95°C for 2 min, 95°C for 15 sec, 60°C for 30 sec and 72°C for 30 sec, 40 cycles

[0559] Protein separation

[0560] Cells were lysed using 1% SDS buffer to destroy the nuclear membrane. In order to avoid protein denaturation, the whole process was carried out on ice. After aspirating the culture medium, the cells were washed twice with cold PBS. The adherent cells of one well of the duplicate approach were lysed with 200 μl of 1% SDS buffer and scraped with a cell scraper. The lysate was then transferred to another well of the duplicate approach and scraped again. The lysate of the two merged wells was then transferred to a snap cap tube. The lysate was subsequently treated with a syringe to destroy sticky DNA and centrifuged at 31000 rpm for 30 minutes at 4 ° C. Due to the presence of protein in the supernatant, the supernatant was transferred to a new snap cap tube and used for further steps.

[0561] Protein quantification

[0562] In order to quantify the amount of protein, bicinchoninic acid (BCA) analysis was performed by Pierce TM BCA protein kit. Thus, 112.5 μl of BCA solution A+B (50:1) and 12.5 μl of sample were added to one well of a 96-well plate and incubated at 37°C for 30 minutes. Depending on the protein concentration, the solution was stained. The protein concentration of the sample was determined by photometric measurement at 562 nm by a microplate reader using a standard series with known protein concentrations.

[0563] SDS gel electrophoresis

[0564] To separate proteins in subsequent sodium dodecyl sulfate polyacrylamide gel electrophoresis, the calculated amount of lysate and lysis buffer was mixed with 15 μl of loading buffer-DDT-Mixture (6:1). The protein load was then boiled at 100°C for 5 minutes. 5 μl of colored protein standard and 40 μl of sample were then loaded onto the gel. For protein separation for viral protein detection, a 10% gel was used. To study genes downregulated by siRNA, a 12% gel was used. The composition of the separation gel and the concentration gel is listed in the "Buffers and Solutions" section. The gel was run at 90V for about 20 minutes in TGS-buffer to concentrate all proteins in one band. Subsequently, the gel was run at 150V for about 60 minutes in TGS-Buffer to separate proteins by size.

[0565] Western blotting

[0566] To transfer the proteins from the gel to the membrane, they were blotted using the Western blotting technique. To activate the hydrophobic PVDF membrane, it was incubated in methanol for about 2 minutes. Subsequently, the membrane was deposited in blotting buffer together with the sponge, filter paper and gel. The proteins were transferred to the membrane in blotting buffer by electrophoresis at 4°C at 100V for about two hours. To avoid nonspecific antibody binding, the membrane was blocked and rotated for one hour at room temperature in 10ml of 5% milk powder dissolved in TBST to analyze cellular proteins in 5ml of 5% BSA-TBST, respectively, and then used to detect antibodies for viral proteins. The membrane was washed five times in TBST for five minutes each time, and the membrane was incubated with the primary antibody solution at 4°C with rotation overnight. For the antibodies GAPDH, E1A, E1B55K, E2A and E4orf6, this step was performed for 1 hour at room temperature. The antibodies were therefore diluted in different multiples in 5% BSA dissolved in TBST containing 0.02% sodium azide. After five more washing steps, the membrane was incubated in secondary antibodies diluted 1:10,000 for 30 minutes at room temperature with rotation. Secondary antibodies for viral antibodies (anti-mouse) were diluted in 5% BSA-TBST, and all other antibodies were diluted in 5% milk powder dissolved in TBST. These secondary antibodies were conjugated to horseradish peroxidase. After the five final washing steps, the membrane was incubated in enhanced chemiluminescence (ECL) solution for 5 minutes to develop the signal of the peroxidase. For membranes incubated with primary antibodies DP-1 and E2F-1, Amersham ECL Prime Western Blot Detection Reagent from GE-Healthcare was used to obtain brighter signals, and for all other membranes, laboratory-produced ECL solutions were used. The "Buffers and Solutions" section lists the composition of ECL A and ECL B, which were mixed together shortly before use at a 1:1 ratio. Finally, the proteins can be detected by developing the signals on the membrane.

[0567] Antibody:

[0568] Checkpoint kinase 1 (sc-377231, Santa Cruz Biotechnology)

[0569] Total RB (554136, BD Biosciences)

[0570] phospho RB Ser 780 (8180, Cell Signaling Technology)

[0571] E2F1(sc-251,Santa Cruz Biotechnology)

[0572] E2F2 (ab138515, abcam)

[0573] E2F3(PG37,Thermo FisherScientific)

[0574] E2F4(WUF10,Thermo Fisher Scientific)

[0575] E2F5(sc-999,Santa Cruz Biotechnology)

[0576] Cyclin D1 (92G2, Cell Signaling Technology)

[0577] Cyclin E2 (4132, Cell Signaling Technology)

[0578] CDK2(78B2,Cell Signaling Technology)

[0579] GAPDH(14C10,Cell Signaling Technology)

[0580] Actin (A2066, Sigma-Aldrich Chemie GmbH)

[0581] E1A(sc-25,Santa Cruz Biotechnology)

[0582] E1B55k (provided by M.Dobbelstein)

[0583] E4orf6 (provided by M. Dobbelstein

[0584] E2A (DBP, provided by M. Dobbelstein)

[0585] Hexon (ABIN2686029, Antibodies online)

[0586] Small molecule inhibitor treatment

[0587] PD-0332991 isethionate (Palbociclib, Sigma-Aldrich Chemie GmbH) and LY-2835219 (Abemaciclib, Selleck Chemicals) were dissolved in sterile water as 10 mM stock solutions. LEE011 (Ribociclib, MedChem Express) and Nutlin-3a (Sigma) were dissolved in DMSO as 10 mM and 5 μM stock solutions, respectively. Freshly prepared working concentrations were used immediately.

[0588] Viral infections and combination therapy

[0589] To determine virus-induced cell killing, cells were seeded in 12-well plates. For combination treatments with PD-033299, LY-2835219, and LEE011, cells were pretreated with inhibitors for 24 hours. Cells were infected with the indicated viruses at the indicated MOI in 200-400 μl of medium without FBS. At 1 hpi, complete medium with or without small molecule inhibitors was added to the cells.

[0590] Cell viability (SRB assay)

[0591] Cells were fixed with 10% TCA for 1 hour at 4°C and stained with 0.5% sulforhodamine B (SRB, Sigma-Aldrich Chemie GmbH) in 1% acetic acid for 30 minutes at room temperature, followed by washing with 1% acetic acid to remove excess SRB. Dried SRB was dissolved in 10 mM Tris buffer and quantified by photometric measurement at 590 nm.

[0592] Titer test

[0593] To determine the production of infectious viral particles, infected cells and supernatants were harvested at 3 dpi using a cell scraper. Viruses were released from intact cells by multiple freeze-thaw cycles followed by centrifugation at 1600 rcf. Viral particle production of cell lysate supernatants was tested using Hek293 cells as described in the AdEasy Virus Titer Kit Instruction Manual (972500). The following reagents were used: goat anti-hexon antibody (1056, Chemicon), rabbit anti-goat antibody (P0449, Dako), DAB solution (Dako).

[0594] Example 2 :Effect of CDK4 / 6 inhibitor PD0332991 on E1-minus adenovirus replication

[0595] It has been shown that E1-deleted adenovirus replicates in cancer cells, albeit with very low efficacy. T24 cells were infected with 100 MOI of E1-minus adenovirus expressing green fluorescent protein (Ad-GFP) and treated with 500 nM PD0332991 one day before infection and during incubation. Under these conditions, an increase in GFP expression was observed, thus indicating E1A-independent viral replication and gene expression mediated by activation of the adenoviral E2-early promoter.

[0596] Example 3 : Combination of wild-type adenovirus or XVir-N-31 with different CDK4 / 6 inhibitors

[0597] Based on the results using E2 early mutant adenovirus Ad-WT / E2M and Ad-GFP in combination with PD0332991, experiments were performed using different CDK4 / 6 inhibitors in combination with wild-type adenovirus Ad-WT or XVir-N-31. As these agents arrest cells in G1, it was surprising to find that all inhibitors were able to support viral replication.

[0598] We further examined whether treatment of cells with three clinically advanced CDK4 / 6 inhibitors, PD-033299, LY-2835219, and LEE011, could affect the effects of infection on cell viability, viral replication, and viral titer generation.

[0599] All three inhibitors showed similar effects on RB expression and phosphorylation levels after treatment, as described in many previous publications. After 24 hours of almost complete dephosphorylation and downregulation of total protein, phosphorylation levels were partially restored over time. CDK2 levels were upregulated after treatment, while cyclin D2 and cyclin E2 levels were downregulated.

[0600] Example 4 : Synergistic effect of the combination of CDK4 / 6 inhibitor and oncolytic adenovirus

[0601] The CDK4 / 6 inhibitors PD-033299, LY-2835219, and LEE011 were used in combination with adenovirus-infected cells. Infection of cells was completed 24 hours after treatment, as downstream effects on target molecules could only be detected between 8 and 24 hours after treatment.

[0602] The results are as follows Figure 1 shown.

[0603] CDK4 / 6 inhibitors have synergistic effects on cell viability, viral replication and viral titer. (a) Cells were pretreated with three CDK4 / 6 inhibitors PD-033299, LY-2835219 and LEE011 for 24 hours and infected with XVir-N-31 (Moi 60) or wild-type adenovirus (Moi 80). Four days after infection, cell viability was measured by SRB assay. The figure shows the average of at least three independent experiments. (b) Three days after infection, lysates were prepared from cells and HEK293 cells were tested for titer. Viral titers are shown as fold changes relative to the control. (c) DNA was extracted from infected cells at 4, 24, 36 and 48 hpi, and qPCR was used to analyze viral replication of tail fiber cDNA. The values ​​were normalized to GAPDH at 4 hpi. The figure shows a representative of at least two independent experiments. Error bars represent standard errors.

[0604] from Figure 1 It can be clearly seen that all three CDK4 / 6 inhibitors significantly supported cell lysis ( Figure 1 a), intracellular replication ( Fig.18 ) and virus particle formation ( Figure 1 b).

[0605] Example 5 :Effect of the CDK4 / 6 inhibitor palbociclib (PD-033299) on the expression levels of selected viral proteins

[0606] To analyze these effects in more detail, the expression levels of selected viral proteins in treated or untreated cells were determined. For this experiment, the inhibitor palbociclib (PD-033299) was used as a representative CDK4 / 6 inhibitor. Cells were infected with an MOI of 15. PD treatment at 500 nM was performed 24 hours after infection until protein isolation. Protein isolation was performed 12, 24 and 36 hours later using 1% SDS buffer. Actin was included as a positive control. Since the loading control shows the same levels of cellular actin in all cell lines, appropriate comparisons between cell lines can be ensured. hpi: hours post infection

[0607] The results are shown in Figure 2In the figure, the results of viral protein expression in T24 cells infected with Ad-WT and XVir-N-31 in combination with the CDK4 / 6 inhibitor PD0332991 (PD) are shown. The viral proteins studied in this experiment (E1A, E1B-55k, DBP (E2A) and hexon) were all expressed at higher levels in cells treated with the CDK4 / 6 inhibitor PD-0332991 compared to adenovirus wild-type virus. For E1A, this effect was observed as early as 12 hpi, and for the other proteins, it was observed at 24 hpi.

[0608] Example 6 : Specificity of CDK4 / 6 inhibitor-mediated effects

[0609] The class of CDK4 / 6 inhibitors in Example 5 requires the expression of RB. Therefore, three RB-positive and two RB-negative bladder cancer-derived cell lines were used and treated with combination therapy. The cell lines were pretreated with IC50 concentrations of PD-0332991 (T24: 500nM, RT112: 2000nM, 253J: 100nM) for 24 hours and infected with XVir-N-31 (T24MOI50, 253J MOI 25, RT112 MOI450). Values ​​are the means of at least two independent experiments. Error bars show standard errors. Cell viability at 4dpi was measured using SRB analysis (a, c). Lysates of cells (b, d) were prepared at 3dpi and titered on Hek293 cells. Viral titers are shown as fold changes relative to the control.

[0610] The results are as follows Figure 3 shown.

[0611] from Figure 3 It can be clearly seen that only the RB-positive cell lines showed a significant decrease in cell growth and cell viability ( Figure 3 a, c). In addition, after PD-0332991 treatment, viral particle formation increased only in RB-positive cell lines ( Figure 3 b, d).

[0612] Example 7 : Effects of combined treatment with CDK4 / 6 inhibitor PD-0332991 and XVir-N-31

[0613] To investigate the effect of PD-0332991 on viral replication in RB-positive cell lines, relative quantification of fiber DNA copies was performed using qPCR. Bladder cancer cell lines were pretreated for 24 h and infected with XVir-N-31 (T24 MOI 40, UMUC3 and 253J MOI 20, RT112 MOI 400). DNA was extracted at 24-48 hpi and viral fibers were analyzed using qPCR. Values ​​were normalized to GAPDH. Data represent at least two independent experiments; error bars SD

[0614] The results are as follows Figure 4 shown.

[0615] from Figure 4 As can be seen, the combined treatment of CDK4 / 6 inhibitor PD-0332991 and XVir-N-31 significantly increased viral replication.

[0616] Example 8 :Temporal kinetics of CDK4 / 6 inhibitors

[0617] The temporal kinetics of dephosphorylation and degradation of RB by CDK4 / 6 inhibitors were approximately 10 hours after cell treatment. Similarly, the results presented above show partial restoration of RB downstream targets over time ( Figure 1 ). This observation suggests that the time dynamics of CDK4 / 6 inhibitors and the effect on virus-induced cell death are important parameters of the combined therapy, as shown in Example 7. For the application of combined therapy, different time points for cell pretreatment were tested. Accordingly, cells were treated before infection (days / hours before infection, dai / hai) or 1 hour after infection, and cell growth was measured using the SRB assay. Error bars represent SE, and values ​​are the averages of three independent experiments.

[0618] The results are as follows Figure 5 shown.

[0619] from Figure 5 It is clear that parallel treatment is sufficient to increase cell death.

[0620] Example 9 : Combination treatment of different adenoviruses with the CDK4 / 6 inhibitor PD0332991

[0621] This example is to provide experimental evidence that different oncolytic adenoviruses can be used for cell killing together with CDK4 / 6 inhibitors (e.g., PD0332991), and the observed increase in viral replication and cell killing is not limited to XVir-N-31. Accordingly, T24 cancer cells with Ad-Δ24 and XVir-E2FM are as follows: T24 bladder cancer cells are infected with 20MOI of the specified oncolytic adenovirus. Treatment with 500nM CDK4 / 6 inhibitor PD0332991 was performed one day before infection and 4 days after infection. Photos were taken 4 days after infection. The appearance of cytopathic effect (CPE) indicates viral replication and cell killing.

[0622] The results are as follows Figure 6 shown.

[0623] from Figure 6 As can be seen in the figure, the CDK4 / 6 inhibitor PD0332991, as a representative example of CDK4 / 6 inhibitors, reduced RB phosphorylation and increased cell killing when combined with other oncolytic adenoviruses such as Ad-Δ24 and XVir-E2FM.

[0624] Embodiment 10: Infection of T24 cells with a recombinant E1-deficient adenovirus expressing GFP (Ad-minus / GFP) in combination with palbociclib resulted in increased GFP expression

[0625] 100,000 T24 cells / well were seeded in 6-well plates and grown in RPMI medium containing 10% FCS at 37°C and 5% CO2. T24 cells were treated with 500nM palbociclib 24 hours before infection and again 1 hour after infection. E1-deficient adenovirus expressing GFP (Ad-minus / GFP) was infected in 400μl medium without serum. Pictures were taken using a fluorescence microscope at 10x magnification 48 hours after infection.

[0626] Fluorescence microscopy analysis of GFP expression with and without palbociclib treatment Figure 7 shown.

[0627] The results showed that treatment of T24 cells with palbociclib caused a strong increase in GFP expression, which was mediated by palbociclib-induced viral DNA replication.

[0628] Embodiment 11 : E1A-independent viral replication in UMUC cells treated with various cell cycle inhibitors

[0629] In order to study the replication differences of dl703 under different treatment conditions (Mantwill et al., 2013, Journal of Translational Medicine, 11, 216), DNA replication analysis was performed. 100,000 UMUC cells were inoculated in 6-well plates and grown in DMEM medium containing 10% FCS at 37°C under 5% CO2 conditions. 24 hours after inoculation, the cells were treated with 10 μM Lee (Ribosini), 1 μM CI-1040, 10 μM Nutlin-3a and 10 μM Roscovertine for 24 hours, and the appropriate amount of inhibitors were added to the culture medium again after infection. 24 hours after treatment, 50 MOI of dl703 (mammalian adenovirus, type C, serotype 5 with 3.2 kb missing in the E1 region) was infected. After 4 hours and 48 hours after infection, DNA was isolated and qPCR was performed using specific primers for viral tail fiber genes. Tail fiber forward primer 5`-AAGCTAGCCCTGCAAACATCA-3`; tail fiber reverse primer 5`-CCCAAGCTACCAGTGGCAGTA-3`.

[0630] The results are as follows Figure 8 shown.

[0631] from Figure 8 It can be clearly seen that treatment of UMUC cells with the CDK 4 / 6 inhibitor LEE011 (Ribociclib) resulted in a dramatic increase (nearly 100-fold) in viral DNA replication of E1-negative adenovirus dl703. This increase strongly suggests that the G1 arrest specifically induced by Ribociclib together with the inhibition of E2F-1 expression promotes E1-independent adenovirus replication. As a result, not only viruses with specific deletions in the E1A gene showed enhanced adenovirus DNA replication under CDK 4 / 6 treatment, but even adenoviruses with a complete deletion of the E1A gene showed an increase in viral DNA replication.

[0632] Although the Mek inhibitor GI-1040 showed similar properties in terms of inhibition of E2F-1 expression and G1 arrest, replication was much lower compared to cells treated with ribociclib. This may be due to the fact that other important cell cycle-related pathways, such as MEK / ERK, which are necessary for viral replication, were also inhibited. In addition, inhibition of the MEK / ERK pathway has been shown to reduce particle formation by more than 100-fold, making it unsuitable for combined treatment with oncolytic adenovirus replication in a clinical setting (Schümann and Doppelstein 2016, Cancer Research, 66, 1282-1288).

[0633] Example 12: Western blot analysis of UMUC cells treated with the indicated cell cycle inhibitors

[0634] Western blot analysis of UMUC cells treated with the indicated concentrations of CI-1040, Roscovitine, Nutlin-3a, and LEE011 (Ribociclib). 6 Cells were seeded in 10 cm dishes. Proteins were isolated 24 h after treatment using 1% SDS buffer to disrupt the nuclear membrane. All samples were pipetted into a syringe several times to disrupt DNA, followed by centrifugation at 30,000 rpm for 30 min at 4 °C. The supernatant was transferred to a new reaction tube and used directly in further steps or stored at -80 °C. To separate proteins, sodium dodecyl sulfate polyacrylamide gel electrophoresis was performed. 40 μg of total protein was loaded and probed against the indicated specific antibodies by electrophoresis at 100 V at 4 °C for about 2 h.

[0635] The results are shown in Fig. 9A , 9B and 9C.

[0636] It can be clearly seen from Figure 9 that Roscovitine and Nutlin-3a have no significant effect on the expression of Rb, phRB and E2F-1, while 10 μM LEE-011 (Ribociclib) and 1 μM MI-1040 can induce the inhibition of E2F-1 and the expression of Rb and phRb.

[0637] Embodiment 13 :Analysis of the effects of CDK 4 / 6 inhibitors on viral DNA replication of the E1-deficient adenovirus dl703

[0638] For cell cycle analysis, cells were seeded in 6-well plates (2.5×10E4 cells / well). Cells were treated with cell cycle inhibitors at the indicated concentrations 8 hours before infection with dl703. After infection with 10 MOI of dl703, the cells were treated again for 48 hours. Untreated cells and dl703-infected cells were used as controls only. 48 hours after infection, cells were collected by trypsinization and fixed with 80% ethanol while vortexing. To study the cell cycle status, the fixed cells were centrifuged at room temperature and 300g for 5 minutes, and the ethanol was aspirated. The cells were resuspended and washed with 1% BSA-PBS (bovine serum albumin) and centrifuged again. The cells were stained with EDU and stained with Click-iT from Thermo Fischer. TMPlus EdU flow cytometry detection kit (catalog number C10632) was used for cell cycle analysis. In addition, after washing 3 times with 1% BSA / PBS, the cells were stained with PI (propidium iodide, 50 μg / ml). The FACScalibur flow cytometry system was used for measurement directly after staining. The data were analyzed using FlowJo software.

[0639] Characteristics of CDK4 / 6 inhibitors

[0640] CI1040: The dual-specific threonine / tyrosine kinase, map kinase kinase (MEK), is a key component of the RAS / RAF / MEK / ERK signaling pathway that is frequently activated in human tumors. CI-1040 is a benzhydroxamate compound that effectively inhibits MEK (Allen et al., 2003, Semin Oncol. (5 Suppl. 16): 105-16) and causes G1 arrest.

[0641] Nutlin-3a: Nutlin-3 is a small molecule antagonist of MDM2 that effectively restores p53 function in MDM2-normal expressing and MDM2-overexpressing cell lines with wild-type p53, leading to cell cycle arrest and apoptosis (Wang et al., 2012, Acta Biochimica et Biophysica Sinica, Vol. 44, No. 8, August 1, 2012, pp. 685-691).

[0642] Roscovitine (Seliciclib or CYC202) is an experimental candidate drug in the family of pharmacological cyclin-dependent kinase (CDK) inhibitors that preferentially inhibits multiple enzyme targets, including CDK2, CDK7 and CDK9, which alter the growth phase or state of the cell cycle of the treated cells (Whitaker et al., 2004, Cancer Research 64, 262-272).

[0643] LEE011 (Ribociclib; trade name Kisqali) is an inhibitor of cyclin D1 / CDK4 and CDK6, used to treat certain types of breast cancer. Inhibition of CDK 4 / 6 leads to G1 cell cycle arrest and inhibition of E2F-1 expression (Kim S. et al., Oncotarget. 2018, Oct 16; 9(81): 35226-35240; Yang C et al., Oncogene (2017) (36, 2255-2264).

[0644] The results are as follows Fig.10 shown.

[0645] CDK 4 / 6 inhibitors LEE011 (Ribociclib) and CI-1040 induced a pronounced G1 arrest. Roscovitine treatment showed a slight increase in G2 / m arrested cells. Nutlin-3a had little or no effect on the cell cycle at the concentrations used. Infection of UMUC cells with E1-deficient (without E1A protein) recombinant adenovirus dl703 did not significantly alter cell cycle distribution.

[0646] Embodiment 14 : Palbociclib increases adenovirus hexon staining in vitro after treatment

[0647] Bladder cell lines RT112, T24 and UMUC were seeded in 6-well plates (2×10 5 cells / well). One day after inoculation, cells were treated with 500 nM palbociclib 24 hours before infection and again 1 hour after infection. Infection was performed with the indicated MOI of AD-WT in 400 μl DMEM medium without serum. Two days after infection, hexon staining was performed using the Adeasy Virus Titration Kit from Agilent (Catalog No.: 972500) according to the manufacturer's instructions.

[0648] The results are as follows Fig.11 shown.

[0649] from Fig.11 It can be clearly seen that treatment with palbociclib (500 nM) as an exemplary CDK4 / 6 inhibitor significantly increased hexon positive cells in palbociclib treated cells 48 hours post infection, as shown in brown / red. It must be concluded that since the expression of adenoviral hexon only occurs at the beginning of viral replication, more cells receiving palbociclib treatment are able to produce viral particles and show increased viral DNA replication.

[0650] As can be seen from the results of Examples 10 to 14, only CDK4 / 6 inhibitors but no other cell cycle inhibitors can increase the replication and gene expression of replication-defective adenovirus (d1703 lacking the E1 gene) and Ad-GFP. In addition, in order to provide such increased viral replication and gene expression, CDK4 / 6 inhibitors must cause G1 arrest of (infected) cells and inhibition of F2F1 expression.

[0651] Embodiment 15 : Treatment of T24 cells with triple therapy containing XVir-N-31, palbociclib and a PARP inhibitor

[0652] To demonstrate the efficacy of triple combination therapy on T24 cells using a triple combination therapy comprising XVir-N-31, Palbociclib, and a PARP inhibitor, BMN673 (Talazolarib), a potency assay was performed.

[0653] 12,500 T24 cells were seeded into each well of a 12-well plate and grown overnight at 37°C in RPMI medium with 10% FCS. Cells were treated with inhibitors 24 h after cell seeding and again 1 h after infection by adding the indicated concentrations to the medium. Cell infection occurred 24 h after inhibitor treatment in 250 μl of serum-free medium. Fixation and SRB staining were performed 4 days after infection. PD, palbociclib; PARPi: BMN673.

[0654] For SRB staining, the medium was removed by aspiration. The cells were fixed with 1 ml (per well) of 10% cold TCA at 4°C for 1 hour. The TCA was removed by aspiration and the cell layer was washed 4 times with tap water. The cells were stained with 1 ml (per well) of 0.5% SRB (sulforhodamine B) dissolved in 1% acetic acid for 30 minutes. In five washing steps, unbound SRB was removed with 1 ml 1% acetic acid / well; after each washing step, the acetic acid was removed by aspiration. The plate was air-dried for 2 hours. To dissolve the SRB-stained cells, 200 μl of 10mM Tris base was added to each well. Then, 20 μl was distributed into the wells of the 96-well plate respectively. The 96-well plate was loaded into the Elisa plate reader and the absorbance of the sample was measured at 560nm. The mock-treated cells were set to 100% cell survival.

[0655] The results are as follows Fig.12 shown.

[0656] Fig.12 The results shown in clearly demonstrate that the triple therapy consisting of palbociclib, BMN673, and XVir-N-31 exhibits superior performance in cell killing over either monotherapy or combination therapy. Nearly 90% cell killing can be achieved using 10 MOI of XVir-N-31 in combination with the PARP inhibitor PARPi (BMN673) and the CDK4 / 6 inhibitor palbociclib (PD). The combination of PARPi and palbociclib without XVir-N-31 killed only 65% ​​of the cells. T24 cells and UMUC cells are sensitive to CDK 4 / 6-inhibitors (providing G1 arrest through E2F-1 downregulation).

[0657] Example 16 : Kinetics of triple combination therapy containing XVir-N-31, palbociclib, and a PARP inhibitor

[0658] To demonstrate the kinetics of triple combination therapy on T24 cells with a triple combination therapy comprising XVir-N-31, Palbociclib, and a PARP inhibitor, BMN673 (Talazolarib), a potency assay was performed and potency was assessed at different time points.

[0659] 3000 T24 cells were seeded into each well of a 12-well plate and grown overnight at 37°C in RPMI medium containing 10% FCS. Cells were treated with inhibitors 24 hours after cell seeding and again 1 hour after infection by adding the specified concentrations to the medium. 24 hours after inhibitor treatment, cells were infected in 250 μl of serum-free medium. Fixation and SRB staining were performed 1-5 days after infection (dpi: days after infection). 15 nM PARPi corresponds to an IC-80 value in T24 cells.

[0660] The results are as follows Fig.13 shown.

[0661] from Fig.13 It is clear that, from a kinetic point of view, triple therapy with a CDK4 / 6 inhibitor (palbociclib (PD) and the PARP inhibitor PARPI (BMN673)) in addition to XVir-N-31 is more effective than monotherapy with XVir-N-31 alone or combination therapy with XVir-N-31 and a PARP inhibitor or a CDK4 / 6 inhibitor. Importantly, in the CDK4 / 6 sensitive cell lines UMUC and T24, the regrowth of tumor cells was significantly reduced on days 4 and 5 (dpi: days post infection).

[0662] Embodiment 17 : Kinetics of triple combination therapy containing XVir-N-31, palbociclib, and a PARP inhibitor

[0663] To demonstrate the kinetics of triple combination therapy with XVir-N-31, Palbociclib, and a PARP inhibitor (BMN673 (Talazolarib)) in UMUC cells, efficacy analysis was performed and efficacy was assessed at different time points.

[0664] Inoculation of UMUC-3: 3000 cells were seeded into each well of a 12-well plate and grown overnight at 37°C in DMEM medium containing 10% FCS. Cells were treated with inhibitors 24 hours after seeding and again 1 hour after infection by adding the indicated concentrations to the medium. Cell infection was performed 24 hours after inhibitor treatment. Fixation and SRB staining were performed 1-6 days after infection (dpi: days after infection). 160 nM PARPi corresponds to an IC-80 value in UMUC3 cells.

[0665] The results are as follows Fig.14 shown.

[0666] Fig.14 The results shown clearly demonstrate that the triple therapy consisting of palbociclib, BMN673 and XVir-N-31 showed superior performance over monotherapy or combination therapy. Importantly, in the CDK4 / 6 sensitive cell lines UMUC and T24, the regrowth of tumor cells was significantly reduced at days 4 and 5 (dpi: days post infection).

[0667] Embodiment 18 : Triple therapy containing XVir-N-31, CDK4 / 6 inhibitor and bromodomain inhibitor

[0668] 5000 T24 cells were seeded in 12-well plates and grown in 1 ml RPMI medium containing 10% FCS. The next day, cells were treated with 500 nM palbociclib and 300 nM JQ-1. 24 h after treatment, cells were infected with XVir-N-31 at the indicated MOI in 200 μl RPMI-medium without FCS. After 1 h, 800 μl RPMI-medium with 10% FCS was added to each well. In addition, 500 nM palbociclib and 300 nM JQ-1 were added to the culture medium. SRB staining was performed 5 days after infection. Mock-treated cells were set to 100% cell survival.

[0669] The results are as follows Fig.15 shown.

[0670] from Fig.15 It is evident that the bromodomain inhibitor JQ1 enhances the cell killing ability of XVir-N-31 at low MOI in combination with the CDK 4 / 6 inhibitor palbociclib. Light microscopy analysis at 48 hours post infection showed that extensive cell death had occurred in cells treated with JQ1 / palbociclib / XVir-N-31. It must be concluded that JQ-1 increases viral transcription in palbociclib-treated cells, thereby promoting viral replication, as monotherapy with only 300nM JQ1 did not increase the cell killing ability of XVir-N-31 at 10 and 20 MOI.

[0671] The JQ-1 enhancement observed in adenovirus-infected cancer cells is a prerequisite for the ability of palbociclib to induce G1 arrest. In cells resistant to palbociclib (see Example 18, same treatment steps), no increase in cell killing was observed. This observation is in sharp contrast to Baojie Lv et al., 2018, Scientific reports, 8, 11554, where cells treated with different concentrations of JQ1 did not cause G1 arrest, nor did they use palbociclib in combination.

[0672] Embodiment 19 : Triple therapy containing XVir-N-31, CDK4 / 6 inhibitor and bromodomain inhibitor

[0673] 100,000 SK-N-MC cells / well were seeded into 12-well plates and grown in RPMI medium with 10% FCS at 37°C under 5% CO2. Cells were treated with 200nM abemaciclib + 500nM JQ1 24 hours before infection and again 1 hour after infection by adding the appropriate amount of medium to the culture medium. Infection with XVir-N-31 was performed in 500μl of serum-free RPMI medium. SRB staining was performed 5 days after infection. Mock-treated cells were set to 100% cell survival.

[0674] The results are as follows Fig.16 shown.

[0675] It has been determined that SK-N-MC cells are resistant to CDK 4 / 6 inhibitors and therefore do not induce G1 arrest. Addition of JQ1 did not increase the killing of SK-N-MC cells resistant to CDK 4 / 6 (abecibib), suggesting that CDK 4 / 6-mediated G1 arrest is a prerequisite for JQ1-mediated cell killing.

[0676] therefore, Fig.16 (as well as Fig.15 ) showed that under the premise of G1 arrest in cells induced by CDK 4 / 6 inhibitor treatment, bromodomain inhibitors targeting BRD2, BRD3, and BRD4 further enhanced the cell-killing effect of XVir-N-3.

[0677] Embodiment 20 : Western blot analysis of SK-N-MC cells treated with the CDK 4 / 6 inhibitor LY-2835219 (Abemaciclib) and the Wee inhibitor MK-1775 (Adavosertib)

[0678] 1×10 6Cells were seeded in 10 cm dishes. Proteins were separated 24 h after treatment using 1% SDS buffer to achieve disruption of the nuclear membrane. All samples were aspirated into a syringe several times to disrupt the DNA, followed by centrifugation at 30,000 rpm for 30 min at 4 °C. The supernatant was transferred to a new reaction tube and used directly in further steps or stored at -80 °C. To separate the proteins, sodium dodecyl sulfate polyacrylamide gel electrophoresis was performed. 40 μg of total protein was loaded and probed against the indicated specific antibodies by electrophoresis at 100 V at 4 °C for about 2 h.

[0679] The results are as follows Fig.17 shown.

[0680] SK-N-MC cells are known to be resistant to Abenaciclib treatment (Dowless M et al., 2018, Clin Cancer Res: 24, 6028-6039). Wee1 is a key component of G2 / M cell cycle checkpoint control and mediates cell cycle arrest by regulating the phosphorylation of CDC2. It has been reported that the inhibition of Wee1 by MK1775 can enhance the cytotoxic effects of DNA damaging agents in different types of cancer. Several studies have shown that pharmacological inhibition of Wee1 by the small molecule kinase inhibitor MK-1775 leads to the removal of CDC2 phosphorylation at Tyr15 in tumor cells (Kreahling et al., 2013, PLoS One. 8 (3), e57523). Although strong G1 arrest was observed in the combined treatment, no changes in Rb and E2F-1 expression were observed.

[0681] Embodiment 21 : Triple therapy including XVir-N-31, CDK4 / 6 inhibitor abemaciclib and Adavosertib (Wee inhibitor MK-1775)

[0682] 100,000 SK-N-MC cells / well were seeded into 12-well plates and grown in RPMI medium containing 10% FCS at 37°C under 5% CO2. Cells were treated with 200 nM abemaciclib 24 h before infection and again 1 h after infection by adding appropriate amounts to the medium. Infection with XVir-N-31 was performed in 500 μl of serum-free RPMI medium. SRB staining was performed 5 days after infection. Mock-treated cells were set to 100% cell survival.

[0683] The results are as follows Fig.18 shown.

[0684] Fig.17( and 18 ) showed that the combination of the CDK 4 / 6 inhibitor abemaciclib and the Wee inhibitor MK-1775 induced G1 arrest without inhibiting E2F-1. Fig.18 Potency assays in the literature showed that the combination was unable to enhance the cell-killing effect of the oncolytic adenovirus XVir-N-31. These results clearly indicate that G1 arrest induced by the combination of the CDK 4 / 6 inhibitor Abemaciclib and the Wee inhibitor MK-1775 does not promote the cell-killing ability of XVir-N-31. Therefore, inhibition of E2F-1 expression is a further requirement for enhancing viral oncolysis.

[0685] Embodiment 22 G1 arrest in combination with E2F-1 inhibition is a prerequisite for enhanced cell killing of XVir-N-31 in combination with CDK 4 / 6 inhibitors

[0686] 48 hours after treatment, wash cells twice with PBS (containing RNase A, 100U / ml). Digest cells with trypsin and centrifuge at 1500rpm for 5 minutes at 4°C. Fix cells by slowly adding 1ml of ice-cold 80% ethanol dropwise to the pellet and incubate overnight. Stain by adding 1ml of staining solution (propidium iodide, 50μg / ml) to cells and incubate at room temperature for 30-60 minutes with gentle shaking. MK: MK-1775; LY: LY-2835219.

[0687] The results are as follows Fig.19 shown.

[0688] from Fig.19 It can be clearly seen that treatment of SK-M-NC cells with LY (Abemaciclib) has no effect on the cell cycle. Treatment with 500nM MK-1775 alone leads to an increase in G2 / M cells. The combination of the two leads to a strong G1 arrest.

[0689] Embodiment 23 :The role of E2F-1 expression in viral DNA replication

[0690] I.

[0691] 2x10 5T24, A549 and HeLa cells were seeded into each well of a 6-well plate and grown in 1.5 ml RPMI 1640 medium (or DMEM medium) containing 10% FBS, penicillin / streptomycin and non-essential amino acids. The next day, 30 pmol siRNA-negative control siRNA (Qiagen#1022076) or siE2F1 (Sigma#NM_005225, siRNA ID SASI_Hs01_00162220) was diluted in 150 μL Opti-MEM medium, and 9 μl Lipofectamine RNAiMAX was prepared in 150 μL Opti-MEM. The siRNA solution and Lipofectamine RNAiMAX solution were mixed and incubated for 5 minutes. The mixture was added dropwise to the cells. After 48 hours, RNA was isolated and RT-qPCR was performed.

[0692] The results are as follows Fig. 20 As shown. Fig. 20 It can be clearly seen that E2-early expression is reduced.

[0693] II.

[0694] For each well of a 6-well plate, place 2x10 5 T24 cells were inoculated into 1.5 ml RPMI 1640 culture medium containing 10% FBS, penicillin / streptomycin and non-essential amino acids. The next day, 30 pmol siRNA-negative control siRNA (Qiagen#1022076) or siE2F1 (Sigma#NM_005225, siRNA ID SASI_Hs01_00162220) was diluted in 150 μL Opti-MEM culture medium, and 9 μl Lipofectamine RNAiMAX was prepared in 150 μL Opti-MEM. The siRNA solution and Lipofectamine RNAiMAX solution were mixed and incubated for 5 minutes. The mixture was added dropwise to T24 cells. After the cells were incubated with 10 MOI of ADWTRGD in 400 μl serum-free culture medium and the plate was shaken every 10-15 minutes for 48 hours, infection occurred. After 1 hour, 1.6 ml complete culture medium was added. RNA separation was performed 24 hours after infection.

[0695] The results are as follows Fig.21 shown.

[0696] III.

[0697] The cells were rinsed with cold PBS, then 500 μl of lysis buffer from the MirVana kit (Thermo Fisher catalog number AM1560) was added to disrupt the cells, the lysate was collected with a scraper, and then pipetted into a 1.5 ml test tube. For organic extraction, 50 μl of homogenization additive was added and the sample was incubated on ice for 10 minutes. 500 μl of acid-phenol:chloroform was added, the sample was vortexed for 60 seconds and incubated on ice for 2 minutes. The sample was centrifuged at 14000 x g for 5 minutes at room temperature to separate the aqueous and organic phases. The upper phase was carefully transferred to a new tube and an equal amount of isopropanol was added. After incubation at room temperature for 10 minutes, RNA was precipitated (14000 x g, 4°C, 30 minutes) and washed twice with 1 mL of 75% ethanol (centrifuged at 7500 × g, 4°C, 5 minutes). The RNA was air-dried for 5-10 minutes and then resuspended in 20-50 μl RNase-free water, dissolved by shaking at 500 rpm for 10 minutes at 55°C, and measured by Nanodrop. 1 μg RNA sample was used with 1 μl 10x DNAse I reaction buffer, nuclease-free water to 9 μl volume, 1 μl DNaseI (1U / μl) was incubated at room temperature for 15 minutes for DNA digestion (Deoxyribonuclease I, Invitrogen catalog number 18068-015), and DNAseI was inactivated by adding 1 μl 25mM EDTA solution and heating at 65°C for 10 minutes. The cDNA was reverse-transcribed using a high-capacity cDNA reverse transcription kit (Thermo Fisher / Applied Biosystems TM Reverse transcription was performed using random hexamers for transcription of tail fibers and actin PCR, and E2 early primers were used for E2 early transcription-PCR.

[0698] Primers and siRNA used

[0699] E2 early forward primer: CCGTCATCTCTACAGCCCAT

[0700] E2 early reverse primer: GGGCTTTGTCAGAGTCTTGC

[0701] Tail fiber forward primer: AAGCTAGCCCTGCAAACATCA

[0702] Tail fiber reverse primer: CCCAAGCTACCAGTGGCAGTA

[0703] Actin forward primer: TCACCCACACTGTGCCCATCTACG

[0704] Actin reverse primer: CAGCGGAACCGCTCATTGCCAATGG

[0705] E2F1 forward primer: CATCCCAGGAGGTCACTTCTG

[0706] E2F1 reverse primer: GACAACAGCGGTTCTTGCTC

[0707] Control siRNA

[0708] JusticeUUCUCCGAACGUGUCACGUdTdT

[0709] Antonym: ACGUGACACGUUCGGAGAAdTdT

[0710] E2F-1 siRNA

[0711] CUGAGGAGUUCAUCAGCCU[dT][dT]

[0712] AGGCUGAUGAACUCCUCAG[dT][dT]

[0713] In order to demonstrate the role of E2-early expression by RT-qPCR, it is absolutely necessary to choose the correct primers. The position of the primers should be between the E2-early and E2-late promoters. Otherwise, the E2-late promoter will strongly affect the results. The position of the primers should be between the E2-early and E2-late promoters. Fig. 22 shown.

[0714] like Fig. 20 and 21 As shown, downregulation of E2F1 by siRNA leads to increased early expression of E2. This can only be explained by the inhibitory effect of E2F1 in early expression of E2. If E2F-1 is an activator, it may lead to reduced early expression of E2. In addition, siRNA against E2F-1 mimics the effects of CDK 4 / 6 inhibitors, which also inhibit the expression of E2F-1 (Yang C et al., Oncogene 2017, 36, 2255-2264).

[0715] Embodiment 24 : Recombinant adenovirus with two E2F binding site mutations in the adenoviral E2-early promoter showed increased E2-early expression.

[0716] A mutant adenovirus was generated with mutations in the two E2F binding sites of the adenovirus E2 early promoter. The promoters of the wild-type E2 early promoter and the mutant E2 early promoter are shown in Fig.23 .

[0717] At 24 hours post infection, RNA expression analysis was performed by RT-qPCR in T24 cells infected with the obtained AdWT-RGD and AdE2Fm (also containing the RGD motif). The AD-WT gene expression was set to 100%. The method was the same as that described in Part III of Example 23.

[0718] The results are as follows Fig.24 shown.

[0719] from Fig.24 It can be clearly seen that E2-early gene expression is higher in cells infected with AdE2Fm compared to cells infected with AD-WT. Therefore, it must be concluded that E2F-1 plays a repressive role in E2 early promoter activation. This is in stark contrast to the current understanding, in which E2F-1 is assumed to be an activator (DeCaprio JA, Virology. 2009 Feb 20; 384(2): 274-84).

[0720] As we all know, Fig. 22 As shown, the structure of the E2 region in all currently known oncolytic adenoviruses has been established. Therefore, the mode of action of E2F-1 is the same as described here. As a result, all of them, that is, all oncolytic adenoviruses, can be used in combination with CDK4 / 6 inhibitors (including ColoAd1 and Delta-24-RGD).

[0721] The characteristics of ColoAd1 are as follows:

[0722] Enadenotucirev (formerly ColoAd1) is a tumor-selective chimeric adenovirus with demonstrated preclinical activity. The capsid of ColoAd1 is derived from Ad11p, a serotype with limited seroprevalence in humans. EnAd infects cells by binding to CD46 and / or desmoglein 2,6, which are widely expressed on many cancer cells. Most of the EnAd genome is derived from Ad11p, with a large deletion in E3 and a smaller deletion in E4. In addition, the E2B region consists of a chimera of sequences from Ad11p and Ad3. The E4 deletion in EnAd is in E4ORF4, which encodes a protein that inactivates protein phosphatase 2A in Ad5, thereby activating the protein translation machinery and regulating the activity of the E1A protein in a feedback inhibition loop. These deletions, possibly in combination with the chimeric E2B region, may contribute to the striking cancer-selective replication of EnAd (Deyer et al., Mol Ther Oncolytics. 2017, 16; 5: 62-74)

[0723] The characteristics of Delta-24-RGD (DNX-2401) are as follows:

[0724] Delta-24-RGD (DNX-2401) is a conditionally replication-competent oncolytic virus designed to preferentially replicate in and lyse tumor cells with abnormalities in the p16 / RB / E2F pathway (Fueyo et al., Oncogene. 2000 Jan 6; 19(1): 2-12). Mutant oncolytic adenoviruses targeting the Rb pathway produce anti-glioma effects in vivo (Dai B. et al., Mol Cancer Therapy. 2017 Apr; 16(4): 662-670).

[0725] The features of the invention disclosed in the foregoing description, the claims and the drawings are essential for the realization of the invention in its various embodiments, both individually and in any combination.

Claims

1. A composition comprising an oncolytic adenovirus and a small molecule CDK4 / 6 inhibitor, wherein the oncolytic adenovirus replicates in a YB-1-dependent manner, wherein the oncolytic adenovirus lacks expression of E1A13S, and wherein the small molecule CDK4 / 6 inhibitor is selected from the group consisting of: Palbociclib, which is also known as PD 0332991; Abemaciclib, which is also known as LY-2835219; Ribociclib, which is also known as LEE011; and Trilaciclib, which is also known as G1T28.

2. The composition of claim 1, wherein the oncolytic adenovirus is replication-defective in cells lacking YB-1 in the nucleus, but replicates in cells having YB-1 in the nucleus.

3. The composition of claim 1, wherein the composition further comprises a PARP inhibitor, wherein the PARP inhibitor is BMN673.

4. The composition of any one of claims 1 to 3, wherein the composition further comprises a bromodomain inhibitor, wherein the bromodomain inhibitor is JQ1.

5. Use of the composition according to any one of claims 1 to 4 in the preparation of a medicament for treating a tumor, wherein the tumor is Rb positive.

6. The use according to claim 5, wherein the tumor is cancer.

7. The composition of claim 1, or the use of claim 5, wherein the oncolytic adenovirus is selected from the group comprising: XVir-N-31, dl520, AdΔ24, AdΔ24-RGD, dl922-947, E1Ad / 01 / 07, dl1119 / 1131, CB016, VCN-01, E1Adl1107, E1Adl1101, ORCA-010, Enadenotucirev.

8. The composition of claim 1, or the use of claim 5, wherein the oncolytic adenovirus lacks expression of the E1B 19 kDa protein.

9. The composition of claim 1, or the use of claim 5, wherein the oncolytic adenovirus is an oncolytic adenovirus expressing an RGD motif on the tail fiber.

10. The composition of claim 1, or the use of claim 5, wherein the oncolytic adenovirus is XVir-N-31.

11. The use according to claim 5 or 6, wherein the cells of the tumor contain YB-1 in the cell nucleus.

12. The use of claim 5 or 6, wherein the tumor is selected from the group comprising bladder cancer, breast cancer, melanoma, glioma, pancreatic cancer, hepatocellular carcinoma, lung adenocarcinoma, sarcoma, ovarian cancer, kidney cancer, prostate cancer and leukemia.

13. The use according to claim 12, wherein the breast cancer is metastatic breast cancer.

14. The use of claim 5 or 6, wherein the oncolytic adenovirus and the small molecule CDK4 / 6 inhibitor are for separate administration.

Images