Method for regulating alkaloid content of plants

Abstract

The present invention provides a method for regulating the alkaloid content of a plant (e.g., a tobacco plant), the method comprising modifying the plant by regulating the activity or expression of at least one protein kinase. The present invention also provides the use of at least a protein kinase gene for regulating the alkaloid content of a plant, and tobacco cells, plants, plant propagation materials, harvested leaves, processed tobacco or tobacco products obtainable according to the present invention.

Description

Technical Field

[0001] The present invention relates to methods for regulating the alkaloid content, such as nicotine content, of a plant or part thereof. The present invention also extends to methods for regulating the expression and / or activity of a polypeptide encoded by a gene, the gene regulating the alkaloid content in a plant. In another aspect, the present invention provides methods for regulating the expression and / or activity of a gene encoding a polypeptide that regulates the alkaloid content in a plant. The present invention also extends to constructs that can be used to regulate the polypeptide, plant cells transformed with such constructs, and the transgenic plants themselves. The present invention also relates to the use of leaves harvested from such transgenic plants, the transgenic plants having been transformed with a genetic construct for regulating the alkaloid content, and smoking articles (e.g., combustible smoking articles) comprising such leaves. Background Art

[0002] Alkaloids are a group of naturally occurring compounds that contain primarily basic nitrogen atoms and are produced by a wide variety of organisms including bacteria, fungi, plants and animals.

[0003] Alkaloids can be classified based on the similarity of the carbon skeleton such as indole, isoquinoline and pyridine. Pyridine derivatives are a class of monomeric alkaloids; this class includes simple pyridine derivatives, polycyclic condensed and non-condensed pyridine derivatives, and sesquiterpene pyridine derivatives. Examples are nicotine, nornicotine, anabasine, mithofamine and anatabine.

[0004] Most of the known biological functions of alkaloids are related to protection. Neuroactive molecules such as caffeine, cocaine, morphine and nicotine act as defense compounds against invading predators. The accumulation of these alkaloids is the result of a signal transduction cascade that monitors gene expression, enzyme activity and alkaloid concentration. The fine regulation of alkaloid content in plants involves negative feedback loops and degradation pathways.

[0005] Nicotine occurs naturally in several plant species, but is found at the highest levels in tobacco plants. Cultivated tobacco produces 2-4% of the alkaloid by dry weight. Nicotine is present in both wild and cultivated tobacco ( Nicotiana ) species and plays an important role in plant defense against herbivores and insects (Voelckel et al. 2001, incorporated herein by reference), accounting for ~90% of the total alkaloid content. The remaining 10% of the alkaloid pool is mainly composed of the structurally related compounds nornicotine, anatabine, anabasine, and pseudooxynicotine (PON).

[0006] The regulation of alkaloid content in tobacco is complex. Several factors including genotype, environment, fertilization, and agronomic practices (e.g., topping) influence alkaloid levels in tobacco plants. Some key regulators of nicotine biosynthesis are well characterized, such as putrescine N-methyltransferase (PMT), which plays a key role in this pathway, is activated by members of the ethylene response factor (ERF) superfamily, the largest family of transcription factors in the tobacco genome (Rushton et al., 2008, incorporated herein by reference). Other transcription factors that induce alkaloid biosynthesis belong to the MYC2-like basic helix-loop-helix (bHLH) family. MYC2-like bHLHs regulate alkaloid levels directly through Gbox-mediated binding and activation of alkaloid structural genes, and indirectly through the activation of ERFs.

[0007] Modifying the alkaloid content in plants (e.g., tobacco) can have several commercial advantages. For example, reducing the total alkaloid content in a plant can increase the value of the plant as a biomass resource. For example, modifying the alkaloid content can include reducing the alkaloid content in a tobacco plant, such as the nicotine content. In view of the "nicotine ceiling", i.e., the potential regulation of the average nicotine upper limit in tobacco products, tobacco plants and products with reduced nicotine may be desirable. On the other hand, increasing the alkaloid content in plants such as tobacco plants can help protect plants from insects and herbivores. There is still a need for plants and methods for preparing the same, wherein the plants have regulated alkaloid content, such as regulated (e.g., reduced) nicotine content, in the case of having a commercially desirable trait that is maintained or improved.

[0008] Tobacco pyridine alkaloids are precursors of tobacco-specific nitrosamines (TSNAs), which are formed during the curing process of leaves after harvest. The four main TSNAs found in cured tobacco leaves are N'-nitrosonornicotine (NNN), N'-nitrosoanatabine (NAT), N'-nitrosoanatabine (NAB), and 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK).

[0009] As described in the examples, the inventors sought to investigate the genes responsible for alkaloid synthesis with the aim of modulating the alkaloid content in plants, for example reducing the nicotine content in tobacco plants. Summary of the invention

[0010] It has surprisingly been found that by modulating the activity or expression of a protein kinase, such as a serine-threonine protein kinase gene as taught herein, the alkaloid content and / or TSNA content or TSNA precursor content of a plant can be modulated. Protein kinases, such as a serine-threonine protein kinase as taught herein, act as negative regulators of nicotine biosynthesis.

[0011] According to the present invention, tobacco products with regulated alkaloid content and commercially desirable traits sought by consumers of tobacco products can be produced.In some cases, consumers may desire products with low levels of alkaloid content, such as low levels of nicotine content.

[0012] The present invention may be particularly useful in the field of plant molecular agriculture, where plants (e.g., tobacco and other Nicotiana species) are used to produce proteins, peptides and metabolites, e.g., for the production of therapeutics and drugs such as antibiotics, virus-like particles, or neutraceuticals or small molecules. Tobacco has been used to develop HIV-neutralizing antibodies in an EU-funded project called PharmPlant, and Medicago Inc. in Canada has been involved in a tobacco-based platform for the production of virus-like particles for influenza vaccine manufacturing.

[0013] Therefore, plants according to the present invention can be used in molecular agriculture to reduce or eliminate the presence of nicotine and / or other nicotine alkaloids. The use of low nicotine plants or rootsocks is beneficial in molecular agriculture and will reduce downstream processing costs associated with purification.

[0014] In other cases, it may be desirable to produce plants with high alkaloid levels, such as high levels of nicotine content, so that nicotine can be purified from the tobacco plant to produce pure nicotine products such as for use in devices that utilize liquids containing nicotine (e.g., e-cigarettes) or tobacco heating devices. For example, the production of plants with leaves containing high levels of nicotine can reduce the cost of nicotine extraction for the production of e-liquids for use in electronic cigarettes.

[0015] The inventors have surprisingly determined a method for regulating the alkaloid content, such as nicotine content, of a plant (e.g., a tobacco plant) by regulating the activity or expression of a protein kinase, which acts as a negative regulator of nicotine in tobacco. The alkaloid content (e.g., nicotine content) of a plant (e.g., a tobacco plant) can be reduced by increasing the activity or expression of a protein kinase, or can be increased by reducing the activity or expression of a protein kinase. Prior to the present invention, it was not known that the regulation of the activity or expression of a protein kinase as described herein could be used to regulate (e.g., reduce) the alkaloid content.

[0016] In one aspect, the present invention provides a method for modulating (e.g., reducing) the alkaloid content of a plant or a part thereof, the method comprising modifying the plant by modulating (e.g., increasing) the activity or expression of a protein kinase, the protein kinase:

[0017] a) comprising the amino acid sequence as shown in SEQ ID No. 3; or a functional variant, functional fragment or ortholog of SEQ ID No. 3; or a sequence having at least 80% identity with SEQ ID No. 3; or

[0018] b) is encoded by: a nucleotide sequence as shown in SEQ ID No. 1 or 2; or a functional variant, functional fragment or ortholog of SEQ ID No. 1 or 2; or a nucleic acid sequence having at least 80% identity with SEQ ID No. 1 or 2.

[0019] In another aspect, the present invention provides a method for modulating (e.g., reducing) the content of tobacco-specific nitrosamines (TSNAs) or TSNA precursors in a tobacco plant or plant part thereof, the method comprising modifying the plant by modulating (e.g., increasing) the activity or expression of a protein kinase, the protein kinase:

[0020] a) comprising the amino acid sequence as shown in SEQ ID No. 3; or a functional variant, functional fragment or ortholog of SEQ ID No. 3; or a sequence having at least 80% identity with SEQ ID No. 3; or

[0021] b) is encoded by: a nucleotide sequence as shown in SEQ ID No. 1 or 2; or a functional variant, functional fragment or ortholog of SEQ ID No. 1 or 2; or a nucleic acid sequence having at least 80% identity with SEQ ID No. 1 or 2.

[0022] In a further aspect, the present invention provides the use of at least one gene encoding a protein kinase for modulating the alkaloid content of a cell or plant or part thereof or a cell culture; wherein the protein kinase:

[0023] a) comprising the amino acid sequence as shown in SEQ ID No. 3; or a functional variant, functional fragment or ortholog of SEQ ID No. 3; or a sequence having at least 80% identity with SEQ ID No. 3; or

[0024] b) is encoded by: a nucleotide sequence as shown in SEQ ID No. 1 or 2; or a functional variant, functional fragment or ortholog of SEQ ID No. 1 or 2; or a nucleic acid sequence having at least 80% identity with SEQ ID No. 1 or 2.

[0025] In yet another aspect, the present invention provides a method for producing a plant or part thereof, cell or cell culture, plant propagation material, leaf, cut harvested leaf, processed leaf or cut and processed leaf having a modulated (e.g. reduced) alkaloid content, the method comprising modifying the plant or part thereof or cell or cell culture to modulate the activity or expression of a protein kinase, said protein kinase:

[0026] a) comprising the amino acid sequence as shown in SEQ ID No. 3; or a functional variant, functional fragment or ortholog of SEQ ID No. 3; or a sequence having at least 80% identity with SEQ ID No. 3; or

[0027] b) is encoded by: a nucleotide sequence as shown in SEQ ID No. 1 or 2; or a functional variant, functional fragment or ortholog of SEQ ID No. 1 or 2; or a nucleic acid sequence having at least 80% identity with SEQ ID No. 1 or 2.

[0028] The present invention provides a method for modulating (eg reducing) the alkaloid content of a plant or a part thereof, the method comprising modifying the plant by modulating (eg increasing) the activity or expression of at least one gene encoding a protein kinase.

[0029] In another aspect, the present invention provides a method for modulating (e.g., reducing) the content of tobacco-specific nitrosamines (TSNAs) or TSNA precursors in a tobacco plant or a plant part thereof, the method comprising modifying the plant by modulating (e.g., increasing) the activity or expression of at least one gene encoding a protein kinase.

[0030] At least one gene may encode a protein kinase polypeptide comprising an amino acid sequence as shown in SEQ ID No. 3, or a functional variant, functional fragment or ortholog thereof, or a sequence having at least 80% identity with SEQ ID No. 3; or at least one gene encoding a protein kinase may comprise a nucleotide sequence as shown in SEQ ID No. 1 or 2, or a functional variant, functional fragment or ortholog thereof, or a nucleic acid sequence having at least 80% identity with SEQ ID No. 1 or 2.

[0031] In another aspect, the present invention provides the use of at least one gene encoding a protein kinase for regulating (e.g., reducing) the alkaloid content of a cell or plant or part thereof or a cell culture; wherein the at least one gene encodes a protein kinase polypeptide comprising an amino acid sequence as shown in SEQ ID No. 3, or a functional variant or functional fragment or straight homologue thereof, or a sequence having at least 80% identity with SEQ ID No. 3; or wherein the at least one gene encoding a protein kinase comprises a nucleotide sequence as shown in SEQ ID No. 1 or 2; or a functional variant or functional fragment or straight homologue of SEQ ID No. 1 or 2, or a nucleic acid sequence having at least 80% identity with SEQ ID No. 1 or 2.

[0032] In yet another aspect, a method for producing a plant or part thereof, a cell or cell culture, a plant propagation material, a leaf, a cut harvested leaf, a processed leaf or a cut and processed leaf having a modulated (e.g., reduced) alkaloid content (e.g., reduced nicotine content) is provided, the method comprising modifying the plant or cell culture to modulate (e.g., increase) the activity or expression of at least one gene encoding a protein kinase, wherein the at least one gene encodes a protein kinase polypeptide comprising: an amino acid sequence as shown in SEQ ID No. 3; or a functional variant or functional fragment or ortholog thereof, or a sequence having at least 80% identity with SEQ ID No. 3; or wherein the at least one gene encoding a protein kinase comprises a nucleotide sequence as shown in SEQ ID No. 1 or 2; or a functional variant or functional fragment or ortholog of SEQ ID No. 1 or 2, or a nucleic acid sequence having at least 80% identity with SEQ ID No. 1 or 2.

[0033] The alkaloid content may be modulated (eg, decreased) compared to a plant or cell culture which has not been modified to modulate (eg, increase) the activity or expression of at least one gene encoding a protein kinase.

[0034] In a further aspect, there is provided a plant or part thereof or a cell or a cell culture which has been modified to achieve modulation (e.g. reduction) in alkaloid content compared to an unmodified plant or unmodified cell culture, wherein the modification is modulation of the activity or expression of a protein kinase which:

[0035] a) comprising the amino acid sequence as shown in SEQ ID No. 3; or a functional variant, functional fragment or ortholog of SEQ ID No. 3; or a sequence having at least 80% identity with SEQ ID No. 3; or

[0036] b) is encoded by: a nucleotide sequence as shown in SEQ ID No. 1 or 2; or a functional variant, functional fragment or ortholog of SEQ ID No. 1 or 2; or a nucleic acid sequence having at least 80% identity with SEQ ID No. 1 or 2.

[0037] In a further aspect, a plant or part thereof or cell or cell culture is provided which has been modified to achieve modulation (e.g., reduction) in alkaloid content (e.g., nicotine content) compared to an unmodified plant or unmodified cell culture, wherein the modification is modulation of the activity or expression of at least one gene encoding a protein kinase polypeptide comprising: an amino acid sequence as shown in SEQ ID No. 3, or a functional variant or functional fragment or ortholog thereof, or a sequence having at least 80% identity with SEQ ID No. 3; or wherein at least one gene encoding a protein kinase comprises a nucleotide sequence as shown in SEQ ID No. 1 or 2, or a functional variant or functional fragment or ortholog thereof, or a nucleic acid sequence having at least 80% identity with SEQ ID No. 1 or 2.

[0038] In another aspect, there is provided plant propagation material obtainable from a plant according to the invention, or a plant or a cell or a cell culture produced by a method according to the invention.

[0039] In one aspect, the alkaloid content of the plant or part thereof or cell or cell culture may be reduced compared to a plant or part thereof or cell or cell culture which has not been modified according to the invention to modulate the activity or expression of at least one protein kinase. Suitably, the activity or expression of at least one protein kinase may be increased compared to a plant or part thereof or cell or cell culture which has not been modified to modulate the activity or expression of a protein kinase.

[0040] In another aspect, the alkaloid content of the plant or part thereof or cell or cell culture may be increased compared to a plant or part thereof or cell or cell culture which has not been modified according to the invention to modulate the activity or expression of at least one protein kinase. Suitably, the activity or expression of at least one protein kinase may be reduced compared to a plant or part thereof or cell or cell culture which has not been modified to modulate the activity or expression of at least one protein kinase.

[0041] Suitably, the total alkaloid content of the plant or cell culture may be modulated (eg reduced).

[0042] The content of one or more alkaloids selected from nicotine, anabasine, anatabine, nornicotine, PON and mithosamine may be regulated (eg, reduced), preferably, the content of nicotine is regulated (eg, reduced).

[0043] The plant or part or plant cell may be from the family Solanaceae ( Solanaceae The plant or part or plant cell may be from the genus Solanum ( Solanum ). The plant or part thereof or plant cell may be from the genus Nicotiana.

[0044] In one aspect, compared with comparable products, the nicotine content of tobacco plant or its part, or tobacco cell or tobacco cell culture, or plant propagation material according to the present invention is regulated. Suitably, compared with comparable products, the nicotine content can be reduced.

[0045] In another aspect, there is provided use of a plant or part thereof or a cell or cell culture according to the invention, or a plant produced by a method of the invention for growing a plant.

[0046] In another aspect, there is provided use of a plant or part thereof or a cell or cell culture according to the invention, or a plant produced by a method according to the invention, for producing a product. Suitably, the product may be a tobacco industry product.

[0047] In another aspect, there is provided the use of a plant according to the invention or a part thereof, or a plant produced by a method according to the invention, for growing crops.

[0048] In another aspect, there is provided use of a plant or part thereof according to the invention, or a plant produced by a method of the invention, for producing leaves.

[0049] In a further aspect, there is provided harvested leaves of a plant of the invention, or obtainable (e.g. obtained from) a plant propagated from the propagation material of the invention, or obtainable (e.g. obtained from) a plant obtained by the use of the invention, or obtainable (e.g. obtained from) a plant produced by the method of the invention.

[0050] The harvested leaves of the plant may be cut harvested leaves.

[0051] In yet another aspect, there is provided a processed leaf, preferably a processed tobacco leaf, preferably a non-viable processed tobacco leaf, which:

[0052] obtainable from (e.g. obtained from) a plant obtainable from the use according to the invention;

[0053] obtainable (e.g. obtained) by processing the plant according to the invention;

[0054] obtainable (eg obtained) from a plant propagated from the plant propagation material according to the invention; or

[0055] obtainable (e.g. obtained) by processing harvested leaves of a plant according to the invention; or

[0056] Obtainable (eg obtained) from a plant produced by a method according to the invention.

[0057] The leaves may be processed by curing, fermenting, pasteurizing, or a combination thereof.

[0058] Suitably, the machining blade may be a cutting machining blade.

[0059] In a further aspect, there is provided a cured tobacco material made from a plant or part thereof or extract thereof according to the invention.

[0060] In another aspect, there is provided a tobacco blend comprising the cured tobacco material according to the present invention.

[0061] In another aspect, a tobacco industry product is provided, which is prepared by:

[0062] A tobacco plant or part thereof according to the invention, or a tobacco cell or a tobacco cell culture according to the invention;

[0063] Tobacco plants or parts thereof propagated from tobacco plant propagation material according to the invention;

[0064] Harvested leaves of a plant according to the present invention, wherein the plant is tobacco;

[0065] The processed leaves according to the invention, wherein the plant is tobacco;

[0066] or

[0067] Plants produced by the methods of the present invention.

[0068] The tobacco industry product may be a combustible smoking article. The tobacco product may be a smokeless tobacco product. The tobacco product may be a non-combustible gas aerosol delivery system, such as a tobacco heating device or an aerosol generating device.

[0069] In a further aspect, there is provided the use of a tobacco cell according to the invention for modulating alkaloid content in a cell culture.

[0070] In another aspect, a combustible smoking article, a non-combustible gas aerosol delivery system, a smokeless tobacco product or a tobacco heating device is provided, which comprises a plant or part thereof or an extract thereof (e.g., a tobacco extract) according to the invention, or a tobacco cell culture according to the invention; or a cured tobacco material according to the invention; or a tobacco blend according to the invention.

[0071] In another aspect, there is provided the use of a nucleotide sequence of at least one gene encoding a protein kinase comprising an amino acid sequence as shown in SEQ ID No. 3; or a functional variant or functional fragment or ortholog thereof, or a sequence having at least 80% identity with SEQ ID No. 3 to select plants having a modulated (e.g. reduced) alkaloid content and / or a modulated (e.g. reduced) TSNA or TSNA precursor content. In another aspect, the present invention provides a mutant of a plant carrying a heritable mutation in a nucleotide sequence, wherein the nucleotide sequence

[0072] a) encodes the amino acid sequence as shown in SEQ ID No. 3; or a functional variant, functional fragment or ortholog of SEQ ID No. 3; or a sequence having at least 80% identity with SEQ ID No. 3; or

[0073] b) comprising a sequence as shown in SEQ ID No. 1 or 2; or a functional variant, functional fragment or ortholog of SEQ ID No. 1 or 2; or a nucleic acid sequence having at least 80% identity with SEQ ID No. 1 or 2;

[0074] wherein the heritable mutation modulates (e.g., reduces) the activity or expression of at least one gene encoding a protein kinase, and wherein the mutant plant has a modulated (e.g., reduced) alkaloid content and / or a modulated tobacco-specific nitrosamine (TSNA) or TSNA precursor content relative to a comparable plant not carrying the heritable mutation.

[0075] In a further aspect, a mutant of a plant carrying a heritable mutation in the nucleotide sequence of at least one gene encoding a protein kinase is provided, wherein the gene is selected from the nucleotide sequence as shown in SEQ ID No. 1 or 2; or a functional variant or functional fragment or ortholog of SEQ ID No. 1 or 2; or a nucleic acid sequence having at least 80% identity with SEQ ID No. 1 or 2, wherein the heritable mutation modulates (e.g., reduces) the activity or expression of at least one gene encoding a protein kinase, and wherein the mutant plant has a modulated (e.g., reduced) alkaloid content and / or a modulated (e.g., reduced) tobacco-specific nitrosamine (TSNA) or TSNA precursor content relative to a comparable plant not carrying the heritable mutation.

[0076] In another aspect, progeny or seeds of a mutant plant carrying a heritable mutation according to the present invention are provided.

[0077] In another aspect, there is provided a harvested leaf, processed leaf or cured tobacco material produced from a plant comprising a modification in a nucleotide sequence:

[0078] a) encodes the amino acid sequence as shown in SEQ ID No. 3; or a functional variant, functional fragment or ortholog of SEQ ID No. 3; or a sequence having at least 80% identity with SEQ ID No. 3; or

[0079] b) comprising a sequence as shown in SEQ ID No. 1 or 2; or a functional variant, functional fragment or ortholog of SEQ ID No. 1 or 2; or a nucleic acid sequence having at least 80% identity with SEQ ID No. 1 or 2;

[0080] wherein the modification modulates (e.g., reduces) the activity or expression of at least one gene encoding a protein kinase, and wherein the plant has a modulated (e.g., reduced) alkaloid content and / or a modulated tobacco-specific nitrosamine (TSNA) or TSNA precursor content relative to a comparable plant not carrying the modification in the protein kinase.

[0081] In a further aspect, there is provided a harvested leaf, processed leaf or cured tobacco material produced from a plant comprising a modification in the nucleotide sequence of at least one gene encoding a protein kinase, wherein the at least one gene is selected from: the nucleotide sequence as shown in SEQ ID No. 1 or 2; or a functional variant or functional fragment or ortholog of SEQ ID No. 1 or 2; or a nucleic acid sequence having at least 80% identity with SEQ ID No. 1 or 2; wherein the modification modulates (e.g., increases) the activity or expression of the at least one gene encoding a protein kinase, and wherein the plant has a modulated (e.g., reduced) alkaloid content and / or a modulated tobacco-specific nitrosamine (TSNA) or TSNA precursor content relative to a comparable plant that does not carry the modification in the at least one gene encoding a protein kinase. BRIEF DESCRIPTION OF THE DRAWINGS

[0082] Embodiments of the present invention will now be described, by way of example only, with reference to the accompanying drawings, in which:

[0083] Figure 1 Nicotine content of 5-week-old TN90 leaves expressing Nitab4.5_0003679g0060.2 (SEQ ID No. 1) is shown. Nicotine content is expressed relative to the control and contains three biological replicates analyzed by t-test. Values ​​are shown as mean ± SEM. Asterisks indicate statistical significance of P value ≤ 0.001.

[0084] Figure 2 Nicotine content of 5-week-old TN90 leaves expressing a construct that silences Nitab4.5_0003679g0060.2 (SEQ ID No. 1) by viral-induced gene silencing is shown. Nicotine content is expressed relative to control and contains three biological replicates analyzed by t-test. Values ​​are shown as mean ± SEM. Asterisks indicate statistical significance of P values ​​≤ 0.001.

[0085] Figure 3 Shown is a coding sequence of the present invention from tobacco ( Nicotiana tabacum ) genomic sequence of Nitab4.5_0003679g0060.2 – SEQ ID No. 1.

[0086] Figure 4 The cDNA sequence of Nitab4.5_0003679g0060.2 encoding the protein kinase from Nicotiana tabacum according to the present invention is shown - SEQ ID No. 2.

[0087] Figure 5 The polypeptide sequence of Nitab4.5_0003679g0060.2 encoding the protein kinase from Nicotiana tabacum according to the present invention is shown - SEQ ID No. 3.

[0088] Figure 6 SEQ ID NO. 4 corresponding to the 248-nucleotide cDNA fragment in Example 2 is shown.

[0089] Figure 7 Alkaloid content of 5-week-old TN90 leaves expressing the constructs shown is shown. Content is expressed relative to the control and contains three biological replicates analyzed by one-way ANOVA and Tukey's multiple-comparison post-test. Values ​​are shown as mean ± SEM. Asterisks indicate statistical significance of P values ​​≤ 0.001.

[0090] Figure 8Shown is an image of SDS-PAGE showing the expression of wild-type Nitab4.5_0003679g0060.2 (SEQ ID No. 3) and the K308M mutant in E. coli. Pro-Q Diamond phosphoprotein gel staining shows the ability of Nitab4.5_0003679g0060.2 (SEQ ID No. 3) and the K308M mutant to autophosphorylate and phosphorylate myelin basic protein (MyBP). The vertical bars indicate lane separation within the same blot.

[0091] Sequence Listing

[0092] A summary of sequence identifiers used throughout the subject specification and the corresponding sequence listing is provided, wherein:

[0093] SEQ ID No. 1 corresponds to the nucleotide sequence encoding the gene referred to as Nitab4.5_0003679g0060.2.

[0094] SEQ ID No. 2 corresponds to the cDNA sequence of Nitab4.5_0003679g0060.2.

[0095] SEQ ID No. 3 corresponds to the protein sequence encoded by Nitab4.5_0003679g0060.2.

[0096] SEQ ID No. 4 corresponds to the 248-nucleotide cDNA fragment in Example 2.

[0097] SEQ ID No. 5 is the primer used in Example 2.

[0098] SEQ ID No. 6 is the primer used in Example 2. DETAILED DESCRIPTION

[0099] The inventors have shown for the first time that by modulating the activity or expression of at least one protein kinase gene in a plant, such as a tobacco plant, the alkaloid and / or TSNA content of the plant can be modulated.

[0100] The present invention provides a method for modulating (eg reducing) the alkaloid content of a plant or a part thereof, the method comprising modifying the plant by modulating (eg increasing) the activity or expression of at least one gene encoding a protein kinase.

[0101] Also provided is a method of modulating (e.g., reducing) the content of tobacco-specific nitrosamines (TSNAs) or TSNA precursors in a tobacco plant or plant part thereof, the method comprising modifying the plant by modulating (e.g., increasing) the activity or expression of at least one gene encoding a protein kinase.

[0102] The at least one protein kinase gene is selected from at least one gene encoding a protein kinase polypeptide, wherein the protein kinase polypeptide comprises an amino acid sequence as shown in SEQ ID No. 3, or a functional variant or functional fragment or ortholog thereof, or a sequence having at least 80% identity with SEQ ID No. 3; or wherein the at least one gene encoding a protein kinase comprises a nucleotide sequence as shown in SEQ ID No. 1 or 2, or a functional variant or functional fragment or ortholog of SEQ ID No. 1 or 2, or a nucleic acid sequence having at least 80% identity with SEQ ID No. 1 or 2.

[0103] Suitably, the at least one protein kinase gene may be one, or two, or three, or four, or five, or six, or seven, or eight, or nine or ten genes selected from the following: a gene encoding a polypeptide comprising: an amino acid sequence as shown in SEQ ID No. 3, or a functional variant, functional fragment or ortholog thereof, or a sequence having at least 80% identity with SEQ ID No. 3; or a gene comprising: a nucleotide sequence as shown in SEQ ID No. 1 or 2, or a functional variant, functional fragment or ortholog of SEQ ID No. 1 or 2, or a nucleic acid sequence having at least 80% identity with SEQ ID No. 1 or 2.

[0104] At least one protein kinase gene encodes a polypeptide comprising an amino acid sequence as shown in SEQ ID No. 3, or a functional variant, functional fragment or ortholog thereof, or a sequence having at least 80% identity with SEQ ID No. 3; or wherein at least one gene encoding a protein kinase comprises a nucleotide sequence as shown in SEQ ID No. 1 or 2, or a functional variant, functional fragment or ortholog thereof, or a nucleic acid sequence having at least 80% identity with SEQ ID No. 1 or 2.

[0105] In one aspect, the activity or expression of at least one further gene is modulated. Suitably, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine additional genes selected from SEQ ID No. 1 or 2, or a functional variant or functional fragment or ortholog of SEQ ID No. 1 or 2, or a nucleic acid sequence having at least 80% identity with SEQ ID No. 1 or 2 may also be modulated.

[0106] The "expression" of a protein kinase gene may refer to the level of transcription, translation, or protein expression.

[0107] The "activity" of a protein kinase gene relates to its ability to modify proteins by chemically adding phosphate groups. Phosphorylation can result in functional changes in the target protein, altering its enzymatic activity, cellular localization, or interaction with other proteins.

[0108] The activity of a protein kinase can be determined by measuring the phosphorylation of the target protein, for example by using phospho-specific antibodies in a Western blot.

[0109] Measuring the level or amount of a gene product can be performed by any suitable method, including, for example, comparison of mRNA transcript levels, protein or peptide levels and / or plant phenotype between modified plants and comparable plants that have not been modified according to the invention.

[0110] In one embodiment, the activity of a protein kinase, or in other words, the ability of a protein to act as a protein kinase, can be determined by identifying the phosphoproteome using mass spectrometry, measuring the phosphorylation state of the target protein using a pan-phospho-antibody or an antibody specific for the phosphorylation site to be analyzed, or using electrophoresis of a gel containing a phospho-binding tag acrylamide, and comparing it to a control protein known not to be a protein kinase. The ability of a protein to act as a protein kinase can be determined by measuring the phosphorylation state of a target such as myelin basic protein (MyBp) and staining the phosphoprotein gel, as described in Martin et al., Proteomics. 2003 Jul; 3(7): 1244-55 (incorporated herein by reference). On the other hand, the phosphorylation state of the target protein can be measured using a phospho-specific antibody and Western blotting or fluorescence detection.

[0111] Term " comparable product " as defined herein will be the product derived from plant (for example tobacco plant), described plant has not been modified according to the present invention, but wherein all other relevant characteristics are identical (for example plant species, growth conditions, processing plant such as tobacco method etc.).Comparable products according to the present invention can mean can derive from or derive from not yet modified according to the present invention, for example, with the plant (for example tobacco plant) or its part of the plant of the activity or expression of regulating protein kinase gene, for example blade (for example tobacco leaf), blade of harvest (for example tobacco leaf of harvest), blade of harvest of cutting (for example tobacco leaf of harvest of cutting), processing blade (for example processing tobacco leaf) or plant propagation material (for example tobacco plant propagation material) or comprise described plant or its part product, for example tobacco product or its combination.In one embodiment, comparable product is the product of the protein kinase gene that does not comprise its activity or expression and has been regulated.

[0112] As used herein, the term "modification" or "modified" means a plant (e.g., a tobacco plant) that has been altered or changed. The present invention encompasses plant modification using techniques for genetic modification of plants or non-genetic modification of plants. Such methods are well known in the art, and examples of genetic modification techniques include transformation, transgenics, cisgenics, and gene editing methods. Examples of non-genetic modification techniques include fast neutron mutagenesis, chemical mutagenesis such as ethyl methanesulfonate (EMS) mutagenesis, and modern population analysis methods.

[0113] The term "unmodified plant" as defined herein would be a plant (e.g., a tobacco plant) that has not been modified according to the present invention to modulate the activity or expression of a protein kinase gene, and wherein all other relevant characteristics are the same (e.g., plant species, growing conditions, methods of processing tobacco, etc.). In one embodiment, an unmodified plant is a plant that does not contain a protein kinase gene whose activity or expression has been modulated.

[0114] Protein kinase

[0115] As used herein, "protein kinase" has its usual meaning in the art and refers to an enzyme that catalyzes the transfer of a phosphate group to a target protein. Serine-threonine protein kinases are kinases that phosphorylate the OH group of a serine or threonine amino acid residue. Suitably, a protein kinase comprises a protein kinase domain.

[0116] As used herein, "protein kinase gene" refers to a gene encoding a protein kinase. Phosphorylation may result in functional changes in the target protein, which alters its enzymatic activity, cellular localization, or interaction with other proteins.

[0117] The protein kinase comprises the amino acid sequence as shown in SEQ ID No. 3; or a functional variant or functional fragment or ortholog of SEQ ID No. 3; or a sequence having at least 80% identity with SEQ ID No. 3; or

[0118] b) is encoded by: a nucleotide sequence as shown in SEQ ID No. 1 or 2; or a functional variant, functional fragment or ortholog of SEQ ID No. 1 or 2; or a nucleic acid sequence having at least 80% identity with SEQ ID No. 1 or 2.

[0119] Suitably, the protein kinase may comprise an amino acid sequence having at least 80% sequence identity to SEQ ID No. 3, or a homologue of SEQ ID No. 3, and comprising a protein kinase domain. Suitably, the protein kinase may comprise a lysine residue at an amino acid position corresponding to position 308 when aligned with SEQ ID No. 3.

[0120] In one embodiment, the protein kinase comprises an amino acid sequence as shown in SEQ ID No. 3, or a sequence having at least 80% identity thereto (preferably having at least 85%, at least 90%, at least 95%, at least 97%, at least 98% or at least 99% identity thereto). In one embodiment, the protein kinase comprises an amino acid sequence as shown in SEQ ID No. 3, or a sequence having at least 80% identity thereto (preferably having at least 85%, at least 90%, at least 95%, at least 97%, at least 98% or at least 99% identity thereto) and comprising a protein kinase domain. Suitably, the protein kinase may comprise an amino acid sequence having at least 80% sequence identity to SEQ ID No. 3, or a homologue of SEQ ID No. 3, and comprising a protein kinase domain. Suitably, the protein kinase may comprise a lysine residue at an amino acid position corresponding to position 308 when aligned with SEQ ID No. 3.

[0121] In one embodiment, the wild-type protein kinase comprises the amino acid sequence shown in SEQ ID NO. 3.

[0122] Suitably, the protein may be derived from tobacco.

[0123] In one embodiment, the protein kinase is encoded by a polynucleotide sequence comprising the sequence shown as SEQ ID No. 1 or SEQ ID No. 2, or a sequence having at least 80% sequence identity thereto.

[0124] Suitably, the protein kinase for use according to the present invention may be encoded by a polynucleotide sequence comprising the sequence shown in SEQ ID No. 1, or a sequence having at least 80% sequence identity thereto (preferably at least 85%, preferably at least 90%, preferably at least 95%, at least 97% or at least 99% identity thereto).

[0125] Suitably, the protein kinase for use according to the present invention may be encoded by a polynucleotide sequence comprising the sequence shown in SEQ ID No. 2, or a sequence having at least 80% sequence identity thereto (preferably at least 85%, preferably at least 90%, preferably at least 95%, at least 97% or at least 99% identity thereto).

[0126] In one embodiment, the protein kinase is encoded by a polynucleotide sequence selected from the group consisting of: SEQ ID No. 1 or SEQ ID No. 2.

[0127] Suitably, the wild-type protein for use according to the present invention may be encoded by a polynucleotide sequence from Nicotiana tabacum.

[0128] In a preferred aspect, the present invention provides a method for reducing the alkaloid content of a plant or a part thereof or a plant cell, the method comprising modifying the plant by increasing the expression or activity of at least one protein kinase, wherein the protein kinase comprises a sequence as shown in SEQ ID No. 3, or a sequence having at least 80% identity thereto, or a functional variant, functional fragment or ortholog of SEQ ID No. 3; or wherein the at least one protein kinase comprises a nucleotide sequence as shown in SEQ ID No. 1 or 2, or a functional variant, functional fragment or ortholog of SEQ ID No. 1 or 2, or a nucleic acid sequence having at least 80% identity thereto.

[0129] In one aspect, the present invention provides a method for reducing the content of tobacco-specific nitrosamines (TSNAs) or TSNA precursors in a plant or a part thereof (e.g., leaves), the method comprising modifying the plant by increasing the expression or activity of at least one protein kinase, wherein the protein kinase comprises a sequence as shown in SEQ ID No. 3, or a sequence having at least 80% identity thereto, or a functional variant, functional fragment, or ortholog of SEQ ID No. 3; or wherein the at least one protein kinase comprises a nucleotide sequence as shown in SEQ ID No. 1 or 2, or a functional variant, functional fragment, or ortholog of SEQ ID No. 1 or 2, or a nucleic acid sequence having at least 80% identity thereto.

[0130] As used herein, the term "increase" (eg, increase the activity or expression of a protein kinase) means that the activity or expression of the protein kinase is higher compared to the activity or expression of an unmodified gene in a comparable product.

[0131] In some embodiments, the modification that increases the activity or expression of at least one protein kinase and thereby reduces the alkaloid content and / or TSNA content (or TSNA precursor content) is selected from:

[0132] Increase, promote or enhance the transcription, translation or expression of at least one protein kinase;

[0133] Increase the synthesis of a polypeptide encoded by at least one protein kinase; or its release from an intracellular store; or

[0134] Reducing the degradation rate of a polypeptide encoded by at least one protein kinase gene.

[0135] Suitably, the method may comprise transforming cells of a plant (e.g. a tobacco plant) with a genetic construct encoding at least one protein kinase comprising an amino acid sequence as shown in SEQ ID No. 3, or a functional variant or functional fragment or ortholog thereof, or a sequence having at least 80% identity to SEQ ID No. 3; or comprising a nucleotide sequence as shown in SEQ ID No. 1 or 2, or a functional variant or functional fragment or ortholog thereof, or a nucleic acid sequence having at least 80% identity to SEQ ID No. 1 or 2; or comprising a nucleotide sequence encoding a protein capable of promoting or enhancing at least one endogenous protein kinase gene. It will be appreciated that each of these options will result in increased activity and expression of a polypeptide encoded by at least one protein kinase gene. The method may comprise regenerating a plant from the transformed cells. Provided is the use of a genetic construct capable of increasing the activity and / or expression of a polypeptide encoded by at least one protein kinase gene for reducing alkaloid content and or TSNA content (or precursors thereof) in a plant transformed with the construct.

[0136] The genetic construct may: encode a polypeptide comprising the amino acid SEQ ID No. 3, or a functional variant, functional fragment or straight homologue of SEQ ID No. 3, or a sequence having at least 80% identity with SEQ ID No. 3; or comprise a nucleotide sequence as shown in SEQ ID No. 1 or 2, or a functional variant, functional fragment or straight homologue of SEQ ID No. 1 or 2, or a nucleic acid sequence having at least 80% identity with SEQ ID No. 1 or 2.

[0137] In another embodiment, the invention relates to a method for reducing the alkaloid content of a plant or a part thereof and / or the TSNA content (or a precursor thereof) in a plant or a part thereof, which comprises modifying said plant by increasing the activity of at least one protein kinase as defined herein.

[0138] In one embodiment, the activity of at least one gene encoding a protein kinase may be increased by introducing (or providing) a mutation to at least one gene encoding a protein kinase.

[0139] Suitably, the activity of at least one protein kinase can be increased by introducing a mutation into at least one gene encoding a protein kinase, wherein the protein kinase comprises an amino acid sequence as shown in SEQ ID No. 3, or a functional variant or functional fragment or ortholog thereof, or a sequence having at least 80% identity with SEQ ID No. 3; or wherein the at least one gene encoding a protein kinase comprises a nucleotide sequence as shown in SEQ ID No. 1 or 2, or a functional variant or functional fragment or ortholog thereof, or a nucleic acid sequence having at least 80% identity with SEQ ID No. 1 or 2.

[0140] In one embodiment, the protein kinase used in accordance with the invention exhibits increased activity compared to an unmodified protein kinase. The protein kinase used in accordance with the invention may exhibit at least about 1%, at least about 3%, at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90% more phosphorylation activity compared to an unmodified protein kinase.

[0141] In one embodiment, the protein kinase comprises a mutation that renders the protein kinase constitutively active. In other words, the protein kinase continuously phosphorylates its target protein. In one embodiment, the activity of the protein kinase can be increased by overexpressing the protein kinase domain. Suitably, the activity of the protein kinase can be increased by providing multiple copies of the kinase domain.

[0142] The activity of protein kinase can be increased by introducing a construct comprising a strong promoter and a nucleotide sequence encoding a protein kinase as described herein. On the other hand, in one aspect, the endogenous promoter of the gene encoding the protein kinase as defined herein can be modified in such a way that it is more active in the modified plant than in the unmodified plant. The means for modifying the endogenous promoter can be, for example, gene editing methods, CRISPRCas9, TALENS or zinc finger nucleases. On the other hand, an extra copy of an endogenous gene encoding a protein kinase including its natural promoter can be introduced into the plant.

[0143] In another aspect, the present invention provides a method for increasing the alkaloid content of a plant or a part thereof or a plant cell, the method comprising modifying the plant by reducing or inhibiting the expression or activity of at least one protein kinase.

[0144] In one aspect, the present invention provides a method for increasing the alkaloid content of a plant or a part thereof or a plant cell, the method comprising modifying the plant by reducing or inhibiting the expression or activity of at least one protein kinase, the at least one protein kinase comprising a sequence as shown in SEQ ID No. 3, or a sequence having at least 80% identity thereto, or wherein the protein kinase is encoded by a nucleotide sequence as shown in SEQ ID No. 1 or 2, or a functional variant or functional fragment or ortholog of SEQ ID No. 1 or 2, or a nucleic acid sequence having at least 80% identity thereto.

[0145] In one aspect, the present invention provides a method for increasing the tobacco-specific nitrosamine (TSNA) or TSNA precursor content of a plant or part thereof (e.g. leaves), the method comprising modifying the plant by reducing or inhibiting the expression or activity of at least one protein kinase as defined herein.

[0146] As used herein, the term "inhibit" (eg, inhibiting the activity or expression of a protein kinase gene) means that the activity or expression of the protein kinase gene is reduced or decreased compared to the activity or expression of the gene in a comparable product.

[0147] The expression of a specific protein kinase gene can be measured by measuring the transcription and / or translation of the gene. Methods for measuring transcription are well known in the art and include, among others, Northern blotting, RNA-Seq, in situ hybridization, DNA microarrays, and RT-PCR. On the other hand, the expression of a gene can be measured indirectly by measuring the level of a gene product, such as a protein encoded by the gene.

[0148] The activity of a protein kinase can be determined by measuring the phosphorylation state of a target protein, for example, a protein comprising a serine or threonine amino acid residue capable of being phosphorylated (eg, myelin basic protein).

[0149] In some embodiments, the activity or expression of a protein kinase may be modulated (i.e., increased or decreased) by at least about 10%, 20%, 30% or 40%, suitably at least about 50%, 60%, 70%, more suitably at least about 80%, 90%, 95% or 100% when compared to the activity or expression of a protein kinase gene in a plant (e.g., a tobacco plant) that has not been modified according to the present invention.

[0150] Suitably, the expression or activity of the protein kinase may be reduced, partially inactivated, inhibited, eliminated, knocked out or lost such that protein expression or function of the protein kinase gene is undetectable.

[0151] In one aspect, at least one protein kinase gene is knocked out. In other words, the protein kinase gene has been rendered completely ineffective.

[0152] Any method known in the art for reducing or preventing the expression or activity of a protein may be used in the methods according to the present invention.

[0153] For example, the method may include:

[0154] ● providing a mutation in a nucleic acid sequence encoding a protein comprising an amino acid sequence as shown in SEQ ID No. 3, or an amino acid sequence having at least 80% sequence identity thereto;

[0155] ● providing a mutation in a regulatory region (e.g., a promoter or enhancer) that helps control the expression of a protein comprising an amino acid sequence as shown in SEQ ID No. 3, or an amino acid sequence having at least 80% sequence identity thereto;

[0156] ● Providing an antisense RNA, siRNA or miRNA that reduces the level of a nucleic acid sequence encoding a protein comprising an amino acid sequence as shown in SEQ ID No. 3, or an amino acid sequence having at least 80% sequence identity thereto.

[0157] The above methods each result in a reduction or prevention of the expression or activity of: a protein comprising an amino acid sequence as shown in SEQ ID No. 3, or an amino acid sequence having at least 80% sequence identity therewith; or a gene encoding a protein kinase, which comprises a nucleotide sequence as shown in SEQ ID No. 1 or 2, or a functional variant or functional fragment or ortholog of SEQ ID No. 1 or 2, or a nucleic acid sequence having at least 80% identity with SEQ ID No. 1 or 2.

[0158] As used herein, the term "mutation" includes natural genetic variants or artificially engineered variants. In particular, the term "mutation" refers to a variation in a nucleotide sequence encoding an amino acid sequence or an amino acid sequence compared to a sequence as shown in SEQ ID No. 3, or an amino acid sequence having at least 80% (preferably at least 85%, preferably at least 90%, preferably at least 95%, preferably at least 97%, preferably at least 98%, preferably at least 99%) sequence identity thereto.

[0159] In one embodiment, the mutation increases the alkaloid content of the plant.

[0160] In one embodiment, the method according to the invention may comprise providing a nucleic acid sequence to a plant or part thereof or a plant cell, wherein the nucleic acid results in a reduction or elimination of the expression or activity of a protein kinase gene. Suitably, the nucleic acid sequence may be introduced into a plant or part thereof or a cell. Suitably, an endogenous nucleic acid sequence in a plant or part thereof or a cell may be modified to encode a polypeptide according to the invention (e.g., by gene editing).

[0161] In a preferred embodiment, the plant or plant cell according to the invention is homozygous. Suitably, the plant or plant cell may be homozygous for a modification such as suppression or mutation.

[0162] In one embodiment, the plant or plant cell according to the invention expresses only a modified, e.g., mutated, nucleic acid encoding a protein kinase. In other words, in some embodiments, no endogenous (or endogenous and functional protein) is present in the plant according to the invention. In other words, if any endogenous protein is present, it is preferably in an inactive form.

[0163] In one embodiment, the method may comprise providing a mutation in: a nucleic acid sequence as shown in SEQ ID No. 1 or SEQ ID No. 2, or a nucleic acid sequence having at least 80% (preferably at least 85%, preferably at least 90%, preferably at least 95%, preferably at least 97%, preferably at least 98%, preferably at least 99%) identity thereto.

[0164] The mutation may alter the plant genome so that the nucleic acid sequence encoding the protein is completely or partially deleted or otherwise rendered non-functional, wherein the protein comprises the amino acid sequence as shown in SEQ ID No. 3, or an amino acid sequence having at least 80% (preferably at least 85%, preferably at least 90%, preferably at least 95%, preferably at least 97%, preferably at least 98%, preferably at least 99%) sequence identity thereto.

[0165] The mutation may interrupt a nucleic acid sequence encoding a protein comprising an amino acid sequence as shown in SEQ ID No. 3, or an amino acid sequence having at least 80% (preferably at least 85%, preferably at least 90%, preferably at least 95%, preferably at least 97%, preferably at least 98%, preferably at least 99%) sequence identity thereto.

[0166] The interruption may result in the nucleic acid sequence not being transcribed and / or translated.

[0167] The nucleic acid sequence can be interrupted, for example, by deleting or otherwise modifying the ATG start codon of the nucleic acid sequence, such that translation of the protein is reduced or prevented.

[0168] The nucleotide sequence may comprise one or more nucleotide changes that reduce or prevent protein expression or influence protein transport. For example, the expression of the protein may be reduced or prevented by introducing one or more premature stop codons, frameshifts, splice mutants or non-tolerant amino acid substitutions in the open reading frame.

[0169] A premature stop codon refers to a mutation that introduces a stop codon into the open reading frame and prevents translation of the entire amino acid sequence. The premature stop codon can be a TAG ("amber"), TAA ("ochre"), or TGA ("cream" or "umber") codon.

[0170] A frameshift mutation (also called a framing error or frame shift) is a mutation caused by the insertion / deletion (insertion or deletion) of multiple nucleotides in a nucleic acid sequence that cannot be divided by three. Due to the triplet nature of gene expression through codons, insertions or deletions can change the reading frame, resulting in a translation that is completely different from the original. Frameshift mutations will often cause the codon after the mutation to be read to encode a different amino acid. Frameshift mutations will usually result in the introduction of premature stop codons.

[0171] Splicing mutants insert, delete or change many nucleotides at specific sites, where splicing occurs during the processing of precursor messenger RNA into mature messenger RNA. The loss of splicing sites causes one or more introns to remain in mature mRNA and may lead to the production of abnormal proteins.

[0172] Non-tolerant amino acid substitutions refer to mutations that cause non-synonymous amino acid substitutions in a protein, which result in reduced or eliminated function of the protein.

[0173] Any method known in the art for providing a mutation in a nucleotide sequence can be used in the method according to the present invention. For example, homologous recombination can be used to produce a vector in which one or more of the nucleotide sequences involved are mutated and used to transform a plant or plant cell. The recombinant plant or plant cell expressing the mutated sequence can then be selected.

[0174] In one embodiment, the mutation introduces a non-tolerant amino acid substitution in a protein comprising an amino acid sequence as shown in SEQ ID No. 3, or a functional variant or functional fragment or ortholog of SEQ ID No. 3, or a sequence having at least 80% (preferably at least 85%, preferably at least 90%, preferably at least 95%, preferably at least 97%, preferably at least 98%, preferably at least 99%) sequence identity with SEQ ID No. 3.

[0175] In one embodiment, the mutation reduces the activity of the protein relative to the protein shown as SEQ ID No. 3.

[0176] In one embodiment, relative to the protein shown as SEQ ID No. 3, the mutation does not alter the level or expression of the protein, but reduces the activity of the protein.

[0177] The expression of the protein can be determined by measuring the presence of the protein using antibodies specific for the protein kinase, for example by Western blot.The activity of the protein kinase can be measured using a phosphorylation assay as described herein.

[0178] An example of a phosphorylation assay includes the use of mobility shifts of proteins measured by Western blot.

[0179] In one embodiment of the phosphorylation assay, the test sample can be treated with a kinase inhibitor such as K251 (which is a general kinase inhibitor), or a tyrosine phosphorylation inhibitor A25 (which specifically inhibits tyrosine kinases), or selumetinib (which specifically inhibits serine / threonine kinases). The control sample is not treated with a kinase inhibitor. Both samples are then analyzed by Western blot. If one of the proteins is a protein kinase, a mobility shift will be observed in the sample treated with the kinase inhibitor.

[0180] In another embodiment, site-directed mutagenesis can be performed on suspected phosphor sites and followed by analysis using phosphoantibodies.

[0181] In another embodiment, phosphorylation can be confirmed by phosphoproteomics, for example by LC-MS / MS or LTQ-Orbitrap MS / MS.

[0182] In one embodiment, the activity of the protein kinase can be determined by measuring autophosphorylation and substrate phosphorylation. Autophosphorylation and substrate phosphorylation (myelin basic kinase) can be performed and detected using non-radioactive methods (ProQ Diamond and / or Western blotting with anti-phospho-serine / threonine).

[0183] As used herein, the term "protein kinase domain" refers to a structurally conserved protein domain that contains the catalytic function of transferring the gamma phosphate from a nucleotide triphosphate to one or more amino acid residues in a protein substrate.

[0184] Protein kinase domains can be annotated or predicted by comparison of the amino acid sequence with known protein structures. For example, protein kinases and protein kinase domains can be identified by alignment against SEQ ID No. 3, wherein the presence of amino acid residues from about 281 to about 535 of SEQ ID No. 3 indicates a protein kinase domain.

[0185] In one embodiment, the protein kinase domain is the region of the protein corresponding to amino acids 281 to 535 of SEQ ID No. 3.

[0186] In one embodiment, the protein kinase domain may contain mutations that modulate the activity or expression of at least one gene encoding a protein kinase. In one embodiment, the protein kinase domain may contain mutations that increase the activity or expression of at least one gene encoding a protein kinase. In one embodiment, the protein kinase domain may contain mutations that decrease the activity or expression of at least one gene encoding a protein kinase.

[0187] The mutation may be an insertion, substitution, deletion, splice mutant or the introduction of a codon encoding a non-tolerant amino acid substitution.

[0188] In one embodiment, the active site of the protein kinase domain may be mutated, thereby modulating the activity of the protein kinase. Suitably, the conserved lysine residue at the active site of the protein kinase may be mutated. Suitably, the conserved lysine residue at the active site of the protein kinase replaces another amino acid. Suitably, the conserved lysine residue at the active site of the protein kinase may be deleted.

[0189] In one embodiment, the protein kinase may comprise a mutation or deletion in an activation site that modulates the activity or expression of at least one gene encoding the protein kinase. In one embodiment, the activation site of the protein kinase comprises an amino acid sequence corresponding to amino acid positions 287-291, 295, 306, 308, 339, 355-358, 362, 364, 402, 404, 406, 407, 409, 420, 423 or 428-441 of SEQ ID NO. 3. Suitably, the corresponding amino acid position can be determined by alignment with the sequence of SEQ ID No. 3. Suitably, the protein kinase may comprise a mutation or deletion in the activation site of the protein kinase corresponding to amino acid position 287-291, 295, 306, 308, 339, 355-358, 362, 364, 402, 404, 406, 407, 409, 420, 423 or 428-441 of SEQ ID NO. 3.

[0190] In one embodiment, the protein kinase comprises a mutation or deletion at a catalytic lysine residue. In one embodiment, the protein kinase comprises a mutation or deletion at an amino acid position corresponding to amino acid position K308 of SEQ ID NO. 3. In one embodiment, the protein kinase comprises a substitution mutation at an amino acid position corresponding to amino acid position K308 of SEQ ID NO. 3. In other words, the amino acid corresponding to position 308 of SEQ ID NO. 3 is mutated from lysine to another amino acid, thereby rendering the protein kinase non-functional.

[0191] In one embodiment, the protein kinase may comprise a mutation or deletion in an active site that modulates the activity or expression of at least one gene encoding the protein kinase. In one embodiment, the active site of the protein kinase comprises an amino acid sequence corresponding to amino acid positions 198-410 of SEQ ID NO. 3. Suitably, the corresponding amino acid positions may be determined by alignment with the sequence of SEQ ID No. 3. Suitably, the protein kinase may comprise a mutation or deletion in an active site of the protein kinase, the active site corresponding to amino acid positions 198-410 of SEQ ID NO. 3.

[0192] In one embodiment, the protein kinase may comprise a mutation or deletion in an activation loop that modulates the activity or expression of at least one gene encoding the protein kinase. In one embodiment, the activation loop of the protein kinase comprises an amino acid sequence corresponding to amino acid positions 419-427 or 437-441 of SEQ ID NO. 3. Suitably, the corresponding amino acid positions may be determined by alignment with the sequence of SEQ ID No. 3. Suitably, the protein kinase may comprise a mutation or deletion in an activation loop of the protein kinase corresponding to amino acid positions 419-427 or 437-441 of SEQ ID NO. 3.

[0193] In one embodiment, the nucleotide sequence can be completely or partially deleted. The deletion can be continuous, or can comprise multiple sections of the sequence. The deletion preferably removes a sufficient amount of nucleotide sequence so that the nucleotide sequence no longer encodes a functional protein. When compared with the corresponding genome of a comparable unmodified plant, the deletion can be complete, in which case 100% of the coding portion of the nucleotide sequence does not exist. The deletion can for example remove at least 50, 60, 70, 80 or 90% of the coding portion of the nucleotide sequence. Suitably, at least a portion of a protein can be deleted. The deletion can for example remove at least 10, 20, 30, 40, 50, 60, 70, 80 or 90% of the coding portion of the protein.

[0194] The deletion may remove at least a portion of the kinase domain of the protein.

[0195] The deletion may, for example, remove at least 10, 20, 30, 40, 50, 60, 70, 80 or 90% of the protein kinase domain.

[0196] Suitably, the deletion may remove at least 50 amino acids, at least 100 amino acids, at least 150, at least 200, at least 250 amino acids from the protein kinase domain. Suitably, the deletion may remove at least 50 amino acids, at least 100 amino acids, at least 150, at least 200, at least 250 amino acids from the protein kinase domain, wherein the domain corresponds to amino acid residues 281 to 535 of SEQ ID No. 3.

[0197] In one embodiment, the deletion may remove at least 100 amino acids, at least 150, at least 200, at least 250, at least 300, at least 350 amino acids from the C-terminus of the protein.

[0198] Suitably, the mutant protein may be a truncated protein lacking at least about 100 amino acids, at least about 150, at least about 200, at least about 250, at least about 300, at least about 350 amino acids corresponding to the amino acids from the C-terminus of SEQ ID No. 3, or a sequence having at least 80% (preferably at least 85%, at least, at least 90%, at least 95%, at least 98%) sequence identity to a truncated protein lacking at least about 100 amino acids, at least about 150, at least about 200, at least about 250, at least about 300, at least about 350 amino acids corresponding to the amino acids from the C-terminus of SEQ ID No. 3.

[0199] Suitably, the mutant protein may be a truncated protein lacking at least 100 amino acids, at least 150, at least 200, at least 250, at least 300, at least 350 amino acids corresponding to the amino acids from the C-terminus of SEQ ID No. 3, or a sequence having at least 80% (preferably at least 85%, at least, at least 90%, at least 95%, at least 98%) sequence identity to a truncated protein lacking at least 100 amino acids, at least 150, at least 200, at least 250, at least 300, at least 350 amino acids corresponding to the amino acids from the C-terminus of SEQ ID No. 3.

[0200] The deletion may remove at least a portion of the active site of the protein kinase. The deletion may remove the active site of the protein kinase.

[0201] Methods for deleting nucleotide sequences in plants are known in the art. For example, homologous recombination can be used to produce a vector in which one or more of the nucleotide sequences involved are lost and used to transform plants or plant cells. Recombinant plants or plant cells expressing the new sequence portion can then be selected.

[0202] Plant cells transformed with the vectors described herein can be grown and maintained according to well-known tissue culture methods, for example, by culturing the cells in a suitable medium supplied with necessary growth factors such as amino acids, plant hormones, vitamins and the like.

[0203] Modification of nucleic acid sequences can be performed using directed mutagenesis methods, also known as targeted nucleotide exchange (TNE) or oligo-directed mutagenesis (ODM). Directed mutagenesis methods include, but are not limited to, those using zinc finger nucleases, TALENs (see WO2011 / 072246 and WO2010 / 079430), Cas9-like, Cas9 / crRNA / tracrRNA, Cas9 / gRNA or other CRISPR systems (see WO 2014 / 071006 and WO2014 / 093622), meganucleases (see WO2007 / 047859 and WO2009 / 059195), or directed mutagenesis methods using mutagenic oligonucleotides, which may contain chemically modified nucleotides having sequence complementarity to the gene for enhanced mutagenesis that are introduced into plant protoplasts (e.g., KeyBase® or TALENs).

[0204] On the other hand, mutagenesis systems such as TILLING (Targeting Induced Local Lesions IN Genomics; McCallum et al., 2000, Nat Biotech 18:455, and McCallum et al. 2000, Plant Physiol. 123, 439-442, both of which are incorporated herein by reference) can be used to generate plant lines containing genes encoding proteins with mutations. TILLING uses traditional chemical mutagenesis (e.g., ethyl methanesulfonate (EMS) mutagenesis to produce random mutations), followed by high-throughput screening of mutations. Therefore, plants, seeds, cells and tissues containing genes with desired mutations can be obtained.

[0205] The method can include the following steps: mutagenesis of plant seeds (for example EMS mutagenesis), merging of plant individuals or DNA, pcr amplification of the region of interest, heteroduplex formation and high-flow detection, identification of mutant plants, sequencing of mutant pcr products. It should be understood that other mutagenesis and selection methods can be used equally to generate the plant of this modification. Seeds can for example be irradiated or chemically treated, and can screen plants with regard to the phenotype of modification.

[0206] Fast neutron deletion mutagenesis can be used in a reverse genetics sense (i.e., using PCR) to identify plant lines carrying deletions in endogenous genes. See, e.g., Ohshima et al. (1998) Virology 213:472-481; Okubara et al. (1994) Genetics 137:867-874; and Quesada et al. (2000) Genetics 154:421-4315, which are incorporated herein by reference.

[0207] In another approach, dominant mutants can be used to trigger RNA silencing due to gene inversion and recombination of duplicated gene loci. See, e.g., Kusaba et al. (2003) Plant Cell 15: 1455-1467 (incorporated herein by reference).

[0208] The modified plants can be distinguished from unmodified plants, i.e., wild-type plants, by molecular methods, such as one or more mutations present in the DNA, and by the phenotypic characteristics of the modification. The modified plants can be homozygous or heterozygous for the modification. Preferably, the modified plants are homozygous for the modification.

[0209] In one embodiment, the method of reducing or preventing protein expression does not include treating the plant with chemicals (eg, agrochemicals), wherein the protein comprises an amino acid sequence as shown in SEQ ID No. 3, or an amino acid sequence having at least 80% sequence identity thereto.

[0210] Other ways to reduce or prevent expression or activity will be apparent to those skilled in the art and include the use of virus-induced gene silencing (VIGs), microRNA silencing, RNAi, antisense, tDNA insertion, or dominant negative constructs (or antimorphic mutations).

[0211] In one embodiment, the expression of a protein comprising an amino acid sequence as shown in SEQ ID No. 3, or an amino acid sequence having at least 80% sequence identity thereto, can be reduced or eliminated by virus-induced gene silencing.

[0212] In one embodiment, the expression of a protein comprising an amino acid sequence as shown in SEQ ID No. 3, or an amino acid sequence having at least 80% sequence identity thereto, can be reduced or eliminated by microRNAs.

[0213] In one embodiment, the expression of a protein comprising an amino acid sequence as shown in SEQ ID No. 3, or an amino acid sequence having at least 80% sequence identity thereto, can be reduced or eliminated by RNAi.

[0214] In one embodiment, expression of a protein comprising an amino acid sequence as shown in SEQ ID No. 3, or an amino acid sequence having at least 80% sequence identity thereto, can be reduced or eliminated by antisense inhibition.

[0215] In one embodiment, expression of a protein comprising an amino acid sequence as shown in SEQ ID No. 3, or an amino acid sequence having at least 80% sequence identity thereto, can be reduced or eliminated by sense suppression.

[0216] In one embodiment, the expression of a protein comprising an amino acid sequence as shown in SEQ ID No. 3, or an amino acid sequence having at least 80% sequence identity thereto, can be reduced or eliminated by tDNA insertion.

[0217] In one embodiment, the expression of a protein comprising an amino acid sequence as shown in SEQ ID No. 3, or an amino acid sequence having at least 80% sequence identity thereto, can be reduced or eliminated by a system based on site-directed mutagenesis.

[0218] In one embodiment, expression of a protein comprising an amino acid sequence as shown in SEQ ID No. 3, or an amino acid sequence having at least 80% sequence identity thereto, can be reduced or eliminated by a CRISPR-based system.

[0219] In one embodiment, the expression of a protein comprising the amino acid sequence shown in SEQ ID No. 3, or an amino acid sequence having at least 80% sequence identity thereto, can be reduced or eliminated by zinc finger nucleases, TALENs, meganucleases, mutagenic oligonucleotides or TILLING.

[0220] Alkaloid content

[0221] In one embodiment, the present invention provides a method for regulating the alkaloid content of a plant (e.g., a tobacco plant) or a part thereof, the method comprising modifying the plant by regulating the activity or expression of at least one protein kinase, the at least one protein kinase comprising a sequence as shown in SEQ ID No. 3, or a sequence having at least 80% sequence identity thereto, or wherein the at least one protein kinase is encoded by the following: a nucleotide sequence as shown in SEQ ID No. 1 or 2, or a functional variant or functional fragment or ortholog of SEQ ID No. 1 or 2, or a nucleic acid sequence having at least 80% identity with SEQ ID No. 1 or 2.

[0222] The term "modulate" is used herein to mean to increase or decrease.

[0223] The term "increasing the alkaloid content" is used herein to mean that the concentration and / or total alkaloid content in the product of the invention (e.g., a plant, a part thereof (e.g., a leaf), a processed leaf, or a product prepared from a plant (e.g., a tobacco product)) is higher than in a comparable product which has not been modified according to the invention.

[0224] The term "reduced alkaloid content" is used herein to mean that the concentration and / or total alkaloid content in the product of the invention (e.g., a plant, a part thereof (e.g., a leaf), a processed leaf, or a product prepared from a plant (e.g., a tobacco product)) is lower than in a comparable product which has not been modified according to the invention.

[0225] In some embodiments, modulation of alkaloid content refers to an increase in alkaloid content, wherein the activity or expression of at least one protein kinase gene is decreased (or inhibited).

[0226] In some embodiments, modulation of alkaloid levels refers to a decrease in alkaloid levels, wherein the activity or expression of at least one protein kinase gene is increased (or in other words, the protein is overexpressed).

[0227] In a further aspect, the alkaloid content is measured from leaves. In one aspect, the alkaloid content is measured from green leaves. In a further aspect, the alkaloid content is measured from conditioned leaves, such as air-cured, flue-cured, fire-cured, or sun-cured leaves. In a further aspect, the alkaloid content is measured from flue-cured leaves. In a further aspect, the alkaloid content is measured from air-cured leaves.

[0228] The term "alkaloid content" is used herein to mean the concentration and / or total amount of the whole group of compounds classified as alkaloids. Alkaloids generally present in tobacco include nicotine, anatabine, anabasine, mithosamine and nornicotine. In one embodiment, the content of one or more alkaloids selected from nicotine, anatabine, anabasine, mithosamine and nornicotine is regulated. In one embodiment, the content of one or more alkaloids selected from nicotine, anatabine, anabasine, mithosamine and nornicotine is reduced. In one embodiment, the content of one or more alkaloids selected from nicotine, anatabine, anabasine, mithosamine and nornicotine is increased. Suitably, nicotine content can be regulated. In one embodiment, nicotine content is reduced. In another embodiment, nicotine content is increased.

[0229] Any method known in the art for determining the concentration and / or total amount of alkaloids may be used.A preferred method for analyzing alkaloid content involves analysis by gas chromatography-flame ionization detection (GC-FID).

[0230] In one embodiment, provide for producing following method: plant (for example tobacco plant) or its part, plant propagation material (for example tobacco plant propagation material), cell (for example tobacco cell), leaf (for example tobacco leaf), leaf of harvest (for example tobacco leaf of harvest), leaf of harvest of cutting (for example tobacco leaf of harvest), processed leaf (for example processed tobacco leaf), leaf of cutting and processing (for example tobacco leaf of cutting and processing), product (for example tobacco product) or its combination comprising described plant or its part, described plant of the present invention has regulated alkaloid content, described method comprises modifying described plant to regulate the activity or expression of protein kinase gene.Alkaloid content of regulation can be determined by comparing alkaloid content in following with comparable product: plant (for example tobacco plant) or its part, plant propagation material (for example tobacco plant propagation material), cell (for example tobacco cell), leaf (for example tobacco leaf), leaf of harvest (for example tobacco leaf of harvest), leaf of harvest of cutting (for example tobacco leaf of harvest), processed leaf (for example processed tobacco leaf), leaf of cutting and processing (for example tobacco leaf of cutting and processing), product (for example tobacco product) or its combination comprising described plant of the present invention or its part.

[0231] Suitably, alkaloid content can be regulated in plant, for example tobacco plant, for example tobacco plant of modification. Suitably, alkaloid content can be regulated in blade (for example tobacco blade, for example tobacco blade from the tobacco plant of modification). Suitably, alkaloid content can be regulated in blade of results (for example tobacco blade from the tobacco plant of modification). Suitably, alkaloid content can be regulated in blade of cutting results (for example tobacco blade from the tobacco plant of cutting results). Suitably, alkaloid content can be regulated in processing blade (for example processing tobacco blade, for example processing tobacco blade from the tobacco plant of modification). Suitably, alkaloid content can be regulated in blade of cutting and processing (for example cutting and processing tobacco blade, for example cutting and processing tobacco blade from the tobacco plant of modification). Suitably, alkaloid content can be regulated in blade after modulation (for example tobacco blade after modulation from the tobacco plant of modification). Suitably, alkaloid content can be regulated in extract of green blade (for example green tobacco blade from the tobacco plant of modification). Suitably, alkaloid content can be regulated in the product (for example tobacco product, for example tobacco product produced by the tobacco plant of modification or its part) comprising plant of the present invention or its part. Suitably, alkaloid content can be regulated in any one of the above-mentioned products or its combination. Suitably, the regulation of the above-mentioned alkaloid content can be an increase in the alkaloid content. Suitably, the regulation of the above-mentioned alkaloid content can be a reduction in the alkaloid content (for example a reduction in the nicotine content).

[0232] In one embodiment, the level of one or more alkaloids selected from nicotine, anatabine, anabasine, mithosamine and nornicotine is reduced.

[0233] Suitably, the above-mentioned modulation of alkaloid content may be a reduction in nicotine content.

[0234] In one embodiment, the nicotine content of the modified plant (e.g., tobacco plant), plant propagation material (e.g., tobacco plant propagation material), leaves (e.g., tobacco leaves), harvested leaves (e.g., harvested tobacco leaves), cut harvested leaves (e.g., cut harvested tobacco leaves), processed leaves (e.g., processed tobacco leaves), cut and processed leaves (e.g., cut and processed tobacco leaves), or tobacco products from the modified tobacco plant is reduced.

[0235] In one embodiment, when respectively with growing under similar growth conditions, not yet modified to regulate the activity of at least one protein kinase gene or the alkaloid content of the plant (for example tobacco plant) or its part compared, the alkaloid content of plant (for example tobacco plant) or its part can be regulated (for example reduced) to at least 2,3,4,5,6,7,8,9 or 10 times.Suitably, alkaloid content can be adjusted to about 2 times to about 10 times, preferably about 3 times to about 10 times, suitably about 3 times to about 5 times.Suitably, modification can be an increase or reduction in alkaloid content.Suitably, regulation can be the regulation of one or more alkaloids selected from nicotine, anatabine, anabasine, mithofamine and nornicotine.Suitably, nicotine content is regulated.

[0236] In one embodiment of the invention, compared with the plant (for example tobacco plant) or its part that has not been modified according to the present invention, the alkaloid content of plant (for example tobacco plant) or its part can be adjusted by 1%, 2%, 5%, 8%, 10%, 12%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80% or 90%.When compared with unmodified plant (for example tobacco plant) or its part, regulation can be an increase or reduction in alkaloid content.Suitably, regulation can be the regulation of total alkaloid content.Suitably, regulation can be the regulation of one or more alkaloids selected from nicotine, anatabine, anabasine, mithofamine and nornicotine.Suitably, modification is the modification of nicotine content.

[0237] Tobacco-specific nitrosamines (TSNA) content

[0238] In one embodiment, the invention provides a method for reducing the content of tobacco-specific nitrosamines (TSNAs) or TSNA precursors in a plant (e.g., a tobacco plant) or a part thereof, the method comprising modifying the plant by increasing the activity or expression of at least one protein kinase gene.

[0239] TSNA can be measured in processed tobacco, such as cured tobacco or reconstituted tobacco. In one embodiment, TSNA content is measured and / or modified (eg, reduced) in cured tobacco plants or parts thereof (eg, cured tobacco leaves).

[0240] As used herein, the term "tobacco-specific nitrosamines" or "TSNAs" has its usual meaning in the art, i.e., nitrosamines found only in tobacco products or other nicotine-containing products. Suitably, at least one tobacco-specific nitrosamine may be 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK), N'-nitrosonornicotine (NNN), N'-nitrosoanatabine (NAT) or N'-nitrosoanatabine (NAB).

[0241] The term "precursor thereof" when used with respect to at least one tobacco-specific nitrosamine refers to one or more chemicals or compounds of the tobacco plant that cause the formation of the tobacco-specific nitrosamine or are involved in a nitrosative reaction leading to the production of tobacco-specific nitrosamines.

[0242] In one embodiment, the TSNA is N'nitrosonornicotine (NNN) and / or the precursor is nornicotine.

[0243] In one embodiment, the TSNA may be one or more selected from the group consisting of N'-nitrosonornicotine (NNN), N'-nitrosonicotinoline (NAT), N'-nitrosonetab (NAB) and 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK). Suitably, at least one tobacco-specific nitrosamine may be NNK or NNN. In one embodiment, the tobacco-specific nitrosamine is NNN.

[0244] In one embodiment, the precursor of TSNA is one or more selected from the group of nornicotine, anabasine, anatabine and oxidized derivatives of nicotine such as pseudo-oxidized nicotine (PON).

[0245] In a preferred embodiment, the precursor of TSNA is nornicotine.

[0246] In one embodiment, the precursor of the TSNA may be PON. Precursors of TSNAs (e.g., NNN, NNK, NAB and / or NAT) may be measured in green tobacco leaves, e.g., prior to processing, e.g., prior to curing. In one embodiment, precursors of TSNAs (e.g., NNN, NNK, NAB and / or NAT) are measured and / or modified (e.g., reduced) in green tobacco leaves, e.g., prior to processing, e.g., prior to curing.

[0247] In one embodiment, performance of the methods and or uses of the invention results in a reduction in at least one TSNA or precursor thereof in the modified tobacco plant (or part thereof) when compared to a tobacco plant (or part thereof) which has not been modified according to the invention.

[0248] The term "reduction of at least one TSNA or a precursor thereof" or "reduction of at least one TSNA or a precursor thereof" is used herein to mean that the concentration and / or total content of at least one TSNA or a precursor thereof is lower in the product, method or use of the invention relative to a comparable product, method or use. For example, a comparable tobacco industry product would be derived from a tobacco plant that has not been modified according to the invention, but in which all other relevant characteristics are the same (e.g., plant species, growing conditions, methods of processing the tobacco, etc.).

[0249] Any method known in the art for determining the concentration and / or level of at least one TSNA or its precursor may be used. In particular, such a method may be used which may include the addition of a deuterium labeled internal standard, water extraction and filtration, followed by analysis using reverse phase high performance liquid chromatography with tandem mass spectrometry (LC-MS / MS). Other examples of methods for determining the concentration and / or level of tobacco specific nitrosamine precursors include methods such as CORESTA recommended method CRM-72: Determination of Tobacco Specific Nitrosamines in Tobacco and Tobacco Products by LC-MS / MS; the CRM being developed as ISO / DIS 21766 or the method detailed in Wagner et al. Analytical Chemistry (2005), 77(4), 1001-1006, which are incorporated herein by reference in their entirety.

[0250] Suitably, the concentration and / or total content of at least one tobacco-specific nitrosamine or its precursor can be reduced by implementing the method and / or use of the present invention. Suitably, the concentration and / or level of at least one tobacco-specific nitrosamine or its precursor can be reduced in the tobacco plant of the present invention (e.g., obtainable or obtained by the method and / or use of the present invention) when compared with the concentration and / or level of at least one tobacco-specific nitrosamine or its precursor in the tobacco plant not yet modified according to the present invention.

[0251] The concentration and / or total content of at least one tobacco-specific nitrosamine or its precursor may be reduced in tobacco leaves, harvested leaves, processed tobacco leaves, tobacco industry products, or a combination thereof, obtainable or obtained from a tobacco plant (or part of a tobacco plant or tobacco cell culture) of the present invention (or part of a tobacco plant or tobacco cell culture), when compared to tobacco leaves, harvested leaves, processed tobacco leaves, tobacco industry products, or a combination thereof, obtainable or obtained from a tobacco plant (or part of a tobacco plant or tobacco cell culture) that has not been modified according to the present invention.

[0252] Suitably, the concentration and / or total content of at least one tobacco-specific nitrosamine or a precursor thereof may be reduced in the processed tobacco leaves.

[0253] Suitably, the concentration and / or level of at least one tobacco-specific nitrosamine or a precursor thereof may be reduced in the tobacco industry product.

[0254] In one embodiment, at least one tobacco-specific nitrosamine or its precursor can be reduced by at least about 1%, at least about 3%, at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90%. In some embodiments, at least one tobacco-specific nitrosamine or its precursor can be reduced by about 5% to about 95%, about 10% to about 90%, 20% to about 80%, 30% to about 70%, or about 40% to 60%.

[0255] With respect to processed (e.g., cured) tobacco leaves (e.g., cured or reconstituted), at least one tobacco-specific nitrosamine or its precursor can be reduced by about 5000 ng / g to about 50 ng / g, about 4000 ng / g to about 100 ng / g, about 3000 ng / g to 500 ng / g, or 2000 ng / g to 1000 ng / g. In some embodiments, at least one tobacco-specific nitrosamine or its precursor can be reduced by at least about 5000 ng / g, at least about 4000 ng / g, at least about 3000 ng / g, at least about 2000 ng / g, at least about 1000 ng / g, at least about 500 ng / g, at least about 100 ng / g, or at least about 50 ng / g.

[0256] Biomass production

[0257] In one aspect, the invention provides a method for producing biomass, comprising:

[0258] Cells that have been artificially engineered to inhibit or reduce the activity or expression of a protein kinase are grown under conditions that produce biomass.

[0259] In one embodiment, the invention provides a method of producing biomass having a modified (e.g., increased) nicotine concentration and / or total content, comprising growing cells that have been artificially engineered to:

[0260] Inhibit or reduce the activity or expression of at least one gene encoding a protein kinase polypeptide, the protein kinase polypeptide comprising an amino acid sequence as shown in SEQ ID No. 3, or a functional variant or functional fragment or straight homolog thereof, or a sequence having at least 80% identity with SEQ ID No. 3; or wherein at least one gene encoding a protein kinase comprises a nucleotide sequence as shown in SEQ ID No. 1 or 2, or a functional variant or functional fragment or straight homolog of SEQ ID No. 1 or 2, or a nucleic acid sequence having at least 80% identity with SEQ ID No. 1 or 2.

[0261] Suitably, the biomass may contain a higher concentration and / or total content of nicotine than biomass produced from comparable cells which have not been modified according to the invention.

[0262] Suitably, the cells for biomass production may be plant cells, such as tobacco cells.

[0263] Suitably, the cells for biomass production may be yeast cells.

[0264] In one embodiment, the cell (e.g., yeast cell) may be further modified to include one or more sequences that increase nicotine alkaloid biosynthesis. Suitably, these one or more sequences may be incorporated into a nucleic acid construct suitable for cell (e.g., yeast cell) transformation. One or more sequences may be overexpressed in a cell (e.g., yeast cell). The sequence may be selected from one or more of the following genes: MPO (or methylputrescine oxidase or MPO1 or MPO2); A622 (or isoflavone reductase-like protein or isoflavone reductase homolog (homolog) or isoflavone reductase-like protein); BBL (or berberine bridge enzyme or berberine bridge enzyme-like or BBE or NBB1); PMT (or putrescine N-methyltransferase or putrescine methyltransferase or S-adenosyl-L-methionine: putrescine N-methyltransferase or PMT or PMT1 or PMT2 or PMT3 or PMT4) and QPT (or quinolinate phosphoribosyltransferase). In one embodiment, the sequence may be selected from one or more of the following genes: BBL, A622, PMT, and MPO (MPO1 or MPO2). Genes suitable for modification in this manner may be taught, for example, in US2016032299, which is incorporated herein by reference.

[0265] Commercially desirable traits

[0266] In one embodiment, the plant of the invention has a modified (i.e., increased or decreased) total alkaloid content, and / or a modified (i.e., increased or decreased) content of one or more alkaloids selected from nicotine, nornicotine, anabasine, mithofamine and anatabine and / or decreased nicotine, while the flavor profile and / or other commercially desirable traits are at least maintained. In one embodiment, the plant of the invention produces leaves of similar grade and / or quality to plants that have not been modified according to the invention.

[0267] In one embodiment, a plant of the invention has a reduced nicotine content without a significant change in the flavor profile of the plant (eg, compared to the same plant that has not been modified according to the invention).

[0268] In one embodiment, the plants of the invention have a modified (i.e. increased or decreased) alkaloid and / or TSNA content (e.g., compared to the same plant that has not been modified according to the invention) without a significant change (e.g., decrease) in other commercially desirable traits of the plant. In particular, the yield of the modified plant is preferably not reduced compared to the same plant that has not been modified according to the invention.

[0269] Thus, in one embodiment, the methods and uses of the present invention relate to modifying (i.e. increasing or decreasing) the total alkaloid content, and / or modifying (i.e. increasing or decreasing) one or more alkaloids selected from nicotine, nornicotine, anabasine and anatabine, and / or modifying (i.e. increasing or decreasing) the nicotine content and / or TSNA content while maintaining the flavor profile and / or other commercially desirable traits (e.g. yield).

[0270] As used herein, the term "commercially desirable traits" will include traits such as yield, mature plant height, number of harvestable leaves, average node length, cutter leaf length, cutter leaf width, quality (e.g., leaf mass, appropriately modulated leaf mass), abiotic (e.g., drought) stress tolerance, herbicide tolerance, and / or biotic (e.g., insect, bacterial or fungal) stress tolerance.

[0271] For example, according to the United States Department of Agriculture (USDA) grades and standards, leaf quality can be measured based on the color, texture, and aroma of the cured leaves.

[0272] Tobacco grades are evaluated based on factors including, but not limited to, petiole position, leaf size, leaf color, leaf uniformity and integrity, maturity, texture, elasticity, gloss (related to the intensity and depth of color and brightness of the leaf), hygroscopicity (the ability of the tobacco leaf to absorb and retain moisture from the environment) and green nuance or cast.

[0273] Leaf grade can be determined using standard methods known in the art, for example, using the Official Standard Grades published by the Agricultural Marketing Service of the US Department of Agriculture (7 USC §511). See, e.g., the official standard grades for Burley Tobacco (U.S. Type 31 and Foreign Type 93), effective November 5, 1990 (55 FR 40645); the official standard grades for Flue-cured Tobacco (U.S. Types 11, 12, 13, 14 and Foreign Type 92), effective March 27, 1989 (54 FR 7925); the official standard grades for Pennsylvania Seedleaf Tobacco (U.S. Type 41), effective January 8, 1965 (29 FR 16854); the official standard grades for Ohio Cigar-Leaf Tobacco (U.S. Types 42, 43, and 44), effective December 8, 1963 (28 F.R. 11719 and 28 FR 7925). 11926); the official standard grades for Wisconsin Cigar-Binder Tobacco (U.S. 54 and 55), effective November 20, 1969 (34 FR 17061); the official standard grades for Wisconsin Cigar-Binder Tobacco (U.S. 54 and 55), effective November 20, 1969 (34 F.R. 17061); the official standard grades for Georgia and Florida ShadeGrown Cigar-Wrapper Tobacco (U.S. 62), effective April 1971. USDA grade index values ​​may be determined based on industry recognized grade indices. See, e.g., Bowman et al., Tobacco Science, 32:39-40 (1988); Legacy Tobacco Document Library (Bates Document #523267826-523267833, July 1, 1988, Memorandum on the Proposed Burley Tobacco Grade Index); and Miller et al., 1990, Tobacco Intern., 192:55-57 (all of the foregoing references are incorporated herein in their entirety).

[0274] In one aspect, the USDA grade index is a 0-100 numerical representation of the received federal grade and is a weighted average of all shank positions. A higher grade index indicates higher quality. In another aspect, the blade grade can be determined via hyper-spectral imaging. See, for example, WO 2011 / 027315 (which is incorporated herein by reference).

[0275] In one embodiment, the tobacco plants of the present invention provide commercially acceptable grades of tobacco.

[0276] Suitably, the tobacco plants of the present invention provide commercially acceptable grades of cured tobacco.

[0277] In one embodiment, when growing under similar growth conditions, tobacco plant of the present invention can produce the leaf of at least about 70% USDA grade index value with the USDA grade index value of comparable plant leaves.Suitably, when growing under similar growth conditions, tobacco plant disclosed herein may be able to produce the leaf of at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% or at least about 98% USDA grade index value with the USDA grade index value of control plant. Suitably, the tobacco plants disclosed herein may be capable of producing leaves having a USDA Grade Index value of 65% to 130%, 70% to 130%, 75% to 130%, 80% to 130%, 85% to 130%, 90% to 130%, 95% to 130%, 100% to 130%, 105% to 130%, 110% to 130%, 115% to 130% or 120% to 130% of the USDA Grade Index value of a comparable plant.

[0278] In one aspect, the tobacco plants of the present invention are capable of producing leaves having a USDA Grade Index value of at least 50. Suitably, the tobacco plants disclosed herein may be capable of producing leaves having a USDA Grade Index value of 55 or more, 60 or more, 65 or more, 70 or more, 75 or more, 80 or more, 85 or more, 90 or more, and 95 or more.

[0279] Unless otherwise indicated, tobacco yield as used herein refers to cured leaf yield, which is calculated based on cured tobacco leaf weight per acre under standard field conditions following standard agronomic and curing practices.

[0280] In one aspect, plants of the invention (e.g., tobacco plants) have a yield that is 50% to 150%, 55% to 145%, 60% to 140%, 65% to 135%, 70% to 130%, 75% to 125%, 80% to 120%, 85% to 115%, 90% to 110%, 95% to 105%, 50% to 100%, 55% to 100%, 60% to 100% of the yield of comparable plants when grown under similar field conditions. %, 65% to 100%, 70% to 100%, 75% to 100%, 80% to 100%, 85% to 100%, 90% to 100%, 95% to 100%, 100% to 150%, 105% to 150%, 110% to 150%, 115% to 150%, 120% to 150%, 125% to 150%, 130% to 150%, 135% to 150%, 140% to 150% or 145% to 150%.

[0281] In another aspect, the yield of plants (e.g., tobacco plants) of the invention is about 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, or 3.0 times the yield of comparable plants when grown under similar field conditions.

[0282] In another aspect, the yield of tobacco plants of the present invention is comparable to the yield of comparable plants that are fire-tube cured when grown under similar field conditions.

[0283] In one aspect, the tobacco plant of the invention provides a yield selected from the group consisting of about 1200 to 3500, 1300 to 3400, 1400 to 3300, 1500 to 3200, 1600 to 3100, 1700 to 3000, 1800 to 2900, 1900 to 2800, 2000 to 2700, 2100 to 2600, 2200 to 2500, and 2300 to 2400 pounds per acre.

[0284] In another aspect, the tobacco plant of the present invention provides a yield selected from the group consisting of about 1200 to 3500, 1300 to 3500, 1400 to 3500, 1500 to 3500, 1600 to 3500, 1700 to 3500, 1800 to 3500, 1900 to 3500, 2000 to 3500, 2100 to 3500, 2200 to 3500, 2300 to 3500, 2400 to 3500, 2500 to 3500, 2600 to 3500, 2700 to 3500, 2800 to 3500, 2900 to 3500, 3000 to 3500, and 3100 to 3500 pounds per acre.

[0285] In a further aspect, the tobacco plant of the present invention provides a yield selected from the group consisting of about 1200 to 3500, 1200 to 3400, 1200 to 3300, 1200 to 3200, 1200 to 3100, 1200 to 3000, 1200 to 2900, 1200 to 2800, 1200 to 2700, 1200 to 2600, 1200 to 2500, 1200 to 2400, 1200 to 2300, 1200 to 2200, 1200 to 2100, 1200 to 2000, 1200 to 1900, 1200 to 1800, 1200 to 1700, 1200 to 1600, 1200 to 1500, and 1200 to 1400 pounds per acre.

[0286] Plant breeding

[0287] In one embodiment, the present invention provides a method for producing a plant having a modified alkaloid content and / or a modified tobacco-specific nitrosamine (TSNA) or TSNA precursor content, comprising:

[0288] a. crossing a donor plant having a modified nicotine content and / or a modified tobacco-specific nitrosamine (TSNA) or TSNA precursor content and wherein the activity or expression of at least one protein kinase has been modulated in the donor plant according to the invention with a recipient tobacco plant that does not have a modified nicotine content or a modified tobacco-specific nitrosamine (TSNA) or TSNA precursor content and has a commercially desirable trait;

[0289] b. isolating genetic material from offspring of the donor plant hybridized with the recipient plant; and

[0290] c. performing molecular marker-assisted selection using molecular markers, comprising:

[0291] i. Identifying a region of the polynucleotide sequence encoding the protein defined in a comprising a mutation introgression;

[0292] At least one of the protein kinases comprises an amino acid sequence as shown in SEQ ID No. 3, or a functional variant, functional fragment or straight homolog thereof, or a sequence having at least 80% identity with SEQ ID No. 3; or is encoded by the following: a nucleotide sequence as shown in SEQ ID No. 1 or 2, or a functional variant, functional fragment or straight homolog of SEQ ID No. 1 or 2, or a nucleic acid sequence having at least 80% identity with SEQ ID No. 1 or 2.

[0293] The protein kinase is modulated in the donor plant when compared to comparable plants.

[0294] Molecular marker assisted selection may comprise performing PCR to identify an introgressed nucleic acid sequence comprising a mutation which modulates the activity or expression of a protein kinase comprising an amino acid sequence as shown in SEQ ID No. 3 or an amino acid sequence having at least 80% sequence identity thereto. Suitably, the activity or expression of the protein kinase is increased. Suitably, the activity or expression of the protein kinase is increased and the alkaloid content and / or TSNA content and / or TSNA precursor content is reduced.

[0295] plant

[0296] Suitable plants according to the present invention include plants of the Solanaceae family, which includes, for example, Datura, Eggplant, Mandrake, Nightshade (Bellagio), Capsicum (Chili pepper, Capsicum annuum), Potato and Tobacco.

[0297] In one embodiment, a suitable genus of the Solanaceae family is Solanum, such as Lycopersicon esculentum ( Solanum lycopersicum ).

[0298] In one embodiment, a suitable genus of the Solanaceae family is Nicotiana ( Nicotiana ), such as Nicotiana tabacum or Nicotiana rustica ( Nicotiana rustica ).

[0299] A suitable species of the genus Nicotiana may be Nicotiana tabacum. Species of the genus Nicotiana may be referred to herein as tobacco plants, or simply tobacco.

[0300] In a preferred embodiment, the plant is a tobacco plant.In a preferred embodiment, the cell is a tobacco cell.

[0301] Tobacco Plant

[0302] The invention provides methods, uses, and cells (eg, tobacco cells), plants (eg, tobacco plants), and plant propagation materials for plants (eg, tobacco plants).

[0303] As used herein, the term "tobacco plant" refers to plants in the genus Nicotiana used in the production of tobacco products. Non-limiting examples of suitable "tobacco" plants include Nicotiana tabacum and Nicotiana rustica (e.g., Nicotiana tabacum ( N. tabacum L.), LAB21, LN KY171, Tl 1406, Basma, Galpao, Perique, Beinhart 1000-1 and Petico).

[0304] Tobacco material can be derived from or derived from the variant of tobacco type, commonly referred to as burley tobacco variant, flue or bright and dark variants. In some embodiments, tobacco material is derived from burley, Virginia or dark tobacco plants. Tobacco plants can be selected from burley tobacco, rare tobacco, specialty tobacco, expanded tobacco, etc.

[0305] The present invention also contemplates the use of tobacco cultivars and elite tobacco cultivars. Thus, the tobacco plants used herein can be tobacco varieties or elite tobacco cultivars. Particularly useful tobacco varieties include flue-cured Virginia type, burley type and Oriental type.

[0306] In some embodiments, the tobacco plant can be, for example, selected from one or more of the following varieties: L. cultivar TI 1068, AA 37-1, B 13P, Xanthi (Mitchell-Mor), KT D#3 Hybrid 107, Bel-W3, 79-615, Samsun Holmes NN, F4 from the cross BU21 x Hoja Parado, line 97, KTRDC#2 Hybrid 49, KTRDC#4 Hybrid 1 10, Burley 21, PM016, KTRDC#5 KY 160 SI, KTRDC#7 FCA, KTRDC#6 TN 86SI, PM021, K 149, K 326, K 346, K 358, K 394, K 399, K 730, KY 10, KY 14, KY 160, KY 17, KY 8959, KY 9, KY 907, MD 609, McNair 373, NC 2000, PG 01, PG 04, P01, P02, P03, RG 11, RG 17, RG 8, Speight G-28, TN 86, TN 90, VA 509, AS44, Banket A1, Basma Drama B84 / 31, Basma I Zichna ZP4 / B, Basma Xanthi BX 2A, Batek, Besuki Jember, C104, Coker 319, Coker 347, Criollo Misionero, PM092, Delcrest, Djebel 81, DVH 405, Galpao Comum, HB04P, Hicks Broadleaf, Kabakulak Elassona、PM102、Kutsage E1 , KY 14 x L8, KY 171, LA BU 21, McNair 944, NC 2326, NC 71, NC 297, NC 3, PVH 03, PVH 09, PVH 19, PVH 21 10, Red Russian, Samsun, Saplak, Simmaba, Talgar 28. PM132, Wislica, Yayaldag, NC 4, TRMadole, Prilep HC-72, Prilep P23, Prilep PB 156 / 1, Prilep P12-2 / 1, Yaka JK-48, YakaJB 125 / 3, TI-1068, KDH-960, TI-1070, TW136, PM204, PM205, Basma, TKF4028, L8, TKF2002, TN 90, GR141, Basma xanthi, GR149, GR153 and Petit Havana.

[0307] Non-limiting examples of varieties or cultivars are: BD 64, CC 101, CC 200, CC 27, CC 301, CC400, CC 500, CC 600, CC 700, CC 800, CC 900, Coker 176, Coker 319, Coker 371 Gold, Coker 48, CD 263, DF91 1, DT 538 LC, Galpao tobacco, GL 26H, GL 350, GL 600, GL 737, GL939, GL 973, HB 04P, HB 04P LC, HB3307PLC, Hybrid 403LC, Hybrid 404LC, Hybrid 501 LC, K 149, K326, K 346, K 358, K394, K 399, K 730, KDH 959, KT 200, KT204LC, KY10, KY14, KY 160, KY17, KY 171, KY 907, KY907LC, KTY14xL8 LC, Little Crittenden, McNair 373, McNair944, msKY 14xL8, Narrow Leaf Madole, Narrow Leaf Madole LC, NBH 98, N-126, N-777LC, N-7371 LC, NC 100, NC 102, NC 2000, NC 291, NC 297, NC 299, NC 3, NC 4, NC 5, NC 6, NC7, NC 606, NC 71, NC 72, NC 810, NC BH 129. NC 2002, Neal Smith Madole, OXFORD 207, PD7302 LC, PD 7309 LC, PD 7312 LC 'Periq'e' Tobacco, PVH03, PVH09, PVH19, PVH50, PVH51, R610, R 630, R 7-1 1 , R 7-12, RG 17, RG 81, RG H51, RGH 4, RGH 51, RS 1410, Speight168, Speight 172, Speight 179, Speight 210, Speight 220, Speight 225, Speight 227, Speight 234, Speight G-28, Speight G-70, Speight H-6, Speight H20, Speight NF3, Tl1406, Tl 1269, TN 86, TN86LC, TN 90, TN 97, TN97LC, TN D94, TND950, TR (Tom Rosson) Madole, VA 309, VA359, AA 37-1, B 13P, Xanthi (Mitchell-Mor), Bel-W3, 79-615, SamsunHolmes NN, KTRDC No. 2 Hybrid 49, Burley 21, KY 8959, KY 9, MD 609, PG 01, PG 04, P01, P02, P03, RG 1 1, RG 8, VA 509, AS44, Banket A1, Basma Drama B84 / 31, Basma I Zichna ZP4 / B, Basma Xanthi BX 2A, Batek, Besuki Jember, C104, Coker 347, Criollo Misionero, Delcrest, Djebel 81. DVH 405. Galpao Comum, HB04P, Hicks Broadleaf, KabakulakElassona, Kutsage E1, LA BU 21, NC 2326, NC 297, PVH 21 10, Red Russian, Samsun, Saplak, Simmaba, Talgar 28, Wislica, Yayaldag, Prilep HC-72, Prilep P23, Prilep PB156 / 1, Prilep P12-2 / 1, Yaka JK-48, Yaka JB 125 / 3, TI-1068, KDH-960, Tl-1070, TW136, Basma, TKF 4028, L8, TKF 2002, GR141, Basma xanthi, GR149, GR153, Petit Havana. Such low converter subvarieties are contemplated even though not specifically identified herein.

[0308] The tobacco plant may be Burley, Flue-cured Virginia, or Oriental.

[0309] In one embodiment, the plant propagation material may be obtainable from a plant of the invention, such as a tobacco plant.

[0310] "Plant propagation material" as used herein refers to any plant matter taken from a plant from which further plants can be produced. Suitably, the plant propagation material may be selected from seeds, plant callus and plant pieces. Suitably, the plant propagation material may be seeds. Suitably, the plant propagation material may be plant callus. Suitably, the plant propagation material may be plant pieces.

[0311] In one embodiment, the cell (eg tobacco cell), tobacco plant and / or plant propagation material may be obtainable (eg obtained) by a method according to the invention.

[0312] Suitably, a tobacco plant according to the present invention may have a modulated (e.g. reduced) nicotine content when compared to an unmodified tobacco plant, wherein the tobacco plant has been modified to modulate (e.g. increase) the activity or expression of at least one gene encoding a protein kinase.

[0313] Suitably, the tobacco plant according to the present invention may have a modulated (e.g. reduced) tobacco-specific nitrosamine (TSNA) or TSNA precursor content when compared to an unmodified tobacco plant, wherein the tobacco plant has been modified to modulate (e.g. increase) the activity or expression of at least one gene encoding a protein kinase.

[0314] In one embodiment, a tobacco plant according to the invention comprises a tobacco cell of the invention.

[0315] In another embodiment, the plant propagation material may be obtainable (eg, obtained) from a tobacco plant of the present invention.

[0316] In one embodiment, there is provided use of a tobacco plant as described herein for breeding tobacco plants.

[0317] In another embodiment, the present invention also provides use of the tobacco plant of the preceding embodiment for producing tobacco industry products.

[0318] In another embodiment, there is provided use of the tobacco plants of the present invention to grow crops.

[0319] In one embodiment, there is provided use of a cell as provided in the preceding embodiments for producing a tobacco industry product.

[0320] In one embodiment, the invention provides cell cultures (eg, in vitro cultures).

[0321] Tobacco cell culture can be a cell suspension culture. These in vitro cultured cells can be incorporated into tobacco industry products, for example as a substitute for conventional tobacco particles, shredded tobacco (shreds), finely cut or long cut tobacco flakes, as an additive component, or both as a substitute and as an additive. Suitably, cell culture can produce nicotine.

[0322] In one embodiment, there is provided the use of a cell culture, such as a harvested and / or processed cell culture according to the invention, for producing a tobacco industry product.

[0323] Tobacco cells harvested from in vitro culture may be dried, such as freeze-dried, for example to produce a powder.

[0324] In one embodiment, cell culture is tobacco cell culture.Technician will know the known methods for establishing the in vitro culture of tobacco cell.Only for example, can use following method: collect the seed from interested tobacco plant, and sterilize its outside to eliminate undesirable organism, plant described seed with growth interested tobacco plant, from tobacco plant (for example, from tobacco stem) take out tissue for use as explant, establish callus culture from tobacco explant, establish cell suspension culture from callus culture, and gather in the crops culture material (for example comprising tobacco cell) to produce tobacco cell culture.

[0325] Tobacco cells can be harvested by various methods including filtration, such as vacuum filtration. The sample can be washed in the filter by adding water and the remaining liquid is removed by filtration, such as vacuum filtration.

[0326] The harvested tobacco cell culture may be further processed, such as dried, such as air-dried and / or freeze-dried.The harvested tobacco cell culture or the dried harvested tobacco cell culture or an extract thereof may be incorporated into a tobacco industry product according to the invention.

[0327] In one embodiment, the invention provides plants (e.g., tobacco plants) or parts thereof for use in molecular agriculture. Suitably, plants or parts thereof modified according to the invention can be used to make proteins, e.g., therapeutic agents, such as antibiotics, virus-like particles, nutritional medicines or small molecules.

[0328] In one embodiment, the present invention provides a method for producing a protein (e.g., a therapeutic protein); the method comprises modifying a plant or part thereof capable of producing the protein (e.g., a therapeutic protein) by regulating the activity or expression of at least one protein kinase gene, wherein the at least one protein kinase gene encodes an amino acid sequence as shown in SEQ ID No. 3, or a functional variant or functional fragment or straight homologue thereof, or a sequence having at least 80% identity with SEQ ID No. 3; or wherein the at least one gene encoding the protein kinase comprises a nucleotide sequence as shown in SEQ ID No. 1 or 2, or a functional variant or functional fragment or straight homologue of SEQ ID No. 1 or 2, or a nucleic acid sequence having at least 80% identity with SEQ ID No. 1 or 2; and cultivating the plant under conditions sufficient to allow production of the protein (e.g., a therapeutic protein).

[0329] In one embodiment, the present invention provides a method for producing a protein (e.g., a therapeutic protein); the method comprises modifying a plant or part thereof capable of producing the protein (e.g., a therapeutic protein) by modulating the activity or expression of at least one protein kinase, wherein the at least one protein kinase has an amino acid sequence as shown in SEQ ID No. 3, or a functional variant or functional fragment or straight homologue thereof, or a sequence with at least 80% identity to SEQ ID No. 3; or wherein the at least one protein kinase comprises a nucleotide sequence as shown in SEQ ID No. 1 or 2, or a functional variant or functional fragment or straight homologue of SEQ ID No. 1 or 2, or a nucleic acid sequence with at least 80% identity to SEQ ID No. 1 or 2; and cultivating the plant under conditions sufficient to allow production of the protein (e.g., a therapeutic protein).

[0330] product

[0331] The invention also provides products obtainable or obtained from a plant according to the invention.Products obtainable or obtained from a plant in which the activity or expression of a protein kinase gene has been modulated are provided.

[0332] In one embodiment, the product may comprise a construct of the invention which modulates the activity or expression of at least one protein kinase gene as defined herein.

[0333] The invention also provides products obtainable or obtained from tobacco according to the invention.

[0334] In one embodiment, there is provided use of a tobacco plant of the present invention for producing tobacco leaves.

[0335] Suitably, the tobacco leaves may be subjected to downstream applications, such as processing.

[0336] Therefore, in one embodiment, the use of the aforementioned embodiments can provide processed tobacco leaves. Suitably, the tobacco leaves can be subjected to modulation, fermentation, pasteurization or a combination thereof. In another embodiment, the tobacco leaves can be cut. In some embodiments, the tobacco leaves can be cut before or after being subjected to modulation, fermentation, pasteurization or a combination thereof.

[0337] In one embodiment, the invention provides harvested leaves of the tobacco plant of the invention.

[0338] In a further embodiment, the harvested leaves may be obtainable (eg, obtained) from a tobacco plant propagated from the propagation material of the invention.

[0339] In another embodiment, there is provided harvested leaves obtainable from the methods or uses of the invention.

[0340] Suitably, the harvested leaves may be cut harvested leaves.

[0341] In some embodiments, the harvested leaves may contain living tobacco cells.In other embodiments, the harvested leaves may be subjected to further processing.

[0342] Processed tobacco leaves are also provided.

[0343] The processed tobacco leaf blade may be obtainable from a tobacco plant of the present invention. Suitably, the processed tobacco leaf blade may be obtainable from a tobacco plant obtained according to any of the methods and / or uses of the present invention.

[0344] In another embodiment, the processed tobacco leaf blade may be obtainable from a tobacco plant propagated from tobacco plant propagation material according to the present invention.

[0345] The processed tobacco leaves of the present invention may be obtainable by processing the harvested leaves of the present invention.

[0346] As used herein, the term "processed tobacco leaf" refers to a tobacco leaf that has undergone one or more processing steps to which tobacco is subjected in the art."Processed tobacco leaf" contains no or substantially no living cells.

[0347] The term "living cell" refers to a cell that is capable of growth and / or metabolic activity. Thus, if a cell is said to be not alive, also known as "non-viable", the cell does not exhibit the characteristics of a living cell.

[0348] The term "substantially free of living cells" means that less than about 5% of all cells are alive. Preferably, less than about 3%, more preferably less than about 1%, even more preferably less than about 0.1% of all cells are alive.

[0349] In one embodiment, the processed tobacco leaves may be processed by one or more of: curing, fermenting, and / or pasteurizing.

[0350] Suitably, the processed tobacco leaves may be processed by curing.

[0351] The tobacco leaves may be cured by any method known in the art. In one embodiment, the tobacco leaves may be cured by one or more curing methods selected from the group consisting of air-curing, open flame curing, fire tube curing, and sun curing.

[0352] Suitably, the tobacco leaves may be air-cured.

[0353] Typically, air-curing is achieved by hanging the tobacco leaves in a well-ventilated curing barn and allowing them to dry. This is usually done over a period of four to eight weeks. Air-curing is particularly suitable for Burley tobacco.

[0354] Suitably, the tobacco leaves may be open fire cured. Open fire curing is generally achieved by hanging the tobacco leaves in large curing barns where a hardwood fire is kept smoldering low, either continuously or intermittently, and typically takes between three days and ten weeks, depending on the process and the tobacco.

[0355] In another embodiment, the tobacco leaves can be fire-tube cured. Fire-tube curing can include stringing the tobacco leaves onto tobacco rods and hanging them on tier-poles in a curing barn. The curing barn usually has a flame path that runs with an externally supplied firebox. Generally, this results in tobacco that has been heat-cured without being exposed to smoke. Typically, the temperature rises slowly during the curing process, and the entire process takes about 1 week.

[0356] Suitably, the tobacco leaves may be cured. This process generally involves exposing uncovered tobacco to the sun.

[0357] Suitably, the processed tobacco leaves may be processed by fermentation.

[0358] Fermentation can be carried out in any manner known in the art. Generally, during fermentation, tobacco leaves are piled into a tobacco pile (pile) covered with a modulation in a sack, for example, to retain moisture. The combination of the residual water inside the leaf and the tobacco weight generates the natural heat that makes tobacco mature. The temperature in the center of the pile is monitored every day. In some methods, the whole pile is opened every week. Then take out the leaf to shake and moisten, and the pile is rotated, so that the inner leaf is placed on the top of the pile outside and the bottom leaf. This ensures the uniform fermentation of the whole pile. The extra moisture on the leaf adds the actual rotation of the leaf itself to generate heat, thereby releasing the natural ammonia of tobacco and reducing nicotine, while also deepening the color and improving the aroma of tobacco. Generally, the fermentation process continues up to 6 months, which depends on the variety of tobacco, the handle position on the leaf, the thickness of the leaf and the intended use.

[0359] Suitably, the processed tobacco leaves may be processed by pasteurisation.Pasteurisation may be particularly preferred when the tobacco leaves are to be used in the preparation of smokeless tobacco industrial products, most preferably snus.

[0360] The pasteurization of tobacco leaves can be carried out by any method known in the art. For example, the pasteurization method can be as described in J Foulds, L Ramstrom, M Burke, K Fagerstrom. Effect of smokeless tobacco (snus) on smoking and public health in Sweden. Tobacco Control (2003) 12 : 349–359, the teachings of which are incorporated herein by reference.

[0361] During snus production, pasteurization is generally carried out by a process in which the tobacco is heat treated with steam for 24-36 hours, reaching a temperature of approximately 100° C. This results in a nearly sterile product, and without wishing to be bound by theory, one of the consequences of this is believed to be limiting further TSNA formation.

[0362] In one embodiment, the pasteurization process may be steam pasteurization.

[0363] In some embodiments, the processed tobacco leaves may be cut. The processed tobacco leaves may be cut before or after processing. Suitably, the processed tobacco leaves may be cut after processing.

[0364] In one embodiment, use of the foregoing embodiments can provide reconstituted tobacco.

[0365] In one embodiment, reconstituted tobacco is provided.

[0366] As used herein, "reconstituted" may also be referred to as reconstituted, recycled or homogenized sheet tobacco, and refers to tobacco material generated from tobacco leaf residues after processing. Reconstituted tobacco allows for the production of consistent, high quality blends, and allows for adjustment of the ratios of the various components.

[0367] Reconstituted tobacco can be nanofibre reconstituted (nanofibres can be extracted in solid or liquid form), paper reconstituted (which uses stems, scraps and midrib as raw materials), or slurry reconstituted (which uses a mixture of finely powdered material and tobacco stems that is ground into powder and mixed with water and a vegetable binder. The soluble residue is formed into sheets by extracting the water).

[0368] Any method known in the art can be used to prepare reconstituted tobacco, for example, see CORESTA Congress, Sapporo, 2012, Smoke Science / Product Technology Groups, SSPT 12 (incorporated herein by reference).

[0369] In some embodiments, the leaf of the results of tobacco plant, tobacco plant and / or processed tobacco leaf can be used to extract nicotine. The extraction of nicotine can be realized using any method known in the art. For example, the method for extracting nicotine from tobacco is taught in US 2,162,738, which is incorporated herein by reference.

[0370] In one aspect, the present invention provides a cured tobacco material made from a tobacco plant or part thereof according to the present invention.

[0371] In another aspect, the present invention provides a tobacco blend comprising a tobacco material made from a tobacco plant or part thereof according to the present invention, or a tobacco cell culture according to the present invention. In one aspect, the present invention provides a tobacco blend comprising a cured tobacco material according to the present invention.

[0372] Suitably, tobacco blends according to the present invention can include about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% tobacco from tobacco plant according to the present invention or its part or from tobacco cell culture according to the present invention. Suitably, tobacco blends can include about 10% tobacco from tobacco plant according to the present invention or its part or from tobacco cell culture according to the present invention. Suitably, tobacco blends can include about 20% tobacco from tobacco plant according to the present invention or its part or from tobacco cell culture according to the present invention. Suitably, tobacco blends can include about 30% tobacco from tobacco plant according to the present invention or its part or from tobacco cell culture according to the present invention. Suitably, tobacco blends can include about 40% tobacco from tobacco plant according to the present invention or its part or from tobacco cell culture according to the present invention. Suitably, tobacco blends can include about 50% tobacco from tobacco plant according to the present invention or its part or from tobacco cell culture according to the present invention. Suitably, tobacco blends can include about 60% tobacco from tobacco plant according to the present invention or its part or from tobacco cell culture according to the present invention. Suitably, tobacco blends can comprise about 70% tobacco from tobacco plant according to the present invention or its part or from tobacco cell culture according to the present invention. Suitably, tobacco blends can comprise about 80% tobacco from tobacco plant according to the present invention or its part or from tobacco cell culture according to the present invention. Suitably, tobacco blends can comprise about 90% tobacco from tobacco plant according to the present invention or its part or from tobacco cell culture according to the present invention.

[0373] In one aspect, the tobacco blend products of the present invention comprise at least about 5, 10, 20, 30, 40, 50, 60, 70, 80, 90 or 95 percent by dry weight of tobacco cured from a tobacco plant or part thereof according to the present invention or a tobacco cell culture according to the present invention.

[0374] Suitably, the tobacco material after curing can be air-cured. Suitably, the tobacco material after curing can be fire-tube cured. Suitably, the tobacco material after curing can be sun-cured. Suitably, the tobacco material after curing can be open flame cured.

[0375] Tobacco industry products or smoking articles according to the invention may comprise a tobacco material according to the invention (eg, a cured tobacco material or a reconstituted tobacco material).

[0376] In another aspect, the invention provides tobacco industry products.

[0377] In one embodiment, the tobacco industry product according to the invention may be a blended tobacco industry product. Suitably, a tobacco blend may comprise a cured tobacco material according to the invention.

[0378] In one embodiment, tobacco industry products can be prepared from the tobacco plants or parts thereof of the present invention.

[0379] Suitably, tobacco plants or parts thereof may be propagated from tobacco plant propagation material according to the invention.

[0380] The term " part " used in the context of tobacco plant as this paper refers to a part of tobacco plant. Suitably, " part " can be a leaf, root or stem or flower of tobacco plant. Suitably, " part " can be a leaf, root or stem of tobacco plant.

[0381] Tobacco industry products

[0382] As used herein, the term "tobacco industry product" is intended to include combustible smoking articles, such as cigarettes, cigarillos, cigars, tobacco for pipes or hand-rolled cigarettes (whether based on tobacco, tobacco derivatives, expanded tobacco, reconstituted tobacco, tobacco substitutes or other smokeable materials), non-combustible gas aerosol delivery systems, such as heating products that release compounds from a matrix material without combustion, such as electronic cigarettes, tobacco heating products, and hybrid systems that generate aerosols from a combination of matrix materials, such as hybrid systems containing liquid or gel or solid matrices, and aerosolizable matrix materials used in these aerosol delivery systems; as well as non-aerosol delivery products, such as lozenges, chewing gum, patches, products containing inhalable powders, and smokeless tobacco industry products such as oral tobacco and snus, which may or may not deliver nicotine.

[0383] In one embodiment, a tobacco industry product can be prepared from (eg, can comprise) a tobacco plant or part thereof of the invention.

[0384] Suitably, tobacco plants or parts thereof may be propagated from tobacco plant propagation material according to the invention.

[0385] As used herein in the context of tobacco plants, the term "part thereof" refers to a part of the tobacco plant. Preferably, the "part thereof" is a leaf of the tobacco plant.

[0386] In another embodiment, tobacco industry products can be prepared from the harvested leaves of the present invention.

[0387] In further embodiments, tobacco industry products can be prepared from the processed tobacco leaves of the present invention.

[0388] Suitably, tobacco industry products may be prepared from tobacco leaves processed by one or more of: curing, fermenting and / or pasteurising.

[0389] Suitably, the tobacco industry product may comprise cut tobacco leaves, optionally processed in accordance with the preceding embodiments.

[0390] In another embodiment, tobacco industry products can be prepared from tobacco cell cultures according to the present invention.

[0391] In another embodiment, a tobacco industry product may be prepared from (eg may comprise) a cured tobacco material according to the invention.

[0392] In another embodiment, a tobacco industry product can be prepared from (eg, can include) a tobacco blend according to the invention.

[0393] In one embodiment, the tobacco industry product may be a smoking article.

[0394] As used herein, the term "smoking article" may include smokeable products such as cigarettes, cigarettes, cigars and cigarillos, whether based on tobacco, tobacco derivatives, expanded tobacco, reconstituted tobacco or tobacco substitutes.

[0395] In another embodiment, the tobacco industry product can be a smokeless tobacco industry product.

[0396] As used herein, the term "smokeless tobacco industry product" refers to a tobacco industry product that is not intended to be smoked and / or subjected to combustion.

[0397] Smokeless tobacco industry products (including heat-not-burn materials) can contain tobacco in any form (including dry particles, shredded tobacco, granules, powders, or slurries) deposited on, mixed in, surrounded by, or combined with other ingredients, the other ingredients taking any form such as sheets, films, tabs, foams, or beads.

[0398] In one embodiment, smokeless tobacco industry products can include snus, snuff, chewing tobacco, and the like.

[0399] In one embodiment, the tobacco industry product is a combustible smoking article selected from the group consisting of cigarettes, cigarillos, and cigars.

[0400] In one embodiment, the tobacco industry product comprises one or more components of a combustible smoking article, such as a filter, a filter rod, a filter rod segment, tobacco, a tobacco rod, a tobacco rod segment, a spill, an additive release component such as a capsule, a thread, a bead, a paper such as a plug wrap, a tipping paper or a cigarette paper.

[0401] In one embodiment, the tobacco industry product is a non-combustible gas aerosol delivery system.

[0402] In one embodiment, the tobacco industry product comprises one or more components of a non-combustible gas aerosol delivery system, such as a heater and an aerosolizable substrate.

[0403] In one embodiment, the aerosol supply system is an electronic cigarette, also known as a vaping device.

[0404] In one embodiment, the electronic cigarette includes a heater, a power source capable of powering the heater, an aerosolizable substrate such as a liquid or gel, a housing, and optionally a mouthpiece.

[0405] In one embodiment, the aerosolizable substrate is contained in a substrate container. In one embodiment, the substrate container is associated with or includes a heater.

[0406] In one embodiment, the tobacco industry product is a heating product that releases one or more compounds by heating rather than burning a matrix material. The matrix material is an aerosolizable material, which may be, for example, tobacco or other non-tobacco products, which may or may not contain nicotine. In one embodiment, the heating product is a tobacco heating product.

[0407] In one embodiment, the heating product is an electronic device.

[0408] In one embodiment, the tobacco heating product comprises a heater, a power source capable of powering the heater, and an aerosolizable substrate such as a solid or gel material.

[0409] In one embodiment, the heating product is a non-electronic article.

[0410] In one embodiment, the heating product includes an aerosolizable substrate, such as a solid or gel material, and a heat source capable of supplying thermal energy to the aerosolizable substrate without any electrical means, such as by burning a combustion material such as charcoal.

[0411] In one embodiment, the heated product further comprises a filter capable of filtering the aerosol generated by heating the aerosolizable substrate.

[0412] In some embodiments, the aerosolizable base material may comprise a vapor or aerosol generating agent or a humectant, such as glycerol, propylene glycol, triacetin, or diethylene glycol.

[0413] In one embodiment, the tobacco industry product is a hybrid system, generates aerosol with the combination of the non-combustion host material by heating.The host material can include, for example, solid, liquid or gel, which may or may not contain nicotine.In one embodiment, the hybrid system includes liquid or gel matrix and solid matrix.Solid matrix can be, for example, tobacco or other non-tobacco products, which may or may not contain nicotine.In one embodiment, the hybrid system includes liquid or gel matrix and tobacco.

[0414] In further embodiments, the tobacco industry product may be a tobacco heating device or a hybrid device or an electronic cigarette, and the like.

[0415] Typically in tobacco heating devices or hybrid devices, an aerosol is generated by transferring heat from a heat source to a physically separate aerosol-forming substrate or material, which may be located within, around or downstream of the heat source. During smoking, volatile compounds are released from the aerosol-forming substrate by heat transfer from the heat source and are entrained in the air drawn in through the smoking article. As the released compounds cool, they condense to form an aerosol that is inhaled by the user.

[0416] Aerosol generating articles and devices for consuming or smoking tobacco heating devices are known in the art. They may include, for example, electrically heated aerosol generating devices, wherein an aerosol is generated by transferring heat from one or more electrical heating elements of the aerosol generating device to an aerosol-forming substrate of the tobacco heating device.

[0417] Suitably, the tobacco heating device may be an aerosol generating device.

[0418] Preferably, the tobacco heating device may be a heat-not-burn device. Heat-not-burn devices are known in the art and release compounds by heating rather than burning tobacco.

[0419] Examples of suitable heat not burn devices may be those taught in WO2013 / 034459 or GB2515502, which are incorporated herein by reference.

[0420] In one embodiment, the aerosol-forming substrate of the tobacco heating device may be a tobacco industry product according to the present invention.

[0421] In one embodiment, the tobacco heating device may be a hybrid device.

[0422] Polynucleotide / polypeptide / construct

[0423] In certain embodiments of the invention, a construct that modulates the activity or expression of at least one protein kinase gene may be transformed or introduced into a plant cell, suitably under the direction of a promoter.

[0424] In certain embodiments of the present invention, under the guidance of a promoter, a construct that reduces (i.e., inhibits) the activity or expression of a protein kinase gene can be transformed into a plant cell. For example, the genetic construct can be a gene editing construct or can include an RNAi molecule, which can include a small interfering RNA (siRNA) molecule or a short hairpin (shRNA) molecule.

[0425] In certain embodiments of the invention, a construct that increases the activity or expression of a protein kinase gene, such as a construct encoding a protein kinase gene, such as an endogenous protein kinase, can be transformed into a plant cell, suitably under the direction of a promoter.

[0426] The construct can be introduced into the plant according to the present invention with the aid of a suitable vector, such as a plant transformation vector. The plant transformation vector may comprise an expression cassette comprising a promoter sequence, a construct sequence targeting a protein kinase gene, and optionally a 3' untranslated terminator sequence in the transcriptional direction 5'-3', including a termination signal for RNA polymerase and a polyadenylation signal for polyadenylase. The promoter sequence may be present in one or more copies, and such copies may be identical or variants of the promoter sequence described above. The terminator sequence may be derived from a plant, bacterial or viral gene. Suitable terminator sequences are, for example, pea E9 Terminator sequence, derived from Agrobacterium tumefaciens ( Agrobacterium tumefaciens )of Nopaline synthase Genetic nos terminator sequence, and from cauliflower mosaic virus 35S terminator Those skilled in the art will readily recognize other suitable terminator sequences.

[0427] The constructs of the present invention may also contain gene expression enhancing mechanisms to increase the strength of the promoter. Examples of such enhancer elements are derived from pea Plastocyanin The enhancer element is part of the promoter of the gene and is the subject of International Patent Application No. WO 97 / 20056, which is incorporated herein by reference. Suitable enhancer elements can be, for example, derived from Agrobacterium tumefaciens. Nopaline synthase Genetic nos Enhancer element, and from cauliflower mosaic virus 35S Enhancer elements.

[0428] These regulatory regions may be derived from the same gene as the promoter DNA sequence, or may be derived from tobacco or other organisms, such as from the Solanaceae family or from the subfamily Lycopodiellae ( Cestroideae All regulatory regions should be able to function in cells of the tissue to be transformed.

[0429] The promoter DNA sequence may be derived from the same gene as the gene of interest, e.g. the gene that the promoter is to direct, e.g. a gene encoding a protein kinase according to the invention, the coding sequence used in the invention, or may be derived from a different gene from tobacco or another organism, e.g. from the Solanaceae family or from the subfamily Lycopodiellae.

[0430] The expression cassette can be incorporated into a basic plant transformation vector, e.g. pBIN 19 Plus , pBI 101 , pKYLX71:35S2, pCAMBIA2300 or other suitable plant transformation vectors known in the art. In addition to the expression cassette, the plant transformation vector will contain such sequences as are necessary for the transformation process. These may include Agrobacterium ( Agrobacterium ) vir gene, one or more T-DNA border sequences, and a selectable marker or other means of identifying transgenic plant cells.

[0431] The term "expression vector or plant transformation vector" means a construct capable of in vivo or in vitro expression. Preferably, the expression vector is incorporated into the genome of the organism. In one embodiment, the vector of the invention expresses a protein, such as a protein kinase as described herein. The term "incorporated" preferably includes stable incorporation into the genome.

[0432] Techniques for transforming plants are well known in the art and include, for example, Agrobacterium-mediated transformation. The basic principle in the construction of genetically modified plants is to insert genetic information into the plant genome in order to obtain stable maintenance of the inserted genetic material. An overview of general techniques can be found in the literature by Potrykus ( Annu Rev Plant Physiol Plant Mol Biol

[1991] 42:205-225) and Christon (AgroFood-Industry Hi-Tech 1994 Mar / Apr 17-27), which references are incorporated herein by reference.

[0433] Generally, in Agrobacterium-mediated transformation, a binary vector carrying an exogenous DNA of interest, i.e., a construct according to the present invention, is transferred from an appropriate Agrobacterium strain to a target plant by co-cultivation of Agrobacterium with an explant from the target plant. The transformed plant tissue is then regenerated on a selective medium containing a selective marker and a plant growth hormone. An alternative method is the floral dip method (Clough & Bent, 1998 Plant J. 1998 December; 16 (6): 735-43, which is incorporated herein by reference), whereby the flower buds of a complete plant are contacted with a suspension of an Agrobacterium strain containing a chimeric gene, and after fruiting, the transformed individuals are germinated and identified by growth on a selective medium. Direct infection of plant tissue by Agrobacterium is a simple technique that has been widely used and described in Butcher DN et al. (1980), Tissue Culture Methods for Plant Pathologists , eds.: DS Ingrams and JP Helgeson, 203-208, which reference is incorporated herein by reference.

[0434] Further suitable transformation methods include direct gene transfer into protoplasts, for example using polyethylene glycol or electroporation techniques, particle bombardment, microinjection, and the use of silicon carbide fibers. The use of ballistic transformation, including silicon carbide whisker technology, to transform plants is taught in Frame BR, Drayton PR, Bagnaall SV, Lewnau CJ, Bullock WP, Wilson HM, Dunwell JM, Thompson JA & Wang K (1994), which references are incorporated herein by reference. Production of fertile transgenic maize plants by silicon carbide whisker-mediated transformation is described in The Plant Journal 6: 941-948, which is incorporated herein by reference), and viral transformation techniques are taught, for example, in Meyer P, Heidmmm I & Niedenhof I (1992), which is incorporated herein by reference. The use of cassava mosaic virus as a vector system for plants is described in Gene 110: 213-217, which is incorporated herein by reference. Further teachings on plant transformation can be found in EP-A-0449375, which is incorporated herein by reference.

[0435] In a further aspect, the present invention relates to a vector system which carries the construct and introduces it into the genome of an organism such as a plant, suitably a tobacco plant. The vector system may comprise one vector, but it may comprise two vectors. In the case of two vectors, the vector system is generally referred to as a binary vector system. The binary vector system is described in Gynheung Anetal, (1980), Binary Vectors, Plant Molecular Biology Manual A3, 1-19, which are incorporated herein by reference.

[0436] A widely adopted system for transforming plant cells uses the Ti plasmid from Agrobacterium tumefaciens or from Agrobacterium rhizogenes ( Agrobacterium rhizogenes ) of the Ri plasmid, which was described by An et al. (1986), Plant Physiol. 81, 301-305 and Butcher DN et al., (1980), Tissue Culture Methods for Plant Pathologists, Editors: DS Ingrams and JP Helgeson, 203-208, which are incorporated herein by reference. After each method of introduction of the desired foreign gene in the plant according to the invention, the presence and / or insertion of further DNA sequences may be necessary. The use of T-DNA for plant cell transformation has been well studied and is described in EP-A-120516; Hoekema, in: The Binary Plant Vector System Offset-drukkerij Kanters BB, Amsterdam, 1985, Chapter V; Fraley et al., Crit. Rev. Plant Sci., 4:1-46; and Anetal., EMBO J( 1985) 4:277-284, which is incorporated herein by reference.

[0437] Plant cells transformed with one or more constructs that modulate the activity or expression of a protein kinase gene can be grown and maintained according to well-known tissue culture methods, for example, by culturing the cells in a suitable medium supplied with necessary growth factors such as amino acids, plant hormones, vitamins, and the like.

[0438] The term "transgenic plant" in connection with the present invention includes any plant comprising a construct which modulates the activity or expression of a protein kinase gene according to the present invention. Accordingly, a transgenic plant is a plant which has been transformed with a construct according to the present invention. Preferably, according to the present invention, the transgenic plant shows modulated protein kinase activity or expression, as well as modulated alkaloid content and / or modulated TSNA content (or its precursors). The term "transgenic plant" does not include the native nucleotide coding sequence in its natural environment when under the control of its native promoter (which is also in its natural environment).

[0439] In one aspect, the protein kinase gene or plant cell according to the invention is in isolated form. The term "isolated" means that the protein kinase gene or plant cell is at least substantially free of at least one other component with which it is naturally associated in nature and as found in nature.

[0440] In one aspect, the protein kinase gene, construct, plant transformation vector or plant cell according to the present invention is in a purified form. The term "purified" means in a relatively pure state, such as at least about 90% pure, or at least about 95% pure, or at least about 98% pure.

[0441] As used herein, the term "nucleotide sequence" refers to an oligonucleotide sequence or a polynucleotide sequence, as well as variants, homologues, fragments and derivatives (e.g., portions thereof). The nucleotide sequence may be of genomic or synthetic or recombinant origin, it may be double-stranded or single-stranded, whether representing the sense strand or the antisense strand.

[0442] The term "nucleotide sequence" related to the present invention includes genomic DNA, cDNA, synthetic DNA and RNA. Preferably, it means a DNA encoding the present invention, more preferably a cDNA sequence.

[0443] In a preferred embodiment, when relevant to and when encompassed by the scope of the present invention itself, the nucleotide sequence, i.e., the protein kinase gene, comprises the native nucleotide sequence when in its natural environment and when it is linked to one or more of its naturally associated sequences that are also in its natural environment. For ease of reference, we shall refer to this preferred embodiment as the "native nucleotide sequence." In this regard, the term "native nucleotide sequence" means the entire nucleotide sequence, which is in its natural environment, and when operably linked to the entire promoter with which it is naturally associated, the promoter is also in its natural environment.

[0444] The nucleotide sequence for use of the present invention can be present in a vector, wherein the nucleotide sequence is operably linked to a regulatory sequence that can ensure expression of the nucleotide sequence by a suitable host organism. The construct for use of the present invention can be transformed into a suitable host cell as described herein to ensure expression of the polypeptide of the present invention. The selection of a vector such as a plasmid, cosmid or phage vector often depends on the host cell to be introduced therein. The vector can be used, for example, for the production of RNA in vitro, or for transfection, transformation, transduction or infection of a host cell.

[0445] In some applications, the nucleotide sequence for use in the present invention is operably linked to a regulatory sequence that is capable of ensuring expression of the nucleotide sequence, for example, by a selected host cell. For example, the present invention includes a vector comprising a nucleotide sequence of a protein kinase gene as described herein operably linked to such a regulatory sequence, i.e., the vector is an expression vector.

[0446] The term "operably linked" refers to a juxtaposition wherein the components are in a relationship permitting them to function in their intended manner. A regulatory sequence "operably linked" to a coding sequence is linked in such a way that expression of the coding sequence is achieved under conditions compatible with the control sequences.

[0447] The term "regulatory sequence" includes promoters and enhancers and other expression regulatory signals. The term "promoter" is used in the usual sense of the art, such as an RNA polymerase binding site. The nucleotide sequence within the construct encoding the protein kinase gene can be operably linked to at least one promoter.

[0448] The term "construct", which is synonymous with terms such as "cassette" or "vector", comprises a nucleotide sequence for use according to the invention attached directly or indirectly to a promoter. Suitably, the construct may be introduced into a cell.

[0449] An example of indirect attachment is between the promoter and the nucleotide sequence of the present invention, providing a suitable spacer group, such as an intron sequence, such as the Sh1-intron or the ADH intron. The same is true for the term "fused" related to the present invention, which includes direct or indirect attachment. In some cases, the term does not include the natural combination of nucleotide sequences encoding proteins that are usually combined with wild-type gene promoters and when they are all in their natural environment. The construct can even contain or express a marker that allows the selection of a genetic construct.

[0450] In some embodiments, the promoter can be operably linked to a nucleotide sequence in a construct or vector for regulating nicotine concentration and / or total content in a cell or cell culture or a tobacco plant or part thereof.

[0451] In some embodiments, the promoter can be selected from the group consisting of: a constitutive promoter, a tissue-specific promoter, a developmentally regulated promoter, and an inducible promoter.

[0452] In one embodiment, the promoter may be a constitutive promoter.

[0453] Constitutive promoters direct the expression of a gene continuously throughout various parts of the plant during plant development, although the gene may not be expressed at the same level in all cell types. Examples of known constitutive promoters include those associated with the cauliflower mosaic virus 35S transcript (Odell JT, Nagy F, Chua NH. (1985). Identification of DNA sequences required for activity of the cauliflower mosaic virus 35S promoter. Nature. 313 810-2), the rice actin 1 gene (Zhang W, McElroy D, Wu R. (1991). Analysis of rice Act1 5' region activity in transgenic rice plants. Plant Cell 3 1155-65) and the maize ubiquitin 1 gene (Cornejo MJ, Luth D, Blankenship KM, Anderson OD, Blechl AE. (1993). Activity of a maize ubiquitin promoter in transgenic rice. Plant Molec. Biol. 23 567-81). A constitutive promoter, for example, the carnation etched ring virus (CERV) promoter (Hull R, Sadler J, Longstaff M (1986) (CaMV / 35S), figwort mosaic virus 35S promoter. The sequence of carnation etched ring virus DNA: comparison with cauliflower mosaic virus and retroviruses. EMBO Journal, 5 (2): 3083-3090).

[0454] The constitutive promoter may be selected from: the Carnation Etch Ring Virus (CERV) promoter, the Cauliflower Mosaic Virus (CaMV35S promoter), the promoter from the rice actin 1 gene or the maize ubiquitin 1 gene.

[0455] The promoter may be a tissue-specific promoter. A tissue-specific promoter is a promoter that directs the expression of a gene in one (or several) parts of a plant, usually throughout the lifetime of those plant parts. The category of tissue-specific promoters also generally includes promoters whose specificity is not absolute, i.e., they may also direct expression at lower levels in tissues other than preferred tissues. Tissue-specific promoters include the phaseolin promoter, the legumin b4-promoter, the usp-promoter, the sbp-promoter, the ST-LS1 promoter, and the B33 (patatin class I promoter).

[0456] In another embodiment, the promoter can be a developmentally regulated promoter.

[0457] Developmentally regulated promoters direct changes in the expression of a gene in one or more parts of a plant at specific times during plant development. A gene may be expressed at different (usually lower) levels in said plant part at other times, and may also be expressed in other plant parts.

[0458] In one embodiment, the promoter may be an inducible promoter.

[0459] Inducible promoters can respond to the expression of inducer-directed genes. In the absence of inducer, the gene will not be expressed. Inducer can act directly on the promoter sequence, or can work by offsetting the effect of repressor molecules. Inducer can be a chemical reagent such as metabolites, proteins, growth regulators (such as auxin and salicylic acid that activate the OCS promoter) or toxic elements, physiological stress such as heat, light (such as soybean SSU promoter), damage (such as nos, nopaline synthase promoter), or osmotic pressure, or the indirect consequences of pathogen or pest action. The promoter of developmental regulation can be described as a specific type of inducible promoter, which responds to the endogenous inducer produced by the plant or the environmental stimulation at a specific moment in the life history of the plant. Examples of known inducible promoters include those associated with wound response as described, for example, by Warner SA, Scott R, Draper J. ((1993) Plant J. 3 191-201), temperature response as disclosed by Benfey & Chua (1989) (Benfey, PN, and Chua, NH. ((1989) Science 244 174-181), and chemical induction as described by Gatz ((1995) Methods in Cell Biol. 50 411-424).

[0460] Nucleotide sequences encoding proteins having the specific properties of being a protein kinase gene as defined herein or proteins suitable for modification can be identified and / or isolated and / or purified from any cell or organism producing the protein. Various methods for the identification and / or isolation and / or purification of nucleotide sequences are well known in the art. For example, once a suitable sequence has been identified and / or isolated and / or purified, further sequences can be prepared using PCR amplification techniques.

[0461] In a still further alternative, the nucleotide sequence encoding the protein kinase may be prepared synthetically by established standard procedures, for example by Beucage SL et al., (1981) Tetrahedron Letters 22, pp. 1859-1869 (which is incorporated herein by reference), or by the phosphoramidite method described in Matthes et al., (1984) EMBO J . 3, pp. 801-805 (which is incorporated herein by reference). In the phosphoramidite method, oligonucleotides are synthesized, for example in an automatic DNA synthesizer, purified, annealed, ligated and cloned in an appropriate vector.

[0462] As used herein, the term "amino acid sequence" is synonymous with the term "polypeptide" and / or the term "protein."

[0463] The present invention also includes the use of sequences that have a certain degree of sequence identity or sequence homology with one or more amino acid sequences of a polypeptide having the specific properties defined herein, or any nucleotide sequence, i.e., a protein kinase gene encoding such a polypeptide (hereinafter referred to as "one or more homologous sequences"). Here, the term "homolog" means an entity that has a certain homology with the subject amino acid sequence and the subject nucleotide sequence. Here, the term "homology" can be equivalent to "identity".

[0464] Homologous amino acid sequences and / or nucleotide sequences and / or fragments should provide and / or encode polypeptides that retain the functional activity of the protein kinase gene and / or enhance the activity of the protein kinase gene. Generally, homologous sequences will contain, for example, the same active sites as the subject amino acid sequence, or will encode the same active sites. Although homology can also be considered in terms of similarity (i.e., amino acid residues with similar chemical properties / functions), in the context of the present invention, it preferably means homology in terms of sequence identity. Homologous sequences generally retain functional domains or motifs. Suitably, homologs of protein kinases may contain protein kinase domains and active sites containing conserved lysine residues such as K308, wherein the amino acid numbers are relative to SEQ ID NO. 3.

[0465] In one embodiment, homologous sequences are employed to include amino acid sequences or nucleotide sequences that have one, two or several additions, deletions and / or substitutions compared to the subject sequence.

[0466] Sequence identity

[0467] Sequence identity comparisons can be performed by eye, or more generally, by means of readily available sequence comparison programs. These commercially available computer programs can calculate the % homology between two or more sequences. % homology or % identity can be calculated on adjacent sequences, i.e., one sequence is compared with another sequence, and each amino acid in one sequence is directly compared with the corresponding amino acid in the other sequence, one residue at a time. This is called a "no gap" comparison. Typically, this no gap comparison is performed only on a relatively short number of residues.

[0468] Although this is a very simple and consistent method, it fails to take into account that, for example, in otherwise identical sequence pairs, an insertion or deletion will cause the amino acid residues in the back to be unable to be compared, thus potentially leading to a significant reduction in % homology when performing an overall comparison. Thus, most sequence comparison methods are designed to produce an optimal comparison that takes into account possible insertions and deletions without overly penalizing the overall homology score. This is achieved by inserting "gaps" in the sequence alignment to attempt to maximize local homology.

[0469] However, these more sophisticated methods assign "gap penalties" to each gap that occurs in the alignment, so that for the same number of identical amino acids, a sequence alignment with as few gaps as possible - reflecting a higher relatedness between the two compared sequences - will receive a higher score than an alignment with many gaps. An "affine gap cost" is generally used, which imposes a relatively high cost for the presence of a gap, and a smaller penalty for each residue after the gap. This is the most commonly used gap scoring system. A high gap penalty will of course produce an optimized alignment with fewer gaps. Most alignment programs allow the gap penalty to be modified. However, when using such software for sequence comparison, it is preferably to use the default value.

[0470] Therefore, calculation of maximum % homology first requires producing an optimal alignment taking into account gap penalties. A suitable computer program for performing such an alignment is Vector NTI (Invitrogen Corp.). Examples of software that can perform sequence comparisons include, but are not limited to, for example, the BLAST package (see Ausubel et al. 1999 Short Protocols in Molecular Biology, 4th edition - Chapter 18), BLAST 2 (see FEMS Microbiol Lett 1999 174 (2): 247-50; FEMS Microbiol Lett 1999 177 (1): 187-8 and tatiana@ ncbi.nlm.nih.gov ), FASTA (Altschul et al. 1990 J. Mol. Biol. 403-410) and AlignX. At least BLAST, BLAST 2 and FASTA can be used for offline and online searching (see Ausubel et al. 1999, pp. 7-58 to 7-60).

[0471] Although final % homology can be measured according to identity, the comparison process itself is generally not based on all-or-no paired comparisons. On the contrary, a similarity score matrix with a change in ratio is usually used, which is based on chemical similarity or evolutionary distance to each paired comparison assignment score. An example of this matrix commonly used is the BLOSUM62 matrix-the default matrix of the BLAST program suite. The Vector NTI program usually uses a disclosed default value or a conventional symbol comparison table (if provided) (for further details, referring to the user manual). For some applications, the default values ​​of the Vector NTI program package are preferably used.

[0472] Alternatively, percent homology can be calculated using the multiple alignment feature in Vector NTI (Invitrogen Corp.) based on an algorithm similar to CLUSTAL (Higgins DG & Sharp PM (1988), Gene 73 (1), 237-244). Once the software has produced an optimal alignment, it is possible to calculate % homology, preferably % sequence identity. The software generally performs this as part of a sequence comparison and generates a numerical result.

[0473] If a gap penalty should be used when determining sequence identity, then preferably the following parameters are used for pairwise alignments:

[0474] For BLAST GAP OPEN 0 GAP EXTENSION 0

[0475] For CLUSTAL DNA protein Word length 2 1 K triplet Gap Penalty 15 10 Gap Extension 6.66 0.1

[0476] In one embodiment, CLUSTAL can be used together with gap penalty and gap extension set as defined above.In some embodiments, the gap penalty for BLAST or CLUSTAL comparison can be different from those described in detail above.Technical staff will understand that the standard parameters for performing BLAST and CLUSTAL comparison may change regularly, and will be able to select appropriate parameters based on the standard parameters detailed for BLAST or CLUSTAL comparison algorithm at that time.

[0477] Suitably, the degree of identity with respect to a nucleotide sequence is determined over at least 50 contiguous nucleotides, preferably over at least 60 contiguous nucleotides, preferably over at least 70 contiguous nucleotides, preferably over at least 80 contiguous nucleotides, preferably over at least 90 contiguous nucleotides, preferably over at least 100 contiguous nucleotides, preferably over at least 150 contiguous nucleotides, preferably over at least 200 contiguous nucleotides, preferably over at least 250 contiguous nucleotides, preferably over at least 300 contiguous nucleotides, preferably over at least 350 contiguous nucleotides, preferably over at least 400 contiguous nucleotides, preferably over at least 450 contiguous nucleotides, preferably over at least 500 contiguous nucleotides, preferably over at least 550 contiguous nucleotides, preferably over at least 600 contiguous nucleotides, preferably over at least 650 contiguous nucleotides, or preferably over at least 700 contiguous nucleotides.

[0478] Suitably, the degree of identity with respect to nucleotide, cDNA, cds or amino acid sequences may be determined over the entire sequence.

[0479] The sequences may also have deletions, insertions or substitutions of amino acid residues which produce silent changes and result in functionally equivalent substances. Deliberate amino acid substitutions may be made based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic properties of the residues, as long as the secondary binding activity of the substance is retained. For example, negatively charged amino acids include aspartic acid and glutamic acid; positively charged amino acids include lysine and arginine; and amino acids with uncharged polar head groups having similar hydrophilicity values ​​include leucine, isoleucine, valine, glycine, alanine, asparagine, glutamine, serine, threonine, phenylalanine, and tyrosine.

[0480] Conservative substitutions can be made, for example, according to the following table. Amino acids in the same group in the second column, and preferably in the same row in the third column, can be substituted for each other:

[0481]

[0482] The present invention also includes homologous substitutions (substitution and replacement are both used herein to mean the exchange of an existing amino acid residue with an alternative residue), i.e. like-for-like substitutions, such as basic substitutions for basic, acidic substitutions for acidic, polar substitutions for polar, etc. Non-homologous substitutions may also occur, i.e. from one class of residues to another, or on the other hand involving the inclusion of unnatural amino acids, such as ornithine (hereinafter referred to as Z), diaminobutyric acid ornithine (hereinafter referred to as B), norleucine ornithine (hereinafter referred to as O), pyridylalanine, thienylalanine, naphthylalanine and phenylglycine.

[0483] Substitution can also be made with unnatural amino acids, including; α* and α-disubstituted* amino acids, N-alkyl amino acids*, lactic acid*, halide derivatives of natural amino acids such as trifluorotyrosine*, p-Cl-phenylalanine*, p-Br-phenylalanine*, p-I-phenylalanine*, L-allyl-glycine*, β-alanine*, L-α-aminobutyric acid*, L-γ-aminobutyric acid*, L-α-aminoisobutyric acid*, L-ε-aminocaproic acid # , 7-aminoheptanoic acid*, L-methionine sulfone # *, L-norleucine*, L-norvaline*, p-nitro-L-phenylalanine*, L-hydroxyproline # , L-thioproline (thioproline)*, methyl derivatives of phenylalanine (Phe) such as 4-methyl-Phe*, pentamethyl-Phe*, L-Phe (4-amino) # , L-Tyr (methyl)*, L-Phe (4-isopropyl)*, L-Tic (1,2,3,4-tetrahydroisoquinoline-3-carboxylic acid)*, L-diaminopropionic acid # and L-Phe(4-benzyl)*. The notation * has been used for the purposes discussed above (in relation to homologous or nonhomologous substitution) to indicate the hydrophobic character of the derivative, while # has been used to indicate the hydrophilic character of the derivative, with #* indicating amphiphilic character.

[0484] In addition to amino acid spacers such as glycine or β-alanine residues, the variant amino acid sequence may include suitable spacers that may be inserted between any two amino acid residues of the sequence, including alkyl groups such as methyl, ethyl or propyl. Further variations involve the presence of one or more amino acid residues in peptidomimetic form, which will be fully understood by those skilled in the art. For the avoidance of doubt, "peptidomimetic form" is used to refer to variant amino acid residues in which the α-carbon substituent is located on the nitrogen atom of the residue rather than the α-carbon. Methods for preparing peptides in peptidomimetic form are known in the art, for example Simon RJ et al., PNAS(1992) 89(20), 9367-9371 and Horwell DC, Trends Biotechnol . (1995) 13(4), 132-134.

[0485] Nucleotide sequences for use in the present invention may include synthetic or modified nucleotides therein. Many different types of modifications to oligonucleotides are known in the art. These include methylphosphonate and phosphorothioate backbones and / or acridine or polylysine chain additions at the 3' and / or 5' ends of the molecule. For the present invention, it will be appreciated that the nucleotide sequences described herein may be modified by any method available in the art. Such modifications may be performed to enhance the in vivo activity or lifespan of the nucleotide sequences of the present invention.

[0486] The present invention also includes sequences complementary to the nucleic acid sequences of the present invention, or sequences that can hybridize with the sequences of the present invention or with sequences complementary thereto. The term "hybridization" as used herein should include "a process by which a nucleic acid strand binds to a complementary strand via base pairing", as well as amplification processes such as those performed in polymerase chain reaction (PCR) technology.

[0487] The present invention also relates to nucleotide sequences that can hybridize with the nucleotide sequences of the present invention (including the complementary sequences of those presented herein). Preferably, hybridization is determined under stringent conditions (e.g., 50° C. and 0.2xSSC {1xSSC = 0.15 M NaCl, 0.015 M Na3 citric acid, pH 7.0}). More preferably, hybridization is determined under high stringency conditions (e.g., 65° C. and 0.1xSSC {1xSSC = 0.15 M NaCl, 0.015 M Na3 citric acid, pH 7.0}).

[0488] A review of general techniques for transforming plants can be found in the literature by Potrykus ( Annu Rev Plant Physiol Plant Mol Biol

[1991] 42:205-225) and Christou (Agro-Food-Industry Hi-Tech 1994 March / April 17-27), which are incorporated herein by reference. Further teachings on plant transformation can be found in EP-A-0449375, which is incorporated herein by reference.

[0489] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present disclosure belongs. Singleton et al., DICTIONARY OF MICROBIOLOGY AND MOLECULAR BIOLOGY, 20 ED., John Wiley and Sons, New York (1994) and Hale & Marham, THE HARPER COLLINS DICTIONARY OF BIOLOGY, Harper Perennial, NY (1991) provide a general dictionary of many of the terms used in the present disclosure for those of skill in the art.

[0490] The present disclosure is not limited by the exemplary methods and materials disclosed herein, and any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the embodiments of the present disclosure. Numerical ranges include the numerical values ​​of the limited ranges. Unless otherwise indicated, any nucleic acid sequence is written from left to right in a 5' to 3' orientation; amino acid sequences are written from left to right in an amino to carboxyl orientation, respectively.

[0491] The headings provided herein are not limitations of the various aspects or embodiments of the disclosure, which can be obtained by reference to the specification as a whole. Accordingly, the terms defined immediately below are more fully defined by reference to the specification as a whole.

[0492] Amino acids are referred to herein using the name, three-letter abbreviation or single-letter abbreviation of the amino acid. As used herein, the term "protein" includes proteins, polypeptides and peptides. As used herein, the term "amino acid sequence" is synonymous with the term "polypeptide" and / or the term "protein". In some cases, the term "amino acid sequence" is synonymous with the term "peptide". In some cases, the term "amino acid sequence" is synonymous with the term "enzyme".

[0493] In the present disclosure and claims, conventional single-letter and three-letter codes for amino acid residues may be used. The 3-letter code for amino acids is as defined by the IUPACIUB Joint Commission on Biochemical Nomenclature (JCBN). It should also be understood that due to the degeneracy of the genetic code, a polypeptide may be encoded by more than one nucleotide sequence.

[0494] Other definitions of terms may appear throughout the specification. Before describing the exemplary embodiments in more detail, it should be understood that the present disclosure is not limited to the specific embodiments described, as these may of course vary. It should also be understood that the terminology used herein is for the purpose of describing specific embodiments only and is not intended to be limiting, as the scope of the present disclosure will be limited only by the appended claims.

[0495] Where a range of values ​​is provided, it is understood that, unless the context clearly indicates otherwise, each intermediate value based on one-tenth of the unit of the lower limit between the upper and lower limits of the range is also specifically disclosed. Each smaller range between any specified value or intermediate value in the specified range and any other specified value or intermediate value in the specified range is included in the present disclosure. Depending on any specifically excluded limits in the specified range, the upper and lower limits of these smaller ranges may be independently included in or excluded from the range, and each range in which any limit, no limit, or both limits are included in the smaller range is also included in the present disclosure. Where a specified range includes one or two limits, ranges excluding either or both of these included limits are also included in the present disclosure.

[0496] It must be noted that, as used herein and in the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "an enzyme" or "nitrate reductase" includes a plurality of such candidate agents and equivalents thereof known to those skilled in the art, and so forth.

[0497] advantage

[0498] It has surprisingly been found that the alkaloid content (e.g., nicotine content) and / or TSNA content of a plant can be regulated (e.g., reduced) by modulating the activity or expression of a protein kinase gene as taught herein, which acts as a negative regulator of nicotine in tobacco. Thus, tobacco products having regulated (e.g., reduced) alkaloid (e.g., nicotine) and / or TSNA content and commercially desirable traits sought by consumers of tobacco products can be produced.

[0499] The present inventors have surprisingly identified methods for regulating the alkaloid content (e.g., nicotine content) and / or TSNA content of plants (e.g., tobacco plants) by regulating the activity or expression of protein kinase genes. The alkaloid (e.g., nicotine content) or TSNA content of plants (e.g., tobacco plants) can be reduced by increasing the activity or expression of protein kinase genes. The alkaloid (e.g., nicotine content) or TSNA content of plants (e.g., tobacco plants) can be increased by inhibiting the activity or expression of protein kinase genes. Prior to the present invention, it was not known that regulation of the activity or expression of protein kinase genes as described herein could be used to regulate the alkaloid (e.g., nicotine) and / or TSNA content of plants (e.g., tobacco plants).

[0500] The present inventors have determined that overexpression of a protein kinase gene can reduce the alkaloid content (eg nicotine content) of modified plants to surprisingly low levels.

[0501] The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein should be construed as an admission that such publication constitutes prior art for the claims appended hereto. Example

[0502] Example 1 - Transient overexpression of protein kinase reduces alkaloid content in leaves

[0503] Methods and Materials

[0504] clone

[0505] Protein kinase expression vector

[0506] The gene sequence (SEQ ID No. 1) is amplified from a Gateway™ compatible cDNA library using primers located outside of the restriction sites flanking the gene sequence. The gene sequence is then transferred to an expression vector.

[0507] The resulting plasmid was sequenced and transformed into Agrobacterium tumefaciens GV3101pMP90 by heat shock and transiently expressed in TN90 leaves.

[0508] Transient gene expression

[0509] Agrobacterium tumefaciens GV3101 strains carrying constructs of interest were grown overnight in Luria-Bertani (LB) medium supplemented with appropriate antibiotics. The culture was spun down quickly and resuspended to OD600 = 0.6 in a buffer containing 10 mM MgCl2, 10 mM 2-(N-morpholino)ethanesulfonic acid (MES) pH 5.6 and 100 µM acetosyringone and incubated at room temperature for 1 hour. Infiltration into TN90 leaves was performed with a needleless syringe. Samples were obtained 5 days after infiltration.

[0510] The tests were performed with three biological replicates.

[0511] Alkaloid measurement

[0512] The relative contents of pyridine alkaloids were determined by reversed-phase high-performance liquid chromatography with tandem mass spectrometry (LC-MS / MS). Chromatographic separation was achieved using a Gemini-NX column (100 mm × 3.0 mm, 3 μm particle size, Phenomenex) and a gradient chromatographic separation using 6.5 mM ammonium acetate buffer (aq) (pH 10) and methanol.

[0513] The mass spectrometer was operated in electrospray (ESI) positive mode using scheduled MRM data acquisition. Two MRM transitions were monitored for each analyte and one for an isotopically labeled internal standard.

[0514]

[0515] Statistical analysis

[0516] Statistical significance based on one-way ANOVA analysis was performed using Prism 5.01 software (GraphPad Software).

[0517] result

[0518] The % nicotine content of 5-week-old TN90 leaves expressing Nitab4.5_0003679g0060.2 is shown in Figure 1 . Contents are expressed relative to controls and include three biological replicates analyzed by t-test. Values ​​are shown as mean ± SEM. Asterisks indicate statistical significance of P value ≤ 0.001. Relative to controls, the nicotine content of 5-week-old TN90 leaves expressing Nitab4.5_0003679g0060.2 was significantly reduced.

[0519] The anabasine and anatabine contents of 5-week-old TN90 leaves expressing Nitab4.5_0003679g0060.2 were also reduced relative to the control.

[0520] in conclusion

[0521] Nitab4.5_0003679g0060.2 is a negative regulator of alkaloid content, especially nicotine content, in leaves.

[0522] Example 2 - Virus-induced gene silencing (VIGS) of protein kinases increases alkaloid content in leaves

[0523] Virus-induced gene silencing (VIGS)

[0524] For virus-induced gene silencing, a 248-nucleotide cDNA fragment was synthesized and cloned into pTV00 (between EcoRI and XhoI sites) using the following primers Nitab4.5_0003679g0060.2_InFusion 5' TGAGTAAGGTTACCGAATTC (SEQ ID No. 5); and Nitab4.5_0003679g0060.2_InFusion 3' CTCGAGGCCCGGGCATGTCC (SEQ ID No. 6) using the In-Fusion cloning kit to form TRV2-Nitab4.5_0003679g0060.2.

[0525] The plasmid was then transformed into Agrobacterium tumefaciens GV3101.

[0526] 248-nucleotide cDNA fragment SEQ ID No. 4.

[0527] TRV vectors containing both (TRV RNA1) and (TRV RNA2) containing the targeted nucleotide sequence were propagated separately in Agrobacterium tumefaciens. These cultures were mixed (1:1) and infiltrated into 2-week-old TN90 plants using a syringe. The silencing effect was evaluated five weeks after virus infection by evaluating the expression level of the target gene.

[0528] VIGS assays were performed as previously described (Ratcliff et al., 2001; The Plant Journal, 25: 237-245 (incorporated herein by reference)). Briefly, independent cultures of A. tumefaciens GV3101 carrying TRV2 and TRV1 plasmids were propagated overnight in LB medium supplemented with appropriate antibiotics. The cultures were resuspended in VIGS buffer (10 mM morpholineethanesulfonic acid pH 5.6, 10 mM MgCL2, and 100 µM acetosyringone) and the optical density was adjusted to OD 600 = 1, and incubated overnight in the dark at room temperature. These cultures were mixed (1: 1) and infiltrated into 2-week-old TN90 plants with a syringe. The silencing effect of the virus infection was evaluated two weeks later by evaluating the expression level of the target gene. TRV-luciferase was used as a negative control, and TRV-PDS (reduced chlorophyll content of silent leaves) was used as a phenotypic silencing control.

[0529] result

[0530] The % nicotine content of 5-week-old TN90 leaves expressing the indicated constructs is shown in Figure 2The content is expressed relative to the control and contains three biological replicates analyzed by t-test. The values ​​are shown as mean ± SEM. The asterisk indicates statistical significance of P value ≤ 0.001.

[0531] Example 3 - Protein Kinase Activity

[0532] The wild-type protein kinase (having the amino acid sequence shown in SEQ ID No. 3) and the inactive form of the kinase having a mutation at amino acid residue 308 of SEQ ID NO. 3 (K308M variant) were transformed into Rosetta 2 (DE3) cells and plated on LB plates supplemented with appropriate antibiotics.

[0533] Cultures prepared from single colonies were grown until OD600 = 0.3-0.4. The cultures were then moved to the relative induction temperature (37°C). When the cultures had reached an OD600 of 0.6-0.8, they were induced with 0.5 mM IPTG for 3 hours. The cells were harvested by centrifugation at 4000 rpm for 20 minutes at 4°C. The pellet was resuspended by pipetting in 2 ml of lysis buffer (25 mM HEPES pH 7.5, 0.2 M NaCl, 1 mM DTT, 1 mM EDTA, 0.2 mM PMSF, 1 mg / ml lysozyme, 0.01 U / µl Benzonase, protease inhibitors) and then freeze-thawed at -80°C and centrifuged at 20k x g for 30 minutes. The supernatant was then diluted 1 / 2 in equilibration buffer (25 mM HEPES pH7.5, 0.2 M NaCl, 1 mM DTT, 1 mM EDTA) and applied to 0.5 ml of Amylose Resin (NEB) which had been pre-equilibrated with 10 CVs of equilibration buffer using a gravity flow column. The flow-through fractions were collected and then four columns were washed with 5 ml (10 CVs) of wash 1, followed by 5 ml (10 CVs) of wash 2 (25 mM HEPES pH7.5, 0.2 M NaCl, 1 mM EDTA). Finally, bound proteins were eluted with 4 CVs (2 x 1 ml) of elution buffer (25 mM HEPES pH7.5, 0.2 M NaCl, 1 mM DTT, 10 mM maltose). Elution fractions were then adjusted to >0.5 mg / ml (measured at A280) and samples were either used fresh for kinase assays or snap frozen with 10% glycerol and stored at -80°C.

[0534] For the kinase reaction, 40 µl reactions were prepared with the following components:

[0535]

[0536] Incubate the reaction at 25°C for 30 minutes. Prepare SDS-PAGE samples: Mix 40 µl of reaction with 10 µl of 4X loading dye and denature at 95°C for 10 minutes, followed by centrifugation at 20k xg for 2 minutes. Load 15 µl per gel = approximately 3µg MBP and approximately 2.6 µg purified test kinase.

[0537] Pro-Q (and Instant Blue) staining:

[0538] Samples were loaded onto 12-well Bio-RAD 4-20% Mini-PROTEAN TGX SDS-PAGE Precast Gels, which were run for 80 min at 100 V. Gels were stained with Pro-Q diamond phosphoprotein stain according to the manufacturer's instructions and imaged using a Syngene G:BOX imager at the correct wavelengths for Abs and Ems.

[0539] Finally, the gel was stained overnight with Instant Blue Coomassie stain and imaged using a Syngene G:BOX imager.

[0540] result

[0541] Figure 8 The SDS-PAGE in Figure 4 shows the expression of wild-type Nitab4.5_0003679g0060.2 (having the sequence SEQ ID No. 3) and the K308M mutant in E. coli. Pro-Q Diamond phosphoprotein gel staining shows the ability of wild-type Nitab4.5_0003679g0060.2 and the K308M mutant to autophosphorylate and phosphorylate myelin basic protein (MyBP). The vertical bars indicate lane separation within the same blot.

[0542] Figure 8 It was shown that K308 (i.e., wild-type SEQ ID No. 3) is an active protein kinase, while the variant K308M is not an active kinase. K308 is essential for protein kinase activity.

[0543] Figure 7 Shown are the % alkaloid content of 5-week-old TN90 leaves expressing the indicated constructs: OE refers to overexpression of the wild-type protein kinase (having the amino acid sequence shown in SEQ ID No. 3), K308M refers to the variant sequence of SEQ ID No. 3 having the K308M mutation.

[0544] Nicotine content is expressed relative to control and contains three biological replicates analyzed by one-way ANOVA and Tukey's multiple comparison post hoc test. Values ​​are shown as mean ± SEM. Asterisks indicate statistical significance of P value ≤ 0.001.

[0545] Figure 7 Expression of the K308M mutant, which is an inactive protein kinase, was shown to increase nicotine levels. K308 acts as a dominant negative. Sequence Listing <110> British American Tobacco (Investments) Limited <120> Method for regulating alkaloid content of plants <130> P115516 <150> GB1817971.3 <151> 2018-11-02 <160> 6 <170> PatentIn version 3.5 <210> 1 <211> 10864 <212> DNA <213> Tobacco (Nicotiana tabacum) <400> 1 attcatcacc taaattttgc caaagctaag aatattaagc aaagcaaaaa aaaaagggga 60 atgtaattag cacgcaaaaa aagcagatcg aagataagca gatccacgtc aacttgactg 120 tgccaattaa aatcccacct ttaccccgag tcaaaaaagg gttatacaat acatacatac 180 atgattcatt tcatgtaccc accccccccca cacacagaga gagggaaaaa cgatatgacc 240 aatgggaatg aaaccttcct caaaaccact ccccccaccg ccatttgttt cttaataatt 300 cttctcagtt ttctttcaca aattaaacat gcatctttga tataaagtag aatttgaatt 360 ctgtaatttt ccatctccat aacgaagatt cactttacgt aaactgcacc gcggccatta 420 ttttcattc cggaggaatt taagactagt gagagaggtg aaatggcgat agaggataac 480 gagagttgtg ggagtagagt ggtggattcg gcgactacca gtggtcgtca tcagagaaaa 540 aaattggagg tctacaatga ggttttacgg aggcttaagg aatcaaacaa cgtcgaggct 600 ttagaacctg gatttgacga tgaactttgg gctcacttca atcgtctacc tactcggtaa 660 cttaccttt ctacctctct ctatgtatta atccgtacaa ttatatacgt tttatgcggt 720 tttctataga cgataatata tgactactga catatgatct caaatgtacc gttgtcgttc 780 gcatttgttg tgcctttggg agattggatt atttttggtc gacagtttca atcttcttat 840 caagttagaa gtcgataatg ccagttatcg tttccagctt cctcttctgg tcttaaattt 900 ttaggtttta cttgccgaaa agtttgctat cttagcttgt taaaatttcg atgaaccagt 960 tgaatttgct aagcagttca catttgtgca gatgtattaa tgtgcgtgtt ttagatgcac 1020 gacgttgcga aacgctgaat actttttttt tttggagaag tgcatactta tgtgccgcca 1080 aaattgattg atcaataaac gaatacctta tttttgcatt taaggtacgc aatagatgtg 1140 aatgtcgaaa gggcagaaga tgtactcaca cacaagcgat tgctacatct tgcacatgtt 1200 ccagctaata gacctgcctt tgatgtccgg ttggtgcagg taattaaact actcttgcaa 1260 gataacacct tttagttgct ttgctcttga tatcgcatac atttaaatca agcatgcctt 1320 tttctggagt taaggaggat atttagatg ttcgttcact ctgactagct agttcaatag 1380 accaacacat ctccgtgtaa tcttggtcct ttgtattttt tgtttattgt tgcttgtcca 1440 gtacctaatt attcccagta tatgctagtt atggattgaa tcaaacttgg cattgtgcag 1500 gttgcttcgg ttcctgatgg aaacttaaga gattcttttc attcgagctt tgcaaagaag 1560 gaagttagca gaaggtatca ccttcgtgac attctacctg aaaacgattt cccataggac 1620 gctgtatttc tttggttact tagtgattca ttgaagcctt tttctgttgt ttaatataat 1680 cttgaattct tacttgtcat tgactgtgct aaataaccgc ttccattttg atacatagtg 1740 tccatcctcc acctgccttt ggttcttctc ctaatctcga agcccttgct tgtgaagcaa 1800 tcaaatctga agttcaagac gaagatactg ctgctccttg tgcaaatttt tcgcggtata 1860 gaattttttt tctttttgtg cattccgctt cgacgagtat atattatgaa gcataaaatt 1920 gtaaataatt ttgcaggccc atgcatgaaa ttacattttc aacagatgac aagccaaagc 1980 ttcttagcca ggtaattgat gtgcttattt attcaataca ctatctgctt gatagaaatg 2040 tactctatct gttggcagag gtgggatgtg gtaagcttt tatttgacat tgaaaaaatg 2100 tccatttatt attgaaacca attgttgacc catgaacatg tataatattt aattctttat 2160 gtagaaatgt aattcaggga ccttgatgta tgaagggctg aggctttgtgt ctgttccttt 2220 gtttcatgaa agaacacaac tctcatcttg ctgcagattt caaaatgatg catgatttgg 2280 aatgtgcaag taaaacagac ataattgtat ttggtgacac caaaattgat aaatattgcc 2340 tgcctacttg gcattgtgat gcagtgagaa aggattgtgt attgcaagaa aagaagtagt 2400 tctttatatc agtttatatc tcatgataag gaaatctgag acaataatga acctttgaat 2460 atgacagtta acttcattac tagctgagct tgggctgaac atccaggaag cgcatgcctt 2520 ttccactgtg gatggctact ccctagatgt ctttgttgtt gatggttggc cctatgaggt 2580 acatctctga cgttatatcc tcactttgat ctgggttcgc ttaggtgcct gttatatttt 2640 gtgacctaac atcaagaagt gacagataat gtatgcatgg tttaaagttc tgtattatgg 2700 tcgctttcag ctcaactaaa aattgagtaa ccacttttaa actatgtaaa gtttatgaga 2760 atttcatcaa attatttagg ctacataatt taaaaggaat ttgataattc tgattaaaaa 2820 ggatttaaa ggatttgtac ttgtacatct agaaaattca gttaataaata cttttaacat 2880 taagatttca ataaatcaaa gtgcataaag gtttacgtat gacaatcgac tatgataaaa 2940 catattggag tataactatg ttgaattcaa tgagagtata tcatacactt tcatttaact 3000 attattatgt cattaggttt ttgttttgtt tttttgttat ttcgtaagaa aaaatgtgac 3060 ataaatttaa taagagtgtc ccgctttcag cttaccttgg gaaatgatta tgtcttgctt 3120 tcttgattat tactttgtat atatcacagt catgattctc tacttcactt attaggaaat 3180 gagttttaaa aggtctacag taaaaataatc tttttgaagt gttggttcgc caattaactt 3240 tttccggcat aggaatcctt tctgtagttg gcttgttgag ttctaggcta cactgttgca 3300 cctctaaatt cagtgcataa actgggagta ttttacattt caaacagaag tgaatgaaat 3360 tctgtgctcc aatgcttcat atttgtagca ccaattccag cattcagtgt gagccccatg 3420 gtaggtgcca atttttattt ttttttctaa ttgaaaaagt aaaatcactc tgttatggtt 3480 tctcggtcat ggtcggggtt gtctattata ttccttctga tgtcatgtgt ccaatggaac 3540 atttatttct gtttcttatc aggaagttgt gcgacttcga actgcattgg agagggaaat 3600 cttgagaaat gaggtacttt cctgttattt tgttctatat aatgacattt gatattctgc 3660 cgagatttct ggatatgttt tttctgcact agttaaatcc caactaatgt acaaaggact 3720 ttggtaagaa cagatttctg gtcgttttct gatgattat acttttggag ttactaggat 3780 tagtcatttc cttgttctcc tcgacgagca atataagatt tagccagttg tctgtaagtt 3840 ttgtgtactt atcatttaac gaggtgtagc tccattcaga aatcatggcc aagcccgtca 3900 caatcgttca taaagcagga gcaagacttg atcaaacgtg aatttgacca tttgacaata 3960 ccttttgatg gcattgacgt ctgggaaatt gatcatcagc ttttaaaatt tgaatacaag 4020 attgcatctg gttcatatgg tgacttgtaa gtttgttatg agctatatca ttcctctgac 4080 cattttagtt tcctggagac ttaattaatt aggtaattgt ttcagataca aaggtacata 4140 ctgcagtcag gatgtagcta tcaaaatcct aaaatctgag cgcttgaaca cagaattgca 4200 gacggagttt gcccaagaag tgtatatcat gaggtctgtc tggttatacc tccctatgaa 4260 gcttatggct attatctttg atttctttct ctatgcttaa aatatgttca gacaatatat 4320 ggtattattg tcacattgct atatccttta cttttcagga caagtataag attacacacc 4380 atgtcaagtc gttatctttc ctctgatact gtatttcttt tgtacttgca gaaaagttcg 4440 tcacaaaaat gttgtccaat tcataggggc ttgtaccagg cctcccaact tgtgtatagt 4500 aacaggtagt aaatgtcgta ttcagatcac ccaacttgca gaattgtttc aaaatcgccg 4560 actatcactg ttttcaaaac catttcctgt atcagtttca gtaggagttc acttaatgtt 4620 tatttatctt tcatttcttt gactgtagag tacatgtctg ggggaagcgt atatgactat 4680 ttacacaaac gaaagggcag ttttaacta cctaccctgc ttaaagtagc gattgatgta 4740 gctaaaggga tgaactacct gcatcaaaat aatattatac atagggactt gaaggctgcc 4800 aatctactga tggatgaaaa tgaagtaaga cgcaattttc agtaaggctg aaaatcttat 4860 actttgtgtg ctgtcttatt gctagatgtt tttagtcgct gatgttacgt atattgatga 4920 ttgatcaact ttctagagta atttttatca tgtccaacta actatgcttg taaatattga 4980 tttcccattt tcatttgcaa atgtagaacc attagctagt acacaaggcc ctaccacatg 5040 aaagaggttt atttctgaac gactataggg aagttatgg agatgccacc acaggatacg 5100 gagcgctgcg tattttat accactgata acattttgtt atcactcttt tgcttagcga 5160 taatgggctg cttgaacttt gggacatttt ccaaagttt tattatcagc ctataggaaa 5220 tctgctaaag gcaaatcatt gtggttgcat tagatctatg aaataggata tgactgtgtt 5280 ttatttcgag tccgtgaaaa acatattgct tttcttgaaa atattgagaa cacaagcagg 5340 ttgaaacaca ctgacgatct gtcctcatcg tggtctttta gtgatagaac caggatggaa 5400 agaactgaga ggcacttaag gctatttttg tataaagata ggaaagaatt aaatgctaaaa 5460 gcggaagtaa caaaacatta gcaagtccaa agcctccttg actgaaaaac agtgtctaaa 5520 aggcagacat gatgtaattc aatttgtagt ttctgttacc tccgtgtctg agattgtaga 5580 acgactccac ttctcccctta cagccagatt ctaatattgg tgaccaaatt gcgcgaaatg 5640 cattaatgat gcaattgcca tcttttatcc caaaatttca ttgttgtagc tttcaattaa 5700 gcttcagctt gaaattcagt tcataacagt ggagttcaaa gtgtgccaaa ttaagggtgt 5760 aatctttcat tcatcccatg ttctttcaat tgtactctag ttttcaacta agtttcactt 5820 tgaaatccct tttaatttga cttaaatcat ttggttagtg tacttagaca taataaaata 5880 tgtgttgtag gcatgtgtgg gttcattagt ccttcatcca ccttatgttc tgaatcagtt 5940 agtggtaaat tttgagtcta aaattagttt tcagctgttt gtaatcaata gtttgctata 6000 attttctcgc agaatatatc gatcatgtta ttttttcaac tgagaattac tcattgatgc 6060 ttcactatgg gttaaattac ccaatacacc tttttatccg cttttatttt cttaagtggg 6120 tttcaaaat aattatattc aagctctctt ttgttagttt agtctaggcc aatcttaacc 6180 caaattagtt ggttgcttat caagttttac ctaatgtctt ttttcaggtc attaaagtgg 6240 ctgattttgg tgttgccaga gtgaaggcac aaacaggtgt aatgacggca gaaaccggga 6300 cttatagatg gatggccccg gaggtaggcc tatcattcaa atcttaagat aggaaattta 6360 atccgaaatc tcccaaacca ggcttaagcc ttaagataga agttagttat gagtgagcag 6420 aattttggtg cagatcttaa atttagccat ctatattgtt taggatttag gcggtattaa 6480 ttgattgtac acacagtagt gagtagactg ttgaaggtga tttaagagaa ggaagggatg 6540 gaagaagagg atagaagaga gggagcagtc cttatgtcaa gagggtggag tcttaactaa 6600 gatttgttca ttataagaat tatataatac aaagacgtgt agactctatt tgatctctca 6660 aagaattcga tagcttgtgg taccaattat gaatccattc aaggtaacag cagttgttac 6720 aatggaggct gaaggtacta aagttatgtg tgaaggcaga ccaatacgaa agcaatatgc 6780 gacatggttc ctctaaatag atacagaaag agctacatac atatgatagg tgtagtatca 6840 gaggtatatg ttgcatcata tttaccaaga actagatagc tagtactacc aatcatgact 6900 tgtgttaggt aagagagtct gcaattactg acacaagctt tccttctgga cctccccatc 6960 caaataactc gcgtgagtcc tagataatgt gccgagatgt tacgttatta aattgctgca 7020 tggcaagtct ctagtgatct tggcaaagga tattttgttt ttttagtacc agaattgtgt 7080 gttactagaa tcagagagct gactgtgggg taccttactg caccattttg ggctgcaact 7140 gcataaggga tgagtatcag aaaaagtttt gtgctttcta aagctctaat atcctttctt 7200 gtagattcta gatacaaact tatcaaaaat ggttaaattg ggaacaaaac acagtttatg 7260 atggagcatg agttttctca tatttccata actggaatta gaggcaattg aaactgtacc 7320 ttttagcttt ttcttgtttg aatttgttt cattggagtg ttgtgagata caagcactga 7380 tatcaactct ctgcccagtt gattgatgca caacaacaac aaacccagtg aaggtgtggg 7440 gaggataatg tgtacacaga ccttacccct accccggaag gtcagagagg gagaggttgt 7500 ttctgataga ccctcgacta gagagtagat gaaatgcgct tttaggaat atcacatata 7560 cataagaag cataggccac aagtaagtaac aaaacagta tattaaaaaa ccaaagcgaa 7620 nationalgccaat storm gtaagatag cagtctatga gtaaaggga taccatacta 7680 atactaatgc tataggtctg gaaagaaag agcagcgcgc tcgactccc actagccttc 7740 taccctaata ctcgacctcc acaacctcct atcaagggac atgtccgcag taagctccag 7800 ctgcgtcata tcctgcctaa tcacctcc ccgatactc ttcggcatgc tacccct 7860 cctcataccc attgttgcta accctcaca catcatact ggggcatca tgtttctcct 7920 ttgtccgaac catctcagac tcgcctcccg catattatcc tccacggagg ccactttcgc 7980 cttttctcaa attackccat tcctaatctt atcaatcgg gtatgccccgc acatccattg 8040 caatattctt atttcagcta cttttctt ttggacatga gagttcttga ctggccaaca 8100 ctctactcca tacacatag tcggtctaac caccactcta tagacttac ctttaagttt 8160 taatggaata ttcttac acagacacc ggaagcgaac tccattcat ccaccctgac 8220 acgatacgat gtgtgacatc ctcatcaacc tccctatttc tttgtattat tgacccaaga 8280 tacctaaaac ttactctctt ggggatgact tgtgtatcaa gcctcacctc catgtccgct 8340 tcctgggtta cgtcgttgaa tttgcactct aagtattccg tcttggtcct gctcaacttg 8400 aaacctttag actccagggt ctccctccaa acctacagtc tcttgttaac acctcccaac 8460 gtctcatcaa tcagaacttt gtcattagca aataacatac accatgacac ctcccttgaa 8520 tgtgtcgcgt aggtgcgtct atcaccaagg aaaatagaaa cgggctaaga gctgatccct 8580 ggtgcaactc tatcacaacc agaaagtgtt ccgagtctcc tcccgttgtc ctaaccaggg 8640 tattacctct atcatacatg tccttaatca ccctaatata ggctaccgtg acccctttag 8700 cctccaagca tctccatagc acctccctcg ggactttgtc gtatactttt tctaggtcaa 8760 tgaacatcat atgcaagtcc tttatctccc tatacctctc caccaatctc ctcacgaggt 8820 gagtggcttc cgtagtcgaa cgacccgaca tgaaaccgaa ctggttctca aaaatagata 8880 caactctcct caccctcact tcaccatcc tctcccaaac tttcatcgta tggctggctc 8940 ttaatatgtt gactatagtg gtgatatctt gtgtttttgt tgtttggagt ggcttagaat 9000 tgaggtattt cattggttgt tactggccaa gaggatccag atgtgttagg taactcctag 9060 gtgtcagtgg tgattgatga aatttaatga ggttgagctt atttagtggg tacacgcaat 9120 gctgatcaat gattttatga ctgcttgtat aagatttgtg ttaaaaactc cctgttattt 9180 tgtataagat ttgtgtcatt gtaagcatca ctgcagttgc ttgaatagta attgaactag 9240 atggagcatg ggaagggtta tagaaactcg gccaaaaaca atcagttagt tatttgtgac 9300 agttacttaa atcagttaat gtgcgagtta cttccgttat tttctcaatg agattttata 9360 taactagttg tgcagttagc atggctgcat tggcttattt cagatctttc ttcttgaagg 9420 taatagaaca caagccctac gatcacaaag cagatgtatt cagttttggg gttgtgctat 9480 gggagttgct gacagggaag gtactgatat gtgattggaa atttttgggt tagcccgttt 9540 ttgttggttg ttttcttggt atatacttat attcacttga ttttgtttaa ccagcttcca 9600 tatgagtact tgaccccatt gcaagctgct attggagtgg tccagaaggt aatgcttctt 9660 ttatttgatt ttattttatt tgtaatatcg tatgaccata atggttgatt gcatattgcg cgctcatcac atgcatgcgg gcgcacatag aaaagatatg cacaaatgat ttgatattaa ttttctaatt gctgccaggg tttgcgacca actataccca agcacactcc tcccagactt gctgagctgc tagagacatg ctggcaacaa gacccgacat ccaggcctga cttttctga atagtagata ttttgcagca aatagcaaaa gaggtatttg tctctgctca ggcattggcc agttaataat tattttctt ggtgataaat gtacagtaca cgtcacaaat tggatttact gggatttaaa agggtattga ttttctttgg ccgaacatct tttggtcacg atttacaatt ttctgtcaaa ttgccacctc atgccgata tataaattgt attaatggct ggggaaaaaa gagttcactc tccttgaact tcttaagagt tggcagtccc ttcttcagct tccctagaat aataactatc ctcatttgtg ctttgctttt aatttctcata atttctctgc acacaaagat ggatttaaat attackcgg tgtaacaaag gaagtagttt attackcgg caacactcga catgtgggtc aggttggaga tgaaagagca gatcgttgca aggttggaga agctggagga ttcttttcag cccttagacg tggacatcat tgagtag cacacataca gaatgttgat aaagttttga tttttagcct catttatcca gactgtacag tttttttcca gatcaatgtt cccatggtca aaaggaagtt attattcca attctttgaa caaattcctt tttaagcaa ctttcttttg gcagctccgt cagaagcttt cggagttgga tcaaattag ttatataat tttgcgacta ctccatcaac atcaacatcc acatccacat cattattcat tccccacgat cacgatatgt ttcgtattcc ctgaaagtaa tggtaggttt cccgtatatt gttgtttccg ctttctagtt gttttgcgtg tgtttcactg tttatgtgat atttgacctt 10800 tatatcgtgg ttttaggttt atggcatcga ttatgtgcgc tatgaaaga tgaattttaa actt 10864 <210> 2 <211> 1689 <212> DNA <213> Prescription (Nicotiana tabacum) <400> 2 atggcgatag aggataacga gagttgtggg agtagtgg tggattcggc gactaccagt ggtcgtcatc agagaaaaaa attggaggtc tacaatgagg ttttacggag gcttaagga tcaaacaacg tcgaggcttt agaacctgga tttgacgatg aactttgggc tcacttcaat 180 cgtctaccta ctcggtacgc aatagatgtg aatgtcgaaa gggcagaaga tgtactcaca 240 cacaagcgat tgctacatct tgcacatgtt ccagctaata gacctgcctt tgatgtccgg 300 ttggtgcagg ttgcttcggt tcctgatgga aacttaagag attcttttca ttcgagcttt 360 gcaaagaagg aagttagcag aagtgtccat cctccacctg cctttggttc ttctcctaat 420 ctcgaagccc ttgcttgtga agcaatcaaa tctgaagttc aagacgaaga tactgctgct 480 ccttgtgcaa atttttcgcg gcccatgcat gaaattacat tttcaacaga tgacaagcca 540 aagcttctta gccagttaac ttcattacta gctgagcttg ggctgaacat ccaggaagcg 600 catgcctttt ccactgtgga tggctactcc ctagatgtct ttgttgttga tggttggccc 660 tatgaggaag ttgtgcgact tcgaactgca ttggagaggg aaatcttgag aaatgagaaa 720 tcatggccaa gcccgtcaca atcgttcata aagcaggagc aagacttgat caaacgtgaa 780 tttgaccatt tgacaatacc ttttgatggc attgacgtct gggaaattga tcatcagctt 840 ttaaaatttg aatacaagat tgcatctggt tcatatggtg acttatacaa aggtacatac 900 tgcagtcagg atgtagctat caaaatccta aaatctgagc gcttgaacac agaattgcag 960 acggagtttg cccaagaagt gtatatcatg agaaaagttc gtcacaaaaa tgttgtccaa 1020 ttcatagggg cttgtaccag gcctcccaac ttgtgtatag taacagagta catgtctggg 1080 ggaagcgtat atgactattt acacaaacga aagggcagtt ttaaactacc taccctgctt 1140 aaagtagcga ttgatgtagc taaagggatg aactacctgc atcaaaataa tattatacat 1200 agggacttga aggctgccaa tctactgatg gatgaaaatg aagtcattaa agtggctgat 1260 tttggtgttg ccagagtgaa ggcacaaaca ggtgtaatga cggcagaaac cgggacttat 1320 agatggatgg ccccggaggt aatagaacac aagccctacg atcacaaagc agatgtattc 1380 agttttgggg ttgtgctatg ggagttgctg acagggaagc ttccatatga gtacttgacc 1440 ccattgcaag ctgctattgg agtggtccag aagggtttgc gaccaactat acccaagcac 1500 actcctccca gacttgctga gctgctagag acatgctggc aacaagaccc gacatccagg 1560 cctgactttt ctgaaatagt agatattttg cagcaaatag caaaagaggt tggagatgaa 1620 agagcagatc gttgcaagga gaagtcagct ggaggattct tttcagccct tagacgtgga 1680 catcattga 1689 <210> 3 <211> 562 <212> PRT <213> Tobacco (Nicotiana tabacum) <400> 3 Met Ala Ile Glu Asp Asn Glu Ser Cys Gly Ser Arg Val Val Asp Ser 1 5 10 15 Ala Thr Thr Ser Gly Arg His Gln Arg Lys Lys Leu Glu Val Tyr Asn 20 25 30 Glu Val Leu Arg Arg Leu Lys Glu Ser Asn Asn Val Glu Ala Leu Glu 35 40 45 Pro Gly Phe Asp Asp Glu Leu Trp Ala His Phe Asn Arg Leu Pro Thr 50 55 60 Arg Tyr Ala Ile Asp Val Asn Val Glu Arg Ala Glu Asp Val Leu Thr 65 70 75 80 His Lys Arg Leu Leu His Leu Ala His Val Pro Ala Asn Arg Pro Ala 85 90 95 Phe Asp Val Arg Leu Val Gln Val Ala Ser Val Pro Asp Gly Asn Leu 100 105 110 Arg Asp Ser Phe His Ser Ser Phe Ala Lys Lys Glu Val Ser Arg Ser 115 120 125 Val His Pro Pro Pro Ala Phe Gly Ser Ser Pro Asn Leu Glu Ala Leu 130 135 140 Ala Cys Glu Ala Ile Lys Ser Glu Val Gln Asp Glu Asp Thr Ala Ala 145 150 155 160 Pro Cys Ala Asn Phe Ser Arg Pro Met His Glu Ile Thr Phe Ser Thr 165 170 175 Asp Asp Lys Pro Lys Leu Leu Ser Gln Leu Thr Ser Leu Leu Ala Glu 180 185 190 Leu Gly Leu Asn Ile Gln Glu Ala His Ala Phe Ser Thr Val Asp Gly 195 200 205 Tyr Ser Leu Asp Val Phe Val Val Asp Gly Trp Pro Tyr Glu Glu Val 210 215 220 Val Arg Leu Arg Thr Ala Leu Glu Arg Glu Ile Leu Arg Asn Glu Lys 225 230 235 240 Ser Trp Pro Ser Pro Ser Gln Ser Phe Ile Lys Gln Glu Gln Asp Leu 245 250 255 Ile Lys Arg Glu Phe Asp His Leu Thr Ile Pro Phe Asp Gly Ile Asp 260 265 270 Val Trp Glu Ile Asp His Gln Leu Leu Lys Phe Glu Tyr Lys Ile Ala 275 280 285 Ser Gly Ser Tyr Gly Asp Leu Tyr Lys Gly Thr Tyr Cys Ser Gln Asp 290 295 300 Val Ala Ile Lys Ile Leu Lys Ser Glu Arg Leu Asn Thr Glu Leu Gln 305 310 315 320 Thr Glu Phe Ala Gln Glu Val Tyr Ile Met Arg Lys Val Arg His Lys 325 330 335 Asn Val Val Gln Phe Ile Gly Ala Cys Thr Arg Pro Pro Asn Leu Cys 340 345 350 Ile Val Thr Glu Tyr Met Ser Gly Gly Ser Val Tyr Asp Tyr Leu His 355 360 365 Lys Arg Lys Gly Ser Phe Lys Leu Pro Thr Leu Leu Lys Val Ala Ile 370 375 380 Asp Val Ala Lys Gly Met Asn Tyr Leu His Gln Asn Asn Ile Ile His 385 390 395 400 Arg Asp Leu Lys Ala Ala Asn Leu Leu Met Asp Glu Asn Glu Val Ile 405 410 415 Lys Val Ala Asp Phe Gly Val Ala Arg Val Lys Ala Gln Thr Gly Val 420 425 430 Methionine Threonine Alanine Glutamic acid Threonine Glycine Threonine Tyrosine Arginine Tryptophan Methionine Alanine Proline Glutamic acid Valine Isoleucine 435 440 445 Glutamic acid Histidine Lysine Proline Tyrosine Aspartic acid Histidine Lysine Alanine Aspartic acid Valine Phenylalanine Serine Phenylalanine Glycine Valine 450 455 460 Valine Leucine Tryptophan Glutamic acid Leucine Leucine Threonine Glycine Lysine Leucine Proline Tyrosine Glutamic acid Tyrosine Leucine Threonine 465 470 475 480 Proline Leucine Glutamine Alanine Alanine Isoleucine Glycine Valine Valine Glutamine Lysine Glycine Leucine Arginine Proline Threonine 485 490 495 Isoleucine Proline Lysine Histidine Threonine Proline Proline Arginine Leucine Alanine Glutamic acid Leucine Leucine Glutamic acid Threonine Cysteine 500 505 510 Tryptophan Glutamine Glutamine Aspartic acid Proline Threonine Serine Arginine Proline Aspartic acid Phenylalanine Serine Glutamic acid Isoleucine Valine Aspartic acid 515 520 525 Isoleucine Leucine Glutamine Glutamine Isoleucine Alanine Lysine Glutamic acid Valine Glycine Aspartic acid Glutamic acid Arginine Alanine Aspartic acid Arginine 530 535 540 Cysteine Lysine Glutamic acid Lysine Serine Alanine Glycine Glycine Phenylalanine Phenylalanine Serine Alanine Leucine Arginine Arginine Glycine 545 550 555 560 Histidine Histidine <210> 4 <211> 300 <212> DNA <213> Tobacco (Nicotiana tabacum) <400> 4 aacaggtgta atgacggcag aaaccgggac ttatagatgg atggccccgg aggtaataga 60 acacaagccc tacgatcaca aagcagatgt attcagtttt ggggttgtgc tatggggagtt 120 gctgacaggg aagcttccat atgagtactt gaccccattg caagctgcta ttggagtggt 180 ccagaagggt ttgcgaccaa ctatacccaa gcacactcct cccagacttg ctgagctgct 240 agagacatgc tggcaacaag acccgacatc caggcctgac ttttctgaaa tagtagatat 300 <210> 5 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Primer sequences <400> 5 tgagtaaggt taccgaattc 20 <210> 6 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Primer sequences <400> 6 ctcgaggccc gggcatgtcc 20

Claims

1. A method for regulating the alkaloid content of a tobacco plant or part thereof, the method comprising modifying the plant by modulating the activity or expression of a protein kinase, the protein kinase: a) consisting of the amino acid sequence shown in SEQ ID No. 3; or b) encoded by the nucleotide sequence shown in SEQ ID No. 1 or 2; The alkaloid whose content is adjusted is one or more alkaloids selected from nicotine, anabasine and anatabine, and wherein: i) the activity or expression of the protein kinase is increased and the alkaloid content of the tobacco plant is reduced compared to a tobacco plant that has not been modified to modulate the activity or expression of the protein kinase; or ii) the activity or expression of the protein kinase is reduced and the alkaloid content of the tobacco plant is increased compared to a tobacco plant which has not been modified to modulate the activity or expression of the protein kinase.

2. Use of a gene encoding a protein kinase for regulating the alkaloid content of a tobacco plant or part thereof or a tobacco cell or cell culture; wherein the protein kinase: a) consisting of the amino acid sequence shown in SEQ ID No. 3; or b) encoded by the nucleotide sequence shown in SEQ ID No. 1 or 2; The alkaloid whose content is adjusted is one or more alkaloids selected from nicotine, anabasine and anatabine, and wherein: i) the activity or expression of the protein kinase is increased and the alkaloid content of the tobacco plant or cell culture is reduced, compared to a tobacco plant or cell culture that has not been modified to modulate the activity or expression of the protein kinase; or ii) the activity or expression of the protein kinase is reduced and the alkaloid content of the tobacco plant or cell culture is increased, compared to a tobacco plant or cell culture which has not been modified to modulate the activity or expression of the protein kinase.

3. A method for producing a tobacco plant or part thereof or a tobacco cell or cell culture having a modulated alkaloid content, the method comprising modifying the tobacco plant or part thereof or the tobacco cell or cell culture to modulate the activity or expression of a protein kinase, the protein kinase: a) consisting of the amino acid sequence shown in SEQ ID No. 3; or b) encoded by the nucleotide sequence shown in SEQ ID No. 1 or 2; The alkaloid whose content is adjusted is one or more alkaloids selected from nicotine, anabasine and anatabine, and wherein: i) the activity or expression of the protein kinase is increased and the alkaloid content of the tobacco plant or cell culture is reduced, compared to a tobacco plant or cell culture that has not been modified to modulate the activity or expression of the protein kinase; or ii) the activity or expression of the protein kinase is reduced and the alkaloid content of the tobacco plant or cell culture is increased, compared to a tobacco plant or cell culture which has not been modified to modulate the activity or expression of the protein kinase.

4. The method of claim 3, wherein the tobacco plant part is a leaf.

5. The method of claim 4, wherein the blade is a machined blade.

6. The method of claim 4, wherein the leaves are cut harvested leaves.

7. A tobacco cell or cell culture which has been modified to achieve modulation in alkaloid content compared to an unmodified tobacco cell culture, wherein the modification is modulation of the activity or expression of a protein kinase which: a) consisting of the amino acid sequence shown in SEQ ID No. 3; or b) encoded by the nucleotide sequence shown in SEQ ID No. 1 or 2; wherein the alkaloid whose content is adjusted is one or more alkaloids selected from nicotine, anabasine and anatabine, and wherein: i) the activity or expression of the protein kinase is increased and the alkaloid content of the tobacco cell culture is decreased, compared to a tobacco cell culture that has not been modified to modulate the activity or expression of the protein kinase; or ii) the activity or expression of the protein kinase is reduced and the alkaloid content of the tobacco cell culture is increased compared to a tobacco cell culture that has not been modified to modulate the activity or expression of the protein kinase.

8. The method or use according to any one of claims 1 to 6, or the tobacco cell or cell culture according to claim 7, wherein the content of one or more alkaloids selected from nicotine, anabasine and anatabine is reduced.

9. The method or use according to claim 8, or the tobacco cell or cell culture according to claim 8, wherein the nicotine content is reduced.

10. (1) Use of a tobacco cell or cell culture according to any one of claims 7 to 9 for growing plants; or (2) Use of a modified tobacco plant or part thereof or a modified tobacco cell or cell culture for growing plants, characterized in that: The modified tobacco plant or modified tobacco cell culture has a modulated alkaloid content compared to an unmodified tobacco plant or unmodified tobacco cell culture, wherein the modification is modulation of the activity or expression of a protein kinase that: a) consisting of the amino acid sequence shown in SEQ ID No. 3; or b) is encoded by the nucleotide sequence as shown in SEQ ID No. 1 or 2, wherein: i) the activity or expression of the protein kinase is increased and the alkaloid content of the tobacco plant or cell culture is reduced, compared to a tobacco plant or cell culture that has not been modified to modulate the activity or expression of the protein kinase; or ii) the activity or expression of the protein kinase is reduced and the alkaloid content of the tobacco plant or cell culture is increased, compared to a tobacco plant or cell culture that has not been modified to modulate the activity or expression of the protein kinase; The alkaloid whose content is regulated is one or more alkaloids selected from nicotine, anabasine and anatabine.

11. (1) Use of a tobacco cell or cell culture according to any one of claims 7 to 9 for producing a product; or (2) Use of a modified tobacco plant or part thereof or a modified tobacco cell or cell culture for producing a product, characterized in that: The modified tobacco plant or modified tobacco cell culture has a modulated alkaloid content compared to an unmodified tobacco plant or unmodified tobacco cell culture, wherein the modification is modulation of the activity or expression of a protein kinase that: a) consisting of the amino acid sequence shown in SEQ ID No. 3; or b) is encoded by the nucleotide sequence as shown in SEQ ID No. 1 or 2, wherein: i) the activity or expression of the protein kinase is increased and the alkaloid content of the tobacco plant or cell culture is reduced, compared to a tobacco plant or cell culture that has not been modified to modulate the activity or expression of the protein kinase; or ii) the activity or expression of the protein kinase is reduced and the alkaloid content of the tobacco plant or cell culture is increased, compared to a tobacco plant or cell culture that has not been modified to modulate the activity or expression of the protein kinase; The alkaloid whose content is regulated is one or more alkaloids selected from nicotine, anabasine and anatabine.

12. (1) Use of a tobacco cell or cell culture according to any one of claims 7 to 9 for growing crops; or (2) Use of a modified tobacco plant or part thereof or a modified tobacco cell or cell culture for growing crops, characterized in that: The modified tobacco plant or modified tobacco cell culture has a modulated alkaloid content compared to an unmodified tobacco plant or unmodified tobacco cell culture, wherein the modification is modulation of the activity or expression of a protein kinase that: a) consisting of the amino acid sequence shown in SEQ ID No. 3; or b) is encoded by the nucleotide sequence as shown in SEQ ID No. 1 or 2, wherein: i) the activity or expression of the protein kinase is increased and the alkaloid content of the tobacco plant or cell culture is reduced, compared to a tobacco plant or cell culture that has not been modified to modulate the activity or expression of the protein kinase; or ii) the activity or expression of the protein kinase is reduced and the alkaloid content of the tobacco plant or cell culture is increased, compared to a tobacco plant or cell culture that has not been modified to modulate the activity or expression of the protein kinase; The alkaloid whose content is regulated is one or more alkaloids selected from nicotine, anabasine and anatabine.

13. (1) Use of a tobacco cell or cell culture according to any one of claims 7 to 9 for producing leaves; or (2) Use of a modified tobacco plant or part thereof or a modified tobacco cell or cell culture for producing leaves, characterized in that: The modified tobacco plant or modified tobacco cell culture has a modulated alkaloid content compared to an unmodified tobacco plant or unmodified tobacco cell culture, wherein the modification is modulation of the activity or expression of a protein kinase that: a) consisting of the amino acid sequence shown in SEQ ID No. 3; or b) is encoded by the nucleotide sequence as shown in SEQ ID No. 1 or 2, wherein: i) the activity or expression of the protein kinase is increased and the alkaloid content of the tobacco plant or cell culture is reduced, compared to a tobacco plant or cell culture that has not been modified to modulate the activity or expression of the protein kinase; or ii) the activity or expression of the protein kinase is reduced and the alkaloid content of the tobacco plant or cell culture is increased, compared to a tobacco plant or cell culture that has not been modified to modulate the activity or expression of the protein kinase; The alkaloid whose content is regulated is one or more alkaloids selected from nicotine, anabasine and anatabine.

14. Non-viable harvested leaves from a modified tobacco plant as defined in any one of claims 10-13, or from a tobacco plant propagated from propagation material obtained from a modified tobacco plant as defined in any one of claims 10-13, or from a tobacco plant obtained by the use according to any one of claims 2 or 10-13, or from a tobacco plant produced by the method of any one of claims 1, 3-6 or 8-9.

15. The non-viable harvested leaves according to claim 14, wherein the harvested leaves of the plant are cut harvested leaves.

16. Non-viable processed blades, which: Obtained from a tobacco plant obtained from the use according to any one of claims 2 or 10-13; Obtained by processing a modified tobacco plant as defined in any one of claims 10 to 13; A tobacco plant derived from plant propagation material obtained from a modified tobacco plant as defined in any one of claims 10 to 13; Obtained by processing non-viable harvested leaves according to claim 14 or 15; or Obtained from a tobacco plant produced by the method of any one of claims 1, 3-6 or 8-9.

17. Non-viable processed leaves according to claim 16, wherein the leaves are processed by curing, fermenting, pasteurizing or a combination thereof.

18. A non-viable processing blade according to claim 16 or 17, wherein the processing blade is a cut processing blade.

19. Cured tobacco material made from: A modified tobacco plant or part thereof, or extract thereof, having a modulated alkaloid content compared to an unmodified tobacco plant, wherein the modification is the modulation of the activity or expression of a protein kinase, said protein kinase: a) consisting of the amino acid sequence shown in SEQ ID No. 3; or b) encoded by the nucleotide sequence as shown in SEQ ID No. 1 or 2, wherein the alkaloid whose content is regulated is one or more alkaloids selected from nicotine, anabasine and anatabine, and wherein: i) the activity or expression of the protein kinase is increased and the alkaloid content of the tobacco plant is reduced compared to a tobacco plant that has not been modified to modulate the activity or expression of the protein kinase; or ii) the activity or expression of the protein kinase is reduced and the alkaloid content of the tobacco plant is increased compared to a tobacco plant which has not been modified to modulate the activity or expression of the protein kinase.

20. A tobacco blend comprising the cured tobacco material of claim 19.

21. Tobacco industry products prepared from: (1) A tobacco cell or cell culture according to any one of claims 7 to 9; (2) A modified tobacco plant or part thereof having a modulated alkaloid content compared to an unmodified tobacco plant, wherein the modification is the modulation of the activity or expression of a protein kinase, wherein the protein kinase: a) consisting of the amino acid sequence shown in SEQ ID No. 3; or b) encoded by the nucleotide sequence shown in SEQ ID No. 1 or 2; in: i) the activity or expression of the protein kinase is increased and the alkaloid content of the tobacco plant is reduced compared to a tobacco plant that has not been modified to modulate the activity or expression of the protein kinase; or ii) the activity or expression of the protein kinase is reduced and the alkaloid content of the tobacco plant is increased compared to a tobacco plant that has not been modified to modulate the activity or expression of the protein kinase; (3) tobacco plants or parts thereof propagated from tobacco plant propagation material obtained from the modified tobacco plants of (2); (4) non-viable harvested leaves of a tobacco plant or tobacco plant part according to claim 14 or 15; or (5) A non-viable machined blade according to any one of claims 16-18.

22. The tobacco industry product according to claim 21, wherein the tobacco industry product is a combustible smoking article.

23. The tobacco industry product according to claim 21, wherein the tobacco industry product is a smokeless tobacco product.

24. The tobacco industry product according to claim 21, wherein the tobacco industry product is a non-combustible gas aerosol supply system comprising a modified tobacco plant or part thereof.

25. The tobacco industry product according to claim 24, wherein the non-combustible gas aerosol supply system is a tobacco heating device or an aerosol generating device comprising a modified tobacco plant or tobacco plant part as defined in claim 21.

26. Combustible smoking articles, non-combustible gas aerosol delivery systems, smokeless tobacco products, or tobacco heating devices, including: (1) A modified tobacco plant or tobacco plant part, cell or cell culture as defined in any one of claims 10 to 13, or an extract thereof; (2) The tobacco cell culture according to any one of claims 7 to 9; (3) a cured tobacco material according to claim 19; or (4) The tobacco blend according to claim 20.

27. A method for producing a mutant tobacco plant carrying a heritable mutation in a nucleotide sequence a) encodes the amino acid sequence shown in SEQ ID No. 3; or b) consisting of the sequence shown in SEQ ID No. 1 or 2; wherein the heritable mutation modulates the activity or expression of a gene encoding a protein kinase, and wherein the mutant tobacco plant has a modulated alkaloid content relative to an unmodified tobacco plant that does not carry the heritable mutation; The alkaloid whose content is adjusted is one or more alkaloids selected from nicotine, anabasine and anatabine, and wherein: i) the activity or expression of the protein kinase is increased and the alkaloid content of the mutant tobacco plant is reduced compared to a tobacco plant that has not been modified to modulate the activity or expression of the protein kinase; or ii) the activity or expression of the protein kinase is reduced and the alkaloid content of the mutant tobacco plant is increased compared to a tobacco plant that has not been modified to modulate the activity or expression of the protein kinase.

28. Non-viable harvested leaves, processed leaves or cured tobacco material produced from a tobacco plant comprising a modification in a nucleotide sequence, said nucleotide sequence: a) encodes the amino acid sequence shown in SEQ ID No. 3; or b) consisting of the sequence shown in SEQ ID No. 1 or 2; wherein the modification modulates the activity or expression of a gene encoding a protein kinase, and wherein a tobacco plant carrying the modification has a modulated alkaloid content relative to an unmodified tobacco plant not carrying the modification in the protein kinase; The alkaloid whose content is adjusted is one or more alkaloids selected from nicotine, anabasine and anatabine, and wherein: i) the activity or expression of the protein kinase is increased and the alkaloid content of the tobacco plant is reduced compared to a tobacco plant that has not been modified to modulate the activity or expression of the protein kinase; or ii) the activity or expression of the protein kinase is reduced and the alkaloid content of the tobacco plant is increased compared to a tobacco plant which has not been modified to modulate the activity or expression of the protein kinase.

Images