L2A5 antibody against tumor antigen or its functional fragment

Abstract

This invention provides antibodies or functional antibody fragments or probes thereof targeting a unique set of antigens recognized in cancer. The invention comprises a nucleotide sequence derived from the L2A5 monoclonal antibody. The antibodies or functional antibody fragments or probes thereof include variable heavy chain domains and variable light chain domains having the amino acid sequences provided herein. The DNA / amino acid sequence binding is unique and has never been previously described. The invention further provides antibodies or functional antibody fragments or conjugates or recombinant proteins useful for the detection, treatment, and prevention of human diseases, including cancer.

Description

Technical Field

[0001] The present invention provides an antibody or functional antibody fragment or probe thereof that targets a group of antigens recognized in cancer. Background Technology

[0002] Sialyl Tn (STn) is a short O-glycan antigen composed of a disaccharide, Neu5Acα-2,6GalNAc, linked to N-acetylgalactosamine. It is sequentially O-linked to serine or threonine residues in the polypeptide chain via the GalNAc residue in the alpha configuration. Its relevance is related to the fact that it is absent in normal healthy tissue but detected at varying frequencies in almost all types of cancer (Julien, Videira, and Delannoy, 2012). Furthermore, STn is a target of metastatic, drug-resistant, and highly malignant cancer cells. Their activation characteristics include:

[0003] 1) The relationship between STn expression and the tumor formation and metastasis ability of human cancer cells and cancer initiation cells (Okasaki et al., 2012).

[0004] 2) The association between STn and poor patient prognosis, reduced overall survival and lack of response to chemotherapy (Choi et al., 2000) and 3) evasion of immune protection (Carrascal et al., 2014).

[0005] α-2,6-sialic acid is often a biomarker for terminating cancer. Short α-2,6-sialylated O-glycans are overexpressed in several types of cancer. They are commonly associated with cancer progression and metastasis. Furthermore, they can contribute to immune evasion by being recognized by various immune receptors, such as sialic acid-binding proteins (Siglecs) (Crocker, Paulson, & Varki, 2007; Nicoll et al., 2003).

[0006] Therefore, this invention provides antibodies, functional antibody fragments, or probes that specifically bind to cancer biomarkers. In addition to specifically recognizing tumor cells, these antibodies also have the potential to block host cell receptors from recognizing these ligands, which are involved in fundamental mechanisms of tumor progression, including immune tolerance.

[0007] A number of antibodies have been approved for the treatment of cancer patients (https: / / www.cancer.org / ). These include:

[0008] 1. Monoclonal antibodies (mAbs) targeting cancer-specific (associated) antigens. The recombinant humanized mAb anti-HER2 trastuzumab (Herceptin™) has been described in various scientific publications, such as Cancer Res., 1998, 58:2825-2831. It targets the HER2 receptor, expressed in nearly 30% of breast cancer patients. Patent document WO0105425 describes an antitumor composition comprising alkylating anthracycline conjugated with anti-HER2 trastuzumab. However, these treatments are only effective in a small number of patients (30% of breast cancer patients). Furthermore, the HER2 protein targeted by the trastuzumab antibody is also expressed in related normal cells such as heart cells, illustrating associated cardiotoxicity. This invention allows for the development of recombinant antibodies targeting a broader list of receptors beyond HER2, expressed by different types of cancer, modified by STn or a group of glycans capped with α-2,6-sialic acid. This has the potential to lead to the development of treatments for a broader cancer patient population. Since both STn and the α-2,6-sialic acid-terminated glycan are highly overexpressed in cancer cells, it also has the potential for higher specificity and reduced toxicity.

[0009] 2. Blocking MAbs (molecules that prevent the immune system from functioning). These are called immune checkpoint inhibitors and include drugs that block CTLA-4, PD-1, and PD-L1. Examples of PD-1 inhibitors are pembrolizumab (Keytruda) and nivolumab (Opdivo), which are approved for the treatment of melanoma, non-small cell lung cancer, kidney cancer, bladder cancer, head and neck cancer, and Hodgkin's lymphoma. However, immune checkpoint inhibitors do not provide an immediate anti-tumor response and are often used as adjuvant therapy. Similarly, immune checkpoint inhibitors can cause the immune system to attack certain normal organs in the body, leading to serious side effects in some people.

[0010] 3. Drugs that block cellular signaling pathways essential for cancer cell division. These include bevacizumab (Avastin), which targets vascular endothelial growth factor (VEGF), an inhibitor of angiogenesis. ) and cetuximab (Erbitux), an antibody that targets a cellular protein called epidermal growth factor receptor (EGFR). EGFR is important for cell growth. However, antibodies that block cell signaling can also affect physiological mechanisms and are associated with toxicity, such as hypertension, hemorrhage, thrombosis, and kidney damage.

[0011] Some patent documents (EP 2014302 A1; WO 2015053871 A4; US 7423126 B2; EP2993184 A1) claim protection for nucleic acids encoding human antibodies that encode tumor-associated carbohydrate antigens; however, the antibodies in the aforementioned patent documents do not recognize STn antigens, which are the targets of the antibodies of this invention.

[0012] Patent application EP2680004(A2) claims protection for an antibody against sialylated glycans comprising STn antigens containing N-acetylneuraminic acid (NeuAc) or N-glycolylneuraminic acid (NeuGc), while the present invention relates to an antibody targeting an STn antigen primarily having NeuAc and a group of glycans capped by α-2,6 sialic acid.

[0013] Patent applications WO 1998046246 A1 and WO 1995029927 A3 claim methods for generating α-O-linked glycoconjugates or glycosides of tumor-associated carbohydrate antigens, including 2,6-sialic acid T antigen. While mentioning the possibility of developing antibodies for cancer treatment, none of these patent applications provide antibody sequences for detecting 2,6-sialic acid T antigen, nor do they provide a group of related 2,6-sialic acid-containing antigens relevant to the subject matter of this patent.

[0014] Several patent applications have claimed protection for antibodies that bind to sialic acid residues, such as CA 2743032 A1, characterized by an IgM antibody recognizing sialic acid residues (including NeuGc), or US 20160184450 A1 and US 8148335 B2, which claim protection for antibodies that specifically bind to deN-acetylated sialic acid, or EP 2302390 A1 and US 20120142903 A1 patent applications, which include antibodies recognizing NeuGc structures; while the present invention claims protection for an antibody that not only recognizes NeuAc (STn antigen) bound to GalNAc, but also recognizes the NeuAc structure in a group of glycans capped by α-2,6-linked sialic acid.

[0015] Patent application EP 2261255 A1 describes the production of antibodies that recognize the monosaccharide NeuAc in chickens, and patent application US20110034676 A1 claims protection for the production and purification of polyclonal antibodies against both the Neu5Ac and Neu5Gc structures. However, this invention claims protection for nucleic acids encoding mAbs produced in mice that target oligosaccharide STn antigens and a group of glycans capped with α-2,6-linked sialic acid. This is advantageous because the invention would allow for the differentiation of tumor-associated glycans, not just the monosaccharide NeuAc, which is also expressed in normal cells.

[0016] Furthermore, US patent application 2010 / 0034825 A1 claims protection for using long Tn- or STn-MUC1 tandem repeat glycopeptides to generate antibodies against the MUC1 glycoprotein through immunization. This work differs from the present invention because the target structure is different; that is, the target is the MUC1 glycoprotein rather than a glycan structure, and STn is not an α-2,6-linked sialic acid-terminated glycan.

[0017] The patented antibody WO2016057916A1 recognizes the STn antigen instead of a glycan capped with α-2,6-linked sialic acid.

[0018] As described above, because tumor antigens are co-expressed in normal cells, they are generally not tumor-specific. Therefore, targeted therapies often exhibit associated toxicity due to off-target effects. Tumor antigens are not pan-tumor antigens and are limited to specific types or grades of cancer. Therefore, targeted therapies are typically limited to specific subsets of cancers.

[0019] Therefore, there is a need to develop antibodies or functional antibody fragments or their probes that target a unique set of antigens that are only recognized in cancer cells.

[0020] Unique nucleic acid sequences allow for the generation of antibodies or functional antibody fragments or their probes to target sialylated glycans such as STn, 2,6-sialic acid T, disialyl acid T, and 2,6-sialic acid-N-acetyllactosamine, which are overexpressed in different types and subtypes of cancer cells.

[0021] This invention relates to nucleotide sequences encoding mAbs that are anti-STn and a group of glycans capped by α-2,6-linked sialic acid. These antigens are short-chain glycans that are overexpressed in cancer but not in normal cells. These antigens are also ligands for immune receptors and attenuate the activity of the immune system against tumor cells, and therefore can also be considered ligands for immune checkpoints. Summary of the Invention

[0022] Monoclonal antibodies (mAbs) are antibodies produced by a single B cell clone. MAbs can also be produced by hybridomas, which are hybrids between B cells and myeloma cells, or cell lines expressing recombinant DNA encoding the heavy and light chains of immunoglobulins, thus producing single and specific antibodies.

[0023] The antibody is expressed in the extracellular environment and then purified from there.

[0024] Antibody specificity is its ability to react with an antigen or group of antigens that share a specific epitope. An epitope, also known as an antigenic determinant, is the part of an antigen that is recognized by an antibody.

[0025] Antibodies belong to the immunoglobulin class of proteins; they consist of two identical heavy chains. and two identical light chains Assembly. At the amino terminus of each heavy or light chain, there is a sequence of 100-130 amino acids that encodes the variable region. At the carboxyl terminus of each heavy or light chain, there is a sequence that encodes the constant region.

[0026] Each antibody binds to the same antigen twice, which means it is bivalent.

[0027] An antigen-binding fragment (Fab) is an antibody fragment that binds to an antigen. Each Fab includes a constant domain and a variable domain from each heavy and light chain of the antibody. The crystallizable fragment (Fc) region includes two or three domains at the carboxyl termini of both heavy chains. The Fab ensures that, upon binding to the antigen, the Fc region ensures that each antibody produces an effector immune response. The Fc region binds to various cellular receptors (e.g., Fc receptors) and other molecules (e.g., complement proteins), mediating various physiological functions, including opsonization to promote phagocytosis by phagocytes, cell lysis by natural killer cells, and degranulation by mast cells, basophils, and eosinophils.

[0028] The term "variable domain" or "variable region" refers to the amino-terminal portion of the light or heavy chain of an antibody that interacts with an antigen. It has a length of approximately 120 to 130 amino acids in the heavy chain and approximately 100 to 110 amino acids in the light chain. The sequence of each variable region is substantially different, particularly in the complementarity-determining regions (CDRs) responsible for interacting with a specific antigen. Flanked by the CDRs are the less variable framework regions (FRs). Each light and heavy chain has three CDRs. CDRs L1, L2, and L3 are located in the light chain. CDRs H1, H2, and H3 are located in the heavy chain.

[0029] The term "functional antibody fragment or probe" refers to a portion of an antibody that includes variable regions of both the heavy and light chains of the antibody, or either variable regions of the heavy chain or variable regions of the light chain. The functional antibody fragment or probe retains most or all of the binding activity of the original antibody derived from it. Such functional antibody fragments or probes may include single-chain Fv (scFv), biantibodies, triantibodies, tetra-chain antibodies, and microantibodies.

[0030] The term "nucleotide sequence" refers to a sequence of nucleotides of any length, which are deoxyribonucleotides or ribonucleotides or their analogues.

[0031] The nucleotide sequence can be transcribed to produce mRNA, which can then be translated into polypeptides and / or fragments thereof.

[0032] Potential therapeutics derived from this invention refer to their use in treating, managing, or improving diseases associated with STn or a group of α-2,6-sialylated glycan expression. In this embodiment, possible therapeutics refer to antibodies, functional antibody fragments, or probes derived from this invention in natural or modified forms.

[0033] Possible treatments may also be combined with agents known to be useful or already or currently used to treat, control or improve diseases, as included in this invention.

[0034] Potential uses as diagnostic agents refer to substances that, when administered to a subject, will aid in the diagnosis of a disease. Such substances can be used to detect and / or define the localization of a disease originating from a process of disease progression. It also includes substances that can help predict response to a particular therapy or disease prognosis. In some embodiments, the use of a diagnostic agent means the conjugation of the antibody or functional antibody fragment or probe of the present invention with a reporter molecule, such as a fluorescent agent, enzyme, or secondary antibody.

[0035] Sialic acid Tn, also known as STn, sialylated Tn, Neu5Ac-α2,6GalNAcα-O-Ser / Thr, or CD175s by the "cluster of differentiation" nomenclature, is the simplest sialylated mucin-type O-glycan. STn is a truncated O-glycan containing sialic acid (Neu5Ac) α-2,6 linked (through C6) N-acetyl-galactosamine (GalNAc) α-O linked serine / threonine (Ser / Thr) (Neu5Ac-α2,6GalNAcα-O-Ser / Thr). Sialization prevents the formation of various core structures that would otherwise be present in mucin-type O-glycans.

[0036] STn is associated with adverse outcomes and poor prognosis in cancer patients. The biosynthesis of STn antigen has been linked to the expression of sialyltransferase ST6GalNAc1 and mutations or loss of heterozygosity in the COSMC gene.

[0037] STn is expressed in more than 80% of human cancers and is associated with poor prognosis in cancer patients.

[0038] This invention provides nucleotide sequences encoding antibody heavy chains or light chains or functional antibody fragments or probes thereof, wherein the antibody heavy chains or light chains or functional antibody fragments or probes thereof encoded by the nucleotide sequences of this invention have one or more CDRs listed in Tables 1 and 2. Antibodies or functional antibody fragments or probes thereof comprising one or more CDRs can specifically bind to STn or a group of α-2,6-sialylated glycans. Specific binding includes specificity, affinity, and / or avidity as provided in Example I.

[0039] In another aspect, the antibodies or functional fragments thereof encoded by the polynucleotides of the present invention may include complement-dependent cytotoxic activity and / or antibody-dependent cell-mediated cytotoxicity (ADCC) activity.

[0040] A method for generating antibodies of the present invention may include fusing two cells that generate hybridomas, introducing the nucleotide sequence of the present invention into a host cell, culturing the host cell under certain conditions and for a sufficient time to generate the heavy chain and / or light chain of the antibody or functional fragment of the present invention encoded therein, and purifying the heavy chain and / or light chain of the antibody or functional fragment.

[0041] Recombinant expression of the antibodies or functional antibody fragments or probes thereof of the present invention that bind to STn or a group of α-2,6 sialylated antigens may include constructing an expression vector comprising a heavy chain and / or a light chain encoding the antibodies or functional antibody fragments or probes thereof of the present invention.

[0042] The vector can be produced using recombinant DNA technology. The vector may also include other encoding nucleotide sequences to produce chimeric sequences. For example, it may include nucleotide sequences encoding constant regions of antibody molecules (WO 86 / 05807 and WO 89 / 01036) enabling the expression of chimeric proteins containing the amino acid sequence of the antibodies, functional antibody fragments, or probes thereof of the present invention, followed by the entire heavy chain, or the light chain, or both the entire heavy chain and the light chain.

[0043] Expression vectors can be transferred into host cells using transfection / transduction techniques, and the resulting cells produce the antibodies or functional fragments thereof of the present invention. Therefore, the present invention includes host cells containing nucleotide sequences encoding the antibodies or functional antibody fragments of the present invention or probes thereof.

[0044] Host cells can be selected to modify the characteristics of products derived from the inserted nucleotide sequence.

[0045] In one embodiment, these host cells can add glycosylation or phosphorylation sites or other modifications to the encoded protein. In another embodiment, the host cells can provide proper protein processing and cellular transport / secretion.

[0046] Single-chain fragment variable antibody (scFv) refers to a functional antibody fragment containing only the VL and VH regions, which are linked by a linker to form a monovalent antigen-binding site. Biantibodies, triantibodies, and tetraantibodies are dimers, trimers, or tetramers of scFv, respectively, containing two, three, and four polypeptide chains, forming two, three, and four antigen-binding sites, which may be the same or different.

[0047] The resulting antibodies, functional antibody fragments, or probes of the present invention may have one or more binding sites. If more than one binding site is included, these sites may be the same as or different from each other. In the case of two different binding sites, the antibody, functional antibody fragment, or probe is referred to as a "bispecific" antibody.

[0048] Site-directed mutagenesis leading to amino acid substitutions and PCR-mediated mutagenesis can be used to introduce affinity-enhancing mutations into the CDR region while preserving the specificity of the antibodies of this invention.

[0049] In some embodiments, the antibodies, functional antibody fragments, or probes of the present invention are conjugated or fused with one or more diagnostic or therapeutic agents or any other desired molecules. The resulting conjugated antibodies, functional antibody fragments, or probes are useful in monitoring or diagnosing the onset, development, progression, and / or severity of diseases associated with the expression of STn or α-2,6-sialylated glycans.

[0050] For example, but not limited to, antibodies can bind to therapeutic agents to induce cell killing or other effects. Therapeutic agents can be chemotherapeutic drugs; paclitaxel; antimetabolites, alkylating agents, antibiotics, antimitotic agents, hormones, nucleoside analogs, kinase inhibitors, radioactive metal ions, toxins, cytokines, or antiangiogenic agents.

[0051] Using classic immunohistochemical methods or immunoassays, such as enzyme-linked immunosorbent assay (ELISA) and radioimmunoassay (RIA), flow cytometry, and Western blotting, the antibodies or functional fragments of the present invention can also be used to detect the expression of STn or α-2,6-sialylated glycans in any biological sample.

[0052] The antibodies, functional antibody fragments, or probes thereof of the present invention can be provided at effective concentrations, either individually included in, combined with, or in combination with a pharmaceutical composition, to produce a therapeutically useful effect with minimal side effects. Summary of the Invention

[0054] This invention provides antibodies, functional antibody fragments, or probes thereof that specifically bind to sialic acid Tn (STn) and a group of sialic acid-terminated glycans linked by α2,6-linked sialic acid.

[0055] Antibodies, functional antibody fragments, or their probes bind to antigen-binding sites. Examples of nucleotide sequences encoding variable heavy and light chains are SEQ ID No. 1 and SEQ ID No. 2, respectively.

[0056] Antibodies were obtained by immunizing mice with mucin containing sialic acid Tn (STn). The nucleotide sequences were derived from the L2A5 monoclonal antibody. One nucleotide sequence provides a variable heavy (VH) chain (SEQ ID No. 1) and contains H-CDR1 (GGCTACTCCATCACCAGTGGTTATTAC, amino acid SEQ ID No. 12), H-CDR2 (ATAAACTACGACGGTAGCAAT, amino acid SEQ ID No. 14), and H-CDR3 (GCAAGAGGGGGGGACTAC, amino acid SEQ ID No. 16). One nucleotide sequence provides a variable light (VL) chain (SEQ ID No. 2) containing complementarity-determining regions (CDRs): L-CDR1 (TCAAGTGTAAGTTAC, amino acid SEQ ID No. 6), L-CDR2 (GACACATCC, amino acid SEQ ID No. 8), and L-CDR3 (CAGCAGTGGAGTAGTGACCCACCCATGCTCACG, amino acid SEQ ID No. 10).

[0057] The combination of the light chain L-CDR1, L-CDR2, and L-CDR3 with the heavy chain H-CDR1, H-CDR2, and H-CDR3 produces a unique sequence that encodes a peptide sequence that not only recognizes the disaccharide STn antigen, but also, unexpectedly, recognizes a group of α-2,6-sialic acid-terminated glycans that are also overexpressed in cancer. These peptide sequences are used to generate other antibodies, functional antibody fragments, or probes. The entire glycan group recognized by said antibodies, functional antibody fragments, or probes includes...

[0058] Sialic acid Tn:

[0059] NeuAcα-6GalNAcα / β1-

[0060] 2,6-Sialic acid T:

[0061]

[0062] Disialic acid T:

[0063]

[0064] 2,6-Sialo-N-acetyllactosamine:

[0065] NeuAcα2-6Galβ1-4Glcβ1-

[0066] In contrast to current antibody and antibody-based anticancer therapies, antibodies with this specificity are of particular interest due to their high tumor specificity and low or no reactivity to normal cells.

[0067] The isolated polynucleotides of the present invention may also include the nucleic acid sequences provided herein, wherein the nucleic acid sequences encode variable heavy and light chain domains of antibodies, functional antibody fragments, or probes. Examples of the nucleic acid sequences are SEQ ID No. 1 and SEQ ID No. 2, respectively.

[0068] In another aspect, the present invention provides an antibody, functional antibody fragment, or probe thereof that specifically binds to STn and a group of glycans capped by α2,6-linked sialic acid for detecting tumors in a subject.

[0069] In some embodiments, the present invention provides pharmaceutical compositions comprising the antibodies, functional antibody fragments or probes of the present invention, and pharmaceutically acceptable carriers.

[0070] In another embodiment, the present invention provides a pharmaceutical composition comprising an antibody, a functional antibody fragment, or a probe that blocks cell-cell or receptor-ligand interactions.

[0071] In some embodiments, the present invention provides a method for treating or preventing a disease in a subject in need by administering a therapeutically effective amount of the pharmaceutical composition of the present invention.

[0072] This disclosure is not intended to be limited thereto, but is presented with accompanying drawings illustrating the embodiments for easier understanding. Attached Figure Description

[0073] Figure 1 The titration and binding of L2A5 antibody to animal mucins using an indirect ELISA are shown. Antibody titration was performed using various coated concentrations of bovine submaxillary mucins (BSM) previously treated with or untreated with sialidase. Phosphate-buffered saline was used as a negative control, and binding of anti-STn antibody B72.3 to BSM was used as a positive control. Binding of L2A5 mAb was detected using goat anti-mouse IgG bound to horseradish peroxidase.

[0074] Figure 2The binding of L2A5 to the cell surface of tumor cells is shown. L2A5 antibody binding was assessed by flow cytometry using cancer cell lines transduced or untransduced (wild-type) with ST6GalNAc1 gene and therefore overexpressing the STn antigen. The figure shows a representative histogram of L2A5 antibody relative cell counts in the STn-positive and WT breast cancer cell line MDA-MB-231. 3F1 antibody (anti-STn antibody) or secondary anti-mouse Ig-FITC antibody (grey outline) was used. To assess the binding specificity to the sialylated antigen, STn-expressing cell lines were desialylated by sialidase treatment. Solid and dashed lines represent histograms of untreated and treated cells, respectively. The X-axis represents fluorescence associated with STn expression.

[0075] Figure 3 The reactivity of L2A5 antibody with membrane-bound proteins and recombinant human mucin 1 (MUC1) was demonstrated. Western blot analysis showed the binding of anti-STn antibody 3F1 and L2A5 to membrane extracts from the STn-expressing MDA-MB-231 cell line and to MUC1 chimeric protein heavily modified with STn-added Ig Fc regions. MDA-MB-231STn + Membrane extracts (A) and chimeric protein MUC1 STn-IgG (B) were stained with 3F1 and L2A5 antibodies. In addition to the untreated membrane extracts and the blotting of the chimeric protein (NT), the membrane extract samples were desialylated using sialidase (T) or unglycosylated MUC1STn-IgG protein (Ung).

[0076] Figure 4 The reactivity of L2A5 antibodies, measured by immunohistochemistry, in paraffin-embedded bladder cancer is shown. a) L2A5 (left) staining exhibits high extension and strong intensity, while B72.3 (middle) and TKH2 (right) mAbs, which bind only to STn, show lower sensitivity, transducing with weak intensity and reduced extension of specific staining. b) Sensitivity of L2A5 compared to available antibodies. L2A5 (left) recognizes reduced amounts of antigen (arrow), unlike B72.3 (middle) and TKH2 (right), which have different reactivity in the same region. c) The role of sialidase treatment in antibody reactivity in cancer tissue. After treatment with sialidase and incubation with L2A5, the staining conferred by L2A5 completely disappears. Left: without sialidase; Right: with sialidase.

[0077] Figure 5This figure shows the reactivity of L2A5 antibody measured by immunohistochemistry in paraffin-embedded colorectal cancer. The graph illustrates the reactivity of L2A5 compared to antibodies against the STn antigen. L2A5 (left) exhibits increased reactivity in terms of extension and intensity compared to B72.3 (middle) and TKH2 (right).

[0078] Figure 6 The reactivity of the L2A5 antibody was demonstrated by immunohistochemistry in paraffin-embedded bladder cancer. The figure shows immunohistochemical evidence of the high specificity of the L2A5 antibody compared to B72.3 and TKH2 anti-STn antibodies. a) – Tumor specificity of L2A5 in metastatic bladder cancer samples. L2A5 is predominantly present in tumor cells (arrows), with no staining in lymphocyte populations, blood vessels, and connective tissue. b) – Reactivity of L2A5 (left) and B72.3 (right) antibodies in normal colorectal tissue. L2A5 shows weak reactivity with intestinal epithelial cells (arrow, left), while B72.3 reacts with goblet cells (right).

[0079] Figure 7 The sequence of the glycan antigen that binds to the L2A5 antibody is shown. The specificity of the glycan is determined by glycan microarray analysis.

[0080] Figure 8 The in vivo target module (TM) demonstrates antitumor activity, comprising a moiety containing amino acids encoded by the target L2A5 of this invention. The L2A5-derived TM is an antibody fragment and possesses the same reactivity as L2A5, namely, an anti-STn TM. Killing STn-positive cells by UniCAR T cells is target-specific and strictly dependent on the presence of the TM.

[0081] Figure 9 The in vivo target module (TM) demonstrated antitumor activity, comprising a moiety containing amino acids encoded by the target L2A5 of this invention. The L2A5-derived TM is an antibody fragment and possesses the same reactivity as L2A5, namely, anti-STn TM. Adoptive transfer of anti-STn TM and UniCAR T cells (Koristka et al. 2014) into animal models expressing STn+ tumors showed effective and TM-dependent eradication of STn-positive tumors. Figure 8This study demonstrated the use of UniCAR T cells equipped with a TM specific for the STn antigen to kill tumor cells. Statistical analysis was performed using one-way ANOVA and the Bonferroni multiple-comparison test (**p<0.01). Detailed Implementation

[0082] This invention provides antibodies, functional antibody fragments, or probes thereof that specifically bind to STn and a group of sialic acid-terminated polysaccharides linked to α2,6-.

[0083] The antibody, functional antibody fragment, or their probe binds to the antigen-binding site. Examples of nucleotide sequences encoding variable heavy and light chains are SEQ ID No. 1 and SEQ ID No. 2, respectively.

[0084] The isolated polynucleotides of the present invention may also include the nucleic acid sequences provided herein, wherein the nucleic acid sequences encode the variable heavy and light chain domains of antibodies, functional antibody fragments or probes.

[0085] The present invention also provides compositions for producing antibodies, functional antibody fragments or probes thereof that specifically bind to STn and a group of sialic acid-terminated polysaccharides linked to α2,6-linked.

[0086] The composition includes a nucleotide sequence encoding an antigen-binding site for an antibody, functional antibody fragment, or probe. The composition also includes nucleotide sequences encoding variable heavy and light chains.

[0087] The isolated polynucleotides of the present invention may also include the nucleic acid sequences provided herein, wherein the nucleic acid sequences encode variable heavy chain and light chain domains of antibodies, functional antibody fragments or probes.

[0088] In another aspect, the present invention provides an antibody, functional antibody fragment, or probe thereof that specifically binds to STn and a group of glycans capped by α2,6-linked sialic acid for detecting tumors in a subject.

[0089] In some embodiments, the present invention provides pharmaceutical compositions comprising a nucleotide sequence encoding an antibody, functional antibody fragment, or probe of the present invention, and a pharmaceutically acceptable carrier.

[0090] In another embodiment, the present invention provides a pharmaceutical composition comprising a nucleotide sequence encoding an antibody, a functional antibody fragment, or a probe that blocks cell-cell or receptor-ligand interactions.

[0091] In some embodiments, the present invention provides a method for treating or preventing a disease in a subject in need by administering a therapeutically effective amount of the pharmaceutical composition of the present invention.

[0092] The method includes the following steps:

[0093] a) Staining biological samples obtained from subjects who may have tumors with antibodies that specifically bind to STn and a group of glycans capped by α2,6-linked sialic acid, wherein the staining is performed under conditions suitable for the specific binding of the antibody or functional antibody fragment or their probe to STn, 2,6-sialic acid T, disialic acid T or 2,6-sialic acid lactosamine.

[0094] b) The presence or absence of antibody binding indicates the presence or absence of tumor cells expressing cell surface STn, 2,6-sialic acid T, disialinate T, or 2,6-sialic acid lactosamine.

[0095] As used in this article, biological samples contain isolated proteins from cells, tissues, or tumors.

[0096] Sialidized glycans (STn) are overexpressed in several types of cancer cells compared to matched healthy cells, while their expression is negligible in matched healthy cells. The highest STn frequency was found in pancreatic, colorectal, and ovarian cancers, where almost 100% of cancer cells express STn (Julien et al., 2012). The frequency was 75% in bladder cancer (Ferreira et al., 205). Expression was close to 80% in lung adenocarcinoma, and between 50% and 70% in cervical, cholangiocarcinoma, esophageal, colon, and breast cancers. Furthermore, STn overexpression occurs early in carcinogenesis, and loss of cell differentiation, often involved in higher histological grades, positively regulates STn expression (Julien et al.).

[0097] Sialidized glycans can be targeted with high affinity and specificity by antibodies, functional antibody fragments, or probes. This invention also provides compositions for producing antibodies, functional antibody fragments, or probes that bind to STn and are capped with α-2,6-sialic acid to a group of glycans.

[0098] These compositions were obtained by immunizing 6-week-old female Balb / c mice with ovine serum mucins, using, for example, the method described in Example I.

[0099] Mouse serum that is reactive to STn-positive cell lines, STn-positive mucins, or cell lysates is selected using the methods described, for example, in Example II, Example III, or Example VI. Spleen cells from those immunized mice that show STn-reactive serum are collected and fused with myeloma cells (Sp2 / O) to obtain immortalized hybridoma cells expressing antibodies.

[0100] Methods of hybridoma technology, such as those described in Example IV, have been well described in the art.

[0101] Hybridoma supernatants containing anti-STn antibodies were screened using methods such as those described in Example II, Example III, or Example VI. The selected hybridomas were then expanded for antibody production and characterization.

[0102] From the several anti-STn mAb samples obtained, mAb L2A5 was selected as the primary candidate and used for further analysis.

[0103] By using the methods described in Example II and Figure 1 The method described in the study determined the reactivity of mucins with high STn content and the antibody titer of L2A5 mAb. Furthermore, desialylation was performed by sialidase treatment to assess the recognition of sialylated structures by the L2A5 antibody. Figure 1 As shown, the reactivity of L2A5 mAb increases logarithmically with mAb concentration. High immunoreactivity to BSM was observed, reaching an endpoint titer of 6,000. Furthermore, treatment with sialidase clearly demonstrated a decrease in the antibody's reactivity to BSM, showing a specific and dependent binding to the sialylated structure. Notably, when the method was similar to that described in Example II, but in which the STn-containing mucin was replaced by desialylated (asialized) mucin, the L2A5 antibody did not show reactivity.

[0104] Sialidized glycans are overexpressed in cancer cells and can be targeted with high affinity and specificity by antibodies, functional antibody fragments, or probes.

[0105] The present invention provides compositions for producing antibodies, functional antibody fragments, or probes thereof that bind to STn and a group of polysaccharides capped with α-2,6-sialic acid.

[0106] Glycosylation is crucial for the quality and development of therapeutic mAbs. Glycosylation patterns vary depending on the chosen expression system or culture conditions, significantly impacting their pharmacokinetics and pharmacodynamics. Therefore, control of glycosylation is essential to ensuring the safety and efficacy of the molecule. For therapeutic cancer cell targeting, antibody-dependent cell-mediated cytotoxicity (ADCC), complement-dependent cytotoxicity (CDC), antibody-dependent cell-mediated phagocytosis (ADCP), and direct cell apoptosis are crucial for therapeutic efficacy.

[0107] MAb produced in the mouse myeloma cell line SP2 / 0 can add sugars that cannot be naturally found on normal human IgG, thereby affecting immunogenicity.

[0108] In an embodiment of the present invention, in order to improve the efficacy of therapeutic antibodies, the glycan composition of IgG molecules is altered at glycosylation sites Asn88 and Asn297 by manipulating mannose, sialic acid, fucose and galactose residues (Liming Liu's comment, 2015).

[0109] In one embodiment, a nonhuman antibody can be humanized, which refers to the construction of a chimeric immunoglobulin containing an amino acid sequence of interest derived from a native nonhuman antibody (e.g., a mouse antibody) contained within a human immunoglobulin (receptor antibody). In a humanized antibody, the CDR amino acid residues of the human antibody are replaced by residues from the CDR of a nonhuman species (e.g., a mouse antibody) having the desired specificity, affinity, and capability. Typically, a humanized antibody will contain at least one, and usually two, variable domains, where all or almost all of the CDR regions correspond to the CDR regions of the nonhuman antibody, while all or part of the FR regions are regions of the human immunoglobulin.

[0110] In one embodiment, immune cells, such as T cells, are modified to express antibodies (fully or partially) or receptors that bind antibodies, namely chimeric antigen receptors (CARs). A CAR is a molecule that specifically binds an antibody against a desired antigen (e.g., a tumor antigen) to an intracellular domain that activates a T cell receptor to produce a chimeric receptor that exhibits specific anti-tumor cellular immune activity. In one embodiment, the antigen recognition domains of these modified T cells bind to tumor-associated antigens. In one embodiment, it involves adoptive cell transfer of CAR-modified T cells.

[0111] CARs can be produced using a variety of techniques known in the art, including but not limited to the use of RNA-guided endonucleases, particularly the Cas9 / CRISPR system, to specifically engineer T cells to express CARs (WO 2014191128 A1). In another embodiment, a target module is used consisting of a binding moiety specific to certain human cell surface proteins and a tag, wherein the tag is derived from any human nuclear protein, preferably from human nuclear La protein (WO2016030414 A1).

[0112] Similarly, the antibodies or functional fragments of the present invention can be linked to nanoparticles and inserted into liposome membranes to serve as specific carriers for in situ delivery of apoptosis-inducing toxic compounds and metal ions useful for hyperthermia therapy.

[0113] The compositions of the present invention for the production of antibodies, functional antibody fragments, or probes thereof were obtained by immunizing 6-week-old female Balb / c mice with sheep serum mucin, using the method described in Example I. Mouse sera showing reactivity to STn-positive cell lines, STn-positive mucin, or cell lysates were selected by methods such as those described in Example II, Example III, or Example VI. To obtain immortalized hybridoma cells expressing anti-STn antibodies, spleen cells from those immunized mice showing STn-responsive sera were collected and fused with myeloma cells. Methods of hybridoma technology, such as those described in Example IV, are well described in the art.

[0114] The hybridoma supernatant containing anti-STn antibodies was screened using methods such as those described in Example II, Example III, or Example VI. The selected hybridomas were then expanded for antibody production and characterization.

[0115] From the several anti-STn mAb samples obtained, mAb L2A5 was selected as the primary candidate and used for further analysis.

[0116] By using the methods described in Example II and Figure 1 The method described in the study determined the reactivity of mucins with high STn content and the antibody titer of L2A5 mAb. Furthermore, desialylation was performed by sialidase treatment to assess the recognition of sialylated structures by the L2A5 antibody. Figure 1 As shown, the reactivity of L2A5 mAb increases logarithmically with mAb concentration.

[0117] High immunoreactivity to BSM was observed, reaching a endpoint titer of 6,000. Furthermore, treatment with sialidase clearly demonstrated a decrease in the antibody's reactivity to BSM, showing a specific and dependent binding to the sialylated structure. Notably, when the method was similar to that described in Example II, but in which the STn-containing mucin was replaced by desialylated (asialized) mucin, the L2A5 antibody showed no reactivity.

[0118] The binding of L2A5 mAb to live MDA-MB-231 cancer cells was confirmed using the method described in Example III. As a model, MDA-MB-231 cancer cells expressing the STn antigen were used due to the overexpression of the ST6GalNAc1 gene. Figure 2 As shown, L2A5 mAb accounts for 80% to 88% of STn + The cells exhibited high reactivity. Treatment of the cancer cell lines with sialidase significantly reduced reactivity. Furthermore... Figure 2 As shown, L2A5 did not bind to wild-type MDA-MB-231 cancer cells that did not express STn antigen. In summary, these results confirm the specificity and selectivity of L2A5 mAb for STn antigen present on the surface of cancer cells. Similarly, as... Figure 2 As shown, other anti-STn antibodies also react with STn and are associated with the cancer cell line MDA-MB-231, exhibiting slightly different binding profiles.

[0119] To confirm the binding specificity of L2A5 mAb to STn-bearing membrane proteins, the assays described in Example VI were performed. Figure 3As shown, L2A5 mAb reacts with proteins derived from the MDA-MB-231 cell line overexpressing ST6GalNAc1, and therefore reacts with STn. The figure shows the reactivity to proteins with molecular weights greater than 245 kDa and approximately 160, 85, 50, and 40 kDa. Decreased or eliminated reactivity was observed after desialylation of the membrane protein, confirming the binding of L2A5 mAb to sialylated proteins. Membrane proteins from wild-type cancer cells do not express the STn antigen and do not react positively with L2A5 mAb. Similarly, as shown... Figure 3 As shown, L2A5 exhibited strong binding to MUC1 STn-IgG (approximately 180 kDa), but did not bind to unglycosylated MUC1 STn-IgG. In summary, the results indicate that L2A5 mAb recognizes STn antigens in membrane extracts of STn-expressing cancer cells and on STn carrier proteins (e.g., MUC1).

[0120] A series of 30 cases, including 15 bladder tumors (eight cystectomies and seven metastases) and 15 colorectal tumors (adenocarcinoma and adenoma), were stained using L2A5 and two anti-STn mAbs. Figure 4 As shown, for metastatic cases, all bladder tumors were positive for all analyzed mAbs. For L2A5, B72.3, and TKH2 mAbs, three were positive and three were negative. One case showed reduced staining with L2A5, while the other mAbs showed no staining. Note that the antigen detection sensitivity against L2A5 is slightly higher. Figure 4 As shown, although TKH2 and B72.3 exhibited similar reactivity, L2A5 showed higher reactivity in bladder cancer cases. This specificity and sensitivity were eliminated after enzymatic treatment of cancer tissue with sialidase.

[0121] like Figure 5 As shown, all colorectal cancer cases were positive for both anti-STn mAb and L2A5, but exhibited different patterns in terms of extension and intensity. Compared to the B72.3 (middle) or TKH2 (right) staining patterns, L2A5 (left) binding showed similar intensity and extension in most pathological tissues (approximately 70%).

[0122] like Figure 6 As shown in a), in metastatic bladder cancer samples, L2A5 primarily reacts with tumor cells, but not with lymphocyte populations, blood vessels, or connective tissue. Figure 6 In b), in normal colorectal cancer tissue, L2A5 (left) shows nonspecific staining in intestinal epithelial cells, while B72.3 (right) reacts with goblet cells.

[0123] In bladder tumor models, L2A5 staining indicates the exclusion of tumors. L2A5 exhibits specific staining in urothelial tumor cells, including low-density STn infiltration and other spots at metastatic sites.

[0124] In colorectal samples, L2A5 reacts with cancerous tissue but also with non-pathological tissue. Staining is primarily located in intestinal epithelial cells, while nonspecific staining is observed in goblet cells obtained with B72.3 or TKH2. No specific staining location is observed in colorectal samples, although weak staining of L2A5 is detectable in dysplastic tissues.

[0125] To examine the specificity of carbohydrate binding in more detail, antibodies were analyzed using a glycan microarray comprising structurally diverse glycan probes printed on a suitable solid surface. The results confirmed the specificity of selective recognition of STn, but binding with the following substances was also observed:

[0126] Sialic acid Tn:

[0127] NeuAcα-6GalNAcα1 / β1

[0128] 2,6-Sialic acid T:

[0129]

[0130] 2-Sialic acid T:

[0131]

[0132] 2,6-Sialyllactosamine:

[0133] NeuAcα2-6Galβ1-4Glcβ1

[0134] Furthermore, it does not actually bind to other antigen sequences present in the microarray. The binding sequences are summarized in... Figure 7 middle.

[0135] To determine the amino acid sequences of the variable regions CDR (SEQ ID Nos. 6, 8, 10, 12, 14, 16) and FR (SEQ ID Nos. 5, 7, 9, 11, 13, 15) of the light and heavy chains of L2A5 mAb, the method described in Example IX was used.

[0136] Example

[0137] The following examples are provided only to illustrate various aspects of this disclosure and should not be construed as limiting this disclosure in any way. They relate to the characterization, selection, and production of antibodies.

[0138] Example I

[0139] Antibody production - immunization

[0140] An exemplary method for generating antibodies is provided, but any other standard method can be used.

[0141] Monoclonal antibody (mAb) production was performed using hybridoma technology. Six-week-old female Balb / c mice (Harlan, UK) were immunized intraperitoneally with 10 μg of ovine submaxillary mucin (OSM) emulsified at a 1:1 (V / V) ratio with complete Freund's adjuvant (Sigma-Aldrich), followed by two additional injections of OSM emulsified with incomplete Freund's adjuvant (Sigma-Aldrich) at 21-day intervals. Blood samples were collected from the mice's cheeks, and the STn binding specificity of the collected serum was screened by ELISA. If the serum showed the desired and specific immune response, a final booster injection was given to the corresponding mice three days before culling and harvesting the spleen.

[0142] Example II

[0143] ELISA method

[0144] Mouse serum titration and screening of hybridoma supernatants were performed using an ELISA targeting bovine submaxillary mucin (BSM), a protein expressing STn. 50 μl of BSM (3 μg / ml) dissolved in phosphate-buffered saline (PBS) was coated into the wells of a 96-well plate and incubated overnight at 4°C. To assess the specific binding of the screened hybridoma supernatant to sialylated structures, 50 μl of sialidase from *Clostridium perfringens* (Roche) was diluted at 25 mU / ml in sialidase buffer (10 mM Na2HPO4, pH 6.0) and added to the well subset, and incubated at 37°C for 90 min. After sialidase treatment, the plate was washed three times with PBS containing 0.05% Tween 20 (PBS-T) and then blocked with 5% skim milk powder for 60 min. After washing with PBS-T, diluted mouse serum or hybridoma supernatant was added to the wells and incubated for 90 minutes. The plate was washed four times with PBS-T and then incubated for 60 minutes with horseradish peroxidase (HRP)-conjugated goat anti-mouse Ig (1:1000) (BD Pharmingen). After three additional washing steps, 50 μl of tetramethylbenzidine (Thermofisher Scientific) substrate was added to each well, the plate was incubated in the dark, and the reaction was terminated by adding 50 μl of 1M HCl. The optical density was measured at 450 nm using a microplate reader. Mice producing the highest titer of antibody of interest were selected for fusion. The same procedure was performed to screen for antibody production in hybridoma cells.

[0145] Example III

[0146] Preparation and analysis of flow cytometry

[0147] Binding of antibodies or hybridoma supernatants was determined by flow cytometry using parental cell lines that stably express and do not express STn. Approximately 3 × 10⁶ cells were collected under each condition. 5Cells were selected and resuspended in PBS buffer. To assess the specific binding of the selected hybridoma supernatant and antibodies to sialylated structures, samples were treated with 100 mU / ml sialidase at 37°C for 90 min. After sialidase treatment, cells were washed and incubated with anti-STn mAb B72.3, 3F1, TKH2, and hybridoma supernatant at 4°C for 30 min. Subsequent washing was performed, and the primary antibody was detected in the dark for 15 min with FITC-bound anti-mouse Ig (Dako; dilution 1:10). After washing, data for each sample were acquired using flow cytometry.

[0148] Example IV

[0149] Antibody production - hybridoma technology

[0150] Spleen cells from immunized mice were mixed with Sp2 / 0 myeloma (ATCC, USA) cells at a 3:1 ratio and fused using a standard protocol in the presence of polyethylene glycol / dimethyl sulfoxide. The cells were then plated into 96-well flat-bottom microplates (Orange Scientific) and maintained in HAT supplemented (1×10⁻⁶). -4 M hypoxanthine, 4×10 - 7 M-aminopterin, 1.6 × 10 -5 Hybridoma cells were incubated in RPMI medium containing 10% FBS, 2mM L-glutamine, 0.2mg / ml gentamicin (Sigma-Aldrich), 1mM sodium pyruvate (Gibco), and 1% (v / v) MEM non-essential amino acids (Gibco) at 37°C for 7–12 days. Hybridoma cells producing antibodies against BSM were amplified and screened by indirect ELISA, and cloned at least three times using limiting dilutions to obtain stable monoclonal cell lines. Selected hybridomas were cultured in HAT-free selection medium at 37°C. One hybridoma, L2A5, specific to sialylated structures, particularly STn, was selected and cloned using four limiting dilutions.

[0151] Example V

[0152] Immunohistochemical analysis of STn expression

[0153] According to the local ethics committee, a series of 30 cases were obtained, including 15 cases of colorectal tumors (adenocarcinoma and adenoma) and 15 cases of bladder tumors (eight cystectomies and seven metastases). Additionally, five cases included normal colorectal tissue adjacent to the tumors. Formalin-fixed, paraffin-embedded (FFPE) tissues were screened for STn using immunohistochemistry (IHC) with the biotin / streptavidin system. Briefly, FFPE tissue sections were deparaffinized with xylene, rehydrated with a series of graded alcohol washes, preheated at maximum power rating for 5 minutes, and then subjected to heat-induced antigen retrieval for 15 minutes in a microwave-safe solution of citrate buffer (Vector, Burlingame, USA) at pH 6.0. The sections were then incubated with 0.3% hydrogen peroxide (MerckKGaA, Darmstadt, Germany) for 25 minutes and then UV-treated. (Thermo Scientific, Fremont, USA) blocked and incubated overnight in a humidified chamber at 4°C with anti-STn mAb B72.3, TKH2 (Kjeldsen et al., 1988), and L2A5. After washing with PBS-Tween, the secondary antibody was added to the tissue sections, followed by incubation with streptavidin. This was achieved by contacting 3,3'-diaminobenzidine (ImmPACT) TM STn was observed by incubation with DAB (Vector, Burlingame, USA) for 4 minutes. Finally, the nuclei were counterstained with hematoxylin for 1 minute. STn expression was assessed using anti-STn mAb B72.3, TKH2, and L2A5 hybridoma culture supernatants diluted 1:5; and in 5% BSA in PBS at dilutions of 1:5 and 1:3, respectively. Positive and negative control sections were tested in parallel. Negative control sections did not contain primary antibody. + Tumor tissue was used as a positive control. Tumors were classified as positive when immunoreactivity with anti-STn TKH2 antibodies was observed through the microscopic presence of brown stained products in tumor cells. STn expression and L2A5 staining were assessed in a double-blind manner by two independent observers and validated by an experienced pathologist. Whenever there was disagreement, the slides were reviewed and consensus was reached. To assess antibody specificity, sialidase treatment was performed after incubation with hydrogen peroxide, in which sialic acid was removed from the STn antigen, thereby impairing antibody recognition. Therefore, positive staining following this enzymatic treatment (4 h at 37°C; 0.2 U / mL) was considered nonspecific.

[0154] Example VI

[0155] Western blot (WB)

[0156] Membrane proteins were isolated from the cell line using a membrane protein extraction kit, following the manufacturer's instructions. The amount of protein obtained was estimated using a protein analysis kit, as recommended by the manufacturer. The membrane protein extract (50 μg) or purified protein containing STn (1 μg) – BSM and MUC1 STn-IgG – was denatured and loaded onto an 8% gradient acrylamide gel. SDS-PAGE electrophoresis was performed under reducing conditions, followed by electrophoresis transfer to a polyvinylidene fluoride (PVDF) membrane (Amersham Hybond P 0.2 μm PVDF, GE Healthcare Life Sciences) according to standard procedures. The membrane was blocked with 10% skim milk in 0.1% TBS Tween (TBS-T) for 1 h, then incubated overnight at 4°C with the supernatant containing anti-STn B72.3, 3F1, or L2A5 primary antibody diluted in TBS-T. After washing with TBS-T, the labeled protein was visualized using HRP-bound goat anti-mouse Ig diluted 1:2500 in TBS-T for 1 h. After washing, the labeled protein was revealed by Lumi-Light protein blot substrate (Roche) and then exposed to X-ray film.

[0157] Example VII

[0158] mRNA isolation and cDNA synthesis

[0159] 1×10 6 and 5×10 6 Hybridoma cells were used for RNA isolation. Cells were centrifuged at 300×g for 5 minutes, and the supernatant was discarded. Cell clumps were washed with PBS and treated with GenElute according to the manufacturer's instructions. TM Total RNA was isolated using a mammalian total RNA micro-preparation kit (Sigma-Aldrich). The extracted total RNA was quantified using nanodroplets, with a maximum of 2 μg used for reverse transcription, as described in the high-capacity cDNA transcription kit (Applied Biosystems). cDNA synthesis was performed using the following thermal cycling conditions: 25 °C for 10 min, then 37 °C for 120 min and 85 °C for 5 s. The reaction was finally held and cooled to 4 °C.

[0160] Example VIII

[0161] Antibody sequencing – scFv fragment

[0162] Use primer pair V HPositive (TTTTTGGATCCSARGTNMAGCTGSAGSAGTCWGG) / V H Reverse (ATTGGGACTAGTTTCTGCGACAGCTGGATT) and V L Positive (TTTTTGAATTCTGAYATTGTGMTSACMCARWCTMCA) / V L The variable weight (V) of L2A5MAb was amplified from cDNA in reverse (TTTTTGGGCCCGGATACAGTTGGTGCAGCATC). H ) and light chains (V L The reaction was performed using the Advantage HF 2PCR kit (Clontech). The following thermal cycling conditions were used: initial melting at 94°C for 3 min, followed by 45°C for 45 s, 70°C for 1 min, and 68°C for 2 min. The reaction was then held at 68°C for 5 min and cooled to 4°C. The purified PCR products were further cloned into the pGEM-Teasy (Promega) cloning vector according to the manufacturer's protocol. The plasmid was isolated using the QIAGEN plasmid addition midi kit (QIAGEN) according to the manufacturer's protocol. Sequencing was performed by Seqlab (Göttingen, Germany) using the T7 promoter primers of the pGEM-Teasy vector.

[0163] These compositions can be produced with consistent quality for clinical and diagnostic applications.

[0164] Example IX

[0165] Antibody domain

[0166] The variable heavy chain (VH) and light chain (VL) nucleotide sequences encoding the L2A5 mAb FR and CDR domains were identified by searching the IMGT-V domain partitioning system (international ImMunoGeneTics database; http: / / imgt.cines.fr) using the sequence analysis tool IgBLAST.

[0167] Example X

[0168] Nucleic acid cloning into the target module

[0169] The anti-STn target module (TM) was prepared as described in (Cartellieri et al., 2016), but the CDR region was replaced with the LA25 nucleic acid sequence. T cell-mediated tumor killing was measured using a standard chromium release assay. MDA-MB-231 and MCR STn+ cell lines were co-incubated with T cells transplanted with vector controls (vector backbone encoding only EGFP marker protein), UniCAR Stop structures (lacking intracellular signal transduction domains), or α-E5B9 signal transduction structures (UniCAR 28 / ζ) (Mitwasi 2017). Both cell lines were cultured with their respective genetically engineered T cells for 24 hours in the presence or absence of 80 nM anti-STn TM (α-STn TM) at an effector-to-target (E:T) ratio of 5:1.

[0170] Example XI

[0171] In vivo anti-tumor activity

[0172] MDA-MB-231STn cells were transduced to express firefly luciferase (Luc) to generate MDA-MB-231STn-Luc cells. The anti-STn target module (TM) was then implemented as described (Cartellieri et al., 2016), but the CDR region was replaced with the LA25 nucleic acid sequence. 1.5 × 10⁻⁶ cells were injected into each mouse. 6 Tumor cells and 1×10 6 UniCAR 28 / ζT cells and 10 μg anti-STn™ were mixed. Individual MDA-MB-231STn-Luc cells (1.5 × 10⁻⁶) were also mixed. 6 ) or with 1×10 without TM 6 UniCAR 28 / ζT cell hybrids of MDA-MB-231STn-Luc cells were used as an untreated control. The respective mixtures were subcutaneously injected into female NMRI-Foxn1nu / Foxn1nu mice, resulting in three groups of five mice each. Starting from day 0, and then on days 1, 3, 6, and 8, luminescence imaging was performed on anesthetized mice 10 minutes after intraperitoneal injection of 200 μL of D-luciferin potassium salt (15 mg / mL).

[0173] This invention will provide new products in the antibody market and the field of cancer research / development.

[0174] The present invention provides compositions for producing an antibody or functional antibody fragment or probe thereof against a group of antigens recognized in cancer.

[0175] Table 1 shows examples of the nucleotide sequences of the variable heavy (VH) chain and variable light (VL) chain of clone L2A5 identified as SEQ ID No. 1 and SEQ ID No. 2, respectively, and examples of the amino acid sequences encoding the variable heavy (VH) chain and variable light (VL) chain identified as SEQ ID Nos. 3 and 4, respectively.

[0176] Table 1 shows examples of the nucleotide sequences and encoded amino acid sequences of the variable light (VL) and variable heavy (VH) chains of clone L2A5.

[0177] SEQ ID No. Chain (mu) 1 Nucleotide sequence of variable heavy (VH) chain 2 nucleotide sequence of variable light (VL) chain 3 The amino acid sequence of the VH chain 4 The amino acid sequence of the VL chain

[0178] Table 2 shows the encoding amino acid sequences of the six frameworks (FRs) and six complementarity-determining regions (CDRs) (H-CDR1, H-CDR2 and H-CDR3, L-CDR1, L-CDR2, LCDR3) of clone L2A5 and the nucleotide sequences identified as SEQ ID NO: 5 to SEQ ID NO: 16.

[0179] Table 2: Encoding amino acid sequences of the three frameworks (FRs) and three complementarity-determining regions (CDRs) (H-CDR1, H-CDR2 and H-CDR3, L-CDR1, L-CDR2, LCDR3) of clone L2A5.

[0180] SEQ ID No. area 5 L-FR1 amino acid sequence 6 L-CDR1 amino acid sequence 7 L-FR2 amino acid sequence 8 L-CDR2 amino acid sequence 9 L-FR3 amino acid sequence 10 L-CDR3 amino acid sequence 11 H-FR1 amino acid sequence 12 H-CDR1 amino acid sequence 13 H-FR2 amino acid sequence 14 H-CDR2 amino acid sequence 15 H-FR3 amino acid sequence 16 H-CD3 amino acid sequence

Claims

1. An antibody comprising a combination of a light chain variable region (VL) and a heavy chain variable region (VH), wherein: The VL includes complementary determination regions (CDRs) L-CDR1, L-CDR2, and L-CDR3, as shown in SEQ ID No. 6, SEQ ID No. 8, and SEQ ID No. 10, respectively; and The VH includes complementary determination regions (CDRs) H-CDR1, H-CDR2, and H-CDR3, as shown in SEQ ID No. 12, SEQ ID No. 14, and SEQ ID No. 16, respectively.

2. The antibody according to claim 1, wherein, The VL includes SEQ ID No. 5, SEQ ID No. 7, and SEQ ID No. 9; and the VH includes SEQ ID No. 11, SEQ ID No. 13, and SEQ ID No.

15.

3. The antibody according to claim 1, wherein, The VL includes SEQ ID No. 4 and the VH includes SEQ ID No.

3.

4. The antibody according to any one of claims 1-3, wherein the antibody binds STn and a group of polysaccharides capped by α2,6-linked sialic acid.

5. The antibody according to claim 4, wherein, The α2,6-linked sialic acid-terminated polysaccharide includes STn, 2,6-sialic acid T, disialialic acid T, or 2,6-sialic acid lactosamine.

6. The antibody according to any one of claims 1-3, wherein the antibody undergoes a glycan change at the glycosylation site.

7. The antibody according to claim 4, wherein the antibody undergoes a glycan change at the glycosylation site.

8. The antibody according to claim 5, wherein the antibody undergoes a glycan change at the glycosylation site.

9. The antibody according to any one of claims 1-3, wherein the antibody is a monoclonal antibody, a chimeric antibody, or a humanized antibody.

10. The antibody according to claim 4, wherein the antibody is a monoclonal antibody, a chimeric antibody, or a humanized antibody.

11. The antibody according to claim 5, wherein the antibody is a monoclonal antibody, a chimeric antibody, or a humanized antibody.

12. The antibody according to claim 6, wherein the antibody is a monoclonal antibody, a chimeric antibody, or a humanized antibody.

13. The antibody according to claim 7, wherein the antibody is a monoclonal antibody, a chimeric antibody, or a humanized antibody.

14. The antibody according to claim 8, wherein the antibody is a monoclonal antibody, a chimeric antibody, or a humanized antibody.

15. The antibody according to any one of claims 1-3, wherein the antibody is a functional antibody fragment thereof, the functional antibody fragment binding STn and a group of polysaccharides capped by α2,6-linked sialic acid.

16. The antibody according to claim 4, wherein the antibody is a functional antibody fragment thereof, the functional antibody fragment binding STn and a group of polysaccharides capped by α2,6-linked sialic acid.

17. The antibody according to claim 5, wherein the antibody is a functional antibody fragment thereof, the functional antibody fragment binding STn and a group of polysaccharides capped by α2,6-linked sialic acid.

18. The antibody according to claim 6, wherein the antibody is a functional antibody fragment thereof, the functional antibody fragment binding STn and a group of polysaccharides capped by α2,6-linked sialic acid.

19. The antibody according to claim 7, wherein the antibody is a functional antibody fragment thereof, the functional antibody fragment binding STn and a group of polysaccharides capped by α2,6-linked sialic acid.

20. The antibody according to claim 8, wherein the antibody is a functional antibody fragment thereof, the functional antibody fragment binding STn and a group of polysaccharides capped by α2,6-linked sialic acid.

21. The antibody according to claim 9, wherein the antibody is a functional antibody fragment thereof, the functional antibody fragment binding STn and a group of polysaccharides capped by α2,6-linked sialic acid.

22. The antibody of claim 10, wherein the antibody is a functional antibody fragment thereof, the functional antibody fragment binding STn and a group of polysaccharides capped by α2,6-linked sialic acid.

23. The antibody according to claim 11, wherein the antibody is a functional antibody fragment thereof, the functional antibody fragment binding STn and a group of polysaccharides capped by α2,6-linked sialic acid.

24. The antibody of claim 12, wherein the antibody is a functional antibody fragment thereof, the functional antibody fragment binding STn and a group of polysaccharides capped by α2,6-linked sialic acid.

25. The antibody according to claim 13, wherein the antibody is a functional antibody fragment thereof, the functional antibody fragment binding STn and a group of polysaccharides capped by α2,6-linked sialic acid.

26. The antibody of claim 14, wherein the antibody is a functional antibody fragment thereof, the functional antibody fragment binding STn and a group of polysaccharides capped by α2,6-linked sialic acid.

27. A composition comprising an antibody of any one of claims 1-26 and a pharmaceutically acceptable carrier.

28. A composition comprising a monoclonal antibody of any one of claims 9-14 and a pharmaceutically acceptable vector.

29. A polynucleotide encoding an antibody according to any one of claims 1-26.

30. The polynucleotide of claim 29, wherein the polynucleotide comprises SEQ ID No. 1 and / or SEQ ID No. 2; nucleotide sequences TCAGTGTAAGTTAC, GACACATCC, and CAGCAGTGGAGTAGTGACCCACCCATGCTCACG; or nucleotide sequences GGCTACTCCATCACCAGTGGTTATTAC, ATAAACTACGACGGTAGCAAT, and GCAAGAGGGGGGGACTAC.

31. An expression vector comprising the polynucleotide of claim 29 or 30.

32. A host cell comprising the expression vector of claim 31.

33. A method for producing antibodies using the host cells of claim 32.

34. Use of the antibody of any one of claims 1-26 in the preparation of a formulation for detecting tumors in a subject, wherein the antibody is used to stain a biological sample obtained from the subject in vitro under conditions suitable for specific binding of the antibody, wherein the presence or absence of binding of the antibody indicates the presence or absence of tumor cells expressing cell surface STn, 2,6-sialic acid T, disialinate T, or 2,6-sialic acid lactosamine.

35. The use according to claim 34, wherein the biological sample comprises isolated proteins of cell, tissue, or tumor origin.

Images