New microalgae with high production of loline

Abstract

This invention relates to a novel microalgae with high ryegrass lactone production. The *Scenedesmus* HS4 of this invention has high biomass production and high ryegrass lactone content, and therefore can be used as a biological resource for producing ryegrass lactone. It can be used in pharmaceutical or cosmetic compositions that require ryegrass lactone derived from *Scenedesmus* HS4.

Description

Technical Field

[0001] This invention relates to a type of Scenedesmus microalgae characterized by excellent growth rate and high content of ryegrass lactone. Background Technology

[0002] As the outermost organ of the human body, the skin is constantly and directly affected by various air pollutants and physical stimuli, especially sunlight, which is part of ultraviolet radiation. Compared to other organs, it is more susceptible to damage due to its exposure to external stimuli. As described above, these external stimuli can hinder the growth of skin cells for various reasons, leading to necrosis and potentially causing cellular aging. Furthermore, the destruction or reduced synthesis of fibrous proteins within skin cells can result in wrinkles.

[0003] Skin aging can be divided into two categories: chronological aging (intrinsic aging), which is a natural aging process that occurs over time as a result of biological processes, and photoaging (photogenic aging), which is a combination of degenerative changes and chronological aging occurring in areas exposed to sunlight. Natural cellular aging can occur when the expression or activity of various factors related to cell growth is impaired. Photoaging of skin cells can occur due to light with wavelengths from 280nm to 400nm contained in sunlight. In particular, exposure to ultraviolet radiation, such as UVB with wavelengths in the 280nm to 320nm range, can cause damage to the skin or fibers, potentially leading to tanning. UVB exposure promotes the accumulation of reactive oxygen species (ROS) and free radicals within skin cells. These free radicals stimulate intracellular signaling systems, inducing oxidative stress in biological molecules such as DNA, proteins, and lipids, which can then damage skin tissue.

[0004] Increased oxidative stress in skin cells stimulates keratinocytes in the epidermis and fibroblasts in the dermis. Through a series of intracellular signaling processes, this may increase the expression of genes such as matrix metalloproteinases (MMPs), which are collagen-degrading enzymes. This leads to a decrease in collagen (the main component of the skin, comprising 90% of the dermis, providing strength and tension, and protecting the skin from external stimuli or forces), potentially resulting in skin aging or wrinkles. Therefore, by adjusting the expression of genes related to the synthesis or breakdown of collagen and other fibrous proteins, it is hoped that skin cell aging can be prevented and wrinkles can be improved.

[0005] The cellular aging effects of ultraviolet radiation from sunlight not only cause cosmetic problems through skin damage, but also damage cellular DNA, potentially leading to cancer or skin diseases and serious health issues. Therefore, solutions are urgently needed.

[0006] In response to the aforementioned issues, as consumers' living standards improve, their attention to skin aging and overall health is also increasing. Therefore, there is active research into the development of pharmaceuticals and cosmetics to prevent and improve skin aging. This primarily involves using extracts from natural materials such as plants to improve skin aging or wrinkles. Retinol (vitamin A), AHA (alpha-hydroxy acid), and adenosine increase the synthesis of collagen, a fibrous protein, and normalize the keratinization process of the epidermis, thus being widely used as substances that aid in skin regeneration. However, as mentioned above, these substances are unstable to light and heat and can irritate the skin.

[0007] On the one hand, it is well known that loliolide is a substance mainly synthesized in plants or giant algae. It has been found in Phyllanthus urinaria and is known to have activity inhibiting the invasion of hepatitis C virus (HCV). There are reports of antioxidant activity in the marine giant algae Sargassum ringgoldianum. However, it is only known that loliolide is present in extracts from freshwater microalgae, and there are no reports of attempts to efficiently synthesize large quantities of loliolide using the aforementioned freshwater microalgae.

[0008] Meanwhile, *Scenedesmus* is classified as a green algae, belonging to the phylum Chlorophyta and class Chlorophyceae, and exists in clusters of 4–8 cells. It is well known that *Scenedesmus* is evenly distributed in freshwater worldwide, and its lipid content is 20–30%. Although there have been studies on converting lipids derived from *Scenedesmus* into biodiesel, further research is needed as a raw material for pharmaceuticals or cosmetics related to skin beauty or skin health. Summary of the Invention

[0009] Technical issues

[0010] The purpose of this invention is to provide a novel microalga with excellent productivity, which, compared with existing well-known microalgae, can produce ryegrass lactone, which increases the synthesis of fibrous proteins in skin cells and thus has the effect of preventing and improving skin aging, with higher efficiency.

[0011] In addition, the present invention aims to provide a pharmaceutical composition for preventing and improving skin aging using extracts of novel microalgae as described above.

[0012] In addition, the present invention aims to provide a cosmetic composition for preventing and improving skin aging by utilizing the extract of the novel microalgae described above.

[0013] Technical solution

[0014] To achieve the aforementioned objective, one aspect of the present invention provides a genus of Scenedesmus HS4 deposited under accession number KCTC13784BP.

[0015] Another aspect of the present invention provides a cosmetic composition for preventing and improving skin aging, in which an extract or fraction of Scenedesmus HS4, preserved under accession number KCTC13784BP, is contained as an active ingredient.

[0016] Another aspect of the invention provides a composition for preventing skin aging comprising ryegrass lactone produced from *Scenedesmus* HS4, which is deposited under accession number KCTC13784BP.

[0017] Invention Effects

[0018] The newly improved *Scenedesmus* HS4 strain of this invention, compared to other previously published microalgae, accumulates high levels of ryegrass lactones within its cells and exhibits excellent organic carbon dissimilatory efficiency. This allows it to grow even in the absence of light and can be cultivated at a rapid growth rate, ensuring high biomass productivity and ryegrass lactone production. This high ryegrass lactone production, achieved through large-scale cultivation of this microalgae, offers the potential to reduce the production cost of ryegrass lactones, and therefore is envisioned for diverse applications in pharmaceuticals, cosmetics, and other fields.

[0019] However, the effects of the present invention are not limited to those mentioned above, and another effect not mentioned above can be clearly understood by those skilled in the art from the following description. Attached Figure Description

[0020] Figure 1 The present invention is illustrated by the genus Scenedesmus HS4.

[0021] Figure 2 This diagram illustrates the principle of the adaptive evolution guidance process for improving the HS4 microalgae of the *Scenedesmus* genus used in this invention. It relates to a method of culturing microalgae by gradually reducing light exposure while gradually increasing the organic carbon content in the culture medium.

[0022] Figure 3This shows their respective light cultivation conditions ( Figure 3 The “Photo”), heterotrophic culture conditions ( Figure 3 "Hetero"), mixed culture conditions ( Figure 3 The growth curve of the HS4 microalgae of the genus Scenedesmus of the present invention after 7 days under “Mixo” and a photograph of the culture medium.

[0023] Figures 4a to 4e These are NMR spectral determination results showing the chemical structures of the active ingredients in the *Scenedesmus* HS4 microalgae extract used to determine the chemical structure of the active ingredients in this invention, each in sequence as follows: 1 H NMR, 13 C NMR, 1 H- 1 Results of HCOSY, HMQC and HMBC spectral measurements.

[0024] Figure 5a The results of ESI-mass spectral analysis for determining the molecular weight of active ingredients in the *Scenedesmus* HS4 microalgae extract of the present invention are shown.

[0025] Figure 5b Based on Figures 4a to 4e , Figure 5a The results revealed the chemical structure of ryegrass lactone, an active ingredient in the extract of the HS4 microalgae of the genus *Scenedesmus* of the present invention.

[0026] Figure 6a This presents the LC analysis results of purified ryegrass lactone and the quantitative lines prepared using it. Figure 6b It is to utilize Figure 6a The quantitative lines are obtained from the LC analysis results of the *Scenedesmus* HS4 microalgae extract of the present invention.

[0027] Figure 7 The graph shows a comparison of the biomass production of *Scenedesmus* JD052 microalgae cultured under light and *Scenedesmus* HS4 microalgae cultured under heterotrophic and mixed cultures, and a comparison of the content of ryegrass lactone in the extracts of the microalgae.

[0028] Figure 8 This is a chart comparing the cell viability of human dermal fibroblasts treated with ryegrass lactone isolated and purified from the HS4 microalgae of the genus Scenedesmus at various concentrations.

[0029] Figure 9 This chart compares the cell viability of human dermal fibroblasts irradiated with ultraviolet (UVB) light and treated with ryegrass lactone isolated and purified from the HS4 microalgae *Scenedesmus* at various concentrations. Human dermal fibroblasts that were not irradiated with UVB and were not treated with ryegrass lactone served as a control group.

[0030] Figure 10 This chart shows the expression levels of the Col1A1 gene in human dermal fibroblasts irradiated with ultraviolet (UVB) light and treated with various concentrations of ryegrass lactone isolated and purified from the HS4 microalgae *Scenedesmus*. Human dermal fibroblasts that were not irradiated with UVB and were not treated with ryegrass lactone were used as a control group.

[0031] Figure 11 This chart shows the expression levels of the MMP1 gene in human dermal fibroblasts irradiated with ultraviolet (UVB) light and treated with various concentrations of ryegrass lactone isolated and purified from the HS4 microalgae *Scenedesmus*. Human dermal fibroblasts that were not irradiated with UVB and were not treated with ryegrass lactone were used as a control group. Detailed Implementation

[0032] The present invention will be described in detail below.

[0033] 1. Novel Scenedesmus microalgae and compositions containing them

[0034] This invention provides a novel genus of microalgae.

[0035] The novel microalgae of the present invention is HS4 of the genus *Scenedesmus*, which is deposited under accession number KCTC13784BP.

[0036] The 18S rRNA nucleotide sequence of the proposed *Scenedesmus* sp. HS4 is identical to that of the microalga *Scenedesmus* sp. JD052, which is deposited under accession number KCTC1899P. Considering the morphological characteristics of the cells, it is classified as belonging to the *Scenedesmus* genus and is specifically named HS4.

[0037] The *Scenedesmus* HS4 species greatly improves the efficiency of dissimilatory utilization of organic carbon. As a result, when the *Scenedesmus* HS4 species is cultured in a glucose-containing medium, it exhibits a high cell growth rate compared to photoautotrophic culture, a common culture method for microalgae, thus resulting in excellent biomass productivity.

[0038] The *Scenedesmus* HS4 species can be cultured even under light-free conditions. Even in heterotrophic culture conditions that exclude light and provide only organic carbon, it exhibits a growth rate similar to that in mixed culture conditions that provide both light and organic carbon.

[0039] In particular, the *Scenedesmus* HS4 can produce ryegrass lactone at a very high content, even compared to the existing *Scenedesmus* JD052 microalgae deposited under accession number KCTC1899P, which is capable of producing ryegrass lactone. It is known that the *Scenedesmus* JD052 microalgae has superior ryegrass lactone production compared to other microalgae species. Therefore, the *Scenedesmus* HS4 microalgae of this invention significantly improves both biomass and ryegrass lactone production compared to all other known microalgae species and the JD052 microalgae. Therefore, by utilizing the *Scenedesmus* HS4 of this invention to produce ryegrass lactone, a process or system conventionally used for ryegrass lactone production can be replaced.

[0040] In specific embodiments of the present invention, cultivation was conducted under heterotrophic culture conditions providing only organic carbon (glucose) without light, mixed culture conditions providing both organic carbon and light, and photoautotrophic culture conditions commonly used for culturing microalgae. The results confirmed that the fastest growth rate was observed under the mixed culture conditions, and the high growth rate was also observed under the heterotrophic culture conditions. This demonstrated that, unlike typical microalgae, it possesses the characteristic of being able to grow even in the absence of light. Specifically, the *Scenedesmus* HS4 microalgae was cultured for 7 days in a medium containing 10 g / L glucose (organic carbon) and 1 g / L yeast extract for 7 days in the absence of light, thereby achieving a cell concentration of 5.9 g / L and a biomass productivity of approximately 0.81 g / L / day. Therefore, co-irradiation with 50 μmol·m -2 ·s -1 When the cells were cultured for 7 days in a medium containing the same amount of glucose and yeast extract as described above, the cell concentration was approximately 5.65 g / L and the biomass productivity was approximately 0.91 g / L / day. In comparison, the cells could grow to a similar level under light-free conditions as under light-exposed conditions.

[0041] Furthermore, according to a specific embodiment of the present invention, the results of culturing HS4 microalgae and JD052 microalgae of the genus Scenedesmus under the culture conditions described above confirmed that, compared with the light-cultured JD052 microalgae, the heterotrophic culture and mixed culture of HS4 showed superior growth rate and thus higher biomass productivity. Based on this, the results of confirming the content of ryegrass lactone showed that, compared with the existing JD052 microalgae, the productivity of ryegrass lactone was also about 2 to 4 times higher.

[0042] According to another aspect of the present invention, a composition containing the novel *Scenedesmus* microalgae is provided.

[0043] The microalgae mentioned are Scenedesmus sp. HS4, which is deposited under accession number KCTC13784BP.

[0044] The active ingredient contained in the composition is not only Scenedesmus HS4, which is preserved with accession number KCTC13784BP, but can also be the culture medium of the microalgae, the dried product of the culture medium, the extract of the culture medium, the extract of the microalgae, or the fraction of the extract.

[0045] The composition of the present invention comprising *Scenedesmus* HS4 can be prepared by means of a carrier, excipients, and / or additives, which can be readily implemented by a person skilled in the art to which this invention pertains, thereby producing a unit volume form or injecting it into a large-volume container. In this case, the composition can be in the form of a solution, suspension, or emulsion in an oil or aqueous medium, or in the form of an extract, powder, granules, tablet, capsule, gel (e.g., hydrogel), or freeze-dried product. As the additives, dispersants, stabilizers, or cryoprotectants can be used.

[0046] When the composition containing the *Scenedesmus* HS4 is in freeze-dried form, the composition comprises freeze-drying the microalgae together with a cryoprotectant for use as a powder. The cryoprotectant may be natural sugar, skim milk powder, maltodextrin, dextrin, trehalose, maltose, lactose, mannitol, cyclodextrin, glycerol, and / or honey, but is not limited thereto. Alternatively, it may be used after being mixed with a preservation carrier for adsorption, followed by drying to a solid state. The preservation carrier may be diatomaceous earth, activated carbon, and / or defatted rice bran.

[0047] The composition containing the Scenedesmus HS4 can be prepared by the following steps: mixing one or more of the group consisting of the microalgae, the culture medium of the microalgae, the concentrate of the culture medium, the dried product of the culture medium, the extract of the culture medium, the extract of the microalgae, and the fraction of the extract with any one of the carrier, excipient or additive.

[0048] The strains, carriers, excipients, and additives are described as above. When a cryoprotectant is used as the additive, the composition containing *Scenedesmus* HS4 can be prepared as follows: the microalgae are mixed with a cryoprotectant, the mixture is frozen at -90°C to -0°C, and after this process, it is dried and pulverized to obtain a powder form. Specifically, the freezing process can be a vacuum freezing process at a temperature of -45°C to -30°C and a pressure of 5 to 50 mTorr for 65 to 75 hours, and the drying process can be a drying process at a temperature of 30°C to 40°C.

[0049] 2. Pharmaceutical compositions for preventing and improving skin aging

[0050] This invention provides a pharmaceutical composition for preventing and improving skin aging.

[0051] According to one aspect of the present invention, the pharmaceutical composition for preventing and improving skin aging contains, as an active ingredient, an extract or fraction thereof of *Scenedesmus sp. HS4*, preserved under the accession number KCTC13784BP.

[0052] In addition, the skin aging prevention and improvement pharmaceutical composition according to other aspects of the present invention contains ryegrass lactone as an active ingredient, especially, the ryegrass lactone may be produced in Scenedesmus sp. HS4 deposited under the accession number KCTC13784BP.

[0053] The extract of *Scenedesmus* sp. HS4 (KCTC13784BP) has shown effective results in preventing and improving skin aging. Skin aging can be natural aging of skin cells or photoaging; it can be physiological and / or chemical aging resulting from skin aging, such as wrinkles, fine lines, decreased skin elasticity and / or tension, wrinkles, thinning, and reduced moisture and luster; it can be internal skin degradation caused by exposure to ultraviolet radiation, particularly the degradation of collagen fibers, leading to changes in skin appearance.

[0054] The extract of the Scenedesmus HS4 microalgae has the effect of inhibiting skin cell aging, and therefore can improve skin wrinkles, increase skin elasticity, maintain good skin condition in terms of beauty or skin health, and protect skin cells from ultraviolet rays, inhibiting the negative effects of ultraviolet rays on the skin.

[0055] The extract of the *Scenedesmus* HS4 microalgae contains ryegrass lactone as an active ingredient. Ryegrass lactone possesses antioxidant activity, thus acting to prevent or improve skin cell aging. Specifically, ryegrass lactone acts on skin cells, promoting the expression of collagen synthesis genes, such as the Col1A1 gene, which are fibrous proteins constituting skin cells, and inhibiting the expression of collagenase genes that break down collagen, such as the MMP1 gene, thereby increasing collagen levels and thus improving skin wrinkles. Furthermore, ryegrass lactone reduces the survival rate of skin cells affected by ultraviolet radiation, improving the reduction in collagen levels mentioned above, increasing cell survival rate, and increasing collagen levels, thereby repairing the negative effects of ultraviolet radiation on skin cells.

[0056] The ryegrass lactone can be included in the composition at a concentration of 1 μg / ml to 25 μg / ml. Specifically, the ryegrass lactone can be included in the composition at concentrations of 2 μg / ml to 23 μg / ml, 3 μg / ml to 20 μg / ml, 5 μg / ml to 18 μg / ml, 5 μg / ml to 15 μg / ml, or 5 μg / ml to 10 μg / ml. When the ryegrass lactone is contained at concentrations within the above-mentioned range based on the overall composition, it exhibits the effect of inhibiting the reduction in cell viability caused by ultraviolet radiation without showing toxicity to cells treated with the composition, effectively adjusting the expression of collagen-related genes, and increasing collagen production.

[0057] In a specific embodiment of the present invention, by 1 H NMR, 13 C NMR, 1 H- 1 The active structures of the active ingredients in the extract of the *Scenedesmus* HS4 microalgae were analyzed by NMR spectroscopy, including H COSY, HMQC, and HMBC spectroscopy. The molecular weight of the active ingredients was determined by ESI-mass spectroscopy and compared with existing databases, thus confirming that ryegrass lactone is included as an active ingredient in the extract of the present invention.

[0058] In specific embodiments of the present invention, it was confirmed that ryegrass lactone, up to a concentration of 20 μg / ml, did not exhibit cytotoxicity against human dermal fibroblasts and possessed activity in restoring the cell viability of said human dermal fibroblasts reduced by ultraviolet radiation. Furthermore, it was confirmed that treatment with ryegrass lactone promoted the expression of the collagen gene (Col1A1) and inhibited the expression of the collagenase gene (MMP1).

[0059] The extract can be obtained by a method comprising the following steps: culturing the *Scenedesmus* HS4; drying the culture of the cultured *Scenedesmus* HS4 and harvesting the dried material; and extracting the harvested dried material by placing it in an organic solvent.

[0060] The cultivation of the *Scenedesmus* HS4 can be carried out at a temperature of 20°C to 30°C, in a culture medium consisting of 5 g / L to 15 g / L glucose and 0.5 g / L to 1.5 g / L yeast extract, under light-free conditions. Alternatively, based on the above conditions, cultivation can be carried out at a concentration of 30 μmol·m -2 ·s -1 Up to 100 μmol·m -2 ·s -1 The process is carried out under photoluminescence conditions. If cultured at temperatures outside the stated temperature range or at a concentration lower than that of glucose in the culture medium, the growth rate of Scenedesmus HS4 is significantly reduced, which may result in a decrease in the harvested biomass. The production of substances that exhibit antioxidant and anti-aging effects on the skin (e.g., ryegrass lactone) may also be reduced, so even if the culture is extracted, the anti-aging and skin cell-improving effects may be significantly lower.

[0061] When harvesting the extract from the raw material, extraction methods such as solvent extraction, reflux extraction, ultrasonic extraction, and filtration can be used. The extraction process can be repeated multiple times, followed by further steps such as concentration or freeze-drying. Specifically, the harvested extract can be concentrated under reduced pressure to obtain a concentrate, which is then freeze-dried and pulverized to obtain a high-concentration extract powder.

[0062] When harvesting the extract from the raw material, the extraction process can be repeated multiple times, followed by further steps such as concentration or freeze-drying. Specifically, the harvested extract can be concentrated under reduced pressure to obtain a concentrated solution, which is then freeze-dried and pulverized to obtain a high-concentration extract powder.

[0063] When extracting the extract, the solvent may be water, an organic solvent, or a mixture thereof. The organic solvent may be ethyl acetate, such as ethanol, hexane (n-hexane), ether, glycerol, propylene glycol, butanediol, methyl acetate, dichloromethane, chloroform, or benzene, but is not limited thereto.

[0064] The extract of the *Scenedesmus* HS4 can be further fractionated, and the fraction obtained above can also be used as an effective ingredient in the pharmaceutical composition for preventing and improving skin aging of the present invention.

[0065] To increase the content of ryegrass lactone, the extract of *Scenedesmus* HS4 can be fractionated to obtain a fraction of *Scenedesmus* HS4. Solvents that can be used in preparing the fraction include, but are not limited to, organic solvents such as ethyl acetate, acetone, acetonitrile, chloroform, dichloromethane, diethyl ether, xylene, hexane, and combinations thereof.

[0066] Furthermore, the fractions of the present invention can also be fractions harvested by further conventional fractionation processes to concentrate the content of ryegrass lactones. For example, fractions obtained by passing an extract of *Scenedesmus* HS4 according to the present invention through an ultrafiltration membrane with a certain molecular weight cutoff value, and active fractions obtained by further purification methods such as separation by various chromatographic methods (prepared for separation based on size, charge, hydrophobicity, or affinity) are also included in the fractions of the present invention.

[0067] The active fraction is a fraction separated from the distillate with a higher ryegrass lactone content, also known as an active fraction or effective fraction. From a distillate containing multiple components obtained through conventional fractionation processes such as systematic fractionation, a specific active fraction with a higher ryegrass lactone content can be obtained by separating the active components according to their properties using methods such as concentration gradient column chromatography. The column chromatography method can utilize a packing material selected from the group consisting of silica gel, cross-linked dextran gel, LH-20, ODS gel, RP-18, polyamide, Toyopearl, and XAD resin to separate and purify the active fraction. The column chromatography can be performed multiple times with a suitable packing material as needed, but is not limited to this. In the use of this chromatographic method, the elution solvent, elution rate, and elution time can be those commonly used in the art.

[0068] On the one hand, the pharmaceutical composition of the present invention, containing the extract or its fractions as an active ingredient, can be formulated using a pharmaceutically acceptable carrier and / or excipients, according to a method readily practiceable by one of ordinary skill in the art to which this invention pertains, thereby being prepared in a unit volume form or injected into a large-volume container. In this case, the dosage form can also be a solution, suspension, or emulsion in an oil or aqueous medium, or an extract, powder, granules, tablet, capsule, or gel (e.g., hydrogel), and may further include dispersants or stabilizers.

[0069] Furthermore, the extract or fraction thereof contained in the pharmaceutical composition can be transported by pharmaceutically acceptable carriers such as colloidal suspensions, powders, physiological saline, lipids, liposomes, microspheres, or nanospheres. The formation of transport units and complexes, or related to this, can be transported in vivo using transport systems known in the art, such as lipids, liposomes, fine particles, gold, nanoparticles, polymers, condensation agents, polysaccharides, polyamino acids, dendritic molecules, saponins, adsorption enhancers, or fatty acids.

[0070] In addition, pharmaceutically acceptable carriers may include, but are not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, starch, gum arabic, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methylcellulose, methylparaben, propylparaben, talc, magnesium stearate, and mineral oil, among others. Furthermore, in addition to the aforementioned components, lubricants, wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents, preservatives, etc., may be further included.

[0071] The pharmaceutical compositions of the present invention can be administered orally or non-orally in clinical administration and can be used in general pharmaceutical formulations. That is, the pharmaceutical compositions of the present invention can be administered in various dosage forms, both orally and non-orally, in actual clinical administration. When preparing formulations, commonly used fillers, expanders, binders, wetting agents, disintegrants, surfactants, and other diluents or excipients can be used. Solid formulations for oral administration include tablets, pills, powders, granules, capsules, etc., which are prepared by mixing at least one excipient, such as starch, calcium carbonate, sucrose or lactose, gelatin, etc., with a crude drug extract or crude drug fermentation product. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Liquid formulations for oral administration include suspensions, oral liquids, emulsions, syrups, etc., and can include various excipients, such as wetting agents, sweeteners, flavoring agents, preservatives, etc., in addition to water and liquid paraffin, which are commonly used simple diluents. Formulations intended for non-oral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, freeze-dried formulations, and suppositories. Non-aqueous solvents and suspensions can include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. As a base for suppositories, witepsol, macrogol, Tween 61, cocoa butter, glyceryl trilaurate, glycerin, and gelatin can be used.

[0072] The effective dosage of the extract or fraction of Scenedesmus HS4 of the present invention can vary depending on factors such as formulation method, administration method, patient's age, weight, sex, disease state, diet, administration time, administration route, excretion rate, and reaction sensitivity. However, it is usually 1 to 20 mg / day per kg of body weight for adult patients, preferably 5 to 10 mg / day. It can be administered multiple times a day at certain time intervals according to the judgment of the doctor or pharmacist, preferably 2 to 3 times a day.

[0073] The present invention provides a method for preventing, improving or treating skin aging, comprising the step of administering to an individual a composition selected from one or more of the following groups: Scenedesmus sp. HS4 (accessed under accession number KCTC13784BP), a culture medium of said Scenedesmus sp. HS4, a concentrate of said culture medium, a dried product of said culture medium, an extract of said culture medium and a fraction of said extract.

[0074] The individual can be a human or an animal excluding humans. When the individual has good skin condition, administering the composition to the individual can prevent skin aging. When the individual already has skin aging, administering the pharmaceutical composition to the individual can improve or treat skin aging.

[0075] Prevention refers to reducing the risk of disease or disorder. It refers to all behaviors that, although one is easily exposed to or susceptible to disease, prevent an individual who has not yet contracted the disease or is not showing symptoms from exhibiting one or more clinical symptoms of the disease, thereby inhibiting or delaying the onset of the disease.

[0076] The treatment refers to all actions that alleviate a disease or disorder, and that prevent or reduce the progression of a disease or one or more of its clinical symptoms, thereby improving or alleviating the symptoms of the disease.

[0077] The improvement refers to all actions that result in an improvement or bettering of the symptoms of a disease or disorder.

[0078] The descriptions relating to the composition, its dosage form, method of administration, dosage, concentration of the active ingredient contained in the composition, and skin aging are as described above.

[0079] 3. Cosmetic compositions for preventing and improving skin aging

[0080] This invention provides a cosmetic composition for preventing and improving skin aging.

[0081] According to one aspect of the present invention, the cosmetic composition for preventing and improving skin aging contains, as an active ingredient, an extract or fraction thereof of *Scenedesmus sp. HS4*, which is deposited under the accession number KCTC13784BP.

[0082] In addition, the cosmetic composition for preventing and improving skin aging according to other aspects of the present invention contains ryegrass lactone as an active ingredient, and in particular, the ryegrass lactone may be produced in Scenedesmus sp. HS4, which is deposited under the accession number KCTC13784BP.

[0083] The ryegrass lactone can be included in the composition at a concentration of 1 μg / ml to 25 μg / ml. Specifically, the ryegrass lactone can be included in the composition at concentrations of 2 μg / ml to 23 μg / ml, 3 μg / ml to 20 μg / ml, 5 μg / ml to 18 μg / ml, 5 μg / ml to 15 μg / ml, or 5 μg / ml to 10 μg / ml. When the ryegrass lactone is contained at concentrations within the above-mentioned range based on the overall composition, it exhibits the effect of inhibiting the reduction in cell viability caused by ultraviolet radiation without showing toxicity to cells treated with the composition, effectively adjusting the expression of collagen-related genes, and increasing collagen production.

[0084] The method for preparing the extract or fraction of the genus *Scenedesmus* HS4 is described in the method of "2. Pharmaceutical composition for preventing and improving skin aging", therefore this description is omitted.

[0085] The cosmetic composition of the present invention may include a cosmetically effective amount of the extract or fraction and a cosmetically acceptable carrier, wherein the cosmetically effective amount refers to an amount sufficient to achieve the skin aging prevention and improvement efficacy.

[0086] The cosmetic compositions of the present invention may further contain, for example, other ingredients having characteristics that can synergistically enhance the activity of the extract or fraction, without affecting the skin aging prevention and improvement of the activity of the extract or fraction. Examples include, fatty substances, organic solvents, solvents, concentrates, gelling agents, emollients, antioxidants, suspending agents, stabilizers, foaming agents, fragrances, surfactants, water, ionic or nonionic emulsifiers, fillers, metal ion blocking agents, chelating agents, preservatives, vitamins, blocking agents, wetting agents, essential oils, dyes, pigments, fragrances, hydrophilic or lipophilic active agents, liposomes, or any other ingredients commonly used in cosmetics—adjuvants typically used in the fields of cosmetics or dermatology, which may be introduced in amounts generally used in the fields of cosmetics or dermatology.

[0087] The cosmetic composition of the present invention can be prepared in any dosage form commonly prepared in the art, such as a solution, suspension, emulsion, gel, lotion, serum, cream, powder, soap, shampoo, conditioner, mask, cleanser containing surfactant, cleansing foam, makeup remover, oil, liquid foundation, cream foundation or spray, etc.

[0088] When the dosage form of the present invention is a solution or emulsion, solvents, solubilizers, or demulsifiers are used as carrier components, such as water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butanediol oil, glyceryl fatty esters, polyethylene glycol, or fatty acid esters of sorbitol. When the dosage form is a suspension, liquid diluents such as water, ethanol, or propylene glycol can be used as carrier components; suspending agents such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitan ester, and polyoxyethylene sorbitan anhydride ester; aluminum hydroxide; microcrystalline cellulose; bentonite, agar, or tragacanth gum, etc. When the dosage form is a cream or gel, waxes, paraffin wax, tragacanth gum, animal oils, starch, cellulose derivatives, silicone, bentonite, polyethylene glycol, silicon dioxide, zinc oxide, or talc, etc., can be used as carrier components. When the dosage form is a powder or spray, the carrier component may include silica, talc, aluminum hydroxide, lactose, calcium silicate, chlorofluorocarbons, propane / butane, or dimethyl ether as a propellant. When the dosage form is a facial cleanser containing surfactants, the carrier component may include fatty alcohol sulfates, fatty alcohol ether sulfates, sulfosuccinate monoesters, imidazoline derivatives, hydroxyethyl sulfonates, methyl taurine, sarcosinates, fatty acid amide ether sulfates, fatty alcohols, alkylamide betaine, fatty acid glycerides, fatty acid diethanolamides, vegetable oils, lanolin derivatives, or ethoxylated glycerol fatty acid esters, etc.

[0089] 4. Compositions for preventing and improving skin aging

[0090] This invention provides a composition for preventing and improving skin aging.

[0091] The skin aging prevention and improvement composition according to one aspect of the present invention comprises ryegrass lactone produced from Scenedesmus sp. HS4, which is deposited under accession number KCTC13784BP.

[0092] The description relating to the genus *Scenedesmus* HS4 is the same as that described in “1. Novel microalgae of the genus *Scenedesmus*”, and therefore that description is omitted.

[0093] The ryegrass lactone can be obtained by a method comprising the following steps: culturing the *Scenedesmus* HS4; drying the cultured *Scenedesmus* HS4 to harvest the dried material; extracting the harvested dried material by placing it in an organic solvent; and separating the ryegrass lactone from the extract. The descriptions relating to the culturing, drying, and extraction steps are the same as those described in “2. Pharmaceutical Compositions for the Prevention and Improvement of Skin Aging”, and therefore are omitted.

[0094] The ryegrass lactone can be included in the composition at a concentration of 1 μg / ml to 25 μg / ml. Specifically, the ryegrass lactone can be included in the composition at concentrations of 2 μg / ml to 23 μg / ml, 3 μg / ml to 20 μg / ml, 5 μg / ml to 18 μg / ml, 5 μg / ml to 15 μg / ml, or 5 μg / ml to 10 μg / ml. When the ryegrass lactone is contained at concentrations within the above-mentioned range based on the overall composition, it exhibits the effect of inhibiting the reduction in cell viability caused by ultraviolet radiation without showing toxicity to cells treated with the composition, effectively adjusting the expression of collagen-related genes, and increasing collagen production.

[0095] In specific embodiments of the present invention, it was confirmed that ryegrass lactone, up to a concentration of 20 μg / ml, did not exhibit cytotoxicity against human dermal fibroblasts and possessed activity in restoring the cell viability of said human dermal fibroblasts reduced by ultraviolet radiation. Furthermore, it was confirmed that treatment with ryegrass lactone promoted the expression of the collagen gene (Col1A1) and inhibited the expression of the collagenase gene (MMP1).

[0096] The ryegrass lactone has shown effective effects in preventing and improving skin aging. Skin aging can be natural aging of skin cells or photoaging; it can be physiological and / or chemical aging resulting from skin aging, such as wrinkles, fine lines, reduced skin elasticity and / or tension, wrinkles, thinning, and reduced moisture and luster; it can be internal skin degradation caused by exposure to ultraviolet radiation, particularly the degradation of collagen fibers, leading to changes in skin appearance.

[0097] The ryegrass lactone has the effect of inhibiting skin cell aging, and therefore can improve skin wrinkles and increase skin elasticity. In terms of beauty or skin health, it can maintain good skin condition, protect skin cells from ultraviolet rays, and inhibit the negative effects of ultraviolet rays on the skin.

[0098] The composition can be used as a pharmaceutical composition or a cosmetic composition. The related description is the same as that described in "2. Pharmaceutical composition for the prevention and improvement of skin aging" and "3. Cosmetic composition for the prevention and improvement of skin aging", so this description is omitted.

[0099] This invention provides one or more skin aging prevention, improvement or treatment uses selected from the group consisting of extracts of the microalgae, extracts of the culture medium and fractions of the extracts.

[0100] The present invention provides an extract of the microalgae, an extract of the culture medium, or a fraction of the extract for use in the prevention, improvement, or treatment of skin aging.

[0101] This invention provides the use of a medicament for the prevention, improvement, or treatment of skin aging, wherein the medicament is selected from one or more of the following groups: Scenedesmus sp. HS4 (accessed under accession number KCTC13784BP), culture medium of Scenedesmus sp. HS4, concentrated culture medium, dried culture medium, extract of the microalgae, extract of the culture medium, and fractions of the extract.

[0102] The descriptions relating to the aforementioned HS4 microalgae of the genus *Scenedesmus*, pharmaceutical compositions containing them, cosmetic compositions, and the prevention, improvement, and treatment of skin aging are as described above.

[0103] The present invention will now be described in detail through examples.

[0104] However, the following embodiments are used to specifically illustrate the present invention, and the content of the present invention is not limited to the following embodiments.

[0105] [Example 1] Improvement of HS4 microalgae of the genus *Scenedesmus*

[0106] To prepare novel microalgae that are highly efficient at dissimilating organic carbon without relying on light, and to guide adaptive evolution in response to light sources and organic carbon, a modified *Scenedesmus* HS4 microalgae was prepared. As the parent strain for improvement, *Scenedesmus* JD052 (accession number KCTC1899P), one of the microalgae capable of producing ryegrass lactones, was used. This *Scenedesmus* JD052 was isolated from the hydrosphere of a clean region in Jeolla Province. Using this *Scenedesmus* JD052 microalgae, organic carbon was provided while the light intensity was varied. To develop microalgae that can grow even in the absence of light, the microalgae was cultured in a conventional light culture medium for microalgae, where adaptive evolution was guided by gradually decreasing the light intensity while increasing the glucose concentration in the medium (see reference). Figure 2 ).

[0107] Specifically, *Scenedesmus* genus JD052 was cultured in a bacterial-free medium consisting of the components listed in Table 1 below. The medium was BG11 medium with the K₂HPO₄ content increased from the existing 0.04 g to 0.2 g. The initial light irradiation was set to 50 μmol·m⁻¹. -2 ·s -1The initial glucose concentration was set to 0 g / L, and the culture was started for one month with a light irradiation of 30 μmol·m⁻¹. -2 ·s -1 Cultured for one month under conditions of 0.1 g / L glucose concentration, with a light irradiation of 15 μmol·m⁻¹. -2 ·s -1 Cultured for one month under conditions of 1 g / L glucose concentration, with a light irradiation of 5 μmol·m -2 ·s -1 Cultured for one month under conditions with a glucose concentration of 5 g / L, and finally irradiated with 0 μmol·m -2 ·s -1 The culture was carried out for one month under a glucose concentration of 10 g / L. The culture was then conducted at 25°C. Every month under each condition, the fastest-growing colonies were selected from agar plates and subcultured again on plates with the next set of conditions. This method ensured the development of a novel microalgae that could grow even in the dark and exhibited excellent organic carbon dissimilatory efficiency.

[0108] Nucleotide sequence analysis of the microalgae ensured by the method described above showed that the nucleotide sequences of the *Scenedesmus* genus JD052 and the 18S rRNA used as the parent strain were identical. However, it could grow on organic carbon alone under light-free conditions, showing completely different characteristics. Therefore, it was named the novel *Scenedesmus* genus HS4.

[0109] Table 1

[0110]

[0111] [Example 2] With the confirmation of the growth curve under the culture conditions

[0112] To confirm the growth of the improved Scenedesmus HS4 microalgae as ensured by Example 1 under different culture conditions, Scenedesmus HS4 was used as the object, and the microalgae were cultured by setting different culture conditions according to heterotrophic culture (culture conditions providing organic carbon), photoautotrophic culture (culture conditions providing light), and mixedotrophic culture (culture conditions providing both organic carbon and light).

[0113] Specifically, under heterotrophic culture conditions, the *Scenedesmus* HS4 of the present invention was cultured for seven days in a 1L flask containing 350 ml of a sterilized culture medium (Ph 7.1) composed of the components listed in Table 1, with 10 g / L glucose and 1 g / L yeast extract added. The initial inoculum size of the HS4 was set to 0.2 g / L. Under photoculture conditions, other conditions were the same as the heterotrophic culture conditions, but a culture medium with glucose and yeast extract removed was used, and the medium was irradiated with 50 μmol·m⁻¹. -2 ·s -1 The culture was conducted under light intensity. When under mixed culture conditions, the same conditions as described in the heterotrophic culture conditions were applied, with irradiation at 50 μmol·m⁻¹ light. -2 ·s -1 The microalgae were cultured under varying light conditions. During the culture process, the cell weight of the microalgae was measured daily under different conditions.

[0114] The results, as shown in Table 2 below, indicate that the fastest growth rate was observed under mixed culture conditions providing both light and organic carbon. While the growth rate was slower under heterotrophic culture conditions compared to mixed culture, it remained at a similar level. However, the growth rate was significantly higher than under light culture conditions. After 7 days of culture, the final cell weights were 2.01 g / L for light culture, 5.9 g / L for heterotrophic culture, and 6.65 g / L for mixed culture. The calculated average daily biomass productivity was approximately 0.26 g / L / day for light culture, approximately 0.81 g / L / day for heterotrophic culture, and approximately 0.92 g / L / day for mixed culture. Therefore, it is confirmed that the *Scenedesmus* HS4 microalgae of this invention differs from other existing microalgae or the JD052 microalgae used as an improved parent strain. It exhibits high growth and can be cultured under heterotrophic culture conditions providing only organic carbon without light, and it is confirmed that the growth rate is faster and a larger biomass can be produced compared to light culture conditions. Figure 3 ).

[0115] Table 2

[0116] Early stage 1st 2nd 3rd 4th 5th 6th 7th Light culture 0.2 0.21 0.29 0.78 1.32 1.74 1.89 2.01 Heterotrophic culture 0.2 0.34 0.99 1.56 2.21 3.56 5.32 5.9 Mixed culture 0.2 0.56 1.21 2.03 2.98 4.12 5.89 6.65

[0117] [Example 3] Analysis of the types of active ingredients

[0118] To identify the active ingredient produced by *Scenedesmus* HS4 of this invention, 55g of extract was obtained from 1000g of the culture medium of the microalgae, and the component was analyzed. The cultured microalgae were centrifuged to remove the supernatant, obtaining only the microalgae cells. These cells were then freeze-dried at -70°C to remove moisture. The cells were then extracted from the freeze-dried biomass using ethyl acetate. After cell extraction, the organic solvent was distilled using a rotary vacuum evaporator to obtain the extract. The extract sample was dissolved in a solvent and fractionated using silica gel column chromatography and high-performance liquid chromatography (HPLC). The active fraction was concentrated from the fractions and purified by preparative ODS MPLC. The purified sample was dissolved in CD3OD and analyzed by... 1 HNMR, 13 C NMR, 1 H- 1 H COSY, HMQC, and HMBC spectra were used to determine the chemical structures of the compounds present in the extract.

[0119] The results identified the chemical structure of the substance contained in the *Scenedesmus* HS4 extract as loliolide. A comparison with the NMR data of loliolide reported in the *Journal of the Korean Chemical Society*, Vol. 48, No. 4, 394-398, 2004, confirms that the active ingredient contained in the extract from the microalgae of this invention is (-)-loliolide. Figures 4a to 4e ).

[0120] Meanwhile, in order to further confirm the chemical structure of the active ingredient identified above, the molecular weight of the ingredient was determined by ESI-mass spectroscopy.

[0121] This result applies to [M+H]. + m / z 197.2, [2M+H] + m / z 393.2, [2M+Na] + A peak was observed at m / z 415.2, confirming a molecular weight of 196. This further confirms the chemical structure explained by the NMR spectrophotometric analysis as ryegrass lactone. Figure 5a as well as Figure 5b ).

[0122] [Example 4] Analysis of the content of lactones in ryegrass

[0123] As demonstrated in Example 3, the extract of *Scenedesmus* HS4 of the present invention contains ryegrass lactone, thus confirming that *Scenedesmus* HS4 can produce more ryegrass lactone compared to other microalgae. First, the purified ryegrass lactone extract was mixed with methanol to prepare a concentration of 200 ppm, which was then diluted again to prepare a quantitative line for ryegrass lactone. Figure 6a Then, using the *Scenedesmus* HS4 extract obtained by the same method as in Example 3 and the *Scenedesmus* JD052 extract obtained by the same method as described above, LC analysis was performed. The content of ryegrass lactone in the two microalgae extracts was analyzed using the quantitative lines established above. Figure 6b ).

[0124] The results confirmed that the ethyl acetate extract of *Scenedesmus* HS4 cultured in mixed culture contained 18.7 ppm of ryegrass lactone per 10,000 ppm, and the extract of HS4 cultured in heterotrophic culture contained 14.3 ppm of ryegrass lactone per 10,000 ppm. In contrast, the ethyl acetate extract of *Scenedesmus* JD052 contained 17.6 ppm of ryegrass lactone per 10,000 ppm.

[0125] Based on the results, the HS4 extract of the genus Scenedesmus of the present invention contains a similar level of content to the existing JD052 microalgae extract, compared to the extract of the same concentration.

[0126] [Example 5] Confirmation of the productivity-enhancing effect of ryegrass lactones from *Scenedesmus* HS4

[0127] To confirm whether the ryegrass lactone production of the HS4 microalgae of the present invention is further improved compared with existing microalgae, biomass production and the ryegrass lactone contained therein were compared using HS4 microalgae JD052 and HS4 as subjects.

[0128] First, *Scenedesmus* genus JD052 is a microalgae with very low dissimilatory efficiency of organic carbon. Therefore, 350 ml of sterilized culture medium (Ph 7.1) composed of the components in Table 1 was irradiated with 50 μmol·m⁻¹ at 25°C in a 1 L flask. -2 ·s -1The light intensity was controlled, and the culture was carried out for 7 days. The initial inoculum of JD052 was 0.2 g / L. The HS4 microalgae of the present invention were cultured separately under mixed culture conditions that provided both light and organic carbon, and heterotrophic culture conditions that excluded light and provided only organic carbon. Specifically, the weight per unit volume of biomass of each microalgae cultured as described above was measured to confirm biomass productivity. The ryegrass lactone content in the microalgae extract analyzed in Example 5 was used to confirm the ryegrass lactone productivity of each microalgae.

[0129] Specifically, in the heterotrophic culture condition, all other conditions were the same as those for JD052, except that a culture medium containing 10 g / L glucose and 1 g / L yeast extract was used, and no light was applied. In the mixed culture condition, the conditions were the same as the heterotrophic culture condition, but with 50 μmol·m⁻² light irradiation. -2 ·s -1 The HS4 was cultured under light of a certain intensity. The initial inoculum size of the HS4 was 0.2 g / L.

[0130] The results confirmed that when the *Scenedesmus* genus JD052 was cultured under light, the biomass productivity was 0.26 g / L / day, and the ryegrass lactone productivity was 11.9 ng / L / day. When the *Scenedesmus* genus HS4 of this invention was cultured heterotrophically, the biomass productivity was confirmed to be 0.81 g / L / day, and the ryegrass lactone productivity was 28 ng / L / day. When the HS4 was cultured in a mixed environment, the biomass productivity was confirmed to be 0.92 g / L / day, and the ryegrass lactone productivity was 43 ng / L / day. Figure 7 ).

[0131] The results confirm that the *Scenedesmus* HS4 microalgae of this invention, compared to the existing JD052 microalgae, exhibits approximately 3-fold and 3.4-fold increases in biomass productivity under heterotrophic and mixed culture conditions, respectively, and approximately 2.4-fold and 3.6-fold increases in ryegrass lactone productivity, respectively. Therefore, it is confirmed that the novel *Scenedesmus* HS4 microalgae of this invention, compared to existing microalgae, also demonstrates excellent growth rate under light-free culture conditions, exhibiting a significant increase in biomass and ryegrass lactone productivity.

[0132] [Example 6] Confirmation of the cytotoxicity of ryegrass lactone purified from Scenedesmus HS4 on human dermal fibroblasts.

[0133] To confirm the effects of ryegrass lactone, an active ingredient produced by the genus HS4 of the present invention, on the skin, the produced ryegrass lactone was purified and processed into human dermal fibroblasts (HDFs), and the resulting effect was confirmed.

[0134] The purification of ryegrass lactone was performed using the same method as in Example 3. An extract was obtained from the freeze-dried culture medium of *Scenedesmus* HS4 microalgae of the present invention using ethyl acetate, followed by fractionation / concentration to purify the ryegrass lactone. For the culture of human dermal cells, human dermal fibroblasts purchased from Lonza (Basel, Switzerland) were cultured at 37°C in a 5% CO2 cell culture apparatus using DMEM medium (Dulbecco's modified Eagle's medium, L0103-500, Biowest, France) further comprising 10% FBS (fetal bovine serum, S1480, Biowest, France).

[0135] First, the cytotoxicity of ryegrass lactone to human dermal fibroblasts was confirmed using the WST-1 assay. The human dermal fibroblasts cultured as described above were divided into 4 × 10⁴ cells per 96-well plate. 3 After culturing cells / wells for 24 hours, ryegrass lactone purified from the *Scenedesmus* HS4 microalgae was used to treat cells at concentrations of 0, 2, 5, 10, and 20 μg / ml. Following ryegrass lactone treatment, after 24 hours, the solution was transferred to the culture medium using WST-1 reagent (EZ-cytox cell viability kit, Itshio, Korea), and the absorbance was measured at 450 nm using an iMark microplate reader (Bio-Rad, USA).

[0136] The result, such as Figure 8 As shown, even when ryegrass lactone was treated to a concentration of 20 μg / ml, the relative viability of cells did not decrease compared to the control group without ryegrass lactone treatment. Therefore, it can be confirmed that the ryegrass lactone produced by *Scenedesmus* HS4 of this invention, up to a concentration of 20 μg / ml, is non-toxic to human dermal fibroblasts.

[0137] [Example 7] Confirmation of the effect of ryegrass lactone on the cell viability repair of human dermal fibroblasts with reduced cell viability due to ultraviolet radiation.

[0138] Cells, including human dermal fibroblasts, experience reduced survival rates when exposed to ultraviolet radiation such as UVB. Therefore, this study investigated how treating human dermal fibroblasts with the purified ryegrass lactone described above resulted in changes in cell viability upon UVB irradiation.

[0139] Human dermal fibroblasts cultured using the same method as in Example 6 were divided into 4 × 10⁴ wells in a 96-well plate. 3 Cells / well were treated with ryegrass lactone at concentrations of 2, 5, 10, and 20 μg / ml for 6 hours. Then, the culture medium was injected with 10 mJ / cm³. 2 After irradiating with UVB for 24 hours, the cells were cultured and their viability was determined by the WST-1 assay performed using the same method as in Example 6.

[0140] The result, such as Figure 9 As shown, when the survival rate of untreated cells was used as a baseline, the cell viability of the control group cells irradiated with UVB but not treated with ryegrass lactone decreased by 35% to 65%. In contrast, the cell viability of cells treated with ryegrass lactone at various concentrations was measured to be even higher, indicating that the cell viability reduced by UVB irradiation was restored. The highest cell viability restoration effect was observed in cells treated with ryegrass lactone at concentrations of 5 μg / ml or 10 μg / ml, at which point the cell viability showed a level of 88%–89%.

[0141] The results confirmed that ryegrass lactone effectively repairs and improves the survival rate of human dermal fibroblasts reduced by UVB. Even when treated with only 2 μg / ml, the cell viability was significantly higher than that of the control group. Therefore, it can be confirmed that ryegrass lactone isolated and purified from Scenedesmus HS4 of the present invention can help repair and improve skin damaged by light.

[0142] [Example 8] Confirmation of the promoting effect of ryegrass lactone on collagen gene (Col1A1) expression and its inhibitory effect on collagenase gene (MMP1) expression.

[0143] Collagen is one of the main proteins that make up the skin. A decrease in collagen can negatively impact skin elasticity and hydration. The ColA1 gene, which is involved in collagen synthesis as described above, may have its expression suppressed by exposure to ultraviolet radiation such as UVB. Conversely, the MMP1 gene, a collagenase that breaks down collagen, may have its expression increased by UVB exposure, potentially leading to a decrease in collagen production. Therefore, the changes in the expression levels of these genes were measured when treated with ryegrass lactone isolated and purified from *Scenedesmus* HS4.

[0144] First, human dermal fibroblasts cultured using the same method as in Example 6 were divided into 4 × 10⁴ wells in a 96-well plate. 3 cells / well, added to the culture medium at 10 mJ / cm 2Irradiation with UVB was performed. Then, the culture medium of the human dermal fibroblasts irradiated with UVB was treated with ryegrass lactone at concentrations of 5 and 10 μg / ml (as shown in the results of Example 7), which exhibited the best cell viability repair effect, and cultured for 24 hours. The expression changes of the ColA1 and MMP1 genes were then determined by qRT-PCR (quantitative real-time PCR). To confirm the amount of DNA product amplified by PCR in real time, SYBR green I (Invitrogen) was used as the fluorescent agent. Specifically, 0.2 μM of primers prepared according to the sequences in Table 3 below were added to the PCR tube, mixed with 50 mM KCl, 20 mM Tris / HCl (Ph 8.4), 0.8 mM dNTPs, 0.5 U of DNA polymerase (Extaq DNA polymerase), 3 mM MgCl2, and 1X SYBR green I to prepare the reaction solution. Then, PCR was performed using a PCR instrument (Linegene K, BioER, China) (PCR conditions: primary denaturation for 3 minutes, denaturation for 30 seconds at 94°C, annealing for 30 seconds at 58°C, polymerization for 30 seconds at 72°C, for a total of 40 cycles), and the fluorescence intensity was measured in each cycle.

[0145] Table 3

[0146] Serial Number sequence name Nucleotide sequence (5`->3`) 1 COL1A1 forward primer AGGGCCAAGACGAAGACATC 2 COL1A1 reverse primer AGATCACGTCATCGCACAACA 3 MMP1 forward primer TCTGACGTTGATCCCAGAGAGCAG 4 MMP1 reverse primer CAGGGTGACACCAGTGACTGCAC 5 β-actin forward primer GGATTCCTATGTGGGCGACGA 6 β-actin reverse primer CGCTCGGTGAGGATCTTCATG

[0147] The results of the ColA1 gene expression level determination, such as Figure 10 As shown, when the expression level of untreated cells was used as a baseline, the ColA1 gene expression level of control cells that were not treated with ryegrass lactone but only irradiated with UVB was reduced by 70% to 30%. In contrast, the ColA1 gene expression level of cells treated with ryegrass lactone at a concentration of 5 μg / ml was 55%, and that of cells treated with a concentration of 10 μg / ml was 65%, thus the expression level reduced by UVB irradiation was restored.

[0148] The results of MMP1 gene expression level determination, such as Figure 11As shown, when the expression level of untreated cells was used as a baseline, the MMP1 gene expression level of control cells that were irradiated with UVB but not treated with ryegrass lactone increased by 2.4 times. In contrast, the MMP1 gene expression level of cells treated with ryegrass lactone at a concentration of 5 μg / ml was 25%, and the MMP1 gene expression level of cells treated with a concentration of 10 μg / ml was 46%, thus the expression level decreased.

[0149] The results show that ryegrass lactone has the effect of restoring the expression level of ColA1 gene in human dermal fibroblasts that has been reduced due to UVB irradiation, while reducing the expression level of MMP1 gene. Therefore, it has the effect of increasing the production of collagen in human dermal fibroblasts. Thus, it can be confirmed that ryegrass lactone isolated and purified from Scenedesmus HS4 of this application can help repair and improve light-damaged skin and help maintain skin elasticity and hydration.

[0150] The present invention has only described the embodiments in detail above. However, those skilled in the art should understand that various modifications and variations can be made within the scope of the technical concept of the present invention, and such modifications and variations should be included in the appended claims.

[0151]

[0152] Sequence Listing <110> Korea Institute of Biotechnology <120> New microalgae with high ryegrass lactone production <130> 2019OPA3063 <150> KR 10-2019-0013108 <151> 2019-01-31 <150> KR 10-2019-0168315 <151> 2019-12-16 <160> 6 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> COL1A1 forward primer <400> 1 agggccaaga cgaagacatc 20 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> COL1A1 reverse primer <400> 2 agatcacgtc atcgcacaac a 21 <210> 3 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> MMP1 forward primer <400> 3 tctgacgttg atcccagaga gcag 24 <210> 4 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> MMP1 reverse primer <400> 4 cagggtgaca ccagtgactg cac 23 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> beta‑actin forward primer <400> 5 ggattcctat gtgggcgacg a 21 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> beta‑actin reverse primer <400> 6 cgctcggtga ggatcttcat g 21

Claims

1. A species of the genus *Scenedesmus* HS4, which is deposited under accession number KCTC13784BP.

2. The *Scenedesmus* HS4 according to claim 1, wherein, The *Scenedesmus* HS4 can produce ryegrass lactone.

Images