Application of Tgfbr2 in the preparation of ovarian function protection drugs

The injection of the adenovirus vector Tgfbr2 gene in situ by the ovary, the ovarian function damage caused by chemotherapy is solved, the repair and reconstruction of ovarian function is achieved, the ovarian reserve function is improved, and the delay and potential risks of chemotherapy are avoided.

CN113209313BActive Publication Date: 2025-08-26TONGJI HOSPITAL ATTACHED TO TONGJI MEDICAL COLLEGE HUAZHONG SCI TECH
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202110713595.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2021-06-25
Publication Date
2025-08-26
Estimated Expiration
2041-06-25

AI Technical Summary

Technical Problem

Ovarian function damage caused by chemotherapy seriously affects female reproductive endocrine and quality of life. The existing fertility protection measures have problems such as delaying chemotherapy, low success rate or potential risks.

Method used

The Tgfbr2 gene was introduced into the ovary through in situ injection using adenovirus vector to achieve gene upregulation, repair ovarian damage, and reconstruct ovarian function.

Benefits of technology

Without affecting the anti-cancer effect, protect ovarian function, repair ovarian damage, delay ovarian aging, improve ovarian reserve function, and rebuild ovarian function, avoiding targeted defects in gene expression and potential hepatotoxicity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN113209313B_ABST
    Figure CN113209313B_ABST
Patent Text Reader

Abstract

The present invention discloses an application of Tgfbr2 in the preparation of ovarian function protection drugs, belonging to the field of tumor fertility protection technology. Specifically, a certain dose of AdV-Tgfbr2 is injected in situ into the ovaries of the test mammals by gene therapy, and the overexpression level of Tgfbr2 is detected. The purpose of reconstructing ovarian function is achieved by repairing the damaged parts. Therefore, the AdV-Tgfbr2 recombinant vector and its pharmaceutical preparation can protect ovarian function without affecting the anti-cancer effect. As a new drug, it plays an important role in repairing ovarian damage and / or resisting and delaying ovarian aging and / or improving ovarian reserve function and / or reconstructing ovarian function.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the application of Tgfbr2 in ovarian function protection drugs, belongs to the technical field of tumor fertility protection, and specifically relates to the application of Tgfbr2 in the preparation of ovarian function protection drugs. Background Art

[0002] Ovarian function, including endocrine and reproductive capacity, is a key factor influencing women's quality of life. Factors influencing ovarian function include age, genetics, immunity, iatrogenic factors, infectious diseases, environment, behavior, and social psychology. Among them, iatrogenic ovarian damage caused by chemotherapy is common in clinical practice and urgently needs to be improved.

[0003] Chemotherapy can lead to impaired ovarian function, and the reproductive endocrine disorders it causes can manifest as amenorrhea, infertility, perimenopausal symptoms and psychological disorders. In addition, the damage to follicle loss and ovarian function caused by chemotherapy is irreversible. Studies have found that the incidence of premature ovarian failure and irreversible infertility in women caused by chemotherapy or whole-body radiotherapy is as high as 80% to 100%, seriously affecting the physical and mental health of patients.

[0004] Therefore, exploring strategies to simultaneously protect ovarian function, minimize ovarian damage, and facilitate subsequent salvage therapy while facilitating chemotherapy is crucial. Numerous studies have been conducted worldwide to address chemotherapy-induced follicular damage, accelerated follicular pool depletion, and diminished ovarian reserve. The main fertility protection strategies currently available are as follows: 1. Embryo cryopreservation: Its advantages are relatively mature and well-established, with high success rates. However, its disadvantages are that oocyte stimulation and maturation require 4–6 weeks, which delays chemotherapy and may not be suitable for patients requiring urgent chemotherapy. Furthermore, it requires a male partner or sperm donor, and ovarian hormone stimulation is not suitable for women with estrogen receptor-positive breast cancer. 2. Mature oocyte cryopreservation: Its advantages are that it does not require a sperm donor. However, its disadvantages are currently lower success rates than embryo cryopreservation, which also delays chemotherapy and may not be suitable for invasive cancers, and hormone stimulation may not be suitable for breast cancer. 3. Ovarian tissue cryopreservation and reimplantation: While its success rate is uncertain, its advantages are that it does not require chemotherapy delays and can be used for patients in whom oocyte stimulation is inappropriately delayed. However, its disadvantages are currently experimental and may lead to secondary malignancies.

[0005] The TGFBR2 gene encodes a member of the serine / threonine protein kinase family and the TGFβ receptor subfamily, encoding a transmembrane protein with a protein kinase domain. It forms a heterodimeric complex with another protein receptor and binds to TGF-β. Mutations in this gene are associated with Marfan syndrome, Loeys-Deitz aortic aneurysm syndrome, Osler-Weber-Rendu syndrome, and the development of various tumor types. It is located on human chromosome 3p24.1 and is a highly conserved gene. The gene is approximately 87.54 kb in length. The TGFBR2 cDNA open reading frame is approximately 1779 nt long, comprising 11 exons and 10 introns, encoding a 592 amino acid protein with a relative molecular weight of approximately 70 / 80 kDa. The basic structure of TGFBR2 consists primarily of a C-terminal protein kinase domain and an N-terminal extracellular domain. The extracellular domain comprises a compact fold consisting of nine β-strands and a single helical structure stabilized by a network of six intrastrand disulfide bonds. The special structure of TGFBR2 determines its biological functions, including participation in Notch pathway, aging, protein kinase activation, vascular development and other biological processes.

[0006] Kim, KK, D. Sheppard, and HAChapman, TGF-β1 Signaling and Tissue Fibrosis. Cold Spring Harbor perspectives in biology, 2018.10(4): p.1-34. reported that Tgfb1 is a profibrotic factor that is closely related to the synthesis of extracellular matrix (ECM) and can induce the fibrosis process of various organs.

[0007] The literature Zhou, F., L.-B. Shi, and S.-Y. Zhang, Ovarian Fibrosis: A Phenomenon of Concern. Chinese medical journal, 2017. 130(3): p. 365-371. reported that abnormal increase in Tgfb1 levels in the ovary can lead to follicular hypoplasia.

[0008] The literature Davidsohn, N., et al., A single combination gene therapy treats multiple age-related diseases. Proceedings of the National Academy of Sciences of the United States of America, 2019. 116(47): p. 23505-23511. reported that Tgfbr2 specifically binds to Tgfb1. Studies have shown that exogenous administration of Tgfbr2 can reduce the binding of Tgfb1 to receptors on the cell membrane and subsequent signaling cascades, thereby inhibiting the progression of fibrosis.

[0009] Gene therapy is a novel treatment for diseases caused by gene defects or abnormal gene expression. It introduces exogenous genes into cells to correct or compensate for diseases caused by these defects or abnormal gene expression. Currently, gene therapy has not only made significant progress in the field of cancer but has also been extensively clinically studied for rare diseases, particularly monogenic and rare genetic disorders. However, research in non-single-gene deletion and non-tumor diseases remains limited, and there are no reports on chemotherapy-induced ovarian damage. Summary of the Invention

[0010] To address the above technical problems, the present invention discloses the use of Tgfbr2 in the preparation of a drug for protecting ovarian function. Specifically, an adenovirus vector is injected in situ into the ovary to upregulate genes in the ovary, thereby repairing the damaged area and restoring ovarian function. Therefore, the AdV-Tgfbr2 recombinant vector and its pharmaceutical preparation can protect ovarian function without affecting anti-cancer effects. As a new drug, it plays an important role in repairing ovarian damage and / or preventing ovarian aging and / or improving ovarian reserve and / or restoring ovarian function.

[0011] To achieve the above objectives, the present invention discloses the use of Tgfbr2 in the preparation of ovarian function protection drugs, wherein the ovarian function protection includes repairing ovarian damage and / or resisting and delaying ovarian aging and / or improving ovarian reserve function and / or reconstructing ovarian function.

[0012] Furthermore, the ovarian function protection is to resist and delay ovarian aging.

[0013] Furthermore, the ovarian function protection is to improve ovarian reserve function.

[0014] Furthermore, the ovarian function protection is to restore ovarian function.

[0015] Furthermore, the ovarian function protection is to repair ovarian damage, and the ovarian damage includes any one of ovarian damage caused by aging, ovarian damage caused by genetic or immune function defects or environment, iatrogenic ovarian damage or pathological ovarian damage.

[0016] Furthermore, the ovarian injury is iatrogenic ovarian injury.

[0017] Furthermore, the ovarian damage is ovarian interstitial fibrosis.

[0018] Preferably, the iatrogenic ovarian injury is ovarian interstitial fibrosis caused by chemotherapy. The present invention further selects that the symptoms of ovarian interstitial fibrosis caused by chemotherapy include decreased ovarian endocrine function, decreased ovarian reserve function, etc., which in turn affects reproductive capacity.

[0019] Preferably, the ovarian function protection is to alleviate iatrogenic ovarian interstitial fibrosis.

[0020] The present invention also discloses the use of Tgfbr2 in preparing a drug for alleviating ovarian interstitial fibrosis caused by chemotherapy.

[0021] Specifically, the present invention discloses the use of Tgfbr2 in the preparation of a drug for alleviating ovarian interstitial fibrosis induced by doxorubicin.

[0022] Furthermore, the drug is a recombinant nucleic acid construct expressing Tgfbr2 protein, and the expression vector of the recombinant nucleic acid construct is any expression vector suitable for gene therapy, including viral vectors or non-viral vectors.

[0023] Furthermore, the viral vector is an adenoviral vector.

[0024] Furthermore, the dosage form of the drug is an injection type.

[0025] Furthermore, it specifically includes using gene therapy to inject a certain dose of AdV-Tgfbr2 into the ovaries of the test mammals in situ, and detecting the overexpression level of Tgfbr2.

[0026] Furthermore, the test mammals include a control group and an experimental group, and the experimental group is a chemotherapy-induced ovarian damage experimental group.

[0027] Furthermore, the construction process of the AdV-Tgfbr2 is as follows:

[0028] 1) Construction of the pENTER vector of the test mammal: The Tgfbr2 gene fragment of the test mammal was constructed into the shuttle vector pENTER by PCR;

[0029] 2) Obtaining adenovirus of a certain titer: transfecting the pENTER vector constructed in step 1) into HEK293 cells containing the adenovirus backbone vector pAD-FH using the lipo2000 transfection system, screening and collecting positive cells that have successfully recombined, lysing the cells, collecting the viral supernatant, and concentrating and purifying to obtain adenovirus of a certain titer;

[0030] 3) Adenovirus purification: The adenovirus from step 2) was purified using iodixanol density gradient ultracentrifugation;

[0031] 4) Adenovirus titer determination: The adenovirus titer was 7.0×10 10 PFU / mL.

[0032] Furthermore, the mammalian subjects include but are not limited to rats, mice, non-human primates, humans, dogs, cats, horses, cows, sheep, pigs, goats, and preferably mice.

[0033] In addition, the present invention also discloses an ovarian function protection drug, which comprises AdV-Tgfbr2 as a main raw material and an indispensable drug carrier.

[0034] Beneficial effects:

[0035] 1. The present invention discloses methods for in situ ovarian injection of adenoviral vectors into a mammalian subject to achieve gene upregulation in the ovaries and restore ovarian function by repairing damaged areas. The in situ ovarian injection method is minimally invasive, requiring a small surgical incision and having no significant impact on mouse survival. It avoids the lack of targeted gene expression associated with tail vein or intraperitoneal injections and avoids the potential for non-integration of the adenoviral genome into the host cell genome, which can lead to tropism in other organs, such as hepatotoxicity.

[0036] 2. The AdV-Tgfbr2 recombinant vector and its pharmaceutical preparation designed in the present invention can protect ovarian function without affecting the anti-cancer effect. As a new drug, it plays an important role in repairing ovarian damage and / or resisting and delaying ovarian aging and / or improving ovarian reserve function and / or reconstructing ovarian function. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 This is a test chart showing the fibrotic damage to the ovary caused by doxorubicin and the detection results of Tgfbr2 protein levels;

[0038] Figure 2 The results of mRNA and protein level detection after AdV-Tgfbr2 was orthotopically injected into mouse ovaries;

[0039] Figure 3The overexpression of Sirt1 and Tgfbr2 proteins changes over time after orthotopic injection of AdV-Sirt1 and AdV-Tgfbr2 into the ovary. Figure 3 A is the protein expression of Sirt1 in the AdV-Sirt1 group at different time points compared with the AdV-GFP group. Figure 3 B shows the protein expression of Tgfbr2 in the AdV-Tgfbr2 group at different time points compared with the AdV-GFP group; Figure 3 C is the semi-quantitative statistical analysis of Sirt1 protein expression; Figure 3 D is the semi-quantitative statistical analysis of Tgfbr2 protein;

[0040] Figure 4 Ovarian gene therapy is used to combat the decline in ovarian endocrine function caused by chemotherapy. Figure 4 A shows the changes in estrogen levels of mice in each group; Figure 4 B shows the changes in progesterone levels in mice of each group; Figure 4 C shows the changes in FSH levels of mice in each group; Figure 4 D is the change of AMH level in each group of mice, and Figure 4 *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001, *compared with Dox group.

[0041] Figure 5 Ovarian gene therapy is used to combat the decline in ovarian reserve caused by chemotherapy, including: Figure 5 A is the H&E staining picture of the ovaries of mice in each group. Figure 5 B is the body weight, ovarian mass and ovarian index of mice in each group; Figure 5 C is the follicle count of mice in each group. Figure 5 *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001, *compared with the Dox group. PMF: primordial follicles; PF: primary follicles; SF: secondary follicles; ANF: antral follicles; THF: total healthy follicles; ATF: atretic follicles. DETAILED DESCRIPTION

[0042] At present, because various factors such as age, genetics, immunity, iatrogenics, pathology, environment, behavior, and social psychology may cause ovarian damage and / or ovarian aging in mammals, how to solve this technical problem and achieve protection of ovarian function is a technical problem that technicians in this field need to solve.

[0043] Definition and Use of Terms

[0044] Chemotherapy is the abbreviation for chemical drug therapy, which uses chemotherapeutic drugs to kill cancer cells to achieve therapeutic goals. Clinically, there are different types of chemotherapy drugs. Based on their different mechanisms of action, they can be divided into alkylating agents, antimetabolites, antibiotics, anti-tumor drugs, herbal anti-tumor drugs, hormonal anti-tumor drugs, and miscellaneous drugs. Most patients require a combination of two or more chemotherapy drugs, including oral chemotherapy drugs and intravenous medications. In addition, some patients can also undergo interventional drug infusion through arteries.

[0045] Ovarian damage: This invention mainly refers to damage caused by various factors such as age, genetics, immunity, iatrogenics, pathology, environment, behavior, and social psychology. Specific damage results include tumor cancer, inflammation, amenorrhea, infertility, perimenopausal symptoms, etc.

[0046] Ovarian damage caused by chemotherapy: The present invention mainly refers to the damage to ovarian function caused by drug chemotherapy that destroys follicles and ovarian tissue, resulting in varying degrees of menstrual disorders, infertility, and even premature ovarian failure. Among them, alkylating agents such as cyclophosphamide are toxic to large follicles in active mitosis, increase the recruitment of primordial follicles, and cause delayed damage to primordial follicles, leading to a decrease in primordial and primary follicles in the ovaries, ovarian fibrosis, destruction of the ovarian medulla, and reduction in ovarian volume, ultimately leading to ovarian failure. Anticancer drugs can inhibit the function of granulosa cells and cause ovarian dysfunction or premature ovarian failure by reducing the number of FSH and LH receptors. In addition to inhibiting granulosa cells, chemotherapy drugs such as cisplatin also induce their apoptosis. The apoptosis of granulosa cells directly affects the development of follicles, leading to abnormal follicular development, anovulation, and even infertility.

[0047] Ovarian aging: mainly includes premature ovarian failure in patients caused by changes in DNA and epigenetic modifications, telomere shortening and decreased telomerase activity, changes in the ovarian microenvironment, accumulation of oxidative damage products, apoptosis and aging of ovarian cells, vascular factors, etc.

[0048] Improve or enhance ovarian reserve function: The ovarian reserve function of the present invention refers to the ability of primordial follicles in the ovarian cortex to develop into fertilizable oocytes. Currently, the main indicators for evaluating ovarian reserve function clinically include age, basal endocrine hormones, cytokines, basal antral follicle count (AFC), etc.

[0049] Reconstruction of ovarian function: restore the patient's ovaries to normal physiological functions, such as normal menstruation or normal fertility.

[0050] Drug carrier: refers to a system that can change the way drugs enter the human body and their distribution in the body, control the release rate of drugs and deliver drugs to target organs, such as microcapsules and microspheres, nanoparticles, liposomes, etc.

[0051] Adriamycin: an antibiotic drug with the molecular formula C 27 H 29 NO 11 It has a broad anti-tumor spectrum and is suitable for acute leukemia (lymphocytic and granulocytic), malignant lymphoma, breast cancer, bronchogenic carcinoma (undifferentiated small cell and non-small cell), ovarian cancer, soft tissue sarcoma, osteosarcoma, rhabdomyosarcoma, Ewing sarcoma, blastoma, neuroblastoma, bladder cancer, thyroid cancer, prostate cancer, head and neck squamous cell carcinoma, testicular cancer, gastric cancer, liver cancer, etc.

[0052] This study focuses on strategies for repairing ovarian damage caused by chemotherapy. Current methods for repairing damaged ovaries and protecting ovarian reproductive function are invasive and have limited applicability. Some of these methods can delay chemotherapy, have low success rates, and may even lead to secondary cancers. Furthermore, these treatments primarily focus on preserving fertility and are unlikely to be effective in maintaining or restoring ovarian function long-term.

[0053] The specific technical solutions are as follows :

[0054] The present invention discloses the use of Tgfbr2 in the preparation of ovarian function protection drugs, wherein the ovarian function protection includes repairing ovarian damage and / or resisting and delaying ovarian aging and / or improving ovarian reserve function and / or reconstructing ovarian function.

[0055] Furthermore, the ovarian function protection is to resist and delay ovarian aging.

[0056] Furthermore, the ovarian function protection is to improve ovarian reserve function.

[0057] Furthermore, the ovarian function protection is to restore ovarian function.

[0058] Furthermore, the ovarian function protection is to repair ovarian damage.

[0059] Furthermore, the ovarian damage includes any one of ovarian damage caused by aging, ovarian damage caused by genetic or immune dysfunction or environment, iatrogenic ovarian damage or pathological ovarian damage.

[0060] Furthermore, the drug is a recombinant nucleic acid construct expressing Tgfbr2 protein, and the expression vector of the recombinant nucleic acid construct is any expression vector suitable for gene therapy, including viral vectors or non-viral vectors.

[0061] Furthermore, the viral vector is an adenoviral vector.

[0062] Furthermore, the dosage form of the drug is an injection type.

[0063] Furthermore, it specifically includes using gene therapy to inject a certain dose of AdV-Tgfbr2 into the ovaries of the test mammals in situ, and detecting the overexpression level of Tgfbr2.

[0064] Furthermore, the mammalian subjects include a control group and an experimental group, wherein the experimental group is a chemotherapy-induced ovarian injury experimental group. The present invention preferably uses doxorubicin to cause fibrotic damage to the ovaries of the mammalian subjects. The control group is a saline intervention group.

[0065] Furthermore, the mammalian subjects include but are not limited to rats, mice, non-human primates, humans, dogs, cats, horses, cows, sheep, pigs, goats, and preferably mice.

[0066] At the same time, the AdV-Tgfbr2 designed by the present invention is obtained by using the following recombinant vector method:

[0067] 1. The coding region sequence of the mouse Tgfbr2 gene transcript (NM_009371.3, 1179 bp) was obtained and analyzed from the GenBank website, and PCR primers were designed. The sequences are shown in Table 1:

[0068] Table 1 Primer sequence list

[0069] Primer sequence (5'-3') Upstream primer (F) GACTGTCCACTTGCGACAAC Downstream primer (R) GGCAAACCGTCTCCAGAGTAA

[0070] The target gene Tgfbr2 gene fragment was constructed by PCR into the shuttle vector pENTER; its multiple cloning sites include Asis1 and Mlul;

[0071] 2. The constructed pENTER vector is transfected into HEK293 cells containing the adenoviral backbone vector pAD-FH using the lipo2000 transfection system. The two vectors undergo homologous recombination within the cells, and the target gene fragment is recombined into the adenoviral backbone vector. After homologous recombination, positive cells with successful recombination are screened by amp resistance, i.e., cells containing the adenoviral backbone vector inserted with the target gene sequence. The backbone vector is then coated with the virus with the help of packaging cells 293 and released from the cells. The cells are collected and lysed, and the viral supernatant is collected and concentrated and purified to obtain adenovirus with a certain titer.

[0072] 3. Adenovirus purification was performed using iodixanol density gradient ultracentrifugation. First, an iodixanol density gradient layer was prepared; crude adenovirus solution was added above the iodixanol density gradient layer; the solution was centrifuged at 268,000 g for 2.5 h at 18°C; the adenovirus in the 40% iodixanol layer was aspirated and ultrafiltered using a 50K ultrafiltration concentrator tube at 4,000 g at 10°C for approximately 1 h; the adenovirus solution was then resuspended in PBS;

[0073] 4. Adenovirus titer determination: Take a 96-well plate and add 10 293T cells to each well. 4 , add 200 μL of liquid, place in the incubator for 24 hours, and dilute the virus to be tested with DMEM complete medium to 1-10 -8 Concentration. Discard the crude culture medium in the 96-well plate, add the diluted virus into the air in sequence, 200 μL per well, make two replicates for each concentration, and set up a culture medium control (without adenovirus). Then continue to culture for 36 hours at 37°C and 5% CO2. Count the fluorescent positive cells under a fluorescence microscope, count the number of fluorescent cells in the last two wells, calculate the sum of the total number in the two replicate wells and calculate the average, assuming it is A (the average number of fluorescent cells in the second to last well) and B (the average number of fluorescent cells in the first to last well), as shown in Table 2.

[0074] Table 2 List of fluorescent cell numbers

[0075] 1 2 3 4 5 6 7 8 9 10 A 10 μl <![CDATA[10 0 ]]> <![CDATA[10 -1 ]]> <![CDATA[10 -2 ]]> <![CDATA[10 -3 ]]> <![CDATA[10 -4 ]]> <![CDATA[10 -5 ]]> <![CDATA[10 -6 ]]> <![CDATA[10 -7 ]]> <![CDATA[10 -8 ]]> B 10 μl <![CDATA[10 0 ]]> <![CDATA[10 -1 ]]> <![CDATA[10 -2 ]]> <![CDATA[10 -3 ]]> <![CDATA[10 -4 ]]> <![CDATA[10 -5 ]]> <![CDATA[10 -6 ]]> <![CDATA[10 -7 ]]> <![CDATA[10 -8 ]]>

[0076] Calculate the virus titer (BT = PFU / ml, transducing units) using the formula:

[0077]

[0078] According to the above formula, the titer of the adenovirus obtained by amplification was approximately 7.0×10 10 PFU / mL.

[0079] 5. Sequencing verification: Verify whether Tgfbr2 has been inserted into the pADM-FH backbone vector and send the extracted recombinant vector to Beijing Qingke Xinye Biotechnology Co., Ltd. for sequencing.

[0080] The present invention also discloses an ovarian function-protecting drug comprising AdV-Tgfbr2 as the primary ingredient and an essential drug carrier. The drug can be formulated into any of a granule, powder, ointment, pill, oral solution, injection, or capsule, with the injection being preferred.

[0081] In order to better explain the technical solution disclosed in the present invention, a detailed description is given below in conjunction with specific embodiments.

[0082] Example Ovarian in situ injection overexpression experiment

[0083] Experimental animals and materials:

[0084] 1. Experimental animals: mice;

[0085] Source, strain, and breed: Beijing Weitonglihua Biotechnology Co., Ltd., inbred strain, C57BL / 6;

[0086] Reproductive age: 8 weeks;

[0087] 2. Experimental materials:

[0088] Chloral hydrate: Shanghai Lingfeng Chemical Reagent Co., Ltd.; AdV-GFP: control adenovirus containing green fluorescent protein gene; the titer of the present invention is preferably 1.0×10 10 pfu / mL;

[0089] Stereo microscope: Olympus, model: SZ61;

[0090] Microinjection needle: Shanghai Gaoge Industry and Trade Co., Ltd. 10 μL (pointed tip) model: A124019;

[0091] Step 1: Anesthetize the mouse: Fast the mouse for 12 hours before surgery. After weighing the mouse, inject the appropriate volume of 4% chloral hydrate (10 μL / g) intraperitoneally. Place the mouse with its back facing up on a sterile gauze pad, stretch its limbs, and secure them to a wooden board.

[0092] Step 2: Expose the surgical field: Shave the mouse's back with a razor. Make an incision above the left and right ovaries. Disinfect the incision site with 75% alcohol. Lift the mouse's dorsal skin with forceps and use scissors to make a small incision on the dorsal medial side just above the ovarian fat pad. Cut the peritoneal wall open, place a sterile saline gauze pad near the incision, locate the ovarian fat pad, gently pull it outward, and place it on the gauze.

[0093] Step 3: Insert the microinjection needle: Under a stereomicroscope, gently insert the alcohol-sterilized microinjection needle (30 gauge) into the fallopian tube bend of the ovarian bursa. The needle tip can be seen under the ovarian bursa.

[0094] Step 4. Injection: Pipette 4-5 μL of prepared AdV-Tgfbr2 into the ovarian bursa for the experimental group and AdV-GFP for the control group. Inject slowly and quickly remove the needle to seal the puncture site. Be gentle and avoid tearing the ovarian bursa. If the injection is done properly, you should see a slight expansion of the ovarian bursa.

[0095] Step 5. Discussion of experimental results: The ovaries were returned to their original anatomical position, and the peritoneal wall, muscularis, and skin were sutured with absorbable sutures; after suturing, the surgical incision was disinfected with iodine. The mice were placed on a heating pad after surgery to avoid hypothermia, allowing the mice to rest and recover, thereby accelerating recovery. The respiratory rate and comfort of the mice, as well as their ability to move independently, were monitored to assess the postoperative recovery effect. Specifically, one week after surgery, the ovaries of the experimental and control groups were taken, and the adipose tissue surrounding the ovaries was separated under a stereomicroscope. On the one hand, total RNA and protein were extracted from the tissues, and the overexpression level of Tgfbr2 was detected by qPCR and WB. On the other hand, the ovaries were subjected to immunofluorescence detection of frozen sections and immunohistochemistry detection of paraffin sections.

[0096] Step 6: Repeat the above steps and, approximately 2 weeks after the in situ ovarian virus injection, administer doxorubicin (10 mg / kg) intraperitoneally to both the control and experimental groups to create an ovarian injury model. The specific procedures are described in the following literature.

[0097] 1. Ben-Aharon, I., et al., Doxorubicin-induced ovariantoxicity. Reproductive biology and endocrinology: RB&E, 2010.8: p.20.

[0098] 2. Bar-Joseph, H., et al., In vivo bioimaging as a novel strategy to detect doxorubicin-induced damage to gonadal blood vessels. PloS one, 2011.6(9):p.e23492.

[0099] at the same time, Figure 1 The results of the fibrotic damage and Tgfbr2 protein level test on the mouse ovary caused by adriamycin were combined with Figure 1 A It can be seen that adriamycin-induced ovarian damage includes increased fibrosis, combined with Figure 1 B and Figure 1 As shown in Figure 3, the expression levels of Tgfbr2 in mRNA and protein decreased. We conducted qPCR and WB experiments to investigate the effect of Tgfbr2 overexpression in ovaries. Figure 2 As shown in Figure 2, the overexpression effect of AdV-Tgfbr2 after orthotopic injection into ovaries was detected at the mRNA and protein levels, and it was found that its expression was significantly upregulated.

[0100] To better demonstrate the beneficial effects of Tgfbr2 designed in the present invention in protecting ovarian function, the present invention also records the effects of using AdV-Sirt1 under the same experimental conditions, as follows:

[0101] (1) In terms of target gene overexpression maintenance time:

[0102] Ovarian tissues of mice in the AdV-GFP, AdV-Tgfbr2, and AdV-Sirt1 groups were collected at 2, 4, 6, and 8 weeks for protein overexpression detection. Proteins from ovarian tissues of each group were extracted and Western blot was performed to detect the expression of Sirt1 and Tgfbr2 proteins at each time point. It was found that Sirt1 protein expression was significantly increased after 2 and 4 weeks of AdV-Sirt1 intervention, as shown in Figure 2. Figure 3 As shown in A, 3C; there was no significant statistical difference at 6-8 weeks; however, it was found that the protein expression of Tgfbr2 was significantly increased after 2 weeks, 4 weeks, and 6 weeks of AdV-Tgfbr2 intervention, but there was no obvious upward trend at 8 weeks, as shown in Figure 3 This indicates that the upregulation of the corresponding target gene by AdV-Tgfbr2 designed in the present invention can be maintained for a longer period of time than that by AdV-Sirt1, which indirectly indicates that the gene therapy effect of AdV-Tgfbr2 may be better if the experimental conditions are the same or similar.

[0103] (2) In terms of counteracting the decline in ovarian endocrine function caused by adriamycin chemotherapy:

[0104] The serum levels of estrogen and progesterone were detected and the results showed that compared with the AdV-GFP+Dox group, the estrogen levels in the AdV-Tgfbr2+Dox group were as follows: Figure 4 A. Figure 4 B, and Figure 4 The AMH levels described in D were significantly increased.

[0105] like Figure 4 As shown in C, there was no significant statistical difference in FSH levels among the groups, but there was a downward trend in the AdV-Tgfbr2+Dox group.

[0106] Although estrogen and AMH levels in the AdV-Sirt1+Dox group also showed an upward trend compared to the AdV-GFP+Dox group, there was no significant statistical difference. This suggests that AdV-Tgfbr2 is more effective than AdV-Sirt1 in improving the decline in ovarian endocrine function caused by doxorubicin chemotherapy.

[0107] (3) In terms of counteracting the decline in ovarian reserve function caused by adriamycin chemotherapy:

[0108] Combine Figure 5 As shown in B, by examining the ovaries of mice, it was found that compared with the AdV-GFP+Dox group, the ovarian mass of the mice in the AdV-Tgfbr2+Dox group was significantly increased, and the ovarian index of the AdV-Sirt1+Dox group and the AdV-Tgfbr2+Dox group was significantly increased, but the increase in the AdV-Tgfbr2+Dox group was more obvious. The mouse ovaries were continuously sectioned for H&E staining. Figure 5 As shown in A, and follicle counts were performed, as Figure 5 As shown in Figure C, it was found that compared with the AdV-GFP+Dox group, the number of atretic follicles in the AdV-Sirt1+Dox group and the AdV-Tgfbr2+Dox group was significantly decreased, and AdV-Tgfbr2 reduced the number of atretic follicles more significantly, and was more capable of improving atretic follicles than AdV-Sirt1.

[0109] In summary, the AdV-Tgfbr2 disclosed in this application advantageously improves the decline in ovarian endocrine function or ovarian reserve function caused by doxorubicin. This is because the AdV-Tgfbr2 disclosed in this application can compensate for the decline in Tgfbr2 expression caused by ovarian interstitial damage caused by doxorubicin through a gene supplementation effect. Its possible mechanism of action is to reduce the degree of ovarian interstitial fibrosis caused by chemotherapy, thereby facilitating the restoration of ovarian endocrine and reserve functions. In addition, since ovarian interstitial fibrosis can also cause ovarian aging or cause the ovaries to lose their responsiveness, it is speculated that the AdV-Tgfbr2 also has the ability to counteract and delay ovarian aging and / or improve ovarian reserve function and / or restore ovarian function.

[0110] As those skilled in the art know, Sirt1 plays a key role in follicular development and can also delay ovarian aging. This application uses AdV-Tgfbr2 to supplement related genes. Compared with AdV-Sirt1, although both are about supplementing their respective related genes and can also achieve protection of ovarian function, the mechanism of action is different. As mentioned above, AdV-Tgfbr2 may reduce the degree of ovarian interstitial fibrosis caused by chemotherapy, while AdV-Sirt1 may be through protecting the development of follicles or follicular microenvironment, and AdV-Tgfbr2 is superior to AdV-Sirt1 in terms of protein expression maintenance time, ovarian reserve and functional recovery, so the two still have significant differences.

[0111] The above embodiments are merely preferred examples and are not intended to limit the embodiments of the present invention. In addition to the above embodiments, the present invention has other embodiments. Any technical solution formed by equivalent substitution or equivalent transformation falls within the scope of protection claimed by the present invention.

Claims

1. The application of Tgfbr2 in the preparation of ovarian function protection drugs, characterized in that: The ovarian function protection is to repair ovarian damage; the ovarian damage is ovarian interstitial fibrosis caused by adriamycin chemotherapy.

2. The application of Tgfbr2 in the preparation of ovarian function protection drugs, characterized in that: The ovarian function protection is to improve the decreased ovarian reserve function caused by adriamycin chemotherapy.

3. The use of Tgfbr2 according to any one of claims 1 to 2 in the preparation of a drug for protecting ovarian function, characterized in that: The drug is a recombinant nucleic acid construct expressing Tgfbr2 protein. The expression vector of the recombinant nucleic acid construct is any expression vector suitable for gene therapy, including a viral vector; the viral vector is an adenovirus vector.

4. The use of Tgfbr2 according to any one of claims 1 to 2 in the preparation of a drug for protecting ovarian function, characterized in that: The dosage form of the medicine is injection type.