A new crystal form

Abstract

The present application discloses a new crystalline form of (S)-N-(5-((R)-2-(2,5-difluorophenyl)pyrrolidin-1-yl)-pyrazolo[1,5-a]pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide, a pharmaceutical composition comprising the crystalline form, and the use of the crystalline form for treating pain, cancer, inflammation, neurodegenerative diseases or Trypanosoma cruzi infection. In some embodiments, the new crystalline form comprises a stable polymorph of (S)-N-(5-((R)-2-(2,5-difluorophenyl)pyrrolidin-1-yl)-pyrazolo[1,5-a]pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide hydrogen sulfate. The present invention further relates to a method for preparing the new crystalline form.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims priority to U.S. Provisional Application Serial Nos. 62 / 080,374, filed November 16, 2014, and 62 / 169,545, filed June 1, 2015, which are hereby incorporated by reference in their entireties. Background Art 1. Technical Field

[0004] The present invention relates to (S)-N-(5-((R)-2-(2,5-difluorophenyl)-pyrrolidin-1-yl)-pyrazolo[1,5-a]pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide (Formula I) and pharmaceutically acceptable salts thereof, such as hydrogen sulfate, and further to novel crystal forms of hydrogen sulfate, which exhibit Trk family protein tyrosine kinase inhibitory effects, as well as to pharmaceutical compositions containing the crystal forms, methods for preparing the crystal forms, and uses of the compounds and crystal forms for treating pain, inflammation, cancer and certain infectious diseases.

[0005] 2. Description of Related Technology

[0006] Trk is a high affinity receptor tyrosine kinase activated by a group of soluble growth factors called neurotrophic factors (NT). The Trk receptor family has three members, namely TrkA, TrkB and TrkC. Among the neurotrophic factors, there are (i) nerve growth factor (NGF) that can activate TrkA, (ii) brain-derived neurotrophic factor (BDNF) and NT-4 / 5 that can activate TrkB, and (iii) NT3 that can activate TrkC. Trk is widely expressed in neuronal tissue and is related to the maintenance, signal transduction and survival of neuronal cells (Patapoutian, A. et al., Current Opinion in Neurobiology, 2001, 11, 272-280).

[0007] Recent literature has also shown that overexpression, activation, amplification and / or mutation of Trks are associated with many cancers, including neuroblastoma (Brodeur, GM, Nat. Rev. Cancer 2003, 3, 203-216), ovarian cancer (Davidson. B. et al., Clin. Cancer Res. 2003, 9, 2248-2259), breast cancer (Kruettgen et al., Brain Pathology 2006, 16: 304-310), prostate cancer (Dionne et al., Clin. Cancer Res. 1998, 4 (8): 1887-1898), pancreatic cancer (Dang et al., Journal of Gastroenterology and Hepatology 2006, 21 (5): 850-858), multiple myeloma (Hu et al., Cancer Genetics and Cytogenetics 2007, 178: 1-10), astrocytoma and medulloblastoma (Kruettgen et al., Brain Pathology 2006, 16: 304-310), glioma (Hansen et al., Journal of Neurochemistry 2007, 103: 259-275), melanoma 25 , thyroid cancer (Brzezianska et al., Neuroendocrinology Letters 2007, 28(3), 221-229), lung adenocarcinoma (Perez-Pinera et al., Molecular and Cellular Biochemistry 2007, 295(1&2), 19-26), large cell neuroendocrine tumors 19 (Marchetti et al., Human Mutation 2008, 29(5), 609-616) and colorectal cancer (Bardelli, A., Science 2003, 300, 949). In preclinical models of cancer, Trk inhibitors are effective in inhibiting tumor growth and preventing tumor metastasis. Specifically, non-selective small molecule inhibitors of TrkA, TrkB, TrkC and Trk / Fc chimeras are effective in inhibiting tumor growth and preventing tumor metastasis. 25(Nakagawara, A. (2001) Cancer Letters 169: 107-114; Meyer, J. et al. (2007) Leukemia, 1-10; Pierottia, MA and Greco A., (2006) Cancer Letters 232: 90-98; Eric Adriaenssens, E. et al., Cancer Res (2008) 68: (2) 346-351). Therefore, inhibitors of the Trk kinase family are expected to be useful in treating cancer.

[0008] In addition, inhibitors of the Trk / neurotrophic factor pathway have been shown to be effective in a variety of preclinical animal models of pain. For example, antagonist NGF and TrkA antibodies (e.g., RN-624) have been shown to be effective in animal models of inflammatory and neuropathic pain and in human clinical trials (Woolf, CJ et al. (1994) Neuroscience 62, 327-331; Zahn, PK et al. (2004) J. pain 5, 157-163; McMahon, SB et al., (1995) Nat. Med. 1, 774-780; Ma, QP and Woolf, CJ (1997) Neuroreport 8, 807-810; Shelton, DL et al. (2005) Pain 116, 8-16; Delafoy, L. et al. (2003) Pain 105, 489-497; Lamb, K. et al. (2003) Neurogastroenterol. Motil. 15, 355-361; Jaggar, SI et al. (1999) Br. J. Anaesth. 83, 442-448). In addition, recent literature shows that after inflammation, BDNF levels and TrkB signaling are increased in dorsal root ganglia (Cho, L. et al., Brain Research 1997, 749, 358), and several studies have shown that antibodies that reduce signaling through the BDNF / TrkB pathway can inhibit neuronal hypersensitivity and related pain (Chang-Qi, L et al., Molecular pain 2008, 4: 27).

[0009] NGF secreted by tumor cells and tumor-invading macrophages has been shown to directly stimulate TrkA located on peripheral pain fibers. Using various tumor models in mice and rats, it has been shown that neutralization of NGF with monoclonal antibodies can inhibit cancer-related pain to an extent similar to or greater than the highest tolerated dose of morphine. In addition, activation of the BDNF / TrkB pathway has been implicated in a number of studies as a pain modulator for various types of pain, including inflammatory pain (Matayoshi, S., J. Physiol. 2005, 569: 685-95), neuropathic pain (Thompson, SW, Proc. Natl. Acad. Sci. USA 1999, 96: 7714-18), and surgical pain (Li, C.-Q et al., Molecular Pain, 2008, 4 (28), 1-11). Because TrkA and TrkB kinases can serve as mediators of NGF-driven biological responses, inhibitors of TrkA and / or other Trk kinases can provide effective treatments for chronic pain states.

[0010] Current treatment options for painful conditions utilize several types of compounds. Opioids (e.g., morphine) have several drawbacks including causing vomiting, constipation, and negative respiratory effects, as well as the potential for addiction. Nonsteroidal anti-inflammatory analgesics (NSAIDs, e.g., COX-1 or COX-2) also have drawbacks including insufficient efficacy in treating severe pain. In addition, COX-1 inhibitors can cause mucosal ulcers. Therefore, there is a continuing need for new and more effective treatments for alleviating pain, especially chronic pain.

[0011] Additionally, inhibition of the neurotrophin / Trk pathway has been shown to be effective in treating preclinical models of inflammatory disease. For example, inhibition of the neurotrophin / Trk pathway has been implicated in preclinical models of inflammatory lung diseases including asthma (Freund-Michel, V; Frossard, N.; Pharmacology & Therapeutics (2008), 117(1), 52-76), interstitial cystitis (Hu Vivian Y et al., The Journal of Urology (2005), 173(3), 1016-21), inflammatory bowel diseases including ulcerative colitis and Crohn's disease (Di Mola, FF et al., Gut (2000), 46(5), 670-678), and inflammatory skin diseases such as atopic dermatitis (Dou, Y.-C. et al., Archives of Dermatological Research (2006), 298(1), 31-37), eczema and psoriasis (Raychaudhuri, SP et al., Journal of Investigative Dermatology (2004), 122(3), 812-819).

[0012] The neurotrophin / Trk pathway, particularly the BDNF / TrkB pathway, has also been implicated in the etiology of neurodegenerative diseases, including multiple sclerosis, Parkinson's disease, and Alzheimer's disease (Sohrabji, Farida; Lewis, Danielle K. Frontiers in Neuroendocrinology (2006), 27(4), 404-414). Modulation of the neurotrophin / Trk pathway may be useful in treating these and related diseases.

[0013] The TrkA receptor is believed to be critical for the disease process in parasitic infections of Trypanosoma cruzi (Chagas disease) in human hosts (de Melo-Jorge, M. et al., Cell Host & Microbe (2007), 1(4), 251-261). Therefore, TrkA inhibition may be useful in the treatment of Chagas disease and related protozoan infections.

[0014] Trk inhibitors can also be used to treat diseases associated with imbalanced bone remodeling regulation, such as osteoporosis, rheumatoid arthritis and bone metastasis. Bone metastasis is a common complication of cancer, with up to 70% of patients with advanced breast cancer or prostate cancer (1) and about 15 to 30% of patients with lung cancer, colon cancer, stomach cancer, bladder cancer, uterine cancer, rectal cancer, thyroid cancer or kidney cancer. Osteolytic metastasis can cause severe pain, pathological fractures, life-threatening hypercalcemia, spinal cord compression and other nerve compression syndromes. For these reasons, bone metastasis is a costly and serious complication of cancer. Therefore, agents that can induce apoptosis of proliferative osteoblasts are very advantageous. Expression of TrkA receptors and TrkC receptors has been observed in the osteoblastic region of a mouse model of fracture (K. Asaumi et al., Bone (2000) 26 (6) 625-633). In addition, localization of NGF has been observed in almost all osteoblasts (K. Asaumi et al.). Recently, pan-Trk inhibitors were shown to inhibit tyrosine signaling activated by neurotrophic factors that bind to all three Trk receptors in human hFOB osteoblasts (J. Pinski et al., (2002) 62, 986-989). This data supports the rationale for using Trk inhibitors to treat bone remodeling diseases such as bone metastasis in cancer patients.

[0015] Several types of small molecule inhibitors of Trk kinases are known which are said to be useful for treating pain or cancer (Expert Opin. Ther. Patents (2009) 19(3)).

[0016] International Patent Application Publications WO 2006 / 115452 and WO 2006 / 087538 describe several classes of small molecules which are said to be inhibitors of Trk kinases useful in treating pain or cancer.

[0017] Pyrazolo[1,5-a]pyrimidine compounds are known. For example, International Patent Application Publication No. WO 2008 / 037477 discloses pyrazolo[1,5-a]pyrimidine compounds carrying an alkyl, aryl or heterocyclic group at the 3-position. These compounds are said to be PI3K and / or mTOR lipid kinase inhibitors.

[0018] PCT Patent Publication No. WO 2008 / 058126 discloses pyrazolo[1,5-a]pyrimidine compounds carrying a phenyl group at position 3. These compounds are said to be Pim-kinase inhibitors.

[0019] U.S. Patent Publication No. 2006 / 0094699 discloses pyrazolo[1,5-a]pyrimidine compounds carrying a -C(=O)NH-phenyl, -C(=O)(4-methylpiperidinyl) or -C(=O)NMe(CH2-trimethylpyrazolyl) group at the 3-position for use in combination therapy with a glucocorticoid receptor agonist.

[0020] PCT Patent Publication Nos. WO 2010 / 033941, WO 2010 / 048314, WO 2011 / 006074 and WO 2011 / 146336 disclose compounds having Trk family protein tyrosine kinase inhibitory effects, which can be used to treat pain, cancer, inflammation, neurodegenerative diseases and certain infectious diseases.

[0021] WO 2010 / 048314 discloses the hydrogen sulfate salt of (S)-N-(5-((R)-2-(2,5-difluorophenyl)-pyrrolidin-1-yl)-pyrazolo[1,5-a]pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide in Example 14A. WO 2010 / 048314 does not disclose the specific form of the hydrogen sulfate salt described herein when prepared according to the method of Example 14A of the document. In particular, WO 2010 / 048314 does not disclose the following crystalline form (I-HS).

[0022] All documents (including scientific articles, patent publications, applications, and the like) mentioned in this application are incorporated herein by reference in their entirety. Summary of the invention

[0023] The present invention relates to (S)-N-(5-((R)-2-(2,5-difluorophenyl)-pyrrolidin-1-yl)-pyrazolo[1,5-a]pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide (Formula I) and pharmaceutically acceptable salts thereof, such as hydrogen sulfate, and further to novel crystal forms of hydrogen sulfate, which exhibit Trk family protein tyrosine kinase inhibitory effects, as well as to pharmaceutical compositions containing the crystal forms, methods for preparing the crystal forms, and uses of the compounds and crystal forms for treating pain, inflammation, cancer and certain infectious diseases.

[0024] Provided herein is a novel crystalline form of a compound of Formula I:

[0025]

[0026] The compound is also referred to as (S)-N-(5-((R)-2-(2,5-difluorophenyl)-pyrrolidin-1-yl)-pyrazolo[1,5-a]pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide. In particular, the new crystalline form includes a stable polymorphic form of the hydrogen sulfate salt of the compound of formula I, hereinafter referred to as Form (I-HS) and LOXO-101, which can be characterized, for example, by its X-ray diffraction pattern - Form (I-HS) having the following formula:

[0027]

[0028] In some embodiments, Form (I-HS) is characterized by having XRPD diffraction peaks (2θ degrees) at 18.4 ± 0.2, 20.7 ± 0.2, 23.1 ± 0.2, and 24.0 ± 0.2. In some embodiments, Form (I-HS) is characterized by having XRPD diffraction peaks (2θ degrees) at 10.7 ± 0.2, 18.4 ± 0.2, 20.7 ± 0.2, 23.1 ± 0.2, and 24.0 ± 0.2. In some embodiments, Form (I-HS) is characterized by having XRPD diffraction peaks (2θ degrees) at 10.7 ± 0.2, 18.4 ± 0.2, 19.2 ± 0.2, 20.2 ± 0.2, 20.7 ± 0.2, 21.5 ± 0.2, 23.1 ± 0.2, and 24.0 ± 0.2. In some embodiments, Form (I-HS) is characterized by having XRPD diffraction peaks (2θ degrees) at 10.7±0.2, 15.3±0.2, 16.5±0.2, 18.4±0.2, 19.2±0.2, 19.9±0.2, 20.2±0.2, 20.7±0.2, 21.5±0.2, 22.1±0.2, 23.1±0.2, 24.0±0.2. 24.4±0.2, 25.6±0.2, 26.5±0.2, 27.6±0.2, 28.2±0.2, 28.7±0.2, 30.8±0.2, and 38.5±0.2.

[0029] In some embodiments, the crystalline form (I-HS) has substantially Fig.29 XRPD pattern shown.

[0030] In some embodiments, the crystalline form has an onset to maximum temperature of about 193 to about 205° C. as measured by differential scanning calorimetry. In some embodiments, the crystalline form (I-HS) has a heat of fusion of about 2.415 mW as measured by differential scanning calorimetry. In some embodiments, the crystalline form (I-HS) has a DSC thermogram substantially as follows Fig.26 In some embodiments, the crystalline form (I-HS) is non-hygroscopic.

[0031] Some embodiments include a pharmaceutical composition comprising a pharmaceutically acceptable carrier and the crystalline form (I-HS). Some embodiments include a pharmaceutical composition prepared by mixing the crystalline form (I-HS) and a pharmaceutically acceptable carrier. Some embodiments include a method of preparing a pharmaceutical composition comprising mixing the crystalline form (I-HS) and a pharmaceutically acceptable carrier.

[0032] The present invention also relates to methods for treating cancer, pain, inflammation and certain infectious diseases, comprising administering a therapeutically effective amount of the crystalline form (I-HS) to a subject in need thereof. Some embodiments include the use of the crystalline form (I-HS) in the preparation of a medicament for treating cancer, pain, inflammation and certain infectious diseases in a subject in need thereof.

[0033] Also provided herein is a method of treating a Trk kinase-mediated cancer in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of the crystalline form (I-HS). In some embodiments, the cancer is mediated by Trk; TrkB; or TrkA and TrkB. In some embodiments, the patient is diagnosed or identified as having a Trk-related cancer.

[0034] Also provided herein is a method for treating cancer in a subject in need thereof, the method comprising: (a) determining whether the cancer is associated with one or more of overexpression, activation, amplification and mutation of Trk kinase; and (b) if the cancer is determined to be associated with one or more of overexpression, activation, amplification and mutation of Trk kinase, administering a therapeutically effective amount of the crystalline form (I-HS) to the subject. In some embodiments, a method for treating cancer in a subject in need thereof is provided, the method comprising: (a) determining whether the cancer is mediated by Trk kinase; and (b) if the cancer is determined to be mediated by Trk kinase, administering a therapeutically effective amount of the crystalline form (I-HS) to the subject. Also provided herein is a method for treating a subject, comprising: (a) testing a sample obtained from a subject to determine whether the subject has a disorder of NTRK genes, Trk proteins, or their expression or levels; and (b) administering a therapeutically effective amount of the crystalline form (I-HS) to a subject determined to have a disorder of NTRK genes, Trk proteins, or their expression or activity or levels.

[0035] In some embodiments, the dysregulation of an NTRK gene, Trk protein, or their expression or levels is chromosomal translation resulting in translation of a Trk fusion protein. For example, the Trk fusion protein is selected from: TP53-TrkA, LMNA-TrkA, CD74-TrkA, TFG-TrkA, TPM3-TrkA, NFASC-TrkA, BCAN-TrkA, MPRIP-TrkA, TPR-TrkA, RFWD2-TrkA, IRF2BP2-TrkA, SQSTM1-TrkA, SS BP2-TrkA, RABGAP1L-TrkA, C18ORF8-TrkA, RNF213-TrkA, TBC1D22A-TrkA, C20ORF112-TrkA, DNER-TrkA, ARHGEF2-TrkA, CHTOP-TrkA, PPL-TrkA, PLEKHA6-TrkA, PEAR1-TrkA, MRPL24-TrkA, MDM4-TrkA, LRRC71-TrkA, GRIPAP1-TrkA, EPS15-TrkA, DYNC2H1-TrkA, CEL-TrkA, EPHB2-TrkA, TGF-TrkA, NACC2-TrkB, QKI-TrkB, AFAP1-TrkB, PAN3-TrkB, SQS TM1-TrkB, TRIM24-TrkB, VCL-TrkB, AGBL4-TrkB, DAB2IP-TrkB, ETV6-TrkC, BTBD1-TrkC, LYN-TrkC, RBPMS-TrkC, EML4-TrkC, HOMER2-TrkC, TFG-TrkC, FAT1-TrkC, and TEL-TrkC.

[0036] In some embodiments, the dysregulation of the NTRK gene, Trk protein, or their expression or activity is one or more point mutations in the gene. For example, the NTRK gene is the NTRK1 gene, and the one or more point mutations in the NTRK1 gene result in the translation of a TrkA protein having a substitution at one or more of the following amino acid positions: 33, 336, 337, 324, 420, 444, 517, 538, 649, 682, 683, 702, and 1879. In some embodiments, one or more point mutations in the NTRK1 gene result in the translation of a TrkA protein having one or more of the following amino acid substitutions: R33W, A336E, A337T, R324Q, R324W, V420M, R444Q, R444W, G517R, G517V, K538A, R649W, R649L, R682S, V683G, R702C, and C1879T.

[0037] The features and advantages described in the above summary of the invention and the following detailed description of the invention are not exhaustive. A person skilled in the art will recognize many other features and advantages in view of the drawings, the specification and the claims of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 The figure illustrates an X-ray powder diffraction (XRPD) pattern of the crystalline form (I-HS) prepared according to Example 2 according to one embodiment.

[0039] Figure 2 The diagram illustrates a simultaneous thermogravimetric / differential thermal analyzer (TG / DTA) curve of the crystalline form (I-HS) prepared according to Example 2, according to one embodiment.

[0040] Figure 3 The diagram illustrates a differential scanning calorimetry (DSC) curve of the crystalline form (I-HS) prepared according to Example 2, according to one embodiment.

[0041] Figure 4A and Figure 4B Illustrated are polarized light microscopy (PLM) images of Form (I-HS) prepared according to Example 2 under (A) non-polarized light and (B) polarized light, according to some embodiments.

[0042] Figure 5 The figure illustrates the dynamic vapor sorption (DVS) isotherm of the crystalline form (I-HS) prepared according to Example 2 according to one embodiment.

[0043] Figure 6 The diagram illustrates the infrared (IR) spectrum curve of the crystalline form (I-HS) prepared according to Example 2 according to one embodiment.

[0044] Figure 7 The diagram illustrates an XRPD pattern of the amorphous free base form of the compound of Formula I according to one embodiment.

[0045] Figure 8 The graph shows that the use of the crystalline form (I-HS) dose-dependently inhibits the proliferation of CUTO-3F lung adenocarcinoma cells having the MPRIP-NTRK1 fusion protein.

[0046] Fig. 9 The graph shows dose-dependent inhibition of proliferation of KM12 colorectal cancer cells with TPM3-NTRK1 fusion protein using the crystalline form (I-HS).

[0047] Fig.10 The graph shows that the use of the crystalline form (I-HS) dose-dependently inhibits the proliferation of MO-91 acute myeloid leukemia cells with ETV6-NTRK3 fusion protein.

[0048] Fig.11 Immunoblot showing that the crystalline form (I-HS) inhibits the activation of MPRIP-TRKA kinases, ERK1 / 2 in CUTO-3F cells and AKT activity in KM12 cells. These cells were treated with the indicated doses of the crystalline form (I-HS) for 2 hours.

[0049] Fig.12 Immunoblot showing that the crystalline form (I-HS) inhibits the activation of TPM3-TRKA kinase and downstream ERK1 / 2 and AKT activities in KM12 cells. These cells were treated with the crystalline form (I-HS) at the indicated doses for 2 hours.

[0050] Fig.13 Immunoblot showing that the crystalline form (I-HS) inhibits TEL-TRKC kinase and ERK1 / 2 and AKT activities in MO-91 cells. These cells were treated with the crystalline form (I-HS) at the indicated doses for 2 hours.

[0051] Fig.14 Schematic diagram depicting the LMNA-NTRK1 gene fusion identified in a patient's tumor sample: the first two exons of LMNA (NM_170707) are combined with exons 11-17 of NTRK1 (NM_002529).

[0052] Fig.15 Figure 2 is a fluorescent micrograph from NTRK1 break-apart FISH analysis showing paired green (5'NTRK1) and red (3'NTRK1) signals corresponding to the normal gene (yellow arrows), and separated red signals (red arrows) observed in tumor cell nuclei (stained blue with DAPI) indicating chromosomal deletions leading to NTRK1 gene fusions.

[0053] Fig.16 The chromatogram is a DNA sequencing result of the RT-PCR product using LMNA (5') and NTRK1 (3') primers, indicating the fusion breakpoint between exon 2 LMNA and exon 11 of NTRK1.

[0054] Fig.17Schematic diagram of the TRK-SHC1 proximity ligation assay (PLA). This cartoon demonstrates the detection of proximal (<40 nM) TRK and SHC1 proteins in tumor cells. The TRK antibody (rabbit) used can detect the c-terminus of TRKA (encoded by NTRK1), TRKB (NTRK2), or TRKC (NTRK3) proteins. SHC1 is detected by SHC1 antibody (mouse). Binding of species-specific secondary antibodies to covalently linked complementary nucleotide sequences allows in situ PCR reactions to generate DNA that can be detected by fluorescent in situ hybridization, which is visualized as red dots in this method. This analysis can detect activated TRKs regardless of the mechanism of activation of the TRK receptor family members (TRKA / B / C) (gene fusion, mutation, or autocrine / paracrine activation of the wild type).

[0055] Fig.18Dataset for validation of TRK-SHC1 PLA. (A) CUTO-3 cell line derived from malignant pleural effusion of a patient with stage IV lung adenocarcinoma with MPRIP-NTRK1 gene fusion was transfected with non-targeting control (NTC) siRNA, NTRK1-directed siRNA or left untreated (control) and analyzed for TRKA protein expression. Western blot analysis confirmed a significant reduction in TRKA protein content and corresponded to the MPRIP-TRKA fusion protein migrating with an apparent molecular weight of 170 kD. TRK-SHC1 PLA was performed in cells treated as in (A), which confirmed a robust positive signal in the siRNA control (B), but a proportional reduction in the NTRK1 siRNA (C). CUTO-3 cells were treated with DMSO (D) or 100 nM concentration of the crystalline form (I-HS) (E) for 2 hours, which confirmed that the TRKA-SHC1 complex was disrupted in the crystalline form (I-HS) treated samples compared to the control. CULC001 is a patient-derived tumor xenograft (PDX) derived from the same tumor as the CUTO-3 cell line and has an MPRIP-NTRK1 gene fusion (not shown). CULC002 is a PDX from a NSCLC patient with no known drivers (ALK, ROS1, EGFR, KRAS, and BRAF negative) and is negative for NTRK1 gene fusion by NTRK1 separation FISH (not shown). TRK PLA analysis confirmed robust signals in the CULC001 (F) tumor cell nucleus and no signals in the CULC002 (G) tumor cell nucleus. (H) and (I) panels show neural bundles from CULC001 PDX. TRK-SHC1 PLA is only positive in this region of the CULC002 tumor sample and indicates autocrine signaling in TRKA, TRKB, or TRKC receptors, because this family is expressed in neural tissue and used as an internal positive control for this otherwise negative tumor sample.

[0056] Fig.19 Figures are images from TRK SHC1 proximity ligation analysis and controls. (A) TRK-SHC1 proximity ligation analysis demonstrates robust signaling in tumor cell nuclei and weak signaling in thick-walled vessels. Nuclei were stained with DAPI (blue) and red signal represents positive PLA indicator of TRKA-SHC1 protein complex. Blood vessels are indicated within the partial ellipse (white dashed line). (B) Hematoxylin and eosin stained adjacent tumor tissue section indicating thick-walled blood vessels (within the partial ellipse indicated by the white dashed line) and flank tumor cell nuclei.

[0057] Fig. 20A set of images showing TRK and ALK PLA in ALK+ tumor samples. FFPE tumor samples from ALK+ patients (autopsy samples) were analyzed using either TRK-SHC1 PLA (A) demonstrating the absence of signal or ALK-GRB2 PLA (B) showing robust ALK signaling.

[0058] Fig.21 For a set of three computed tomography images from a subject with an undifferentiated sarcoma. The CT images were obtained after preoperative chemotherapy and primary tumor resection (with arrows indicating the presence of a small right lung nodule of 18 mm) (A), baseline imaging (B) on the day of the study just before administration with the crystalline form (I-HS), and after 1 cycle (28 days) of administration with the crystalline form (I-HS) (C). It was observed that the patient had metastatic disease only in the lungs, and therefore the CT scan images showed axial images (top) and coronal (bottom) images focused on the chest cavity. These images confirmed initial rapid disease progression (AB, 13-week intervals), followed by significant tumor responses, including reduction in size and / or regression of numerous lung metastases (BC, 4-week intervals).

[0059] Fig. 22 Figure 1 is a graph showing the serum CA125 content over time in patients with undifferentiated sarcomas treated with crystalline form (I-HS). It was found that the serum CA125 level in this patient increased and was subsequently tracked as a potential active indicator. The baseline before administration (-8 days) and the serum CA125 at the indicated time points after the start of administration from -3 days to 56 days were plotted to confirm the time-dependent reduction of this tumor marker. The red dotted line indicates the upper limit of normal (35U / mL) for this laboratory test.

[0060] Fig.23 The graph shows that the crystal form (I-HS) dose-dependently inhibits the proliferation of HCC78 cells having the SLC34A2-ROS1 fusion protein.

[0061] Fig.24 is a graph showing thermogram data for AM(HS) 1. The top line of the graph is a graph of thermogravimetric analysis (TGA) of the compound, while the bottom line is a graph of differential scanning calorimetry (DSC).

[0062] Fig.25 is a graph showing wet spectrogram data for AM(HS) 2. The top line of the graph is a graph of thermogravimetric analysis (TGA) of the compound, while the bottom line is a graph of differential scanning calorimetry (DSC).

[0063] Fig.26is a graph showing thermogram data of the crystalline form (I-HS). The top line of the graph is a graph of thermogravimetric analysis (TGA) of the compound, while the bottom line is a graph of differential scanning calorimetry (DSC).

[0064] Fig. 27 The diagram illustrates the overlay of X-ray powder diffraction (XRPD) patterns of AM(HS) 1, AM(HS) 2, and Form (I-HS). AM(HS) 1 and AM(HS) 2 are broad lines in the lower portion of the figure, while Form (I-HS) exhibits sharp peaks.

[0065] Fig.28 The X-ray powder diffraction (XRPD) patterns of AM(HS)1 and AM(HS)2 are illustrated.

[0066] Fig.29 The diagram illustrates the X-ray powder diffraction (XRPD) pattern of the crystalline form (I-HS).

[0067] Fig.30 This is an image of a sample of AM(HS)1 under polarized light microscopy at 20X magnification.

[0068] Fig.31 This is an image of a sample of AM(HS)2 under polarized light microscopy at 20X magnification.

[0069] Fig.32 This is an image of a sample of the crystalline form (I-HS) under polarized light microscopy at 20X magnification.

[0070] Fig.33 Graph of the hygroscopicity of AM(HS)1 using dynamic vapor sorption (DVS).

[0071] Fig.34 Illustrated are the X-ray powder diffraction (XRPD) patterns of AM(HS)1 before DVS (top line) and after DVS (bottom line).

[0072] Fig.35 Graph of the hygroscopicity of AM(HS)2 using dynamic vapor sorption (DVS).

[0073] Fig.36 Illustrated are the X-ray powder diffraction (XRPD) patterns of AM(HS)2 before DVS (top line) and after DVS (bottom line).

[0074] Fig.37 Graph of the hygroscopicity of the crystalline form (I-HS) using dynamic vapor sorption (DVS).

[0075] Fig.38Illustrated are X-ray powder diffraction (XRPD) patterns of the crystalline form (I-HS) before DVS (top line) and after DVS (bottom line).

[0076] Fig.39 A graph of tensile strength versus compression pressure for various 200 mg direct compression blend compacts incorporating Form (I-HS) or AM(HS) 2. In this graph, (1) is a 2:1 MCC:lactose blend with AM(HS) 2; (2) is a 2:1 MCC:lactose blend with Form (I-HS); (3) is a 1:1 MCC:starch blend with AM(HS) 2; (4) is a 1:1 MCC:starch blend with Form (I-HS).

[0077] Fig.40 Overlay of the DSC thermograms of AM(HS)1 at T0 (bottom line) and after 5 weeks at 40°C / 75%RH (top line).

[0078] Fig.41 Overlay of the DSC thermograms of the crystalline form (I-HS) at T0 (bottom line) and after 5 weeks at 40°C / 75%RH (top line).

[0079] Fig.42 The graph illustrates the overlay of the X-ray powder diffraction (XRPD) patterns of AM(HS)1 at T0 (broad lines) and after 5 weeks at 40°C / 75%RH (sharp peaks).

[0080] Fig.43 The diagram illustrates the overlay of the X-ray powder diffraction (XRPD) patterns of the crystalline form (I-HS) at T0 (bottom) and after 5 weeks at 40°C / 75% RH (top).

[0081] Fig.44 Schematic illustration of the overlay of X-ray powder diffraction (XRPD) patterns of Form (I-HS) (bottom) and AM(HS) 1 (top) after 5 weeks at 40°C / 75%RH.

[0082] Fig.45 Graph showing the percentage change in volume of xenograft (human) tumors derived from the lung adenocarcinoma CUTO-3F cell line (CUTO-3.29) over time in mice treated with vehicle (triangles) or orally dosed with a daily dose of 60 mg / kg (circles) or 200 mg / kg (squares) of the crystalline form (I-HS) after implantation of the xenografts into mice.

[0083] Fig.46Graph showing the percentage change in volume of xenograft (human) tumors derived from the colorectal cancer KM12 cell line over time in mice treated with vehicle (triangles) or orally dosed with a daily dose of 60 mg / kg (circles) or 200 mg / kg (squares) of the crystalline form (I-HS) after implantation of the xenografts into mice.

[0084] Fig.47 Graph of the percentage change in volume of xenograft (human) tumors derived from the acute myeloid leukemia MO-91 cell line over time in mice treated with vehicle (triangles) or orally dosed with a daily dose of 60 mg / kg (circles) or 200 mg / kg (squares) of the crystalline form (I-HS) after implantation of the xenografts into mice.

[0085] The figures depict various embodiments of the present invention for purposes of illustration only. From the following discussion, those skilled in the art will readily recognize that alternative embodiments of the structures and methods illustrated herein may be employed without departing from the principles of the present invention set forth herein. DETAILED DESCRIPTION OF THE INVENTION

[0086] The present invention relates to (S)-N-(5-((R)-2-(2,5-difluorophenyl)-pyrrolidin-1-yl)-pyrazolo[1,5-a]pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide (Formula I) and pharmaceutically acceptable salts thereof, such as hydrogen sulfate, and further to novel crystal forms of hydrogen sulfate, which exhibit Trk family protein tyrosine kinase inhibitory effects, as well as to pharmaceutical compositions containing the crystal forms and methods for preparing the crystal forms.

[0087] Provided herein is a novel crystalline form of a compound of Formula I:

[0088]

[0089] In particular, the novel crystalline form comprises a stable polymorphic form of the hydrogen sulfate salt of the compound of Formula I, hereinafter referred to as Form (I-HS), which can be characterized, for example, by its X-ray diffraction pattern.

[0090] like Figure 1As illustrated in , in some embodiments, the crystalline form (I-HS) can be characterized by its X-ray powder diffraction pattern (XRPD). XRPD was performed on a D5000 X-ray diffractometer from Siemens with a CuKα1, 0.1540562 nm long fine focus sealed tube source by scanning the sample between 3 and 40° 2-θ with a step size of 0.0200° 2-θ and a time / step of 1 second. The effective scan speed was 0.0200° / s, and the instrument voltage was 40 kV and the current was set to 40 mA. The sample was analyzed in reflection mode using a divergent slit with a size of 2 mm under the following experimental conditions.

[0091] In some embodiments, the crystalline form (I-HS) has an XRPD pattern with at least 20 characteristic peaks (2θ degrees ± 0.3), as listed in Table 1.

[0092] Table 1. XRPD peaks of crystalline form (I-HS)

[0093]

[0094] In some embodiments, the crystalline form (I-HS) has an XRPD pattern having at least 8 characteristic peaks (2θ degrees ± 0.3), including peaks with a relative intensity greater than or equal to about 15%, as listed in Table 2.

[0095] Table 2. XRPD peaks of crystalline form (I-HS)

[0096]

[0097] In some embodiments, the crystalline form (I-HS) has an XRPD pattern having at least 5 characteristic peaks (2θ degrees ± 0.3), including peaks with a relative intensity greater than or equal to about 25%, as listed in Table 3.

[0098] Table 3. XRPD peaks of crystalline form (I-HS)

[0099]

[0100] In some embodiments, the crystalline form (I-HS) has an XRPD pattern with at least 4 characteristic peaks (2θ degrees ± 0.3), including peaks with a relative intensity greater than or equal to about 30%, as listed in Table 4.

[0101] Table 4. XRPD peaks of crystalline form (I-HS)

[0102]

[0103] In certain embodiments, the crystalline form (I-HS) has an XRPD pattern substantially similar to Figure 1 The XRPD patterns shown are identical.

[0104] In some embodiments, Form (I-HS) is characterized by having XRPD diffraction peaks (2θ degrees) at about 18.4, 20.6, 23.0, and 24.0. In some embodiments, Form (I-HS) is characterized by having XRPD diffraction peaks (2θ degrees) at about 10.6, 18.4, 20.6, 23.0, and 24.0. In some embodiments, Form (I-HS) is characterized by having XRPD diffraction peaks (2θ degrees) at about 10.6, 18.4, 19.1, 20.2, 20.6, 21.5, 23.0, and 24.0. In some embodiments, Form (I-HS) is characterized by having XRPD diffraction peaks (2θ degrees) at about 10.6, 15.3, 16.4, 18.4, 19.1, 19.8, 20.2, 20.6, 21.5, 22.0, 23.0, 24.0, 24.4, 25.6, 26.5, 27.5, 28.2, 28.6, 30.8, and 38.5.

[0105] In certain embodiments, the crystalline form (I-HS) has an XRPD pattern substantially similar to Fig.29 The XRPD patterns shown are identical.

[0106] In some embodiments, the crystalline form (I-HS) has an XRPD pattern having at least the 20 characteristic peaks (2θ degrees ± 0.3) as listed in Table 5.

[0107] Table 5. XRPD peaks of crystalline form (I-HS)

[0108] Position (°2θ) Relative strength (%) 10.76 29.85 15.38 13.22 16.52 16.46 18.50 48.07 19.22 22.92 19.92 16.05 20.26 30.80 20.74 100.00 21.56 23.78 22.16 15.51 23.16 32.52 24.10 33.89 24.50 12.14 25.72 8.89 26.50 10.88 27.62 8.61 28.32 11.44 28.74 10.73 30.92 8.23 38.60 8.88

[0109] In some embodiments, the crystalline form (I-HS) has an XRPD pattern with at least 8 characteristic peaks (2θ degrees ± 0.3), including peaks with a relative intensity greater than or equal to about 15%, as listed in Table 6.

[0110] Table 6. XRPD peaks of crystalline form (I-HS)

[0111] Position (°2θ) Relative strength (%) 10.76 29.85 18.50 48.07 19.22 22.92 20.26 30.80 20.74 100.00 21.56 23.78 23.16 32.52 24.10 33.89

[0112] In some embodiments, the crystalline form (I-HS) has an XRPD pattern having at least 5 characteristic peaks (2θ degrees ± 0.3), including peaks with a relative intensity greater than or equal to about 25%, as listed in Table 7.

[0113] Table 7. XRPD peaks of crystalline form (I-HS)

[0114] Position (°2θ) Relative strength (%) 10.76 29.85 18.50 48.07 20.74 100.00 23.16 32.52 24.10 33.89

[0115] In some embodiments, the crystalline form (I-HS) has an XRPD pattern with at least 4 characteristic peaks (2θ degrees ± 0.3), including peaks with a relative intensity greater than or equal to about 30%, as listed in Table 8.

[0116] Table 8. XRPD peaks of crystalline form (I-HS)

[0117] Position (°2θ) Relative strength (%) 18.50 48.07 20.74 100.00 23.16 32.52 24.10 33.89

[0118] In some embodiments, Form (I-HS) is characterized by having XRPD diffraction peaks (2θ degrees) at about 18.5, 20.7, 23.2, and 24.1. In some embodiments, Form (I-HS) is characterized by having XRPD diffraction peaks (2θ degrees) at about 10.8, 18.5, 20.7, 23.2, and 24.1. In some embodiments, Form (I-HS) is characterized by having XRPD diffraction peaks (2θ degrees) at about 10.8, 18.5, 19.2, 20.3, 20.7, 21.6, 23.2, and 24.1. In some embodiments, Form (I-HS) is characterized by having XRPD diffraction peaks (2θ degrees) at about 10.8, 15.4, 16.5, 18.5, 19.2, 19.9, 20.3, 20.7, 21.6, 22.2, 23.2, 24.1, 24.5, 25.7, 26.5, 27.6, 28.3, 28.7, 30.9, and 38.6.

[0119] In some embodiments, considering Figure 1 and 29 The XRPD pattern provided, Form (I-HS) is characterized by having the XRPD peaks (2θ degrees) shown in Table 9.

[0120] Table 9. XRPD peaks of crystalline form (I-HS)

[0121] Figure 1 Fig.29 difference average 10.76 10.63 0.13 10.70 15.38 15.25 0.13 15.32 16.52 16.39 0.13 16.46 18.50 18.37 0.13 18.44 19.22 19.08 0.14 19.15 19.92 19.79 0.13 19.86 20.26 20.15 0.11 20.21 20.74 20.61 0.13 20.68 21.56 21.47 0.09 21.52 22.16 22.01 0.15 22.09 23.16 23.04 0.12 23.10 24.10 23.97 0.13 24.04 24.50 24.35 0.15 24.43 25.72 25.58 0.14 25.65 26.50 26.48 0.02 26.49 27.62 27.50 0.12 27.56 28.32 28.17 0.15 28.25 28.74 28.58 0.16 28.66 30.92 30.77 0.15 30.85 38.60 38.47 0.13 38.54

[0122] In some embodiments, Form (I-HS) is characterized by having XRPD diffraction peaks (2θ degrees) at 18.4 ± 0.2, 20.7 ± 0.2, 23.1 ± 0.2, and 24.0 ± 0.2. In some embodiments, Form (I-HS) is characterized by having XRPD diffraction peaks (2θ degrees) at 10.7 ± 0.2, 18.4 ± 0.2, 20.7 ± 0.2, 23.1 ± 0.2, and 24.0 ± 0.2. In some embodiments, Form (I-HS) is characterized by having XRPD diffraction peaks (2θ degrees) at 10.7 ± 0.2, 18.4 ± 0.2, 19.2 ± 0.2, 20.2 ± 0.2, 20.7 ± 0.2, 21.5 ± 0.2, 23.1 ± 0.2, and 24.0 ± 0.2. In some embodiments, Form (I-HS) is characterized by having XRPD diffraction peaks (2θ degrees) at 10.7±0.2, 15.3±0.2, 16.5±0.2, 18.4±0.2, 19.2±0.2, 19.9±0.2, 20.2±0.2, 20.7±0.2, 21.5±0.2, 22.1±0.2, 23.1±0.2, 24.0±0.2. 24.4±0.2, 25.6±0.2, 26.5±0.2, 27.6±0.2, 28.2±0.2, 28.7±0.2, 30.8±0.2, and 38.5±0.2.

[0123] It should be understood that the 2θ values ​​of the X-ray powder diffraction pattern of the crystalline form (I-HS) may vary slightly between instruments and also depend on variations in sample preparation and batch-to-batch variations, and therefore the values ​​quoted should not be considered absolute values. It should also be understood that the relative intensities of the peaks may vary depending on orientation effects, so that the intensities shown in the XRPD traces included herein are illustrative and are not intended for absolute comparison. Therefore, it should be understood that the phrase "substantially the same as Figure 1 or Fig.29 "Same XRPD pattern shown in" means that for comparison purposes there is Figure 1 or Fig.29 It will be appreciated that the relative peak positions can be Figure 1 or Fig.29 The peak positions shown in the figure vary by ±0.3 degrees. It should be further understood that for comparison purposes the peak intensities are allowed to be relative to Figure 1 and Fig.29 There are some changes shown in .

[0124] Figure 2The simultaneous thermogravimetric / differential thermal analyzer (TG / DTA) curve of the crystal form (I-HS) according to one embodiment is illustrated. For analysis, about 5 mg of the crystal form (I-HS) was weighed into an open aluminum pan and loaded into a simultaneous thermogravimetric / differential thermal analyzer (TG / DTA) and kept at room temperature. The sample was then heated from 25°C to 300°C at a rate of 10°C / min, during which time the change in sample weight and any differential thermal events were recorded. Nitrogen was used as the purge gas with a flow rate of 100 cm 3 The TG / DAT curve of the crystalline form (I-HS) shows an initial weight loss of 0.8% between 27.4°C and 182.4°C, followed by a 4.9% weight loss between 182.4°C and 225.0°C in the TG curve, which is also seen as an endotherm in the DTA curve. These weight losses may be decomposition of the material.

[0125] Figure 3 The diagram illustrates a differential scanning calorimetry (DSC) curve of the crystalline form (I-HS) according to one embodiment. The DSC analysis of the sample was carried out using a Seiko DSC6200 differential scanning calorimeter (equipped with a cooler). About 5 mg of the crystalline form (I-HS) was weighed into an aluminum DSC pan and non-hermetically sealed with a perforated aluminum lid. The sample pan was then loaded into a Seiko DSC6200 (equipped with a cooler), cooled and maintained at 25°C. After a stable heat flow reaction was obtained, the sample and reference were heated to 270°C at a scanning rate of 10°C / min while monitoring the resulting heat flow reaction. In some embodiments, the crystalline form (I-HS) has substantially Figure 3 As used herein, "substantially as Figure 3 "shown in" means Figure 3 The temperature of the endothermic event shown in can vary by about ±5°C.

[0126] like Figure 3 As shown in , the DSC thermogram of the crystalline form (I-HS) indicates a small endothermic change in the baseline between 122.9° C. and 152.8° C., followed by a sharp endotherm, which corresponds to the melting of the crystalline form (I-HS) at a melting onset temperature of 190.8° C., a melting peak temperature of 197.9° C., and a melting heat of 2.415 mW. The transition after the melting endotherm may be caused by the decomposition of the molten crystalline form (I-HS).

[0127] Figure 4A and Figure 4BIllustrated are polarized light microscopy (PLM) images of the crystalline form (I-HS) under (A) non-polarized light and (B) polarized light according to some embodiments. The presence of crystallinity (birefringence) was determined using an Olympus BX50 polarizing microscope equipped with a Motic camera and image capture software (Motic ImagesPlus 2.0). All images were recorded using a 20x objective. The crystalline form (I-HS) exhibited birefringence without a clear morphology or aggregates when examined under polarized light.

[0128] Figure 5 The dynamic vapor sorption (DVS) isotherm of the crystal form (I-HS) according to one embodiment is illustrated. To perform the DVS measurement, a sample of the crystal form (I-HS) is cycled by changing the humidity conditions to determine its hygroscopicity. The sample is analyzed using a surface measurement system DVS-1 dynamic vapor sorption system (Surface Measurement System DVS-1 Dynamic VaporSorption System). About 10 mg of the crystal form (I-HS) is placed in a mesh vapor sorption balance pan and loaded into a dynamic vapor sorption balance as a component of the Surface Measurement System. Data is collected at 1 minute intervals. Nitrogen is used as a carrier gas. The sampled crystal form (I-HS) is subjected to an increasing curve of 20% to 90% relative humidity (RH) in 10% increments, maintaining the sample at each step until a stable weight is reached (99.5% step completion). After the adsorption cycle is completed, the sample is dried using the same procedure, but it is always reduced to 0% RH and finally returned to the starting point of 20% RH. Plotting the weight change during the adsorption / desorption cycle allows the hygroscopic properties of the sample to be determined.

[0129] like Figure 5 As shown in Figure 1, Form (I-HS) appears to be non-hygroscopic. A small increase in mass of about 1.7% was observed between 0% RH and 90% RH during the adsorption cycle. In addition, very little hysteresis was observed between the adsorption and desorption cycles. The XRPD pattern of Form (I-HS) after DVS analysis (not shown) is similar to Figure 1 or Fig.29 The XRPD pattern before DVS is similar to that shown in , indicating that the crystalline form (I-HS) did not change during DVS.

[0130] Figure 6 The infrared (IR) spectrum curve of the crystalline form (I-HS) of the compound of Formula I according to one embodiment is illustrated. The IR spectrum was performed on a Bruker ALPHA P spectrometer. Sufficient material of the crystalline form (I-HS) was placed on the center of the spectrometer plate and a 4 cm -1The transmittance spectrum was obtained with a resolution of 16 scans, a background scan time of 16 scans, and a sample scan time of 16 scans, and the transmittance spectrum was obtained from 4000 cm -1 Up to 400cm -1 Data collection. The IR spectrum of the observed crystalline form (I-HS) is shown in Figure 6 middle.

[0131] Crystalline Form (I-HS) has a number of properties that make it unexpectedly superior to the amorphous form of (S)-N-(5-((R)-2-(2,5-difluorophenyl)-pyrrolidin-1-yl)-pyrazolo[1,5-a]pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide hydrogen sulfate (AM(HS)). For example, Crystalline Form (I-HS) has properties that aid in its manufacturability and production as a commercial product. As shown in Example 8, Crystalline Form (I-HS) has better flow properties than the amorphous API (AM(HS)), as demonstrated by Carr's and Hausner Index. For example, Crystalline Form (I-HS) exhibits a Carr's Index value of greater than 20%. In some embodiments, Crystalline Form (I-HS) exhibits a Hausner Ratio of less than 1.35 (e.g., a value between about 1.26 to about 1.34). Differences in flow properties can make amorphous APIs more difficult to develop into solid oral dosage forms than crystalline APIs.

[0132] The crystalline form (I-HS) also demonstrated good stability in an accelerated stability study conducted at 40°C / 75%RH for 5 weeks in LDPE bags. While neither AM (HS) nor the crystalline form (I-HS) exhibited significant changes in chemical impurity content during the course of the study, the study did reveal that the crystalline form (I-HS) had stable physicochemical properties. On the other hand, the amorphous API was converted into a crystalline form substantially similar to the crystalline form (I-HS) (by XRPD, DSC, TGA, KF and polarized light microscopy). In addition, the amorphous API became an agglomerated powder with reduced flow properties during the course of the stability test. These changes in the physical properties of the compound during storage (including the amorphous powder becoming a crystalline substance and / or an agglomerated powder with reduced flow) can make it almost impossible to manufacture a solid oral dosage form based on the amorphous compound for use by patients. However, the properties observed for the crystalline form (I-HS) are consistent with those expected for commercial products, including having a stable physical and chemical structure.

[0133] As previously described, Form (I-HS) is non-hygroscopic. As used herein, "non-hygroscopic" means that the compound exhibits less than 2% weight gain after 24 to 48 hours at 25°C and 80% RH (see, e.g., Example 10). However, the AM(HS) compound was found to deliquesce after exposure to humidity. In view of this tendency, the use of the AM(HS) compound may require significant handling precautions during storage and manufacturing to prevent this form change from occurring, while Form (I-HS) does not require these precautions during the manufacture of the API. It is also expected that this stability to humidity extends to any solid oral dosage product prepared using Form (I-HS).

[0134] Finally, the crystalline form (I-HS) provides a significantly improved impurity profile relative to the amorphous API. The ability to control the impurity profile is critical for patient safety, developing reproducible manufacturing methods, and satisfying regulatory authorities prior to use in humans.

[0135] The compounds provided herein, including (S)-N-(5-((R)-2-(2,5-difluorophenyl)-pyrrolidin-1-yl)-pyrazolo[1,5-a]pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide (Formula I) and pharmaceutically acceptable salts thereof (e.g., hydrogen sulfate salts) and further novel crystalline forms of hydrogen sulfate salts (crystalline form (I-HS)) exhibit Trk family protein tyrosine kinase inhibitory effects, and the compounds, their hydrogen sulfate salts and crystalline forms can be used to treat pain, inflammation, cancer and certain infectious diseases.

[0136] Some embodiments include the use of the crystalline form (I-HS) for treating conditions and diseases that can be treated by inhibiting TrkA, TrkB and / or TrkC kinases (e.g., TrkA, TrkB and / or TrkC-mediated conditions, such as one or more conditions described herein, including Trk-related cancers). In some embodiments, the crystalline form (I-HS) can also be used to treat pain (including chronic and acute pain). In some embodiments, the crystalline form (I-HS) can be used to treat various types of pain, including inflammatory pain, neuropathic pain, surgical pain, and pain associated with cancer, surgery and fractures. In addition, the crystalline form (I-HS) can be used to treat inflammation, active and chronic neurodegenerative diseases and certain infectious diseases. The present invention further relates to a pharmaceutical composition comprising the crystalline form (I-HS). In some embodiments, the pharmaceutical composition comprises the crystalline form (I-HS) and a pharmaceutically acceptable diluent or carrier.

[0137] The ability of the crystalline form (I-HS) to act as a TrkA, TrkB and / or TrkC inhibitor can be demonstrated by testing as described in Examples A and B disclosed in U.S. Patent No. 8,513,263, issued on August 20, 2013, which is incorporated herein by reference.

[0138] In some embodiments, provided herein is a method for treating a patient diagnosed with a Trk-related cancer, comprising administering to the patient a therapeutically effective amount of a crystalline form (I-HS) or a compound of Formula I or a salt thereof, such as a bisulfate salt (e.g., see Example 14A of U.S. Pat. No. 8,513,263). The Trk family of neurotrophic factor receptors, TrkA, TrkB and TrkC (encoded by NTRK1, NTRK2 and NTRK3 genes, respectively) and their neurotrophic factor ligands regulate the growth, differentiation and survival of neurons. Disorders of NTRK genes, Trk proteins or their expression or activity or levels (e.g., translocations involving the NTRK kinase domain, mutations involving the TRK ligand-binding site, amplification of NTRK genes, Trk mRNA splice variants and Trk autocrine / paracrine signaling) are described in a variety of tumor types and may contribute to tumor formation. Recently, NTRK1 fusions were described in a small group of adenocarcinoma lung cancer patients. 2 Translocations of NTRK1, NTRK2, and NTRK3, resulting in the production of constitutively active TrkA, TrkB, and TrkC fusion proteins, are oncogenic and prevalent in a wide range of tumor types, including lung adenocarcinoma, thyroid cancer, head and neck cancer, glioblastoma, and others.

[0139] In some embodiments, the disorder of NTRK genes, Trk proteins or their expression or activity or level comprises overexpression of wild-type TrkA, TrkB or TrkC (e.g., resulting in autocrine activation). In some embodiments, the disorder of NTRK genes, Trk proteins or their expression or activity or level comprises overexpression, activation, amplification or mutation of a chromosome fragment (comprising NTRK1, NTRK2 or NTKR3 genes or a portion thereof). In some embodiments, the disorder of NTRK genes, Trk proteins or their expression or activity or level comprises one or more chromosomal translocations or inversions that cause NTRK1, NTRK2 or NTRK3 gene fusions, respectively. In some embodiments, the disorder of NTRK genes, Trk proteins or their expression or activity or level is the result of gene translocation, wherein the expressed protein is a fusion protein containing residues from non-TrkA chaperones and TrkA, non-TrkB chaperones and TrkB or non-TrkC chaperones and TrkC proteins, and comprises a minimal functional TrkA, TrkB or TrkC kinase domain, respectively.

[0140] In some embodiments, the TrkA fusion protein is one of the TrkA fusion proteins shown in Table 10, wherein:

[0141] Table 10. Exemplary TrkA fusion proteins and cancers

[0142]

[0143]

[0144] A Créancier et al., Cancer Lett. 365(1): 107-111, 2015.

[0145] B U.S. Patent Application Publication No. 2015 / 0315657.

[0146] C U.S. Patent Application Publication No. 2015 / 0283132.

[0147] D Egren et al., Cancer Res. 75(15 Supplement): 4793, 2015.

[0148] In some embodiments, the disorder of NTRK genes, Trk proteins, or their expression or activity or level comprises one or more deletions, insertions, or point mutations in TrkA proteins. In some embodiments, the disorder of NTRK genes, Trk proteins, or their expression or activity or level comprises a deletion of one or more residues derived from TrkA proteins, resulting in constitutive activity of the TrkA kinase domain. In some embodiments, the deletion comprises a deletion of amino acids 303-377 in TrkA isoform 2.

[0149] In some embodiments, the dysregulation of NTRK genes, Trk proteins, or their expression or activity or levels comprises at least one point mutation in the NTRK1 gene that results in a TrkA protein having one or more amino acid substitutions compared to a wild-type TrkA protein (e.g., see the point mutations listed in Table 11).

[0150] Table 11. Activating TrkA point mutations

[0151] Point mutation Rationale <![CDATA[R33W 1 ]]> A336E Close to NGF binding site A337T Close to NGF binding site R324Q or R324W Close to NGF binding site V420M Close to the membrane R444Q or R444W Close to the membrane G517R or G517V P-Ring K538A activation R649W or R649L Arginine stabilizes the autoinhibited conformation. R682S Activation Ring V683G Activation Ring R702C exposed to form face-to-face disulfide-linked dimers <![CDATA[C1879T 2 ]]>

[0152] 1 Zhang et al., Blood 124(21):1682, 2014. Mutations found in T-cell prolymphocytic leukemia.

[0153] 2 Park et al., Proc. Natl. Acad. Sci. USA 112(40): 12492-12497, 2015. Mutations found in colorectal cancer.

[0154] In some embodiments, the dysregulation of the NTRK gene, Trk protein, or their expression or activity or level comprises a splice variation of TrkA mRNA that results in an expressed protein that is another alternative spliced ​​variant of TrkA that lacks at least one residue (compared to the wild-type TrkA protein), resulting in constitutive activity of the TrkA kinase domain. In some embodiments, the constitutively active alternative splice form of TrkA has a deletion of exons 8, 9, and 11 that results in an expressed protein that lacks residues 192-284 and 393-398 relative to TrkA isoform 2, a deletion of exon 10 in TrkA, or a deletion in the NTRK1 gene encoding a TrkA protein with a 75 amino acid deletion in the transmembrane domain (Reuther et al., Mol. Cell Biol. 20: 8655-8666, 2000).

[0155] Cancers identified as having dysregulation of NTRK genes, Trk proteins, or their expression or activity or levels (see references cited herein and the websites www.cancer.gov and www.nccn.org) include:

[0156] (A) Cancers in which the dysregulation of NTRK genes, Trk proteins, or their expression or activity or levels comprises one or more chromosomal translocations or inversions producing TrkA fusion proteins, for example comprising:

[0157]

[0158] (B) Cancers in which the dysregulation of NTRK genes, Trk proteins, or their expression or activity or levels comprises one or more deletions, insertions or mutations in TrkA protein, for example comprising:

[0159]

[0160] (C) Cancers in which the NTRK gene, Trk protein, or the dysregulation of their expression, activity or level, including overexpression of wild-type TrkA (autocrine activation), for example, include:

[0161]

[0162]

[0163] In some embodiments, dysregulation of an NTRK gene, Trk protein, or their expression or activity or levels comprises a translocation resulting in expression of a TrkB fusion protein (eg, one of the TrkB fusion proteins shown in Table 12).

[0164] Table 12. Exemplary TrkB fusion proteins and cancers

[0165]

[0166] In some embodiments, dysregulation of an NTRK gene, Trk protein, or their expression or activity or levels comprises a translocation resulting in expression of a TrkC fusion protein (eg, one of the TrkC fusion proteins shown in Table 13).

[0167] Table 13. Exemplary TrkC fusion proteins and cancers

[0168]

[0169]

[0170] B Tannenbaum et al., Cold Spring Harb. Mol. Case Study 1:a000471, 2015.

[0171] C U.S. Patent Application Publication No. 2015 / 0315657.

[0172] In some embodiments, provided herein is a method of treating a patient diagnosed with a Trk-related cancer, comprising administering to the patient a therapeutically effective amount of a crystalline form (I-HS) or a compound of Formula I or a salt thereof, such as a hydrogen sulfate salt (e.g., see Example 14A of U.S. Pat. No. 8,513,263). For example, the Trk-related cancer can be selected from: non-small cell lung cancer, papillary thyroid cancer, glioblastoma multiforme, acute myeloid leukemia, colorectal cancer, large cell neuroendocrine carcinoma, prostate cancer, neuroblastoma, pancreatic cancer, melanoma, squamous cell carcinoma of the head and neck, gastric cancer, Spitz carcinoma, papillary thyroid cancer, colon cancer, acute myeloid leukemia, sarcoma, pediatric glioma, intrahepatic bile duct carcinoma, pilocytic astrocytoma, low-grade glioma, lung adenocarcinoma, salivary gland carcinoma, secretory breast cancer, fibrosarcoma, renal tumor, and breast cancer.

[0173] In some embodiments, the Trk-related cancer is selected from: Non-limiting examples of TRK-related cancers include: Spitzoid melanoma, Spitz tumor (e.g., metastatic Spitz tumor), non-small cell lung cancer (NSCLC), thyroid cancer (e.g., papillary thyroid carcinoma (PTC)), acute myeloid leukemia (AML), sarcoma (e.g., undifferentiated sarcoma or adult soft tissue sarcoma), pediatric glioma, colorectal cancer (CRC), glioblastoma multiforme (GBM), large cell neuroendocrine cancer (LCNEC), thyroid cancer, intrahepatic bile duct carcinoma (ICC), pilocytic astrocytoma, low grade glioma, head and neck squamous cell carcinoma, adenocarcinoma (e.g., lung adenocarcinoma) , salivary gland cancer, secretory breast cancer, breast cancer, acute myeloid leukemia, fibrosarcoma, nephroma, melanoma, bronchogenic carcinoma, B-cell cancer, Bronchus cancer, oral cavity or pharyngeal cancer, blood tissue cancer, cervical cancer, stomach cancer, kidney cancer, liver cancer, multiple myeloma, ovarian cancer, pancreatic cancer, salivary gland cancer, small intestine or appendix cancer, testicular cancer, urinary bladder cancer, uterine or endometrial cancer, inflammatory myofibroblastic tumor, gastrointestinal stromal tumor, non-Hodgkin lymphoma, neuroblastoma, small cell lung cancer, squamous cell carcinoma, esophageal-gastric cancer, skin cancer, neoplasms (e.g., melanocytic neoplasms), Spitz nevus, astrocytoma, medulloblastoma, glioma, large cell neuroendocrine tumor, bone cancer, and rectal cancer.

[0174] In some embodiments, the compounds provided herein can be used to treat Trk-related cancers in pediatric patients. For example, the compounds provided herein can be used to treat infantile sarcoma, neuroblastoma, congenital mesoblastic nephroma, brain low-grade glioma and pontine glioma.

[0175] In some embodiments, the compounds provided herein can be used to treat Trk-related cancers in combination with one or more other therapeutic agents or therapies that act by the same or a different mechanism of action.

[0176] In some embodiments, the additional therapeutic agent is selected from the group consisting of therapeutic agents targeting receptor tyrosine kinases, including cabozantinib, crizotinib, erlotinib, gefitinib, imatinib, lapatinib, nilotinib, pazopanib, pertuzumab, regorafenib, sunitinib, and trastuzumab.

[0177] In some embodiments, the additional therapeutic agent is selected from a signal transduction pathway inhibitor, including, for example, a Ras-Raf-MEK-ERK pathway inhibitor (e.g., sorafenib, trametinib, or vemurafenib), a PI3K-Akt-mTOR-S6K pathway inhibitor (e.g., everolimus, rapamycin, perifosine, or sirolimus), and a modulator of an apoptotic pathway (e.g., obataclax).

[0178] In some embodiments, the additional therapeutic agent is selected from the group consisting of cytotoxic chemotherapeutic agents including, for example, arsenic trioxide, bleomycin, cabazitaxel, capecitabine, carboplatin, cisplatin, cyclophosphamide, cytarabine, dacarbazine, daunorubicin, docetaxel, doxorubicin, etoposide, fluorouracil, gemcitabine, irinotecan, lomustine, methotrexate, mitomycin C, oxaliplatin, paclitaxel, pemetrexed, temozolomide, and vincristine.

[0179] In some embodiments, the additional therapeutic agent is selected from angiogenesis-targeted therapies, including, for example, aflibercept and bevacizumab.

[0180] In some embodiments, the additional therapeutic agent is selected from immune-targeted agents, including, for example, aldesleukin, ipilimumab, lambrolizumab, nivolumab, and sipruset-T.

[0181] In some embodiments, the additional therapeutic agent is selected from agents effective against the downstream Trk pathway, including, for example, biologic drugs that target NGF, such as NGF antibodies and panTrk inhibitors.

[0182] In some embodiments, the other therapeutic agent or therapy is radiation therapy, including, for example, radioiodide therapy, external beam radiation, and radium 223 therapy.

[0183] In some embodiments, the additional therapeutic agent includes any of the therapies or therapeutic agents listed above that are standard of care for cancers in which the cancer has a dysregulation of NTRK genes, Trk proteins, or their expression or activity or levels.

[0184] Methods for detecting dysregulation of NTRK genes, Trk proteins, or their expression or activity or levels include, for example, detecting NTRK gene translocations using, for example, fluorescence in situ hybridization (FISH) (e.g., as described in International Application Nos. PCT / US2013 / 061211, PCT / US2013 / 057495, which are incorporated herein by reference).

[0185] In some embodiments, provided herein are methods of treating cancer (e.g., a Trk-related cancer) in a patient, comprising administering to the patient a crystalline form (I-HS) or a compound of Formula I, or a salt thereof, such as a bisulfate salt (e.g., see Example 14A of U.S. Pat. No. 8,513,263) in combination with at least one other treatment or therapeutic agent. In some embodiments, the at least one other treatment or therapeutic agent is selected from radiation therapy (e.g., radioiodide therapy, external beam radiation, or radium 223 therapy), cytotoxic chemotherapeutic agents (e.g., arsenic trioxide, bleomycin, cabazitaxel, capecitabine, carboplatin, cisplatin, cyclophosphamide, cytarabine, dacarbazine, daunorubicin, docetaxel, doxorubicin, etoposide, fluorouracil, gemcitabine, irinotecan, lomustine, methotrexate, mitomycin C, oxaliplatin, paclitaxel, pemetrexed, temozolomide, or vincristine), tyrosine kinase targeted therapy (e.g., afatinib, cabozantinib, cetuximab, crizotinib, dabrafenib, erlotinib, Gefitinib, imatinib, lapatinib, nilotinib, pazopanib, panitumumab, pertuzumab, regorafenib, sunitinib, or trastuzumab), apoptosis modulators and signal transduction inhibitors (e.g., everolimus, perifosine, rapamycin, sorafenib, sirolimus, trametinib, or vemurafenib), immune-targeted therapies (e.g., aldesleukin, interferon α-2b, ipilimumab, lamuzumab, nivolumab, prednisone, or siprusatum-T), and angiogenesis-targeted therapies (e.g., aflibercept or bevacizumab), wherein the amount of the compound provided herein or a pharmaceutically acceptable salt thereof is effective to treat the cancer when combined with other treatments or therapeutic agents.

[0186] In some embodiments, the other therapeutic agent is a different Trk inhibitor. Non-limiting examples of other Trk inhibitors include (R)-2-phenylpyrrolidine substituted imidazopyridazines, AZD6918, GNF-4256, GTx-186, GNF-5837, AZ623, AG-879, altiratinib, CT327, AR-772, AR-523, AR-786, AR-256, AR-618, AZ-23, AZD7451, cabozantinib, CEP-701, CEP-751, PHA-739358, dovitinib, entrectinib, PLX7486, 6976, GW441756, MGCD516, ONO-5390556, PHA-848125AC, regorafenib, sorafenib, sunitinib, TSR-011, VM-902A, K252a, 4-aminopyrazolylpyrimidine and substituted pyrazolo[1,5-a]pyrimidine compounds.

[0187] In some embodiments, the additional therapeutic agents include: receptor tyrosine kinase-targeted therapeutic agents such as afatinib, cabozantinib, cetuximab, crizotinib, dabrafenib, erlotinib, gefitinib, imatinib, lapatinib, lestaurinib, nilotinib, pazopanib, panitumumab, pertuzumab, sunitinib, trastuzumab, AG 879, AZ-23, AZ623, 6976, GNF-5837, GTx-186, GW 441756, MGCD516, RPI-1, RXDX101, and TSR-011; RET-targeted therapeutics, such as alectinib, apatinib, cabozantinib, dovitinib, lenvatinib, motesanib, nintedanib, ponatinib, regorafenib, sunitinib, sorafenib, vatalanib, vandetanib, AUY-922, BLU6864, DCC-2157, MGCD516, NVP-AST487, PZ-1, RXDX105, SPP86, TG101209, and XL-184; signal transduction pathway inhibitors, such as Ras-Raf-MEK-ERK pathway inhibitors (e.g., binimetinib, selumetinib, enkefibrate); nivolumab (encorafinib, sorafenib, trametinib and vemurafenib), PI3K-Akt-mTOR-S6K pathway inhibitors (e.g., everolimus, rapamycin, perifosine, sirolimus), other kinase inhibitors such as baricitinib, brigatinib, capmatinib, darusetib, ibrutinib, milciclib, quercetin, regorafenib, ruxolitinib, semaxanib, AP32788, BLU285, BLU554, INCB39110, INCB40093, INCB50465, INCB52793, INCB54828, MGCD265, NMS-088, NMS-1286937, PF 477736, PLX3397, PLX7486, PLX8394, PLX9486, PRN1008, PRN1371, RXDX103, RXDX106, RXDX108, and TG101209; checkpoint inhibitors such as ipilimumab, tesimumab, nivolumab, pidilizumab, MPDL3208A, MEDI4736, MSB0010718C, BMS-936559, BMS-956559, BMS-935559 (MDX-1105), AMP-224, and pembrolizumab; apoptosis pathway modulators agents (e.g., obataclax); cytotoxic chemotherapeutic agents, such as arsenic trioxide, bleomycin, cabazitaxel, capecitabine, carboplatin, cisplatin, cyclophosphamide, cytarabine, dacarbazine, daunorubicin, docetaxel, doxorubicin, etoposide, fluorouracil, gemcitabine, irinotecan, lomustine, methotrexate, mitomycin C, oxaliplatin, paclitaxel, pemetrexed, temozolomide, and vincristine; angiogenesis-targeted therapies, such as aflibercept and bevacizumab; immune-targeted agents, such as aldesleukin, interferon alpha-2b, ipilimumab, lamaduzumab, nivolumab, prednisone, sipruset-T;Radiation therapy, such as radioiodide therapy, external beam radiation, and radium 223 therapy. ;

[0188] Other therapeutic agents include RET inhibitors as described, for example, in U.S. Pat. Nos. 8,299,057; 8,399,442; 8,937,071; 9,006,256; and 9,035,063; U.S. Publication Nos. 2014 / 0121239; 2011 / 0053934; 2011 / 0301157; 2010 / 0324065; 2009 / 0227556; 2009 / 0130229; 2009 / 0099167; 2005 / 0209195; International Publication Nos. WO 2014 / 184069; WO 2014 / 072220; WO 2012 / 053606; WO 2009 / 017838; WO 2008 / 031551; WO 2007 / 136103; WO 2007 / 087245; WO 2007 / 057399; WO 2005 / 051366; and WO 2005 / 044835; and those in J. Med. Chem. 2012, 55(10), 4872-4876.

[0189] These other therapeutic agents can be administered with one or more compounds provided herein as part of the same or separate dosage forms, via the same or different routes of administration and on the same or different dosing schedules according to standard pharmaceutical practices known to those skilled in the art.

[0190] Also provided herein are (i) a pharmaceutical combination for treating cancer (e.g., Trk-related cancer) in a patient in need thereof, comprising (a) crystalline form (I-HS) or a compound of Formula I or a salt thereof (e.g., hydrogen sulfate salt) (e.g., see Example 14A of U.S. Patent No. 8,513,263), (b) another therapeutic agent, and (c) optionally at least one pharmaceutically acceptable carrier for simultaneous, separate or sequential treatment of a tumor disease, wherein the amount of the compound or its salt and the other therapeutic agent together is effective to treat the cancer; (ii) a pharmaceutical composition comprising the combination; (iii) use of the combination for the preparation of a medicament for treating cancer (e.g., Trk-related cancer); and (iv) a commercial package or product comprising the combination as a combined preparation for simultaneous, separate or sequential use; and a method of treating cancer (e.g., Trk-related cancer) in a patient in need thereof.

[0191] Also provided are methods of treating a subject identified or diagnosed as having a Trk-related cancer (e.g., a subject identified or diagnosed as having a Trk-related cancer by using a regulatory agency-approved, e.g., FDA-approved, kit for identifying dysregulation of NTRK genes, Trk proteins, or their expression or activity or level in a subject or in a biopsy sample of a subject) (e.g., any of the Trk-related cancers described herein or known in the art), comprising administering to the subject a therapeutically effective amount of a crystalline form (I-HS) or a compound of Formula I, or a salt thereof, such as a bisulfate salt (e.g., see Example 14A of U.S. Pat. No. 8,513,263). Also provided is a crystalline form (I-HS) or a compound of Formula I or a salt thereof, such as a hydrogen sulfate salt, for use in treating a Trk-related cancer in a subject identified or diagnosed as having a Trk-related cancer (e.g., see Example 14A of U.S. Pat. No. 8,513,263) (e.g., by using a regulatory agency-approved, e.g., FDA-approved, kit for identifying a disorder of an NTRK gene, a Trk protein, or their expression or activity or level in a subject or a biopsy sample of a subject, to identify or diagnose a subject as having a Trk-related cancer) (e.g., any of the Trk-related cancers described herein or known in the art). Also provided is the use of the crystalline form (I-HS) or a compound of Formula I or a salt thereof, such as the hydrogen sulfate salt (e.g., see Example 14A of U.S. Pat. No. 8,513,263) in the preparation of a medicament for treating a Trk-related cancer in a subject identified or diagnosed as having a Trk-related cancer (e.g., by using a kit approved by a regulatory agency, e.g., FDA, for identifying a disorder of NTRK genes, Trk proteins, or their expression or activity or level in a subject or a biopsy sample of a subject, to identify or diagnose a subject as having a Trk-related cancer) (e.g., any of the Trk-related cancers described herein or known in the art).

[0192] Also provided herein are methods for treating a subject (e.g., a subject suspected of having a Trk-related cancer, a subject presenting one or more symptoms of a Trk-related cancer, or a subject at increased risk of developing a Trk-related cancer), comprising performing an analysis (e.g., analysis using next generation sequencing, immunohistochemistry, or break-apart FISH analysis) of a sample obtained from the subject (e.g., using a kit approved by a regulatory agency (e.g., FDA approved)) to determine whether the subject has a disorder of an NTRK gene, a Trk protein, or their expression or activity or level, and administering (e.g., specifically or selectively administering) a therapeutically effective amount of a crystalline form (I-HS) or a compound of Formula I, or a salt thereof (e.g., a bisulfate salt) (e.g., see Example 14A of U.S. Pat. No. 8,513,263). Other analyses, non-limiting analyses, that can be used in these methods are described herein. Other analyses are also known in the art. Also provided herein is the use of the crystalline form (I-HS) or a compound of Formula I or a salt thereof (e.g., hydrogen sulfate salt) (e.g., see Example 14A of U.S. Patent No. 8,513,263) for treating Trk-related cancer in a subject identified or diagnosed with Trk-related cancer, by performing an analysis (e.g., in vitro analysis) (e.g., analysis using next generation sequencing, immunohistochemistry, or break-apart FISH analysis) on a sample obtained from the subject (e.g., using a kit approved by a regulatory agency (e.g., FDA approved)) to determine whether the subject has a dysregulation of NTRK genes, Trk proteins, or their expression or activity or levels, wherein the presence of a dysregulation of NTRK genes, Trk proteins, or their expression or activity or levels identifies the subject as having Trk-related cancer. Also provided herein is the use of the crystalline form (I-HS) or a compound of Formula I or a salt thereof (e.g., hydrogen sulfate salt) (e.g., see Example 14A of U.S. Patent No. 8,513,263) for the manufacture of a medicament for treating Trk-related cancer in a subject identified or diagnosed with Trk-related cancer, by performing an analysis (e.g., in vitro analysis) (e.g., analysis utilizing next generation sequencing, immunohistochemistry, or break-apart FISH analysis) on a sample obtained from the subject (e.g., using a kit approved by a regulatory agency (e.g., FDA approved)) to determine whether the subject has a dysregulation of an NTRK gene, Trk protein, or expression or activity or level thereof, wherein the presence of a dysregulation of an NTRK gene, Trk protein, or expression or activity or level thereof identifies the subject as having a Trk-related cancer.Some embodiments of any of the methods or uses described herein further include recording in the subject's clinical record (e.g., a computer-readable medium) that a subject who has been determined by performing an analysis to have a disorder of an NTRK gene, a Trk protein, or their expression or activity or level should be administered a crystalline form (I-HS) or a compound of Formula I or a salt thereof (e.g., a hydrogen sulfate salt) (e.g., see Example 14A of U.S. Pat. No. 8,513,263).

[0193] In some embodiments of any of the methods or uses described herein, the subject has been identified or diagnosed with a cancer with a disorder of NTRK genes, Trk proteins, or their expression or activity or level (e.g., as determined using an assay or kit approved by a regulatory agency (e.g., FDA approved)). In some embodiments of any of the methods or uses described herein, the subject has a tumor that is positive for a disorder of NTRK genes, Trk proteins, or their expression or activity or level (e.g., as determined using an assay or kit approved by a regulatory agency). In some embodiments of any of the methods or uses described herein, the subject may be a subject with a tumor that is positive for a disorder of NTRK genes, Trk proteins, or their expression or activity or level (e.g., identified as positive using an assay or kit approved by a regulatory agency (e.g., FDA approved)). In some embodiments of any of the methods or uses described herein, the subject may be a subject whose tumor has a disorder of NTRK genes, Trk proteins, or their expression or activity or level (e.g., where the tumor is also identified using a kit or assay approved by a regulatory agency (e.g., FDA approved)). In some embodiments of any of the methods or uses described herein, the subject is suspected of having a Trk-related cancer. In some embodiments of any of the methods or uses described herein, the subject's clinical record indicates that the subject has a tumor with a dysregulation of an NTRK gene, Trk protein, or their expression or activity or level (and optionally the clinical record indicates that the subject should be treated with any of the compositions provided herein).

[0194] Also provided herein is a method for treating a subject, comprising administering a therapeutically effective amount of a crystalline form (I-HS) or a compound of formula I or a salt thereof (e.g., bisulfate) (e.g., see Example 14A of U.S. Pat. No. 8,513,263) to a subject whose clinical record indicates that the subject has a disorder of NTRK gene, Trk protein, or their expression, activity, or level (e.g., see Example 14A of U.S. Pat. No. 8,513,263). Also provided herein is the use of a crystalline form (I-HS) or a compound of formula I or a salt thereof (e.g., bisulfate) (e.g., see Example 14A of U.S. Pat. No. 8,513,263) for the manufacture of a medicament for a Trk-related cancer in a subject whose clinical record indicates that the subject has a disorder of NTRK gene, Trk protein, or their expression, activity, or level. Also provided herein is the use of a crystalline form (I-HS) or a compound of Formula I or a salt thereof (e.g., hydrogen sulfate) (e.g., see Example 14A of U.S. Pat. No. 8,513,263) for the manufacture of a medicament for treating a Trk-related cancer in a subject whose clinical record indicates that the subject has a disorder of NTRK genes, Trk proteins, or their expression or activity or level. Some embodiments of these methods and uses may further include: a step of analyzing a sample obtained from a subject (e.g., in vitro analysis) (e.g., analysis using next generation sequencing, immunohistochemistry, or break-apart FISH analysis) (e.g., using a kit approved by a regulatory agency (e.g., FDA approved)) to determine whether the subject has a disorder of NTRK genes, Trk proteins, or their expression or activity or level, and recording in the subject's clinical file (e.g., computer-readable medium) that the subject has been identified as having a disorder of NTRK genes, Trk proteins, or their expression or activity or level.

[0195] Also provided herein are methods for selecting a treatment for a subject (e.g., an in vitro method), comprising selecting a treatment comprising administering a therapeutically effective amount of a crystalline form (I-HS) or a compound of Formula I or a salt thereof (e.g., a bisulfate salt) (e.g., see Example 14A of U.S. Pat. No. 8,513,263) to a subject identified or diagnosed with a Trk-related cancer (e.g., any of the Trk-related cancers described herein or known in the art) (e.g., a subject identified or diagnosed with a Trk-related cancer using a regulatory agency-approved (e.g., FDA-approved) kit for identifying a subject or a biopsy sample from a subject for disorders of NTRK genes, Trk proteins, or their expression or activity or level). Some embodiments may further include administering a selected treatment to a subject identified or diagnosed with a Trk-related cancer. Some embodiments may further include the step of performing an analysis (e.g., an in vitro analysis) (e.g., an analysis utilizing next generation sequencing, immunohistochemistry, or break-apart FISH analysis) on a sample obtained from a subject (e.g., using a kit approved by a regulatory agency (e.g., FDA approved)) to determine whether the subject has a disorder of an NTRK gene, Trk protein, or their expression or activity or level, and identifying or diagnosing a subject determined to have a disorder of an NTRK gene, Trk protein, or their expression or activity or level as having a Trk-related cancer.

[0196] Also provided herein are methods for selecting a treatment for a subject, comprising administering a therapeutically effective amount of a crystalline form (I-HS) or a compound of Formula I, or a salt thereof (e.g., bisulfate salt) (e.g., see Example 14A of U.S. Patent No. 8,513,263), wherein these methods include the step of performing an analysis (e.g., in vitro analysis) (e.g., analysis utilizing next generation sequencing, immunohistochemistry, or break-apart FISH analysis) on a sample obtained from the subject (e.g., using a kit approved by a regulatory agency (e.g., FDA approved)) to determine whether the subject has a disorder of an NTRK gene, Trk protein, or their expression or activity or level, and identifying or diagnosing a subject determined to have a disorder of an NTRK gene, Trk protein, or their expression or activity or level as having a Trk-related cancer, and selecting a therapeutic treatment for a subject identified or diagnosed as having a Trk-related cancer comprising administering a therapeutically effective amount of a crystalline form (I-HS) or a compound of Formula I, or a salt thereof (e.g., bisulfate salt) (e.g., see Example 14A of U.S. Patent No. 8,513,263). Some embodiments further comprise administering a selected treatment to a subject identified or diagnosed with a Trk-related cancer.

[0197] Also provided herein are methods of selecting a subject for treatment comprising administering a therapeutically effective amount of a crystalline form (I-HS) or a compound of Formula I or a salt thereof (e.g., bisulfate salt) (e.g., see Example 14A of U.S. Pat. No. 8,513,263), the methods comprising selecting, identifying or diagnosing a subject with a Trk-related cancer, and selecting a subject for treatment comprising administering a therapeutically effective amount of a crystalline form (I-HS) or a compound of Formula I or a salt thereof (e.g., bisulfate salt) (e.g., see Example 14A of U.S. Pat. No. 8,513,263). In some embodiments, identifying or diagnosing a subject with a Trk-related cancer may include performing an analysis (e.g., in vitro analysis) (e.g., analysis using next generation sequencing, immunohistochemistry, or break-apart FISH analysis) of a sample obtained from the subject (e.g., using a kit approved by a regulatory agency (e.g., FDA approved)) to determine whether the subject has a dysregulation of an NTRK gene, Trk protein, or their expression or activity or level, and identifying or diagnosing a subject determined to have a dysregulation of an NTRK gene, Trk protein, or their expression or activity or level as having a Trk-related cancer. In some embodiments, the selected treatment can be used as part of a clinical study involving administration of various treatments for Alk-associated cancers.

[0198] In some embodiments of any of the methods or uses described herein, the assays used to determine whether a subject has a dysregulation of NTRK genes, Trk proteins, or their expression or activity or levels using a sample (e.g., a biological sample or a biopsy sample (e.g., a paraffin-embedded biopsy sample) from a subject (e.g., a subject suspected of having a Trk-related cancer, a subject having one or more symptoms of a Trk-related cancer, and / or a subject at increased risk of developing a Trk-related cancer) may include, for example, next generation sequencing, immunohistochemistry, fluorescence microscopy, break-apart FISH analysis, Southern blot, Western blot, FACS analysis, Northern blot, and PCR-based amplification (e.g., RT-PCR). As is well known in the art, these assays are typically performed using, for example, at least one labeled nucleic acid probe or at least one labeled antibody or antigen-binding fragment thereof. The assays may utilize other detection methods known in the art for detecting dysregulation of NTRK genes, Trk proteins, or their expression or activity or levels (e.g., see references cited herein).

[0199] In some embodiments, the crystalline form (I-HS) or the compound of formula I or its salt, such as the bisulfate salt (e.g., see Example 14A of U.S. Patent No. 8,513,263) is used to treat chronic and acute pain, including pain associated with cancer, surgery and fractures. The crystalline form (I-HS) or the compound of formula I or its salt, such as the bisulfate salt (e.g., see Example 14A of U.S. Patent No. 8,513,263) can be used to treat various types of pain, including inflammatory pain, neuropathic pain, and pain associated with cancer, surgery and fractures. The crystalline form (I-HS) or the compound of formula I or its salt, such as the bisulfate salt (e.g., see Example 14A of U.S. Patent No. 8,513,263) can also be used to treat cancer, including neuroblastoma, ovarian, pancreatic and colorectal cancer. The crystalline form (I-HS) or the compound of formula I or its salt, such as the bisulfate salt (e.g., see Example 14A of U.S. Patent No. 8,513,263) can also be used to treat inflammation and certain infectious diseases. In addition, the crystalline form (I-HS) or the compound of formula I or its salt, such as bisulfate (e.g., see Example 14A of U.S. Patent No. 8,513,263) can also be used to treat interstitial cystitis (IC), painful bladder syndrome (PBS), urinary incontinence, asthma, anorexia, atopic dermatitis and psoriasis. The crystalline form (I-HS) or the compound of formula I or its salt (e.g., bisulfate) (e.g., see Example 14A of U.S. Patent No. 8,513,263) can also be used to treat demyelination and myelination disorders by promoting myelination, neuronal survival and oligodendrocyte differentiation via blocking Sp35-TrkA interaction. The crystalline form (I-HS) or the compound of formula I or its salt (e.g., bisulfate) (e.g., see Example 14A of U.S. Patent No. 8,513,263) can be used to treat various types of pain, including inflammatory pain, neuropathic pain, surgical pain and pain associated with cancer. Crystalline form (I-HS) or a compound of Formula I or a salt thereof (e.g., bisulfate salt) (e.g., see Example 14A of U.S. Pat. No. 8,513,263) can be used to treat bone-related diseases (e.g., those involving bone resorption). Examples of bone-related diseases include metastatic bone disease, treatment-induced bone loss, osteoporosis, rheumatoid arthritis, ankylosing spondylitis, Paget's disease, and periodontal disease. Osteoporosis can be attributed to (1) menopause in women, (2) aging in men or women, (3) suboptimal bone growth during childhood and adolescence that results in failure to reach peak bone mass, and / or (4) bone loss secondary to other disease conditions, dietary disorders, medications, and / or medical treatments. Other osteolytic diseases that can be treated according to the methods provided herein are more limited. A specific example is metastatic tumor-induced osteolysis. In this condition, bone cancer or bone metastasis induces localized osteolysis, resulting in pain, bone fragility, and fractures.This localized osteolysis also allows for increased tumor growth by creating more space in the bone for these tumors and by releasing growth factors from the bone matrix. Cancers currently known to cause tumor-induced osteolysis include hematological malignancies (e.g., myeloma and lymphoma) and solid tumors (e.g., breast, prostate, lung, kidney, and thyroid), all of which are encompassed by the present invention. As used herein, the term "treatment" includes prevention as well as treatment of existing conditions.

[0200] Thus, also provided herein are methods for treating a disease or medical condition in a subject in need thereof, wherein the disease or condition can be treated with an inhibitor of TrkA and / or TrkB (e.g., Trk-related cancer), comprising administering to the subject an amount of crystalline form (I-HS) or a compound of formula I or a salt thereof (e.g., bisulfate) effective to treat or prevent the condition (e.g., see Example 14A of U.S. Pat. No. 8,513,263). In a specific embodiment, provided herein are methods for treating pain, cancer, inflammation, neurodegenerative disease, or Trypanosoma cruzi infection in a mammal, comprising administering to the mammal a therapeutically effective amount of crystalline form (I-HS) or a compound of formula I or a salt thereof (e.g., bisulfate) (e.g., see Example 14A of U.S. Pat. No. 8,513,263). In another embodiment, provided herein are methods for treating osteolytic diseases in a mammal, comprising administering to the subject in need thereof a therapeutically effective amount of crystalline form (I-HS) or a compound of formula I or a salt thereof (e.g., bisulfate) (e.g., see Example 14A of U.S. Pat. No. 8,513,263).

[0201] The crystalline form (I-HS) or the compound of Formula I or a salt thereof (e.g., hydrogen sulfate) (e.g., see Example 14A of U.S. Pat. No. 8,513,263) can be used in combination with one or more other drugs that act by the same or different mechanisms of action. Such combination therapy can be achieved by simultaneous, sequential or separate administration of the individual components of the treatment. Examples include anti-inflammatory compounds, steroids (e.g., dexamethasone, cortisone and fluticasone), analgesics such as NSAIDs (e.g., aspirin, ibuprofen, indomethacin and ketoprofen), and opioids (e.g., morphine) and chemotherapeutic agents.

[0202] In the field of medical oncology, it is common practice to use a combination of different forms of treatment to treat each patient with cancer. In medical oncology, the other components of the combined treatment in addition to the compositions provided herein may be, for example, surgery, radiotherapy, chemotherapy, signal transduction inhibitors and / or monoclonal antibodies.

[0203] Thus, the crystalline form (I-HS) can be administered in combination with one or more agents selected from the group consisting of mitotic inhibitors, alkylating agents, antimetabolites, antisense DNA or RNA, intercalating antibiotics, growth factor inhibitors, signal transduction inhibitors, cell cycle inhibitors, enzyme inhibitors, retinoid receptor modulators, proteasome inhibitors, topoisomerase inhibitors, biological response modifiers, antihormones, angiogenesis inhibitors, cell growth inhibitors, antiandrogens, targeting antibodies, HMG-CoA reductase inhibitors, and prenyl-protein transferase inhibitors.

[0204] When the compounds disclosed herein have at least one chiral center, then these compounds can therefore exist as enantiomers. If the compounds have two chiral centers, then these compounds can additionally exist as diastereomers. That is, the compound of formula I, in addition to having the desired configuration named by nomenclature "(S)-N-(5-((R)-2-(2,5-difluorophenyl)-pyrrolidin-1-yl)-pyrazolo[1,5-a]pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide hydrogen sulfate" (hereinafter referred to as (S,R) isomer), it can also exist in very small amounts as the isomer (R)-N-(5-((R)-2-(2,5-difluorophenyl)-pyrrolidin-1-yl)-pyrazolo[1,5-a]pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide hydrogen sulfate (hereinafter referred to as (R,R) The present invention discloses a novel isomer (S)-N-(5-((S)-2-(2,5-difluorophenyl)-pyrrolidin-1-yl)-pyrazolo[1,5-a]pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide hydrogen sulfate (hereinafter referred to as the (S,S) isomer) and / or may also exist in very small amounts as (S)-N-(5-((S)-2-(2,5-difluorophenyl)-pyrrolidin-1-yl)-pyrazolo[1,5-a]pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide hydrogen sulfate (hereinafter referred to as the (S,S) isomer) and / or may exist in very small amounts as the isomer (R)-N-(5-((S)-2-(2,5-difluorophenyl)-pyrrolidin-1-yl)-pyrazolo[1,5-a]pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide hydrogen sulfate (hereinafter referred to as the (R,S) isomer). It should be understood that all these isomers and mixtures thereof are encompassed within the scope of the present invention. Preferably, wherein the compound is present as the (S,R) isomer, the (S,R) isomer is present in an excess of greater than or equal to about 80%, more preferably in an excess of greater than or equal to about 90%, even more preferably in an excess of greater than or equal to about 95%, even more preferably in an excess of greater than or equal to about 98%, and even more preferably in an excess of greater than or equal to about 99%.

[0205] It is understood that the crystalline form (I-HS) contains two asymmetric centers and can therefore be prepared and isolated as a mixture of isomers (e.g., a racemic or diastereomeric mixture) or in enantiomerically pure form. Where stereochemistry is specified by a solid wedge or dashed line representing a specific configuration, the stereoisomer is so specified and defined.

[0206] As used herein, unless otherwise stated, the term "isolated form" shall mean a compound that exists in a form separated from any solid mixture, solvent system, or biological environment with another compound. In some embodiments, the crystalline form (I-HS) exists in an isolated form.

[0207] As used herein, unless otherwise stated, the term "substantially pure form" shall mean that the molar percentage of impurities in the isolated compound or crystalline form is less than about 5 mol%, preferably less than about 2 mol%, more preferably less than about 0.5 mol%, and most preferably less than about 0.1 mol%. In some embodiments, the crystalline form (I-HS) is present in a substantially pure form.

[0208] As used herein, unless otherwise stated, the term "substantially free of other amorphous forms, polymorphs or crystalline forms" when used to describe Form (I-HS) shall mean that the mole percentage of other amorphous forms, polymorphs or crystalline forms of the isolated base of Form (I-HS) is less than about 5 mole%, preferably less than about 2 mole%, more preferably less than about 0.5 mole%, and most preferably less than about 0.1 mole%. In some embodiments, Form (I-HS) is present in a form that is substantially free of other amorphous forms, polymorphs or crystalline forms.

[0209] The terms "polymorph and polymorphic form" refer to different crystalline forms of a single compound. That is, polymorphs are different solids with the same molecular formula, but each polymorph may have different solid-state physical properties. Thus, a single compound may produce multiple polymorphic forms, each of which has different and unique solid-state physical properties, such as different solubility properties, dissolution rates, melting point temperatures, fluidity, and / or different X-ray diffraction peaks. Differences in physical properties can affect drug parameters such as storage stability, compressibility, and density (which can be important in formulation and product manufacturing) and dissolution rate (which can be an important factor in bioavailability). Techniques for characterizing polymorphs include, but are not limited to, X-ray powder diffraction (XRPD), differential scanning calorimetry (DSC), thermogravimetric analysis (TGA), single crystal X-ray diffraction (XRD), vibrational spectroscopy (e.g., infrared (IR) spectroscopy and Raman spectroscopy, solid-state and solution nuclear magnetic resonance (NMR) spectroscopy), optical microscopy, hot-stage optical microscopy, scanning electron microscopy (SEM), electron crystallography and quantitative analysis, particle size analysis (PSA), surface area analysis, solubility measurements, dissolution measurements, elemental analysis, and Karl Fischer analysis.

[0210] The term "amorphous" means a solid in a non-crystalline state in the solid state. An amorphous solid is a disordered arrangement of molecules and therefore has no distinguishable lattice or unit cell and therefore no definable long-range order. The solid state form of a solid can be determined by polarized light microscopy, X-ray powder diffraction ("XRPD"), differential scanning calorimetry ("DSC"), or other standard techniques known in the art.

[0211] As used herein, unless otherwise indicated, the terms "treating," "treatment," and the like shall include the management and care of a subject or patient (preferably a mammal, more preferably a human) for the purpose of combating a disease, disorder or condition and includes the administration of the disclosed compounds to alleviate symptoms or complications or reduce the rate of progression of the disease, disorder or condition.

[0212] As used herein, unless otherwise stated, the term "preventing" shall include (a) reducing the frequency of one or more symptoms; (b) reducing the severity of one or more symptoms; (c) delaying or avoiding the development of other symptoms; and / or (d) delaying or avoiding the development of a disorder or condition.

[0213] As used herein, the term "Trk-related cancer" should be defined to include cancers associated with or having a disorder of NTRK genes, Trk proteins, or their expression or activity or levels (e.g., any of the types of disorders of NTRK genes, Trk proteins, or their expression or activity or levels described herein). Non-limiting examples of Trk-related cancers are described herein.

[0214] As used herein, the term "pain" shall be defined to include acute, chronic, inflammatory and neuropathic pain, including diabetic neuropathy. In addition, pain may be centrally mediated, peripherally mediated, caused by structural tissue damage, caused by soft tissue damage, or caused by progressive disease. Any centrally mediated, peripherally mediated, structural tissue damage, soft tissue damage, or progressive disease-related pain may be acute or chronic.

[0215] As used herein, unless otherwise stated, pain shall include inflammatory pain, centrally mediated pain, peripherally mediated pain, visceral pain, structure-related pain, cancer pain, pain associated with soft tissue injury, pain associated with progressive diseases, neuropathic pain, acute pain from acute injury, acute pain from trauma, acute pain from surgery, headache, dental pain, back pain (preferably lumbar pain), chronic pain from neuropathic disorders, and chronic pain from post-stroke disorders.

[0216] Some embodiments include methods of treating pain, wherein the pain is acute pain. Some embodiments include methods of treating pain, wherein the pain is chronic pain. Some embodiments include methods of treating pain, wherein the pain is neuropathic pain, including diabetic neuropathy. Some embodiments include methods of treating pain, wherein the pain is inflammatory pain.

[0217] In some embodiments, the pain is selected from the group consisting of osteoarthritis, rheumatoid arthritis, fibromyalgia, headache, toothache, burns, sunburn, animal bites (e.g., dog bites, cat bites, snake bites, spider bites, insect bites, and the like), neurogenic bladder disorder, benign prostatic hypertrophy, interstitial cystitis, rhinitis, contact dermatitis / allergy, pruritus, eczema, pharyngitis, mucositis, enteritis, cellulitis, causalgia, sciatica, mandibular joint neuralgia, peripheral neuritis, polyneuritis, stump pain, phantom limb pain, postoperative ileus, cholecystitis, postmastectomy pain syndrome, oral neuropathic pain, Charcot's pain pain), reflex sympathetic dystrophy, Guillain-Barre syndrome, meralgia paresthesia, burning mouth syndrome, post-herpetic neuralgia, trigeminal neuralgia, peripheral neuropathy, bilateral peripheral neuropathy, diabetic neuropathy, postherpetic neuralgia, trigeminal neuralgia, optic neuritis, postfebrile neuritis, migratory neuritis, segmental neuritis, Gombault's neuritis, neuronitis, cervicobrachial neuralgia, cranial neuralgia, geniculate ganglion neuralgia, glossopharyngeal neuralgia, migraine neuralgia, idiopathic neuralgia, intercostal neuralgia, breast neuralgia, Morton's neuralgia, nasociliary neuralgia, occipital neuralgia, erythematous neuralgia, Sluder's neuralgia neuralgia), sphenopalatine neuralgia, supraorbital neuralgia, vidian neuralgia, inflammatory bowel disease, irritable bowel syndrome, labor, delivery, menstrual cramps, cancer, back pain, low back pain and carpal tunnel syndrome pain.

[0218] Acute pain includes pain resulting from acute injury, trauma, illness, or surgery, such as open-heart surgery (including open heart surgery or bypass surgery). Acute pain also includes (and is not limited to) headache, postoperative pain, kidney stone pain, gallbladder pain, gallstone pain, labor pain, rheumatic pain, dental pain, or pain resulting from sports medicine injuries, carpal tunnel syndrome, burns, musculoskeletal sprains and strains, tendon strains, cervicobrachial pain syndrome, dyspepsia, gastric ulcer, duodenal ulcer, dysmenorrhea, or endometriosis.

[0219] Chronic pain includes pain caused by inflammatory conditions, osteoarthritis, rheumatoid arthritis or disease, acute injury or sequelae of trauma. Chronic pain also includes (and is not limited to) headache, upper back pain or lumbar pain (selected from back pain caused by systemic, regional or primary spinal disease (selected from radiculopathy)), bone pain (selected from osteoarthritis, osteoporosis, bone metastasis or bone pain of unknown cause), pelvic pain, pain associated with spinal cord injury, cardiac chest pain, non-cardiac chest pain, central post-stroke pain, myofascial pain, cancer pain, AIDS pain, sickle cell pain, geriatric pain or pain caused by headache, migraine, trigeminal neuralgia, temporomandibular joint syndrome, fibromyalgia syndrome, osteoarthritis, rheumatoid arthritis, gout, fibrositis or thoracic outlet syndrome.

[0220] Neuropathic pain includes pain caused by chronic or debilitating conditions or disorders. Chronic or debilitating conditions or disorders that may lead to neuropathic pain include, but are not limited to, painful diabetic peripheral neuropathy, post-herpetic neuralgia, trigeminal neuralgia, post-stroke pain, pain associated with multiple sclerosis, neuropathy-related pain (e.g., in idiopathic or post-traumatic neuropathy and mononeuritis), HIV-related neuropathic pain, cancer-related neuropathic pain, carpal tunnel-related neuropathic pain, pain associated with spinal cord injury, complex regional pain syndrome, fibromyalgia-related neuropathic pain, low back and neck pain, reflex sympathetic dystrophy, phantom limb syndrome, and other chronic and debilitating condition-related pain syndromes.

[0221] "Acute neurodegenerative disorders or diseases" include, but are not limited to, various types of acute neurodegenerative disorders associated with neuronal death or damage, including cerebrovascular insufficiency, focal brain trauma, diffuse brain damage, and spinal cord injury, i.e., cerebral ischemia or infarction (including embolic occlusion and thrombotic occlusion), acute ischemia followed by reperfusion, perinatal hypoxic ischemic injury, cardiac arrest, and any type of intracranial hemorrhage (including, but not limited to, epidural, subdural, subarachnoid, and intracerebral), and intracranial and intraspinal lesions (including, but not limited to, contusions, penetrations, shearing, compressions, and lacerations) and whiplash shaken infant syndrome. In some embodiments, the acute neurodegenerative disorder is the result of a stroke, acute ischemic injury, head injury, or spinal cord injury.

[0222] "Chronic neurodegenerative disorders or diseases" include, but are not limited to, Alzheimer's disease, Pick's disease, diffuse Lewy body disease, progressive supranuclear palsy (Steel-Richardson syndrome), multiple system degeneration (Shy-Drager syndrome), chronic epileptic disorders associated with neurodegeneration, motor neuron diseases (including amyotrophic lateral sclerosis), degenerative disorders, cortical basal degeneration, ALS-Parkinson's-Dementia complex of Guam, subacute sclerosing panencephalitis, Huntington's disease, Parkinson's disease, synucleinopathies (including multiple system atrophy), primary progressive aphasia, striatonigral degeneration, Machado-Joseph disease / spinocerebellar disorder type 3 and olivopontocerebellar degeneration, Gilles De La Tourette's disease, bulbar and pseudobulbar palsy, spinal and spinobulbar muscular atrophy (Kennedy's disease), multiple sclerosis, primary lateral sclerosis, familial spastic paraplegia, Werdnig-Hoffmann disease, Kugelberg-Welander disease, Tay-Sach's disease, Sandhoff disease, familial spastic disorders, Wohlfart-Kugelberg-Welander disease, spastic hindquarters paresis, progressive multifocal leukoencephalopathy, familial dysautonomia (Riley-Day syndrome), and prion diseases disease) (including but not limited to Creutzfeldt-Jakob disease, Gerstmann-Straussler-Scheinker disease, Kuru, and fatal familial insomnia). In some embodiments, the chronic neurodegenerative disorder is selected from Alzheimer's disease, Parkinson's disease, multiple sclerosis, or cerebral palsy.

[0223] As used herein, the term "subject" refers to an animal, preferably a mammal, most preferably a human being, that is the target of treatment, observation or experiment. In some embodiments, the subject has experienced and / or exhibits at least one symptom of a disease or disorder to be treated and / or prevented. In some embodiments, the patient is a pediatric patient (i.e., a patient under 21 years of age at the time of diagnosis or treatment). The term "pediatric" can be further divided into a variety of subgroups, including: newborns (from birth to the first 28 days of life); infants (29 days old to less than 2 years old); children (2 years old to less than 12 years old); and adolescents (12 to 21 years old (up to (but not including) the 22nd birthday)).

[0224] In some embodiments, the subject has been identified or diagnosed with a cancer having a disorder of NTRK genes, Trk proteins, or their expression or activity or level (e.g., as determined using an assay or kit approved by a regulatory agency (e.g., FDA approved)). In some embodiments, the subject has a tumor that is positive for a disorder of NTRK genes, Trk proteins, or their expression or activity or level (e.g., as determined using an assay or kit approved by a regulatory agency). The subject may be a subject having a tumor that is positive for a disorder of NTRK genes, Trk proteins, or their expression or activity or level (e.g., identified as positive using an assay or kit approved by a regulatory agency (e.g., FDA approved)). The subject may be a subject whose tumor has a disorder of NTRK genes, Trk proteins, or their expression or activity or level (e.g., where the tumor is confirmed by identification using a kit or assay approved by a regulatory agency (e.g., FDA approved)). In some embodiments, the subject is suspected of having a Trk-related cancer. In some embodiments, the subject has a clinical record indicating that the subject has a tumor with a dysregulation of NTRK genes, Trk proteins, or their expression or activity or levels (and optionally the clinical record indicates that the subject should be treated with any of the compositions provided herein).

[0225] The term "Trk" or "Trk protein" includes any of the Trk proteins described herein (eg, TrkA, TrkB, or TrkC protein).

[0226] The term "NTRK gene" includes any of the NTRK genes described herein (eg, NTRK1, NTRK2, or NTRK3 genes).

[0227] The term "wildtype" or "wild-type" describes a nucleic acid (e.g., an NTRK gene or Trk mRNA) or protein (e.g., a Trk protein) that is found in a subject that does not have a Trk-related cancer (and optionally also does not have an increased risk of developing a Trk-related cancer or disorder and / or is not suspected of having a Trk-related cancer or disorder) or in cells or tissues from a subject that does not have a Trk-related cancer or disorder (and optionally also does not have an increased risk of developing a Trk-related cancer or disorder and / or is not suspected of having a Trk-related cancer or disorder).

[0228] The term "regulatory agency" is a national agency that approves the medical use of pharmaceutical agents. For example, a non-limiting example of a regulatory agency is the US Food and Drug Administration (FDA).

[0229] The phrase "dysregulation of NTRK genes, Trk proteins, or their expression or activity or levels" refers to gene mutations (e.g., NTRK gene translocations resulting in expression of fusion proteins, NTRK gene deletions resulting in expression of Trk proteins (including deletion of at least one amino acid compared to wild-type Trk proteins), or NTRK gene mutations resulting in expression of Trk proteins with one or more point mutations, alternative splicing versions of Trk mRNAs resulting in Trk proteins with deletion of at least one amino acid in Trk proteins compared to wild-type Trk proteins), or NTRK gene duplications resulting in overexpression of Trk proteins) or autocrine activity caused by overexpression of NTRK genes in cells, which results in a pathogenic increase in the activity of the kinase domain of the Trk protein in the cell (e.g., a constitutively active kinase domain of the Trk protein). For example, the dysregulation of NTRK genes, Trk proteins, or their expression or activity or levels may be a mutation of an NTRK1, NTRK2, or NTRK3 gene encoding a Trk protein that is constitutively active or has increased activity compared to a protein encoded by an NTRK1, NTRK2, or NTRK3 gene that does not include the mutation. For example, the dysregulation of NTRK genes, Trk proteins, or their expression or activity or levels may be the result of a gene translocation that results in the expression of a fusion protein that contains a first portion of TrkA, TrkB, or TrkC (which includes a functional kinase domain) and a second portion of a partner protein (i.e., which is not TrkA, TrkB, or TrkC). The gene encoding the fusion protein may include, for example, the following exons of a wild-type NTRK1 gene: exons 10-19, exons 12-19, exons 12-19, exons 13-19, exons 14-19, or exons 15-19. The gene encoding the fusion protein may include, for example, the following exons of the wild-type NTRK2 gene: exons 12-21, exons 13-21, exons 15-21, exons 16-21, or exons 17-21. The gene encoding the fusion protein may include, for example, the following exons of the wild-type NTRK3 gene: exons 17-22 or exons 16-22. Non-limiting examples of fusion proteins that are the result of NTRK gene translocations are described in Tables 1, 3, and 4.

[0230] Disregulation of NTRK genes, Trk proteins, or their expression, activity, or levels may include, for example, mutations in NTRK1, NTRK2, or NTRK3 genes that result in TrkA, TrkB, or TrkC containing at least one (e.g., 2, 3, 4, or 5) point mutations (e.g., one or more of the point mutations listed in Table 6). Disregulation of NTRK genes, Trk proteins, or their expression, activity, or levels may include, for example, mutations in the NTRK2 gene that result in a TrkB protein comprising a point mutation of V673M. Disregulation of NTRK genes, Trk proteins, or their expression, activity, or levels may include, for example, mutations in the NTRK3 gene that result in a TrkC protein comprising a point mutation of H677Y.

[0231] The dysregulation of NTRK genes, Trk proteins, or their expression or activity or level can be caused by one or more consecutive amino acids (e.g., at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 110, at least 120, at least 130, at least 140, at least 150, at least 160, at least 170, at least 180) in TrkA, TrkB or TrkC proteins. , at least 190, at least 200, at least 210, at least 220, at least 230, at least 240, at least 250, at least 260, at least 270, at least 280, at least 290, at least 300, at least 310, at least 320, at least 330, at least 340, at least 350, at least 360, at least 370, at least 380, at least 390, or at least 400 amino acids) in the NTRK1, NTRK2 or NTRK3 gene (except for the deletion of amino acids in the kinase domain of TrkA, TrkB or TrkC that can cause inactivation of the kinase domain). In some embodiments, dysregulation of NTRK genes, Trk proteins, or their expression or activity or levels may include a deletion of the NTRK1 gene, which results in a TrkA protein lacking an NGF binding site or exon 10 (which includes the NGF binding site), the lack of exon 10 being associated with acute myeloid leukemia.

[0232] In some examples, dysregulation of NTRK genes, Trk proteins, or their expression or activity or levels may include alternative splicing forms of Trk mRNA, e.g., TrkAIII spliced ​​variants or alternative splicing forms of TrkA mRNA, which results in the production of TrkA proteins lacking the amino acids encoded by exon 10. In some examples, dysregulation of NTRK genes, Trk proteins, or their expression or activity or levels includes amplification of NTRK genes (e.g., 1, 2, 3, or 4 extra copies of NTRK genes), which can result, for example, in autocrine expression of NTRK genes in cells.

[0233] The term "Trk-related cancer or tumor" is a cancer associated with a dysregulation of NTRK genes, Trk proteins, or their expression or activity or levels (e.g., a cancer associated with at least one instance (e.g., 2, 3, 4 or 5 instances) of a dysregulation of NTRK genes, Trk proteins, or their expression or activity or levels described herein).

[0234] As used herein, the term "mammal" refers to a warm-blooded animal having or at risk of developing a disease described herein and includes, but is not limited to, guinea pigs, dogs, cats, rats, mice, hamsters, and primates (including humans).

[0235] As used herein, the term "therapeutically effective amount" means the amount of an active compound or pharmaceutical agent that induces a biological or medical response in a tissue system, animal or human being that is sought by a researcher, veterinarian, physician or other clinician, including the alleviation of the symptoms of the disease or condition being treated. Specifically, a therapeutically effective amount is sufficient to (i) treat or prevent a specific disease, condition or condition that can be treated with an inhibitor of TrkA and / or TrkB, (ii) attenuate, improve or eliminate one or more symptoms of the specific disease, condition or condition, or (iii) prevent or delay the onset of one or more symptoms of a specific disease, condition or condition described herein when administered to a subject in need of such treatment. The amount of Form (I-HS) corresponding to this therapeutically effective amount will vary depending on factors such as the disease condition and its severity, the identity (e.g., weight) of the mammal in need of treatment, but can still be routinely determined by those skilled in the art.

[0236] As used herein, the term "composition" is intended to encompass a product comprising the specified ingredients in the specified amounts, as well as any product which results, directly or indirectly, from combination of the specified ingredients in the specified amounts.

[0237] To provide a more concise description, some quantitative expressions given herein are not limited by the term "about". It should be understood that the term "about", whether explicitly used or not, is intended to refer to the actual given value for each quantity given herein, and it is also intended to refer to the approximate value of the given value that can be reasonably inferred by a person skilled in the art, including the approximate value of the given value caused by experimental and / or measurement conditions.

[0238] In some embodiments, the term "about" as used herein means approximately, in the vicinity, roughly, or around. When the term "about" is used in conjunction with a numerical range, it modifies the range by extending the boundaries above and below the numerical values. Typically, the term "about" as used herein modifies a numerical value to vary 10% above and below the numerical value.

[0239] The term "about" before one or more peak positions in an X-ray powder diffraction pattern means that all peaks of the group defined by the term are reported as angular positions (2θ) with an allowable variability of ±0.3°. When comparing two powder X-ray diffraction patterns, it is intended to use a variability of ±0.3°. In practice, two peaks are considered to have the same angular position if the diffraction pattern peaks from one figure are assigned an angular position (2θ) range of ±0.3° of the measured peak position and if these peak position ranges overlap. For example, if a peak from one figure is determined to have a position of 11.0°, for comparison purposes, the allowable variability allows the peak to be assigned a position within the range of 10.7°-11.3°.

[0240] The term "about" preceding values ​​of DSC, TGA, TG or DTA reported in degrees Celsius has an allowable variation of ± 5°C.

[0241] To provide a more concise description, some quantitative expressions herein are listed as a range from about amount X to about amount Y. It should be understood that if a range is listed, the range is not limited to the upper and lower limits listed, but includes all ranges from about amount X to about amount Y or any range therein.

[0242] Further provided herein are pharmaceutical compositions containing the crystalline form (I-HS) and a pharmaceutically acceptable carrier. Pharmaceutical compositions containing the crystalline form (I-HS) as an active ingredient can be prepared by thoroughly mixing the crystalline form (I-HS) with a pharmaceutical carrier according to conventional pharmaceutical mixing techniques. The carrier can take a variety of forms depending on the desired route of administration (e.g., oral, parenteral). Thus, for liquid oral preparations (e.g., suspensions, elixirs, and solutions), suitable carriers and additives include water, glycols, oils, alcohols, flavoring agents, preservatives, stabilizers, colorants, and the like; for solid oral preparations (e.g., powders, capsules, and tablets), suitable carriers and additives include starch, sugar, diluents, granulating agents, lubricants, binders, disintegrants, and the like. Solid oral preparations may also be coated with substances such as sugar or enteric coatings to adjust the primary site of absorption. For parenteral administration, the carrier will generally consist of sterile water, and other ingredients may be added to increase solubility or preservation. Injectable suspensions or solutions may also be prepared using aqueous carriers and appropriate additives.

[0243] The crystalline form (I-HS) can be administered by any convenient route, for example, to the gastrointestinal tract (e.g., rectal or oral), nose, lung, muscle or blood vessels or transdermally or transdermally. The crystalline form (I-HS) can be administered in any convenient form, such as tablets, powders, capsules, solutions, dispersions, suspensions, syrups, sprays, suppositories, gels, emulsions, patches, etc. These compositions may contain conventional components of pharmaceutical preparations, such as diluents, carriers, pH modifiers, sweeteners, bulking agents and other active agents. If parenteral administration is desired, the composition is sterile and in the form of a solution or suspension suitable for injection or infusion. These compositions form another aspect of the present invention.

[0244] Also provided herein are pharmaceutical compositions comprising the crystalline form (I-HS). To prepare the pharmaceutical compositions provided herein, the crystalline form (I-HS) as the active ingredient is thoroughly mixed with a pharmaceutical carrier according to conventional pharmaceutical mixing techniques, and the carrier can be in a variety of forms depending on the desired dosage form for administration (e.g., oral or parenteral (e.g., intramuscular)). In preparing compositions in oral dosage form, any commonly used pharmaceutical medium can be used. Thus, for liquid oral preparations (e.g., suspensions, elixirs, and solutions), suitable carriers and additives include water, glycols, glycerol, oils, cyclodextrins, alcohols (e.g., ethanol), flavoring agents, preservatives, colorants, and the like; for solid oral preparations (e.g., powders, capsules, caplets, soft capsules, and tablets), suitable carriers and additives include starches, sugars, diluents, granulating agents, lubricants, binders, disintegrants, and the like. Suitable binders include, but are not limited to, starch, gelatin, natural sugars (e.g., glucose or beta-lactose), corn sweeteners, natural and synthetic gums (e.g., acacia, tragacanth), or sodium oleate, sodium stearate, magnesium stearate, sodium benzoate, sodium acetate, sodium chloride, and the like. Disintegrators include, but are not limited to, starch, methylcellulose, agar, bentonite, xanthan gum, and the like.

[0245] Tablets and capsules are easy to administer, so they represent the most advantageous oral unit dosage form, in which case, solid pharmaceutical carriers are obviously used. If desired, tablets can be coated with sugar or enteric coatings by standard techniques. For parenteral, the carrier will generally include sterile water, and other ingredients may be included, for example, for purposes such as assisting solubility or for preservation. Injectable suspensions may also be prepared, in which case suitable liquid carriers, suspending agents and the like may be used. The pharmaceutical composition herein will contain the active ingredient of the amount necessary for delivering the above-mentioned effective dose per dosage unit (e.g., tablets, capsules, powders, injections, teaspoons and the like).

[0246] The pharmaceutical compositions herein will contain about 0.1 mg to 1000 mg per dosage unit (e.g., tablets, capsules, suspensions, solutions, sachets for reconstitution, powders, injections, IV, suppositories, sublingual / lozenge films, teaspoonfuls, etc.), or any range therein, and may be administered at a dosage of about 0.01 mg / kg / day to 300 mg / kg / day, or any range therein, preferably about 0.5 mg / kg / day to 50 mg / kg / day, or any range therein. In some embodiments, the pharmaceutical compositions provided herein contain, per dosage unit, about 25 mg to about 500 mg of a compound provided herein (e.g., about 25 mg to about 400 mg, about 25 mg to about 300 mg, about 25 mg to about 250 mg, about 25 mg to about 200 mg, about 25 mg to about 150 mg, about 25 mg to about 100 mg, about 25 mg to about 75 mg, about 50 mg to about 500 mg, about 100 mg to about 500 mg, about 150 mg to about 500 mg, about 200 mg to about 500 mg, about 250 mg to about 500 mg, about 300 mg to about 500 mg, about 400 mg to about 500 mg, about 50 to about 200 mg, about 100 to about 250 mg, about 50 to about 150 mg). In some embodiments, the pharmaceutical compositions provided herein contain, per dosage unit, about 25 mg, about 50 mg, about 100 mg, about 150 mg, about 200 mg, about 250 mg, about 300 mg, about 400 mg, or about 500 mg of the compounds provided herein. However, the dosage may vary according to the patient's needs, the severity of the condition being treated, and the compound being used. In some embodiments, the dosage is once a day (QD) or twice a day (BID) administration.

[0247] Preferably, these compositions are in the form of unit dosage forms such as tablets, pills, capsules, powders, granules, sterile parenteral solutions or suspensions, metered aerosol or liquid sprays, drops, ampoules, automatic injector devices or suppositories; for oral parenteral, intranasal, sublingual or rectal administration or for administration by inhalation or insufflation. Alternatively, the composition may be in a form suitable for once-weekly or once-monthly administration; for example, an insoluble salt of the active compound (e.g., a decanoate) may be suitable for providing a long-acting preparation for intramuscular injection. For the preparation of solid compositions such as tablets, the crystalline form (I-HS) is mixed with a pharmaceutical carrier (e.g., conventional tableting ingredients such as corn starch, lactose, sucrose, sorbitol, talc, stearic acid, magnesium stearate, dicalcium phosphate or gelatin) and other pharmaceutical diluents (e.g., water) to form a solid preformulated composition containing a homogenous mixture of the crystalline form (I-HS). When referring to these pre-formulated compositions as homogeneous, it means that the active ingredient is evenly dispersed throughout the composition so that the composition can be easily subdivided into equally effective dosage forms, for example, tablets, pills and capsules. Then, this solid pre-formulated composition is subdivided into unit dosage forms of the above-described type containing 0.1 mg to about 1000 mg or any amount or range thereof of the active ingredient provided herein. The tablets or pills of the composition can be coated or compounded to provide a dosage form with a lasting effect advantage. For example, a tablet or pill can include an inner dosage component and an outer dosage component, the latter being in the form of encapsulating the former. The two components can be separated by an enteric layer, which is used to resist disintegration in the stomach and allow the inner component to enter the duodenum intact or delay release. Various materials can be used for these enteric layers or coatings, including a large amount of polymeric acids and materials such as shellac, cetyl alcohol and cellulose acetate.

[0248] The novel compositions provided herein can be included in liquid forms for oral or injection administration, including aqueous solutions, cyclodextrins, appropriately flavored syrups, aqueous or oily suspensions, and emulsions and elixirs and similar pharmaceutical vehicles using edible oils (e.g., cottonseed oil, sesame oil, coconut oil, or peanut oil) flavors. Dispersants or suspending agents suitable for aqueous suspensions include synthetic and natural colloids, such as tragacanth, gum arabic, alginate, dextran, sodium carboxymethylcellulose, methylcellulose, polyvinylpyrrolidone, or gelatin. For parenteral administration, sterile suspensions and solutions are desirable. When intravenous administration is desired, isotonic preparations generally containing suitable preservatives are used.

[0249] The crystalline form (I-HS) may be administered in intranasal form via topical use of a suitable intranasal vehicle, or via transdermal patches well known to those skilled in the art. When administered in the form of a transdermal delivery system, the dosage administration will, of course, be continuous rather than intermittent throughout the dosage regimen.

[0250] To prepare the pharmaceutical compositions provided herein, the crystalline form (I-HS) as the active ingredient is fully mixed with a pharmaceutical carrier according to conventional pharmaceutical mixing techniques, and the carrier can be in a variety of forms depending on the desired formulation form for administration (e.g., oral or parenteral). Suitable pharmaceutically acceptable carriers are well known in the art. The description of some of these pharmaceutically acceptable carriers can be found in The Handbook of Pharmaceutical Excipients published by the American Pharmaceutical Association and the Pharmaceutical Society of Great Britain.

[0251] Methods of formulating pharmaceutical compositions are described in numerous publications, such as Pharmaceutical Dosage Forms: Tablets, Second Edition, Revised and Expanded, Volumes 1 to 3, edited by Lieberman et al., published by Marcel Dekker Company; Pharmaceutical Dosage Forms: Parenteral Medications, Volumes 1 to 2, edited by Avis et al.; and Pharmaceutical Dosage Forms: Disperse systems, Volumes 1 to 2, edited by Lieberman et al.

[0252] Whenever treatment of cancer, pain, inflammation, neurodegenerative disease, or Trypanosoma cruzi infection is required, the compounds provided herein can be administered in any of the above-described compositions and according to dosage regimens established in the art.

[0253] The daily dose of the crystalline form (I-HS) can vary in a wide range of 1.0 mg / adult / day to 10,000 mg / adult / day or higher or in any range thereof. For oral administration, the composition is preferably provided to the patient to be treated in the form of a tablet containing 0.01 mg, 0.05 mg, 0.1 mg, 0.5 mg, 1.0 mg, 2.5 mg, 5.0 mg, 10.0 mg, 15.0 mg, 25.0 mg, 50.0 mg, 100 mg, 150 mg, 200 mg, 250 mg and 500 mg of active ingredient (adjusting the dose according to the symptoms). The effective amount of the drug is generally provided at a dosage level of about 0.1 mg / kg body weight / day to about 1000 mg / kg body weight / day or in any range thereof. Preferably, the range is about 0.5 mg / kg body weight / day to about 500 mg / kg body weight / day or in any range thereof. More preferably, about 1.0 mg / kg body weight / day to about 250 mg / kg body weight / day or any range thereof. More preferably, about 0.1 mg / kg body weight / day to about 100 mg / kg body weight / day or any range thereof. In one example, the range may be about 0.1 mg / kg body weight / day to about 50.0 mg / kg body weight / day or any amount or range thereof. In another example, the range may be about 0.1 mg / kg body weight / day to about 15.0 mg / kg body weight / day or any range thereof. In yet another example, the range may be about 0.5 mg / kg body weight / day to about 7.5 mg / kg body weight / day or any amount to range thereof. Crystalline form (I-HS) may be administered based on a regimen of 1 to 4 times a day or with a single daily dose.

[0254] The optimal dosage for desired administration can be easily determined by those skilled in the art, and will vary with the mode of administration, formulation strength, mode of administration, and progression of the disease condition. In addition, factors associated with the specific patient being treated (including patient age, weight, diet, and administration time) will require adjustment of dosage.

[0255] Those skilled in the art will recognize that in vivo and in vitro assays using appropriate known and generally accepted cell and / or animal models are predictive of the ability of a test compound to treat or prevent a given disorder.

[0256] Those skilled in the art will further recognize that human clinical trials (including first-in-human trials, dose-ranging trials, and efficacy trials) in healthy patients and / or those suffering from a given condition can be accomplished according to methods well known in the clinical and medical communities.

[0257] The acronyms used in this specification have the following meanings:

[0258] ATP ATP DI Deionization EtOH Ethanol GC Gas chromatography MOPS 3-(N-Morpholino)-propanesulfonic acid MTBE Methyl tert-butyl ether PDA Photodiode array RRT Relative retention time RT Room temperature THF Tetrahydrofuran TMB 3,3',5,5'-Tetramethylbenzidine

[0259] The following examples illustrate the invention and are set forth to aid in the understanding of the invention and are not intended and should not be construed in any way to limit the invention set forth in the claims.

[0260] Unless otherwise indicated, in the following examples, all temperatures are set forth in degrees Celsius. Reagents were purchased from commercial suppliers (e.g., Sigma-Aldrich Chemical Company, EMD, JTBaker, or Pharco-Aaper) and were used without further purification unless otherwise indicated. Tetrahydrofuran (THF), heptane, and other organic solvents were purchased from commercial suppliers (e.g., Sigma-Aldrich Chemical Company, ACROS, Alfa-Aesar, Lancaster, TCI, or Maybridge) and used as received.

[0261] Those skilled in the art will recognize that, if not otherwise specified, the reaction steps are carried out according to known methods under suitable conditions to provide the desired product. Those skilled in the art will also recognize that, if the reaction steps as disclosed herein can be carried out in a variety of solvents or solvent systems, the reaction steps can also be carried out in a mixture of suitable solvents or solvent systems. Those skilled in the art will recognize that in the description and claims as presented herein, if a reagent or reagent class / type (e.g., base, solvent, etc.) is mentioned in more than one step of the method, each reagent is independently selected for each reaction step and may be the same or different from each other. For example, if two steps of the method mention an organic base or an inorganic base as a reagent, the organic or inorganic base selected for the first step may be the same or different from the organic or inorganic base of the second step.

[0262] The reactions described below were typically carried out in "ACS grade" solvents under positive nitrogen pressure (unless otherwise stated), and the reaction flasks were typically equipped with rubber septa for the introduction of substrates and reagents via syringes or addition funnels.

[0263] Two reverse phase high performance liquid chromatography (HPLC) systems were used for process monitoring and analysis, using acetonitrile and water / trifluoroacetic acid as mobile phases. One system employed an Agilent Zorbax Extend C18 column (at 264 nm), while the other system (hereinafter, "TRK1PM1 HPLC") included a Waters Xbridge Phenyl column (at 268 nm). Unless otherwise noted, the former system was used. The silica for both systems was stirred in a flask with the compound, and then filtered through a polypropylene cloth before analysis.

[0264] The amorphous free base form of the compound of formula I:About 1 gram of (S)-N-(5-((R)-2-(2,5-difluorophenyl)pyrrolidin-1-yl)-pyrazolo[1,5-a]pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide was dissolved in a minimum amount of water and cooled to a temperature of about -26°C and then dried in a freeze dryer for 24 hours. About 20 mg of amorphous material obtained from the freeze dryer was weighed into a vial to which 5 volume equal parts of the appropriate solvent system were added. The mixture was checked for dissolution and if dissolution was not apparent, the mixture was heated to about 40°C and checked again. This procedure was continued until dissolution was observed or until 100 volumes of solvent had been added. The XRPD pattern of the amorphous material obtained from the freeze drying experiment is shown in Figure 7 middle.

[0265] Amorphous hydrogen sulfate salt of the compound of formula I Prepared as described in Example 14A of WO 2010 / 048314 (see Example 3). The XRPD patterns of two different batches of amorphous material prepared by this method are shown in Fig.28 middle.

[0266] Also provided herein is a method for preparing the crystalline form (I-HS). In some embodiments, the method comprises the steps as shown in Scheme 1.

[0267] In some embodiments, provided herein is a method for preparing a crystalline form (I-HS), comprising:

[0268] (a) adding concentrated sulfuric acid to a solution of (S)-N-(5-((R)-2-(2,5-difluorophenyl)pyrrolidin-1-yl)-pyrazolo[1,5-a]pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide in EtOH to form the hydrogen sulfate salt of (S)-N-(5-((R)-2-(2,5-difluorophenyl)pyrrolidin-1-yl)-pyrazolo[1,5-a]pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide;

[0269] (b) adding heptane to the solution in step (a) to form a slurry;

[0270] (c) filtering the slurry to isolate (S)-N-(5-((R)-2-(2,5-difluorophenyl)pyrrolidin-1-yl)-pyrazolo[1,5-a]pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide hydrogen sulfate;

[0271] (d) mixing the (S)-N-(5-((R)-2-(2,5-difluorophenyl)pyrrolidin-1-yl)-pyrazolo[1,5-a]pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide hydrogen sulfate with a 5:95 w / w water / 2-butanone solution;

[0272] (e) heating the mixture from step (d) at about 65-70° C. with stirring until the weight percent of ethanol is about 0.5% to form a slurry of a crystalline form of (S)—N-(5-((R)-2-(2,5-difluorophenyl)pyrrolidin-1-yl)-pyrazolo[1,5-a]pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide hydrogen sulfate; and

[0273] (f) A crystalline form of (S)-N-(5-((R)-2-(2,5-difluorophenyl)pyrrolidin-1-yl)-pyrazolo[1,5-a]pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide hydrogen sulfate was isolated by filtration.

[0274] In some embodiments, the above method further comprises: (b1) crystallizing the solution from step (a) with (S)-N-(5-((R)-2-(2,5-difluorophenyl)pyrrolidin-1-yl)-pyrazolo[1,5-a]pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide hydrogen sulfate at room temperature and stirring the solution until a slurry is formed.

[0275] In some embodiments, provided herein is a method for preparing a crystalline form (I-HS), comprising:

[0276] (a) reacting 5-chloro-3-nitropyrazolo[1,5-a]pyrimidine with (R)-2-(2,5-difluorophenyl)-pyrrolidine (R)-2-hydroxysuccinate in the presence of a base to form (R)-5-(2-(2,5-difluorophenyl)pyrrolidine-1-

[0277] 1-nitropyrazolo[1,5-a]pyrimidine;

[0278] (b) treating the (R)-5-(2-(2,5-difluorophenyl)pyrrolidin-1-yl)-3-nitropyrazolo[1,5-a]pyrimidine with Zn and hydrochloric acid to form (R)-5-(2-(2,5-difluorophenyl)pyrrolidin-1-yl)pyrazolo[1,5-a]pyrimidin-3-amine;

[0279] (c) treating the (R)-5-(2-(2,5-difluorophenyl)pyrrolidin-1-yl)pyrazolo[1,5-a]pyrimidin-3-amine with a base and phenyl chloroformate to form phenyl (R)-(5-(2-(2,5-difluorophenyl)pyrrolidin-1-yl)pyrazolo[1,5-a]pyrimidin-3-yl)carbamate;

[0280] (d) reacting the (R)-(5-(2-(2,5-difluorophenyl)pyrrolidin-1-yl)pyrazolo[1,5-a]pyrimidin-3-yl)carbamic acid phenyl ester with (S)-pyrrolidin-3-ol to form (S)-N-(5-((R)-2-(2,5-difluorophenyl)pyrrolidin-1-yl)pyrazolo[1,5-a]pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide;

[0281] (e) adding sulfuric acid to the (S)-N-(5-((R)-2-(2,5-difluorophenyl)pyrrolidin-1-yl)pyrazolo[1,5-a]pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide to form (S)-N-(5-((R)-2-(2,5-difluorophenyl)pyrrolidin-1-yl)-pyrazolo[1,5-a]pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide hydrogen sulfate; and

[0282] (f) Isolation of a crystalline form of (S)-N-(5-((R)-2-(2,5-difluorophenyl)pyrrolidin-1-yl)-pyrazolo[1,5-a]pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide hydrogen sulfate.

[0283] In some embodiments of step (a) above, the base is an amine base, such as triethylamine.

[0284] In some embodiments of step (c) above, the base is an alkali metal base, such as an alkali metal carbonate, such as potassium carbonate.

[0285] Preparation A

[0286]

[0287] Preparation of 5-chloro-3-nitropyrazolo[1,5-a]pyrimidine

[0288] Step A - Preparation of sodium pyrazolo[1,5-a]pyrimidine-5-olate : A solution of 1H-pyrazole-5-amine and 1,3-dimethylpyrimidine-2,4(1H,3H)-dione (1.05 equiv) was added to a round bottom flask equipped with a mechanical stirrer, a steamer, a reflux condenser, a J-Kem temperature probe, and a N2 adapter for positive N2 pressure control. The solid was suspended in 4 volumes (4 mL / g) of anhydrous EtOH under a nitrogen atmosphere under mechanical stirring, and then 2.1 equiv of NaOEt (21 wt% solution in EtOH) was added, followed by a line flush with 1 volume (1 mL / g) of anhydrous EtOH. The slurry was warmed to about 75°C and stirred at a slight reflux until the reaction progress was followed by TRK1PM1HPLC (using 20 μL of slurry diluted in 4 mL of deionized water and 5 μL of injection at 220 nm) until less than 1.5 area % of 1H-pyrazole-5-amine was observed.

[0289] After another hour, 2.5 vol. (2.5 mL / g) of heptane was added to the mixture and then refluxed at 70 ° C for 1 hour. Then the slurry was cooled to room temperature overnight. Solids were collected by filtering on a benchtop funnel and polypropylene filter cloth. The reactor was rinsed and 4 volumes (4 mL / g) of heptane were loaded on the filter cake, and the filter cake was taken out, and the solid was transferred to a tared drying dish and dried under high vacuum at 45 ° C until its weight was constant. Pale yellow solid pyrazolo [1,5-a] - pyrimidine -5- alcohol sodium was obtained with a 93-96% yield (corrected) and was observed to be greater than 99.5 area % by HPLC (1 mg / mL dilution in deionized water, TRK1PM1 at 220 nm).

[0290] Step B- Preparation of 3-nitropyrazolo[1,5-a]pyrimidin-5(4H)-one : A tared round bottom flask was filled with sodium pyrazolo[1,5-a]pyrimidine-5-olate dissolved in 3.0 volumes (3.0 mL / g) of deionized water at 40-45°C and then concentrated on a rotary evaporator under high vacuum at 65°C in a water bath until 2.4× the weight of the starting material (1.4 vol / 1.4 mL / g deionized water content) was observed. Gas chromatography (GC) performed on residual EtOH (30 μL of a solution dissolved in approximately 1 mL of MeOH) showed less than 100 ppm, with traces of ethyl nitrate fumes observed below after HNO3 was added later. In some cases, the initial solution was filled with another 1.5 volumes (1.5 mL / g) of DI water and then concentrated under high vacuum at 65°C in a water bath on a rotary evaporator until 2.4× the weight of the starting material (1.4 vol / 1.4 mL / g DI water content) was observed. Gas chromatography on residual EtOH (30 μL dissolved in about 1 mL MeOH) showed << 100 ppm residual EtOH, and no ethyl nitrate fumes were observed below after the later addition of HNO 3 .

[0291] To a round bottom vessel equipped with a mechanical stirrer, steamer, reflux condenser, J-Kem temperature probe and N2 adapter for positive N2 pressure control was added 3 volumes (3 mL / g, 10 equivalents) of >90 wt% HNO3 under nitrogen atmosphere and cooled to about 10°C under nitrogen atmosphere using an external ice-water cooling bath. Using a pressure equalizing addition funnel, 1.75-1.95 volumes of a deionized water solution of sodium pyrazolo[1,5-a]pyrimidine-5-olate (1.16-1.4 mL DI water / g sodium pyrazolo[1,5-a]pyrimidine-5-olate) were added to the HNO3 solution at a rate to maintain an internal temperature of 35-40°C under cooling. Two azeotropes were observed and there was no fumes of ethyl nitrate. The azeotrope flask, transfer line (if applicable) and addition funnel were rinsed with 2×0.1 volumes (2×0.1 mL / g) of deionized water and added to the reaction mixture. After the addition was complete, the temperature was gradually increased to about 45-50 °C and maintained for about 3 hours, and HPLC showed >99.5 area % conversion of sodium pyrazolo[1,5-a]pyrimidin-5-olate to 3-nitropyrazolo[1,5-a]pyrimidin-5(4H)-one.

[0292] Step C-Preparation of 5-chloro-3-nitropyrazolo[1,5-a]pyrimidine : 3-Nitropyrazolo[1,5-a]pyrimidin-5(4H)-one was charged into a round bottom flask equipped with a mechanical stirrer, a heating mantle, a reflux condenser, a J-Kem temperature probe and an N2 adapter for positive N2 pressure control. The solid was suspended in 8 volumes (8 mL / g) of CH3CN under mechanical stirring, and then 2,6-lutitine (1.05 eq) was added, and the slurry was then warmed to about 50°C. Using a pressure equalizing addition funnel, 0.33 eq of POCl3 was added dropwise to the mixture. This addition gave a thick beige trimer slurry, which was homogenized while stirring until a semi-fluid material was observed. An additional 1.67 eq of POCl3 was charged to the mixture while the temperature was allowed to stabilize, and the reaction mixture was then warmed to a slight reflux (78°C). Some blowing was observed after the mixture was warmed, which later subsided as the thick slurry thinned.

[0293] The reaction mixture was refluxed until complete dissolution to a dark solution and until HPLC (20 μL diluted in 5 mL CH3CN, TRK1PM1 HPLC, 5 μL injection, 268 nm) confirmed that the trimer was no longer present (RRT 0.92) by manual removal of any interfering peaks and early eluting peaks (related to lutidine) from area integration and less than 0.5 area % of 3-nitropyrazolo[1,5-a]pyrimidin-5(4H)-one was observed (RRT 0.79). On a 1.9 kg scale, 0 area % of trimer, 0.25 area % of 3-nitropyrazolo[1,5-a]pyrimidin-5(4H)-one, and 99.5 area % of 5-chloro-3-nitropyrazolo[1,5-a]pyrimidine were observed at 268 nm using TRK1PM1 HPLC after 19 hours of gentle reflux.

[0294] Preparation B

[0295]

[0296] Preparation of (R)-2-(2,5-difluorophenyl)-pyrrolidine (R)-2-hydroxysuccinate

[0297] Step A - Preparation of tert-butyl (4-(2,5-difluorophenyl)-4-oxobutyl)-carbamate: 2-Bromo-1,4-difluorobenzene (1.5 eq.) was dissolved in 4 volumes of THF (based on the weight of tert-butyl 2-oxopyrrolidine-1-carboxylate) and cooled to about 5°C. A solution of 2.0M iPrMgCl in THF (1.4 eq.) was added to the mixture over 2 hours while keeping the reaction temperature below 25°C. The solution was cooled to about 5°C and stirred for 1 hour (GC analysis confirmed Grignard formation). A solution of tert-butyl 2-oxopyrrolidine-1-carboxylate (1.0 eq.) in 1 volume of THF was added over about 30 min while maintaining the reaction temperature below 25°C. The reaction was stirred at about 5°C for 90 min (confirming that tert-butyl 2-oxopyrrolidine-1-carboxylate was less than 0.5 area % (by HPLC)). The reaction was quenched with 5 volumes of 2M aqueous HCl while maintaining the reaction temperature below 45°C. Then, reactant is transferred in separatory funnel, 10 volumes of heptane are added and water layer is removed. Organic layer is washed with 4 volumes of saturated NaCl aqueous solution, and 2 x 1 volumes of saturated NaCl aqueous solution are added subsequently. The solvent of organic layer is replaced with heptane (<1%wt THF, confirmed by GC), distillation temperature is 35-55 ℃ and distillation pressure is 100-200mm Hg, and 2 x 4 volumes of heptane and minimum distillation volume are added for about 7 volumes. Then, mixture is diluted to 10 volumes with heptane, and is heated to about 55 ℃ simultaneously, and dense solid is obtained, and mixture is cooled to room temperature overnight. Make slurry cooled to less than 5 ℃ and filter via polypropylene filter cloth. Wash wet cake with 2×2 volumes of heptane. Solid is dried under vacuum at 55 ℃, until constant weight, obtains white solid (4-(2,5-difluorophenyl)-4-oxobutyl)-t-butyl carbamate of about 75% to 85% theoretical yield.

[0298] Step B- Preparation of 5-(2,5-difluorophenyl)-3,4-dihydro-2H-pyrrole : (4-(2,5-difluorophenyl)-4-oxobutyl)-carbamic acid tert-butyl ester was dissolved in 5 vol. toluene and 2.2 equivalents of 12M HCl were added, and slight exotherm and gas release were observed. The reactants were heated to 65°C and kept for 12-24 hours and monitored by HPLC. After completion, the reactants were cooled to less than 15°C with an ice / water bath. The pH was adjusted to about 14 with 3 equivalents of 2M NaOH aqueous solution (4.7 vol.). The reactants were stirred at room temperature for 1-2 hours. The mixture was transferred to a separatory funnel with toluene. The water layer was removed and the organic layer was washed with 3 volumes of saturated NaCl aqueous solution. The organic layer was concentrated to an oil and redissolved in 1.5 volumes of heptane. The resulting suspension was filtered through GF / F filter paper and concentrated to a light yellow oil of 5-(2,5-difluorophenyl)-3,4-dihydro-2H-pyrrole with a theoretical yield of 90% to 100%.

[0299] Step C - Preparation of (R)-2-(2,5-difluorophenyl)-pyrrolidineChloro-1,5-cyclooctadiene iridium dimer (0.2 mol%) and (R)-2-(2-(diphenylphosphino)phenyl)-4-isopropyl-4,5-dihydrooxazole (0.4 mol%) were suspended in 5 volumes of MTBE (based on 5-(2,5-difluorophenyl)-3,4-dihydro-2H-pyrrole) at room temperature. The mixture was stirred for 1 hour and most of the solids dissolved and the solution turned dark red. The catalyst formation was monitored using an HPLC / PDA detector. The reactants were cooled to less than 5°C and 5-(2,5-difluorophenyl)-3,4-dihydro-2H-pyrrole (1.0 equiv.) was added, rinsing with 0.5 volumes of MTBE. Diphenylsilane (1.5 equiv.) was added over approximately 20 minutes while the reaction temperature was maintained below 10°C. The reactants were stirred at below 10°C for 30 minutes and then warmed to room temperature. The reactants were stirred overnight at room temperature. The reaction was confirmed to be completed by HPLC and then cooled to less than 5 ° C. The reaction was quenched with 5 volumes of 2M HCl aqueous solution, and the temperature was maintained below 20 ° C. After 10 minutes, the ice / water bath was removed and the reaction temperature was increased to room temperature while stirring for 2 hours. The mixture was transferred to a separatory funnel with 3 volumes of MTBE. The aqueous layer was washed with 3.5 volumes of MTBE, and then 5 volumes of MTBE were added to the aqueous layer, while pH was adjusted to about 14 by adding 0.75 volumes of 50% NaOH aqueous solution. The organic layer was washed with 5 volumes of saturated NaCl aqueous solution, and then condensed into oil, and diluted with 3 volumes of MTBE. The solution was filtered through polypropylene filter cloth and rinsed with 1 volume of MTBE. The filtrate was concentrated into an oily substance of (R)-2-(2,5-difluorophenyl)-pyrrolidine with 95% to 100% theoretical yield and 75-85%ee.

[0300] Step D - Preparation of (R)-2-(2,5-difluorophenyl)-pyrrolidine (R)-2-hydroxy-succinate (R)-2-(2,5-difluorophenyl)-pyrrolidine (1.0 eq.) was transferred to a round bottom flask charged with 15 volumes (corrected for potency) of EtOH (200 prf). D-Malic acid (1.05 eq.) was added and the mixture was heated to 65°C. At about 64°C the solids were completely dissolved. The solution was allowed to cool to RT. At about 55°C the solution was crystallized with (R)-2-(2,5-difluorophenyl)-pyrrolidine (R)-2-hydroxy-succinate (about 50 mg, >97% ee) and stirred at room temperature overnight. The suspension was then filtered through a polypropylene filter cloth and washed with 2 x 1 volumes of EtOH (200 prf). The solid was dried under vacuum at 55°C to give (R)-2-(2,5-difluorophenyl)-pyrrolidine (R)-2-hydroxy-succinate in 75% to 90% theoretical yield and >96% ee.

[0301] Referring to Scheme 1, suitable bases include tertiary amine bases such as triethylamine and K2CO3. Suitable solvents include ethanol, heptane and tetrahydrofuran (THF). The reaction is conveniently carried out at a temperature between 5°C and 50°C. The progress of the reaction is usually monitored by HPLCTRK1PM1.

[0302] Solution 1

[0303]

[0304] Compound II (5-chloro-3-nitropyrazolo[1,5-a]pyrimidine) and III ((R)-2-(2,5-difluorophenyl)-pyrrolidine (R)-2-hydroxysuccinate, 1.05 eq.) were added to a round bottom flask equipped with a mechanical stirrer, a J-Kem temperature probe, and a N2 adapter for positive N2 pressure control. A solution of 4:1 EtOH:THF (10 mL / g compound II) was added via an addition funnel, followed by triethylamine (NEt3, 3.50 eq.), and the temperature reached about 40°C during the addition. Once the addition was complete, the reaction mixture was heated to 50°C and stirred for 0.5-3 hours to give compound IV.

[0305] Compound IV and then tetrahydrofuran (10 mL / g compound IV) were added to a round-bottom flask equipped with a mechanical stirrer, a J-Kem temperature probe, and a N2 inlet. The solution was cooled to less than 5°C in an ice bath, and Zn (9-10 equivalents) was added. 6M HCl (9-10 equivalents) was then added dropwise at a rate such that the temperature was maintained below 30°C (for a 1 kg scale, the addition took about 1.5 hours). After the exotherm subsided, the reactants were warmed to room temperature and stirred for 30-60 min until compound IV was not detected by HPLC. At this point, an aqueous solution of potassium carbonate (K2CO3, 2.0 equivalents) (5 mL / g compound IV) was added once and then phenyl chloroformate (PhOCOCl, 1.2 equivalents) was quickly added dropwise. Gas release (CO2) was observed during both additions, and the temperature increased to about 30°C after the addition of phenyl chloroformate. The carbamate formation was stirred at room temperature for 30-90 min. HPLC analysis was performed immediately afterwards to ensure the presence of less than 1 area % of the amine in solution and a high yield of Compound VI.

[0306] To the above solution was added amine VII ((S)-pyrrolidin-3-ol, 1.1 equiv. based on theoretical yield of compound VI) and EtOH (10 mL / g compound VI). Compound VII was added before or simultaneously with EtOH to avoid the formation of ethyl carbamate impurities. The above EtOH solution was concentrated to a minimum volume (4-5 mL / g) using a batch concentrator under reduced pressure (THF content should be <5% by GC), and EtOH (10 mL / g compound VI) was added back to give a total of 10 mL / g. The reaction was then heated at 50°C for 9-19 hours or until HPLC showed less than 0.5 area % of compound VI. The reaction was then cooled to room temperature, and sulfuric acid (H2SO4, 1.0 equiv. relative to compound VI) was added via an addition funnel to give compound I-HS, and the temperature was typically exothermic at about 30°C.

[0307] Example 1

[0308] Preparation of Crystalline Form (I-HS) (Method 1)

[0309] (S)-N-(5-((R)-2-(2,5-difluorophenyl)pyrrolidin-1-yl)-pyrazolo[1,5-a]pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide (0.500 g, 1.17 mmol) was dissolved in EtOH (2.5 mL) and cooled to about 5 °C. Concentrated sulfuric acid (0.0636 mL, 1.17 mmol) was added to the cooled solution and stirred for about 10 minutes while warming to room temperature. Methyl tert-butyl ether (MTBE) (2 mL) was slowly added to the mixture, causing the product to precipitate as a colloid. EtOH (2.5 mL) was then added to the mixture and heated to about reflux until all solids dissolved. After cooling to room temperature and stirring for about 1 hour, some solids formed. After cooling to about 5 °C, the solids were filtered and washed with MTBE. After filtration and air drying for about 15 minutes, (S)-N-(5-((R)-2-(2,5-difluorophenyl)pyrrolidin-1-yl)-pyrazolo[1,5-a]pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide hydrogen sulfate was isolated as a solid.

[0310] Example 2

[0311] Preparation of Crystalline Form (I-HS) (Method 2)

[0312] Concentrated sulfuric acid (392 mL) was added to a solution of 3031 g (S)-N-(5-((R)-2-(2,5-difluorophenyl)pyrrolidin-1-yl)-pyrazolo[1,5-a]pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide in 18322 mL EtOH to form the bisulfate salt. The solution was seeded with 2 g (S)-N-(5-((R)-2-(2,5-difluorophenyl)pyrrolidin-1-yl)-pyrazolo[1,5-a]pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide bisulfate salt and the solution was stirred at room temperature for at least 2 hours to form a bisulfate slurry. Heptane (20888 g) was added and the slurry was stirred at room temperature for at least 60 min. The slurry was filtered and the filter cake was washed with 1:1 heptane / EtOH. The solid was then dried in vacuo at ambient temperature (oven temperature set at 15°C).

[0313] The dried bisulfate (6389 g from a combination of 4 batches) was added to a 5:95 w / w water / 2-butanone solution (total weight 41652 g). The mixture was heated at about 68°C with stirring until the weight percent of ethanol was about 0.5%, at which time a slurry was formed. The slurry was filtered and the filter cake was washed with a 5:95 w / w water / 2-butanone solution. The solid was then dried under vacuum at ambient temperature (oven temperature was set at 15°C) to provide a crystalline form of (S)-N-(5-((R)-2-(2,5-difluorophenyl)-pyrrolidin-1-yl)-pyrazolo[1,5-a]pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide bisulfate.

[0314] Example 3

[0315] Preparation of amorphous form AM(HS)

[0316] To a solution of (S)-N-(5-((R)-2-(2,5-difluorophenyl)pyrrolidin-1-yl)pyrazolo[1,5-a]pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide (9.40 g, 21.94 mmol) in MeOH (220 mL) was slowly added sulfuric acid (0.1 M in MeOH, 219.4 mL, 21.94 mmol) at ambient temperature with rapid stirring. After 30 minutes, the reaction was first concentrated to near dryness by rotary evaporator and then kept under high vacuum for 48 h to provide an amorphous form of (S)-N-(5-((R)-2-(2,5-difluorophenyl)pyrrolidin-1-yl)pyrazolo[1,5-a]pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide sulfate (11.37 g, 21.59 mmol, 98.43% yield). LCMS (apci m / z 429.1, M+H).

[0317] Example 4

[0318] Preparation of Crystalline HCl Salt of Formula I

[0319] A mixture of (S)-N-(5-((R)-2-(2,5-difluorophenyl)pyrrolidin-1-yl)pyrazolo[1,5-a]pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide (0.554 g, 1.29 mmol) in EtOH (6 mL, 200 proof) and MTBE (10 mL) was heated to 50° C. while stirring to obtain a solution, and then hydrochloric acid (conc.) (0.108 mL, 1.29 mmol) was added in one portion. The reaction mixture was then first cooled to ambient temperature and then cooled to about 5° C. in an ice-water bath while stirring to induce crystallization. The suspension was stirred in an ice-water bath for 4 h, then it was vacuum-filtered, and the filter cake was rinsed with MTBE and dried in vacuo at 55 °C to constant weight to give crystalline (S)-N-(5-((R)-2-(2,5-difluorophenyl)pyrrolidin-1-yl)pyrazolo[1,5-a]pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide hydrochloride (0.534 g, 89% yield). LCMS (apci m / z 429.2, M+H).

[0320] Preparation of Crystalline HBr Salt of Formula I

[0321] A mixture of (S)-N-(5-((R)-2-(2,5-difluorophenyl)pyrrolidin-1-yl)pyrazolo[1,5-a]pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide (0.505 g, 1.18 mmol) in EtOH (6 mL, 200 proof) and MTBE (10 mL) was heated to 50° C. with stirring to give a solution, then hydrogen bromide (33% in water) (0.213 mL, 1.18 mmol) was added in one portion. The reaction mixture was heated to reflux to give a mostly clear solution with a small amount of oily residue on the glass walls of the reaction vessel. After cooling to ambient temperature, a precipitate formed and the oily residue solidified. The mixture was heated to 50° C. again, then cooled to room temperature and stirred overnight. The suspension was vacuum-filtered, and the filter cake was rinsed with MTBE and dried in vacuo at 55°C to constant weight to give crystalline (S)-N-(5-((R)-2-(2,5-difluorophenyl)pyrrolidin-1-yl)pyrazolo[1,5-a]pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide hydrobromide (0.51 g, 85% yield). LCMS (apci m / z 429.3, M+H).

[0322] Preparation of crystalline mesylate salt of formula I

[0323] A mixture of (S)-N-(5-((R)-2-(2,5-difluorophenyl)pyrrolidin-1-yl)pyrazolo[1,5-a]pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide (0.532 g, 1.24 mmol) in EtOH (2.7 mL, 200 proof) and MTBE (5.3 mL) was heated to 50° C. with stirring to give a solution, then methanesulfonic acid (0.076 mL, 1.24 mmol) was added in one portion. The reaction mixture was heated to reflux to give a mostly clear solution with a small amount of particles. After cooling to ambient temperature, precipitation occurred along with some oily residue. Additional EtOH (0.5 mL, 200-proof) and methanesulfonic acid (0.010 mL) were added to give a solution. The mixture was heated to 50° C. again, then cooled to room temperature and stirred for 1 h. The suspension was vacuum-filtered, and the filter cake was rinsed with MTBE and dried in vacuo at 55°C to constant weight to give crystalline (S)-N-(5-((R)-2-(2,5-difluorophenyl)pyrrolidin-1-yl)pyrazolo[1,5-a]pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide methanesulfonate (0.51 g, 78% yield). LCMS (apci m / z 429.4, M+H).

[0324] Preparation of crystalline camphorsulfonate salt of formula I

[0325] A mixture of (S)-N-(5-((R)-2-(2,5-difluorophenyl)pyrrolidin-1-yl)pyrazolo[1,5-a]pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide (0.500 g, 1.17 mmol) and S-(+)-camphorsulfonic acid (0.271 g, 1.17 mmol) in EtOH (3 mL, 200 proof) and MTBE (5 mL) was heated to reflux with stirring to give a solution. Upon cooling to ambient temperature, precipitation occurred. The suspension was stirred at room temperature overnight and then vacuum-filtered, and the filter cake was rinsed with MTBE and dried in vacuo at 55°C to constant weight to give crystalline (S)-N-(5-((R)-2-(2,5-difluorophenyl)pyrrolidin-1-yl)pyrazolo[1,5-a]pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide ((1S,4R)-7,7-dimethyl-2-oxobicyclo[2.2.1]hept-1-yl) methanesulfonate.

[0326] Example 5

[0327] (S)-N-(5-((R)-2-(2,5-difluorophenyl)-pyrrolidin-1-yl)-pyrazolo[1,5-a]pyrimidin-3-yl)- Comparison of 3-hydroxypyrrolidine-1-carboxamide salts

[0328] Other salt forms of (S)-N-(5-((R)-2-(2,5-difluorophenyl)-pyrrolidin-1-yl)-pyrazolo[1,5-a]pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide, e.g., the hydrochloride, hydrobromide, methanesulfonate and camphorsulfonate salts (see Example 4), were compared with Form (I-HS) by determining their differential scanning calorimetry (DSC) melting points, dynamic vapor sorption (DVS) weight gain and stability on aluminum slides at 40° C. and 75% relative humidity (RH). DSC and DVS measurements were performed as described above, and the results are summarized in Table 14.

[0329] Table 14. Physicochemical properties of the crystalline salt of (S)-N-(5-((R)-2-(2,5-difluorophenyl)-pyrrolidin-1-yl)-pyrazolo[1,5-a]pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide

[0330]

[0331] Example 6

[0332] TrkA and TrkB enzyme assays

[0333] Using Invitrogen's LanthaScreen TM The Eu kinase binding technique measures the affinity of compound binding to Trk kinase. Briefly, His-tagged recombinant human Trk cytoplasmic domain from Invitrogen (5 nM TRK A - Catalog No. PV3144 or 10 nM TRK B - Catalog No. PV3616) was mixed with 5 nM Trk in a buffer consisting of 25 mM MOPS (pH 7.5), 5 mM MgCl2, 0.005% Triton X-100 and 2% DMSO. Tracer 236 (PR9078A), 2nM biotinylated anti-His (Catalog No. M4408) and 2nM europium-labeled streptavidin (Streptavdidn) (Catalog No. PV5899) were incubated together with the test compound. Compounds were usually prepared in three-fold serial dilutions in DMSO and added to the test to obtain the appropriate final concentration. After incubation at 22°C for 60 minutes, the reaction was measured via TR-FRET dual wavelength detection using a PerkinElmer EnVision multi-mode plate reader, and the control percentage (POC) was calculated using a ratio emission factor. 100POC was determined using no test compound and 0POC was determined using a concentration of a control compound that completely inhibited the enzyme. The POC values ​​were fitted to a 4-parameter logistic curve and the IC50 value was the point where the curve intersected with 50POC. The crystalline form (I-HS) had an average IC of 8.4nM when tested for TrkA in this analysis.50 , and had an average IC of 4.2 when tested against TrkB in this assay. 50 .

[0334] Example 7

[0335] TRK fusion proteins drive tumorigenesis and are inhibited by the crystalline form (I-HS)

[0336] A set of experiments was performed to determine whether the crystalline form (I-HS) can inhibit cell proliferation in three different cancer cell line models with different Trk gene fusions: CUTO-3F cell line, KM12 cell line and MO-91 cell line. CUTO-3F cells are derived from a patient with lung adenocarcinoma with MPRIP-NTRK1 gene fusion. KM12 cell line is a colorectal cancer cell line with TPM3-NTRK1 fusion (Vaishnavi et al., Nature Med. 19: 1469-1472, 2013). MO-91 cell line is derived from an acute myeloid leukemia patient with ETV6-NTRK3 fusion (Taipale et al., Nature Biotech. 31: 630-637, 2013). Measurement of cell proliferation after treatment with the crystalline form (I-HS) confirmed dose-dependent inhibition of cell proliferation in all three tested cell lines ( Figure 8-10 ). For CUTO-3F cells IC 50 Less than 100nm( Figure 8 ) and for KM12 cells and MO-91 cells IC 50 Less than 10nm (respectively Fig. 9 and Fig.10 ).

[0337] Consistent with the inhibition of cell proliferation, inhibition of phosphorylation of MPRIP-TRKA oncoprotein and ERK1 / 2 was observed in CUTO-3F cells using low doses of the crystalline form (I-HS) ( Fig.11 ), the inhibition of phosphorylation of TPM3-TRKA, pAKT and pERK1 / 2 was observed in KM12 cells using a low dose of the crystalline form (I-HS) ( Fig.12 ), and inhibition of phosphorylation of TEL-TRKC oncoprotein (encoded by ETV6-NTRK3), pAKT, and pERK1 / 2 was observed in MO-91 cells using a low dose of the crystalline form (I-HS) ( Fig.13). Together, these data show that Trk fusion proteins are constitutively active and regulate key downstream signaling pathways (e.g., MAPK and AKT) and are inhibited by the crystalline form (I-HS). These data also indicate that the crystalline form (I-HS) can be used to treat different cancers that express dysregulated Trks (e.g., constitutively active forms of Trk proteins (e.g., Trk fusion proteins or Trk point mutations)).

[0338] Example 8

[0339] Crystalline form (I-HS) successfully treated subjects with undifferentiated sarcoma

[0340] A 41-year-old female presented with a firm mass in her left groin. Initial imaging was used to confirm a 10 cm mass in the musculature of her anterior thigh. An open biopsy revealed an undifferentiated sarcoma. An initial segmented scan confirmed multiple bilateral 4-13 mm pulmonary nodules consistent with metastatic disease. The female was enrolled in a Phase 2 trial of sorafenib (ClinicalTrials.gov ID: NCT02050919) with chemotherapy, preoperative radiation, and limb-sparing surgery. After 2 weeks of daily dosing with 400 mg of sorafenib, the patient received 30 mg / m 2 Epirubicin and 2,500 mg / m daily 2 The patient was treated with 100 mg of ifosfamide and 3 consecutive days of mesna, and continued daily dosing of sorafenib. The tumor became increasingly painful during this 5-week systemic therapy. During simulated preoperative radiation, a craniocaudal extension of the tumor was noted within the psoas muscle, which prevented safe administration of an effective radiation dose due to anticipated intestinal toxicity. Therefore, the patient stopped this regimen and was transferred to surgical resection.

[0341] Resection of the primary tumor yielded negative margins and examination of pathological specimens confirmed 90% tumor necrosis. A restaging chest CT scan (shown in Fig.21 A) showed worsening metastatic disease, with the largest nodule now measuring 18 mm. The patient's postoperative course was complicated by a polymicrobial wound infection that required repeated wound debridements and prolonged antibiotic therapy. A repeat chest CT was obtained before chemotherapy was resumed and demonstrated dramatic progression during the first 9 weeks with multiple pulmonary nodules larger than 3 cm, the largest approaching 7 cm, and a large left pleural effusion. After tunneled pleural drainage was implemented and supplemental home oxygen was started, the patient received one 75 mg / m 2 of doxorubicin while awaiting the addition of treatment using the crystalline form (I-HS).

[0342] Patients' diagnostic open tumor biopsies were tested using the FoundationOneHeme panel (Foundation Medicine, Cambridge, MA). This multi-target comprehensive genomic profiling (CGP) test, which uses DNA and RNA sequencing of hundreds of cancer-related genes, confirmed the presence of a gene fusion of exons 1-2 of the lamin A / C gene (LMNA) encoding the lamin A / C gene and exons 11-17 of the NTRK1 gene, resulting in the LMNA-NTRK1 fusion gene ( Fig.14 ). CGP also showed loss of the tumor suppressor CDKN2A / B (not shown), but no other known oncogenic mutations.

[0343] Subsequent break-apart fluorescence in situ hybridization (FISH) analysis of the patient's tumor sample revealed a single, predominant 3'NTRK1 (red fluorescent signal) pattern in 64% of tumor cell nuclei, consistent with genomic alterations involving the NTRK1 locus, which, given the location and orientation of LMNA and NTRK1 on the large arm of chromosome 1, was most likely secondary to a genomic deletion between the two genes ( Fig.15 ). mRNA expression of the novel fusion transcript from the gene fusion was confirmed by RT-PCR and sequencing ( Fig.16 ).

[0344] A novel proximity ligation assay (PLA) was performed using patient tumor samples to evaluate protein expression and functional activity of fusion oncoproteins. PLA is unique in that it can detect in situ a functional signaling complex between a kinase and one of its aptamers. In this assay, TRKA ( Fig.17 The test was validated in both human cell lines and formalin-fixed patient-derived xenograft (PDX) tumor samples ( Fig.18 ). It was found that RNAi knockdown of NTRK1 was similar to inhibition by the crystalline form (I-HS) ( Fig.18 D and 18E) can disrupt the TRKA-SHC1 complex in the CUTO-3 cell line with the MPRIP-NTRK1 fusion gene ( Fig.18 AC). TRKPLA detects functional signaling complexes in FFPE tumor samples from patient-derived xenograft (PDX) CULC001, which harbors the MPRIP-NTRK1 gene fusion, but not PDX CULC002, which has no known oncogenic driver mutations ( Fig.18F and 18G). TRK-SHC PLA can also detect non-oncogenic signaling complexes, as shown by positive signals in areas of peripheral nerve tissue of CULC001 PDX, where receptors of the TRK family have high expression (activity mediated by neurotrophic factors). Application of this test to patient tumor samples confirmed robust signaling associated with tumor cell nuclei, but only weak signals in blood vessels (human endothelial cells express TRKA, consistent with oncogenic signaling through the LMNA-TRKA oncoprotein ( Fig.19 A and B). TRK-SHC1 PLA confirmed negative results on tumor samples from ALK+ NSCLC patients, while ALK-GRB2 PLA was positive ( Fig. 20 ), which further confirms the ability of this test to detect oncogenic signaling in human tumor samples.

[0345] The presence of the LMNA-NTRK1 fusion, detected by the FoundationOneHeme test and then validated by FISH and RT-PCR, together with evidence of TRKA protein expression and functional activity of the TRK pathway in the patient's tumor sample, indicates that the patient has a TRK-driven cancer that is amenable to treatment with a TRK-specific inhibitor.

[0346] Based on multiple genetic and functional biomarker data suggesting the presence of a TRK driver oncogene, the patient was recommended to be considered for enrollment in a Phase 1 trial of the crystalline form (I-HS). One month later, the patient was found eligible for the trial and provided written informed consent. Baseline CT scans showed continued tumor progression and multiple large lung metastases in both lungs, but the pleural effusion resolved after pleural drainage ( Fig.21 C). Based on clinical presentation, the patient had significant exertional dyspnea and required 5 L of supplemental oxygen to maintain an oxygen saturation of 90%. Baseline laboratory values ​​were notable for elevated CA125 tumor marker levels ( Fig. 22 ). The patient received an initial dose of 100 mg of the crystalline form (I-HS) 3 days before starting continuous dosing, and then received the same dose about 12 hours later on the same day, and a 48-hour pharmacokinetic and safety evaluation was performed according to the study protocol. The patient started cycle 1 day 1 3 days later. The patient was visited weekly for pharmacokinetic and safety analysis. No drug-related adverse events were noted, and the patient experienced improvement in exercise dyspnea every week during this 4-week period. CA125 levels normalized after experiencing cycle 1. CT was implemented before starting cycle 2 day 1, which confirmed significant improvement in multiple lung metastases and was considered to be a partial response by RECIST 1.1. Repeated CT was implemented before cycle 3 day 1 and sustained response was confirmed, and therefore a partial response was confirmed by RECIST 1.1 ( Fig.21C). Clinically, the patient had significantly improved exertional dyspnea and no longer required supplemental oxygen, and had an oxygen saturation of 97% on room air. After 4 months of dosing, the patient had no adverse events attributed to the crystalline form (I-HS). These data show that the crystalline form (I-HS) is able to treat the subject's undifferentiated sarcoma, as well as other cancers with dysregulated Trk proteins (e.g., constitutively active forms of Trk proteins, e.g., Trk fusion proteins or Trk point mutations).

[0347] LMNA-NTRK1 gene fusion has been previously reported in Spitzoid nevi and is constitutively activated when expressed in cells, leading to activation of ERK1 / 2, AKT, and PLCγ, which confirms its oncogenicity (Taipale et al., Nature Biotech. 31:630-637, 2013). Foundation Medicine (FM) has previously tested 1272 soft tissue sarcoma samples using the FoundationOneHeme CGP assay and detected 8 NTRK1 or NTRK3 fusions, including the patient described in this report (Table 15). Notably, 6 of the 8 sarcoma patients with NTRK fusions were under 25 years old (Fisher's exact, P value = 4x10 -4 ), and 4 of the 8 were under 5 years old (Fisher's exact, P value = 2x10 -5 ), indicating an increased detection rate of NTRK fusions in pediatric patients (4.1%; 95% CI 1.8%-9.3%) and specifically in those under 5 years of age (14.3%; 95% CI 5.7%-31.5%). Also of interest is that one of the gene fusions detected combines a large portion of the NTRK3 gene (exons 1-17) with the 3' end of the HOMER2 gene (exons 2-9), which contains a dimerization domain (coiled coil domain) and thus represents a 3' gene fusion event that has now been described for a variety of other RTK encoding genes, such as EGFR, AXL, and FGFR3 (Sleijfer et al., Eur. J. Cancer 46:72-83, 2010; Linch et al., Clin. Oncol. 11:187-202, 2014; Rutkowski et al., J. Eur. Acad. Dermatol. Venereol. 25:264-270, 2011).

[0348] Table 15. Clinical features and NTRK fusion gene details of patients with soft tissue sarcoma

[0349]

[0350] In addition, experiments were performed to show that the crystal form (I-HS) specifically inhibited the activity of Trk kinase. For example, the crystal form (I-HS) did not inhibit the cell proliferation of the HCC78 cell line derived from non-small cell lung cancer expressing the SLC34A2-ROS1 fusion protein ( Fig.23 )(Vaishnavi et al., Nat Med. 19:1469-72, 2013).

[0351] Materials and Methods

[0352] Clinical trials

[0353] NCT02122913 is an ongoing multicenter Phase 1 dose escalation study that evaluates the safety and pharmacokinetics of crystalline form (I-HS) (selective pan-TRK) in unselected patients with metastatic or advanced solid tumors who have no standard treatment options. The study was approved by Institutional Review Boards at the institutions of all enrolled patients, and eligible patients provided written informed consent to participate. Crystal form (I-HS) is provided in 100 mg capsules. Enrolled patients received increasing doses of crystalline form (I-HS) according to a modified 3+3 design, and received crystalline form (I-HS) once or twice a day until intolerable toxicity, disease progression, or withdrawal of consent. In patients with measurable disease, efficacy was evaluated according to RECIST 1.1 criteria.

[0354] Next Generation Sequencing (NGS)

[0355] DNA and RNA were extracted and adapter-ligated sequencing libraries were captured by solution hybridization using a custom bait set targeting 405 cancer-related genes and 31 frequently rearranged genes (by DNA-seq) and 265 frequently rearranged genes (by RNA-seq) (FoundationOne Heme). All captured libraries were sequenced at high depth (Illumina HiSeq) in a CLIA-certified CAP-accredited laboratory (Foundation Medicine), with an average of >500x (for DNA) and >6M unique pairs (for RNA). Sequence data of gDNA and cDNA were mapped to the reference human genome (hg19) and analyzed by a computational analysis pipeline to obtain genomic changes present in the sample, including substitutions, short insertions and deletions, rearrangements, and copy number changes.

[0356] Fluorescence in situ hybridization (FISH)

[0357] NTRK1 break-apart FISH was performed on 4-micron slides of formalin-fixed, paraffin-embedded (FFPE) tumor samples as previously described using Vysis LSI NTRK1 (Cen) Spectrum Green (Cat. No. 08N43-030) and Vysis LSINTRK1 (Tel) Spectrum Red (Abbott Molecular, Nos. 08N43-030 and 08N43-020, respectively) (Vaishnavi et al., Cancer Discov. 5:25-34, 2015).

[0358] RT-PCR and DNA sequencing

[0359] Reverse transcriptase polymerase chain reaction (RT-PCR) was performed as previously described using a forward primer for LMNA (LMNA F1, 5'gagggcgagctgcatgat3'; SEQ ID NO: 1) (Weisner et al., Nat. Comm. 5:3116, 2014) and a reverse primer for NTRK1 (NTRK1 Y490rev, 5'cggcgcttgatgtggtgaac3'; SEQ ID NO: 2). DNA sequencing of RT-PCR products was performed using Sanger DNA sequencing at the Pathology Core at the University of Colorado.

[0360] Cell lines

[0361] Informed consent was obtained to obtain immortalized cell lines from patients. The CUTO-3 cell line and its derivatives were derived from malignant pleural effusions of patients with stage IV lung adenocarcinoma with MPRIP-NTRK1 gene fusion as previously described (Vaishnavi et al., Cancer Discov. 5:25-34, 2015; Davies et al., PLoS One 8:e82236, 2013). KM12 and MO-91 have been described previously (Vaishnavi et al., Nature Med. 19:1469-1472, 2013; Taipale et al., Nat. Biotech. 31:630-637, 2013).

[0362] Patient-derived xenograft generation

[0363] Informed consent was obtained from the patient to generate patient-derived murine xenografts. Tumor tissue from an oncogene-negative lung adenocarcinoma patient (CULC001) was cut into 3×3×3 mm fragments, which were transferred to DMEM supplemented with 10% fetal bovine serum (FBS) and 200 units / mL penicillin and 200 ug / mL streptomycin. Tumor fragments were immersed in matrigel (Corning) and inserted into an incision on each flank of 5 nude mice. Pleural fluid from a lung adenocarcinoma patient with MRPIP-NTRK1 gene fusion (CULC002) was centrifuged and the resulting cell pellet was suspended in 5 ml ACK buffer (Lonza) for 2 min to completely lyse the red blood cells. The lysis was stopped by adding 20 mL PBS and the sample was centrifuged. The pellet was washed twice with PBS and then suspended in the above-mentioned DMEM supplemented medium. 100 μl of cells (1 x 10 6 The resulting xenografts were propagated and maintained as described previously (Keysar et al., Mol. Oncol. 7:776-790, 2013).

[0364] Proximity ligation test

[0365] Cells were seeded onto glass coverslips (in 48-well plates) or chamber slides at 25-75k cells / well. Cells were treated with the indicated doses and times and then fixed by shaking in 4% paraformaldehyde for 15 minutes at room temperature. Cells were rinsed twice in PBS and then cultured in mice / rabbits (Red) using Sigma Aldrich according to the manufacturer's protocol (Cat. No. DUO92101). In situ Kit. Optimize antibody concentrations using immunofluorescence prior to PLA experiments. Prepare mouse or patient FFPE tissue PLA as described in Histology. Additionally, treat samples with 300 mM glycine for 15 min prior to the blocking step, otherwise test according to the manufacturer's protocol. Cells were fixed with gold antifade reagent (with DAPI) and fixed overnight before imaging. Images were taken on a Nikon standard inverted fluorescence microscope at 40× or on a 3I Marianas spinning disk confocal in the University of Colorado Anschutz Medical Campus Advance Light Microscopy Core at 40× or 100×. The following antibodies were used: TRK (C17F1) and ALK (D5F3) from CellSignaling, SHCl from Novus, and Grb2 (610111) from BD.

[0366] Proliferation test

[0367] All proliferation assays were performed using Cell Titer 96 MTS (Promega) in medium supplemented with 5% FBS as previously described (Bouhana et al., EORTC-NCI-AACR 26 th Symposium on Molecular Targets and Cancer Therapeutics, Barcelona, ​​Spain 2014). Cells were seeded at 500-2000 cells / well and treated for 72 hours at the drug concentrations described in each graph. Each test was performed in triplicate with at least 3 independent biological replicates. Data were plotted and IC50 values ​​were calculated using GraphPad software.

[0368] Immunoblotting

[0369] Immunoblotting was performed as described previously (Vaishnavi et al., Nature Med. 19: 1469-1472, 2013). Briefly, cells were lysed in RIPA buffer with Halt protease and phosphatase inhibitor cocktail (Thermo Scientific) and diluted in loading buffer (LI-COR Biosciences). Membranes were scanned and analyzed using Odyssey Imaging System and software (LI-COR). The following antibodies from Cell Signaling were used: pTRK Y490 (rabbit polyclonal, No. 9141), pERK1 / 2 XP T202 / Y204 (No. 9101), total ERK1 / 2, pAKT S473 (rabbit mAb, No. 4060), and total AKT mouse clone D3A7 (No. 2920). TRK (C-14) rabbit polyclonal antibody was purchased from Santa Cruz Biotechnology. GAPDH (MAB374) and pTYR (4G10) were from Millipore.

[0370] Statistical analysis

[0371] Confidence intervals for the detection rate of NTRK fusions in samples from sarcoma patients were calculated using the 1-sample ratio test. Disease histology classification was based on the Basic Medicine disease ontology. Enrichment of NTRK fusions in younger patient cohorts was tested using Fisher's exact test. All statistical tests were performed in R v 3.1.3.

[0372] Example 9

[0373] I-HS (a selective TRKA / B / C inhibitor) in patients with solid tumors harboring NTRK gene fusions Phase 1 study of clinical safety and activity

[0374] method

[0375] In this continuous open label multicenter 3+3 dose escalation phase I study of crystalline form (I-HS), 23 patients with solid tumors with normal hematopoiesis and major organ function who were not significantly effective for standard therapy were recruited. Crystal form (I-HS) was administered orally with a single dose, followed by QD or BID doses for 28 consecutive days of circulation. Reaction was measured by RECIST standard version 1.1. Serum was collected on the 1st and 8th days of cycle 1 for pharmacokinetic analysis. Safety information was collected for all patients, and the definition of dose-limiting toxicity was applied to adverse events regardless of the relationship with the research product.

[0376] result

[0377] So far, 23 patients have been treated at each of the first 5 dose levels ranging from 50 mg QD to 150 mg BID. The crystalline form (I-HS) is well tolerated; MTD has not yet been reached and the most common adverse events are grade 1 and grade 2 fatigue (35%), dizziness (26%) and anemia (22%). Two patients had dose-limiting toxicity (elevated AST, grade 3 (dose level 150 mg BID) and delirium, grade 3 unrelated (dose level 100 mg BID)).

[0378] PK analysis showed that the maximum plasma concentration of the crystalline form (I-HS) was reached 30-60 minutes after dosing and exposure increased approximately proportionally to the dose. The unbound drug levels of the crystalline form (I-HS) appeared to be sufficient for approximately 98% inhibition of TRKA / B / C at all dose levels at peak concentrations.

[0379] Three of the 23 patients had NTRK fusions and were treated at 100 mg BID or 150 mg BID. These patients achieved partial responses: undifferentiated sarcoma with LMNA-NTRK1 fusion (59% reduction; 7 cycles +), c-kit negative GI stromal tumor (GIST) with ETV6-NTRK3 fusion (30% reduction; 2 cycles +), and breast secretory carcinoma-like with ETV6-NTRK3 fusion (64% reduction; 2 cycles +). These data are supported by in vivo tumor growth inhibition and regression in xenograft mouse models of TRK fusions.

[0380] in conclusion

[0381] The crystalline form (I-HS) was well tolerated and had adequate systemic exposure for robust inhibition of NTRK fusions, as demonstrated by pharmacokinetic drug levels and sustained clinical responses observed in the three patients with NTRK fusions enrolled in this study. These data further validate this molecular target as an oncogenic driver in multiple tumor histologies.

[0382] Example 10

[0383] Comparison of crystalline (I-HS) and amorphous sulfate

[0384] Several experiments were performed to compare the properties of amorphous (S)-N-(5-((R)-2-(2,5-difluorophenyl)-pyrrolidin-1-yl)-pyrazolo[1,5-a]pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide hydrogen sulfate and crystalline Form (I-HS). These studies included impurity profiles, stability, flow properties, and hygroscopicity. In the following studies, two batches of amorphous material (AM(HS)1 and AM(HS)2) were compared to a single batch of crystalline Form (I-HS). AM(HS)1 and AM(HS)2 were prepared as described in Example 3. Crystalline Form (I-HS) was prepared as described in Example 2.

[0385] method

[0386] Residual solvent

[0387] Solutions of AM(HS)1, AM(HS)2 and Form (I-HS) were analyzed using GC-MS headspace analysis.

[0388] Thermogravimetric analysis (TGA)

[0389] The sample was placed on a platinum pan and subjected to 10°C / min to 300°C.

[0390] Differential Scanning Calorimetry (DSC)

[0391] The sample was placed in a crimped aluminum crucible with a pinhole in the lid and subjected to 10°C / minute to 250°C under nitrogen.

[0392] X-ray diffraction (XRD)

[0393] At 44 kV, 40 mA, Cu Ka irradiation through Ni filter, using 2 / 3° divergence slit, 10 mm divergence HL slit, scattering slit set to "Auto" (scattering slit determined by computer / instrument), 0.3 mm receiving slit. Continuous scanning from 3° to 40° 2θ at 2° / min; sampling width (step size) of 0.02° / sec, step time of 0.4 points / sec. The sample was rotated at 60 rpm in a plane parallel to the sample surface.

[0394] Polarized Light Microscopy (PLM)

[0395] The samples were placed on glass microscope slides, immersed in low viscosity oil and covered with glass coverslips. They were examined under a 20× objective using crossed polarizers and a 530 nm cutoff filter. Imaging was performed using a PAX-It camera and processed by PAX-It software.

[0396] Dynamic Vapor Sorption (DVS)

[0397] 1. Hygroscopicity was studied at 25°C using an IGAsorp analyzer.

[0398] 2. Place approximately 15 mg of sample in a tared mesh sample holder and set the initial ambient room humidity to approximately 35%.

[0399] 3. A total wet / dry nitrogen flow rate of 250 cc / min was used throughout the study.

[0400] 4. The solid was studied by implementing a complete cycle of the following program: drying at 40°C under dry N2 for 60 minutes, followed by setting 0%RH, 10%RH, 20%RH, 30%RH, 40%RH, 50%RH, 60%RH, 70%RH, 80%RH, 90%RH and 95%RH, where the exposure time at each humidity set point was determined by the 99.5% confidence in the F1 fitting model or 60 minutes. The maximum time allowed at any one humidity set point was 120 min. The sample was kept under dry N2 after completing the cycle.

[0401] The % weight gain was calculated on a dry weight basis.

[0402] Part I: Physical Characterization of Crystalline Form (I-HS)

[0403] AM(HS)1, AM(HS)2 and the crystalline form (I-HS) were characterized by appearance, residual solvent, thermogravimetric analysis (TGA), Karl Fischer water content (KF), differential scanning calorimetry (DSC), X-ray diffraction (XRD), polarized light microscopy (PLM) and hygroscopicity by dynamic vapor sorption (DVS). The data of physical characterization of the three batches can be found in Tables 16-19 and Figures 24 to 38 .

[0404] Table 16. Appearance

[0405] Compound Appearance Munsell# AM(HS)1 Yellow powder, no aggregate 7.5Y 9 / 10 AM(HS)2 Yellow powder, no aggregate 7.5Y 9 / 10 Crystallized I-HS Orange powder, no aggregate 2.5YR 7 / 10

[0406] Table 17. Residual Solvents

[0407]

[0408] Table 18. Thermogravimetric and Karl Fischer (water content) analysis

[0409]

[0410] Table 19. Differential Scanning Calorimetry Analysis

[0411]

[0412] Physical Characterization Conclusion

[0413] API forms AM(HS)1 and AM(HS)2 are amorphous with no birefringence by polarized light microscopy, and the XRPD patterns of both batches are also distinctly amorphous with no discernible x-ray diffraction peaks. The TGA of the amorphous compound shows a gradual weight loss, consistent with the endothermic events observed in differential scanning calorimetry. The first two endothermic events are quite broad and may indicate evaporation and / or desolvation. The last endothermic event occurs at the approximate temperature of melting observed in the crystalline material. The hygroscopicity of both amorphous batches is quite strong and significantly delayed after desorption. AM(HS)1 increased more than 13% of its initial mass at 80% RH. Similarly, AM(HS)2 increased nearly 12% of its initial mass at 80% RH. The XRPD after DVS indicated no form change during dynamic vapor sorption, however, deliquesced powder was observed in the sample holder, making it difficult to remove the deliquesced powder from the sample holder.

[0414] Form (I-HS) has crystalline properties with numerous diffraction peaks (by x-ray diffraction) and true birefringence (by polarized light microscopy) in its agglomerate-like morphology. Form (I-HS) exhibits a 6% thermogravimetric weight loss consistent with an endothermic melting onset occurring at 193.7°C. Form (I-HS) is not hygroscopic and only increases 1% of its starting mass at 80% RH.

[0415] Part II: Powder properties of the crystalline form (I-HS)

[0416] The following studies compared the crystalline bisulfate salt to the amorphous bisulfate salt powder and included a study of the flow properties of each form that are important for manufacturing solid oral dosage forms such as tablets or capsules. The work performed included bulk density, tap density, angle of repose, and compression profile.

[0417] Blends

[0418] Blends were produced according to the formulations presented in Tables 20 and 21. These blends are typical of tablet formulations that can be manufactured as direct compression or roller-compression based tablets or formulated capsules. First, the API (i.e., AM(HS) or crystalline form (I-HS)), microcrystalline cellulose (MCC), and starch or lactose were added to a 30 cc amber glass bottle and stirred at 4 °C. Mix on a Shaker mixer at 25 rpm for 3 minutes. Then, add the remaining excipients to the bottle and Mix for another 3 minutes at 25 rpm.

[0419] Table 20. Tablet Formulations with 2:1 MCC:Lactose, 50% Drug Load

[0420]

[0421] Table 21. Tablet formulation with 1:1 MCC:starch, 50% drug load

[0422]

[0423] Angle of repose

[0424] The angle of repose is the angle formed by a horizontal baseline through the surface and the edge of a cone-like pile of particles. It is calculated from the following equation:

[0425]

[0426] The angle of repose was measured by slowly pouring about 1 g of sample through a funnel with a 3 / 16" outlet inner diameter. The powder was then allowed to drop 1 11 / 16" to land on the surface of an inverted crystallizing dish, forming a powder pile thereon. A picture of the pile was taken after all material was added. The angle between the crystallizing dish surface and the pile surface was measured on the picture via a protractor. The same position and drop distance was carefully replicated in the setup between different samples.

[0427] Bulk density and tap density

[0428] The powder was added to a pre-weighed 10 mL measuring cylinder through a funnel that was not in direct contact with the measuring cylinder to avoid transfer by vibration. The powder was added until a volume of 10 mL was reached and then the measuring cylinder with the powder was weighed. The bulk density was calculated by: The sample in the cylinder was tapped in the following order: 100 taps, 150 taps, 250 taps, 250 taps. The volume was measured after each interval. The tap density was calculated by:

[0429] The Carr index is calculated according to the following equation:

[0430]

[0431] The Hausner ratio is calculated using the following equation:

[0432]

[0433] Compression Overview

[0434] Compression profiles were generated by producing 5 / 16" diameter round tablets at 5 different compression pressures for each blend. The compression settings were 1 second dwell time and 15% pump speed. Tablets were produced for all four powder blends using compression forces of 700 kg, 1000 kg, 1500 kg, and 2000 kg. The highest compression force was selected based on the results of the previous tablets. Tablet mass, size, and rupture force were then measured. These data were graphed using a template to produce a graph of compression pressure versus tensile strength ( Fig.39 ).

[0435] result

[0436] Table 22. Reference values

[0437] Flow characteristics Angle of repose Hausner Compression index (%) Excellent 25-30° 1.00-1.11 ≤10 good 31-35° 1.12-1.18 11-15 generally 36-40° 1.19-1.25 16-20 Fair 41-45° 1.26-1.34 21-25 Difference 46-55° 1.35-1.45 26-31 Very bad 56-65° 1.46-1.59 32-27 Very very bad ≥66° ≥1.60 ≥38

[0438] The results are presented in Tables 23 and 24 and Fig.39 According to the US Pharmacopeial Convention (USP), all samples were classified as having fair or poor flow, as measured by the angle of repose. A larger angle indicates worse flow. According to the USP Carr's Index (compression index) and Hausner ratio, it was classified between fair and very poor. Crystalline APIs differed significantly from amorphous APIs and these differences were present in all formulated blends (regardless of the content of amorphous or crystalline API). For crystalline APIs, the Hausner ratio and Carr's index indicated that the flow properties were "fair". Amorphous APIs had quite poor flow properties and were classified as "very poor" according to the Hausner ratio and Carr's index. For relevant USP tables, see Table 22. .

[0439] When tablets were produced for the compression profile, the crystalline API blend produced multiple tablets that broke after ejection from the tooling. The amorphous API blend appeared to produce visually better tablets, i.e., little to no breakage.

[0440] Table 23. Angle of repose

[0441]

[0442] *θ and is the angle on either side of the cone (2D).

[0443] Table 24. Bulk density and tap density

[0444]

[0445]

[0446] Powder Properties Conclusion

[0447] The tested crystalline (I-HS) formulated blends, amorphous API and amorphous API formulated blends had "very poor" flow characteristics according to the angle of repose. However, the crystalline API (crystalline (I-HS)) had "fair" flow characteristics according to Carr's Index and Hausner Ratio. The significantly better flow properties here are beneficial for solid oral dosage form development and manufacturing. There were also no major differences in the compression profiles of the two blends with the two batches of powder. This indicates that (S)-N-(5-((R)-2-(2,5-difluorophenyl)-pyrrolidin-1-yl)-pyrazolo[1,5-a]pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide hydrogen sulfate (amorphous or crystalline) does not positively and negatively affect the flow of the blends at 50% drug loading.

[0448] Part III: Stability of AM(HS)1 and its crystalline form (I-HS)

[0449] Aliquots of powders of AM(HS)1 and Form (I-HS) were placed in uncapped (open) 20 mL scintillation vials and the vials were placed in LDPE bags placed in a stability chamber maintained at 40°C / 75% RH for 5 weeks. After removal from the chamber, the samples were physically characterized by appearance, KF, TGA, DSC, XRD, and PLM. The samples were also analyzed by HPLC for chromatographic purity, chiral integrity, and potency. Where applicable, the data presented in the stability section also include initial T=0 data for comparison purposes. The data can be found in Tables 25-29 and Figures 40 to 44 .

[0450] Table 25. Appearance of stability samples

[0451]

[0452] Table 26. TGA and KF of stability samples

[0453]

[0454] Table 27. DSC of stability samples

[0455]

[0456] Table 28. HPLC data of stability samples

[0457]

[0458] Table 29. HPLC Data: Peak Area Percent of Stability Samples by RRT

[0459]

[0460] Stability Conclusion

[0461] Amorphous compound AM (HS) 1 is unstable under humid conditions and tends to crystallize over a period of time. This can be confirmed by deliquescence and changing appearance (by eye and polarized light microscopy) of samples stored in a humidity chamber (data not shown). The amorphous material changes from a free-flowing yellow powder to an orange accumulated non-free-flowing powder. Polarized light microscopy, XRPD, DSC, TGA and KF of the amorphous API also changed significantly during the course of the accelerated stability study, becoming the same polymorph as the crystalline form (I-HS). During the course of the accelerated stability study, the XRPD pattern of the amorphous compound AM (HS) 1 was converted to the XRPD pattern of the crystalline form (I-HS). Polarized light microscopy changes from non-birefringence to birefringence under orthogonal polarized light, indicating that the amorphous form changes to a crystalline API. The DSC at t = 0 has two endothermic events with melting maxima at 68.3 ° C and 152.8 ° C, which disappear at the t = 5 week time point. Only a single endothermic event with a melting maximum of 206°C remained for the amorphous material. This melting maximum matched the thermogram of the crystalline API. The TGA curve of the amorphous material at t=5 weeks also changed to match the curve and weight loss of the crystalline API. The crystalline form (I-HS) did not show any changes in hygroscopicity nor in color, morphology or crystallinity after storage under accelerated conditions.

[0462] The API chemical purity of AM(HS)1 or crystalline form (I-HS) did not change significantly during the course of the stability study. However, the impurity profiles of the amorphous and crystalline forms (I-HS) were significantly different. The amorphous material contained significantly higher impurity levels than the crystalline form (I-HS) (Tables 22 and 23). It is believed that the reduced impurities of the crystalline form (I-HS) relative to the amorphous AM(HS)1 at relative retention times (RRT) 0.863 (0.00% vs. 0.98%) and 1.535 (0.00% vs. 0.12%) are caused by the separation of the crystalline form (I-HS) via the crystallization method, which rejects these impurities and is superior to the method for separating amorphous AM(HS)1. The amorphous AM(HS)1 separation method does not appear to effectively reject these impurities.

[0463] General overview of the study

[0464] 1. The crystalline form (I-HS) has better flow properties than the amorphous form AM(HS). The difference in flow properties relative to AM(HS) will improve the development of solid oral dosage forms of the crystalline form (I-HS).

[0465] 2. Stability studies at 40°C / 75%RH for 5 weeks in LDPE bags did not show significant changes in the levels of chemical impurities for any form of the compound. However, it was revealed that the crystalline form (I-HS) did not undergo significant changes in its physicochemical properties during the course of the study. On the contrary, according to XRPD, DSC, TGA, KF and polarized light microscopy, AM(HS) was converted into a crystalline form substantially similar to the crystalline form (I-HS). In addition, AM(HS) became an agglomerated powder with reduced flow properties during the course of the stability test. The change of the properties of amorphous AM(HS) to a crystalline material with reduced flowability and / or an agglomerated powder after storage of AM(HS) would make it impossible to manufacture a solid oral dosage form based on the amorphous compound for use in patients.

[0466] 3. AM(HS) deliquesces when exposed to humidity. This would require significant handling precautions to prevent this from occurring during storage and manufacturing, whereas Form (I-HS) does not require these precautions during the manufacture of Form (I-HS) and any solid oral dosage product prepared using Form (I-HS).

[0467] 4. Crystalline Form (I-HS) provides a significantly improved impurity profile compared to AM(HS). The ability to control the impurity profile is important for patient safety and is required by regulatory agencies.

[0468] Embodiment 11

[0469] The crystalline form (I-HS) reduces the growth of tumors characterized by the expression of Trk fusion proteins

[0470] A set of experiments was conducted to determine whether the crystalline form (I-HS) would inhibit the growth of three different xenograft (human) tumors in mice, each of which was derived from a cancer cell line. The three different cancer cell lines were the CUTO-3F cell line, the KM12 cell line, and the MO-91 cell line, each of which expressed a different Trk gene fusion. As described in Example 7, the CUTO-3F cell line was derived from a patient with lung adenocarcinoma having an MPRIP-NTRK1 gene fusion, the KM12 cell line was a colorectal cancer cell line having a TPM3-NTRK1 fusion (Vaishnavi et al., Nature Med. 19: 1469-1472, 2013), and the MO-91 cell line was derived from an acute myeloid leukemia patient having an ETV6-NTRK3 fusion (Taipale et al., Nature Biotech. 31: 630-637, 2013). After implantation of one of the three different xenograft (human) tumors in mice, changes in the volume of each tumor were monitored. After xenograft implantation, the resulting mice were treated with vehicle or orally administered with a daily dose of 60 mg / kg or 200 mg / kg of the crystalline form (I-HS), respectively. Figures 45 to 47 ).

[0471] These data show that administration of the crystalline form (I-HS) is effective in preventing the growth of, or reducing the rate of growth of, human tumors characterized by expression of oncogenic Trk fusion proteins in mammals.

[0472] While the above description teaches the principles of the invention, and the embodiments are provided for purposes of illustration, it should be understood that the practice of the invention encompasses all common changes, modifications and / or adaptations, which are also within the scope of the following claims and their equivalents.

[0473] References :

[0474] 1. Wiesner et al., Nature Comm. 5: 3116, 2014.

[0475] 2. Vaishnavi et al., Nature Med. 19:1469-1472, 2013.

[0476] 3. Greco et al., Mol. Cell. Endocrinol. 28:321, 2010.

[0477] 4. Kim et al., PloS ONE 9(3):e91940, 2014.

[0478] 5. Vaishnavi et al., Nature Med. 19:1469-1472, 2013.

[0479] 6. Fernandez-Cuesta et al., “Cross-entity mutation analysis of lungneuroendocrine tumors sheds light into their molecular origin and identifies new therapeutic targets,” AACR Annual Meeting 2014, Abstract, April 2014.

[0480] 7. Stransky et al., Nature Comm. 5: 4846, 2014.

[0481] 8. Ross et al., Oncologist 19:235-242, 2014.

[0482] 9. Doebele et al., J. Clin. Oncol. 32: 5s, 2014.

[0483] 10. Jones et al., Nature Genetics 45:927-932, 2013.

[0484] 11. Wu et al., Nature Genetics 46:444-450, 2014.

[0485] 12. WO 2013 / 059740

[0486] 13. Zheng et al., "Anchored multiplex PCR for targeted next-generation sequencing," Nature Med., published online on November 10, 2014.

[0487] 14. Caria et al., Cancer Genet. Cytogenet. 203:21-29, 2010.

[0488] 15. Frattini et al., Nature Genet. 45: 1141-1149, 2013.

[0489] 16. Martin-Zanca et al., Nature 319:743, 1986.

[0490] 17. Meyer et al., Leukemia 21:2171-2180, 2007.

[0491] 18. Reuther et al., Mol. Cell. Biol. 20:8655-8666, 2000.

[0492] 19. Marchetti et al., Human Mutation 29(5):609-616, 2008.

[0493] 20. Tacconelli et al., Cancer Cell 6:347, 2004.

[0494] 21. Walch et al., Clin. Exp. Metastasis 17:307-314, 1999.

[0495] 22. Papatsoris et al., Expert Opin. Invest. Drugs 16(3): 303-309, 2007.

[0496] 23. Van Noesel et al., Gene 325: 1-15, 2004.

[0497] 24. Zhang et al., Oncology Reports 14:161-171, 2005.

[0498] 25. Truzzi et al., J. Invest. Dermatol. 128(8): 2031, 2008.

[0499] 26. Kolokythas et al., J. Oral Maxillofacial Surgery 68(6): 1290-1295, 2010.

[0500] 27. Ni et al., Asian Pacific Journal of Cancer Prevention 13:1511, 2012.

Claims

1. A crystalline form (I-HS) having the following formula: Features It has XRPD diffraction peaks (2θ degrees) located at 18.4±0.2, 20.7±0.2, 23.1±0.2 and 24.0±0.2, wherein the crystalline form is substantially free of an amorphous form.

2. The crystalline form according to claim 1, characterized in that It has XRPD diffraction peaks (2θ degrees) at 10.7±0.2, 18.4±0.2, 20.7±0.2, 23.1±0.2 and 24.0±0.

2.

3. The crystalline form according to claim 1, wherein the crystalline form contains less than 5 mol% of an amorphous form.

4. The crystalline form according to claim 1, wherein the crystalline form contains less than 2 mol% of an amorphous form.

5. A pharmaceutical composition comprising a pharmaceutically acceptable carrier and the crystalline form according to any one of claims 1 to 4.

6. Use of the crystalline form according to any one of claims 1 to 4 in the preparation of a medicament for treating a disease selected from the group consisting of Trk kinase-mediated cancer, pain, inflammation, neurodegenerative diseases or Trypanosoma cruzi infection.

7. Use of a crystalline form according to any one of claims 1 to 4 for the preparation of a medicament for treating a Trk kinase-mediated cancer in a subject in need thereof.

8. The use of claim 6, wherein the cancer is mediated by TrkA.

9. The use of claim 6, wherein the cancer is mediated by TrkB.

10. Use of a crystalline form according to any one of claims 1 to 4 for the preparation of a medicament for treating cancer in a subject in need thereof, wherein the treatment first comprises determining whether the cancer is mediated by Trk kinases.

Images