Forensic multiplex amplification kit for 50 X-SNPs detected based on MALDI-TOF MS platform

Abstract

The present invention belongs to the field of forensic genetics, specifically a forensic composite amplification kit for detecting 50 SNP sites on chromosome X based on MALDI-TOF MS platform. The main technical methods of the present invention are single base extension technology (SBE-PCR) and matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS) technology, which uses X-SNP genetic markers to identify the gender and identity of individuals of unknown origin, and also has good effects in complex kinship identification. The kit includes 50 pairs of primer mixtures for composite amplification, and simultaneously amplifies 50 SNP sites on chromosome X, so that 50 X-SNPs can be detected at one time more conveniently, and the identity of unknown individuals can be identified.

Description

Technical Field

[0001] The invention relates to the field of forensic genetics, and in particular to a forensic composite amplification kit of 50 X-SNPs based on MALDI-TOF MS technology for gender and identity identification and complex kinship identification of unknown individuals. Background Art

[0002] Kinship identification is an important part of forensic genetics and is also the most common research content in the daily work of forensic evidence. At present, the common method used by the evidence laboratories of various domestic identification institutions is to detect and type short tandem repeats (STRs) on autosomes, and complete the identification of kinship by calculating relevant forensic parameters. This method can basically solve most identification cases, but in some special cases, when the use of autosomal genetic markers alone cannot provide sufficient evidence, sex chromosome genetic markers are needed. For example, in the absence of the father, the identification of the ancestry of the grandmother and granddaughter, the identification of the half-sibling relationship between half-sisters, etc., require the auxiliary analysis of X chromosome genetic marker typing for identification and analysis.

[0003] At present, forensic genetics divides DNA genetic markers into two types: di-allelic genetic markers and multi-allelic genetic markers. This classification method also applies to X chromosomes.

[0004] Multi-allelic genetic markers are commonly used STR markers in daily case detection. STR has the characteristics of high polymorphism and high heterozygosity in the population. At the same time, it can be typed only by using the first-generation sequencing based on capillary electrophoresis (CE). It has the advantages of being fast and cheap, and is the main method of DNA analysis at present. However, STR typing technology often has high requirements for the integrity of the extracted DNA fragments. The typing of STR sites in large fragments of some degraded samples may be lost, showing NULL typing, and subsequent kinship analysis cannot be performed. At the same time, some commonly used STR loci have a high mutation rate, and additional supplementary sites are needed in paternity testing for further confirmation to avoid misjudgment.

[0005] Bi-allelic genetic markers are divided into two types: single nucleotide polymorphisms (SNPs) and insertion and deletion (InDel). SNPs are widely used in forensic genetics. SNP genetic markers are the most common type of genetic variation in the human genome, and they are abundant and widely distributed. Compared with STR, SNP has the advantage of low mutation rate in the population, and the amplification length is mostly around 100bp, which is more suitable for large fragment degradation samples. At the same time, SNP is easier to carry out high-throughput sequencing research, which is consistent with the emerging massively parallel sequencing (MPS), and will show better research value in future research.

[0006] There are many methods for SNP detection at present: SNaPshot, pyrosequencing and more emerging next generation sequencing (NGS) technologies.

[0007] SNaPshot technology is a method based on the CE platform. Due to the limitations of CE itself, it is impossible to process a large number of SNPs in one reaction system and cannot perform continuous detection of SNPs. It has been rarely used in daily scientific research.

[0008] Pyrosequencing technology can effectively handle the situation of a large number of SNPs, and is fast and intuitive. However, in the case of the presence of a Poly-A tail, inaccurate results may occur during the sequencing process.

[0009] MiSeq technology based on the Illumina platform is an emerging sequencing technology with advantages such as high throughput and accuracy. However, due to its high cost and the need for professional skills training for experimenters during the experimental process, it cannot be widely used in daily scientific research.

[0010] Therefore, there is an urgent need in the art to develop a high-throughput, rapid, accurate and low-cost method for X chromosome typing. Summary of the invention

[0011] The purpose of the present invention is to provide a method for X chromosome typing with high throughput, rapidity, accuracy and low cost.

[0012] In a first aspect of the present invention, there is provided an X chromosome nucleic acid typing kit, the kit comprising: a nucleic acid detection reagent for specifically detecting the A1 group X-SNP genetic marker site;

[0013] Group A1:

[0014]

[0015]

[0016] In another preferred embodiment, the kit further comprises: a nucleic acid detection reagent for specifically detecting the X-SNP genetic marker site of group A2;

[0017] Group A2:

[0018]

[0019] In another preferred embodiment, the kit further comprises: a nucleic acid detection reagent for specifically detecting the X-SNP genetic marker loci of group A3;

[0020] Group A3:

[0021]

[0022] In another preferred embodiment, the kit further comprises: a nucleic acid detection reagent for specifically detecting the X-SNP genetic marker site of group A4;

[0023] A4 Group:

[0024]

[0025] In another preferred embodiment, the kit further comprises: a nucleic acid detection reagent for specifically detecting the X-SNP genetic marker site of group A5;

[0026] Group A5:

[0027]

[0028] In another preferred embodiment, the detection reagent is selected from the following group: primers, nucleic acid chips, PCR kits, ion exchange resins, or a combination thereof.

[0029] In another preferred embodiment, the nucleic acid detection reagent includes: composite amplification primers and single base extension reaction primers for each X-SNP genetic marker site.

[0030] In another preferred embodiment, the kit contains a composite amplification primer pair and a single base extension reaction primer for the A1 group X-SNP genetic marker site, the sequence of the composite amplification primer pair is shown in SEQ ID NO: 1-20, and the sequence of the single base extension reaction primer is shown in SEQ ID NO: 101-110.

[0031] In another preferred embodiment, the kit further contains a composite amplification primer pair and a single base extension reaction primer for the A2 group X-SNP genetic marker site, the sequence of the composite amplification primer pair is shown in SEQ ID NO: 21-40, and the sequence of the single base extension reaction primer is shown in SEQ ID NO: 111-120.

[0032] In another preferred embodiment, the kit further contains a composite amplification primer pair and a single base extension reaction primer for the A3 group X-SNP genetic marker site, the sequence of the composite amplification primer pair is shown in SEQ ID NO:41-60, and the sequence of the single base extension reaction primer is shown in SEQ ID NO:121-130.

[0033] In another preferred embodiment, the kit further contains a composite amplification primer pair and a single base extension reaction primer for the A4 group X-SNP genetic marker site, the sequence of the composite amplification primer pair is shown in SEQ ID NO:61-80, and the sequence of the single base extension reaction primer is shown in SEQ ID NO:131-140.

[0034] In another preferred embodiment, the kit further contains a composite amplification primer pair and a single base extension reaction primer for the A5 group X-SNP genetic marker site, the sequence of the composite amplification primer pair is shown in SEQ ID NO:81-100, and the sequence of the single base extension reaction primer is shown in SEQ ID NO:141-150.

[0035] In another preferred embodiment, the kit further comprises standard DNA, and the standard DNA comprises male standard DNA and / or female standard DNA.

[0036] In another preferred embodiment, the male standard DNA is 9948+ male standard.

[0037] In another preferred embodiment, the female standard DNA is 9947A+ female standard.

[0038] In a second aspect of the present invention, a method for X chromosome typing is provided, comprising the steps of:

[0039] (i) obtaining a sample to be tested;

[0040] (ii) providing the kit as described in the first aspect of the present invention, and subjecting the sample to be tested to a composite amplification reaction and a single base extension reaction;

[0041] (iii) testing and typing the sample obtained in step (ii).

[0042] In another preferred embodiment, the method further comprises performing parallel testing on control samples.

[0043] In another preferred example, the control sample includes a positive control sample and a negative control sample.

[0044] In another preferred example, the positive control sample is a standard DNA, preferably, the standard DNA includes 9948+male standard and / or 9947A+female standard.

[0045] In another preferred embodiment, the negative control sample is ultrapure water.

[0046] In another preferred embodiment, in the step (ii), after the sample to be tested is subjected to the composite amplification reaction and before the single base extension reaction is performed, it is purified using shrimp alkaline phosphatase (SAP).

[0047] In another preferred embodiment, before step (iii), the sample obtained in step (ii) is desalted and purified.

[0048] In another preferred embodiment, in the step (iii), detection is performed by mass spectrometry.

[0049] In another preferred embodiment, in the step (iii), detection is performed by a matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS) platform, and typing is performed by MALDI-TOF MS Typer 4.0 software.

[0050] In another preferred embodiment, the method is non-diagnostic and non-therapeutic.

[0051] In another preferred embodiment, the sample is a sample extracted from a crime scene.

[0052] In another preferred embodiment, the sample is a sample containing human DNA.

[0053] In another preferred embodiment, the detection and typing conclusions obtained in step (iii) include: identification of special kinship, gender identification of individuals of unknown origin, identity identification of individuals of unknown origin, auxiliary identification of unknown mixed spots and study of population genetic characteristics among populations, or a combination thereof.

[0054] In another preferred embodiment, the special kinship identification includes: identification of kinship between half-sisters who lack both parents, single-parent kinship identification involving father-daughter relationship, single-parent kinship identification involving mother-daughter or mother-son relationship, intergenerational kinship identification involving grandmother-granddaughter relationship, etc., or a combination thereof.

[0055] In the third aspect of the present invention, there is provided a use of the kit as described in the first aspect of the present invention for nucleic acid typing.

[0056] In another preferred embodiment, the nucleic acid is X chromosome nucleic acid.

[0057] In another preferred embodiment, the kit is used for forensic evidence identification.

[0058] In another preferred embodiment, the forensic evidence identification includes: special kinship identification, gender identification of individuals of unknown origin, identity identification of individuals of unknown origin, auxiliary identification of unknown mixed spots and research on population genetic characteristics among human groups, or a combination thereof.

[0059] In another preferred embodiment, the special kinship identification includes: identification of kinship between half-sisters who lack both parents, single-parent kinship identification involving father-daughter relationship, single-parent kinship identification involving mother-daughter or mother-son relationship, intergenerational kinship identification involving grandmother-granddaughter relationship, etc., or a combination thereof.

[0060] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described one by one here. DETAILED DESCRIPTION

[0061] The inventor has developed a nucleic acid typing method suitable for Chinese people (especially East China people) for forensic identification for the first time after extensive and in-depth research and a large number of screenings. Experiments show that by using the kit of the present invention and the single base extension technology based on the matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS) platform detection, the genotyping results of 50 X-SNP genetic markers of multiple samples can be obtained at one time. The kit and method of the present invention have good individual identification and kinship identification performance. The present invention was completed on this basis.

[0062] the term

[0063] As used herein, the terms "typing system of the present invention", "nucleic acid typing of the present invention", "X chromosome nucleic acid typing system of the present invention" or "X chromosome complex amplification typing system of the present invention" are used interchangeably to refer to a system for performing multi-step typing based on the 50 X-SNP loci unique to the present invention. It should be understood that the terms include typing kits, typing platforms, locus complex detection systems, or similar analysis systems.

[0064] X chromosome and its application significance

[0065] The X chromosome is one of the human sex chromosomes, and is genetically characterized by sex-linked inheritance and cross-inheritance. In male individuals, sex chromosomes consist of X chromosomes and Y chromosomes, of which the X chromosome comes from the individual's mother and is inherited by the individual to his daughter; at the same time, since male individuals only have one X chromosome, it appears as a haplotype in the X chromosome marker test. This feature makes the X chromosome genetic markers and Y chromosome genetic markers have the same function in male individual identification, and better distinguish different male individuals. On the other hand, the sex chromosomes of female individuals consist of two X chromosomes, one from the mother and the other from the father, and each locus shows two alleles, and one of the X chromosomes is passed on to the son or daughter when it is inherited to the offspring.

[0066] In the field of forensic identification, in some special cases, auxiliary analysis methods of X chromosome genetic marker typing are needed for identification and analysis. For example, in the absence of the father, the identification of the paternal relationship between the grandmother and the granddaughter; the identification of the half-sibling relationship between half-sisters, the gender identification of individuals of unknown origin, the identity identification of individuals of unknown origin, the auxiliary identification of unknown mixed spots, and the study of population genetic characteristics among people.

[0067] The main technical problem solved by the present invention is to identify certain special kinship relationships by using X-SNP genetic markers, and to identify unknown individuals.

[0068] Kit of the present invention

[0069] In the present invention, a forensic composite amplification kit based on 50 X-SNPs is provided, comprising a multiple composite amplification primer mixture and a multiple single-base extension primer mixture separately packaged in the kit; the multiple composite amplification primer mixture of the kit comprises 50 pairs of front and rear amplification primers of X-SNP genetic marker sites, a total of 100 amplification primers, and the nucleotide sequence information of each amplification primer is shown in SEQ ID NO:1 to SEQ ID NO:100 in Table 1; the multiple single-base extension primer mixture of the kit comprises 50 extension primers of 50 X-SNP genetic markers, a total of 50 extension primers, and the nucleotide sequence information of each extension primer is shown in SEQ ID NO:101 to SEQ ID NO:150 in Table 2.

[0070] The 50 X-SNP genetic marker sites screened by the present invention basically cover the entire X chromosome: the Xp region contains 21 X-SNPs, the central centromere region contains 1 X-SNP, and the remaining 28 X-SNPs are located in the Xq region. The site information involved is shown in Table 3. However, since the X-SNP genetic markers are all located on the X chromosome, when the physical or genetic distance of two X-SNP genetic markers is very close, it is necessary to consider the possibility of linkage inheritance of the two SNP sites. The tightness of gene linkage is related to the possibility of allele recombination exchange within the linkage group during meiosis. If the two SNP sites are highly linked or even completely linked, when calculating forensic parameters such as gene diversity and polymorphism information content in the later stage, the two sites should be regarded as one haploid block, and the typing should be treated as haplotype. The distance between the sites selected by the present invention is between 0.5Mb and 11.2Mb, and the physical distance is greater than the minimum length (30kb) that theoretically produces linkage disequilibrium. However, it has been shown in past studies that there is also a possibility of linkage disequilibrium when the site spacing is greater than 30 kb. After further literature review and data analysis, the inventors found that the selected 50 sites were all in a state of linkage equilibrium, that is, no linkage phenomenon between sites was found, and the specific detailed data are omitted. In summary, the present invention finally confirmed that all 50 X-SNP genetic marker sites were used to construct a composite amplification system based on the MALDI-TOF MS platform.

[0071] In the present invention, 50 X-SNP genetic marker loci are ranked according to their determination effect on typing, and divided into five groups A1, A2, A3, A4 and A5 as described in the first aspect of the present invention according to the ranking.

[0072] The kit of the present invention also includes standard DNA, wherein the standard DNA is 9947A female standard and 9948 male standard.

[0073] The kit of the present invention comprises a detection reagent for the 50 X chromosome SNP genetic marker sites provided by the present invention, and the detection reagent is selected from the following group: primers, nucleic acid chips, PCR kits, ion exchange resins, or a combination thereof.

[0074] Preferably, the PCR kit is preferably Complete Gold Genotyping Reagent Set96 (Agena, USA) kit (PCR step: 10×PCR buffer, 25mM MgCl2 solution, 25mM dNTPs mixture, 5U / μL PCR enzyme; SAP purification step: SAP buffer, 1.7U / μL shrimp alkaline phosphatase; single base extension reaction step: iPLEX buffer, iPLEX reaction termination mixture, iPLEX enzyme).

[0075] The reaction system in the PCR step can be a 5μL PCR system obtained by halving the components of the 10μL PCR system described in 2×Multiplex PCR Mix (Shanghai Jinan Protein Technology Co., Ltd.). The SAP purification step can also use the kit purification method to purify the PCR product using an existing commercial purification kit to remove free NTPs. The different methods described above can be used in combination, but in order to save cost and experimental time, it is recommended to use Complete The reaction was performed using the Gold Genotyping Reagent Set 96 kit.

[0076] In a preferred embodiment, the specific components of the kit of the present invention include:

[0077] a) Composite amplification reaction mixture: 10× PCR buffer, 25 mM MgCl2, 25 mM dNTPs Mix, 5 U / μL DNA polymerase, deionized water;

[0078] b) Composite amplification primer mixture: a composite amplification primer mixture consisting of forward and reverse amplification primer pairs of 50 X chromosome SNP genetic markers as shown in Table 1;

[0079] c) SAP reaction mixture: SAP buffer, 1.7 U / μL shrimp alkaline phosphatase, deionized water;

[0080] d) Multiplex single-base extension reaction mixture: iPLEX buffer, iPLEX terminal mixture, iPLEX enzyme, deionized water;

[0081] e) Multiplex single-base extension primer mixture: a multiplex single-base extension primer mixture consisting of extension primers for 50 X chromosome SNP genetic markers as shown in Table 2.

[0082] Wherein a) composite amplification reaction mixture, c) SAP reaction mixture and d) multiple single base extension reaction mixture are commercial products of Agena (formerly Sequenom). The method of extracting template DNA can be applied by various conventional methods currently in the art (except Chelex method, because it requires DNA of higher purity), or commercial kit instructions can be used for DNA extraction.

[0083] Mass spectrometry technology

[0084] The basic principle of mass spectrometry is to separate and determine the molecular weight of sample molecules based on the difference in charge-to-mass ratio (m / e) between different ions after ionization.

[0085] A preferred mass spectrometry method suitable for SNP detection in the present invention is mainly matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF). MALDI-TOF uses mass spectrometry to analyze a sample in just a few seconds, and can analyze thousands of samples a day, with the characteristics of rapidity, accuracy, and high degree of automation.

[0086] The basic principle adopted by the kit of the present invention is the matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS) technology. The specific method is: add SNP sequence specific extension primers to the PCR amplification product purified by SAP, and extend 1 base at the specific SNP site. Then the prepared sample analyte is combined with the matrix on the chip by co-crystallization, the chip is placed in the vacuum chamber of the mass spectrometer, and then the matrix crystal molecules are excited by instantaneous strong laser to sublimate the matrix crystals, and the nucleic acid molecules are desorbed into an ion state rich in negative charge, which moves to the positive electrode in the accelerating electric field, and finally the nucleic acid molecules in the ion state are separated according to the mass-to-charge ratio. The time required to reach the time-of-flight detector in the vacuum tube (Time Of Flight, TOF) distinguishes ions of different masses: the smaller the ion mass, the faster the ionization speed, and the smaller the TOF; conversely, the larger the TOF. The detectable molecular mass of the MALDI-TOF MS platform is positively correlated with the length of the vacuum tube, that is, the longer the vacuum tube, the greater the detectable molecular mass. At present, the detectable range of the platform is 5000-8500 Daltons (Da).

[0087] Method of the present invention

[0088] In the present invention, a method for X chromosome typing is provided, comprising the steps of:

[0089] (i) obtaining a sample to be tested;

[0090] (ii) providing the kit as described in the first aspect of the present invention, and subjecting the sample to be tested to a composite amplification reaction and a single base extension reaction;

[0091] (iii) testing and typing the sample obtained in step (ii).

[0092] The method for detecting SNP in the present invention is mainly SBE-PCR technology and MALDI-TOF MS technology. This method distinguishes and resolves bases based on the molecular weight difference of the extension products generated by different bases, and has the characteristics of high throughput, rapidity, accuracy, automation, etc., and the experimental process only requires 3 steps of PCR reaction, 1 step of purification and 1 step of flight mass spectrometry to complete the detection of multiple samples and multiple SNP sites.

[0093] Preferably, the working principle of the method of the present invention is roughly divided into the following five steps: multiple composite amplification system reaction, shrimp alkaline phosphatase (SAP) purification treatment, multiple single base extension reaction, ion exchange resin treatment and matrix-assisted laser desorption ionization flight mass spectrometry reaction.

[0094] 1) The primers used in the multiplex composite amplification system are the composite amplification primer mixture of the kit of the present invention, and the reagents used are the same as those of the Complete iPLEX@Gold Genotyping Reagent Set 100 kit. 50 X-SNP genetic markers constitute a composite amplification system.

[0095] 2) The amplified product is purified with SAP to digest the excess free dNTPs to avoid affecting the next reaction of the system.

[0096] 3) The SAP-treated sample will undergo a single-base extension reaction in the next step. The primers used are the multiple single-base extension primer mixture of the kit of the present invention. The reagents used are the same as those of the Complete iPLEX@Gold GenotypingReagent Set 100 kit. This reaction will produce single-stranded single-base products of 50 X-SNPs.

[0097] 4) Thereafter, ultrapure water and ion exchange resin are added to the extension product to desalt and purify the product. The purpose of adding ultrapure water is to allow the sample to fully bind to the resin.

[0098] 5) Before the final step of the flight mass spectrometry, the desalted samples in the 100-well plate need to be spotted onto a chip containing a matrix using a MALDI-TOFMS RS1000 nanoliter spotter. Each matrix corresponds to a sample product. The chip with the sample is then placed in a MALDI-TOF MS flight mass spectrometer for fully automatic detection. The test results are viewed using the MALDI-TOF MS Typer 4.0 software that comes with the computer.

[0099] In one embodiment, 9947A female standard and 9948 male standard are used as positive controls, and ultrapure water is used as a negative control for compound amplification simultaneously with the sample.

[0100] The typing results obtained by the positive control will be used as the standard for judging whether the subsequent experiments are correct. The results obtained by the negative control should be blank to determine whether the typing results are non-specific amplification. In the subsequent experiments, we should first analyze whether the control results are the same as the first experimental results. If they are the same, it means that the results of this experiment are reliable and the downstream experimental data analysis can be carried out; if they are different, find the cause and re-amplify.

[0101] In a preferred embodiment, the analysis method of the kit of the present invention comprises the following steps:

[0102] 1) Extract the DNA of the sample to be tested and use it as a template for amplification.

[0103] 2) The DNA extracted in step 1) and the male 9948 standard and the female 9947A standard were subjected to composite amplification using the composite amplification reaction mixture and composite amplification primer mixture. The composite amplification PCR reaction conditions were as follows: denaturation at 95°C for 2 minutes; 95°C for 30 seconds, 56°C for 30 seconds, 72°C for 1 minute, for a total of 45 cycles; extension at 72°C for 5 minutes; and storage at 4°C for later use.

[0104] 3) Purify the amplified product obtained in step 2) using the SAP reaction mixture. The reaction conditions are: incubate at 37° C. for 40 minutes, heat-inactivate the SAP enzyme at 85° C. for 5 minutes, and store at 4° C. for later use.

[0105] 4) Using the purified amplification product in step 3) as a template, multiple single base extension reactions were performed using the multiple single base extension reaction mixture and the multiple single base extension primer mixture. The single base extension PCR reaction conditions were as follows: denaturation at 94°C for 30 seconds; 94°C for 5 seconds, 52°C for 5 seconds, 80°C for 5 seconds, 52°C for 5 seconds, 80°C for 5 seconds, 52°C for 5 seconds, 80°C for 5 seconds, 52°C for 5 seconds, 80°C for 5 seconds, 52°C for 5 seconds, 80°C for 5 seconds, 80°C for 5 seconds, a total of 40 cycles; extension at 72°C for 3 minutes; storage at 4°C for later use.

[0106] 5) The product obtained in step 4) was diluted to 50 μL with deionized water, and then 0.15 g of clean ion exchange resin was added, and the mixture was placed in a rotary mixer for 15 minutes, and then centrifuged at 4400 × g for 5 minutes to allow the ion-bound exchange resin to be fully centrifuged to the lower layer. The purpose of dilution is to better bind the sample product to the ion exchange resin and complete desalting and purification.

[0107] 6) Using MALDI-TOF The product in step 5) is spotted onto the SpectroCHIP Array 96-spot chip using a nanoliter spotter. The spotting volume is controlled within 8-12 nL by the spotting time and speed.

[0108] 7) Using MALDI-TOF The flight mass spectrometer automatically detects the sample chip, and the typing results are checked using the MALDI-TOFMS Typer 4.0 software.

[0109] The result analysis method involved in step 7) is as follows: first, perform typing analysis on the positive and negative controls (male standard 9948, female standard 9947A and deionized water) to ensure that the results are accurate, and then perform typing analysis on other samples to obtain the genotyping of 50 X-SNPs of the sample to be tested.

[0110] The main advantages of the present invention include:

[0111] 1) The 50 X-SNP genetic markers contained in the kit of the present invention can effectively distinguish individuals and there is no significant difference in gene frequency between the samples of both sexes in population statistics. In addition, the 50 loci selected by the present invention are all in a state of linkage equilibrium, that is, no linkage phenomenon between loci is found.

[0112] 2) This kit uses SBE-PCR technology and MALDI-TOF MS technology based on the MALDI-TOF MS platform. 50 X-SNP genetic markers form a composite amplification system, which can obtain the genotyping of X-SNP genetic markers of multiple different samples at one time, and quickly complete the identification of unknown samples or the identification of special relatives. It has the advantages of convenience, high throughput, low cost, etc., and can also save samples.

[0113] 3) To ensure the accuracy of each typing, the present invention performs typing of standard DNA (9947A for females and 9948 for males) as a positive control and typing of pure water as a blank control while performing genotyping on the samples, to ensure that the typing of each X-SNP genetic marker is accurate.

[0114] 4) The products of the composite amplification of the kit of the present invention range from 80 bp to 100 bp, which can be used to accurately type large fragments of degraded samples, and has good application prospects and promotion value in future routine inspections.

[0115] 5) The composite amplification site and its amplification primers and extension primers used in this kit can also be applied to other platforms for analysis.

[0116] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the present invention. The experimental methods in the following examples where specific conditions are not specified are usually performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or under conditions recommended by the manufacturer. Unless otherwise indicated, percentages and parts are weight percentages and weight parts.

[0117] The following are the consumables and instruments used in the experiment of this kit

[0118] Consumables:

[0119] 1) 96-well PCR micro plate, Axygen, USA

[0120] 2) 96-well plate sealing film, Axygen, USA

[0121] 3) 0.2mL, 1.5mL EP tube, Axygen, USA

[0122] instrument:

[0123] 1) FLC-3 clean bench, Thermo Fisher, USA

[0124] 2) Micropipettes (2.5 μL, 10 μL, 20 μL, 100 μL and 1000 μL), Eppendorf, Germany

[0125] 3) NanoDrop ND-100, BioTek, USA

[0126] 4) Milli-Q synthesis ultrapure water instrument, Millipore Corporation, USA

[0127] 5) Decolorization shaker, China TS-1

[0128] 6) MX-F stationary mixer, Scilogex, USA

[0129] 7) Centrifuge 5417R small high-speed refrigerated centrifuge, Eppendorf, Germany

[0130] 8) Centrifuge 5430 small high-speed centrifuge, Eppendorf, Germany

[0131] 9) PCR System 9700, Thermo Fisher Scientific, USA

[0132] 10) MALDI-TOF MS DNA mass spectrometry array gene analyzer, Agena (formerly Sequenom), USA

[0133] 11) MALDI-TOF Nanoliter spotter, Agena (formerly Sequenom), USA Table 1 List of primers for composite amplification of the present invention

[0134]

[0135]

[0136]

[0137] Table 2 Single base extension reaction primer list of the present invention

[0138]

[0139]

[0140] Example 1: Preparation of the kit of the present invention

[0141] a) Composite amplification primer mixture:

[0142] The primers were mixed with the amplification primers shown in Table 1, and the primers were synthesized by Shanghai Invitrogen Co., Ltd. The synthesized primers were diluted with deionized water to a 100 μM stock solution, and then the primers of each site were mixed to obtain a composite amplification primer mixture with a final concentration of 0.5 μM for each primer pair.

[0143] b) Composite amplification reaction mixture:

[0144] In this example, iPLEX@PCR reaction premix from Agena (formerly Sequenom) was used.

[0145] c) SAP reaction mixture and SAP enzyme:

[0146] In this example, iPLEX@SAP reaction premix and SAP enzyme from Agena (formerly Sequenom) were used.

[0147] d) Multiplex single base extension primer mixture:

[0148] The primers were obtained by mixing the extension primers shown in Table 2, and the primers were synthesized by Shanghai Invitrogen Co., Ltd. The synthesized primers were diluted with deionized water to a 750 μM mother solution, and then the amount to be added to the mixture for each site was calculated according to the molecular weight of the extension primer to prepare a multiple single-base extension primer mixture.

[0149] e) Multiple single base extension reaction mixture:

[0150] In this example, iPLEX@ extension reaction premix from Agena (formerly Sequenom) was used.

[0151] After the above reagents are packaged according to their conventional requirements, a forensic composite amplification kit based on X-SNP is obtained for subsequent experiments.

[0152] Example 2: Using the kit of the present invention to detect X-SNP typing of 203 unrelated individuals

[0153] Using the forensic composite amplification kit based on 50 X-SNPs, X-SNPs were detected in 203 unrelated individuals in East China, including 101 female samples and 102 male samples.

[0154] The specific detection process is as follows:

[0155] a. Use the kit to extract genomic DNA from the blood samples of the above samples as a template for composite amplification

[0156] b. Determination of DNA purity and concentration: NanoDrop ND-100 was used to measure the purity and concentration of the DNA of the test samples. The sample concentrations ranged from 19 ng / μL to 170 ng / μL. Finally, the DNA of each sample was diluted to 5 ng / μL and stored at 4°C for future use.

[0157] c. Dilute each pair of amplification primers with deionized water to a 100 μM stock solution according to the primer synthesis report, and then mix the primers at each site to obtain a composite amplification primer mixture with a final concentration of 0.5 μM for each primer pair. Dilute each extension primer with deionized water to a 750 μM stock solution according to the primer synthesis report, and calculate the amount of each site to be added to the mixture according to the molecular weight of the extension primer to prepare a multiple single-base extension primer mixture.

[0158] d. Using the DNA diluted in step b as a template, the sample was subjected to PCR composite amplification using a composite amplification primer mixture and a composite amplification reaction mixture in the following amplification system with a total volume of 5 μL.

[0159] Amplification system:

[0160] 10×PCR buffer 0.5μL, 25mmol / L MgCl2 0.4μL, 25mmol / L dNTPs Mix 0.1μL, amplification primer mixture 0.5μL, 5U / μL DNA polymerase 0.1μL, 5ng / μL DNA template 1μL and deionized water 2.3μL.

[0161] Amplification conditions:

[0162] Denature at 95°C for 2 minutes; cycle at 95°C for 30 seconds, 56°C for 30 seconds, and 72°C for 60 seconds for a total of 45 cycles; extend at 72°C for 5 minutes; store at 4°C until use.

[0163] e. Add 0.17 μL of 1.7 U / μL SAP enzyme, 0.3 μL of SAP buffer and 1.53 μL of ultrapure water to the PCR amplification product in d. The SAP reaction conditions are incubation at 37°C for 40 min, heat inactivation of SAP at 85°C, and storage at 4°C for later use.

[0164] f. The purified product in step e. was subjected to a single base extension reaction according to the following ingredients: 10×Complete Pro Buffer Plus 0.2μL, Complete Pro Termination Mix 0.2μL, Single Base Primer Mix 0.94μL, Complete Pro enzyme 0.04 μL and deionized water 0.62 μL.

[0165] The PCR reaction conditions are as follows:

[0166] Denature at 94°C for 30 seconds; 40 cycles of 95°C for 5 seconds, 52°C for 5 seconds, 80°C for 5 seconds, 52°C for 5 seconds, 80°C for 5 seconds, 52°C for 5 seconds, 80°C for 5 seconds, 52°C for 5 seconds, 80°C for 5 seconds, 52°C for 5 seconds, 80°C for 5 seconds; extend at 72°C for 3 minutes; store at 4°C for later use.

[0167] g. Add 41 μL of deionized water to the product obtained in step f. to dilute it to 50 μL, then add 0.15 g of clean, dry ion exchange resin, place it in a rotary mixer and mix it for 15 minutes, then centrifuge it at 4400×g for 5 minutes to allow the exchange resin bound to the ions to fully centrifuge to the lower layer. The purpose of dilution is to better bind the sample product to the ion exchange resin and complete desalting and purification.

[0168] h. Using MALDI-TOF The product in step g is spotted onto the SpectroCHIP Array 96-spot chip using a nanoliter spotter. The spotting volume is controlled within 8-12 nL by the spotting time and speed.

[0169] i. Using MALDI-TOF The flight mass spectrometer automatically detects the sample-loaded chip, and the genotyping results are checked using the MALDI-TOF MSTyper 4.0 software.

[0170] After processing the obtained typing results, it can be seen that the allele frequencies of all 50 X-SNP sites range from 0.3454 to 0.6546, and the allele frequency distribution meets the criteria of the inventor's initial screening site. Among them, the site rs6629958, the two-gene frequency is closest to 0.5, and has the strongest individual recognition ability in the East China Han population.

[0171] The detection kit and detection system of the present invention have a cumulative individual recognition rate of 0.99999 in the female population and a cumulative individual recognition probability of 0.9999999999 in the male population, which indicates that the kit of the present invention has good individual recognition ability for the population in East China.

[0172] At the same time, the inventors also calculated the non-paternity exclusion probability for kinship identification. The calculation results show that the non-paternity exclusion probability of the doublet of 50 X-SNP genetic markers in the kit ranges from 0.2271 to 0.2500, and the non-paternity exclusion probability of the triplet ranges from 0.3511 to 0.3750; the cumulative non-paternity exclusion probability of the doublet is 0.99999, and the cumulative non-paternity exclusion probability of the triplet is 0.999999999, which also has good performance in kinship identification.

[0173] It can be seen that the kit of the present invention has good individual identification and kinship identification performance in the population of East China, and can assist existing commonly used kits to perform more detailed analysis of individual identification and complex kinship identification.

[0174] Table 3 Statistics of relevant forensic parameters

[0175]

[0176]

[0177] Table 4 Typing results of 203 unrelated individuals based on 50 X-SNPs

[0178]

[0179]

[0180]

[0181]

[0182] All documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference individually. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application. Sequence Listing <110> Institute of Forensic Science <120> Forensic multiplex amplification kit for 50 X-SNPs detected based on MALDI-TOF MS platform <130> P2019-1988-1CNCN <140> CN 202010269750.4 <141> 2020-04-08 <160> 150 <170> PatentIn version 3.5 <210> 1 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 1 acgttggatg cctgttcact ggtttctttg 30 <210> 2 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 2 acgttggatg actcctggca tcaataggac 30 <210> 3 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 3 acgttggatg aaagtgggta tcccctttcc 30 <210> 4 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 4 acgttggatg tgcttgtgga gaagagctac 30 <210> 5 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 5 acgttggatg gtaaaatgat gaattgacac 30 <210> 6 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 6 acgttggatgcttactcattgcatcccctg 30 <210> 7 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 7 acgttggatg atgcacggat acgcagacag 30 <210> 8 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 8 acgttggatg aactgtatatccctccatcc 30 <210> 9 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 9 acgttggatg gatgctgtga ggaaaggaag 30 <210> 10 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 10 acgttggatg gtgttctaac catcatcccc 30 <210> 11 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 11 acgttggatg taccgctttt caacagtgga 30 <210> 12 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 12 acgttggatg ggagaatact tgaaggctac 30 <210> 13 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 13 acgttggatg agctcaatga ggtgatgagg 30 <210> 14 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 14 acgttggatg ccgttcaaca aatatcaagg c 31 <210> 15 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 15 acgttggatg tcagagaggt aggaagagag 30 <210> 16 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 16 acgttggatg cacctatttg ctcctttgag 30 <210> 17 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 17 acgttggatg cttccaccca atcctagttc 30 <210> 18 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 18 acgttggatg ttagtagcat tcgtgccccc 30 <210> 19 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 19 acgttggatg cagacaaacc acggagaatc 30 <210> 20 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 20 acgttggatg ccaacttccttttgaatacc 30 <210> twenty one <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> twenty one acgttggatg aaatggtcctttctgccctc 30 <210> twenty two <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> twenty two acgttggatg cacaagagct aagaaaacca g 31 <210> twenty three <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> twenty three acgttggatg caagtggatg ccatttgctc 30 <210> twenty four <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> twenty four acgttggatg gcaacagaca aacttgcttc 30 <210> 25 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 25 acgttggatg ttgtggggatc atgtggtagc 30 <210> 26 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 26 acgttggatg cccttgtaca ctgttgttgg 30 <210> 27 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 27 acgttggatg ctgctgatga gtgcagtaac 30 <210> 28 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 28 acgttggatg cctgggcatg aaacaaatgg 30 <210> 29 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 29 acgttggatg gggctctgcc aaagtaaaag 30 <210> 30 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 30 acgttggatg cacttaactg tggcagcttc 30 <210> 31 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 31 acgttggatg aatacagatg agctgggtgc 30 <210> 32 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 32 acgttggatg acttgagaga acctgcaacc 30 <210> 33 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 33 acgttggatg ctaggcatcc agttaatgtt c 31 <210> 34 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 34 acgttggatg ccaagttgtt tagataatcc 30 <210> 35 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 35 acgttggatg acaattgccc agctcaaatc 30 <210> 36 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 36 acgttggatg tccccaagga gcaaaatagg 30 <210> 37 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 37 acgttggatg gattgtgtag ttgtctctgc 30 <210> 38 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 38 acgttggatg ttagctaatg gagccagatg 30 <210> 39 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 39 acgttggatg gactcatctc ccaatggtta 30 <210> 40 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 40 acgttggatg taatgtgccc tttgacaccc 30 <210> 41 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 41 acgttggatg actgagccat ttctagtgcc 30 <210> 42 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 42 acgttggatg ttaagggtag caaagcaccg 30 <210> 43 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 43 acgttggatg aagtcacagt ggccaaatgc 30 <210> 44 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 44 acgttggatg tgatccaacc aaccttccac 30 <210> 45 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 45 acgttggatg tcatgagagc tggttttggg 30 <210> 46 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 46 acgttggatg ctttccaagc tcagttatac 30 <210> 47 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 47 acgttggatg ggacattaaggatgcaactg 30 <210> 48 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 48 acgttggatg tcaggaattc tgattggttg 30 <210> 49 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 49 acgttggatg agaaacaagg aagaaaaccc 30 <210> 50 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 50 acgttggatg gtgctgacctttgaaaacac 30 <210> 51 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 51 acgttggatg gaaggactgc taatgctacc 30 <210> 52 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 52 acgttggatg ggtttttgta cctggcttcc 30 <210> 53 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 53 acgttggatg gatatggtta gatagaggtg 30 <210> 54 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 54 acgttggatg gcttgtggct ttgaagcatc 30 <210> 55 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 55 acgttggatg gaagtcatta atgctttcgc c 31 <210> 56 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 56 acgttggatg gaaggtggta caggaaatgc 30 <210> 57 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 57 acgttggatg ccattcaccc atagaaagac 30 <210> 58 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 58 acgttggatg gacttcttaa tctgctcgcc 30 <210> 59 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 59 acgttggatg gtggtgattc agggatttgg 30 <210> 60 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 60 acgttggatg tgaccttgga agccactttg 30 <210> 61 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 61 acgttggatg tcaaggaaca ggatctggag 30 <210> 62 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 62 acgttggatg agagccattg gtgggaagag 30 <210> 63 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 63 acgttggatg gcgtcattga tttaaacctc c 31 <210> 64 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 64 acgttggatg ggttttctca tgagaactgg 30 <210> 65 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 65 acgttggatg ggacccagtg gattcattgc 30 <210> 66 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 66 acgttggatg tccagactat atctggggagc 30 <210> 67 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 67 acgttggatg cataagctac atcagaggtg 30 <210> 68 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 68 acgttggatg gcagattcta catttgctga 30 <210> 69 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 69 acgttggatg ttgcagctga tgctttttcc 30 <210> 70 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 70 acgttggatg aacttcgtaa cggagctgtc 30 <210> 71 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 71 acgttggatg ttctgcaaat gccttgctgg 30 <210> 72 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 72 acgttggatg tttgtaaggt gggcaggttg 30 <210> 73 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 73 acgttggatg aaaaggcaga tcagaactcc 30 <210> 74 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 74 acgttggatg ttggcctgca gtctatagtc 30 <210> 75 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 75 acgttggatg aagagacaac caattgcccc 30 <210> 76 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 76 acgttggatg gagttagaaa gcaccatgcc 30 <210> 77 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 77 acgttggatg agctgagtat ccctaatctg 30 <210> 78 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 78 acgttggatg cactggtcat tttctttggg 30 <210> 79 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 79 acgttggatg agagctagga tacttggcag 30 <210> 80 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 80 acgttggatg taccagtgaa gcgtcaatcc 30 <210> 81 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 81 acgttggatg atgcataaca gacactcaag 30 <210> 82 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 82 acgttggatg tcctttccct atatgttggc 30 <210> 83 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 83 acgttggatg tatcacctgc aacgtccaag 30 <210> 84 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 84 acgttggatg cactatcaga accatgtaat c 31 <210> 85 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 85 acgttggatg gtaagaaatt gccgatctgt c 31 <210> 86 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 86 acgttggatg catacattct gacgacgctg 30 <210> 87 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 87 acgttggatg ttcacttacc tcacgtgtgc 30 <210> 88 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 88 acgttggatg ctcactaaaa gcttttgaac 30 <210> 89 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 89 acgttggatg ctgctctgag ctactaagtc 30 <210> 90 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 90 acgttggatg ttgatggctg tttcttcggg 30 <210> 91 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 91 acgttggatg ggcaaattag acatctgaag 30 <210> 92 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 92 acgttggatg gtggggctca tcctatcgta 30 <210> 93 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 93 acgttggatg aaaaggcaag ctgtaactac 30 <210> 94 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 94 acgttggatg tctgctacaa tgccatggtc 30 <210> 95 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 95 acgttggatg acttccaatt ccacaaaggc 30 <210> 96 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 96 acgttggatg gtaaaacaat cagaaatggg c 31 <210> 97 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 97 acgttggatg ggccctcatc caattacac 29 <210> 98 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 98 acgttggatg agcagcagct agacaacatc 30 <210> 99 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 99 acgttggatg gggccttagt cttatgaaat c 31 <210> 100 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 100 acgttggatg tcacttccat ctactgtccc 30 <210> 101 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 101 ggggaaattt aggacagta 19 <210> 102 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 102 cacaggcatg tggtc 15 <210> 103 <211> twenty two <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 103 cttatgaatt gacacaaaag gt 22 <210> 104 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 104 cgcagacaga tagatgac 18 <210> 105 <211> twenty four <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 105 gtgtgaggaa aggaagagaa aata 24 <210> 106 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 106 cctttcccat tatcaggaca 20 <210> 107 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 107 ggcctcagat gttttatga 19 <210> 108 <211> twenty four <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 108 ggagaagaca ataatgatct gaag 24 <210> 109 <211> twenty two <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 109 gggaatggct agcaaatgaa ga 22 <210> 110 <211> twenty two <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 110 cctcaggaaa caggaagata ta 22 <210> 111 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 111 aaaaccaggt accgtaa 17 <210> 112 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 112 gtattattat tgttttcttg taaagaag 28 <210> 113 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 113 tccaaaccct tctcca 16 <210> 114 <211> twenty three <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 114 ggaacttgag tagcttgtag aga 23 <210> 115 <211> twenty three <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 115 acacagtaaa agcctaggca ggt 23 <210> 116 <211> twenty four <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 116 cgctgggtgc aaaattttaa aata 24 <210> 117 <211> twenty four <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 117 ccagttaatg ttcatcaact aata 24 <210> 118 <211> twenty one <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 118 tggtaaacat atttggtatg a 21 <210> 119 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 119 ggggcagtac acgttacatt aggaatt 27 <210> 120 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 120 caataaatga aaaagatcac acatc 25 <210> 121 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 121 ggttatagtg cctgcactta catcagt 27 <210> 122 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 122 gccaaatgcc acagt 15 <210> 123 <211> twenty one <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 123 gctgtgcaaa tgaattaagc a 21 <210> 124 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 124 ggaggagggc tatcgac 17 <210> 125 <211> twenty three <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 125 caccaggaag aaaaccccta att 23 <210> 126 <211> twenty two <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 126 ccacgctacc aacaagggta aa 22 <210> 127 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 127 gttagataga ggtgggattc 20 <210> 128 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 128 ctccggcttt cgccaaatat tctagttc 28 <210> 129 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 129 ggggcatttg aggctgggc 19 <210> 130 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 130 tgggctcctt ccatc 15 <210> 131 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 131 ggggcaatga gcaaaaaagg agaga 25 <210> 132 <211> twenty three <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 132 gatcatggga aaaacagtta acc 23 <210> 133 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 133 caaacctagt cctggactc 19 <210> 134 <211> twenty one <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 134 aggaggtgtt gtaaatagag c 21 <210> 135 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 135 cccgttaaat tctttttctt gtgttc 26 <210> 136 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 136 ttaatccctc tgcattga 18 <210> 137 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 137 cctggcatga tgacgta 17 <210> 138 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 138 ccccagcttt cactatctc 19 <210> 139 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 139 tctgcaaaat ctgaaacttt ttaagca 27 <210> 140 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 140 ggagtatact tggcagattt atttga 26 <210> 141 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 141 gaaccgacac tcaagaagga atataa 26 <210> 142 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 142 cccgtaacgt ccaagttgta catcac 26 <210> 143 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 143 gattggaata aaaagactac ctatg 25 <210> 144 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 144 cctctaattt aagctaaaaa gaaaata 27 <210> 145 <211> twenty one <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 145 ccactaagtc cagactctga a 21 <210> 146 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 146 tttccataga caacagaatg 20 <210> 147 <211> twenty four <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 147 ccccaaagct gtaactaccc aagg 24 <210> 148 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 148 cacaaaggca aatggatat 19 <210> 149 <211> twenty one <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 149 cccactatgc tcattgttga a 21 <210> 150 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> Primer sequences <400> 150 tgggtttggg gatgaag 17

Claims

1. A X chromosome nucleic acid typing kit, characterized in that: The kit comprises: a nucleic acid detection reagent for specifically detecting X-SNP genetic marker sites of group A1, group A2, group A3, group A4 and group A5; The nucleic acid detection reagent includes: composite amplification primers and single base extension reaction primers for each X-SNP genetic marker site; The sequences of the composite amplification primers of Group A1 are shown in SEQ ID NOs: 1-20, and the sequences of the single base extension reaction primers are shown in SEQ ID NOs: 101-110; The sequences of the composite amplification primers of group A2 are shown in SEQ ID NOs: 21-40, and the sequences of the single base extension reaction primers are shown in SEQ ID NOs: 111-120; The sequences of the composite amplification primers of Group A3 are shown in SEQ ID NOs: 41-60, and the sequences of the single base extension reaction primers are shown in SEQ ID NOs: 121-130; The sequences of the composite amplification primers of Group A4 are shown in SEQ ID NOs: 61-80, and the sequences of the single base extension reaction primers are shown in SEQ ID NOs: 131-140; The sequences of the A5 group composite amplification primers are shown in SEQ ID NOs: 81-100, and the sequences of the single base extension reaction primers are shown in SEQ ID NOs: 141-150.

2. The kit according to claim 1, characterized in that The kit also includes standard DNA, which includes male standard DNA and / or female standard DNA.

3. The kit according to claim 2, characterized in that The male standard DNA is 9948+ male standard.

4. The kit according to claim 2, characterized in that The female standard DNA is 9947A+ female standard.

5. A method for X chromosome typing for non-disease diagnosis and non-disease treatment purposes, characterized in that: Includes steps: (i) obtaining a sample to be tested; (ii) providing a kit according to any one of claims 1 to 4, and subjecting the sample to be tested to a composite amplification reaction and a single base extension reaction; (iii) testing and typing the sample obtained in step (ii).

6. The method according to claim 5, characterized in that The method also includes performing parallel testing on a control sample.

7. The method according to claim 6, characterized in that The control samples include positive control samples and negative control samples.

8. The method according to claim 7, characterized in that The positive control sample is standard DNA.

9. The method according to claim 8, characterized in that The standard DNA includes 9948+male standards and / or 9947A+female standards.

10. The method according to claim 7, characterized in that The negative control sample was ultrapure water.

11. The method according to claim 5, characterized in that In the step (ii), after the sample to be tested is subjected to the composite amplification reaction, it is purified using shrimp alkaline phosphatase SAP before being subjected to the single base extension reaction.

12. The method according to claim 5, characterized in that Prior to step (iii), the sample obtained in step (ii) is subjected to desalting and purification.

13. The method according to claim 5, characterized in that In said step (iii), detection is performed by mass spectrometry.

14. The method according to claim 5, characterized in that In the step (iii), detection is performed using a matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS) platform, and typing is performed using MALDI-TOF MS Typer 4.0 software.

15. The method according to claim 5, characterized in that The sample to be tested is a sample extracted from a crime scene.

16. The method according to claim 5, characterized in that The sample to be tested is a sample containing human DNA.

17. The method according to claim 5, characterized in that The detection and typing conclusions obtained in the step (iii) are: special kinship identification, individual identification of individuals of unknown origin, or a combination thereof; the special kinship identification is: identification of kinship between half-sisters who lack both parents, single-parent paternity identification involving father-daughter relationship, single-parent paternity identification involving mother-daughter or mother-son relationship, intergenerational kinship identification involving grandmother-granddaughter relationship, or a combination thereof.

18. A use of the kit according to any one of claims 1 to 4 for non-disease diagnosis and non-disease treatment purposes, characterized in that: Used for X chromosome nucleic acid typing.

19. The use according to claim 18, characterized in that The kit is used for forensic evidence identification.

20. The use according to claim 19, characterized in that The forensic evidence identification includes: special kinship identification, individual identification of individuals of unknown origin, or a combination thereof; the special kinship identification includes: identification of kinship between half-sisters who lack both parents, single-parent paternity identification involving father-daughter relationship, single-parent paternity identification involving mother-daughter or mother-son relationship, inter-generational kinship identification involving grandmother-granddaughter relationship, or a combination thereof.

Images