Cell transfection method

Abstract

The present invention relates to methods of transfecting cells. In particular, the present invention relates to methods of transfecting primordial germ cells in avians, and methods of breeding avians with modified traits.

Description

[0001] This application is a divisional application of a patent application filed on April 19, 2013, with application number 201380031734.X and title “Cell Transfection Method”. Technical Field

[0002] The present invention relates to methods of transfecting cells. In particular, the present invention relates to methods of transfecting primordial germ cells in avians, and methods of breeding avians with modified traits. Background Art

[0003] The development of effective technologies for developing transgenic or genetically modified poultry is critical to the agricultural and biopharmaceutical industries, as well as increasing our understanding of avian biology through functional genomics research. Poultry production will play a critical role in ensuring global food security in the face of a growing population, and current advances in biotechnology, such as the development of transgenic poultry, will help the industry meet the demand for increased production.

[0004] More specifically, the application of transgenic technology to modify traits in poultry that cannot be obtained through traditional breeding, such as disease resistance and regulation of sex determination, is now possible and provides great benefits to the poultry industry. The demand for biopharmaceutical proteins has grown rapidly, and until recently, cell-based in vitro manufacturing systems were used to produce new recombinant proteins for disease treatment. The use of transgenic livestock as bioreactors for recombinant protein production is now developing into a major alternative to expensive and labor-intensive cell-based systems. The development of chicken transgenic technology has enabled the development of eggs as bioreactors for high-level production and purification of biopharmaceutical proteins.

[0005] There are also attempts to introduce selected foreign genes by cloning the foreign genes into retroviral vectors (e.g., reticuloendothelial virus or avian leukosis virus), injecting the recombinant virus into fertilized eggs, allowing the virus to infect the developing embryo (e.g., primordial germ cells) to establish chimeric gonads or oocytes, and using the resulting recombinants to attempt to introduce the foreign genes into offspring. However, the poultry industry is reluctant to use this technology commercially because viruses (in their natural state) are pathogens, and even different replication-active viral vectors can sometimes cause tumors, while replication-inactive variants require higher or repeated doses. Even replication-defective viral constructs can pose a risk of recombination with endogenous viral envelopes and thus become replication-active. In addition, these vectors are currently limited to DNA inserts that are relatively small in size (e.g., 2 kb or less).

[0006] There are also attempts to inject exogenous DNA into undeveloped fertilized eggs surgically removed from hens. However, this method requires the developing embryos to be incubated in a series of surrogate containers. In addition, it requires a dedicated laying flock and repeated practice to obtain the required surgical and technical skills.

[0007] An alternative method includes injecting genetically modified embryonic cells or primordial germ cells (PGC) into a recipient embryo shortly after spawning. In this method, a PCG culture is generated that retains the ability to differentiate into functional ovum or sperm, which produces cells when integrated into the developing embryo. This type of PCG culture can be genetically modified and then injected into the recipient embryo. The recipient embryo will usually be modified by gamma irradiation to weaken the endogenous primordial germ cells, thereby giving the injected cells a selective advantage in colonizing the gonadal ridge. The modified cells will then mature and produce sperm or ovum that can transmit the transgene to at least the next generation. However, this technology is very time-consuming because it requires PGC to be removed from the donor embryo, and its subsequent cultivation and re-introduction into the recipient embryo. In addition, the efficiency of birds containing genetically modified PGC that can be obtained using this technology is very low.

[0008] Therefore, there remains a need for methods for genetically modifying avian primordial germ cells. SUMMARY OF THE INVENTION

[0009] The present inventors have discovered that injecting a transfection reagent mixed with DNA directly into the blood of a developing avian embryo results in the introduction of the DNA into primordial germ cells (PGCs) and the insertion of the DNA into the genome of the avian.

[0010] Accordingly, the present invention provides a method for producing an avian comprising a genetically modified germ cell, the method comprising:

[0011] (i) injecting a transfection mixture comprising a polynucleotide mixed with a transfection reagent into a blood vessel of an avian embryo, whereby the polynucleotide is inserted into the genome of one or more germ cells in the avian.

[0012] In one embodiment, the method further comprises (ii) incubating the embryo at a temperature sufficient to allow the embryo to develop into a bird.

[0013] The transfection mixture is preferably injected into avian embryos at about stage 12-17 PGC migration. In a preferred embodiment, the transfection mixture is injected into avian embryos at stage 13-14.

[0014] Although any suitable transfection reagent may be used in the methods of the present invention, transfection reagents comprising cationic lipids are preferred.

[0015] In one embodiment, the transfection reagent comprises a monovalent cationic lipid selected from one or more of the following: DOTMA (N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride), DOTAP (1,2-bis(oleoyloxy)-3-3-(trimethylamino)propane), DMRIE (1,2-ditetradecyloxypropyl 3-dimethyl-hydroxyethylammonium bromide) and DDAB (dimethyldioctadecylammonium bromide).

[0016] In another embodiment, the transfection reagent comprises a multivalent cationic lipid selected from one or more of the following: DOSPA (2,3-dioleyloxy-N-[2-(sperminecarboxyamide)ethyl]-N,N-dimethyl-1-propylammonium trifluoroacetate) and DOSPER (1,3-dioleoyloxy-2-(6-carboxysperminyl)propionamide), TMTPS (tetramethyltetrapalmitoylspermine), TMTOS (tetramethyltetraoleylspermine), TMTLS (tetramethyltetralaurylspermine), TMTMS (tetramethyltetramyristylspermine) and TMDOS (tetramethyldioleylspermine).

[0017] In another embodiment, the transfection reagent comprises DOSPA (2,3-dioleyloxy-N-[2-(sperminecarboxamide)ethyl]-N,N-dimethyl-1-propylammonium trifluoroacetate).

[0018] In another embodiment, the transfection reagent further comprises a neutral lipid. The neutral lipid may comprise, for example, DOPE (dioleoylphosphatidylethanolamine), DPhPE (diphytanoylphosphatidylethanolamine) or cholesterol.

[0019] In a specific embodiment, the transfection reagent comprises a 3:1 (w / w) mixture of DOSPA and DOPE prior to mixing the transfection reagent with the polynucleotide.

[0020] Advantageously, the method of the invention is suitable for use in non-retroviral methods of introducing polynucleotides into the genome of germ cells.Thus, in one embodiment, the polynucleotide further comprises a nucleotide sequence encoding a transposon or a zinc finger nuclease.

[0021] In a specific embodiment, the transfection mixture comprises a polynucleotide encoding a transposase. The transposase may be encoded by DNA, such as in a plasmid, or alternatively, the polynucleotide encoding the transposase is RNA.

[0022] In a specific embodiment, the transposon is selected from Tol2, mini-Tol2, Sleeping Beauty and PiggyBac.

[0023] In another embodiment, the polynucleotide comprises a sequence encoding a zinc finger nuclease.

[0024] The germ cells which are genetically modified in avians may be embryonic germ cells, preferably the cells are primordial germ cells.

[0025] In one embodiment, the injection mixture is injected into an embryo in an eggshell where the embryo develops.

[0026] The polynucleotide in the transfection mixture can be an RNA molecule or a DNA molecule encoding a polypeptide, or a DNA molecule encoding an RNA comprising a double-stranded region. In a specific embodiment, the polynucleotide encodes an RNA comprising a double-stranded region. The RNA molecule can be, for example, siRNA, shRNA, or RNA decoy.

[0027] In another embodiment, the polynucleotide encodes a polypeptide.

[0028] In one embodiment, the RNA molecule or polypeptide reduces viral replication in a cell compared to a cell lacking the RNA molecule or polypeptide.

[0029] The methods of the invention can be used to target any viral pathogen of poultry. In one embodiment, the virus is an influenza virus.

[0030] The present invention further provides an avian comprising a genetically modified germ cell, wherein the avian is produced by the method of the present invention.

[0031] The present invention further provides a genetically modified germ cell of an avian of the present invention, wherein the germ cell comprises a polynucleotide inserted into the genome.

[0032] The present invention further provides sperm produced by an avian species comprising a genetically modified cell of the present invention.

[0033] The invention further provides eggs produced by avians comprising the genetically modified cells of the invention.

[0034] The present invention further provides a method for genetically modifying germ cells in avians, the method comprising:

[0035] (i) injecting a transfection mixture comprising a polynucleotide mixed with a transfection reagent into a blood vessel of an avian embryo contained in an egg; and

[0036] (ii) incubating the embryo at a temperature sufficient to allow the embryo to develop into a bird;

[0037] Wherein the polynucleotide is inserted into the genome of one or more germ cells in the avian.

[0038] In another embodiment, the method comprises one or more features of the invention described herein.

[0039] The present invention further provides a method for producing a genetically modified avian, the method comprising:

[0040] (i) obtaining avian species comprising genetically modified germ cells of the present invention;

[0041] (ii) producing offspring from said bird comprising a genetically modified germ cell; and

[0042] (iii) selecting progeny that comprise the polynucleotide inserted into the genome.

[0043] The invention further provides genetically modified avians produced by the methods of the invention.

[0044] The present invention further provides a method for producing a food, the method comprising:

[0045] (i) obtaining an avian animal comprising a genetically modified germ cell of the present invention or a genetically modified avian animal of the present invention; and

[0046] (ii) producing food from said poultry.

[0047] In one embodiment, the method comprises harvesting meat and / or eggs from the poultry.

[0048] The present invention further provides a method for breeding genetically modified birds, the method comprising:

[0049] (i) carrying out the method of the present invention to produce a bird or offspring;

[0050] (ii) allowing the chick or offspring to develop into a sexually mature bird; and

[0051] (iii) breeding the sexually mature birds to produce genetically modified birds.

[0052] In one embodiment, the invention provides a genetically modified avian produced according to the methods of the invention.

[0053] The present invention further provides a method for regulating an avian trait, the method comprising:

[0054] (i) injecting a transfection mixture comprising a polynucleotide mixed with a transfection agent into a blood vessel of an avian embryo, whereby the polynucleotide is inserted into the genome of one or more germ cells in the avian; and

[0055] (ii) incubating the embryo at a temperature sufficient to allow the embryo to develop into a bird;

[0056] The polynucleotide encodes a polypeptide that regulates avian traits or an RNA molecule comprising a double-stranded region.

[0057] In one embodiment, the RNA molecule comprises siRNA, shRNA, or RNA bait.

[0058] In one embodiment, the trait is selected from muscle mass, gender, nutritional composition and / or disease resistance.

[0059] The present invention further provides a method for increasing the resistance of avian species to viruses, the method comprising implementing the method of the present invention, wherein the polynucleotide is an siRNA, shRNA or RNA decoy that reduces viral replication in cells, or the polynucleotide encodes an antiviral peptide that reduces viral replication in cells.

[0060] In a specific embodiment, the virus is an influenza virus.

[0061] The invention further provides birds produced according to the method of the invention.

[0062] In certain embodiments of the invention, the poultry is selected from the group consisting of chicken, duck, turkey, goose, bantam or quail.

[0063] In another embodiment of the method of the present invention, the transfection mixture further comprises a targeting nuclease, or a polynucleotide encoding a targeting nuclease, so that the polynucleotide is integrated into the genome of the germ cell. For example, the targeting nuclease can be selected from zinc finger nuclease, TALEN and CRISPR.

[0064] The present invention further provides a method for producing an avian comprising a genetically modified germ cell, the method comprising:

[0065] (i) injecting a transfection mixture comprising a polynucleotide mixed with a transfection agent into a blood vessel of an avian embryo, whereby the polynucleotide is inserted into the genome of one or more germ cells in the avian; and

[0066] (ii) incubating the embryo at a temperature sufficient to allow the embryo to develop into a bird;

[0067] The transfection reagent comprises a cationic lipid, the polynucleotide further comprises a sequence encoding a transposon, and the transfection mixture is injected into a blood vessel of an avian embryo at stage 13-14.

[0068] In one embodiment, before the transfection reagent is mixed with the polynucleotide, the transfection reagent comprises Lipofectamine 2000 or a 3:1 (w / w) mixture of DOSPA and DOPE, the transposon is Tol2 or mini-Tol2, and the transfection mixture comprises a polynucleotide encoding a Tol2 transposase.

[0069] The present invention further provides a method for producing an avian comprising a genetically modified germ cell, the method comprising:

[0070] (i) injecting a transfection mixture comprising a polynucleotide mixed with a transfection agent into a blood vessel of an avian embryo, whereby the polynucleotide is inserted into the genome of one or more germ cells in the avian; and

[0071] (ii) incubating the embryo at a temperature sufficient to allow the embryo to develop into a bird;

[0072] The transfection reagent comprises a cationic lipid and a neutral lipid, the polynucleotide further comprises a sequence encoding a zinc finger nuclease, and the transfection mixture is injected into a blood vessel of an avian embryo at stage 13-14.

[0073] In one embodiment, the transfection reagent comprises Lipofectamine 2000 or a 3:1 (w / w) mixture of DOSPA and DOPE prior to mixing the transfection reagent with the polynucleotide.

[0074] It will be apparent that preferred features and characteristics of one aspect of the invention may be applicable to many other aspects of the invention.

[0075] Throughout the present specification the word "comprise" or variations thereof should be understood to mean the inclusion of stated elements, integers or steps, or groups of elements, integers or steps, but not the exclusion of any other elements, integers or steps, or groups of elements, integers or steps.

[0076] The invention will now be described by way of the following non-limiting examples and with reference to the accompanying drawings. BRIEF DESCRIPTION OF THE DRAWINGS

[0077] Figure 1 : DNA encoding EGFP complexed with Lipofectamine 2000 was injected directly into avian embryos. Fluorescence (left) and matched bright field (right) images of gonads removed from 7 day embryos.

[0078] Figure 2: DNA encoding EGFP complexed with Lipofectamine 2000 was injected directly into 14-day avian embryos. Fluorescence (right) and matched bright field (left) images of gonads removed from 14-day embryos. The last fluorescent image is a close-up of the green cell cluster in the left-hand embryo. This area is separated from the rest of the gonad stained with chicken vasa homolog (cvh). A small portion of the rest of the gonad was used as a negative control.

[0079] Figure 3 : DNA encoding EGFP complexed with Lipofectamine 2000 was injected directly into avian embryos. The PGC marker cvh was stained in the cells. DAPI staining shows nucleic acid material and stains all cells. The PGC-specific marker cvh stains a subset of cells (brighter gray cells). The arrows indicate transformed cells that received the directly injected transposon and are stained green.

[0080] Figure 4 : Confirmation of in vitro optimization by direct injection into avian embryos. EGFP expression in the gonads of 14-day embryos.

[0081] Figure 5 : DNA encoding EGFP and a multi-warhead construct containing multiple sequences encoding shRNAs complexed with Lipofectamine 2000 were injected directly into chicken broiler line embryos. Fluorescence images from 12 day gonads.

[0082] Figure 6 : DNA encoding EGFP, multi-warhead constructs and extended hairpin constructs complexed with Lipofectamine 2000 were injected directly into layer line chicken embryos. Fluorescence image of embryonic gonads 14 days after direct injection.

[0083] Figure 7 : Tol2-EGFP construct was directly injected with each of two multi-shRNA expression cassettes (pMAT084 and pMAT085). Images of 10 gonads removed at 14 days showing EGFP expression.

[0084] Figure 8 : Gel electrophoresis of screening PCR products, indicating that PB shRNA integrates into directly injected embryos. Five days after direct injection of ZFN and repair plasmid (containing PB shRNA), DNA was extracted from samples enriched with PGCs from ZFN-treated embryos and from control embryos. Screening PCR was then performed to detect integration of PB shRNA into the genome. Lane 1 shows PB-injected embryos, lane 2 is a control embryo, lane 3 is a ZFN-treated cell (positive control), and lane 4 is a water control.

[0085] Key to sequence listing

[0086] SEQ ID NO:1 - Tol2 EGFP construct polynucleotide sequence

[0087] SEQ ID NO:2—Tol2 transposase amino acid sequence

[0088] SEQ ID NO:3 - Oligonucleotide primer for Screen 7

[0089] SEQ ID NO:4 - Oligonucleotide primer for Screen 6

[0090] SEQ ID NO:5—miniTol2 forward oligonucleotide primer

[0091] SEQ ID NO:6—miniTol2 reverse oligonucleotide primer

[0092] SEQ ID NO:7—miniTol2 detection probe

[0093] SEQ ID NO:8 - Genomic control region forward primer

[0094] SEQ ID NO:9 - Genomic control region reverse primer

[0095] SEQ ID NO: 10 - Genomic control region probe DETAILED DESCRIPTION OF THE INVENTION

[0096] General Techniques and Definitions

[0097] Unless otherwise specifically defined, all technical and scientific terms used herein should be understood to have the same meaning as commonly understood by one of ordinary skill in the art (e.g., protein chemistry, biochemistry, cell culture, molecular genetics, microbiology, and immunology).

[0098] Unless otherwise indicated, the recombinant DNA and protein, cell culture and immunological techniques used in the present invention are standard procedures well known to those skilled in the art. The techniques are described and explained throughout the following references, for example, J. Perbal, A Practical Guide to Molecular Cloning, John Wiley and Sons (1984), J. Sambrook et al., Molecular Cloning: A Laboratory Manual, 3 rdedn, Cold Spring Harbour Laboratory Press (2001), R. Scopes, Protein Purification – Principals and Practice, 3 rd edn, Springer (1994), T. A. Brown (editor), Essential Molecular Biology: A Practical Approach, Volumes 1 and 2, IRL Press (1991), D. M. Glover and B. D. Hames (editors), DNA Cloning: A Practical Approach, Volumes 1 - 4, IRL Press (1995 and 1996), and F. M. Ausubel et al. (editors), Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley - Interscience (1988, including all updates to date), Ed Harlow and David Lane (editors) Antibodies: A Laboratory Manual, Cold Spring Harbour Laboratory, (1988), and J. E. Coligan et al. (editors) Current Protocols in Immunology, John Wiley & Sons (including all updates to date).

[0099] As used herein, the term "avian" refers to any species, subspecies or variety of organisms in the taxonomic class Aves, such as, but not limited to, chickens, turkeys, ducks, geese, quail, pheasants, parrots, finches, hawks, crows and runners (including ostriches, emus and cassowaries). The term includes the various known strains of Gallus gallus (chicken), such as White Leghorn, Brown Leghorn, Barred-Rock, Sussex, New Hampshire, Rhode Island, Australorp, Minorca, Amrox, California Gray, Italian Partidge-colored, as well as breeds of turkeys, pheasants, quail, ducks, ostriches and other poultry commonly raised on a commercial scale.

[0100] The term "poultry" includes all birds raised, harvested or domesticated for their meat or eggs, such as chickens, turkeys, ostriches, game hens, squabs, guinea fowl, pheasants, quail, ducks, geese and cassowaries (emu).

[0101] As used herein, a "genetically modified avian" or "transgenic avian" refers to any avian in which one or more cells of the avian contain a heterologous nucleic acid introduced by human intervention.

[0102] Direct injection technique

[0103] The germ cell line in chickens starts when cells from the ectoderm of stage X embryos enter the nascent endoderm (Kagami et al., 1997; and Petitte, 2002). As the endoderm develops forward, the pre-primordial germ cells are pushed forward into the germ crescent, where they can be identified as large glycogen-filled cells. The earliest identification of cells in the germ cell line by these morphological criteria is about 8 hours after the start of hatching (stage 4 of the staged system established by Hamburger and Hamilton, (1951)). From stage 4 until it migrates through the vasculature during stages 12-17, the primordial germ cells are located in the germ crescent. During this time, the primordial germ cells are small colonies of about 200 cells. As the gonads differentiate, the primordial germ cells migrate from the vasculature into the gonadal ridge and integrate into the ovary or testis.

[0104] Germline chimeric chickens have been produced before by transplanting donor PGCs and gonadal germ cells from different developmental stages (blastocyst to 20-day embryos) into recipient embryos. Methods for obtaining transgenic chickens from long-term cultures of avian primordial germ cells (PGCs) have also been documented in, for example, U.S. Patent Application 20060206952. When combined with host avian embryos by known procedures, these modified PGCs are transported through the germline to produce genetically modified offspring.

[0105] Compared with the commonly used prior art methods that rely on harvesting PGCs from donor embryos, the method of the present invention includes injecting the transfection mixture directly into avian embryos. Therefore, the method of the present invention can be used to transfect avian germ cells including PGCs and embryonic germ cells.

[0106] Transfection mixture

[0107] In the method of the present invention, the polynucleotide is compounded or mixed with a suitable transfection reagent. The term "transfection reagent" as used herein refers to a composition added to the polynucleotide for enhancing the absorption of the polynucleotide by eukaryotic cells including but not limited to avian cells such as primordial germ cells. Although any transfection reagent suitable for transfecting eukaryotic cells known in the art can be used, the inventors have found that transfection reagents comprising cationic lipids are particularly suitable for the method of the present invention. Therefore, in a preferred embodiment, the monovalent cationic lipid is selected from one or more of the following: DOTMA (N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride), DOTAP (1,2-bis(oleoyloxy)-3-3-(trimethylamino)propane), DMRIE (1,2-ditetradecyloxypropyl 3-dimethyl-hydroxyethylammonium bromide) or DDAB (dimethyldioctadecyl ammonium bromide). Preferred multivalent cationic lipids are lipospermines, in particular DOSPA (2,3-dioleyloxy-N-[2-(sperminecarboxylic acid amide) ethyl]-N,N-dimethyl-1-propylammonium trifluoroacetate) and DOSPER (1,3-dioleoyloxy-2-(6-carboxysperminyl) propionamide), as well as di- and tetraalkyltetramethylspermines, including but not limited to TMTPS (tetramethyltetrapalmitoylspermine), TMTOS (tetramethyltetraoleylspermine), TMTLS (tetramethyltetralaurylspermine), TMTMS (tetramethyltetramyristylspermine) and TMDOS (tetramethyldioleylspermine). The cationic lipids are optionally combined with non-cationic lipids, in particular neutral lipids, such as the following lipids: DOPE (dioleoylphosphatidylethanolamine), DPhPE (diphytanoylphosphatidylethanolamine) or cholesterol. Cationic lipid compositions consisting of a 3:1 (w / w) mixture of DOSPA and DOPE or a 1:1 (w / w) mixture of DOTMA and DOPE are typically used in the methods of the present invention. Non-limiting examples of suitable commercially available transfection reagents comprising cationic lipids include Lipofectamine (Life Technologies) and Lipofectamine 2000 (Life Technologies).

[0108] In general, any dendrimer useful for introducing nucleic acids into any cell, particularly eukaryotic cells, can be used in the methods of the present invention. Dendrimers of generation 5 or higher (G5 or higher) are preferred, with dendrimers of generation G5-G10 being of particular interest. Dendrimers useful in the present invention include those having NH 3 or ethylenediamine core dendrimers, GX(NH 3) or GX(EDA), where X = number of generations. Preferred dendrimers are those where X = 5-10. Dendrimers useful in the present invention include those where the repeating units of the internal layers are amides (to form polyamides, i.e., PAMAM). Useful dendrimers include those where the terminal functional groups at the outer surface of the dendrimer provide a positive charge density, such as terminal amino functional groups. The surface charge and chemical properties of the outer surface of the dendrimer can be varied by changing the functional groups on the surface, such as by reacting some or all of the surface amino groups. Of particular interest are dendrimers that have been functionalized by reaction with positive amino acids such as lysine or arginine. Grafted dendrimers are described, for example, in PCT applications WO 9622321 and WO9631549, and mentioned in U.S. Pat. No. 5,266,106, which can be used in the methods of the present invention. Activated dendrimers (Haensler and Szoka, 1993; and Tang et al., 1996) can also be used in the methods of the present invention.

[0109] The transfection reagent may further comprise peptide sequences from viruses, bacteria or animal proteins and other sources, including peptides, proteins or fragments or parts thereof that can enhance the transfection efficiency of eukaryotic cells, and the transfection is mediated by a transfection reagent comprising a cationic lipid and a dendrimer. The peptides are described in US20030069173 and include, for example, viral peptides or proteins of influenza virus, adenovirus, Semliki forest virus, HIV, hepatitis, herpes simplex virus, vesicular stomatitis virus or simian virus 40, more specifically, any of the aforementioned RGD peptide sequences, NLS peptide sequences and / or VSVG peptide sequences and modified peptides or proteins.

[0110] The polynucleotide can be mixed (or "complexed") with the transfection reagent according to the manufacturer's instructions or known protocols. For example, when transfecting plasmid DNA with Lipofectamine 2000 transfection reagent (Invitrogen, Life Technologies), the DNA can be diluted into 50 μl of Opit-MEM medium and gently mixed. The Lipofectamine 2000 transfection reagent is gently mixed and diluted into 50 μl of Opit-MEM medium at an appropriate level. After incubation for 5 minutes, the diluted DNA and transfection reagent are combined and gently mixed for 20 minutes at room temperature.

[0111] The transfection mixture of suitable volume can then be directly injected into avian embryos according to the method of the present invention. Although the suitable volume can be determined by factors such as the embryonic stage and the avian species to be injected, the suitable volume for injection into avian embryos is generally about 1 μl to about 3 μl. It will be appreciated by those skilled in the art that the protocol for mixing the transfection reagent and DNA, and the volume to be injected into the avian embryo can be optimized according to the teachings of this specification.

[0112] Injection into embryos

[0113] Prior to injection, the eggs are incubated at a temperature suitable for embryonic development, e.g., about 37.5 to 38° C., with the taglion facing up, for about 2.5 days (stages 12-17), or until the blood vessels in the embryo are of sufficient size to allow injection. The optimal time for injection of the transfection mixture is during PGC migration, which typically occurs around stage 12-17, but more preferably stage 13-14. It will be appreciated by those skilled in the art that broiler strain chickens typically have faster growing embryos, so injection should preferably occur early in stage 13-14 to allow the transfection mixture to be introduced into the bloodstream during PGC migration.

[0114] In order to access the blood vessels of the avian embryo, a hole is made in the eggshell. For example, a hole of about 10 mm can be made in the pointed end of the egg using a suitable tool such as forceps. The shell portion and the associated membranes are carefully removed while avoiding damage to the embryo and its membranes.

[0115] The micropipette made of siliconized glass capillaries can be used to inject the transfection mixture into the blood vessels of avian embryos. Typically, the micropipette is elongated or "pulled out" with a needle puller, and the tip is beveled to a diameter (inner opening) of about 10 μm to about 50 μm, more preferably a diameter of about 25 μm to about 30 μm, with the assistance of a pipette grinder. The micropipette is usually ground to a diameter of about 25 μm to about 30 μm, so that PGC is injected into avian embryos. It will be appreciated by those skilled in the art that since the transfection mixture does not contain cells, a narrower diameter can be used for the method of the present invention. The micropipette produced in this way is also referred to as a "drawn glass capillary".

[0116] A brushed glass capillary is loaded with about 1-3 μl of transfection complex. It can be injected into any blood vessel of sufficient size to accommodate the capillary, such as the iliac artery or dorsal aorta, or any other blood vessel of sufficient size to accommodate the capillary. Air pressure can be used to expel the transfection complex from the capillary into the blood vessel.

[0117] Following the injection of the transfection mixture into the blood vessels of the avian embryo, the egg is sealed with a sufficient amount of parafilm or other suitable sealing membrane known in the art. For example, if a 10 mm hole is opened in the shell, a square piece of about 20 mm parafilm can be used to cover the hole. A warm surgical blade can then be used to adhere the parafilm to the outer surface of the egg. The egg is then flipped to a position with the pointed end facing downward and incubated at a temperature sufficient to allow the embryo to develop, for example until subsequent analysis or hatching.

[0118] As used herein, the phrases "temperature sufficient to allow the embryo to develop" and "temperature sufficient to allow the embryo to develop into a bird" refer to the incubation temperature required for the avian embryo to continue to develop in the egg, preferably to develop into a bird ready to hatch. Suitable incubation temperatures can be determined by those skilled in the art. For example, eggs are usually incubated at about 35.8 to about 38°C. Incubators are commercially available that control the incubation temperature at a desired level, such as 37.9°C from 1 to 6 days after egg laying, about 37.6°C for 9 and 10 days, about 37.5°C for 11 and 12 days, about 37.4°C for 13 days, about 37.3°C for 14 and 15 days, about 37.2°C for 16 days, about 37.1°C for 17 days, and can be reduced to about 35.8°C for 22 days.

[0119] Genomic integration of polynucleotides

[0120] To facilitate integration of the polynucleotide into the genome of avian germ cells, transposons, zinc finger nucleases or other non-viral constructs or vectors are preferably used in the methods of the present invention.

[0121] Examples of suitable transposons include Tol2 (Kawakami et al., 2002), mini-Tol2, SleepingBeauty (Ivics et al., 1997), PiggyBac (Ding et al., 2005), Mariner and Galluhop. The Tol2 transposon was first isolated from the medaka fish Oryzias latipes and belongs to the hAT family transposon, which is described in Kawakami et al. (2000). Mini-Tol2 is a variant of Tol2 and is described in Balciunas et al. (2006). When acting together with the Tol2 transposase, the Tol2 and Mini-Tol2 transposons facilitate the integration of transgenes into the genome of the organism. By delivering the Tol2 transposase via a separate non-replicating plasmid, only the Tol2 or Mini-Tol2 transposon and the transgene are integrated into the genome, and the plasmid containing the Tol2 transposase is lost in a limited number of cell divisions. Therefore, the integrated Tol2 or Mini-Tol2 transposon no longer has the ability to carry out subsequent transposition events. In addition, since Tol2 is not known to be a naturally occurring avian transposon, there is no endogenous transposase activity in avian cells, such as chicken cells, to cause further transposition events. It is understood in the art that RNA encoding the Tol2 transposase can be included in the transfection mixture to replace the DNA plasmid encoding the transposase. Therefore, the Tol2 transposon and transposase are particularly suitable for use in the method of the present invention.

[0122] Any other suitable transposon system can be used in the method of the invention. For example, the transposon system can be the Sleeping Beauty, Frog Prince or Mos1 transposon system, or any transposon belonging to the tc1 / mariner or hAT family of transposons can be used.

[0123] Those skilled in the art will appreciate that it is desirable to include extra genetic elements in the construct to be injected into avian embryos.The example of the extra genetic elements that can be included in the nucleic acid construct comprises reporter gene, for example one or more fluorescent marker proteins such as the gene of GFP or RFP, the enzyme that is easy to measure, for example beta-galactosidase, luciferase, beta-glucuronidase, chloramphenicol acetyltransferase or secreted embryonic alkaline phosphatase, or have the protein for its ready-made immunoassay, for example hormone or cytokine.Other genetic elements that can be used for embodiments of the present invention comprise the genetic elements of coded proteins, and the protein gives cell selective growth advantage, for example adenosine deaminase, aminoglycoside phosphotransferase, dihydrofolate reductase, hygromycin-β-phosphotransferase, or drug resistance.

[0124] Genome editing technology can also be used in the method of the present invention. For example, the genome editing technology can be a targeted nuclease. The term "targeted nuclease" used herein includes naturally occurring proteins or modified proteins. In one embodiment, the targeted endonuclease can be a meganuclease. A meganuclease is an endodeoxyribonuclease characterized by a long recognition sequence, i.e., the recognition sequence is generally about 12 base pairs to about 40 base pairs. As a result of this requirement, the recognition sequence usually only appears once in any given genome. Among the meganucleases, the homing endonuclease family named LAGLIDADG has become a valuable tool for genome and genome editing research. By modifying the recognition sequence of a meganuclease using techniques well known to those skilled in the art, a meganuclease can be targeted to a specific chromosome sequence.

[0125] In another embodiment, the "targeted nuclease" is a zinc finger nuclease. Zinc finger nucleases (ZFNs) are artificial nucleases made by fusing zinc finger DNA binding domains with DNA cleavage domains. The zinc finger domains can be modified to target desired DNA sequences, which allows zinc finger nucleases to target unique sequences in complex genomes. By utilizing endogenous DNA repair machinery, these agents can be used to precisely alter the genomes of higher organisms. Zinc finger nucleases are known in the art and are described, for example, in U.S. Pat. No. 7,241,574, and are also reviewed in Durai et al. (2005) and Davis and Stokoe (2010).

[0126] Prior to the present invention, it was expected that in order to modify PGCs using zinc finger nuclease technology, zinc finger constructs would be introduced into cultured PGCs. Transfected cells containing the desired insertion / modification could then be selected and cloned. The sorted and cloned cells would be injected into recipient embryos from which PGCs had been removed.

[0127] The inventors surprisingly found that direct injection of zinc finger nuclease constructs into avian embryos resulted in specific genomic modifications that were detectable in the gonads of 14-day transfected embryos. This finding was surprising because one would expect the combined levels of transfection efficiency and zinc finger nuclease activity to be too low to detect specific modifications in directly injected embryos. Given the specificity of targeting the intended DNA sequence, and the inventors' discovery that the combination of zinc finger nucleases and transfection reagents injected directly into embryos achieved higher than expected levels of efficiency, zinc finger nucleases are particularly suitable for introducing polynucleotides into the genome of avian germ cells in the methods of the present invention.

[0128] In another embodiment, the targeting endonuclease can be a transcription activator-like effector (TALE) nuclease (see, e.g., Zhang et al., 2011). TALEs are transcription factors from plant pathogens Xanthomonas that are easily modified to bind new DNA targets. TALEs or truncated forms thereof can be linked to the catalytic domain of an endonuclease such as Fok1 to create a targeting endonuclease called a TALE nuclease or TALEN.

[0129] In another embodiment, the "targeted nuclease" is a clustered regularly interspaced short palindromic repeat (CRISPR) nuclease (Barrangou, 2012). CRISPR is a microbial nuclease system involved in the defense against invading phages and plasmids. The CRISPR locus in the microbial host contains a combination of CRISPR-associated (Cas) genes and non-coding RNA elements that can program CRISPR-mediated nucleic acid cleavage. Three types (I-III) of CRISPR systems have been identified in a wide range of bacterial hosts. A major feature of each CRISPR locus is the presence of a large number of repetitive sequences (direct repeats) spaced by short fragments of non-repetitive sequences (spacers). The non-coding CRISPR array is transcribed and cut in direct repeats to form a short crRNA containing a single spacer sequence, which directs the Cas nuclease to the target site (protospacer sequence).

[0130] Type II CRISPR is one of the best understood systems (see, for example, Cong et al., 2013), which performs targeted DNA double-strand breaks in four sequential steps. First, two non-coding RNAs, the pre-crRNA array and the tracrRNA, are transcribed from the CRISPR locus. Second, tracrRNA hybridizes with the repeat region of the pre-crRNA and mediates the processing of the pre-crRNA into a mature crRNA containing a single spacer sequence. Third, the mature crRNA:tracrRNA complex directs Cas9 to the target DNA through the Wastson-Crick base pairing between the spacer on the crRNA and the pre-spacer sequence on the target DNA next to the pre-spacer sequence adjacent motif (PAM), which is an additional requirement for target recognition. Finally, Cas9 mediates the cutting of the target DNA to produce double-strand breaks in the pre-spacer sequence. The CRISPR system can also be used to produce single-strand breaks in the genome. Therefore, the CRISPR system can be used for RNA-guided site-specific genome editing.

[0131] Polynucleotide

[0132] The method of the present invention can be used to integrate a polynucleotide into the genome of avian primordial germ cells, and the polynucleotide can be passed to genetically modified offspring. The polynucleotide integrated into the genome can confer the desired function or activity of the genetically modified cell comprising the polynucleotide, such as modifying production traits or increasing disease resistance. Therefore, the polynucleotides that can be integrated into the genome of the germ cell include polynucleotides encoding short interfering RNA (siRNA), short hairpin RNA (shRNA), extended short hairpin RNA (ehRNA), catalytic RNA such as ribozymes, RNA baits, and polynucleotides encoding endogenous or exogenous polypeptides such as polypeptides that can be used to regulate avian production traits or increase avian disease resistance.

[0133] Therefore, in some embodiments, the methods of the present invention can be used to modify any trait of poultry. Preferred traits that can be modified include production traits and disease resistance. The term "production trait" as used herein refers to any poultry phenotype with commercial value, such as muscle quality, sex, disease resistance or nutritional content. Preferred traits that can be modified according to the methods of the present invention include sex, muscle quality and disease resistance. Examples of genes that can be targeted to modify sex as a poultry production trait include DMRT1, WPKCI (ASW), R-spondin, FOX9, aromatase, AMH and β-catenin.

[0134] As used herein, the term "muscle mass" refers to the weight of muscle tissue. Increases in muscle mass are determined by weighing the total muscle tissue of a bird hatched from an egg treated as described herein, compared to a bird from the same species, more preferably the same strain or breed of avian, even more preferably the same bird (not administered the nucleic acid defined herein). Alternatively, specific muscles such as breast and / or leg muscles can be used to identify increases in muscle mass. Genes that can be targeted for regulating muscle mass include, for example, the myostatin gene.

[0135] RNA interference

[0136] In certain embodiments, the methods of the present invention utilize nucleic acid molecules encoding double-stranded regions for RNA interference, thereby regulating avian traits. The terms "RNA interference," "RNAi" or "gene silencing" generally refer to a method in which a double-stranded RNA molecule reduces the expression of a nucleic acid sequence that the double-stranded RNA molecule shares substantial or complete homology with. However, it has been demonstrated that RNA interference can be achieved using non-RNA double-stranded molecules (see, e.g., US 20070004667).

[0137] The double-stranded region should be at least 19 continuous nucleotides, for example about 19-23 nucleotides, or can be longer, for example 30 or 50 nucleotides, or 100 nucleotides or more. The full-length sequence corresponding to the entire gene transcript can be used. Preferably, they are about 19 to about 23 nucleotides long.

[0138] The degree of identity of the double-stranded region of the nucleic acid molecule to the targeted transcript should be at least 90%, more preferably 95-100%.The nucleic acid molecule may of course contain unrelated sequences, which may serve to stabilize the molecule.

[0139] As used herein, the term "short interfering RNA" or "siRNA" refers to a nucleic acid molecule comprising ribonucleotides that are capable of inhibiting or down-regulating gene expression, for example by mediating RNAi in a sequence-specific manner, wherein the double-stranded portion is less than 50 nucleotides in length, preferably about 19 to about 24 nucleotides in length. For example, the siRNA can be a nucleic acid molecule comprising self-complementary sense and antisense regions, wherein the antisense region comprises a nucleotide sequence that is complementary to a nucleotide sequence in a target nucleic acid molecule or a portion thereof, and the sense region has a nucleotide sequence that corresponds to a target nucleic acid sequence or a portion thereof. The siRNA can be assembled from two separate oligonucleotides, wherein one strand is a sense strand and the other strand is an antisense strand, wherein the antisense strand and the sense strand are self-complementary.

[0140] The term siRNA as used herein is meant to be equivalent to other terms used to describe nucleic acid molecules capable of mediating sequence-specific RNAi, such as micro-RNA (miRNA), short hairpin RNA (shRNA), short interfering oligonucleotides, short interfering nucleic acids (siNA), short interfering modified oligonucleotides, chemically modified siRNA, post-transcriptional gene silencing RNA (ptgsRNA) and others. In addition, the term RNAi as used herein is meant to be equivalent to other terms used to describe sequence-specific RNA interference, such as post-transcriptional gene silencing, translation inhibition, or epigenetics. For example, the siRNA molecules described herein can be used to epigenetically silence genes at the post-transcriptional level or the pre-transcriptional level. In a non-limiting example, the epigenetic regulation of gene expression by the siRNA molecules described herein can be due to siRNA-mediated chromatin structure modifications that change gene expression.

[0141] "shRNA" or "short hairpin RNA" means an RNA molecule in which less than about 50 nucleotides, preferably about 19 to about 23 nucleotides, are base paired with a complementary sequence located on the same RNA molecule, and wherein the sequence and the complementary sequence are separated by an unpaired region of at least about 4 to about 15 nucleotides that forms a single-stranded loop over a stem structure established by the two base complementary regions.

[0142] Included shRNAs are two-finger or multi-finger hairpin dsRNAs, where the RNA molecule contains two or more such neck-loop structures separated by a single-stranded spacer region.

[0143] MicroRNA regulation is a specialized branch of the RNA silencing pathway that has evolved away from traditional RNAi / PTGS and toward gene regulation. MicroRNAs are a specific class of small RNAs that are encoded in gene-like elements composed of unique inverted repeat sequences. When transcribed, microRNA genes produce collar-loop precursor RNAs, from which microRNAs are subsequently processed. MicroRNAs are typically about 21 nucleotides long. The released miRNAs integrate into a RISC-like complex containing a group of specific Argonaute proteins, demonstrating sequence-specific gene repression.

[0144] Disease resistance

[0145] The methods of the present invention can be used to integrate polynucleotides that confer disease resistance to cells into the primordial germ cell genome of avian embryos. For example, the polynucleotides can encode nucleic acid molecules, such as siRNA, shRNA or miRNA, which reduce host or pathogen gene expression, resulting in reduced viral replication in cells in which the polynucleotides are present. As used herein, "viral replication" refers to the amplification of the viral genome in a host cell, the packaging of the viral genome in a cell, and / or the release of infectious viral particles from a cell.

[0146] Alternatively, the polynucleotide may encode an RNA bait. RNA baits are known in the art and contain specific nucleotide base sequences that bind to viral proteins necessary for the replication of pathogenic viruses. RNA baits targeting HIV proteins were first described by Sullenger et al. (1990). However, it will be appreciated by those skilled in the art that RNA baits may be designed to target proteins that play a role in the replication of avian viral pathogens, such as RNA baits targeting influenza virus polymerase complex proteins.

[0147] Preferably, the genetically modified poultry comprising the polynucleotide will have increased resistance to viral pathogens by reducing viral replication in poultry cells. A poultry that is "resistant" or has "increased resistance" to a pathogen or viral pathogen herein exhibits reduced or no disease symptoms when exposed to the pathogen compared to susceptible poultry. Using the methods of the present invention, poultry can be resistant to pathogens such as, but not limited to, influenza virus, Marek's disease virus, Newcastle disease virus, and infectious bursal disease virus.

[0148] Production of recombinant proteins in ovo

[0149] Petitte and Modziak (2007) documented domestic hens as "very efficient protein bioreactors". Recognizing that avian eggs contain large amounts of protein, with more than half of the protein, either albumin or albumin, being composed of a single species, there is great potential for producing recombinant or heterologous proteins in eggs. The art is well aware of the difficulties faced by prior art methods of producing transgenic poultry for producing therapeutic proteins in eggs. Despite the use of undesirable lentiviral systems, the production of transgenic birds has been achieved that store high levels of commercially relevant proteins in eggs. Thus, the methods of the present invention can be used to produce genetically modified birds that express heterologous or recombinant polypeptides in eggs. Proteins of commercial importance that can be produced in eggs include therapeutic proteins, such as antibodies and vaccine antigens.

[0150] Production and breeding of genetically modified poultry

[0151] The methods of the present invention include methods for breeding genetically modified poultry and methods for producing food from genetically modified poultry. It will be appreciated by those skilled in the art that the poultry of the present invention comprising genetically modified germ cells can be germ cell line mosaic because only some of the germ cells that migrate into the gonads are genetically modified. Therefore, poultry comprising genetically modified germ cells can be bred to produce offspring in which all cells are genetically modified. Therefore, in one embodiment, the present invention provides a method for producing genetically modified poultry, the method comprising: (i) obtaining poultry comprising germ cells genetically modified according to the present invention; (ii) breeding offspring from the poultry comprising genetically modified germ cells; and (iii) selecting offspring comprising a polynucleotide inserted into the genome.

[0152] The poultry comprising the genetically modified germ cells of the present invention, and the poultry genetically modified according to the present invention can be used for food production. Therefore, the method of the present invention can be used to produce poultry products for human and animal consumption. Methods for producing food from poultry are well known in the art and may include harvesting meat and / or eggs from poultry, such as but not limited to chickens. In certain embodiments, the poultry is genetically modified to include a polynucleotide that regulates production traits. Example

[0153] Example 1: Direct injection of EGFP expression construct into embryos

[0154] 5.1 μg of a nucleic acid construct encoding enhanced GFP (EGFP) flanked by Tol2 sequences and 1.0 μg of a plasmid encoding Tol2 transposase were complexed with 3 μl of Lipofectamine 2000. Complexation of nucleic acid and transfection reagent was performed in a total volume of 90 μl of OptiMEM or OptiPRO medium using the incubation time recommended by the manufacturer (Life Technologies).

[0155] After the final 20 minutes of incubation, 1-3 μl of the complex was injected into the blood vessels of 2.5 day old chick embryos (stages 13-17, Hamburger and Hamilton, 1951). No blood removal was required. The embryo was accessed by removing a small portion (10 mm) of the shell. After injection, the hole was sealed with a 20 mm square of parafilm.

[0156] At 7 and 14 days, different levels of EGFP expression were observed in most gonads. Cells isolated from gonads and green cells were also confirmed to be PGCs ( Figure 1-3 ).

[0157] Example 2: Optimizing the ratio of DNA to transfection reagent in vitro

[0158] The optimal ratio of DNA:Lipofectamine 2000 and the volume of medium constituting the transfection complex were experimentally tested. DNA constructs encoding EGFP and single hairpin (shRNA) flanked by Tol2 sequences were complexed with Lipofectamine 2000 in OptiMEM volumes of 50, 40, 30 or 20 μl. The ratios of DNA (μg) to Lipofectamine 2000 (μl) used were as follows: 1:2, 2:4 and 4:8.

[0159] The complex was transfected into chicken fibroblasts (DF-1) and analyzed for EGFP expression. The results (not shown) showed that a 1:2 ratio of DNA (μg): Lipofectamine 2000, 30 μl medium was slightly better than a 2:4 ratio, 50 μl medium.

[0160] The in vitro data were then validated in embryos. 0.33 μg of the DNA construct containing the Tol2 transposon, 0.66 μg of the transposase plasmid, and 2 μl of Lipofectamine 2000 were complexed in OptiMEM and injected directly into chick embryos. All surviving embryos had good EGFP expression levels at day 14 ( Figure 4 ).

[0161] Example 3: Testing FuGene transfection reagent

[0162] FuGene (Promega) was tested as a transfection reagent using a DNA:Fugene ratio similar to that recommended by the manufacturer for cell culture transfection. The DNA construct complexed with FuGene contained an EGFP expression cassette flanked by Tol2 sequences. The complex (0.66 μg EGFP-Tol2 construct, 1.33 μg transposase plasmid, 6 μl FuGene) was injected directly into 15 embryos. One of the embryos showed very low levels of EGFP expression in the gonads at day 14. The experiment was repeated and all 10 injected embryos were still alive at day 12. Two of the embryos had several green cells in their gonads.

[0163] Example 4: Direct injection into transformed meat product system

[0164] Since the previous direct injection experiments were conducted on egg-laying strains of chickens, the purpose of this experiment was to test whether this direct injection method could be used to successfully transform broiler strains of chickens. The EGFP expression construct containing a single hairpin and flanking Tol2 sequences was complexed with Lipofectamine 2000 (0.33 μg transposon construct, 0.66 μg transposase, 2 μl Lipofectamine 2000) and injected directly into the dorsal aorta of chicken embryos. Twelve of the 13 injected embryos survived at 10 days and considerable EGFP expression was detected in most gonads.

[0165] The experiment was repeated using an EGFP expression construct containing multiple hairpins (shRNA) (0.33 μg transposon, 0.66 μg transposase, 2 μl lipofectamine 2000). A considerable amount of EGFP expression was found in 12-day embryos.

[0166] Example 5: Comparison of OptiMEM and OptiPRO as transfection reagent culture medium

[0167] Comparison of OptiMEM (containing animal products), OptiPRO (free of animal products) and PBSA as transfection reagent media. An EGFP expression construct containing flanking Tol2 sequences was complexed with a transfection reagent (0.33 μg transposon, 0.66 μg transposase, 2 μl lipofectamine 2000) and injected directly into chick embryos. All embryos showed some green color in the gonads at 12 days, and the medium used did not affect mortality. OptiMEM and OptiPRO produced comparable results, while PBSA resulted in a significant reduction in the expression of EGFP in the gonads.

[0168] Example 6. Injection of egg-laying chicken strains with multi-warhead constructs

[0169] Two DNA constructs were complexed with transfection reagents and injected directly into chick embryos. The first DNA construct contained an EGFP expression cassette and multiple shRNA hairpins flanked by Tol2 sequences, and the second construct contained an EGFP expression construct and a single extended hairpin cassette encoding three double-stranded regions. The constructs were complexed with transfection reagents in the following amounts: 0.33 μg transposon, 0.66 μg transposase, 2 μL liposome 2000. At 14 days, EGFP expression was found in most embryonic gonads for both constructs.

[0170] Example 7: Testing the persistence of Tol2-EGFP

[0171] The DNA construct containing the EGFP expression cassette, the multiple hairpins and the Tol2 flanking genes was complexed with the transfection reagent (0.33 μg transposon, 2 μL Lipofectamine 2000). The transfection complex without transposase was directly injected into chicken embryos.

[0172] Embryos lacking the transposase still showed green cells in some embryos, but fewer than when the transposase was included. This suggests that the plasmid can be retained in gonadal cells for at least 2 weeks after direct injection and that not all of the observed green color is due to integration of Tol2 into the genome.

[0173] Example 8: Animal-free liposomes

[0174] The EGFP expression cassette with Tol2 and multiple shRNA expression cassettes was complexed with an animal product-free transfection reagent (Lipofectamine 2000CD) (0.33 μg transposon, 0.66 μg transposase, 2 μL Lipofectamine 2000CD). At day 14, all 10 embryos tested had abundant EGFP expression in the gonads ( Figure 7 ).

[0175] Example 9: Direct injection at 3.5 days

[0176] In all previous experiments, transfection complex injections were performed at 2.5 days. The aim of this experiment was to test direct injection into embryos at another time (3.5 days). DNA constructs containing EGFP expression constructs and Tol2 were complexed with Lipofectamine 2000 CD (0.33 μg transposon, 0.66 μg transposase, 2 μl Lipofectamine 2000 CD).

[0177] At day 14, 8 of 21 embryos had low levels of EGFP expression in the gonads. Therefore, the timing of direct injection at day 2.5 is important, as no efficient PGC transfection was observed with direct injection at day 3.5.

[0178] Example 10: Changing the ratio of transposon to transposase

[0179] While maintaining the ratio of DNA:Lipofectamine 2000 CD:medium, we increased the proportion of transposon in the DNA mixture while slightly reducing the proportion of transposase plasmid. Since future experiments will require the injection of more eggs, we used slightly different volumes. The inventors also tested removing blood from the embryos before injecting the transfection mixture to determine if this would allow injection of an increased volume of the mixture.

[0180] The DNA construct containing the EGFP expression cassette and Tol2 was complexed with the transfection reagent (0.66 μg transposon, 1.0 μg transposase, 3 μl Lipofectamine 2000 CD). At 14 days, the pre-bled embryos had similar levels of EGFP expression in the gonads compared to embryos that were not pre-bled. The new DNA ratio worked well and good EGFP expression levels were observed.

[0181] Example 11: JetPEI transfection reagent

[0182] For JetPEI, a DNA construct containing an EGFP expression cassette and Tol2 was complexed with a transfection reagent (4 μg transposon, 6 μg transposase, 1.6 μl JetPEI (Polyplus transfection)) in 50 μl OptiPRO (containing 5% glucose). JetPEI caused blood coagulation during transfection, but this did not affect embryo viability. Green cells were found in these embryos and gonads, but most were different from the transformed PGC phenotype seen when transfected with Lipofectamine 2000.

[0183] A second experiment was performed to test the JetPEI transfection reagent. Two reaction mixtures were used: i) 0.66 μg transposon, 1.0 μg transposase, 0.5 μl JetPEI in 100 μl OptiPRO (containing 5% glucose); and ii) 1.32 μg transposon, 2.0 μg transposase, 0.5 μl JetPEI in 100 μl OptiPRO (containing 5% glucose).

[0184] JetPEI causes blood coagulation during transfection, and the reaction mixture (ii) leads to improved embryonic viability. Some EGFP expression is found again in the gonads, but the cell type is not like PGC again. The gonads are taken out, the cells are isolated and stained for PGC markers. No green cells show staining for PGC markers, which indicates that PGCs are not transfected by the JetPEI complex.

[0185] Example 12: Zinc Finger Nuclease

[0186] The purpose of this experiment was to determine whether zinc finger nuclease plasmids could be used to transform PGCs by direct injection. The DNA used in this experiment contained two zinc finger nuclease plasmids and overlapping fragments, which were complexed with the transfection reagent 0.5 μg of each plasmid, 3 μl of Lipofectamine 2000 CD in 90 μl OptiPRO.

[0187] Since EGFP is not present on the plasmid, the inventors relied on a PCR test that will amplify the fragment only when the overlapping fragment has been integrated into the chicken genome. After 14 days of incubation, the gonads were removed, the PGCs were enriched using an antibody sorting method, and genomic DNA was prepared. PCR showed that the overlapping fragments had been integrated into the chicken genome. These results confirm that zinc finger nucleases are suitable for integrating DNA into the avian PGC genome using the direct injection method of the present invention.

[0188] Example 13: Results

[0189] Following the protocol outlined above, the inventors saw significant transformation of PGCs in recipient embryos, and to a greater degree than the methods of transfecting PGCs described in the prior art. By staining cells with PGC-specific markers, the inventors confirmed that most of the transformed cells in the gonads were PGCs. The inventors cultured recipient embryos to sexual maturity and were able to detect Tol2 transposon sequences in >90% of adult male semen.

[0190] Other transfection reagents were used, however lipid based reagents resulted in better transfection of PGCs. JetPEI did transfect cells by this method, but it was not possible to confirm that any of the transfected cells were PGCs. FuGene transfected cells at a very low rate.

[0191] Example 14: Direct injection of zinc finger nucleases to modify genomes

[0192] Zinc finger nucleases (ZFNs) targeting a region within intron 5 of the PANK1 gene were injected into embryos along with a plasmid containing the anti-influenza shRNA PB1-2257 and a region required for homology repair, which were then analyzed for shRNA integration.

[0193] Prior to injection of 30 2.5-day-old eggs, a total of 1.5 μg of DNA (500 μg of each ZFN plasmid and 500 μg of repair plasmid) was added to 45 μl OptiPRO and then complexed with 3 μl Lipofectamine 2000 CD in 45 μl OptiPRO. Eggs were incubated until day 7, when gonads were removed and isolated and MACS sorted using SSEA-1 antibody (Santa Cruz Biotech) to enrich for PGCs. DNA was isolated from PGC-enriched samples from ZFN-treated and control embryos using the Qiagen DNAeasy kit.

[0194] Successful integration of shRNA was screened by PCR using primers that bind to the genome outside the region used for homology repair (Screen 7: 5'GTGACTCAGACTCCTGTTAG (SEQ ID NO: 3)) and primers that bind to shRNA (Screen 6: 5'TCTGCTGCTTCACAGTCTTC (SEQ ID NO: 4)). PCR was performed using green master mix (Promega) according to the manufacturer's instructions, with cycling conditions of 94°C for 2 minutes, followed by 94°C for 45 seconds, 36 cycles of 55°C for 45 seconds, and 72°C for 1 minute and 10 seconds. This was followed by a final extension at 72°C for 10 minutes.

[0195] PCR was performed on DNA from PGC-enriched samples from ZFN-treated and control embryos, DNA from positive control cells that had been previously confirmed to have shRNA integration, and a water control. Figure 8 Gel electrophoresis of these PCR reactions is shown. The first lane, which contains the PCR from ZFNs injected directly into embryos, clearly shows the band representing genomic integration in the injected embryos.

[0196] Example 15: Results of direct injection of chicken genome modification

[0197] After several rounds of direct injection, a total of 277 roosters raised to sexual maturity and their semen were tested for the presence of the Tol2 transgene. Of the 277 samples tested, 98 were found to contain the Tol2 transgene, with varying percentage levels of positive semen. Some of these positive G(0) roosters were mated, and a total of 7393 G(1) chicks were screened. 65 chicks were found to be transgenic. Subsequent matings using these G(1) chicks confirmed the Mendelian inheritance of the transgene to the G(2) generation.

[0198] The hatched chicks were raised to sexual maturity and the presence of miniTol-EGFP in semen was detected by quantitative real-time PCR (qPCR). Semen samples were collected and DNA was extracted from 20 μl of semen diluted in 180 μl PBS using the Qiagen DNeasy blood and tissue kit according to the manufacturer's instructions. Semen genomic DNA was then diluted 1 / 100 in ddHO 2 O for PCR reaction. qPCR was performed on an Eppendorf realplex (Eppendorf Hamburg, Germany). Briefly, a 20 μl reaction was set up containing 10 μl Taqman 2×Universal master mix (Applied Biosystems), 1 μl 20×FAM labeled Assay Mix (Applied Biosystems) and 9 μl diluted DNA. Each sample was set up in duplicate and contained specific primers and probes for minTol2:

[0199] Forward primer: 5′CAGTCAAAAAGTACTTATTTTTTGGAGATCACT 3′ (SEQ ID NO: 5);

[0200] Reverse primer: 5′GGGCATCAGCGCAATTCAATT 3′ (SEQ ID NO: 6);

[0201] Detection probe: 5′ATAGCAAGGGAAAATAG 3′ (SEQ ID NO: 7);

[0202] and specific primers and probes for a genomic control region from the chicken genome as a template control:

[0203] Forward primer: 5′GATGGGAAAACCCTGAACCTC 3′ (SEQ ID NO: 8);

[0204] Reverse primer: 5′CAACCTGCTAGAGAAGATGAGAAGAG 3′ (SEQ ID NO: 9);

[0205] Detection probe: 5' CTGCACTGAATGGAC 3' (SEQ ID NO: 10).

[0206] PCR cycle parameters were: initial annealing step at 95°C for 10 min, followed by 45 cycles of 95°C for 15 s, and then 60°C for 1 min. Each cock was tested at least twice. If the minTol2C T Values ​​below 36 were classified as positive. T Values ​​below 32 are used to indicate that the sample tested contains sufficient DNA.

[0207] Those skilled in the art will appreciate that, without departing from the broad overall scope of the present disclosure, various changes and / or modifications may be made to the above embodiments. Therefore, the present embodiments should be considered in all aspects as illustrative and not restrictive.

[0208] All publications discussed and / or cited herein are incorporated herein in their entirety.

[0209] This application claims priority to US 61 / 636,331 filed on April 20, 2012, US 61 / 783,823 filed on March 14, 2013, and AU 2013204327 filed on April 12, 2013, the entire contents of each of which are incorporated herein by reference.

[0210] Any discussion of documents, acts, materials, devices, articles and the like included in this specification is for the sole purpose of providing a background to the present invention and should not be construed as an admission that any or all of these matters constitute the basis of prior art or were common general knowledge in the relevant field before the priority date of each claim of this application.

[0211] References

[0212] Balciunas et al.(2006)PLoS Genet.10:e169.

[0213] Barrangou(2012)Nature Biotechnology,30:836-838.

[0214] Cong et al.(2013)Science,339:819-823.

[0215] Davis and Stokoe(2010)BMC Med,8:42.

[0216] Ding et al.(2005)Cell,122:473-483.

[0217] Durai et al.(2005)Nucleic Acids Res,33:5978-5990.

[0218] Hamburger and Hamilton(1951)J Morphol,88:49-92.

[0219] Haensler and Szoka,(1993)Bioconjugate Chem,4:372-379.

[0220] Ivics et al.(1997)Cell,91:501-510.

[0221] Kagami et al.(1997)Mol Reprod Dev,48:501-510.

[0222] Kawakami et al.(2000)Proc Natl Acad Sci USA,97:11403-11408.

[0223] Petitte(2002)J Poultry Sci,39:205-228.

[0224] Pettite and Modziak(2007)Proc Natl Acad Sci USA,104:1739-1740.

[0225] Sullenger et al.(1990)Cell,63:601-608.

[0226] Tang et al. (1996) Bioconjugate Chem, 7:703-714.

[0227] Zhang et al. (2011) Nature Biotechnology, 29:149-153. Sequence Listing <110> CSIRO Aviagen <120> Cell transfection method <130> 513415 <150> US 61 / 636,331 <151> 2012-04-20 <150> US 61 / 783,823 <151> 2013-03-14 <150> AU 2013204327 <151> 2013-04-12 <160> 10 <170> PatentIn version 3.5 <210> 1 <211> 4090 <212> DNA <213> Artificial Sequence <220> <223> EGFP expression construct flanked by Tol2 sequences <400> 1 cagaggtgta aagtacttga gtaattttac ttgattactg tacttaagta ttatttttgg 60 ggatttttac tttacttgag tacaattaaa aatcaatact tttactttta cttaattaca 120 tttttttaga aaaaaaagta ctttttactc cttacaattt tatttacagt caaaaagtac 180 ttattttg gagatcactt cattctattt tcccttgcta ttaccaacc aattgaattg 240 cgctgatgcc cagtttaatt taaatgttat ttattctgcc tatgaaaatc gttttcacat 300 tatatgaaat tggtcagaca tgttcattgg tcctttggaa gtgacgtcat gtcacatcta 360 ttaccacaat gcacagcacc tgacctgga aattagggaa attatacag tcaatcagtg 420 gagaaaatg gaggaagtat gtgattcatc agcagctgcg agcagcag tccaaaatca 480 gccacaggat caagcacc cgtggccgta tcttcgcaga tcgacattga ttattgacta 540 gttattaata gtaatcatt acggggtcat tagttcatag cccatatatg gagttccgcg 600 ttacataact tacggtaat ggcccgcctg gctgaccgcc caacgacccc cgcccattga 660 cgtcaataat gacgtatgtt cccatagtaa cgccaatagg gactttccat tgacgtcaat 720 gggtggagta tttacggtaa actgcccact tggcagtaca tcaagtgtat catatgccaa 780 gtacgccccc tattgacgtc aatgacggta aatggcccgc ctggcattat gcccagtaca 840 tgaccttatg ggactttcct acttggcagt accactacgt attagtcatc gctattacca 900 tgggtcgagg tgagccccac gttctgcttc actctcccca tctccccccc ctccccaccc 960 ccaattttgt atttatttat tttttaatta ttttgtgcag cgatgggggc gggggggggg 1020 ggggcgcgcg ccaggcgggg cggggcgggg cgaggggcgg ggcggggcga ggcggagagg 1080 tgcggcggca gccaatcaga gcggcgcgct ccgaaagttt ccttttatgg cgaggcggcg 1140 gcggcggcgg ccctataaaa agcgaagcgc gcggcgggcg ggagtcgctg cgttgccttc 1200 gccccgtgcc ccgctccgcg ccgcctcgcg ccgcccgccc cggctctgac tgaccgcgtt 1260 actcccacag gtgagcgggc gggacggccc ttctcctccg ggctgtaatt agcgcttggt 1320 ttaatgacgg ctcgtttctt ttctgtggct gcgtgaaagc cttaaagggc tccgggaggg 1380 ccctttgtgc gggggggagc ggctcggggg gtgcgtgcgt gtgtgtgtgc gtggggagcg 1440 ccgcgtgcgg cccgcgctgc ccggcggctg tgagcgctgc gggcgcggcg cggggctttg 1500 tgcgctccgc gtgtgcgcga ggggagcgcg gccgggggcg gtgccccgcg gtgcgggggg 1560 gctgcgaggg gaacaaaggc tgcgtgcggg gtgtgtgcgt gggggggtga gcagggggtg 1620 tgggcgcggc ggtcgggctg taaccccccc ctgcaccccc ctccccgagt tgctgagcac 1680 ggcccggctt cgggtgcggg gctccgtgcg gggcgtggcg cggggctcgc cgtgccgggc 1740 ggggggtggc ggcaggtggg ggtgccgggc ggggcggggc cgcctcgggc cggggagggc 1800 tcgggggagg ggcgcggcgg ccccggagcg ccggcggctg tcgaggcgcg gcgagccgca 1860 gccattgcct tttatggtaa tcgtgcgaga gggcgcaggg acttcctttg tcccaaatct 1920 ggcggagccg aaatctggga ggcgccgccg caccccctct agcgggcgcg gggcgaagcg 1980 gtgcggcgcc ggcaggaagg aaatgggcgg ggagggcctt cgtgcgtcgc cgcgccgccg 2040 tccccttctc cctctccagc ctcggggctg tccgcggggg gacggctgcc ttcggggggg 2100 acggggcagg gcggggttcg gcttctggcg tgtgaccggc ggctctagag cctctgctaa 2160 ccatgttcat gccttcttct ttttcctaca gctcctgggc aacgtgctgg ttattgtgct 2220 gtctcatcat tttggcaaag aattgtacca ccatggtgag caagggcgag gagctgttca 2280 ccggggtggt gcccatcctg gtcgagctgg acggcgacgt aaacggccac aagttcagcg 2340 tgtccggcga gggcgagggc gatgccacct acggcaagct gaccctgaag ttcatctgca 2400 ccaccggcaa gctgcccgtg ccctggccca cactagtgac caccttcgct tacggcgtgc 2460 agtgcttcag ccgctacccc gaccacatga agcagcacga cttcttcaag tccgccatgc 2520 ccgaaggcta cgtccaggag cgcaccatct tcttcaagga cgacggcaac tacaagaccc 2580 gcgccgaggt gaagttcgag ggcgacaccc tggtgaaccg catcgagctg aagggcatcg 2640 acttcaagga ggacggcaac atcctggggc acaagctgga gtacaacttc aacagccaca 2700 acgtatacat catggccgac aagcagaaga acggcatcaa ggtgaacttc aagatccgcc 2760 acaacatcga ggacggcagc gtgcagctcg ccgaccacta ccagcagaac acccccatcg 2820 gcgacggccc cgtgctgctg cccgacaacc actacctgag cacccagtcc gccctgagca 2880 aagaccccaa cgagaagcgc gatcacatgg tcctgctgga gttcgtgacc gccgccggga 2940 tcactcacgg catggacgag ctgtacaagt agggcggctc gaggatatca ggatcaattc 3000 actcctcagg tgcaggctgc ctatcagaag gtggtggctg gtgtggccaa tgccctggct 3060 cacaaatacc actgagatct ttttccctct gccaaaaatt atggggacat catgaagccc 3120 cttgagcatc tgacttctgg ctaataaagg aaatttattt tcattgcaat agtgtgttgg 3180 aatttttgt gtctctcact cggaaggaca tatgggagg caaatcattt aaaacatcag 3240 aatgagtatt tggtttagag tttggcaaca tatgcccata tgctggctggc catgaacaaa 3300 ggttggctat aaagaggtca tcagtatatg aaacagcccc ctgctgtcca ttccttattc 3360 catagaaaag ccttgacttg aggttagatt ttttttatt tttgttttgt gttattttt 3420 tctttaacat ccctaaaatt ttccttacat gttttactag ccagattttt cctcctctcc 3480 tgactactcc cagtcatagc tgtccctctt ctcttatgga gatccctcga cctgcagccc 3540 aagctcgagg gcccatctgg cctgtgtttc agacaccagg gagtctctgc tcacgtttcc 3600 tgctatttgc agcctctcta tcaagactaa tacacctctt cccgcatcgg ctgcctgtga 3660 gaggcttttc agcactgcag gattgctttt cagccccaaa agagctaggc ttgacactaa 3720 caattttgag aatcagcttc tactgaagtt aaatctgagg ttttacaact ttgagtagcg 3780 tgtactggca ttagattgtc tgtcttatag tttgataatt aaatacaaac agttctaaag 3840 caggataaaa ccttgtatgc atttcattta atgttttttg agattaaag cttaaacaag 3900 aatctctagt ttctttctt gcttttactt ttactcctt atactcaag tacaatttta 3960 atggagtactt tactcagta atggattcttact cagatacttt tactttaat 4020 tgagtaaaat ttccctaag tacttgtact tcacttgag taaaattttt gagtactttt 4080 tacaccctctg 4090 <210> 2 <211> 706 <212> PRT <213> Artificial Sequence <220> <223> Tol2 transposase encoding sequence <400> 2 Met Phe Met Pro Ser Ser Phe Ser Tyr Ser Trp Ala Thr Cys Trp 1 5 10 15 Leu Leu Cys Cys Leu Ile Leu Ala Lys Asn Ser Ser Arg Ser Ser 20 25 30 His Tyr Tyr His Asn Ala Gln His Leu Asp Leu Glu And Arg Glu 35 40 45 Ile Ile Thr Will Asn Gln Trp Lys Lys Met Glu Glu Will Cys Asp Ser 50 55 60 Ser Ala Ala Ala Ser Ser Thr Val Gln Asn Gln Pro Gln Asp Gln Glu 65 70 75 80 His Pro Trp Pro Tyr Leu Arg Glu Phe Phe Ser Leu Ser Gly Val Asn 85 90 95 Lys Asp Ser Phe Lys Met Lys Cys Val Leu Cys Leu Pro Leu Asn Lys 100 105 110 Glu Ile Ser Ala Phe Lys Ser Ser Pro Ser Asn Leu Arg Lys His Ile 115 120 125 Glu Arg Met His Pro Asn Tyr Leu Lys Asn Tyr Ser Lys Leu Thr Ala 130 135 140 Gln Lys Arg Lys Ile Gly Thr Ser Thr His Ala Ser Ser Ser Lys Gln 145 150 155 160 Leu Lys Val Asp Ser Val Phe Pro Val Lys His Val Ser Pro Val Thr 165 170 175 Val Asn Lys Ala Ile Leu Arg Tyr Ile Ile Gln Gly Leu His Pro Phe 180 185 190 Ser Thr Val Asp Leu Pro Ser Phe Lys Glu Leu Ile Ser Thr Leu Gln 195 200 205 Pro Gly Ile Ser Val Ile Thr Arg Pro Thr Leu Arg Ser Lys Ile Ala 210 215 220 Glu Ala Ala Leu Ile Met Lys Gln Lys Val Thr Ala Ala Met Ser Glu 225 230 235 240 Val Glu Trp Ile Ala Thr Thr Thr Asp Cys Trp Thr Ala Arg Arg Lys 245 250 255 Ser Phe Ile Gly Val Thr Ala His Trp Ile Asn Pro Gly Ser Leu Glu 260 265 270 Arg His Ser Ala Ala Leu Ala Cys Lys Arg Leu Met Gly Ser His Thr 275 280 285 Phe Glu Val Leu Ala Ser Ala Met Asn Asp Ile His Ser Glu Tyr Glu 290 295 300 Ile Arg Asp Lys Val Val Cys Thr Thr Thr Asp Ser Gly Ser Asn Phe 305 310 315 320 Met Lys Ala Phe Arg Val Phe Gly Val Glu Asn Asn Asp Ile Glu Thr 325 330 335 Glu Ala Arg Arg Cys Glu Ser Asp Asp Thr Asp Ser Glu Gly Cys Gly 340 345 350 Glu Gly Ser Asp Gly Val Glu Phe Gln Asp Ala Ser Arg Val Leu Asp 355 360 365 Gln Asp Asp Gly Phe Glu Phe Gln Leu Pro Lys His Gln Lys Cys Ala 370 375 380 Cys His Leu Leu Asn Leu Val Ser Ser Val Asp Ala Gln Lys Ala Leu 385 390 395 400 Ser Asn Glu His Tyr Lys Lys Leu Tyr Arg Ser Val Phe Gly Lys Cys 405 410 415 Gln Ala Leu Trp Asn Lys Ser Ser Arg Ser Ala Leu Ala Ala Glu Ala 420 425 430 Val Glu Ser Glu Ser Arg Leu Gln Leu Leu Arg Pro Asn Gln Thr Arg 435 440 445 Trp Asn Ser Thr Phe Met Ala Val Asp Arg Ile Leu Gln Ile Cys Lys 450 455 460 Glu Ala Gly Glu Gly Ala Leu Arg Asn Ile Cys Thr Ser Leu Glu Val 465 470 475 480 Pro Met Phe Asn Pro Ala Glu Met Leu Phe Leu Thr Glu Trp Ala Asn 485 490 495 Thr Met Arg Pro Val Ala Lys Val Leu Asp Ile Leu Gln Ala Glu Thr 500 505 510 Asn Thr Gln Leu Gly Trp Leu Leu Pro Ser Val His Gln Leu Ser Leu 515 520 525 Lys Leu Gln Arg Leu His His Ser Leu Arg Tyr Cys Asp Pro Leu Val 530 535 540 Asp Ala Leu Gln Gln Gly Ile Gln Thr Arg Phe Lys His Met Phe Glu 545 550 555 560 Asp Pro Glu Ile Ile Ala Ala Ala Ile Leu Leu Pro Lys Phe Arg Thr 565 570 575 Ser Trp Thr Asn Asp Glu Thr Ile Ile Lys Arg Gly Met Asp Tyr Ile 580 585 590 Arg Val His Leu Glu Pro Leu Asp His Lys Lys Glu Leu Ala Asn Ser 595 600 605 Ser Ser Asp Asp Glu Asp Phe Phe Ala Ser Leu Lys Pro Thr Thr His 610 615 620 Glu Ala Ser Lys Glu Leu Asp Gly Tyr Leu Ala Cys Val Ser Asp Thr 625 630 635 640 Arg Glu Ser Leu Leu Thr Phe Pro Ala Ile Cys Ser Leu Ser Ile Lys 645 650 655 Thr Asn Thr Pro Leu Pro Ala Ser Ala Ala Cys Glu Arg Leu Phe Ser 660 665 670 Thr Ala Gly Leu Leu Phe Ser Pro Lys Arg Ala Arg Leu Asp Thr Asn 675 680 685 Asn Phe Glu Asn Gln Leu Leu Leu Lys Leu Asn Leu Arg Phe Tyr Asn 690 695 700 Phe Glu 705 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Screen 7 oligonucleotide primer <400> 3 gtgactcaga ctcctgttag 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Screen 6 oligonucleotide primer <400> 4 tctgctgctt cacagtcttc 20 <210> 5 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> miniTol2 forward oligonucleotide primer <400> 5 cagtcaaaaa gtacttattt tttggagatc act 33 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> miniTol2 Reverse oligonucleotide primer <400> 6 gggcatcagc gcaattcaat t 21 <210> 7 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> miniTol2 detection probe <400> 7 atagcaaggg aaaatag 17 <210> 8 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Genomic control region forward primer <400> 8 gatgggaaaa ccctgaacct c 21 <210> 9 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Genomic region control reverse primer <400> 9 caacctgcta gagaagatga gaagag 26 <210> 10 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> Genomic control region oligonucleotide probe <400> 10 ctgcactgaa tggac 15

Claims

1. A method for producing an avian comprising a genetically modified germ cell, the method comprising: (i) injecting a transfection mixture comprising a targeted nuclease or a polynucleotide encoding the targeted nuclease mixed with a transfection reagent into a blood vessel of an avian embryo at stage 12-17, whereby the targeted nuclease edits the genome of one or more primordial germ cells in the avian, wherein the transfection reagent comprises a cationic lipid, and (ii) incubating the embryo at a temperature sufficient to allow the embryo to develop into a bird.

2. A method for producing an avian comprising a genetically modified germ cell, the method comprising: (i) injecting a transfection mixture comprising an RNA guide for genome editing mixed with a transfection reagent into a blood vessel of an avian embryo at stage 12-17, wherein the transfection reagent comprises a cationic lipid, wherein in the presence of a CRISPR-Cas targeting nuclease, the genome of one or more primordial germ cells in the avian is edited, and (ii) incubating the embryo at a temperature sufficient to allow the embryo to develop into a bird.

3. The method of claim 1, wherein the targeting nuclease is selected from a CRISPR-Cas targeting nuclease, a zinc finger nuclease or a TALEN.

4. The method of claim 3, wherein the targeting nuclease is CRISPR-Cas and the transfection mixture further comprises an RNA guide or a polynucleotide encoding the RNA guide.

5. The method of claim 1 or 2, wherein the transfection mixture is injected into avian embryos at stage 13-14.

6. The method of claim 1 or 2, wherein the cationic lipid is a monovalent cationic lipid selected from one or more of the following: DOTMA (N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride), DOTAP (1,2-bis(oleoyloxy)-3-3-(trimethylamino)propane), DMRIE (1,2-ditetradecyloxypropyl 3-dimethyl-hydroxyethylammonium bromide) and DDAB (dimethyldioctadecylammonium bromide).

7. The method of claim 1 or 2, wherein the cationic lipid is a multivalent cationic lipid selected from one or more of the following: DOSPA (2,3-dioleyloxy-N-[2-(sperminecarboxylic acid amide) ethyl]-N,N-dimethyl-1-propylammonium trifluoroacetate) and DOSPER (1,3-dioleoyloxy-2-(6-carboxysperminyl) propionamide), TMTPS (tetramethyltetrapalmitoylspermine), TMTOS (tetramethyltetraoleylspermine), TMTLS (tetramethyltetralaurylspermine), TMTMS (tetramethyltetramyristylspermine) and TMDOS (tetramethyldioleylspermine).

8. The method of claim 7, wherein the transfection reagent comprises DOSPA (2,3-dioleyloxy-N-[2-(sperminecarboxamide)ethyl]-N,N-dimethyl-1-propylammonium trifluoroacetate).

9. The method of claim 1 or 2, wherein the transfection reagent further comprises a neutral lipid.

10. The method of claim 9, wherein the neutral lipid comprises DOPE (dioleoylphosphatidylethanolamine), DPhPE (diphytanoylphosphatidylethanolamine), or cholesterol.

11. The method of claim 10, wherein the transfection reagent comprises a 3:1 w / w mixture of DOSPA and DOPE before the transfection reagent is mixed with the polynucleotide.

12. The method of claim 1 or 2, wherein the transfection mixture is injected into an embryo in an eggshell, wherein the embryo develops in the eggshell.

13. The method of claim 1 or 2, wherein the poultry is selected from the group consisting of chicken, duck, turkey, goose or quail.

14. The method of claim 1 or 2, wherein the poultry is a chicken.

15. The method of claim 1 or 2, further comprising (i) allowing the bird or its offspring containing the genetically modified germ cell to develop into a sexually mature avian containing the genetically modified germ cell, and (ii) breeding the sexually mature avian species comprising the genetically modified germ cells to produce genetically modified avian offspring.

16. Use of a transfection reagent comprising a cationic lipid and a targeted nuclease or a transfection reagent comprising a cationic lipid and a polynucleotide encoding a targeted nuclease in producing avians comprising genetically modified germ cells by injection into a blood vessel of a developing avian embryo at stage 12-17, wherein the targeted nuclease is suitable for facilitating integration of a heterologous polynucleotide into the genome of the germ cells.

17. Use of a transfection reagent comprising a cationic lipid and a CRISPR system for RNA-guided site-specific genome editing in primordial germ cells in the blood vessels of developing stage 12-17 avian embryos.

18. Use of zinc finger nucleases for introducing genetic modifications into primordial germ cells of developing avian embryos, wherein the zinc finger nucleases are injected into the blood vessels of the avian embryos at stages 12-17 together with a transfection reagent comprising a cationic lipid.

19. Use of a targeted nuclease and a transfection mixture comprising a transfection reagent and a heterologous polynucleotide in producing avians comprising genetically modified germ cells, wherein the transfection reagent comprises a cationic lipid, wherein the transfection mixture is injected into a blood vessel of a developing stage 12-17 avian embryo, and the targeted nuclease assists integration of the heterologous polynucleotide into the genome of the germ cells.

Images