Therapeutic nuclease compositions and methods

By developing hybrid nuclease molecules containing nuclease domain and Fc domain, the problem of over-release of nucleoprotein in systemic lupus erythematosus was solved, and the effect of reducing nucleoprotein release and reducing immune stimulation was achieved.

CN113528485BActive Publication Date: 2025-06-27UNIV OF WASHINGTON
View PDF 72 Cites 0 Cited by

Patent Information

Application Number
CN202110852975.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Priority Date
2010-08-04
Filing Date
2010-11-02
Publication Date
2025-06-27
Estimated Expiration
2030-11-02

AI Technical Summary

Technical Problem

The prior art is difficult to effectively remove excessively released nuclear proteins in systemic lupus erythematosus, resulting in immune stimulation and aggravation of the disease.

Method used

Develop a hybrid nuclease molecule, including nuclease domains (such as RNase or DNase) and Fc domains, which bind to Fc receptors on the cell surface through the Fc domain, improve the serum half-life and activity of nucleases, and thus reduce the release of nucleoproteins.

Benefits of technology

By increasing the serum half-life and activity of nucleases, it effectively reduces the release of nucleoprotein, reduces immune stimulation, and alleviates the symptoms of systemic lupus erythematosus.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN113528485B_ABST
    Figure CN113528485B_ABST
Patent Text Reader

Abstract

The present invention relates to hybrid nuclease molecules and methods for treating immune-related diseases or conditions in mammals, as well as pharmaceutical compositions for treating immune-related diseases in mammals.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] This application is a divisional application of a Chinese patent application (application number 201080060471.1, with an application date of November 2, 2010 and an invention title of "Therapeutic nuclease compositions and methods") that enters the Chinese national phase from international application PCT / US2010 / 055131, and is also a divisional application of a divisional application (application number 201610979041.9, with an application date of November 2, 2010 and an invention title of "Therapeutic nuclease compositions and methods").

[0002] Cross-reference to related applications

[0003] This application claims priority to U.S. Provisional Patent Application No. 61 / 257,458, filed November 2, 2009, and U.S. Provisional Patent Application No. 61 / 370,752, filed August 4, 2010, the entire contents of which are hereby incorporated by reference in their entirety.

[0004] Statement regarding federally sponsored research

[0005] This invention was made with government support under National Institutes of Health grants AI44257, NS065933, and AR048796, the Lupus Research Alliance, and the Washington State Life Sciences Discovery Fund (2087750). The government has certain rights in the invention.

[0006] Sequence listing reference

[0007] This application is being filed together with a sequence listing in electronic form, which is submitted as a file named DOCS-#2346946-v1-17583_PCT_Sequence_Listing_2010_12_07.txt_, created on December 7, 2010, and having a size of 357 Kb. The sequence listing is hereby incorporated by reference into this application. Background of the invention

[0008] In dead and dying cells, the excessive release of (ribo)nucleoproteins can lead to lupus pathology through two mechanisms: (i) deposition or in situ formation of chromatin / anti-chromatin complexes, leading to nephritis and further renal function loss; and (ii) activation of the innate immune system by nucleoproteins through Toll-like receptors (TLRs) 7, 8, and 9 and TLR-independent pathways. The release of nucleoproteins can serve as an effective antigen for systemic lupus erythematosus autoantibodies, and through the interaction of antigen receptors with TLRs, B cell expansion and DC cell activation occur. There is a need for methods to remove stimulatory antigens and / or mitigate immune stimulation, immune amplification, and immune complex-mediated diseases in a desired subject. Summary of the invention

[0009] The present invention discloses a hybrid nuclease molecule, which comprises a first nuclease domain and an Fc domain, wherein the first nuclease domain is effectively coupled to the Fc domain. In certain embodiments, the hybrid nuclease molecule further comprises a first linker domain, and the first nuclease domain is effectively coupled to the Fc domain through the first linker domain.

[0010] In certain embodiments, the hybrid nuclease molecule is a polypeptide, wherein the amino acid sequence of the first nuclease domain comprises a human wild-type RNase amino acid sequence, wherein the first linker domain is (Gly4Ser)n, where n is 0, 1, 2, 3, 4 or 5, wherein the amino acid sequence of the Fc domain comprises the amino acid sequence of a human wild-type IgG1 Fc domain, and wherein the first linker domain is linked to the C-terminus of the first nuclease domain and the N-terminus of the Fc domain. In certain embodiments, the hybrid nuclease molecule is a polypeptide comprising the sequence shown in Table 2, or a polypeptide consisting of the sequence shown in Table 2. In certain embodiments, the hybrid nuclease molecule is a polypeptide comprising SEQ ID NO:149. In certain embodiments, the hybrid nuclease molecule is a polypeptide comprising SEQ ID NO:145. In certain embodiments, the hybrid nuclease molecule is a polypeptide comprising SEQ ID NO:161. In certain embodiments, the hybrid nuclease molecule is a polypeptide comprising SEQ ID NO:162. In certain embodiments, the hybrid nuclease molecule is a polypeptide comprising SEQ ID NO:163.

[0011] In certain embodiments, the hybrid nuclease molecule comprises wild-type human DNase1 conjugated to wild-type human IgG1. In certain embodiments, the hybrid nuclease molecule comprises human DNase1 G105R A114F linked to the wild-type human IgG1 Fc domain via a (gly4ser)n linker domain, where n = 0, 1, 2, 3, 4, or 5. In certain embodiments, the hybrid nuclease molecule comprises wild-type human RNase1 linked to wild-type human IgG1, which is linked to wild-type human DNase1. In certain embodiments, the hybrid nuclease molecule comprises wild-type human RNase1 linked to wild-type human IgG1, which is linked to human DNase1 G105R A114F. In certain embodiments, the hybrid nuclease molecule is a polypeptide, wherein the amino acid sequence of the first nuclease domain comprises an RNase amino acid sequence, wherein the length of the first linker domain is between 5 and 32 amino acids, wherein the amino acid sequence of the Fc domain comprises a human Fc domain amino acid sequence, and wherein the first linker domain is conjugated to the C-terminus of the first nuclease domain and the N-terminus of the Fc domain. In certain embodiments, the linker domain comprises (gly4ser)5 and the restriction sites BglII, AgeI, and XhoI. In certain embodiments, the hybrid nuclease molecule is a polypeptide, wherein the amino acid sequence of the first nuclease domain comprises a human RNase amino acid sequence, wherein the first linker domain is an NLG peptide having a length of 5 to 32 amino acids, wherein the amino acid sequence of the Fc domain comprises a human wild-type Fc domain amino acid sequence, and wherein the first linker domain is conjugated to the C-terminus of the first nuclease domain and the N-terminus of the Fc domain.

[0012] In certain embodiments, the Fc domain binds to the Fc receptor on human cells. In certain embodiments, the serum half-life of the molecule is significantly longer than the serum half-life of the first nuclease domain alone. In certain embodiments, the nuclease activity of the first nuclease domain of the molecule is the same as or higher than that of the nuclease domain alone. In certain embodiments, the results of the mouse lupus model test show that administering the molecule to mice can increase the survival rate of the mice.

[0013] In certain embodiments, the hybrid nuclease molecule comprises a leader sequence. In certain embodiments, the leader sequence is the human VK3LP peptide from the human κ light chain family, and the leader sequence is conjugated to the N-terminus of the first nuclease domain.

[0014] In certain embodiments, the molecule is a polypeptide. In certain embodiments, the molecule is a polynucleotide.

[0015] In certain embodiments, the first nuclease domain comprises an RNase. In certain embodiments, the RNase is a human RNase. In certain embodiments, the RNase is a polypeptide comprising an amino acid sequence that is at least 90% similar to the RNase amino acid sequence shown in Table 2. In certain embodiments, the RNase is a member of the human RNase A family. In certain embodiments, the RNase is human pancreatic RNase1.

[0016] In certain embodiments, the first nuclease domain comprises a DNase. In certain embodiments, the DNase is a human DNase. In certain embodiments, the DNase is a polypeptide comprising an amino acid sequence that is at least 90% similar to the DNase amino acid sequence shown in Table 2. In certain embodiments, the DNase is selected from human DNase I, TREX1, and human DNase1L3.

[0017] In certain embodiments, the Fc domain is a human Fc domain. In certain embodiments, the Fc domain is a wild-type Fc domain. In certain embodiments, the Fc domain is a mutant Fc domain. In certain embodiments, the Fc domain is a human IgG1 Fc domain. In certain embodiments, the Fc domain is a polypeptide comprising an amino acid sequence that is at least 90% similar to the Fc domain amino acid sequence shown in Table 2.

[0018] In certain embodiments, the length of the first linker domain is from about 1 to about 50 amino acids. In certain embodiments, the length of the first linker domain is from about 5 to about 31 amino acids. In certain embodiments, the length of the first linker domain is from about 15 to about 25 amino acids. In certain embodiments, the length of the first linker domain is from about 20 to about 32 amino acids. In certain embodiments, the length of the first linker domain is about 20 amino acids. In certain embodiments, the length of the first linker domain is about 25 amino acids. In certain embodiments, the length of the first linker domain is about 18 amino acids. In certain embodiments, the first linker domain comprises a gly / ser peptide. In certain embodiments, the gly / ser peptide is represented by the general formula (Gly4Ser)n, where n is a positive integer selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10. In certain embodiments, the gly / ser peptide comprises (Gly4Ser)3. In certain embodiments, the gly / ser peptide comprises (Gly4Ser)4. In certain embodiments, the gly / ser peptide comprises (Gly4Ser)5. In certain embodiments, the first linker domain comprises at least one restriction site. In certain embodiments, the first linker domain comprises about 12 or more nucleotides that contain at least one restriction site. In certain embodiments, the first linker domain comprises two or more restriction sites. In certain embodiments, the first linker domain comprises a plurality of restriction sites. In certain embodiments, the first linker domain comprises an NLG peptide. In certain embodiments, the first linker domain comprises an N-linked glycosylation site.

[0019] In certain embodiments, the first nuclease domain is linked to the N-terminus of the Fc domain. In certain embodiments, the first nuclease domain is linked to the C-terminus of the Fc domain.

[0020] In certain embodiments, the hybrid nuclease molecule further comprises a second nuclease domain. In certain embodiments, the first and second nuclease domains are different nuclease domains. In certain embodiments, the first and second nuclease domains are the same nuclease domain. In certain embodiments, the second nuclease domain is linked to the C-terminus of the Fc domain. In certain embodiments, the second nuclease domain is linked to the N-terminus of the Fc domain. In certain embodiments, the second nuclease domain is linked to the C-terminus of the first nuclease domain. In certain embodiments, the second nuclease domain is linked to the N-terminus of the first nuclease domain.

[0021] The present invention also discloses a dimeric polypeptide comprising a first polypeptide and a second polypeptide, wherein the first polypeptide comprises a first nuclease domain and an Fc domain, and wherein the first nuclease domain is effectively coupled to the Fc domain. In certain embodiments, the second polypeptide is a second hybrid nuclease comprising a second nuclease domain and a second Fc domain, wherein the second nuclease domain is effectively coupled to the second Fc domain.

[0022] The present invention also discloses a pharmaceutical composition comprising at least one hybrid nuclease molecule and / or at least one dimeric polypeptide as described in the present invention, and a pharmaceutically acceptable excipient.

[0023] The present invention also discloses a nucleic acid molecule encoding the hybrid nuclease molecule disclosed in the present invention. The present invention also discloses a recombinant expression vector comprising the nucleic acid molecule disclosed in the present invention. The present invention also discloses a host cell transfected with the recombinant expression vector disclosed in the present invention.

[0024] The present invention also discloses a method for preparing the hybrid nuclease disclosed in the present invention, the method comprising: providing a host cell comprising a nucleic acid sequence encoding a hybrid nuclease molecule; and maintaining the host cell under conditions for expressing the hybrid nuclease molecule.

[0025] The present invention also discloses a method for treating or preventing a condition associated with abnormal immune response, the method comprising administering to a patient in need an effective amount of the isolated hybrid nuclease molecule disclosed in the present invention. In certain embodiments, the condition is an autoimmune disease. In certain embodiments, the autoimmune disease is selected from insulin-dependent diabetes mellitus, multiple sclerosis, experimental autoimmune encephalomyelitis, rheumatoid arthritis, experimental autoimmune arthritis, myasthenia gravis, thyroiditis, experimental uveitis, Hashimoto's thyroiditis, primary myxedema, thyrotoxicosis, pernicious anemia, autoimmune atrophic gastritis, Addison's disease, premature menopause, male infertility, juvenile diabetes, Goodpasture's syndrome, pemphigus vulgaris, pemphigoid, sympathetic ophthalmia, phacoanaphylactic uveitis, autoimmune hemolytic anemia, idiopathic leukopenia, primary biliary cirrhosis, chronic active hepatitis Hbs-ve, cryptogenic cirrhosis, ulcerative colitis, Sjogren's syndrome, scleroderma, Wegener's granulomatosis, polymyositis, dermatomyositis, discoid lupus erythematosus, systemic lupus erythematosus (SLE), and connective tissue disease. In certain embodiments, the autoimmune disease is systemic lupus erythematosus (SLE).

[0026] Brief Description of the Drawings

[0027] These and other features, aspects, and advantages of the present invention will become more readily understood by the following description and the corresponding drawings, wherein:

[0028] Figure 1 Shows the nucleotide and amino acid sequences of mRNase-mIgG2a with mutations at the P238S, K322S, and P331S sites. This sequence is represented as huVK3LP+mrib1+mIgG2A-C-2S (SEQ ID NO:114) in the sequence listing.

[0029] Figure 2 Shows a schematic diagram of the hybrid nuclease molecules of certain embodiments of the present invention.

[0030] Figure 3 Shows the results of SDS-PAGE gel analysis of mRNase-mIgG2a-c under reducing and non-reducing conditions.

[0031] Figure 4 Shows the results of gel immunoprecipitation analysis of mRNasemIg2a-c.

[0032] Figure 5 Shows the anti-RNA antibody ELISA titers in mouse 410 before and after injection of the RNase-Ig hybrid nuclease molecule. This data shows that the injection of RNase-Ig results in a decrease in the titer of anti-RNA antibodies and lasts for more than 3 weeks.

[0033] Figure 6 Shows that the addition of RNase-Ig stops the induction of interferon-α in human peripheral blood mononuclear cells stimulated by the immune complexes formed by the serum of a systemic lupus erythematosus patient (J11) and nucleic acid extracts (NE). The titer of anti-RNA antibodies decreases after injection of RNase-Ig.

[0034] Figure 7 Shows that the addition of RNase-Ig stops the induction of interferon-α in human peripheral blood mononuclear cells stimulated by the immune complexes formed by the serum of a systemic lupus erythematosus patient (J11) and nucleic acid extracts.

[0035] Figure 8 Shows the results of single-phase enzyme diffusion (SRED) analysis of two RNase transgenic (Tg) mice compared to normal B6 mice.

[0036] Figure 9 Shows the RNaseA concentrations detected by ELISA in Tg and double Tg (DTg) mice. Each point represents the concentration detected in each mouse.

[0037] Figure 10 Shows the survival of TLR7.1 Tg compared to TLR7.1xRNaseA DTg mice.

[0038] Figure 11Shows the quantitative PCR results of IRG in the spleen of Tg versus DTg mice.

[0039] Figure 12 Shows an example structure of a hybrid nuclease molecule in different embodiments created.

[0040] Figure 13 Shows the use of RNase Alert Substrate TM The enzyme kinetics of the hRNase1-G88D-hIgG1 SCCH-P238S-K322S-P331S hybrid nuclease molecule detected.

[0041] Figure 14 Shows the binding of hRNase1-WT-hIgG1-WT to the human monocyte cell lines U937 and TNP1. The peaks on the left in both figures are controls, and the peaks on the right in both figures are hRNase1-WT-hIgG1-WT.

[0042] Figure 15 Shows the blocking activity of hRNase1-WT-hIgG1-WT against human IVIg with U937 and THP-1 cells.

[0043] Figure 16 Shows the results of DNA digestion assay of Trex1-(g4s)n-mIgG alternative forms.

[0044] Figure 17 Shows the Western blot detection results of the culture supernatant of trex1-(Gly4S)4-Ig and trex1-(Gly4S)5-Ig from COS-7 transient transfection.

[0045] Figure 18 Shows the DNA digestion patterns of different stable transfected CHO DG44 clones named 2A3, 3A5, and 8H8, which express the DNAse1L3-mIgG2a-c hybrid nuclease molecule.

[0046] Figure 19 Shows the DNA digestion patterns of the reduction in the amount of DNase1L3-Ig hybrid nuclease molecule after incubation for different times with or without heparin as an enzyme inhibitor.

[0047] Figure 20 Shows the Western blot of immunoprecipitated fusion proteins from transiently transfected COS cells that express different embodiments of hRNase1-Ig-hDNase1 or hDNase1-Ig hybrid nuclease molecules.

[0048] Figure 21Shows the results of SRED analysis evaluating RNase activity in COS supernatants expressing different embodiments of hRNase1-Ig-hDNase1 or hDNase1-Ig hybrid nuclease molecules.

[0049] Figure 22 The composite graph of Figure 21 shows the results of DNase nuclease activity assays performed in COS supernatants of transfected cells. The numbered descriptions in this figure (e.g., 090210-8 and 091210-8) are the same as Figure 21 the same.

[0050] Figure 23 Shows the results of enzyme kinetics assays using the Rnase Alert substrate (Ambion / IDT) and fluorescence quantification assays using a Spectramax M2 microplate reader. Data analysis was performed using Softmax Pro software (Molecular Devices). The reaction rate was determined at different substrate concentrations, and the data were represented as a Lineweaver-Burk plot. The volume-corrected apparent Km was 280 nM.

[0051] Figure 24 Shows the levels of anti-RNA antibodies in the sera of mice over consecutive time intervals as the transgenic mice age, where the mouse sera are from H564 and H564-RNaseA double transgenic mice. DETAILED DESCRIPTION OF THE INVENTION

[0052] Unless otherwise indicated, the definitions of the terms in the claims and the specification are as set forth below. If there is a direct conflict with the terms in the original provisional patent application, the terms used in the specification of this application shall prevail.

[0053] "Amino acid" refers to naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that have similar functions to naturally occurring amino acids. Naturally occurring amino acids refer to genetically encoded amino acids and subsequently modified amino acids, such as hydroxyproline, γ-carboxyglutamic acid, and O-phosphoserine. Amino acid analogs refer to compounds having the same basic chemical structure as naturally occurring amino acids, i.e., an α-carbon bonded to hydrogen, a carboxyl group, an amino group, and an R group, such as homoserine, norleucine, methionine sulfoxide, and methionine methyl sulfonium. Such analogs have modified R groups (e.g., norleucine) or modified peptide backbones, but retain the same basic chemical structure as naturally occurring amino acids. Amino acid mimetics refer to compounds having a structure different from the general chemical structure of amino acids, but having a function similar to that of naturally occurring amino acids.

[0054] In the present invention, amino acids can be represented either in the commonly known three-letter form or in the one-letter form recommended by the IUPAC-IUB Commission on Biochemical Nomenclature. Similarly, nucleotides can be represented by the conventional single-letter codes.

[0055] "Amino acid substitution" means that at least one amino acid residue present in a predefined amino acid sequence (the amino acid sequence of the initial polypeptide) is replaced by another different "substituting" amino acid residue. "Amino acid insertion" means adding at least one additional amino acid to the predefined amino acid sequence. Insertions generally consist of the insertion of one or two amino acid residues, but longer "peptide insertions" can be made, for example, inserting about three to about five or even about ten, fifteen, or twenty amino acid residues. The inserted residues can be the naturally occurring or non-naturally occurring residues described above. "Amino acid deletion" means removing at least one amino acid residue from the predefined amino acid sequence.

[0056] "Polypeptide", "peptide", and "protein" are used interchangeably in the present invention to refer to polymers of amino acid residues. These terms are used to describe both naturally occurring amino acid polymers and non-naturally occurring amino acid polymers, and can also describe such amino acid polymers in which one or more amino acid residues are artificial chemical mimics corresponding to naturally occurring amino acids.

[0057] "Nucleic acid" refers to polymers of deoxyribonucleotides or ribonucleotides in their single-stranded or double-stranded forms. Unless otherwise specified, the term includes nucleic acids containing known analogs of natural nucleotides, which have similar binding properties to standard nucleic acids and are metabolized in a manner similar to that of naturally occurring nucleotides. Unless otherwise stated, a particular nucleic acid sequence also implicitly encompasses its appropriate modified variants (e.g., degenerate codon substitutions) and complementary sequences as well as the explicitly recited sequence. In particular, degenerate codon substitutions can be achieved in the resulting sequence by replacing the third position of one or more selected (or all) codons in the sequence with a mixture of bases and / or deoxyinosine residues (Batzer et al., Nucleic Acid Res. 19:5081, 1991; Ohtsuka et al., J. Biol. Chem. 260:2605-2608, 1985; and Cassol et al., 1992; Rossolini et al., Mol. Cell. Probes 8:91-98, 1994). For arginine and leucine, modifications at the second base can also be conservative. The term nucleic acid can be used interchangeably with gene, cDNA, and mRNA encoded by the gene.

[0058] The polynucleotides of the present invention can be composed of any polyribonucleotides or polydeoxyribonucleotides, which can be unmodified RNA or DNA, or modified RNA or DNA. For example, the polynucleotides can be composed of the following molecules: single-stranded and double-stranded DNA, single-stranded and double-stranded region mixture DNA, single-stranded and double-stranded RNA, and single-stranded and double-stranded region mixture RNA, as well as hybrid molecules, which contain single-stranded DNA and RNA, or more typically double-stranded DNA and RNA, or DNA and RNA with a mixture of single-stranded and double-stranded regions. In addition, the polynucleotides can be composed of triple-stranded regions, which contain RNA, or DNA, or both RNA and DNA. The polynucleotides can also contain one or more modified bases, or a DNA or RNA backbone modified for stability or other reasons. "Modified" bases include, for example, triphenyl bases and rare bases such as inosine. A variety of modifications can be made to DNA and RNA; thus, "polynucleotides" include chemically, enzymatically, or metabolically modified forms.

[0059] In the present application, the term "hybrid nuclease molecule" refers to a polynucleotide or polypeptide that contains at least one nuclease domain and at least one Fc domain. Hybrid nuclease molecules also refer to fusion proteins and fusion genes. For example, in one embodiment, the hybrid nuclease molecule can be a polypeptide that contains at least one Fc domain linked to a nuclease domain, such as DNase and / or RNase. As another example, the hybrid nuclease molecule can contain an RNase nuclease domain, a linker domain, and an Fc domain. SEQ ID NO: 161 is an example of a hybrid nuclease molecule. Other examples will be described in more detail below. In one embodiment, the hybrid nuclease molecules of the present invention can include additional modifications. In another embodiment, the hybrid nuclease molecules can be modified to incorporate functional groups (e.g., PEG, drugs, or labels).

[0060] In some aspects, the hybrid nuclease molecules of the present invention can incorporate one or more "linker domains", such as polypeptide linkers. The term "linker domain" as used in the present application refers to a sequence that connects two or more domains in a linear sequence. The term "polypeptide linker" as used in the present application refers to a peptide or polypeptide sequence (e.g., a synthetic peptide or polypeptide sequence) that connects two or more domains in the linear amino acid sequence of a polypeptide chain. For example, a polypeptide linker can connect a nuclease domain to an Fc domain. Preferably, such polypeptide linkers can provide flexibility to the polypeptide molecule. In some embodiments, polypeptide linkers are used to connect (e.g., gene fusion) one or more Fc domains and / or one or more nuclease domains. The hybrid nuclease molecules of the present invention can contain more than one linker domain or peptide linker.

[0061] The term "gly-ser polypeptide linker" as used in this application refers to a peptide composed of glycine and serine residues. Exemplary gly / ser polypeptide linkers comprise the amino acid sequence Ser(Gly4Ser)n. In one embodiment, n = 1. In one embodiment, n = 2. In another embodiment, n = 3, i.e., Ser(Gly4Ser)3. In another embodiment, n = 4, i.e., Ser(Gly4Ser)4. In another embodiment, n = 5. In yet another embodiment, n = 6. In another embodiment, n = 7. In yet another embodiment, n = 8. In another embodiment, n = 9. In yet another embodiment, n = 10. Another exemplary gly / ser polypeptide linker comprises the amino acid sequence Ser(Gly4Ser)n. In one embodiment, n = 1. In one embodiment, n = 2. In a preferred embodiment, n = 3. In another embodiment, n = 4. In another embodiment, n = 5. In yet another embodiment, n = 6.

[0062] The terms "linked", "fused", or "fusion" as used in this application may be used interchangeably. These terms refer to two or more elements or parts or domains being joined together in any manner, including by chemical coupling or recombination. Methods of chemical coupling (e.g., using heterobifunctional crosslinkers) are known in the art.

[0063] The term "Fc region" as used in this application is defined as a part of a native immunoglobulin formed by the Fc domains (or Fc portions) of each of two heavy chains.

[0064] The term "Fc domain" as used in this application refers to a portion of a single immunoglobulin (Ig) heavy chain. Thus, the Fc domain can also be referred to as "Ig" or "IgG". In certain embodiments, the Fc domain begins just upstream of the papain cleavage site in the hinge region and terminates at the C-terminus of the antibody. Accordingly, a complete Fc domain comprises at least one hinge domain, CH2 domain, and CH3 domain. In certain embodiments, the Fc domain comprises at least one of the following regions: a hinge (e.g., upper, middle, and / or lower hinge region) domain, CH2 domain, CH3 domain, CH4 domain, or variants, portions, or fragments thereof. In other embodiments, the Fc domain comprises a complete Fc domain (i.e., a hinge domain, CH2 domain, and CH3 domain). In one embodiment, the Fc domain comprises a hinge domain (or a portion thereof) fused to a CH3 domain (or a portion thereof). In another embodiment, the Fc domain comprises a CH2 domain (or a portion thereof) fused to a CH3 domain (or a portion thereof). In another embodiment, the Fc domain consists of a CH3 domain or a portion thereof. In another embodiment, the Fc domain consists of a hinge domain (or a portion thereof) and a CH3 domain (or a portion thereof). In another embodiment, the Fc domain consists of a CH2 domain (or a portion thereof) and a CH3 domain. In another embodiment, the Fc domain consists of a hinge domain (or a portion thereof) and a CH2 domain (or a portion thereof). In one embodiment, the Fc domain lacks at least a portion of the CH2 domain (e.g., all or part of the CH2 domain). In one embodiment, the Fc domain of the present invention comprises at least that portion of the Fc molecule required for FcRn binding known in the art. In another embodiment, the Fc domain of the present invention comprises at least that portion of the Fc molecule required for FcγR binding known in the art. In one embodiment, the Fc domain of the present invention comprises at least that portion of the Fc molecule required for protein A binding known in the art. In one embodiment, the Fc domain of the present invention comprises at least that portion of the Fc molecule required for protein G binding known in the art. The Fc domain in the present invention generally refers to a polypeptide comprising all or part of the Fc domain of an immunoglobulin heavy chain. That is, it includes, but is not limited to, polypeptides comprising the entire CH1, hinge, CH2, and / or CH3 domains, as well as fragments of such peptides comprising only, for example, the hinge, CH2, and / or CH3 domains. The Fc domain can be from immunoglobulins of any species and / or any subtype, including but not limited to human IgG1, IgG2, IgG3, IgG4, IgD, IgA, IgE, or IgM antibodies. The Fc domain comprises native Fc and Fc variant molecules. For Fc variants and native Fc, the term Fc domain includes monomeric or polymeric forms, whether obtained by enzymatic cleavage from a complete antibody or produced by other means.

[0065] As described in the present application, those of ordinary skill in the art will appreciate that the amino acid sequence of any modified Fc domain will be different from the amino acid sequence of the native Fc domain of a naturally occurring immunoglobulin molecule. In certain exemplary embodiments, the Fc domain retains effector function (e.g., FcγR binding).

[0066] The Fc domain of the polypeptide of the present invention can be from different immunoglobulin molecules. For example, the Fc domain of the polypeptide can include the CH2 and / or CH3 domains from an IgG1 molecule and the hinge region from an IgG3 molecule. In another example, the Fc domain can include a chimeric hinge region that is part from an IgG1 molecule and part from an IgG3 molecule. In another example, the Fc domain can include a chimeric hinge region that is part from an IgG1 molecule and part from an IgG4 molecule.

[0067] "From" with respect to a polypeptide or amino acid sequence of a polypeptide or protein refers to the source of the polypeptide. Preferably, the polypeptide or amino acid sequence from a particular sequence has an amino acid sequence that is substantially the same as the sequence or a portion thereof, where the portion consists of at least 10-20 amino acids, preferably at least 20-30 amino acids, more preferably at least 30-50 amino acids, or other portions that can be identified by those skilled in the art as having that source in the sequence.

[0068] A polypeptide from another peptide can have one or more mutations relative to the initial polypeptide, such as one or more amino acid residues being replaced by another amino acid residue, or having one or more amino acid residues inserted or deleted.

[0069] The polypeptide can comprise a non-naturally occurring amino acid sequence. Such variants will necessarily have less than 100% sequence identity or similarity to the initial hybrid nuclease molecule. In a preferred embodiment, the amino acid sequence of the variant, for example, over the full length of the variant molecule, has about 75% to less than 100% amino acid sequence identity or similarity to the amino acid sequence of the initial polypeptide, more preferably about 80% to less than 100%, more preferably about 85% to less than 100%, more preferably about 90% to less than 100% (e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%) and most preferably about 95% to less than 100%.

[0070] In certain embodiments, there is a difference of one amino acid between the initial polypeptide sequence and the sequence from the initial polypeptide. Identity or similarity to a sequence, as defined herein, is the percentage of amino acid residues in a reference sequence that are identical (i.e., the same residue) to the starting amino acid residue after aligning the sequences and introducing gaps as needed to achieve the highest percentage of sequence identity.

[0071] In certain embodiments, the polypeptides of the invention comprise, consist of, or consist essentially of an amino acid sequence selected from Table 2 and functionally active variants thereof. In one embodiment, the polypeptide comprises an amino acid sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the amino acid sequence shown in Table 2. In one embodiment, the polypeptide comprises a contiguous amino acid sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the contiguous amino acid sequence shown in Table 2. In one embodiment, the polypeptide comprises an amino acid sequence having at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 200, 300, 400, or 500 (or any integer between these numbers) contiguous amino acids of the amino acid sequence shown in Table 2.

[0072] In one embodiment, the polypeptide of the present invention is encoded by a nucleotide sequence. The nucleotide sequences of the present invention can be used for a variety of purposes, including: cloning, gene therapy, protein expression and purification, introduction of mutations, DNA immunization of desired hosts, generation of antibodies for, e.g., passive immunization, PCR, generation of primers and probes, design and generation of siRNA (see, e.g., the Dharmacon siDesign website), and the like. In one embodiment, the nucleotide sequence of the present invention comprises, consists of, or consists essentially of a nucleotide sequence selected from Table 2. In one embodiment, the nucleotide sequence comprises a nucleotide sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleotide sequence shown in Table 2. In one embodiment, the nucleotide sequence comprises a continuous nucleotide sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the continuous nucleotide sequence shown in Table 2. In one embodiment, the nucleotide sequence comprises a nucleotide sequence having at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 200, 300, 400, or 500 (or any integer among these numbers) consecutive nucleotides of the nucleotide sequence shown in Table 2.

[0073] Preferred hybrid nuclease molecules of the present application comprise sequences from human immunoglobulin sequences (e.g., at least one Fc domain). However, the sequences can comprise one or more sequences from other mammalian species. For example, a primate Fc domain or nuclease domain can be included in the sequences. Alternatively, one or more murine amino acids can be present in the polypeptide. In certain embodiments, the polypeptide sequences of the present invention are non-immunogenic and / or have reduced immunogenicity.

[0074] One of ordinary skill in the art also knows that the hybrid nuclease molecules of the present invention can be altered such that their sequences are changed compared to the naturally occurring sequences or the native sequences from which they are derived, but still retain the desired activities of the native sequences. For example, nucleotide or amino acid substitutions can be made to effect conservative substitutions or changes at "non-essential" amino acid residues. One or more nucleotide substitutions, additions, or deletions can be introduced into the nucleotide sequence of an immunoglobulin such that one or more nucleotide substitutions, additions, or deletions are introduced into the encoded protein, thereby constructing an isolated nucleic acid molecule that encodes a non-natural variant of a hybrid nuclease molecule from an immunoglobulin (e.g., the Fc domain). Mutations can be introduced by standard techniques such as site-directed mutagenesis and PCR-mediated mutagenesis.

[0075] The peptide hybrid nuclease molecules of the present invention can contain conservative amino acid substitutions at one or more amino acid residues, for example, at essential or non-essential amino acid residues. "Conservative amino acid substitutions" refer to the replacement of an amino acid residue with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art and include basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine), and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Thus, preferably, non-essential amino acid residues of the binding polypeptide are replaced with other amino acid residues from the same side chain family. In another embodiment, a stretch of amino acids can be replaced with a stretch of amino acids that are structurally similar but differ in sequence and / or composition of side chain family members. Alternatively, in another embodiment, mutations can be randomly introduced into all or part of the coding sequence, such as by using saturation mutagenesis, and the resulting variants can be added to the binding polypeptides of the present invention and screened for their binding ability to the desired target.

[0076] The term "ameliorate" refers to any beneficial therapeutic outcome following treatment of a disease state, such as an autoimmune disease state (e.g., systemic lupus erythematosus), including prevention of the state, reduction in severity or retardation of progression, elimination, or cure.

[0077] The term "ex vivo" refers to the growth of living cells outside of a living organism, e.g., in tissue culture.

[0078] The term "in vivo" refers to processes that occur within a living organism.

[0079] As used herein, the terms "mammal" or "subject" or "patient" include human and non-human, and include, but are not limited to, humans, non-human primates, dogs, cats, mice, cows, horses, and pigs.

[0080] When the term "identical" percentage is used for two or more nucleic acid or polypeptide sequences, it refers to the specific percentage of identical nucleotide or amino acid residues when two or more sequences or subsequences are compared or aligned using one of the sequence comparison algorithms described below (e.g., BLASTP and BLASTN or other algorithms that can be used by those skilled in the art) or by visual inspection to achieve maximum identity. Depending on its application, the "identical" percentage can exist in the regions of the sequences being compared, such as functional domains, or in the full length of the two sequences being compared.

[0081] For sequence comparison, generally one sequence is used as a control sequence and compared with the sequence to be tested. When using a sequence comparison algorithm, the sequence to be tested and the control sequence are input into a computer, and if necessary, subsequence coordinates are specified, and the sequence algorithm program parameters are specified. Subsequently, the sequence comparison algorithm calculates the percentage of sequence identity of the sequence to be tested relative to the control sequence according to the specified program parameters.

[0082] Optimal alignment of sequences for comparison can be achieved by methods such as the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443 (1970), the similarity research method of Pearson & Lipman, Proc. Nat'l. Acad. Sci. USA 85:2444 (1988). The computer-executable forms of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.) can be used, or by visual inspection (usually referring to Ausubel et al. described above).

[0083] An example of an algorithm suitable for determining the percentage of sequence identity and sequence similarity is the BLAST algorithm, which has been described in Altschul et al., J. Mol. Biol. 215:403-410 (1990). Software for performing BLAST analysis can be obtained by the public on the website of the National Center for Biotechnology Information.

[0084] The term "sufficient amount" means an amount sufficient to produce the desired result, such as an amount sufficient to regulate intracellular protein aggregation.

[0085] The term "therapeutically effective amount" means an amount effective in ameliorating the symptoms of a disease. When prevention is considered as treatment, the therapeutically effective amount can be a "preventively effective amount".

[0086] It should be noted that, unless the context clearly dictates otherwise, the singular forms of "a", "an", and "the" as used in the specification and the appended claims include plural referents.

[0087] Composition

[0088] Hybrid nuclease molecule

[0089] In certain embodiments, the compositions of the invention include hybrid nuclease molecules. In certain embodiments, the hybrid nuclease molecules include a nuclease domain operably linked to an Fc domain. In certain embodiments, the hybrid nuclease molecules include a nuclease domain linked to an Fc domain. In certain embodiments, the hybrid nuclease molecules are nuclease proteins. In certain embodiments, the hybrid nuclease molecules are nuclease polynucleotides.

[0090] In certain embodiments, the nuclease domain is linked to the Fc domain via a linker domain. In certain embodiments, the linker domain is a linker peptide. In certain embodiments, the linker domain is a linker nucleotide. In certain embodiments, the hybrid nuclease molecules include a leader molecule, such as a leader peptide. In certain embodiments, the leader molecule is a leader peptide located at the N-terminus of the nuclease domain. In certain embodiments, the hybrid nuclease molecules will include a stop codon. In certain embodiments, the stop codon is located at the C-terminus of the Fc domain.

[0091] In certain embodiments, the hybrid nuclease molecules further include a second nuclease domain. In certain embodiments, the second nuclease domain is linked to the Fc domain via a second linker domain. In certain embodiments, the second linker domain is located at the C-terminus of the Fc domain. Figure 12 At least one embodiment of a hybrid nuclease molecule is shown. In certain embodiments, the hybrid nuclease molecule includes the sequence shown in Table 2.

[0092] In certain embodiments, the hybrid nuclease molecule is an RNase molecule or a DNase molecule or a multi-enzyme molecule (e.g., both RNase and DNase, or two RNA or DNA nucleases with different substrate specificities) linked to an Fc domain that specifically binds to an extracellular immune complex. In certain embodiments, the Fc domain does not bind effectively to Fcγ receptors. In one aspect, the hybrid nuclease molecule does not bind effectively to C1q. In other aspects, the hybrid nuclease molecule comprises an in-frame Fc domain from IgG1. In other aspects, the hybrid nuclease molecule further comprises mutations in the hinge, CH2, and / or CH3 domains. In other aspects, the mutations are P238S, P331S or N297S, and may include mutations in one or more of the three hinge cysteines. In certain such aspects, the mutations in one or more of the three hinge cysteines may be SCC or SSS. In other aspects, the molecule comprises an SCC hinge but otherwise has wild-type human IgG1 Fc CH2 and CH3 domains and binds effectively to Fc receptors, facilitating uptake of the hybrid nuclease molecule into endocytic vesicles of cells to which it binds. In other aspects, the molecule has activity against single-stranded and / or double-stranded RNA substrates.

[0093] In certain aspects, the activity of the hybrid nuclease molecule can be detected in vitro and / or in vivo. In certain aspects, the hybrid nuclease molecule binds to cells, malignant cells, or cancer cells and interferes with the biological activity of the cells.

[0094] In other aspects, provided is a multifunctional RNase molecule linked to another enzyme or antibody having binding specificity, such as an scFv targeting RNA, or a second nuclease domain having the same or different specificity as the first domain.

[0095] In another aspect, provided is a multifunctional DNase molecule linked to another enzyme or antibody having binding specificity, such as an scFv, the scFv targeting DNA, or targeting a second nuclease domain with the same or different specificity as the first domain.

[0096] In another aspect, the hybrid nuclease molecule is suitable for preventing or treating a disease or condition in a mammal by administering to a mammal in need thereof a therapeutically effective amount of the hybrid nuclease molecule linked to an Fc region to prevent or treat the disease. In other aspects, the disease or condition is an autoimmune disease or cancer. In certain such aspects, the autoimmune disease is insulin-dependent diabetes mellitus, multiple sclerosis, experimental autoimmune encephalomyelitis, rheumatoid arthritis, experimental autoimmune arthritis, myasthenia gravis, thyroiditis, experimental uveitis, Hashimoto's thyroiditis, primary myxedema, thyrotoxicosis, pernicious anemia, autoimmune atrophic gastritis, Addison's disease, premature menopause, male infertility, juvenile diabetes, Goodpasture's syndrome, pemphigus vulgaris, pemphigoid, sympathetic ophthalmia, phacoantigenic uveitis, autoimmune hemolytic anemia, idiopathic leukopenia, primary biliary cirrhosis, chronic active hepatitis Hbs-ve, cryptogenic cirrhosis, ulcerative colitis, Sjogren's syndrome, scleroderma, Wegener's granulomatosis, polymyositis, dermatomyositis, discoid lupus erythematosus, systemic lupus erythematosus or connective tissue disease.

[0097] In certain embodiments, the RNase enzyme activity target of the RNase hybrid nuclease molecule is mainly extracellular and consists of, for example, RNA in anti-RNP autoantibody immune complexes and RNA expressed on the cell surface during apoptosis. In certain embodiments, the RNase nuclease molecule is active in the acidic environment of endocytic vesicles. In certain embodiments, the RNase hybrid nuclease molecule comprises a wild-type (wt) Fc domain, thereby allowing, for example, the molecule to bind to FcR and enter endocytic vesicles via the entry pathway utilized by immune complexes. In certain embodiments, the RNase hybrid nuclease molecule comprising a wild-type Fc domain is engineered to be active both extracellularly and in the endocytic environment (where TLR7 can be expressed). In certain aspects, this enables the RNase nuclease molecule comprising a wild-type Fc domain to terminate TLR7 signal transduction via previously internalized immune complexes or RNA that activates TLR7 after viral infection. In certain embodiments, the wild-type RNase of the RNase hybrid nuclease molecule is not resistant to inhibition by RNase cytoplasmic inhibitors. In certain embodiments, the wild-type RNase of the RNase hybrid nuclease molecule is inactive in the cytoplasm of the cell.

[0098] In certain embodiments, the hybrid nuclease molecule comprising a wild-type Fc domain is used to treat autoimmune diseases, such as systemic lupus erythematosus.

[0099] In certain embodiments, the binding of the Fc domain to the Fc receptor (FcR) is increased, for example, by alterations in glycosylation and / or changes in the amino acid sequence. In certain embodiments, the hybrid nuclease molecule has one or more Fc alterations that result in increased FcR binding.

[0100] Alternative ways of constructing the connection between the hybrid nuclease molecule and the Fc domain are envisioned. In certain embodiments, the orientation of the domain can be altered to construct an Ig-RNase molecule or an Ig-DNase molecule or an RNase-Ig molecule or an RNase-Ig molecule that can still bind to the FcR and has an active nuclease domain.

[0101] In certain embodiments, the DNase hybrid nuclease molecule includes a wild-type Fc domain that allows the molecule to be endocytosed, for example, after binding to the FcR. In certain embodiments, the DNase hybrid nuclease molecule can act on extracellular immune complexes containing DNA, which can be in soluble form or precipitated as insoluble complexes.

[0102] In certain embodiments, the hybrid nuclease includes DNase and RNase. In certain embodiments, these hybrid nuclease molecules can improve the treatment of systemic lupus erythematosus because they can digest immune complexes containing RNA, DNA, or a combination of RNA and DNA, for example; and when they further include a wild-type Fc domain, they are active both extracellularly and in endocytic vesicles where TLR7 and TLR9 can localize.

[0103] In certain embodiments, the linker domain including the (gly4ser)3, 4, or 5 variant changes the length of the linker domain in 5-amino acid increments. In another embodiment, the length of the linker domain is approximately 18 amino acids and includes an N-linked glycosylation site that is sensitive to protease cleavage in vivo. In certain embodiments, the N-linked glycosylation site can protect the linker domain of the hybrid nuclease molecule from cleavage. In certain embodiments, the N-linked glycosylation site can assist in separating the folding of the independent functional domains that are separated by the linker domain.

[0104] In certain embodiments, the hybrid nuclease molecule may comprise a mutant and / or wild-type human IgG1 Fc domain. In certain embodiments, the hybrid nuclease molecule may be expressed by transient COS and stable CHO transfection. In certain embodiments, the CD80 / 86 binding ability and RNase activity are both retained in the hybrid nuclease molecule. In certain embodiments, the hybrid nuclease molecule comprises a DNase1L3-Ig-linker-RNase construct. In certain embodiments, the hybrid nuclease molecule comprises a DNase1-Ig-linker-RNase construct or an RNase-Ig-linker-DNase construct. In certain embodiments, the fusion junction between the enzyme domain and other domains of the hybrid nuclease molecule is optimized.

[0105] In certain embodiments, the hybrid nuclease molecule comprises a DNase-Ig hybrid nuclease molecule and / or a hybrid DNase-RNase hybrid nuclease molecule.

[0106] In certain embodiments, the hybrid nuclease molecule comprises TREX1. In certain embodiments, the TREX1 hybrid nuclease molecule can digest chromatin. In certain embodiments, the TREX1 hybrid nuclease molecule is expressed by cells. In certain embodiments, the expressed hybrid nuclease molecule comprises murine TREX-1 and a murine (wild or mutant) Fc domain. In certain embodiments, a linker domain of 20-25 amino acids (aa) between TREX1 and the IgG hinge is required for DNase activity. In certain embodiments, the hybrid nuclease molecule with a linker domain of 15 amino acids is inactive. In certain embodiments, chromatin digestion assays show that functional activity can be obtained using linker domains of 20 and 25 amino acids (plus two or more amino acids to introduce restriction sites). In certain embodiments, a hydrophobic region of approximately 72 amino acids can be removed from the COOH terminus of TREX-1 and then fused to the Fc domain via a linker domain. In certain embodiments, the hybrid nuclease molecule with a linker domain of 20 amino acids shows a higher expression level compared to controls and / or other hybrid nuclease molecules. In certain embodiments, the enzyme activity of the hybrid nuclease molecule is quantitatively compared with that of a control using a kinetic enzyme assay.

[0107] In certain embodiments, the fusion junction for TREX1 enzyme truncation can be selected for further optimization to improve the expression of the hybrid nuclease molecule.

[0108] In certain embodiments, the hybrid nuclease molecule comprises a human TREX1-linker-Ig Fc domain hybrid nuclease molecule with a 20- and / or 25-amino acid linker domain. In certain embodiments, the linker domain is a variant of the (gly4ser)4 or (gly4ser)5 expression cassette, which is linked with one or more restriction sites for introduction into the hybrid nuclease molecule construct. In certain embodiments, head-to-tail dimerization is useful for the enzymatic activity of TREX1; thus, a flexible, longer linker domain can be used to facilitate proper folding.

[0109] In certain embodiments, the hybrid nuclease molecule is a TREX1-tandem hybrid nuclease molecule. In certain embodiments, another way to promote the head-to-tail folding of TREX1 is to generate a hybrid nuclease molecule of TREX1-TREX1-Ig hybridization, where two tandem TREX1 domains are added, followed by a linker domain and an Ig Fc domain. In certain embodiments, the head-to-tail connection orientation of the TREX1 expression cassette can be modified to the head-to-tail folding mode on each arm of the immunoenzyme, and a single functional TREX1 domain is introduced on each arm of the molecule. In certain embodiments, each immunoenzyme of the hybrid nuclease molecule has two functional TREX1 enzymes, which are linked to a single IgG Fc domain.

[0110] In certain embodiments, the hybrid nuclease molecule comprises TREX1-linker1-Ig-linker2-RNase.

[0111] In certain embodiments, the hybrid nuclease molecule comprises RNase-Ig-linker-TREX1. In certain embodiments, when the enzyme is in the reverse configuration, expression cassettes for its amino fusion and carboxyl fusion are generated for introduction into the hybrid nuclease molecule. In certain embodiments, regardless of the position of RNase in the hybrid nuclease molecule, it exhibits considerable functional activity. In certain embodiments, alternative hybrid nuclease molecules can be designed to detect the presence of a specific configuration to improve the expression and / or function of the hybrid nuclease molecule components.

[0112] In certain embodiments, the hybrid nuclease molecule comprises 1L3-Ig. In certain embodiments, the 1L3 DNase is constructed and expressed from a murine sequence. In certain embodiments, the enzyme is active. In certain embodiments, a murine 1L3 DNase-Ig-RNase hybrid nuclease is constructed and expressed. In certain embodiments, the molecule comprises human 1L3-Ig, human 1L3-Ig-RNase, and / or human RNase-Ig-1L3.

[0113] In certain embodiments, the hybrid nuclease molecule comprises DNase1-Ig. In certain embodiments, the naturally occurring variant allele A114F is included in the DNase1-Ig hybrid nuclease molecule, and the A114F has reduced sensitivity to actin. In certain embodiments, this mutation is introduced into the hybrid nuclease molecule to produce a more stable human DNase1 derivative. In certain embodiments, a DNase1-linker-Ig comprising a linker domain of 20 or 25 amino acids is prepared. In certain embodiments, the hybrid nuclease molecule comprises RNase-Ig-linker-DNase1, wherein the DNase1 domain is on the COOH side of the Ig Fc domain. In certain embodiments, a hybrid nuclease molecule incorporating DNase1 is prepared, and the molecule comprises: DNase1-linker-Ig-linker2-RNase and / or RNase-Ig-linker-DNase1.

[0114] Another aspect of the present invention is to use one or more hybrid nuclease molecules to treat or prevent conditions, diseases, and states by gene therapy. The gene therapy method involves introducing the nucleic acid (DNA, RNA, and antisense DNA or RNA) sequence of the hybrid nuclease molecule into an animal to express one or more polypeptides of the present invention. The method may include introducing one or more polynucleotides encoding the polypeptide of the hybrid nuclease molecule of the present invention that are operably linked to a promoter and genetic elements necessary for the expression of the polypeptide in the target tissue.

[0115] In gene therapy applications, the hybrid nuclease molecule gene is introduced into cells to achieve the in vivo synthesis of a therapeutically effective gene product. "Gene therapy" includes both conventional gene therapies, namely, a single treatment that is effective for a long time, and the administration of gene therapy agents, which includes the administration of therapeutically effective DNA or mRNA one or more times. Oligonucleotides can be modified to enhance their uptake, for example, by replacing the negatively charged phosphodiester groups with uncharged groups.

[0116] Fc domain

[0117] In some embodiments, hybrid nucleic acid enzyme molecule comprises Fc structural domain.Can obtain the Fc structural domain that is used to produce hybrid nucleic acid enzyme molecule of the present invention from multiple different sources.In a preferred embodiment, the Fc structural domain of hybrid nucleic acid enzyme molecule is from human immunoglobulin.But, it is appreciated that the Fc structural domain can be from the immunoglobulin of other mammal species, comprises for example, rodent (for example mouse, rat, rabbit, guinea pig) or non-human primate (for example, chimpanzee, macaque) species.And the Fc structural domain of hybrid nucleic acid enzyme molecule or its part can come from any immunoglobulin kind, comprises IgM, IgG, IgD, IgA and IgE, and any immunoglobulin subtype, comprises IgG1, IgG2, IgG3 and IgG4.In a preferred embodiment, use human IgG1 subtype.

[0118] Various Fc domain gene sequences (e.g., human constant region sequences) can be obtained in a form that is easily accessible to the public. The constant region domain comprises an Fc domain sequence, and a constant region domain having a specific effector function (or lacking a specific effector function) or with a specific modification can be selected to reduce immunogenicity. The sequences of many antibodies and antibody encoding genes have been disclosed, and suitable Fc domain sequences (e.g., hinge, CH2 and / or CH3 sequences, or portions thereof) can be selected from these sequences using techniques known in the art. Subsequently, the genetic material obtained using any of the aforementioned methods can be transformed or synthesized to obtain the polypeptide of the present invention. The scope of the present invention will be further understood to include alleles, variants and mutations of constant region DNA sequences.

[0119] The Fc domain sequence can be cloned, for example, using polymerase chain reaction and primers, and the primers selected can be used to amplify the target domain. To clone the Fc domain sequence from an antibody, mRNA can be isolated from a hybridoma, spleen, or lymphocyte, reverse transcribed into DNA, and the antibody gene amplified using PCR. For a detailed description of PCR amplification methods, see U.S. Patent Nos. 4,683,195; 4,683,202; 4,800,159; 4,965,188; and, for example, "PCR Protocols: A Guide to Methods and Applications" Innis et al., eds., Academic Press, San Diego, Calif. (1990); Ho et al. 1989. Gene 77:51; Horton et al. 1993. Methods Enzymol. 217:270. PCR can be initiated with universal constant region primers or more specific primers based on published heavy and light chain DNA and amino acid sequences. As discussed above, PCR can also be used to isolate DNA clones encoding antibody light and heavy chains. In this case, universal primers or larger homologous probes such as mouse constant region probes can be used to screen libraries. Many primer sets suitable for antibody gene amplification are well known in the art (e.g., 5' primers based on the N-terminal sequence of a purified antibody (Benhar and Pastan. 1994. Protein Engineering 7:1509); rapid amplification of cDNA ends (Ruberti, F. et al. 1994. J. Immunol. Methods 173:33); antibody leader sequences (Larrick et al. 1989 Biochem. Biophys. Res. Commun. 160:1250)). For further description of antibody sequence cloning, see Newman et al., U.S. Patent No. 5,658,570, filed Jan. 25, 1995, which is incorporated herein by reference.

[0120] The hybrid nuclease molecules of the present invention can comprise one or more Fc domains (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10 or more Fc domains). In one embodiment, the Fc domains can be of different types. In one embodiment, at least one Fc domain in the hybrid nuclease molecule comprises a hinge domain or a portion thereof. In another embodiment, the hybrid nuclease molecule of the present invention comprises at least one Fc domain, which comprises at least one CH2 domain or a portion thereof. In another embodiment, the hybrid nuclease molecule of the present invention comprises at least one Fc domain, which comprises at least one CH3 domain or a portion thereof. In another embodiment, the hybrid nuclease molecule of the present invention comprises at least one Fc domain, which comprises at least one CH4 domain or a portion thereof. In another embodiment, the hybrid nuclease molecule of the present invention comprises at least one Fc domain, which comprises at least one hinge domain or a portion thereof and at least one CH2 domain or a portion thereof (e.g., in the hinge-CH2 orientation). In another embodiment, the hybrid nuclease molecule of the present invention comprises at least one Fc domain, which comprises at least one CH2 domain or a portion thereof and at least one CH3 domain or a portion thereof (e.g., in the CH2-CH3 orientation). In another embodiment, the hybrid nuclease molecule of the present invention comprises at least one Fc domain, which comprises at least one hinge domain or a portion thereof, at least one CH2 domain or a portion thereof, and at least one CH3 domain or a portion thereof, for example, in the following orientations: hinge-CH2-CH3, hinge-CH3-CH2, or CH2-CH3-hinge.

[0121] In certain embodiments, the hybrid nuclease molecule comprises at least one intact Fc region from one or more immunoglobulin heavy chains (e.g., the Fc domain comprises the hinge, CH2, and CH3 domains, but they do not all need to be from the same antibody). In other embodiments, the hybrid nuclease molecule comprises at least two intact Fc regions from one or more immunoglobulin heavy chains. In a preferred embodiment, the intact Fc domain is from a human IgG immunoglobulin heavy chain (e.g., human IgG1).

[0122] In another embodiment, the hybrid nuclease molecule of the present invention comprises at least one Fc domain, said Fc domain comprising a complete CH3 domain. In another embodiment, the hybrid nuclease molecule of the present invention comprises at least one Fc domain, said Fc domain comprising a complete CH2 domain. In another embodiment, the hybrid nuclease molecule of the present invention comprises at least one Fc domain, said Fc domain comprising at least one CH3 domain, at least one hinge region and a CH2 domain. In one embodiment, the hybrid nuclease molecule of the present invention comprises at least one Fc domain, said Fc domain comprising a hinge and a CH3 domain. In another embodiment, the hybrid nuclease molecule of the present invention comprises at least one Fc domain, said Fc domain comprising a hinge, a CH2 and a CH3 domain. In a preferred embodiment, the Fc domain is derived from the heavy chain of human IgG immunoglobulin (e.g., human IgG1).

[0123] The constant region domain or a portion thereof that constitutes the Fc domain of the hybrid nuclease molecule of the present invention may be derived from different immunoglobulin molecules. For example, the polypeptide of the present invention may comprise a CH2 domain or a portion thereof from an IgG1 molecule and a CH3 region or a portion thereof from an IgG3 molecule. In another example, the hybrid nuclease molecule may comprise an Fc domain, said Fc domain comprising a hinge domain that is partially from an IgG1 molecule and partially from an IgG3 molecule. As described in the present application, those of ordinary skill in the art will understand that the Fc domain can be modified such that its amino acid sequence is different from that in a naturally occurring antibody molecule.

[0124] In another embodiment, the hybrid nuclease molecule of the present invention comprises one or more truncated Fc domains, but still sufficient to confer the property of binding to the Fc receptor (FcR) on the Fc region. Thus, the Fc domain of the hybrid nuclease molecule of the present invention may comprise an FcRn-binding portion or consist of an FcRn-binding portion. The FcRn-binding portion may be derived from the heavy chain of any isotype, including IgG1, IgG2, IgG3, and IgG4. In one embodiment, the FcRn-binding portion of a human isotype IgG1 antibody is used. In another embodiment, the FcRn-binding portion of a human isotype IgG4 antibody is used.

[0125] In one embodiment, the hybrid nuclease molecule of the present invention lacks one or more constant domain structures of the complete Fc region, i.e., part or all of it is deleted. In certain embodiments, the hybrid nuclease molecule of the present invention will lack the entire CH2 domain (ΔCH2 construct). Those skilled in the art will understand that such constructs may be preferred because the CH2 domain can regulate the catabolic rate of the antibody. In certain embodiments, the hybrid nuclease molecule of the present invention comprises an Fc region with the CH2 domain deleted, and the Fc domain is derived from a vector (e.g., from IDEC Pharmaceuticals, San Diego) encoding the IgG1 human constant domain (see, for example, WO 02 / 060955A2 and WO02 / 096948A2). This exemplary vector was modified to delete the CH2 domain and provide a synthetic vector that expresses the domain-deleted IgG1 constant region. It is noted that these exemplary constructs are preferably modified to directly fuse the bound CH3 domain to the hinge region of the respective Fc domain.

[0126] In other constructs, it may be necessary to provide a peptide spacer between one or more Fc domain components. For example, the peptide spacer can be located between the hinge region and the CH2 domain, and / or between the CH2 and CH3 domains. For example, a compatible construct can be expressed in which the CH2 domain is deleted and the remaining CH3 domain (synthetic or non-synthetic) is linked to the hinge region with a 1-20, 1-10, or 1-5 amino acid peptide spacer. Introducing such a peptide spacer can, for example, ensure that the regulatory elements of the constant domain remain free and accessible, or ensure that the hinge region remains flexible. Preferably, any linker peptide compatible with the present invention will be relatively non-immunogenic and will not hinder the proper folding of the Fc.

[0127] Alteration of Fc amino acids

[0128] In certain embodiments, the Fc domain used in the hybrid nuclease molecule of the present invention is altered, for example, by amino acid mutations (e.g., addition, deletion, or substitution). As used in this application, the term "Fc domain variant" refers to an Fc domain having at least one amino acid substitution compared to the wild-type Fc from which the Fc domain is derived. For example, the Fc domain in the variant is from a human IgG1 antibody and contains at least one amino acid mutation (e.g., substitution) compared to the wild-type amino acid at the corresponding position in the human IgG1 Fc region.

[0129] The amino acid substitution of the Fc variant can be located at a site within the Fc domain, and the reference number of this site corresponds to the number assigned to the residue in the Fc region of the antibody.

[0130] In one embodiment, the Fc variant comprises substitutions at amino acid positions located in the hinge domain or a portion thereof. In another embodiment, the Fc variant comprises substitutions at amino acid positions located in the CH2 domain or a portion thereof. In another embodiment, the Fc variant comprises substitutions at amino acid positions located in the CH3 domain or a portion thereof. In another embodiment, the Fc variant comprises substitutions at amino acid positions located in the CH4 domain or a portion thereof.

[0131] In certain embodiments, the hybrid nuclease molecule of the invention comprises an Fc variant that includes more than one amino acid substitution. The hybrid nuclease molecule of the invention can comprise, for example, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more amino acid substitutions. Preferably, there is a spatial separation of at least 1 amino acid position or more between each amino acid substitution, for example, at least 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acid positions or more. More preferably, there is a spatial separation of at least 5, 10, 15, 20 or 25 amino acid positions or more between the modified amino acids.

[0132] In certain embodiments, due to having an Fc domain comprising the wild-type Fc domain, the Fc variant can improve at least one effector function (e.g., the binding ability of the Fc domain to an Fc receptor (e.g., FcγRI, FcγRII or FcγRIII) or a complement protein (e.g., C1q) is increased, or antibody-dependent cell-mediated cytotoxicity (ADCC), phagocytosis or complement-dependent cytotoxicity (CDCC) is triggered). In other embodiments, the Fc variant provides a modified cysteine residue.

[0133] The hybrid nuclease molecules of the present invention may incorporate Fc variants recognized in the art, which are known to be capable of improving effector function and / or FcR binding. In particular, the hybrid nuclease molecules of the present invention may include, for example, alterations (e.g., substitutions) at one or more amino acid positions, see International PCT Publication Nos. WO88 / 07089A1, WO96 / 14339A1, WO98 / 05787A1, WO98 / 23289A1, WO99 / 51642A1, WO99 / 58572A1, WO00 / 09560A2, WO00 / 32767A1, WO00 / 42072A2, WO02 / 44215A2, WO02 / 060919A2, WO03 / 074569A2, WO04 / 016750A2, WO04 / 029207A2, WO04 / 035752A2, WO04 / 063351A2, WO04 / 074455A2, WO04 / 099249A2, WO05 / 040217A2, WO04 / 044859, WO05 / 070963A1, WO05 / 077981A2, WO05 / 092925A2, WO05 / 123780A2, WO06 / 019447A1, WO06 / 047350A2, and WO06 / 085967A2; U.S. Patent Publication Nos. US2007 / 0231329, US2007 / 0231329, US2007 / 0237765, US2007 / 0237766, US2007 / 0237767, US2007 / 0243188, US20070248603, US20070286859, US20080057056; or U.S. Patent Nos. 5,648,260; 5,739,277; 5,834,250; 5,869,046; 6,096,871; 6,121,022; 6,194,551; 6,242,195; 6,277,375; 6,528,624; 6,538,124; 6,737,056; 6,821,505; 6,998,253; 7,083,784; and 7,317,091, all of which are incorporated herein by reference. In one embodiment, specific alterations (e.g., specific substitutions at one or more amino acid positions disclosed in the art) may be made at one or more of the disclosed amino acid positions. In another embodiment, different alterations (e.g., different substitutions at one or more amino acid positions disclosed in the art) may be made at one or more of the disclosed amino acid positions.

[0134] In certain embodiments, the hybrid nuclease molecules of the invention comprise amino acid substitutions in the Fc domain that alter antigen-independent antibody effector functions, particularly the circulating half-life of the antibody. Compared to hybrid nuclease molecules lacking such substitutions, the hybrid nuclease molecules of the invention exhibit increased or decreased binding to FcRn and thus have an extended or shortened serum half-life, respectively. Fc variants with improved affinity for FcRn are expected to have a longer serum half-life, and such molecules can be used in the treatment of mammals that require administration of polypeptides with a longer half-life, such as for treating chronic diseases or conditions. Conversely, Fc variants with reduced FcRn binding affinity may have a shorter half-life, and such molecules are also useful, for example, in administering to a mammal where a shortened circulation time may be beneficial to the mammal, such as for in vivo diagnostic imaging or in cases where the initial polypeptide has toxic side effects when present in the circulation for an extended period. Fc variants with reduced FcRn binding affinity are also less likely to cross the placenta, and thus, such Fc variants can also be used to treat diseases or conditions in pregnant women. In addition, other applications that require reduced FcRn binding affinity include applications that require targeting to the brain, kidney, and / or liver. In one exemplary embodiment, the hybrid nuclease molecules of the invention exhibit a reduced amount of transport from the vasculature to glomerular epithelial cells. In another embodiment, the hybrid nuclease molecules of the invention exhibit a reduced amount of transport from the brain across the blood-brain barrier (BBB) into the vascular compartment. In one embodiment, the hybrid nuclease molecules with altered FcRn binding comprise at least one Fc domain (e.g., one or two Fc domains), and the hybrid nuclease molecules have one or more amino acid substitutions within the "FcRn binding loop" of the Fc domain. Exemplary amino acid substitutions that can alter FcRn binding activity are disclosed in International PCT Publication No. WO05 / 047327, which is incorporated herein by reference.

[0135] In other embodiments, the hybrid nuclease molecules of the invention comprise an Fc variant that contains amino acid substitutions that alter the polypeptide's antigen-dependent effector functions, particularly antigen-dependent cell-mediated cytotoxicity or complement activation, e.g., as compared to the wild-type Fc region. In one exemplary embodiment, the hybrid nuclease molecule exhibits an altered binding to an Fcγ receptor (e.g., CD16). Such hybrid nuclease molecules, as compared to wild-type polypeptides, exhibit increased or decreased binding to FcRγ and thus mediate enhanced or diminished effector functions, respectively. Fc variants with improved affinity for FcγR are expected to enhance effector functions and such molecules can be used in therapeutic methods that require the disruption of mammalian target molecules. In contrast, Fc variants with reduced binding affinity for FcRγ are expected to reduce effector functions and such molecules are also useful, e.g., for treating diseases where undesired target cell destruction is not desired, such as where normal cells may express the target molecule, or where long-term administration of the polypeptide may result in harmful immune system activation. In one embodiment, a polypeptide comprising an Fc exhibits at least one alteration in antigen-dependent effector function as compared to a polypeptide comprising a wild-type Fc region, the alteration being selected from opsonization, phagocytosis, complement-dependent cytotoxicity, antigen-dependent cell-mediated cytotoxicity (ADCC), or effector cell modulation.

[0136] In one embodiment, the hybrid nuclease molecule exhibits an altered binding to an activated Fcγ receptor (e.g., FcγI, FcγIIa, or FcγRIIIa). In another embodiment, the hybrid nuclease molecule exhibits an altered binding affinity for an inhibitory Fcγ receptor (e.g., FcγRIIb). Exemplary amino acid substitutions that can alter FcR or complement binding activities are disclosed in International PCT Publication No. WO05 / 063815, which is incorporated herein by reference.

[0137] The hybrid nuclease molecules of the invention can also comprise amino acid substitutions that alter the glycosylation of the hybrid nuclease molecule. For example, the Fc domain of the hybrid nuclease molecule can comprise a mutant Fc domain that has mutations that result in reduced glycosylation (e.g., N- or O-linked glycosylation); or can comprise a wild-type Fc domain with an altered glycoform (e.g., a low-fucose or fucose-free glycan). In another embodiment, the hybrid nuclease molecule has an amino acid substitution near or within a glycosylation motif, e.g., an N-linked glycosylation motif containing the amino acid sequence NXT or NXS. Exemplary amino acid substitutions that reduce or alter glycosylation are disclosed in International PCT Publication No. WO05 / 018572 and U.S. Patent Publication No. 2007 / 0111281, which are incorporated herein by reference.

[0138] In other embodiments, the hybrid nuclease molecule of the invention comprises at least one Fc domain having a modified cysteine residue or analogue thereof located on the solvent-exposed surface. Preferably, the modified cysteine residue or analogue thereof does not interfere with the effector functions conferred by the Fc. More preferably, the modification does not interfere with the ability of the Fc to bind to Fc receptors (e.g., FcγRI, FcγRII, or FcγRIII) or complement proteins (e.g., C1q), nor does it interfere with the ability of the Fc to trigger immune effector functions (e.g., antibody-dependent cell-mediated cytotoxicity (ADCC), phagocytosis, or complement-dependent cytotoxicity (CDCC)). In a preferred embodiment, the hybrid nuclease molecule of the invention comprises an Fc domain containing at least one modified free cysteine residue or analogue thereof that does not substantially form a disulfide bond with a second cysteine residue. Any of the modified cysteine residues or analogues described above can be conjugated to a functional domain (e.g., conjugated to a thiol-reactive heterobifunctional linker) using techniques recognized in the art.

[0139] In one embodiment, the hybrid nuclease molecule of the invention can comprise a genetically fused Fc domain having two or more Fc domain moieties independently selected from the Fc domains described herein. In one embodiment, the Fc domains are identical. In another embodiment, at least two Fc domains are different. For example, the Fc domains of the hybrid nuclease molecule of the invention contain the same number of amino acid residues or differ in length by one or more different numbers of amino acid residues (e.g., about 5 amino acid residues (e.g., 1, 2, 3, 4, or 5 amino acid residues), about 10 residues, about 15 residues, about 20 residues, about 30 residues, about 40 residues, or about 50 residues). In yet another embodiment, the sequences of the Fc domains of the hybrid nuclease molecule of the invention can differ at one or more amino acid positions. For example, at least two Fc domains can differ at about 5 amino acid positions (e.g., 1, 2, 3, 4, or 5 amino acid positions), about 10 positions, about 15 positions, about 20 positions, about 30 positions, about 40 positions, or about 50 positions.

[0140] Linker domain

[0141] In certain embodiments, the hybrid nuclease molecule includes a linker domain. In certain embodiments, the hybrid nuclease molecule includes multiple linker domains. In certain embodiments, the linker domain is a polypeptide linker. In certain aspects, a polypeptide linker is preferably used to fuse one or more Fc domains with one or more nuclease domains to form a hybrid nuclease molecule.

[0142] In one embodiment, the polypeptide linker is synthetic. As used herein, the term "synthetic" polypeptide linker includes a peptide (or polypeptide) containing an amino acid sequence (which may or may not be a naturally occurring sequence) whose linear amino acid sequence is linked to a sequence that is not naturally linked to it in nature (which may or may not be a naturally occurring sequence) (e.g., an Fc domain sequence). For example, the polypeptide linker may comprise a non-naturally occurring polypeptide that is a modified form of a naturally occurring polypeptide (e.g., containing a mutation such as an addition, substitution, or deletion), or comprise a first amino acid sequence (which may or may not be a naturally occurring sequence). The polypeptide linker of the present invention can be used, for example, to ensure that the Fc domains are juxtaposed and to ensure proper folding and formation of a functional Fc domain. Preferably, the polypeptide linker compatible with the present invention will be relatively non-immunogenic and will not inhibit any non-covalent binding in the monomeric subunits of the binding protein.

[0143] In certain embodiments, the hybrid nuclease molecules of the present invention use a polypeptide linker to in-frame link any two or more domains in a single polypeptide chain. In one embodiment, the two or more domains can be independently selected from any of the Fc domains or nuclease domains discussed herein. For example, in certain embodiments, the polypeptide linker can be used to fuse identical Fc domains to form a homotypic Fc region. In other embodiments, the polypeptide linker can be used to fuse different Fc domains (e.g., a wild-type Fc domain and an Fc domain variant) to form a heterotypic Fc region. In other embodiments, the polypeptide linker of the present invention can be used to genetically fuse the C-terminus of a first Fc domain (e.g., a hinge domain or a portion thereof, a CH2 domain or a portion thereof, a complete CH3 domain or a portion thereof, an FcRn-binding portion, an FcγR-binding portion, a complement-binding portion or a portion thereof) to the N-terminus of a second Fc domain (e.g., a complete Fc domain).

[0144] In one embodiment, the polypeptide linker comprises a portion of the Fc domain. For example, in one embodiment, the polypeptide linker may comprise the immunoglobulin hinge domain of IgG1, IgG2, IgG3, and / or IgG4 antibodies. In another embodiment, the polypeptide linker may comprise the CH2 domain of IgG1, IgG2, IgG3, and / or IgG4 antibodies. In other embodiments, the polypeptide linker may comprise the CH3 domain of IgG1, IgG2, IgG3, and / or IgG4 antibodies. Other portions of immunoglobulins (e.g., human immunoglobulins) may also be used. For example, the polypeptide linker may comprise the CH1 domain or a portion thereof, the CL domain or a portion thereof, the VH domain or a portion thereof, or the VL domain or a portion thereof. The portion may be from any immunoglobulin, including, for example, IgG1, IgG2, IgG3, and / or IgG4 antibodies.

[0145] In an exemplary embodiment, the polypeptide linker may comprise at least a portion of the immunoglobulin hinge region. In one embodiment, the polypeptide linker comprises an upstream hinge domain (e.g., an IgG1, IgG2, IgG3, or IgG4 upstream hinge domain). In another embodiment, the polypeptide linker comprises a midstream hinge domain (e.g., an IgG1, IgG2, IgG3, or IgG4 midstream hinge domain). In another embodiment, the polypeptide linker comprises a downstream hinge domain (e.g., an IgG1, IgG2, IgG3, or IgG4 downstream hinge domain).

[0146] In other embodiments, a polypeptide linker can be constructed by combining hinge elements from the same or different antibody isotypes. In one embodiment, the polypeptide linker comprises a chimeric hinge comprising at least a portion of an IgG1 hinge region and at least a portion of an IgG2 hinge region. In one embodiment, the polypeptide linker comprises a chimeric hinge comprising at least a portion of an IgG1 hinge region and at least a portion of an IgG3 hinge region. In another embodiment, the polypeptide linker comprises a chimeric hinge comprising at least a portion of an IgG1 hinge region and at least a portion of an IgG4 hinge region. In one embodiment, the polypeptide linker comprises a chimeric hinge comprising at least a portion of an IgG2 hinge region and at least a portion of an IgG3 hinge region. In one embodiment, the polypeptide linker comprises a chimeric hinge comprising at least a portion of an IgG2 hinge region and at least a portion of an IgG4 hinge region. In one embodiment, the polypeptide linker comprises a chimeric hinge comprising at least a portion of an IgG1 hinge region, at least a portion of an IgG2 hinge region, and at least a portion of an IgG4 hinge region. In another embodiment, the polypeptide linker can comprise an IgG1 upstream hinge and midstream hinge and a single IgG3 midstream hinge repeat motif. In another embodiment, the polypeptide linker can comprise an IgG4 upstream hinge, an IgG1 midstream hinge, and an IgG2 downstream hinge.

[0147] In another embodiment, the polypeptide linker comprises or consists of a gly-ser linker. As used herein, the term "gly-ser linker" refers to a peptide composed of glycine and serine residues. An exemplary gly / ser linker comprises an amino acid sequence represented by the formula (Gly4Ser)n, where n is a positive integer (e.g., 1, 2, 3, 4, or 5). A preferred gly / ser linker is (Gly4Ser)4. Another preferred gly / ser linker is (Gly4Ser)3. Another preferred gly / ser linker is (Gly4Ser)5. In certain embodiments, the gly-ser linker can be inserted between two other sequences of a polypeptide linker (e.g., any polypeptide linker sequence described herein). In other embodiments, the gly-ser linker is appended to one or both ends of another polypeptide linker sequence (e.g., any polypeptide linker sequence described herein). In other embodiments, two or more gly-ser linkers are inserted continuously into the polypeptide linker. In one embodiment, a polypeptide linker of the present invention comprises at least a portion of an upstream hinge region (e.g., from an IgG1, IgG2, IgG3, or IgG4 molecule), at least a portion of a midstream hinge region (e.g., from an IgG1, IgG2, IgG3, or IgG4 molecule), and a series of gly / ser amino acid residues (e.g., a gly / ser linker such as (Gly4Ser)n).

[0148] In one embodiment, the polypeptide linker of the present invention comprises a non-naturally occurring immunoglobulin hinge domain, e.g., a hinge domain that is not naturally present in a polypeptide, the polypeptide comprising a hinge domain and / or an altered hinge domain such that its amino acid sequence is different from a naturally occurring immunoglobulin hinge domain. In one embodiment, mutations can occur in the hinge domain to prepare the polypeptide linker of the present invention. In one embodiment, the polypeptide linker of the present invention comprises a hinge domain that does not contain the naturally occurring number of cysteines, i.e., the polypeptide linker contains fewer or more cysteines than the naturally occurring hinge molecule.

[0149] In other embodiments, the polypeptide linker of the present invention comprises a biologically relevant peptide sequence or a partial sequence thereof. For example, the biologically relevant peptide sequence can include, but is not limited to, sequences from anti-rejection or anti-inflammatory peptides. The anti-rejection or anti-inflammatory peptides can be selected from cytokine inhibitory peptides, cell adhesion inhibitory peptides, thrombin inhibitory peptides, and platelet inhibitory peptides. In a preferred embodiment, the peptide sequence comprised by the polypeptide linker is selected from IL-1 inhibitory or antagonistic peptide sequences, erythropoietin (EPO)-mimetic peptide sequences, thrombopoietin (TPO)-mimetic peptide sequences, granulocyte colony-stimulating factor (G-CSF) mimetic peptide sequences, tumor necrosis factor (TNF) antagonist peptide sequences, integrin-binding peptide sequences, selectin antagonist peptide sequences, anti-pathogenic peptide sequences, vasoactive intestinal peptide (VIP) mimetic peptide sequences, calmodulin antagonist peptide sequences, mast cell antagonists, SH3 antagonist peptide sequences, urokinase receptor (UKR) antagonist peptide sequences, somatostatin or cortisol stabilizing protein mimetic peptide sequences, and macrophage and / or T-cell inhibitory peptide sequences. Exemplary peptide sequences have been disclosed in U.S. Patent No. 6,660,843, the disclosure of which is incorporated herein by reference, and any one of the exemplary peptide sequences can be introduced as the polypeptide linker.

[0150] It will be appreciated that variant forms of these exemplary polypeptide linkers can be constructed by substituting, adding, or deleting one or more nucleotides in the nucleotide sequence encoding the polypeptide linker, such that one or more amino acid substitutions, additions, or deletions are introduced into the polypeptide linker. For example, mutations can be introduced by standard techniques such as site-directed mutagenesis and PCR-mediated mutagenesis.

[0151] The polypeptide linker of the present invention is at least one amino acid in length and its length can vary. In one embodiment, the length of the polypeptide linker of the present invention is about 1 to about 50 amino acids. As used in this application, the term "about" means + / - two amino acid residues. Since the linker length must be a positive integer, a length of about 1 to about 50 amino acids refers to a length of 1 to 48 - 52 amino acids. In another embodiment, the length of the polypeptide linker of the present invention is about 10 - 20 amino acids. In another embodiment, the length of the polypeptide linker of the present invention is about 15 to about 50 amino acids.

[0152] In another embodiment, the length of the polypeptide linker of the present invention is from about 20 to about 45 amino acids. In another embodiment, the length of the polypeptide linker of the present invention is from about 15 to about 25 amino acids. In another embodiment, the length of the polypeptide linker of the present invention is about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60 or more amino acids.

[0153] Polypeptide linkers can be introduced into polypeptide sequences using techniques well known in the art. The modifications can be confirmed by DNA sequence analysis. Plasmid DNA can be used to transform host cells for stable production of the resulting polypeptide.

[0154] Nuclease domain

[0155] In certain aspects, the hybrid nuclease molecule comprises a nuclease domain. Accordingly, the hybrid nuclease molecules of the present invention generally comprise at least one nuclease domain and at least one linked Fc domain. In certain aspects, the hybrid nuclease molecule comprises multiple nuclease domains.

[0156] In certain embodiments, the nuclease domain is DNase. In certain embodiments, the DNase is a type I secreted DNase. In certain embodiments, the DNase is DNase 1 and / or DNase 1-like (DNaseL) enzyme 1-3. In certain embodiments, the DNase is TREX1.

[0157] In certain embodiments, the nuclease domain is RNase. In certain embodiments, the RNase is an extracellular or secreted RNase in the RNase A superfamily, such as RNase A.

[0158] In one embodiment, the nuclease domain is effectively linked to the N-terminus of the Fc domain (e.g., by chemical conjugation or gene fusion (e.g., direct linkage or via a polypeptide linker)). In another embodiment, the nuclease domain is effectively linked to the C-terminus of the Fc domain (e.g., by chemical conjugation or gene fusion (e.g., direct linkage or via a polypeptide linker)). In other embodiments, the nuclease domain is effectively linked to the Fc domain via an amino acid side chain (e.g., by chemical conjugation or gene fusion (e.g., direct linkage or via a polypeptide linker)). In certain exemplary embodiments, the nuclease domain is fused to the Fc domain via a human immunoglobulin hinge domain or a portion thereof.

[0159] In certain embodiments, the hybrid nuclease molecules of the present invention comprise two or more nuclease domains and at least one Fc domain. For example, the nuclease domains can be effectively linked to the N-terminus and C-terminus of the Fc domain. In other exemplary embodiments, the nuclease domains can be effectively linked to the N-terminus and C-terminus of multiple Fc domains (e.g., two, three, four, five or more Fc domains), and the Fc domains are A series of linked together in the form of a tandem array of Fc domains.

[0160] In other embodiments, two or more nuclease domains are linked to each other (e.g., via a polypeptide linker) and are effectively linked (e.g., by chemical conjugation or gene fusion (e.g., direct linkage or via a polypeptide linker)) to the C-terminus or N-terminus of an Fc domain or a tandem array of Fc domains in the form of a tandem array of nuclease domains. In other embodiments, the tandem array of nuclease domains is effectively linked to the C-terminus and N-terminus of an Fc domain or an In series array of Fc domains.

[0161] In other embodiments, one or more nuclease domains can be inserted between two Fc domains. For example, one or more nuclease domains can form all or part of the polypeptide linker of the hybrid nuclease molecules of the present invention.

[0162] Preferred hybrid nuclease molecules of the present invention comprise at least one nuclease domain (e.g., RNase or DNase), at least one linker domain, and at least one Fc domain.

[0163] In certain embodiments, the hybrid nuclease molecules of the present invention have at least one nuclease domain that is specific for a target molecule that mediates a biological effect. In another embodiment, binding of the hybrid nuclease molecules of the present invention to a target molecule (e.g., DNA or RNA) results in the reduction or elimination of the target molecule, such as from a cell, tissue, or from the circulation.

[0164] In certain embodiments, the hybrid nuclease molecules of the present invention may comprise two or more nuclease domains. In one embodiment, the nuclease domains are the same, such as RNase and RNase, or TREX1 and TREX1. In another embodiment, the nuclease domains are different, such as DNase and RNase.

[0165] In other embodiments, the hybrid nuclease molecules of the present invention may assemble together or form a binding protein having two or more polypeptides (“multimer”) with other polypeptides, wherein at least one polypeptide in the multimer is the hybrid nuclease molecule of the present invention. Exemplary multimeric forms include dimeric, trimeric, tetrameric, and hexameric binding proteins, etc. In one embodiment, the polypeptides in the multimer are the same (i.e., homotypic binding proteins, such as homodimers, homotetramers). In another embodiment, the polypeptides in the multimer are different (e.g., heterotypic).

[0166] Method for preparing hybrid nuclease molecule

[0167] The hybrid nuclease molecules of the present invention can be mainly prepared in transformed host cells by recombinant DNA technology. To this end, recombinant DNA molecules encoding the peptides are prepared. Methods for preparing such DNA molecules are well known in the art. For example, the sequence encoding the peptide can be excised from the DNA using appropriate restriction enzymes. Alternatively, DNA molecules can be synthesized using chemical synthesis techniques such as the phosphoramidite method. Combinations of these techniques can also be used.

[0168] The present invention also includes vectors capable of expressing the peptides in a suitable host. The vector contains a DNA molecule, and the peptide encoded by the DNA molecule is operably linked to an appropriate expression control sequence. Methods for effecting such operable linkage before or after insertion of the DNA molecule into the vector are well known in the art. Expression control sequences include promoters, activators, enhancers, operators, ribonuclease domains, initiation signals, termination signals, capping signals, Polyadenylic acid polyadenylation signals, and other signals involved in transcriptional or translational control.

[0169] The obtained vector having the above DNA molecule is used to transform a suitable host. This transformation can be carried out using methods well known in the art.

[0170] In practicing the present invention, any of a large number of available known host cells can be used. The choice of a particular host depends on a number of factors well known in the art. This includes, for example, compatibility with the selected expression vector, toxicity of the DNA molecule encoding the polypeptide, transformation efficiency, ease of peptide recovery, expression characteristics, biosafety, and cost. It is understood that a balance of these factors needs to be considered since not all hosts will express a particular DNA sequence equivalently. Among these general principles, useful microbial hosts include cultured bacteria (such as Escherichia coli), yeast (such as Saccharomyces cerevisiae), and other fungi, insects, plants, mammalian (including human) cells, or other hosts known in the art.

[0171] Next, the transformed host is cultured and purified. The host cells can be cultured under conventional fermentation conditions to express the desired compound. Such fermentation conditions are well known in the art. Finally, the peptide is purified from the culture medium using methods well known in the art.

[0172] The compound can also be prepared using synthetic methods. For example, solid-phase synthesis techniques can be used. Suitable techniques well known in the art include those described below: Merrifield (1973), Chem. Polypeptides, pp. 335 - 61 (Katsoyannis and Panayotis eds.); Merrifield (1963), J. Am. Chem. Soc. 85:2149; Davis et al. (1985), Biochem. Intl. 10:394 - 414; Stewart and Young (1969), Solid Phase Peptide Synthesis; U.S. Patent No. 3,941,763; Finn et al. (1976), The Proteins (3rd ed.) 2:105 - 253; and Erickson et al. (1976), The Proteins (3rd ed.) 2:257 - 527. Solid-phase synthesis is the preferred technique for preparing individual peptides as it is the most cost-effective method for preparing small peptides. Compounds containing derivatized peptides or non-peptide groups can be synthesized using methods well known in organic chemistry techniques.

[0173] Other methods of molecular expression / synthesis are generally ordinary Person skilled in the art knowledge in the art.

[0174] Use of pharmaceutical composition and treatment method

[0175] In certain embodiments, the hybrid nuclease molecule is administered alone. In certain embodiments, the hybrid nuclease molecule is administered prior to administration of at least one other therapeutic agent. In certain embodiments, the hybrid nuclease molecule is co-administered with at least one other therapeutic agent. In certain embodiments, the hybrid nuclease molecule is administered after administration of at least one other therapeutic agent. In other embodiments, the hybrid nuclease molecule is administered prior to administration of at least one other therapeutic agent. Those skilled in the art will recognize that, in certain embodiments, the hybrid nuclease molecule is combined with other reagents / compounds. In certain embodiments, the hybrid nuclease molecule is co-administered with other reagents. In certain embodiments, the hybrid nuclease molecule and other reagents are not administered simultaneously, and the hybrid nuclease molecule is administered before or after administration of the reagent. In certain embodiments, the hybrid nuclease molecule and other reagents are administered to a subject during a prophylactic phase, disease onset, and / or treatment phase.

[0176] The pharmaceutical compositions of the invention can be administered in combination therapy, i.e., in combination with other reagents. In certain embodiments, the combination therapy includes combining a nuclease molecule with at least one other reagent. Reagents include, but are not limited to, chemically synthesized compositions, antibodies, antigen-binding regions, and combinations and conjugates thereof prepared in vitro. In certain embodiments, the reagent can be an agonist, antagonist, allosteric modulator, or toxin.

[0177] In certain embodiments, the pharmaceutical compositions provided by the invention comprise a hybrid nuclease molecule and a pharmaceutically acceptable diluent, carrier, solubilizer, emulsifier, preservative, and / or adjuvant.

[0178] In certain embodiments, the pharmaceutical compositions provided by the invention comprise a hybrid nuclease molecule and a therapeutically effective amount of at least one other therapeutic agent and a pharmaceutically acceptable diluent, carrier, solubilizer, emulsifier, preservative, and / or adjuvant.

[0179] In certain embodiments, acceptable formulation materials are preferably non-toxic to the recipient at the dosages and concentrations employed. In certain embodiments, the formulation materials are for subcutaneous and / or intravenous administration. In certain embodiments, the pharmaceutical composition can contain formulation materials that are used to modify, maintain, or preserve properties of the composition such as pH, osmotic pressure, viscosity, clarity, color, isotonicity, odor, sterility, stability, dissolution or release rate, absorption, or permeability. In certain embodiments, suitable formulation materials include, but are not limited to, amino acids (such as glycine, glutamine, asparagine, arginine, or lysine); antimicrobial agents; antioxidants (such as ascorbic acid, sodium sulfite, or sodium bisulfite); buffers (such as borate, bicarbonate, Tris-HCl, citrate, phosphate, or other organic acids); fillers (such as mannitol or glycine); chelating agents (such as sodium ethylenediaminetetraacetate (EDTA)); complexing agents (such as caffeine, polyvinylpyrrolidone, β-cyclodextrin, or hydroxypropyl-β-cyclodextrin); fillers; monosaccharides; disaccharides; and other carbohydrates (such as glucose, mannose, or dextrin); proteins (such as serum albumin, gelatin, or immunoglobulins); coloring agents, flavoring agents, and diluents; emulsifying agents; hydrophilic polymers (such as polyvinylpyrrolidone); low molecular weight polypeptides; salt-forming counterions (such as sodium); preservatives (such as benzalkonium chloride, benzoic acid, salicylic acid, thimerosal, phenethyl alcohol, methylparaben, propylparaben, chlorhexidine, sorbic acid, or hydrogen peroxide); solvents (such as glycerol, propylene glycol, or polyethylene glycol); sugar alcohols (such as mannitol or sorbitol); suspending agents; surfactants or wetting agents (such as pluronics, PEG, sorbitan esters, polysorbates such as polysorbate 20, polysorbate 80, Triton, tromethamine, lecithin, cholesterol, tyloxapol); stability enhancers (such as sucrose or sorbitol); tonicity enhancers (such as alkali metal halides, preferably sodium chloride or potassium, mannitol, sorbitol); delivery media; diluents; excipients; and / or pharmaceutical adjuvants. (Remington's Pharmaceutical Sciences, 18th Edition, A.R. Gennaro, ed., Mack Publishing Company (1995)) In certain embodiments, the formulation contains PBS; 20 mM NaOAc, pH 5.2, 50 mM NaCl; and / or 10 mM NaOAc, pH 5.2, 9% sucrose.

[0180] In certain embodiments, the hybrid nuclease molecule and / or therapeutic molecule is linked to a half-life extending moiety known in the art. Such moieties include, but are not limited to, polyethylene glycol, glycogen (e.g., glycosylated hybrid nuclease molecules), and dextran. Such moieties have been described, for example, in U.S. application serial number 09 / 428,082, now U.S. Patent No. 6,660,843 and published PCT application number WO 99 / 25044, the disclosures of which are hereby incorporated by reference.

[0181] In certain embodiments, the optimal pharmaceutical composition will be determined by one of ordinary skill in the art, e.g., based on the intended route of administration, delivery format, and desired dosage. See, e.g., Remington's Pharmaceutical Sciences, supra. In certain embodiments, such compositions can alter the physical state of the antibodies of the invention, Stability the rate of release in vivo, and the rate of clearance in vivo.

[0182] In certain embodiments, the nature of the primary vehicle or carrier in the pharmaceutical composition can be either aqueous or non-aqueous. For example, in certain embodiments, suitable vehicles or carriers can be water for injection, physiological saline solution, or artificial cerebrospinal fluid, and may also include other common ingredients for parenteral administration. In certain embodiments, salts include isotonic phosphate buffered salts. In certain embodiments, further exemplary vehicles are neutral buffered salts or mixtures of salts with serum albumin. In certain embodiments, the pharmaceutical composition comprises a Tris buffered salt at a pH of about 7.0 - 8.5, or an acetate buffered salt at a pH of about 4.0 - 5.5, which may further include sorbitol or a suitable substitute. In certain embodiments, the composition comprises a hybrid nuclease molecule, with or without at least one other therapeutic agent, and can be made in the form of a lyophilized cake or an aqueous solution for storage by mixing selected components of the desired purity with optional formulation reagents (see Remington's Pharmaceutical Sciences, supra). Further, in certain embodiments, Combination the composition comprises a hybrid nuclease molecule, with or without at least one other therapeutic agent, and can be made into a lyophilized formulation using a suitable excipient such as sucrose.

[0183] In certain embodiments, the pharmaceutical composition is alternatively selected for parenteral Delivery . In certain embodiments, the composition is alternatively selected for delivery by inhalation or through the digestive tract, such as orally. Preparation of such pharmaceutically acceptable compositions is within the capabilities of one of ordinary skill in the art.

[0184] In certain embodiments, the concentration of the formulation ingredients is acceptable at the site of administration AcceptIn certain embodiments, a buffer is used to maintain the composition at physiological pH or slightly lower pH conditions, with a typical pH range of from about 5 to about 8.

[0185] In certain embodiments, when parenteral administration is contemplated, the therapeutic composition can be a pyrogen-free, parenterally acceptable aqueous solution that contains the desired hybrid nuclease molecule(s) in a pharmaceutically acceptable medium, and may or may not contain other therapeutic agents. In certain embodiments, the parenteral injection medium is sterile distilled water, in which the hybrid nuclease molecule(s), with or without at least one other therapeutic agent, is formulated into a sterile, isotonic, preservable preparation. In certain embodiments, the formulation can include a desired molecular formulation with a reagent such as an injectable microsphere, a bioerodible particle, a polymeric compound (such as polylactic acid or polyglycolic acid), a microsphere or a liposome, which can provide controlled or sustained release of the product, and the product can subsequently be delivered by depot injection. In certain Mode embodiments, hyaluronic acid can also be used, which can prolong the duration in circulation. In certain embodiments, an implantable drug delivery medium can be used to introduce the desired molecule(s).

[0186] In certain embodiments, the pharmaceutical composition can be formulated for inhalation. In certain embodiments, the hybrid nuclease molecule(s), with or without at least one other therapeutic agent, can be formulated as a dry powder for inhalation. In certain embodiments, an inhalation solution containing the hybrid nuclease molecule(s) may or may not contain at least one other therapeutic agent and can be formulated with a propellant for aerosol delivery. In certain embodiments, the solution can be nebulized. Pulmonary administration is further described in PCT application No. PCT / US94 / 001875, which describes the pulmonary delivery of chemically modified proteins.

[0187] In certain embodiments, the formulation can be administered orally. In certain embodiments, the hybrid nuclease molecule(s) administered in this manner may or may not contain at least one other therapeutic agent and can be prepared with or without a carrier that is commonly used in the preparation of solid dosage forms such as tablets and capsules. In certain embodiments, the capsule can be designed to release the active ingredient of the formulation when the bioavailability is highest and the pre-systemic degradation is lowest in the gastrointestinal tract. In certain embodiments, at least one other reagent can be added to facilitate the absorption of the hybrid nuclease molecule(s) and / or any other therapeutic agent. In certain embodiments, diluents, flavoring agents, low melting point beeswax, vegetable oils, lubricants, suspending agents, tablet disintegrants, and binders can also be added.

[0188] In certain embodiments, the pharmaceutical composition can include an effective amount of a hybrid nuclease molecule, with or without at least one other therapeutic agent, admixed with a non-toxic excipient suitable for the manufacture of tablets. In certain embodiments, a unit dosage form solution is made by dissolving the tablets in sterile water, or other suitable medium. In certain embodiments, suitable excipients include, but are not limited to, inert diluents such as calcium carbonate, Sodium carbonate or sodium bicarbonate, lactose or calcium phosphate; or binders such as starch, gelatin or acacia; or lubricants such as magnesium stearate, stearic acid or talc.

[0189] Other pharmaceutical compositions will be apparent to those skilled in the art, including sustained release or controlled release formulations that contain a hybrid nuclease molecule, with or without at least one other therapeutic agent. In certain embodiments, a variety of other sustained release or controlled release formulation techniques, such as liposome carriers, bioerodible microparticles or porous microspheres and depot injections, are also known to those skilled in the art. See, for example, PCT application number PCT / US93 / 00829, which describes controlled release porous polymeric microparticles for delivering pharmaceutical compositions. In certain embodiments, the sustained release formulation can include a semipermeable polymeric material in the form of shaped particles, such as a membrane or microcapsule. Sustained release materials can include polyesters, hydrogels, poly(lactide) (U.S. Patent No. 3,773,919 and European Patent No. 058,481), copolymers of L-glutamic acid and γ-ethyl-L-glutamic acid (Sidman et al., Biopolymers, 22:547-556 (1983)), poly(2-hydroxyethyl methacrylate) (Langer et al., J. Biomed. Mater. Res., 15:167-277 (1981) and Langer, Chem. Tech., 12:98-105 (1982)), ethylene vinyl acetate (see Langer et al. described above) or poly-D(-)-3-hydroxybutyric acid (EP 133,988). In certain embodiments, the sustained release composition can also include liposomes, which can be prepared by any of several methods known in the art. See, for example, Eppstein et al., Proc. Natl. Acad. Sci. USA, 82:3688-3692 (1985); European Patent Nos. 036,676; 088,046 and 143,949.

[0190] Drug compositions for in vivo administration are generally sterile. In certain embodiments, this can be achieved by filtration through a sterile filter membrane. In certain embodiments, when the composition is lyophilized, the aseptic processing by this method can be carried out before or after lyophilization and reconstitution. In certain embodiments, compositions for parenteral administration can be stored in lyophilized form or in solution form. In certain embodiments, parenteral compositions are typically placed in a container with a sterile port, e.g., an intravenous administration solution bag or bottle with a stopper that can be pierced by a hypodermic needle.

[0191] In certain embodiments, once the pharmaceutical composition is formulated, the pharmaceutical composition can be stored in a sterile vial in the form of a solution, suspension, gel, emulsion, solid, or as a dehydrated or lyophilized powder. In certain embodiments, such formulations can be stored in ready-to-use form or in a form that requires reconstitution (e.g., lyophilized) prior to administration.

[0192] In certain embodiments, kits providing single-dose administration units are provided. In certain embodiments, the kit can include a first container containing a dry protein and a second container containing an aqueous formulation. In Certain embodiments, kits including single-chamber and multi-chamber prefilled syringes (e.g., liquid syringes and lyophilized syringes) are included.

[0193] In certain embodiments, the effective amount of a pharmaceutical composition for therapeutic use can be determined, e.g., based on the therapeutic context and purpose, the pharmaceutical composition comprising a hybrid nuclease molecule, with or without at least one other therapeutic agent. Those skilled in the art will understand that the appropriate dosage level for treatment according to certain embodiments will vary in part depending on the following factors: the molecule being delivered, the indication for which the hybrid nuclease molecule with or without at least one other therapeutic agent is used, the route of administration, and the size (body weight, body surface area, or organ size) and / or physical condition (age and general health) of the patient. In certain embodiments, the clinician can adjust the dosage and change the route of administration to achieve the optimal therapeutic effect. In certain embodiments, the dosage can generally range from about 0.1 μg / kg to up to about 100 mg / kg or more, depending on the above factors. In certain embodiments, the dosage can range from about 0.1 μg / kg to up to about 100 mg / kg; or from 1 μg / kg to about 100 mg / kg; or from 5 μg / kg to up to about 100 mg / kg.

[0194] In certain embodiments, the dosing frequency will take into account the pharmacokinetic parameters of the hybrid nuclease molecule and / or any other therapeutic agent in the formulation used. In certain embodiments, the clinician will administer the composition until a certain dose that achieves the desired effect is reached. In certain embodiments, the composition may thus be administered once or twice or multiple times (with or without the same amount of the desired molecule) over a period of time, or by an implant device or catheter. Continuous Infusion. More precise appropriate dosing can be determined by those of ordinary skill in the art in a conventional manner and is within their routine scope of action. In certain embodiments, an appropriate dose can be determined by using appropriate dose-effect data.

[0195] In certain embodiments, the routes of administration of the pharmaceutical composition are all known methods, such as oral administration, injection by intravenous, intraperitoneal, intracerebral (intraparenchymal), intraventricular, intramuscular, subcutaneous, intraocular, arterial, portal vein or intracapsular routes; administration by a sustained release system or an implant device. In certain embodiments, the composition may be administered by bolus or continuous infusion, or by an implant device.

[0196] In certain embodiments, the composition may be administered locally by implanting a membrane, sponge or other suitable material that absorbs or encapsulates the desired molecule. In certain embodiments, when using an implant device, the device can be implanted into any suitable tissue or organ, and the desired molecule can be delivered by diffusion, timed release bolus, or continuous administration.

[0197] In certain embodiments, it is necessary to use the pharmaceutical composition in an ex vivo manner, which contains a hybrid nuclease molecule, with or without at least one other therapeutic agent. In such examples, cells, tissues, and / or organs are removed from the patient's body, contacted with a pharmaceutical composition containing a hybrid nuclease molecule with or without at least one other therapeutic agent, and then the cells, tissues, and / or organs are re-implanted into the patient's body.

[0198] In certain embodiments, the hybrid nuclease molecule and / or any other therapeutic agent can be delivered by implanting certain cells that have been genetically engineered to express and secrete polypeptides using the methods described in the present invention. In certain embodiments, such cells can be animal or human cells, and can be autologous, heterologous, or xenogeneic. In certain embodiments, the cells can be immortalized. In certain embodiments, to reduce the chance of an immune response, the cells can be encapsulated to avoid infiltration of the surrounding tissue. In certain embodiments, the encapsulation material is generally a biocompatible, semi-permeable polymeric shell or membrane that allows the release of the protein product but prevents the patient's immune system or other harmful factors in the surrounding tissue from destroying the cells.

[0199] The hybrid nuclease molecules of the present invention are particularly effective for the treatment of autoimmune diseases or immune dysresponses. In this regard, it is understood that the hybrid nuclease molecules of the present invention can be used to control, inhibit, regulate, treat or eliminate harmful immune responses caused by external and self-antigens. In other embodiments, the polypeptide of the present invention can be used to treat immune diseases including, but not limited to, insulin-dependent diabetes, multiple sclerosis, experimental autoimmune encephalomyelitis, rheumatoid arthritis, experimental autoimmune arthritis, myasthenia gravis, thyroiditis, experimental uveitis, Hashimoto's thyroiditis, primary myxedema, thyrotoxicosis, pernicious anemia, autoimmune atrophic gastritis, Addison's disease, premature menopause, male infertility, juvenile diabetes, Goodpasture's syndrome, pemphigus vulgaris, pemphigoid, sympathetic ophthalmia, phacoanaphylactic uveitis, autoimmune hemolytic anemia, idiopathic leukopenia, primary biliary cirrhosis, chronic active hepatitis Hbs-ve, cryptogenic cirrhosis, ulcerative colitis, Sjogren's syndrome, scleroderma, Wegener's granulomatosis, polymyositis, dermatomyositis, Discoid lupus erythematosus systemic lupus erythematosus or connective tissue disease.

[0200] For illustrative purposes only, the present invention includes, but is not limited to, the following technical solutions:

[0201] Technical solution 1. A hybrid nuclease molecule comprising a first nuclease domain and an Fc domain, wherein the first nuclease domain is effectively coupled to the Fc domain.

[0202] Technical solution 2. The hybrid nuclease molecule according to Technical solution 1, wherein the hybrid nuclease molecule is a polypeptide, wherein the amino acid sequence of the first nuclease domain comprises the human wild-type RNase amino acid sequence shown in SEQ ID NO: 149, and wherein the amino acid sequence of the Fc domain comprises the human wild-type IgG1 Fc domain shown in SEQ ID NO: 145.

[0203] Technical solution 3. The hybrid nuclease molecule according to Technical solution 1, wherein the hybrid nuclease molecule is a polypeptide consisting of SEQ ID NO: 163.

[0204] Technical solution 4. The hybrid nuclease molecule according to Technical solution 1, wherein the hybrid nuclease molecule comprises wild-type human DNase1 linked to wild-type human IgG1.

[0205] Technical solution 5. The hybrid nuclease molecule according to Technical solution 1, wherein the hybrid nuclease molecule comprises human DNase1 G105R A114F linked to wild-type human IgG1.

[0206] Technical solution 6. The hybrid nuclease molecule according to technical solution 1, wherein the hybrid nuclease molecule comprises wild-type human RNase1 linked to wild-type human IgG1, and the wild-type human IgG1 is linked to wild-type human DNase1.

[0207] Technical solution 7. The hybrid nuclease molecule according to technical solution 1, wherein the hybrid nuclease molecule comprises wild-type human RNase1 linked to wild-type human IgG1, and the wild-type human IgG1 is linked to human DNase1 G105R A114F.

[0208] Technical solution 8. The hybrid nuclease molecule according to technical solution 1, wherein the Fc domain binds to the Fc receptor in human cells.

[0209] Technical solution 9. The hybrid nuclease molecule according to technical solution 1, wherein the serum half-life of the molecule is significantly longer than the serum half-life of the first nuclease domain alone.

[0210] Technical solution 10. The hybrid nuclease molecule according to technical solution 1, wherein the nuclease activity of the first nuclease domain of the molecule is the same as or higher than that of the nuclease domain alone.

[0211] Technical solution 11. The hybrid nuclease molecule according to technical solution 1, wherein the detection result of the mouse lupus model shows an increase in the survival rate of mice after administering the molecule to the mice.

[0212] Technical solution 12. The hybrid nuclease molecule according to technical solution 1, wherein the molecule further comprises a first linker domain, and wherein the first nuclease domain is effectively coupled to the Fc domain through the first linker domain.

[0213] Technical solution 13. The hybrid nuclease molecule according to technical solution 12, wherein the hybrid nuclease molecule is a polypeptide, wherein the amino acid sequence of the first nuclease domain comprises an RNase amino acid sequence, wherein the length of the first linker domain is between 5 and 32 amino acids, wherein the amino acid sequence of the Fc domain comprises a human Fc domain amino acid sequence, and wherein the first linker domain is coupled to the C-terminus of the first nuclease domain and the N-terminus of the Fc domain.

[0214] Technical solution 14. The hybrid nuclease molecule according to technical solution 12, wherein the hybrid nuclease molecule is a polypeptide, wherein the amino acid sequence of the first nuclease domain comprises a human RNase amino acid sequence, wherein the first linker domain is an NLG peptide with a length between 5 and 32 amino acids, wherein the amino acid sequence of the Fc domain comprises the amino acid sequence of a human wild-type Fc domain, and wherein the first linker domain is coupled to the C-terminus of the first nuclease domain and the N-terminus of the Fc domain.

[0215] Technical solution 15. The hybrid nuclease molecule according to technical solution 1, which further comprises a leader sequence.

[0216] Technical solution 16. The hybrid nuclease molecule according to technical solution 15, wherein the hybrid nuclease molecule is a polypeptide, wherein the leader sequence is a human VK3LP peptide, and wherein the leader sequence is coupled to the N-terminus of the first nuclease domain.

[0217] Technical solution 17. The hybrid nuclease molecule according to technical solution 1, wherein the molecule is a polypeptide.

[0218] Technical solution 18. The hybrid nuclease molecule according to technical solution 1, wherein the molecule is a polynucleotide.

[0219] Technical solution 19. The hybrid nuclease molecule according to technical solution 1, wherein the first nuclease domain comprises RNase.

[0220] Technical solution 20. The hybrid nuclease molecule according to technical solution 19, wherein the RNase is a human RNase.

[0221] Technical solution 21. The hybrid nuclease molecule according to technical solution 19, wherein the hybrid nuclease molecule is a polypeptide, and wherein the RNase is a polypeptide comprising an amino acid sequence that has at least 90% similarity to the RNase amino acid sequence shown in Table 2.

[0222] Technical solution 22. The hybrid nuclease molecule according to technical solution 19, wherein the RNase is human pancreatic RNase1.

[0223] Technical solution 23. The hybrid nuclease molecule according to technical solution 1, wherein the first nuclease domain comprises DNase.

[0224] Technical solution 24. The hybrid nuclease molecule according to technical solution 23, wherein the DNase is a human DNase.

[0225] Aspect 25. The hybrid nuclease molecule according to Aspect 23, wherein the hybrid nuclease molecule is a polypeptide, and wherein the DNase is a polypeptide comprising an amino acid sequence that has at least 90% similarity to the DNase amino acid sequence shown in Table 2.

[0226] Aspect 26. The hybrid nuclease molecule according to Aspect 23, wherein the DNase is selected from human DNase I, TREX1, and human DNase 1L3.

[0227] Aspect 27. The hybrid nuclease molecule according to Aspect 1, wherein the Fc domain is a human Fc domain.

[0228] Aspect 28. The hybrid nuclease molecule according to Aspect 1, wherein the Fc domain is a wild-type Fc domain.

[0229] Aspect 29. The hybrid nuclease molecule according to Aspect 1, wherein the Fc domain is a mutant Fc domain.

[0230] Aspect 30. The hybrid nuclease molecule according to Aspect 1, wherein the Fc domain is a human IgG1 Fc domain.

[0231] Aspect 31. The hybrid nuclease molecule according to Aspect 1, wherein the hybrid nuclease molecule is a polypeptide, and wherein the Fc domain is a polypeptide comprising an amino acid sequence that has at least 90% similarity to the Fc domain amino acid sequence shown in Table 2.

[0232] Aspect 32. The hybrid nuclease molecule according to Aspect 12, wherein the hybrid nuclease molecule is a polypeptide, and wherein the length of the first linker domain is from about 1 to about 50 amino acids.

[0233] Aspect 33. The hybrid nuclease molecule according to Aspect 12, wherein the hybrid nuclease molecule is a polypeptide, and wherein the length of the first linker domain is from about 5 to about 32 amino acids.

[0234] Aspect 34. The hybrid nuclease molecule according to Aspect 12, wherein the hybrid nuclease molecule is a polypeptide, and wherein the length of the first linker domain is from about 15 to about 25 amino acids.

[0235] Aspect 35. The hybrid nuclease molecule according to Aspect 12, wherein the hybrid nuclease molecule is a polypeptide, and wherein the length of the first linker domain is from about 20 to about 32 amino acids.

[0236] Aspect 36. The hybrid nuclease molecule according to Aspect 12, wherein the hybrid nuclease molecule is a polypeptide, and wherein the length of the first linker domain is about 20 amino acids.

[0237] Aspect 37. The hybrid nuclease molecule according to Aspect 12, wherein the hybrid nuclease molecule is a polypeptide, and wherein the length of the first linker domain is about 25 amino acids.

[0238] Aspect 38. The hybrid nuclease molecule according to Aspect 12, wherein the hybrid nuclease molecule is a polypeptide, and wherein the length of the first linker domain is about 18 amino acids.

[0239] Aspect 39. The hybrid nuclease molecule according to Aspect 12, wherein the hybrid nuclease molecule is a polypeptide, and wherein the first linker domain comprises a gly / ser peptide.

[0240] Aspect 40. The hybrid nuclease molecule according to Aspect 39, wherein the gly / ser peptide has the general formula (Gly4Ser)n, where n is a positive integer selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10.

[0241] Aspect 41. The hybrid nuclease molecule according to Aspect 39, wherein the gly / ser peptide comprises (Gly4Ser)3, (Gly4Ser)4, or (Gly4Ser)5.

[0242] Aspect 42. The hybrid nuclease molecule according to Aspect 12, wherein the hybrid nuclease molecule is a polypeptide, and wherein the first linker domain comprises an NLG peptide.

[0243] Aspect 43. The hybrid nuclease molecule according to Aspect 12, wherein the hybrid nuclease molecule is a polypeptide, and wherein the first linker domain comprises an N-linked glycosylation site.

[0244] Aspect 44. The hybrid nuclease molecule according to Aspect 1, wherein the hybrid nuclease molecule is a polypeptide, and wherein the first nuclease domain is linked to the N-terminus of the Fc domain.

[0245] Aspect 45. The hybrid nuclease molecule according to Aspect 1, wherein the hybrid nuclease molecule is a polypeptide, and wherein the first nuclease domain is linked to the C-terminus of the Fc domain.

[0246] Aspect 46. The hybrid nuclease molecule according to Aspect 1, which further comprises a second nuclease domain.

[0247] Technical solution 47. The hybrid nuclease molecule according to technical solution 46, wherein the first and second nuclease domains are different nuclease domains.

[0248] Technical solution 48. The hybrid nuclease molecule according to technical solution 46, wherein the first and second nuclease domains are the same nuclease domains.

[0249] Technical solution 49. The hybrid nuclease molecule according to technical solution 46, wherein the hybrid nuclease molecule is a polypeptide, and wherein the second nuclease domain is linked to the C-terminus of the Fc domain.

[0250] Technical solution 50. The hybrid nuclease molecule according to technical solution 46, wherein the hybrid nuclease molecule is a polypeptide, and wherein the second nuclease domain is linked to the N-terminus of the Fc domain.

[0251] Technical solution 51. The hybrid nuclease molecule according to technical solution 46, wherein the hybrid nuclease molecule is a polypeptide, and wherein the second nuclease domain is linked to the C-terminus of the first nuclease domain.

[0252] Technical solution 52. The hybrid nuclease molecule according to technical solution 46, wherein the hybrid nuclease molecule is a polypeptide, and wherein the second nuclease domain is linked to the N-terminus of the first nuclease domain.

[0253] Technical solution 53. A dimeric polypeptide comprising a first polypeptide and a second polypeptide, wherein the first polypeptide comprises a first nuclease domain and an Fc domain, and wherein the first nuclease domain is effectively coupled to the Fc domain.

[0254] Technical solution 54. The dimeric polypeptide according to technical solution 53, wherein the second polypeptide is a second hybrid nuclease molecule comprising a second nuclease domain and a second Fc domain, and wherein the second nuclease domain is effectively coupled to the second Fc domain.

[0255] Technical solution 55. A pharmaceutical composition comprising at least one hybrid nuclease molecule and / or at least one dimeric polypeptide according to any one of technical solutions 1-54, and a pharmaceutically acceptable excipient.

[0256] Technical solution 56. A nucleic acid molecule encoding the hybrid nuclease molecule according to technical solution 17.

[0257] Technical solution 57. A recombinant expression vector comprising the nucleic acid molecule according to technical solution 56.

[0258] Aspect 58. A host cell transformed with the recombinant expression vector according to Aspect 57.

[0259] Aspect 59. A method for preparing the hybrid nuclease molecule according to Aspect 1, the method comprising: providing a host cell comprising a nucleic acid sequence encoding the hybrid nuclease molecule; and maintaining the host cell under conditions for expressing the hybrid nuclease molecule.

[0260] Aspect 60. A method for treating or preventing a condition associated with abnormal immune response, the method comprising administering to a patient in need an effective amount of the isolated hybrid nuclease molecule according to Aspect 1.

[0261] Aspect 61. The method according to Aspect 60, wherein the condition is an autoimmune disease.

[0262] Aspect 62. The method according to Aspect 61, wherein the autoimmune disease is selected from insulin-dependent diabetes, multiple sclerosis, experimental autoimmune encephalomyelitis, rheumatoid arthritis, experimental autoimmune arthritis, myasthenia gravis, thyroiditis, experimental uveitis, Hashimoto's thyroiditis, primary myxedema, thyrotoxicosis, pernicious anemia, autoimmune atrophic gastritis, Addison's disease, premature menopause, male infertility, juvenile diabetes, Goodpasture's syndrome, pemphigus vulgaris, pemphigoid, sympathetic ophthalmia, phacoanaphylactic uveitis, autoimmune hemolytic anemia, idiopathic leukopenia, primary biliary cirrhosis, chronic active hepatitis Hbs-ve, cryptogenic cirrhosis, ulcerative colitis, Sjögren's syndrome, scleroderma, Wegener's granulomatosis, polymyositis, dermatomyositis, discoid lupus erythematosus, systemic lupus erythematosus (SLE), and connective tissue disease.

[0263] Aspect 63. The method according to Aspect 61, wherein the autoimmune disease is systemic lupus erythematosus. Examples

[0264] The following are examples for implementing specific embodiments of the present invention. These examples are for illustrative purposes only and are not intended to limit the scope of protection of the present invention in any way. Although efforts have been made to ensure the accuracy of the numbers used (e.g., amounts, temperatures, etc.), some experimental errors and deviations are still allowed.

[0265] Unless otherwise indicated, the practice of the present invention will employ conventional protein chemistry, biochemistry, recombinant DNA techniques, and pharmacological methods within the skill of the art. Such techniques have been explained in detail in the literature. See, for example, T.E. Creighton, Proteins: Structures and Molecular Properties (W.H. Freeman and Company, 1993); A.L. Lehninger, Biochemistry (Worth Publishers, Inc., current edition); Sambrook, et al., Molecular Cloning: A Laboratory Manual (2nd ed., 1989); Methods In Enzymology (S. Colowick and N. Kaplan eds., Academic Press, Inc.); Remington's Pharmaceutical Sciences, 18th ed. (Easton, Pennsylvania: Mack Publishing Company, 1990); Carey and Sundberg Advanced Organic Chemistry 3 rd Ed. (Plenum Press) Vols A and B (1992).

[0266] Example 1: Construction of RNase-Ig fusion gene.

[0267] Murine RNase 1 was amplified from a full-length cDNA from an EST library (from Dr. C. Raine, Albert Einstein School of Medicine, Bronx, NY), and the clone was directly sent to this laboratory by Dr. C. Raine without an MTA. The sequence-specific 5' and 3' primers used were from publicly available sequences. The sequence of the clone was verified by sequence analysis. The Genebank accession number is NCBI geneID 19752. Full-length human RNase 1 was isolated from random primer and oligo dT primer cDNA, which was from total human pancreas RNA (Ambion / Applied Biosystems, Austin, TX).

[0268] After isolating the full-length clone, primers were designed to construct fusion genes with the Fc domain of murine IgG2a (SEQ ID NO:114) or human IgG1 (SEQ ID NO:110). Two different primers were designed for the 5’ sequence fused to the amino terminus of the Fc tail; the first incorporated the native leader peptide from murine (or human) RNase, while the second incorporated an AgeI site at the predicted signal peptide cleavage site at the amino terminus of RNase to fuse RNase to the human VKIII leader peptide that had been used in other expression studies. For murine RNase, the sequence of the first primer was:

[0269] mribNL5’

[0270] 30mer (RNase 5’ with native signal peptide and HindIII+Kozak)

[0271] gTT AAg CTT gCC ACC ATg ggT CTg gAg AAg TCC CTC ATT CTg-3’(SEQ ID NO:1)

[0272] The second primer constructed a gene fusion junction between the existing leader sequence and the mature sequence at the RNase 5’ terminus, which was located at or near the predicted leader peptide cleavage site.

[0273] 27mer (RNase 5’ mature sequence (leaderless, with AgeI site))

[0274] 5’-gAT ACC ACC ggT Agg gAA TCT gCA gCA CAg AAg TTT CAg-3’(SEQ ID NO:2)

[0275] The 3’ primer sequence fused to the carboxyl terminus of RNase and the amino terminus of the Fc tail of murine IgG2a is shown below:

[0276] mrib3NH2

[0277] 28mer (RNase 3’ terminus with XhoI site for fusion to mIgG2a).

[0278] 5’-ggC TCg AgC ACA gTA gCA TCA AAg tGG ACT ggT ACg TAg g-3’(SEQ IDNO:3)

[0279] Two additional oligonucleotides were designed to construct the –Ig-RNase fusion gene, where the –Ig tail is the amino terminus of the RNase enzyme domain.

[0280] mrib5X

[0281] The 36mer RNase 5’ terminus with a linker amino acid and XbaI site for fusion to the carboxyl terminus of the Fc domain.

[0282] 5’-AAA TCT AgA CCT CAA CCA ggT Agg gAA TCT gCA gCA CAg AAg TTT CAg-3’(SEQ ID NO:4)

[0283] mrib3X

[0284] The 31mer RNase 3’ terminus with two stop codons and XbaI site for fusion to the carboxyl terminus of the Fc domain.

[0285] 5’-TCT AgA CTA TCA CAC AgT AgC ATC AAA gTg gAC Tgg TAC gTA g-3’(SEQID NO:5)

[0286] Example 2: Isolation of anti-RNA or anti-DNA scFvs from hybridomas expressing monoclonal antibodies.

[0287] The anti-RNA hybridoma designated H564 was used to isolate the RNA-specific V region. Prior to harvest, H564 anti-RMA hybridoma cells were maintained in logarithmic growth for several days in PRMI 1640 medium (Invitrogen / Life Technologies, Gaithersburg, Md.) supplemented with glutamine, sodium pyruvate, DMEM non-essential amino acids, and penicillin-streptomycin. The medium was centrifuged to pellet the cells, and used 2x10 7RNA was prepared from cells. Using the QIAGEN RNAeasy kit (Valencia, Calif.), the total RNA isolation kit and QIAGEN QIAshredder, RNA was isolated from hybridoma cells according to the manufacturer's instructions provided with the kit. 4 μg of total RNA was used for reverse transcription to prepare the cDNA template. The RNA, 300 ng of random primers, 500 ng of oligo dT (12 - 18), and 1 μl of 25 mM dNTP were mixed and denatured at 80 °C for 5 minutes, and then the enzyme was added. Superscript III reverse transcriptase (Invitrogen, Life Technologies) was added to the mixture of RNA and primers with a total volume of 25 μl, along with the 5× second buffer provided with the enzyme and 0.1 M DTT. The reverse transcription reaction was carried out at 50 °C for one hour.

[0288] According to the manufacturer's instructions, the cDNA obtained from the reverse transcription reaction was purified using the QIAquick PCR purification kit (QIAGEN, Valencia CA), and the poly-G sequence tail was added using terminal transferase (Invitrogen, Carlsbad, CA). The tailed cDNA was purified again using the QIAquick PCR purification kit and eluted with 30 μl of elution buffer (EB buffer) provided in the kit. 2 μl of the tailed cDNA was used as a template, and the variable regions of the H564 antibody light and heavy chains were amplified by PCR using an anchored-tail 5' primer containing a poly-C domain and a constant region-specific, degenerate 3' primer. Restriction enzyme sites were designed to be added to the two variable chains so that after amplification and restriction enzyme digestion, the two V regions were assembled into scFv by ligation with a linker sequence in three fragments.

[0289] The linker sequence was amplified by overlap extension PCR using overlapping primers encoding the two halves of the (gly4ser)4 peptide linker, so as to insert the (gly4ser)4 peptide linker between the two V regions. The PCR fragments were separated by agarose gel electrophoresis, the appropriate bands were cut from the gel, and the amplified DNA was purified using the QIAquick gel extraction kit (QIAGEN, Valencia, CA) to isolate the fragments. The scFv derivative from the H564 hybridoma was assembled into a VH-linker-VL fusion gene and could be ligated to the two ends of a larger - Ig fusion gene. The V H domain was amplified without a leader peptide but containing a 5' AgeI restriction site for fusion with V L and a 3' terminal BglII restriction site for fusion with the linker domain.

[0290] The scFv-Ig was assembled by inserting the scFv HindIII-XhoI fragment into pDG, which contains the human IgG1 hinge, CH2, and CH3 regions that can be digested by the restriction enzymes HindIII and XhoI. After ligation, the ligation product was transformed into DH5-α bacteria. The scFv-Ig cDNA was cycle-sequenced in a PE 9700 thermal cycler using a 25-cycle program: denaturation at 96°C for 10 seconds, annealing at 50°C for 30 seconds, and extension at 72°C for 4 minutes. The sequencing primers were the pDG forward and reverse primers, and the internal primer annealed to the human CH2 domain of the IgG constant region. The sequencing reaction was performed using the Big Dye Terminator Ready Sequencing Mix v3.1 (PE-Applied Biosystems, Foster City, Calif.) according to the manufacturer's instructions. Subsequently, the samples were purified using an Autoseq G25 column (GE Healthcare), the eluate was dried on a Savant vacuum dryer, denatured using the template suppression reagent (PE-ABI), and analyzed on an ABI 310 Genetic Analyzer (PE-Applied Biosystems). The sequences were edited, translated, and analyzed using Vector Nti version 10.0 (Informax / Invitrogen, North Bethesda, Md.).

[0291] Construct the human RNaseI-hIgG1 (SEQ ID NO: 125-127) fusion gene

[0292] Human RNase1 (SEQ ID NO:113) was isolated by PCR amplification from total human pancreas RNA, which was obtained from Ambion / Applied Biosystems (Austin, TX). 4 μg of total RNA was used as a template to prepare cDNA by reverse transcription. The RNA, 300 ng of random primers, 500 ng of oligo dT (12-18), and 1 μl of 25 mM dNTP were mixed and denatured at 80 °C for 5 minutes before adding the enzyme. Superscript III reverse transcriptase (Invitrogen, Life Technologies) was added to the mixture of RNA and primers in a total volume of 25 μl, along with the second-strand buffer provided with the enzyme and 0.1 M DTT. The reverse transcription reaction was carried out at 50 °C for one hour. The reaction product was further purified using a QIAquick PCR purification column, and the cDNA was eluted into 40 μl of EB buffer before the PCR reaction. 2 μl of the cDNA eluate was added to the PCR reaction mixture containing 50 pmol of human RNase 1 specific 5' and 3' primers, and 45 μl of PCR High Fidelity SuperMix (Invitrogen, Carlsbad, CA) was added to a 0.2 ml PCR reaction tube. The PCR reaction was carried out using a C1000 Thermal Cycler (BioRad, Hercules CA). The reaction included an initial denaturation step at 95 °C for 2 minutes, followed by 34 cycles of denaturation at 94 °C for 30 sec, annealing at 50 °C for 30 sec, and extension at 68 °C for 1 minute, followed by a final extension at 72 °C for 4 minutes. After separating the wild-type tail, the fragment was TOPO cloned into the pCR2.1 vector; DNA was prepared using the QIAGEN Spin Miniprep Kit according to the manufacturer's instructions. The plasmid DNA was sequenced using the ABI Dye Terminator v3.1 Ready Reaction Mix according to the manufacturer's instructions.

[0293] Example 3: Isolation of human and mouse-Fc domains and introduction of mutations in coding sequences.

[0294] RNA for the isolation of the mouse (SEQ ID NO:114) and human (SEQ ID NO:110)-Fc domains was from mouse or human tissues described below. Single cell suspensions were from mouse spleens in RPMI medium. Alternatively, human PBMCs were isolated from fresh whole blood using Lymphocyte Separation Medium (LSM) Organon Teknika (Durham, NC), the buffy coat was collected according to the manufacturer's instructions, and the cells were washed three times in PBS before use. The cells were collected by centrifuging the medium, and were resuspended in 2x10 7RNA was prepared from cells. Using the QIAGEN RNAeasy kit (Valencia, Calif.), the total RNA isolation kit and the QIAGEN QIAshredder column, RNA was isolated from cells according to the manufacturer's instructions provided with the kit. 4 μg of total RNA was used as a template for reverse transcription to prepare cDNA. The RNA, 300 ng of random primers, 500 ng of oligo dT (12 - 18), and 1 μl of 25 mM dNTPs were mixed and denatured at 80 °C for 5 minutes before adding the enzyme. Superscript III reverse transcriptase (Invitrogen, Life Technologies) was added to the mixture of RNA and primers with a total volume of 25 μl, along with the second strand buffer provided with the enzyme and 0.1 M DTT. The reverse transcription reaction was carried out at 50 °C for one hour. The cDNA was purified using a QIAquick (QIAGEN) PCR purification column according to the manufacturer's instructions and eluted into 40 μl of EB buffer before use in the PCR reaction.

[0295] Using the cDNA described above as a template, the wild-type mouse and human - Fc domains were isolated by PCR amplification. The following primers were used for the initial amplification of the wild-type sequence, but the required mutagenic changes were introduced into the hinge domain:

[0296] mahIgG1CH2M: 47mer

[0297] 5’-tgtccaccgtgtccagcacctgaactcctgggtggatcgtcagtcttcc-3’ (SEQ ID NO:6)

[0298] hIgG1 - 5scc: 49mer

[0299] 5’-agatctcgagcccaaatcttctgacaaaactcacacatgtccaccgtgt-3’ (SEQ ID NO:7)

[0300] mahIgG1S: 51mer

[0301] 5’-tctagattatcatttacccggagacagagagaggctcttctgcgtgtagtg-3’ (SEQ ID NO:8)

[0302] muIgG2aCH2: 58mer

[0303] 5’-cctccatgcaaatgcccagcacctaacctcttgggtggatcatccgtcttcatcttcc-3’(SEQ ID NO:9)

[0304] mIgG2a-5scc:47mer

[0305] 5’-gaagatctcgagcccagaggtcccacaatcaagccctctcctcca-3’(SEQ ID NO:10)

[0306] mIgG2a3S:48mer

[0307] 5’-gtttctagattatcatttacccggagtccgagagaagctcttagtcgt-3’(SEQ ID NO:11)

[0308] The PCR reaction was performed using a C1000 Thermal Cycler (BioRad, Hercules CA) or an Eppendorf Thermal Cycler (ThermoFisher Scientific, Houston TX). The reaction included an initial denaturation step at 95 °C for 2 minutes, followed by 34 cycles: denaturation at 94 °C for 30 seconds, annealing at 50 °C for 30 seconds, and extension at 72 °C for 1 minute, followed by a final extension at 72 °C for 4 minutes. After isolation of the wild-type tail, the fragment was TOPO cloned into the pCR2.1 vector, DNA was prepared using the QIAGEN Spin Miniprep Kit according to the manufacturer's instructions, and the clones were sequenced using the ABI Dye Terminator v3.1 sequencing reaction according to the manufacturer's instructions.

[0309] DNA from the correct clone was used as a template in overlap extension PCR to introduce mutations at the desired positions in the mouse IgG2a or human-IgG1 coding sequences. The PCR reaction was set up in a 50 μl reaction volume using the full-length wild-type clone as a template (1 μl), 50 pmol of 5’ and 3’ primers for each part reaching and including the desired mutation site in the -Fc domain by PCR from each direction, and the PCR High Fidelity SuperMix (Invitrogen, Carlsbad CA), using short amplification cycles. As an example of overlap PCR mutagenesis, the following primer combination was used to introduce the P331S mutation into human-IgG1:

[0310] The 5'-subfragment was amplified using the full-length wild-type clone as a template. The 5'-primer was hIgG1-5scc: 5'-agatctcgagcccaaatcttctgacaaaactcacacatgtccaccgtgt-3' (SEQ ID NO:12), and the 3'-primer was P331AS: 5'-gttttctcgatggaggctgggagggctttgttggagacc-3' (SEQ ID NO:13). The 3'-subfragment was amplified using the full-length wild-type clone as a template. The 5'-primer was P331S: 5'aaggtctccaacaaagccctcccagcctccatcgagaaaacaatctcc-3' (SEQ ID NO:14), and the 3'-primer was mahIgG1S: 5'-tctagattatcatttacccggagacagagagaggctcttctgcgtgtagtg-3' (SEQ ID NO:15).

[0311] After amplifying the subfragments and separating them by agarose gel electrophoresis, the amplification products were purified using a QIAquick Gel Extraction Kit according to the manufacturer's instructions and eluted into 30 μl of EB buffer. Subsequently, two rounds of PCR were performed using the two subfragments as overlapping templates for a new reaction. The cycling was paused, and 5' (hIgG1-5scc, see above) and 3' (mahIgG1S, see above) flanking primers (both 50 pmol) were added to the reaction mixture. Subsequently, 34 cycles of PCR amplification were performed under the conditions used for the wild-type molecule described above. The full-length fragment was separated by gel electrophoresis and TOPO cloned into the pCR2.1 vector for sequence analysis. Then the fragment with the correct sequence from the clone Subcloning was introduced into the expression vector to construct the different hybrid nuclease molecules described in the present invention.

[0312] Example 4: RNAse-Ig (SEQ ID NO: 124, 125, 126, 127, 174 (nucleotides) or 160, 161, 162, 163, 175 (amino acids)), DNAse-Ig (SEQ ID NO: 118, 119, 120, 121, 122, 123, 186 (nucleotides) or SEQ ID NO: 154, 155, 156, 157, 158, 159, 187 (amino acids)), multi-subunit Ig fusion construct (SEQ ID NO: 115, 116, 117, 172, 176, 178, 180 (nucleotides) or SEQ ID NO: 151, 152, 153, 173, 177, 179, 181 (amino acids)), and expression of H564 scFv-Ig fusion protein.

[0313] This example illustrates the expression of the different -Ig fusion genes described in the present invention in a eukaryotic cell line, and the identification of the expressed fusion proteins by SDS-PAGE and IgG sandwich ELISA.

[0314] The -Ig fusion gene fragment with the correct sequence was inserted into the mammalian expression vector pDG, and DNA from positive clones was amplified using the QIAGEN plasmid preparation kit (QIAGEN, Valencia, Calif.). Subsequently The recombinant plasmid DNA (100 μg) was linearized in the non-essential region by digestion with AscI, purified using the phenol extraction method, and resuspended in tissue culture medium Excell 302 (Catalog No. #14312-79P, JRH Biosciences, Lenexa, Kans. / SAFC). The cells for transfection, CHO DG44 cells, were maintained in logarithmic growth, and 10 7 cells were collected for each transfection reaction. Linear DNA with a total volume of 0.8 ml was added to the CHO cells for electroporation.

[0315] The selectable, amplifiable plasmid pDG, which contains RNase-Ig cDNA under the control of the CMV promoter, was introduced into Chinese hamster ovary (CHO) cells by electroporation to achieve stable production of the -Ig fusion protein. The pDG vector is a modified version of pcDNA3, which encodes a DHFR selectable marker with a weakened promoter to increase the selective pressure of the plasmid. Plasmid DNA was prepared using the Qiagen maxiprep kit and linearized at the unique AscI site before phenol extraction and ethanol precipitation. Salmon sperm DNA (Sigma-Aldrich, St. Louis, Mo.) was added as carrier DNA, and 100 μg each of plasmid and carrier DNA were transfected by electroporation into 10 7CHO DG44 cells. Cells were grown to the log phase in Excell 302 medium (JRHBiosciences) (hereinafter referred to as "Excell 302 complete" medium), which contained glutamine (4 mM), sodium pyruvate, recombinant insulin, penicillin-streptomycin, and 2xDMEM non-essential amino acids (all from Life Technologies, Gaithersburg, Md.). The medium used for non-transfected cells also contained HT (100x solution diluted from hypoxanthine and thymidine) (Invitrogen / Life Technologies). The medium for selective transfection contained different levels of methotrexate (Sigma-Aldrich) as a selection agent, ranging from 50 nM to 1 μM. Electroporation was carried out at 280 V and 950 μF. Transfected cells were allowed to recover overnight in non-selective medium and then selectively seeded at different serial dilutions ranging from 125 cells / well to 2000 cells / well into 96-well flat-bottom culture plates (Costar). The medium used for cell cloning was Excell 302 complete medium containing 50 nM methotrexate. Once the clones had grown out sufficiently, the supernatant of the master well medium was serially diluted and then screened for the expression of -Ig fusion proteins using -IgG sandwich ELISA. Briefly, NUNC immulon II plates were coated overnight at 4°C with a PBS solution of 7.5 μg / ml F(ab’2) goat anti-mouse IgG (KPL Labs, Gaithersburg, MD). The plates were blocked with PBS / 3% BSA, and serial dilutions of the medium supernatant were incubated for 2 - 3 hours at room temperature. The plates were washed 3 times with PBS / 0.05% Tween 20 and incubated with a mixture of horseradish peroxidase-conjugated F(ab’2) goat anti-mouse IgG2a (SouthernBiotechnologies) and goat anti-mouse IgG (KPL), both diluted 1:3500 in PBS / 1.0% BSA, and incubated for 1 - 2 hours at room temperature. The plates were washed 4 times with PBS / 0.05% Tween 20, and binding was detected using SureBlue Reserve, TMB substrate (KPL Labs, Gaithersburg, MD). The reaction was terminated by adding an equal volume of 1N HCl, and the plates were read at 450 nm using a Spectramax Pro microplate reader (Microdevices, Sunnyvale CA). Clones with the highest fusion protein yields were successively amplified into T25 and T75 flasks to provide an appropriate number of cells for cryopreservation and large-scale production of the fusion protein.Cultures from the four best clones were gradually amplified in medium containing methotrexate to further increase their production levels. In each successive passage of the cells. Process The concentration of methotrexate in Excell 302 complete medium was increased such that only cells that had amplified the DHFR plasmid were able to survive. The production levels of the four unamplified master wells from the RNaseIg CHO transfectants ranged from 30 - 50 mg per milliliter of medium, and the master wells were the four wells with the highest production levels. The amplified cultures were immediately assayed to determine their production levels.

[0316] The supernatant of the CHO cells expressing RNase-Ig was collected, filtered using a 0.2 μm PES rapid filter (Nalgene, Rochester, N.Y.), and passed through a protein A-agarose (IPA 300 cross-linked agarose) column (Repligen, Needham, Mass.). The column was washed with column wash buffer (90 mM Tris-base, 150 mM NaCl, 0.05% sodium azide, pH 8.7), and the bound protein was eluted using 0.1 M citrate buffer pH 3.0. The fractions were collected, and the protein concentration was determined at 280 nm using a Nanodrop (Wilmington DE) micro-sample spectrophotometer, with a blank assay using 0.1 M pH 3.0 citrate buffer. The fractions containing the fusion protein were pooled, buffer exchanged using a centricon concentrator with continuous shaking in PBS, and then filtered using a 0.2 μm filter to reduce the likelihood of endotoxin contamination. The extinction coefficient was determined to be 1.05 using the protein analysis tool in the Vector Nti version 10.0 software package (Informax, North Bethesda, Md.), and the cleavage site was predicted using the online ExPasy protein analysis tool.

[0317] Example 5 : SDS-PAGE analysis of RNaseIg fusion protein.

[0318] The purified RNase-Ig (SEQ ID NO:115) was analyzed by SDS-polyacrylamide gel electrophoresis. The fusion protein samples were boiled in SDS loading buffer with or without dithiothreitol reduction, and then loaded onto a SDS 10% Tris-BIS gel (catalog number #NP0301, Novex, Carlsbad, Calif.). Five micrograms of each purified protein were loaded into the gel. After electrophoresis, Coomassie Brilliant Blue staining (Pierce Gel Code Blue staining reagent, catalog number #24590, Pierce, Rockford, Ill.) was performed and the gel was destained with distilled water for protein detection. Molecular weight markers (Kaleidoscope prestained standards, catalog number #161-0324, Bio-Rad, Hercules, Calif) were loaded into the same gel. Other samples were treated as follows: The Rnase-Ig fusion protein was added to the loading buffer (62.5 mM Tris-HCl, pH 6.8, 2% SDS, 10% glycine, 0.01% bromophenol blue, with or without 5% 2-mercaptoethanol) and loaded onto a 4-12% precast gel (Bio-RAD). The gel was run at 100 V until the dye had run off the gel. The gel was stained overnight at room temperature with GelCode Blue (Thermo scientific) and then washed with water.

[0319] Figure 3 The results of the RNase-Ig fusion protein compared to mouse IgG are shown. Rnase-Ig was purified from the supernatant of CHO transfected cells by binding to and elution from protein A agarose. In the SDS-PAGE gel Show , Rnase-Ig was approximately 50 kDa under reducing conditions and approximately 110 kDa under non-reducing conditions.

[0320] Example 6: Detection of RNase-Ig in mouse serum.

[0321] SRED detection

[0322] Prepare a 2% agarose gel using distilled water. Dissolve Poly-IC (Sigma) in distilled water to a concentration of 3 mg / ml and prepare the gel slab as follows: Place 1.5 ml of reaction buffer (0.2 M pH 7.0 Tris-HCl, 40 mM EDTA, and 0.1 mg / ml ethidium bromide), 1 ml of Poly-IC, and 0.5 ml of water in a test tube and maintain at 50 °C for 5 min. Add 3 ml of agarose (maintained at 50 °C) to the test tube. Immediately pour the mixture onto a glass plate. Punch sample wells in the gel. Add 2 μl of each serum sample to each well and incubate the gel in a wet box at 37 °C for 4 hours. Then incubate the gel in buffer (20 mM sodium acetate pH 5.2, 20 mg / ml ethidium bromide) placed on ice for 30 min and detect under UV.

[0323] Figure 4 Shows the RNase activity after intravenous injection of the Rnase-Ig fusion protein (SEQ ID NO: 150) (purified from the supernatant of COS transfected cells in this experiment by binding to and eluting from protein A agarose) in three mice (410, 413, and 418). The top row is the standard. Note the second injection in mouse 410 two weeks later (see arrow). Take 2 μl of serum from each of the three mice and add to a 1% agarose gel containing 0.5 mg / ml poly-C. Incubate the gel in a wet box at 37 °C for 4 hours and then in Buffer a solution containing 20 mM sodium acetate and 20 μg / ml ethidium bromide for 30 min. The RNase activity is reflected by the size and intensity around the central well. This data shows an extended half-life of the Rnase-Ig fusion protein in mouse serum.

[0324] Example 7 : Anti-RNA ELISA to detect RNA-specific antibodies in mouse serum.

[0325] Coat a 96-well plate (Nunc, Thermo Fisher scientific) with 50 μg / ml poly-L-lysine (Sigma) overnight. Wash the plate five times with PBS containing 0.05% Tween, and then coat the plate with PBS containing 10 μg / ml yeast RNA at 4 °C overnight. After washing the plate five times, block the plate with PBS containing 1% BSA at room temperature for 2 hours. Add the 1:50 diluted serum sample to the plate and incubate overnight at 4 °C. Use the hybridoma H564 (anti-RNA) medium as a standard, and perform serial two-fold dilutions starting from a ratio of 1:300. The detection antibody is anti-mouse IgG conjugated with alkaline phosphatase (Jackson Lab), which is diluted at a ratio of 1:5000 and added to the plate, and incubated at room temperature for 1 hour. Dissolve alkaline phosphatase (Sigma) in the chromogenic buffer (Thermo Fisher Scientific) and add it to the plate at a volume of 50 μl / well. Read the samples at 405 nm using a Spectramax Plus microplate reader (Microdevices, Sunnyvale, CA).

[0326] Figure 5 The ELISA titer results of anti-RNA antibodies before and after intravenous injection of RNase-Ig fusion protein (SEQ ID NO: 150) into mouse 410 are shown. Coat the plate pre-coated with poly-L-lysine (50 μg / ml) with 10 μg / ml yeast RNA. Add the serum (1:50) to the plate and incubate overnight at 4 °C. Use the detection antibody anti-mouse IgG-alkaline phosphatase (Jackson Labs) at a ratio of 1:5000 and incubate at room temperature for 1 hour, Subsequently add the phosphatase substrate and read the absorbance at 405 nm. The data show that injection of Rnase-Ig results in a decrease in anti-RNA antibody titer that persists for more than 3 weeks.

[0327] Figure 6 The ELISA titer results of anti-RNA antibodies before and after injection of RNase-Ig fusion protein (SEQ ID NO: 150) in mouse 413 over a three-week period are shown. The experimental procedure is as described for mouse 410. After injection of Rnase-Ig, the titer of anti-RNA antibodies decreases.

[0328] Example 8: Inhibition of IFN-α production by human PBMC after addition of RNaseIg in vitro cultures 。

[0329] The addition of RNase-Ig (SEQ ID NO:150) terminated the induction of interferon-α in human peripheral blood monocytes stimulated with immune complexes formed by the serum of an SLE patient (J11) and nuclear extract (NE). Briefly, ELISA plates were coated with 50 μl of capture antibody (anti-IFNα, PBL 21112-1, Piscataway, NJ) diluted at a ratio of 1:2500 and incubated overnight at 4°C. The plates were washed with PBS / 0.05% Tween 20, blocked with PBS / 1% BSA for 2 h at room temperature, washed with PBS / 0.05% Tween 20, and incubated with a standard dilution of IFN-α or serial dilutions of serum samples for 2 h at room temperature. The plates were washed and incubated with the detection antibody (PBL 31101-2, Piscataway, NJ) diluted 1:2000 in PBS / 1% BSA. The plates were washed with PBS / 0.05% Tween 20 and incubated with 50 μl of donkey anti-rabbit HRP (Jackson Immunoresearch, Westgrove, PA) diluted 1:12,000 in PBS / 1% BSA. The plates were washed five times before adding the TMB substrate. The reaction was terminated by adding 1 / 2 volume of 2N H2SO4, and the samples were read at 450 nm in a Spectramax Pro microplate reader (MicroDevices, Sunnyvale, CA). The results are shown in Figure 7 , and the results showed that the addition of RNase-Ig terminated the induction of interferon-α in human peripheral blood monocytes stimulated with immune complexes, the Immune complex formed by the serum of an SLE patient (J11) and nuclear extract.

[0330] Example 9 : Phenotype of TLR7.1xRNaseA double transgenic mice.

[0331] A mouse overexpressing RNaseA (RNase Tg) was generated. This nuclease had a high expression level in RNase Tg mice (see Figure 8 ). A single-phase enzyme diffusion (SRED) assay (left panel) and a quantitative ELISA were developed that were able to more accurately quantify RNase in serum (see Figure 9 ). We crossed RNaseA Tg with TLR7.1 Tg mice to obtain double Tg (DTg) with 8 - 16 copies of TLR7. TLR7.1 mice develop a very severe and rapidly progressive lupus-like disease and start to die at 3 months of age, with a median survival of 6 months. In a preliminary analysis, blood samples were collected from 3-month-old DTg and their littermate controls to determine if there were signs of improvement in DTg mice. As Figure 8As shown, the RNase level in the serum of DTg mice is very high (equivalent amount > 13 U / ml RNase, specific activity of the standard product is 993 U / mg). The concentration of RNase A in Tg and DTg mice was measured by ELISA, and the results are shown in Figure 9 . The serum concentration of RNase A in RNase A Tg and TLR7.1XRNaseA Dtg mice is between 1 - 2 ng / ml.

[0332] Rnase A Detailed method of ELISA (Example 9, Figure 9 )

[0333] 1. Coat the plate with anti-RnaseA Abcam Ab (ab6610): 2.5 - 10 μg / ml O / N, 4°C.

[0334] 2. Wash the plate 3 times with 0.05% Tween / 1X PBS.

[0335] 3. Block with PBS containing 1% BSA for at least 1 hour.

[0336] 4. Wash the plate 3 times with 0.05% Tween / 1X PBS.

[0337] 5. Load the samples, diluted 1:50.

[0338] 6. Incubate for 2 hours at room temperature.

[0339] 7. Wash the plate 3 times with 0.05% Tween / 1X PBS.

[0340] 8. Prepare a biotinylated anti-Rnase antibody diluted 1:4500 (2.2 μg / ml). Let it stand at room temperature for 1 hour (Rockland 200 - 4688: 10 mg / ml).

[0341] 9. Wash the plate 3 times.

[0342] 10. Dilute StrepAV HRP (Biolegend 405210) at a ratio of 1:2500. Cover with foil and let it stand at room temperature for 25 - 30 min.

[0343] 11. Wash the plate 6 times, and let the liquid stay in each well for at least 30 s between two washes.

[0344] 12. Add BD OptEIA substrate A + B 1:1. Let it stand until the color changes, up to 5 - 10 min. The reading of the standard product in the top well should not exceed 1.0. Add 80 μl. (Catalog number: 51 - 2606KC; reagent A, 51 - 2607KC; reagent B)

[0345] 13. Add 40 μl of 1 M sulfuric acid to terminate the reaction

[0346] Product / Reagent Information:

[0347] RNaseA Ab: ab6610 (90 mg / ml)

[0348] ELISA buffer: PBS containing 1% BSA

[0349] ELISA wash buffer: 0.05% Tween / 1X PBS

[0350] Anti-RNaseA biotin-conjugated Ab: Rockland: 200-4688 (10 mg / ml)

[0351] Strep AV HRP: Biolegend 405210

[0352] BD OptEIA reagents A and B: 51-2606KC and 51-2607KC

[0353] Example 10 : Survival curve of TLR7.1 transgenic mouse line.

[0354] There are very significant differences in the survival rates between DTg and TLR7.1 littermate controls. As Figure 10As shown, at 10 months, 61% of TLR7.1 mice died, while 31% of DTg mice died. This data shows that overexpression of RNaseA produces a powerful therapeutic effect. Although severe anemia, thrombocytopenia, and glomerulonephritis played a part in this, the reason for the premature death of TLR7.1 mice is not fully clear. To determine whether red blood cell and platelet counts in DTg mice were indeed affected by RNaseA expression, we performed blood counts, but no differences were found between TLR7.1 and DTg mice. Instead, significant improvement was seen in renal histopathology in DTg mice. We observed reduced deposition of IgG and C3 in DTg mice. PAS staining, which reflects glomerular membrane inflammation, was also reduced in DTg mice compared to TLR7.1 littermate controls. When comparing macrophage infiltration in the kidneys with anti-MAC-2 (galectin 3) antibody (Lyoda et al. Nephrol Dial Transplat 22:3451, 2007), fewer mac-2 positive cells were found in the glomeruli of DTg mice. Counting 20 glomeruli per mouse in 5 mice per group showed that the mean ± SE for single and DTg were 3.8 ± 1.1 and 1.4 ± 0.2, respectively, p =.05. In addition, the size of the glomerular tuft was quantitatively measured, and a significant reduction in the size of the glomerular tuft was observed in DTg mice (179 ± 41 and 128 ± 16.8 μm2 in single and DTg, respectively, p = 0.037). In summary, the survival period of TLR7.1 X RNaseA DTg mice was significantly longer than that of their single Tg TLR7.1 littermates, and inflammation and damage in the kidneys were reduced.

[0355] Example 11 : IRG analysis in spleen of TLR Tg mice.

[0356] Analysis of interferon-responsive genes (IRGs) in the spleens of TLR7.1 Tg and TLR7.1 X RNaseA DTg mice showed that the expression of the IRF7 gene was significantly reduced in DTg mice (p = 0.03). Compared to Tg mice, some other IRGs including MX1 and VIG1 were reduced in DTg mice, but this difference was not significant. See Figure 11Quantitative PCR was performed as follows: Total RNA was isolated from mouse spleens using the RNeasy mini kit (Qiagen, Valencia, CA, USA), and DNase was treated with Turbo-DNA-free (Applied Biosystems, Foster City, CA, USA). First-strand cDNA was prepared using random primers with the RNA-to-cDNA kit (Applied Biosystems). The 260 / 280 of the isolated RNA was detected using NanoDrop (Thermo Scientific, Waltham, MA, USA) to be between 1.7 and 2.0. The cDNA was diluted to be equivalent to 1 ng / μl of total RNA, and 8 μl was used for each reaction. Primers for the control gene (18s) and the gene of interest (GOI) were synthesized (IDT, Coralville, Iowa, USA) and diluted with molecular-grade water to a concentration suitable for qPCR. The BLAST results of the primers showed that they were specific sequences homologous only to the control gene or GOI. The reactions were set up in duplicate (20 μl) and carried out in an ABI Fast7500 system using the SensiMix SYBR low-ROX master mix (Bioline, London, UK) containing a 1:1 mixture of template and primer. The relative amounts were calculated by the 2 -ddCT -ΔΔCt method, and age-matched wild-type B6 mice were used as the baseline to determine the fold change of each GOI. The dissociation curves of the reactions showed a single melting peak for each gene. The standard curves showed that each gene had a similar amplification efficiency and the template concentration was within the linear kinetic range of each primer.

[0357] Example 12: Structure of the generated hybrid nuclease molecule.

[0358] Hybrid nuclease molecules are designed to incorporate the desired structural and functional activities. The single- or multi-enzyme structures of these molecules are compatible with restriction enzyme sites as modular cassettes for shuttle and domain exchange. Schematic structures of different embodiments of the hybrid nuclease molecules are shown in Figure 12 . The primers are shown in Table 1. The nucleotide and amino acid sequences of representative hybrid nuclease molecules are shown in Table 2.

[0359] General pathway for generating hybrid nuclease molecules

[0360] Human cDNA was isolated from human pancreatic RNA (Ambion) or human PBMC RNA was isolated from normal human peripheral blood lymphocytes (approx. 5x10e6) using the QIAgen RNAeasy kit (Valencia, CA). The cell lysates were homogenized using the QIAshredder kit (Qiagen, Valencia, CA). Human PBMCs were isolated from heparinized human blood diluted 1:1 with D-PBS and layered using Ficoll gradient LSM lymphocyte separation medium (MP Biomedicals, Irvine, CA).

[0361] Mouse spleen RNA was isolated from approximately 5x10e6 splenocytes using the QIAgen RNAeasy kit (Valencia, CA). Cells were collected by centrifuging the medium and RNA was prepared using 5x10e6 cells. Total RNA was isolated from the cells using the QIAGEN RNAeasy kit (Valencia, Calif.) total RNA isolation kit and the QIAGEN QIAshredder according to the kit and the manufacturer's instructions supplied with the kit. 1 to 2 micrograms (1-2 μg) of total RNA was used as a template for cDNA preparation by reverse transcription. The RNA, 300 ng of random primers, 500 ng of oligo dT (12-18), and 1 μl of 25 mM dNTP were mixed and denatured at 80°C for 5 minutes before the addition of the enzyme. Superscript III reverse transcriptase (Invitrogen, Life Technologies) was added to the mixture of RNA and primers in a total volume of 25 μl, which also contained 5x the second strand buffer and 0.1 M DTT added with the enzyme. The reverse transcription reaction was carried out at 50°C for one hour.

[0362] 10 - 100 ng of cDNA is used for PCR amplification reactions using primers specific for target nuclease genes (RNaseA, RNase1, DNase1, Trex1, DNase1L3, etc.). For the initial cloning reaction, primers are designed to isolate full-length cDNA or truncated products encoding the target gene. Full-length or shortened PCR fragments are separated by agarose gel electrophoresis and purified using a Qiagen QIAquick column to remove nucleotides, primers, and unwanted amplification products. The purified fragments are cloned into the pCR2.1 TOPO cloning vector (Invitrogen, Carlsbad, CA) and transformed into TOP10 competent bacteria. Isolated clones are picked and inoculated into Luria Broth medium containing 50 μg / ml carbenicillin and grown overnight to isolate plasmids. The TOPO clones are screened for correct digestion to the proper size with the restriction enzyme EcoRI (NEB, Ipswich, MA), and the digested fragments are analyzed by agarose gel electrophoresis. Positive clones are analyzed for DNA sequence using an ABI ready reaction mix v 3.1 and an ABI 3730XL DNA sequencer. After obtaining the correct clone, further sequence modifications are designed and PCR reactions are performed to generate the desired alleles or expression cassettes. Truncated products and alleles are generated using PCR mutagenesis, which uses overlapping primers to introduce mutations at specific sites in the gene. By overlap PCR, adapters are synthesized using internal overlapping primers and additional sequences are ligated to both ends through successive PCR cycles. Hybrid nuclease molecules are assembled as a string of several interchangeable cassettes. The molecules in the preferred embodiment include a fixed leader peptide, a nuclease cassette, an optional cassette encoding several different alternative polypeptide linkers, a stop codon or linker at the carboxyl terminus of the CH3 domain and an -Ig Fc domain cassette for resolvICase-type molecules, a second linker cassette, followed by a second nuclease cassette. Figure 12 Examples of the cassette structures of these hybrid nuclease molecules and the possible sequences inserted at each site are shown. After assembling the hybrid nuclease molecules, they are transferred to the mammalian expression plasmid pDG, which is suitable for transient expression in COS7 or other cells and stable expression in CHO DG44 cells selected with methotrexate for DHFR.

[0363] Transient expression of hybrid nuclease molecules

[0364] COS-7 cells were transiently transfected with the expression vector pDG containing a hybrid nuclease molecule inserted gene. One day before transfection, the cells were seeded at a density of 4x10e5 cells per 60 mm dish in 4 ml of DMEM (ThermoFisher / Mediatech cell gro) + 10% FBS tissue culture medium. The DMEM basal medium was supplemented with 4.5 g / L glucose, sodium pyruvate, 4 mM L-glutamine, and non-essential amino acids. Fetal bovine serum (Hyclone, Logan, UT ThermoFisher Scientific) was added to the medium at a final volume of 10%. The cells were incubated overnight at 37 °C in 5% CO2 and reached approximately 40 - 80% confluence on the day of transfection. Plasmid DNA was prepared using the Qiagen (Valencia, CA) QIAprep miniprep kit according to the manufacturer's instructions and eluted into 50 μl of EB buffer. The concentration of DNA was measured using a Nanodrop 1000 (Thermo Fisher Scientific, Wilmington DE) spectrophotometer. Plasmid DNA was transfected using the Polyfect (Qiagen, Valencia, CA) transfection reagent according to the manufacturer's instructions. 2.5 μg of plasmid DNA and 15 μl of polyfect reagent dissolved in 150 μl of serum-free DMEM transfection mixture were added per 60 mm dish. After mixing, the reaction was diluted to 1 ml in cell growth medium containing serum and all additives and added dropwise to a dish containing 3 ml of fresh complete DMEM medium. The transient transfection was incubated for 48 - 72 hours before collecting the culture medium supernatant for further analysis.

[0365] Stable CHO Passage of DG44 transfectants expressing the target hybrid nuclease molecule

[0366] The selectable, amplifiable plasmid pDG containing RNase-Ig cDNA was introduced into Chinese hamster ovary (CHO) cells by electroporation under the control of the CMV promoter to achieve stable production of hybrid nuclease molecules. The pDG vector is a modified version of pcDNA3, and the pDG vector encodes a DHFR selectable marker with a weakened promoter to increase the selection pressure of the plasmid. Plasmid DNA was prepared using the Qiagen maxiprep kit and linearized at the unique AscI site before phenol extraction and ethanol precipitation. Salmon sperm DNA (Sigma-Aldrich, St. Louis, Mo.) was added as carrier DNA, and 100 μg each of plasmid and carrier DNA were used for electroporation transfection of 10 7CHO DG44 cells. Cells were grown to the logarithmic phase in Excell 302 medium (JRHBiosciences) (hereinafter referred to as "Excell 302 complete" medium), which contained glutamine (4 mM), sodium pyruvate, recombinant insulin, penicillin-streptomycin, and 2xDMEM non-essential amino acids (all from Life Technologies, Gaithersburg, Md.). The medium used for non-transfected cells also contained HT (100x solution diluted from hypoxanthine and thymidine) (Invitrogen / Life Technologies). The medium for selective transfection contained different levels of methotrexate (Sigma-Aldrich) as a selection agent, ranging from 50 nM to 1 μM. Electroporation was performed at 280 V and 950 μF. Transfected cells were allowed to recover overnight in non-selective medium and then selectively seeded at different serial dilutions ranging from 125 cells / well to 2000 cells / well into 96-well flat-bottom culture plates (Costar). The medium used for cell cloning was Excell 302 complete medium containing 50 nM methotrexate. After the clones had grown out sufficiently, the supernatant of the master well medium was serially diluted and used to screen for the expression of -Ig fusion proteins using -IgG sandwich ELISA. Briefly, NUNC immulon II plates were coated overnight at 4 °C with 7.5 μg / ml F(ab’2) goat anti-mouse IgG PBS solution (KPL Labs, Gaithersburg, MD) or 2 μg / ml goat anti-human or anti-mouse IgG (Jackson Immunoresearch, West Grove PA). The plates were blocked with PBS / 2-3% BSA, and serial dilutions of the medium supernatant were incubated at room temperature for 2-3 hours. The plates were washed 3 times with PBS / 0.05% Tween 20 and incubated with a mixture of horseradish peroxidase-conjugated F(ab’2) goat anti-mouse IgG2a (Southern Biotechnologies) and goat anti-mouse IgG (KPL), both diluted 1:3500 in PBS / 1.0% BSA, or with horseradish peroxidase-conjugated F(ab’2) goat anti-human IgG1 (Jackson Immunoresearch, West Grove, PA) diluted 1:2500, at room temperature for 1-2 hours. The plates were washed 4 times with PBS / 0.05% Tween 20, and binding was detected using SureBlue Reserve, TMB substrate (KPL Labs, Gaithersburg, MD).The reaction was terminated by adding an equal volume of 1N HCl, and the plate was read at 450 nm using a Spectramax Pro microplate reader (Microdevices, Sunnyvale CA). Clones with the highest fusion protein yields were successively amplified in T25 and T75 flasks to provide a suitable number of cells for cryopreservation and large-scale production of the fusion protein. Cultures from the four best clones were gradually amplified in medium containing methotrexate to further increase their production levels. During each successive passage of the cells, the concentration of methotrexate in Excell 302 complete medium was increased so that only cells that had amplified the DHFR plasmid could survive.

[0367] The supernatant of CHO cells expressing the hybrid nuclease molecule was collected, filtered using a 0.2 μm PES rapid filter (Nalgene, Rochester, N.Y.), and passed through a Protein A-agarose (IPA 300 cross-linked agarose) column (Repligen, Needham, Mass.). The column was washed with column wash buffer (90 mM Tris-base, 150 mM NaCl, 0.05% sodium azide, pH 8.7), and the bound protein was eluted with 0.1 M citric acid buffer at pH 3.0. Fractions were collected, and the protein concentration was determined at 280 nm using a Nanodrop (Wilmington DE) micro-sample spectrophotometer, with a blank measurement using 0.1 M citric acid buffer at pH 3.0. The fractions containing the fusion protein were pooled and buffer-exchanged by continuous shaking in PBS using a centricon concentrator, followed by filtration through a 0.2 μm filtration device to reduce the likelihood of endotoxin contamination.

[0368] Example 13 : Enzymatic kinetic analysis of hRNase1-G88D-hIgG1[SCCH-P238S-K322S-P331S].[[]END]

[0369] As described for the nuclease molecule in Example 12, the human RNase1 sequence was isolated from human pancreas RNA by random primer cDNA reverse transcription and PCR amplification. The following primers were used from the primer set in the PCR primer table, 50 pmol per reaction.

[0370] hRNase5’age: accggtaaggaatcccgggccaagaaattcc (SEQ ID NO:16)

[0371] hRNase3’bx: ctcgagatctgtagagtcctccacagaagcatcaaagtgg (SEQ ID NO:17)

[0372] The following two primers were used to construct the mutation of human RNase G88D in PCR and overlap PCR reactions to introduce a mutation at position 88, converting the enzyme resistance into a cytoplasmic inhibitor.

[0373] hRNaseG88D-S: agactgccgcctgacaaacgactccaggtaccc (SEQ ID NO:18)

[0374] hRNAseG88D-AS: gggtacctggagtcgtttgtcaggcggcagtct (SEQ ID NO:19)

[0375] As described above for hybrid nuclease molecules, wild-type and mutant human RNase1 were isolated and cloned. The wild-type sequence was cloned using the first two primers listed above. After TOPO cloning and sequencing of the RNase fragment, the AgeI-XhoI cassette was transferred into the pDG expression vector, which already contained the human VK3LP insert and the human IgG1-WT cassette. The construct was verified by enzymatic digestion, and plasmid DNA for transient transfection was prepared. After confirming the function from small-scale transient transfection, the molecule was stably transfected into CHO DG44 to express an amount sufficient for further in vitro analysis. The wild-type human RNase1 fusion protein is shown in Table 2, hVK3LP-hRNase1-WT-hIgG1-WT (SEQ ID NO:163). Similarly, wild-type human RNase1 was also expressed as a fusion gene with a (gly4ser)4 (SEQ ID NO:125 or SEQ ID NO:161) or (gly4ser)5 (SEQ ID NO:126 or SEQ ID NO:162) linker domain inserted between the hRNase cassette and the hIgG1 Fc domain. The G88D mutation of human RNase1 was expressed as a fusion gene, named hVK3LP-hRNase-G88D-hIgG1-WT (SEQ ID NO:124 or 160) or hIgG1-SCCH-P238S-K322S-P331S (SEQ ID NO:174 or 175), listed in Table 2.

[0376] The Lineweaver Burk curve of the enzyme kinetics of the mutant hRNase1-G88D-hIgG1[SCCH-P238S-K322S-P331S] (SEQ ID NO:175) is as Figure 13As shown, to further define the functional characteristics of the bivalent RNase-Ig fusion protein, the Michaelis constant Km was preliminarily detected. The enzyme kinetics of the purified human RNase1-Ig fusion protein was determined using the RNase Alert substrate (Ambion / IDT, San Diego, CA.) according to the manufacturer's instructions, and fluorescence detection was performed using a Spectramax M2 microplate reader (Molecular Devices, Sunnyvale, CA). Fluorescence data was collected every 30 s during a 30-minute incubation period and analyzed using SoftmaxPro software (Molecular Devices). The reaction rates at different substrate concentrations were measured, and the data is shown in the Lineweaver Burke curve.

[0377] Example 14 : Analysis of the binding of hRNase1-hIgG to human monocyte cell line.

[0378] The protein A-purified hybrid nuclease molecule hRNase1-hIgG1-WT was co-incubated with the human monocytic cell lines THP-1 or U937 to evaluate the FcR-mediated binding of molecules containing wild-type or mutant Fc. Figure 14 The binding pattern of hRNase1-WT-hIgG1-WT (SEQ ID NO: 161) to these two cell lines is shown. The cells were incubated on ice with PBS / 2% FBS containing 5 μg / ml of the purified fusion protein for 45 minutes, washed three times in PBS / 2% FBS, and incubated on ice with FITC-goat anti-human IgG (Fc specific) (Jackson Immunoresearch, West Grove, PA) for 45 minutes, and the antibody was diluted at a ratio of 1:200. The cells were washed twice in PBS / 2% FBS and analyzed using a FACS Canto (BD, Franklin Lakes, NJ) flow cytometer and FlowJo software (TreeStar, Ashland, OR).

[0379] Example 15 : IVIg Block Binding of hRNase1-hIgG1 to human monocyte cell line.

[0380] Pre-incubate THP-1 or U937 cells with IVIg at an initial concentration of 10 mg / ml and perform serial dilutions in a 10-fold ratio in each well of a 96-well plate. Incubate the cells (approximately 1x10e6 per well) on ice for 45 minutes. Wash the cells twice before binding, and add approximately 5 μg / ml of AF750-conjugated hRNase1-WT-hIgG1-WT (SEQ ID NO:161) to each well. Incubate on ice for 45 minutes for the binding reaction, wash twice in PBS / 2% FBS, and perform flow cytometry analysis as described above. IVIg was able to partially block the binding of the labeled nuclease fusion protein, but even at 10 mg / ml, there was still detectable residual binding above background. Figure 15 Shows the blocking activity of human IVIg against the binding of hRNase1-WT-hIgG1-WT (SEQ ID NO:161) to U937 and THP-1 cells.

[0381] Example 16 : Trex1-Ig activity assay.

[0382] Mouse Trex1 was cloned from mouse cDNA using the following primers:

[0383] mTrex1-5’age: accggtatgggctcacagaccctgccccatggtcaca (SEQ ID NO:20)

[0384] mTrex1-3’bx: ctcgagatctgttgttccagtggtagccggagtgccgtacatg (SEQ ID NO:21)

[0385] 50 pmol of each primer was used in the PCR reaction with a total volume of 50 μl, and the reaction was carried out for 35 amplification cycles under the amplification conditions of 94 °C for 30 s; 50 °C for 60 s; 68 °C for 90 s. As previously described for the cloning of the example nuclease fusion gene, the PCR product was cloned into the pCR2.1 vector and TOPO clones were screened. After verifying the sequence, the cassette was subcloned into the pDG expression vector fused with the mIgG tail, or co-cloned with one of the (g4s)n linkers to construct Trex1-lnk molecules with different linker lengths. The isolated plasmids were transiently transfected into COS cells as described above and stable CHO transfectants used for the example nuclease fusion gene as described above.

[0386] Construction of the Trex1Ig fusion gene is as follows: The gene with the human VK3 leader peptide is fused with murine Trex1, where Trex1 is truncated by 72 amino acids at the COOH terminus (removing the intracellular nucleic acid targeting sequence), then fused with a (gly4ser)4 (SEQ ID NO: 130) or (gly4ser)5 linker (SEQ ID NO: 131), and then fused with the murine IgG2a / c allele, with some alterations introduced into the IgGc sequence of the Balb / c IgG2a allele by fusion.

[0387] The exonuclease activity of Trex1-Ig was assayed in a 30 μl reaction system containing 20 mM Tris (pH 7.5), 5 mM MgCl2, and 3 mM DTT, using a 36-mer oligonucleotide as the substrate. The incubation reaction was carried out at 37 °C for 20 - 30 min. Samples were electrophoresed overnight on a 23% polyacrylamide DNA gel. The gel was incubated in TBE buffer containing 0.5 μg / ml ethidium bromide. DNA was visually inspected under UV transillumination and photographed using a Kodak EDAS290 digital camera equipped with an ethidium bromide filter, and analyzed using Kodak molecular imaging software. The results of the trex1 activity assay of mTrex1-(g4s)4-mIgG2a-c (SEQ ID NO: 166) and mTrex1-(g4s)5-mIgG2a-c (SEQ ID NO: 167) produced by COS are shown in Figure 16 .

[0388] Example 17 : by Western blot of single hybrid nuclease molecule mTrex1-Ig produced by transient transfection of COS-7.

[0389] As shown below, COS-7 cells were transiently transfected with a plasmid containing the encoded hybrid nuclease molecule Trex1-Ig: The gene with the human VK3 leader peptide was fused to murine Trex1, which was truncated by 72 amino acids at the COOH terminus (removing the intracellular nucleic acid targeting sequence), then fused with a (gly4ser)4 (SEQ ID NO:130) or (gly4ser)5 linker, and then fused with the murine IgG2a / c allele, with some alterations introduced into the IgGc sequence of the Balb / c IgG2a allele by the fusion. After 72 hours, the COS supernatant was collected, and 0.5 - 1.0 ml of the sample (depending on different experiments) was immunoprecipitated with 100 μl of protein A-agarose beads at 4°C. The protein A beads were centrifuged, washed twice with PBS, and then resuspended in reducing SDS-PAGE loading buffer. The sample was heat-treated at 100°C for 5 minutes, the protein A beads formed a pellet after centrifugation, and the loading buffer was added to a 10% SDS-PAGE gel. The sample was electrophoresed at 150 V for 1.5 - 2 hours, and the gel was transferred to a nitrocellulose membrane at 30 mAmp for 1 hour. The Western blot was blocked overnight with TBS / 5% non-fat milk powder. The blot was incubated with 1:2500 HRP (horseradish peroxidase)-conjugated goat anti-mouse IgG2a / c (Fc-specific, KPL) at room temperature for 1.5 hours, washed five or more times in PBS / 0.5% Tween 20, and the blot was developed using ECL reagent. Figure 17 Immunoprecipitation Western blot of COS7 culture medium supernatant, where COS7 expresses the mTrex1-(g4s)4 (SEQ ID NO:166) or (g4s)5-mIgG2a-c (SEQ ID NO:167) fusion protein.

[0390] Example 18: Exonuclease activity of the fusion protein from DNase1L3Ig CHO.

[0391] DNase1L3 was cloned from murine spleen cDNA, and the following primer pairs were used to clone mDNase1L3 containing its native leader peptide sequence:

[0392] mdnase1L3-NL: GTT AAG CTT GCC ACC ATG TCC CTG CAC CCA GCT TCC CCA CGCCTG (SEQ ID NO:22)

[0393] Mdnase1L3-3bx: CTC GAG ATC TGA GGA GCG ATT GCC TTT TTT TCT CTT TTT GAGAG (SEQ ID NO:23)

[0394] Alternatively, use the following primer pairs to initiate a PCR reaction with the human VK3 leader peptide replacing the native leader peptide.

[0395] mdnase1L3-age: ACC GGT CTA AGG CTC TGC TCC TTC AAT GTG AGG TCC TTT GGA (SEQ ID NO:24)

[0396] Mdnase1L3-3bx: CTC GAG ATC TGA GGA GCG ATT GCC TTT TTT TCT CTT TTT GAGAG (SEQ ID NO:25)

[0397] In the PCR reaction, 50 pmol of each primer was used, and the total volume was 50 μl. The reaction was carried out under the amplification conditions of 94 °C for 30 s; 50 °C for 60 s; 68 °C for 90 s for 35 amplification cycles. As described previously for the cloning of the exemplary nuclease fusion gene, the PCR product was cloned into the pCR2.1 vector and TOPO clones were screened. After verifying the sequence, the cassette was subcloned into the pDG expression vector fused with the mIgG tail. The isolated plasmid was transiently transfected into COS cells as described above and stable CHO transfectants for the exemplary nuclease fusion gene as described above.

[0398] The exonuclease activity of the protein extract from the DNase1L3Ig (SEQ ID NO:185) CHO clone was detected in a 30 μl reaction system containing 20 mM Tris (pH 7.5), 5 mM MgCl2, 2 mM DTT, and the substrate. The incubation reaction was carried out at 37 °C for 20 - 30 min. The samples were electrophoresed in an agarose DNA gel overnight. The gel was incubated in TBE buffer containing ethidium bromide. The DNA was visualized under UV. The results of the chromatin digestion analysis are shown in Figure 18 .

[0399] Example 19: Dose titration of the effect of increasing the CHO supernatant volume on exonuclease activity.

[0400] Figure 19 Results of a titration analysis of the exonuclease cleavage type of the COS supernatant, where the COS expresses the DNase1L3Ig fusion protein (SEQ ID NO: 183 or 185). Detection of nuclear DNA degradation was performed as follows: HeLa cells were cultured in DMEM medium, nuclei were collected from 10e5 cells, and separated using NP-40 lysis buffer. The nuclei were diluted into 200 μl of reaction buffer containing 10 mM Hepes (pH 7.0), 50 mM NaCl, 2 mM MgCl2, 2 mM CaCl2, and 40 mM β-glycerophosphate. The nuclei were incubated at 37 °C for 3 hours. The numbers marked on the figure are the volumes of the COS cell culture supernatant transfected with DNase1L3. Nuclear DNA was isolated using the QiAmp Blood DNA Micro Kit. DNA was analyzed by 1.5% agarose gel electrophoresis. In the control reaction, 250 i.u. / ml heparin was used to inhibit nuclease activity.

[0401] Example 20: Construction and expression of DNase1-Ig single and double enzyme hybrid nuclease molecules.

[0402] Natural alleles of human DNase1 or DNase1-like molecules have been reported. The A114F mutation that occurs in natural variants of the human DNAse1-like enzyme has been previously reported and causes actin resistance of the enzyme that contains this sequence alteration. See, Pan, CQ, Dodge TH, Baker DL, Prince WE, Sinicropi DV, and Lazarus RA. J Biol Chem 273:18374-18381, (1998); Zhen A, Parmelee D, Hyaw H, Coleman TA, Su K, Zhang J, Gentz R, Ruben S, Rosen C, and Li Y. Biochem and Biophys Res Comm 231:499-504 (1997); and Rodriguez AM, Rodin D, Nomura H, Morton CC, Weremowicz S, and Schneider MC. Genomics 42:507-513 (1997), the entire contents of which are incorporated herein by reference in their entirety.

[0403] Similarly, it has recently been reported that the G105R mutation is a single nucleotide polymorphism in the gene encoding human DNAse 1, which is polymorphic in some or all populations and is associated with autoimmunity. (See, Yasuda T, Ueki M, Takeshita H, Fujihara J, Kimura-Kataoka K, Lida R, Tsubota E, Soejima M, Koda Y, Dato H, Panduro A. Int J Biochem Cell Biol 42(7):1216-1225(2010), which is incorporated herein by reference). The allelic variant at this locus is a highly active DNase1 isoform compared to the wild type. Another naturally occurring, polymorphic mutation (R21S) has also been reported to have higher activity (see Yasuda, supra).

[0404] It has been reported that the activity level of DNase1 is significantly reduced in patients with systemic lupus erythematosus (see, Martinez-Valle F, Balada E, Ordi-Ros J, Bujan-Rivas S, Sellas-Fernandez A, Vilardell-Tarres M. Lupus 18(5):418-423(2009), which is incorporated herein by reference).

[0405] When administered to patients, naturally occurring enzyme variants may have lower immunogenicity because these isoforms are present in the population. We have demonstrated in detail that combining an allele similar to A114F with actin-resistant properties with an allele like G105R that can increase enzyme activity will generate new human DNase1 allelic variants that may exhibit improved clinical activity in vitro and in vivo. To our knowledge, we report for the first time the generation of a new mutant form of said DNase1 by combining two naturally occurring variants, G105R and A114F.

[0406] Human DNase1 was isolated from human pancreas RNA (Ambion) by the method described above, cDNA was obtained by random primers and PCR was performed using the following primer sets:

[0407] 5’hDNase1-age: GTT ACC GGT CTG AAG ATC GCA GCC TTC AAC ATC CAG (SEQ ID NO:26)

[0408] 5’hDNase1-bx: GTT CTC GAG ATC TTT CAG CAT CAC CTC CAC TGG ATA GTG(SEQID NO:27)

[0409] Alternatively, use the following primer pairs to amplify the 3’ DNase cassette by PCR.

[0410] 3’hDNase1-RV: GTT GAT ATC CTG AAG ATC GCA GCC TTC AAC ATC CAG(SEQ IDNO:28)

[0411] 3’hDNase1-stop: GTT TCT AGA TTA TCA CTT CAG CAT CAC CTC CAC TGG ATAGTG(SEQ ID NO:29)

[0412] Perform a PCR reaction using Platinum PCR Supermix described above under the conditions that each primer is 50 pmol, 2 μl cDNA, and the total volume is 50 μl. Conduct 35 amplification cycles under the amplification conditions of 94 °C for 30 s; 55 °C for 30 s; 68 °C for 90 s.

[0413] After obtaining the wild-type gene by PCR amplification, the gene fragment was subjected to gel electrophoresis, and the 850 bp fragment was purified using a QIAquick column. The fragment was cloned into pCR2.1 and transformed by TOPO cloning according to the manufacturer's instructions as described for other constructs. After verifying the sequence, PCR primers were used to produce sub-fragments containing the naturally occurring alleles of DNase1, which have been reported to have improved specific activity and improved resistance to actin inhibition. These sub-fragments contain folding sequences that allow for the amplification of full-length DNase1 sub-clones containing the desired allelic variants described above. COS 7 cells were transiently transfected in 60 mm dishes using Polyfect (Qiagen, Valencia, CA) transfection reagent. Plasmid DNA was prepared using the Qiagen QIAprep Miniprep Kit according to the manufacturer's instructions. The plasmid was eluted into 50 μl of EB buffer. The concentration of DNA was detected using Nanodrop, and 2.5 μg of plasmid DNA was used for each transfection reaction. Each DNaseIg (SEQ ID NOS.: 118, 119, 120, 121, 122, or 123) or RNase-Ig-DNase (SEQ ID NOS.: 115, 116, 117) expression cassette was inserted into the expression vector pDG, which was derived from pcDNA3.1 for mammals. The transfected cells were incubated at 37 °C in 5% CO2 for 72 hours before collecting the culture supernatant for further analysis. The culture supernatant was collected, centrifuged to remove residual cells in the solution, and the liquid was transferred to a new tube.

[0414] COS-7 cells were transiently transfected with plasmids containing the human DNase1 wild-type (SEQ ID NO: 118) or naturally occurring DNase 1 mutant alleles (G105R and / or A114F) (SEQ ID NOS.: 115, 116, or 117) fused to the wild-type human IgG1 Fc domain. The hinge-CH2-CH3 cassette contains a single C→S mutation in the hinge region to remove the first cysteine in this domain, as the lack of a paired ligand in the light chain of the antibody prevents its pairing. In addition, more complex polynuclease fusion proteins can be expressed by transient transfection of COS cells. Western blot analysis was performed on the supernatants of the transient transfectants. Figure 20 The molecule therein contains a fusion of human DNase1 with the wild-type Fc domain of human IgG1 (SEQ ID NO: 154, 155, 156, or 159), or comprises a fusion of human RNase1 (wild-type) with the SCC hinge-CH2-CH3 Fc domain of human IgG1, followed by a novel linker containing an N-linked glycosylation site to protect the linker domain from protease cleavage, and human DNase1 in the wild-type (SEQ ID NO: 153) or mutant allele (SEQ ID NO: 151 or 152) form at the carboxyl terminus of the molecule. The COS supernatant was collected after 72 hours, and 0.5 - 1.0 ml of the sample (depending on different experiments) was immunoprecipitated with 100 μl of protein A-agarose beads at 4°C. The protein A beads were centrifuged and washed twice in PBS before resuspension with SDS-PAGE loading buffer, using NuPAGE gels - reducing or non-reducing LDS loading buffer. The samples were heated according to the manufacturer's instructions, the protein A beads were pelleted after centrifugation, and the loading buffer was added to a 5 - 12% NuPAGE gradient gel. The samples were electrophoresed at 150 V for 1.5 - 2 hours and transferred to a nitrocellulose membrane at 30 mAmp for 1 hour. The Western blot was blocked overnight using TBS / 5% non-fat milk powder. The blot was incubated with 1:2500 HRP (horseradish peroxidase)-conjugated goat anti-human IgG (Fc specific, Jackson Immunoresearch) or goat anti-mouse IgG for 1.5 hours at room temperature, washed five or more times in PBS / 0.5% Tween 20, and developed using ECL reagent.

[0415] Example 22: Screening of nuclease activity in COS supernatant.

[0416] Figure 21 Shows the results of RNase activity assay (SRED) analysis of the collected COS supernatant using SRED, where the COS expresses the hDNAse1Ig and hRNase1-Ig-hDNase1 fusion proteins.

[0417] As described below, nuclease activity of the COS supernatant was assayed, where the COS was transiently transfected with the hDNaseI g single or multi-specific nuclease. A 2% agarose gel was prepared using distilled water. Poly-C (Sigma) was dissolved in distilled water to a concentration of 3 mg / ml. The gel slab was prepared as follows: 1.5 ml of reaction buffer (0.2 M Tris-HCl pH 7.0, 40 mM EDTA, and 0.1 mg / ml ethidium bromide), 1 ml of Poly-C, and 0.5 ml of water were added to a tube and held at 50 °C for 5 minutes. 3 ml of agarose (held at 50 °C) was added to the tube. The mixture was immediately poured onto a glass plate. Wells were punched in the gel. Approximately 2 μl of each sample was loaded and the gel was incubated in a wet box at 37 °C for 4 hours. The gel was then incubated in buffer (20 mM sodium acetate pH 5.2, 20 mg / ml ethidium bromide) placed on ice for 30 min and detected under UV. The gel was photographed using a Kodak digital camera DC290 system equipped with an ethidium bromide filter under illumination of a UV transilluminator and analyzed using Kodak molecular imaging software.

[0418] Figure 22 is a composite figure showing the results of DNase nuclease activity assays performed in COS supernatants from transfected cells. Culture supernatants were collected 72 hours after transfection of the following wild-type and mutant DNase1-Ig fusion protein clones: (1) 090210-8 = hDNAse1-WT-hIgG1 WT (SEQ ID NO:154); (2) 090210-9 = hDNase1-G105R; A114F-hIgG1 WT (SEQ ID NO:159); (3) 091210-8 = hRNase1-WT-hIgG1-WT-DNase1-G105R; A114F (SEQ ID NO:151); and (4) 091210-14 = hRNase-WT-hIgG1-WT-DNase1-A114F (SEQ ID NO:152).

[0419] The supernatant was adjusted to pH 8.0 using sodium bicarbonate buffer so that the expressed -Ig fusion protein bound to protein A agarose beads. Figure 23 Figure A in [reference] shows the results of gel electrophoresis analysis of digested plasmid DNA. Protein A agarose packing material (50 μl per sample) was washed in PBS and incubated overnight at 4 °C with 100 μl of culture supernatant to immunoprecipitate the -Ig fusion protein. The immunoprecipitate was washed 4 - 5 times in 750 μl of PBS, centrifuged at approximately 3500 rpm, and then the PBS was aspirated off. The final protein A pellet was resuspended in 50 μl of reaction buffer containing 1.5 μg of plasmid DNA (pDG expression vector) and 20 mM Tris pH 7.5, 2 mM CaCl2, and 2 mM MgCl2. The reaction mixture was incubated at 37 °C for 30 minutes, heated to 65 °C for 5 min, and the DNA present in the reaction mixture was analyzed by agarose gel electrophoresis in a 1.5% TBE - agarose gel.

[0420] Figure B shows the results of nuclease activity assays in the same culture supernatant using the DNase Alert kit (IDT / Ambion). As described below, reaction tubes containing the lyophilized DNase Alert substrate (50 pmol) were resuspended with 5 μl of nuclease - free ddH2O, 5 μl of 10X DNase alert buffer, and 40 μl of immunoprecipitated protein A packing material provided in the kit: for these immunoprecipitations, 50 μl of protein A agarose beads were incubated overnight with 50 μl of culture supernatant. Subsequently, the samples were washed 5 times with 0.75 ml of PBS. The final protein A pellet was resuspended in 80 μl of nuclease - free ddH2O, and 40 μl of the packing material (half of the pellet) was transferred to the reaction tube. Negative controls were set up with mock - transfected IP and ddH20 added. A positive control containing DNase1 (2 units) provided in the kit was also set up. The reaction mixtures were incubated at 37 °C for 1 hour and exposed to short - wavelength UV transillumination to show fluorescence. The relative amount of DNA digestion was indicated by the degree of fluorescence.

[0421] Example 22 : Examination of mac-2 positive cells in DTg mice.

[0422] Mortality in early lupus is usually due to nephritis or infections resulting from immunosuppressive treatment of nephritis. Thus, for any new therapy, an extremely important outcome is improvement of nephritis. Although human studies have been limited to quantification of proteinuria and creatinine, in mice, renal inflammation and injury can be precisely evaluated by histological and immunohistochemical methods. We reported that TLR7.1 x RNase double transgenic (DTg) mice showed reduced anti-RNA antibodies, decreased B cell activity, reduced immune deposits, and fewer PAS-positive stained glomeruli. Macrophage infiltration in the kidney was further compared using anti-Mac-2 (galectin 3) antibody (Iyoda et al. Nephrol Dial Transplant 22:3451, 2007). As described above (Iyoda et al.), the number of Mac-2+ macrophages and glomerular size were examined in frozen sections from single or double Tg kidneys. The number of positive cells was counted in twenty randomly selected glomeruli (from the outer to the inner side of the kidney). The number of mac-2 positive stained cells was less in the glomeruli of double Tg compared to single Tg mice (data not shown). In a preliminary study, results from counting 20 glomeruli per mouse in 4-5 mice per group showed that the mean + / - SE for single and double Tg were 3.8 + / - 1.1 and 1.4 + / - 0.2, respectively, p = 0.05. In addition, the size of the glomerular tuft was quantified and a significant decrease in glomerular tuft size was observed in DTg mice (179.4 + / - 41 vs 128 + / - 16.8 um2 for single and double Tg, respectively, p = 0.037).

[0423] Example 23: Km of purified murine RNaseA-Ig fusion protein 。

[0424] To further define the functional properties of the bivalent RNase-Ig fusion protein (SEQ ID NO:150), we determined the Michaelis constant Km. As Figure 23 shown, the enzyme has a high affinity with a provisional Km value of 280 nM (for comparison, the Km of RNase A with polyC as substrate is 34 nM (delCardayre et al, Prot Eng 8:261, 1995)). Figure 23 Enzyme kinetic results obtained using the Rnase Alert substrate (Ambion / IDT) and fluorescence quantification using a Spectramax M2 microplate reader are shown. Data were analyzed using Softmax Pro software (Molecular Devices). Reaction rates were determined at different substrate concentrations and data were plotted as Lineweaver-Burk curves. The volume-corrected apparent Km was 280 nM.

[0425] Example 24: Anti-RNA antibody analysis in 564Igi Tg mice.

[0426] 564Igi Tg mice: Dr. Imanishi-Kari inserted the rearranged VDJ gene from the H564 hybridoma into the endogenous Igh and Igk loci to create 564Igi mice on a B6 background. The cytoplasm and nucleoli of fixed cells in the mouse serum were stained, indicating significant anti-RNA specificity. Consistent with this finding and of particular relevance to the present invention, antibody production was inhibited when these mice were made TRL7-deficient, suggesting that it is indeed RNA that stimulates antibody production. The onset of glomerulonephritis was delayed in this strain of mice. The expression of anti-RNA antibodies was analyzed in H564 transgenic mice and double transgenic mice co-expressing 564Ig and RNase transgenes. Figure 24 The levels of anti-RNA antibodies in the mouse serum were compared at successive intervals of time measured as the age of these transgenic mice.

[0427] See Gavalchin, J., R. A. Seder, and S. K. Datta. 1987. The NZB X SWR model of lupus nephritis. I. Cross-reactive idiotypes of monoclonal anti-DNA antibodies in relation to antigenic specificity, charge, and allotype. Identification of interconnected idiotype families inherited from the normal SWR and the autoimmune NZB parents. J. Immunol. 138:128 - 137; and Berland, R., L. Fernandez, E. Kari, J. H. Han, I. Lomakin, S. Akira, H. H. Wortis, J. F. Kearney, A. A. Ucci, and T. Imanishi-Kari. 2006. Toll-like receptor 7-dependent loss of B cell tolerance in pathogenic autoantibody knockin mice. Immunity 25:429 - 440.

[0428] Example 25: In vitro evaluation of the biological activity of hybrid nuclease molecules.

[0429] The method described in the above embodiments is used to purify one or more hybrid nuclease molecules by, for example, affinity or ion exchange chromatography. In certain examples, the hybrid nuclease molecule is a polypeptide. In certain examples, the hybrid nuclease molecule comprises one or more sequences in Table 2. In certain examples, the molecule is SEQ ID NO: 161, 162, or 163. In certain examples, the molecule comprises SEQ ID NO: 145 and SEQ ID NO: 149. In certain examples, the molecule is SEQ ID NO: 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 166, 167, 169, 170, 171, 173, 175, 177, 179, 181, 187, 189, 191, 193, 195, 197, 199, 201, 203, 205, or 207. The hybrid nuclease molecule can be any one disclosed in the present invention and any one constructed from the sequences disclosed in the present invention (see Table 2), for example, taking a nuclease domain and linking it to an Fc domain; or for example, taking a nuclease domain and linking it to an Fc domain through a linker domain. A variety of linker domains (such as those described in the present invention) can be used to link the Fc domain and / or the nuclease domain. For example, linker domains with amino acid lengths of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, or more can be used. Qualitative assays are used to detect the specific nuclease activity of the molecule in vitro to verify whether it has the desired nuclease function. The specific activity is usually determined by a fluorescence-based kinetic assay and a microplate reader that sets the readings as a function of time, and the assay uses substrates such as RNase or DNase Alert kit reagents. In addition, commercially available kits, such as the Pyrotell Limulus Amebocyte Lysate (LAL) kit, are generally used to detect the endotoxin contamination of the protein solution. The kit is purchased from Cape Cod, Inc. (E. Palmouth, MA) and the detection limit of the product is 0.06 EU / ml. A variety of in vitro assays are used to detect the biological activity of the molecule.

[0430] A series of in vitro assays will determine the effect of the molecule on cytokine production by measuring the response of human PBMCs to different stimuli in the presence or absence of the molecule in the culture medium. Human PBMCs (about 1x10e6 cells) from normal or patient samples will be cultured for 24, 48, or 96 hours as needed for the assay. PBMCs will be cultured in the presence of stimulants such as TLR ligands, co-stimulatory antibodies, immune complexes, and normal or autoimmune sera. Commercial reagents such as the IL-6, IL-8, IL-10, IL-4, IFN-γ, TNF-α antibody pair kits from Biolegend (San Diego, CA) will be used to detect the effect of the molecule on cytokine production. Culture medium supernatants of the in vitro cultures will be collected at 24, 48 hours, or longer time points to determine the effect of the molecule on cytokine production. The production of IFN-α will be detected using, for example, anti-human IFN-α antibody and standard curve reagents from PBL interferon source (Piscataway, NJ). Similar series of assays will be performed using human lymphocyte subsets (isolated monocytes, B cells, pDCs, T cells, etc.); purification will be performed using magnetic beads such as those from commercially available isolation kits from Miltenyi Biotech (Auburn, CA).

[0431] In addition, the effect of the molecule on the expression of lymphocyte activation receptors such as CD5, CD23, CD69, CD80, CD86, and CD25 will be evaluated at different time points after stimulation. Multicolor flow cytometry will be performed on PBMCs or isolated cell subsets to determine how these molecules affect the expression of different receptors associated with immune cell activation.

[0432] The effect of these molecules on the proliferation of different lymphocyte subsets in vitro will be determined by another series of assays. Prior to stimulation, these assays will be performed on human PBMCs using, for example, CFDA-SE staining (Invitrogen, Carlsbad, CA). 5 mM CFSE will be diluted 1:3000 with PBS / 0.5% BSA and added to 10e7 - 10e8 PBMCS or purified cell subclasses, and the labeling reaction will be incubated at 37 °C for 3 - 4 minutes, followed by washing several times in RPMI / 10% FBS to remove residual CFSE. Subsequently, the CFSE-labeled cells will be incubated with various stimulants (TLR ligands, co-stimulatory antibodies, etc.) and the molecule in co-culture reactions for 4 days, and cell proliferation will be analyzed by flow cytometry using dye-conjugated cell subset-specific antibodies.

[0433] Using normal and patient PBMC samples, the effect of these molecules on the maturation of monocytes into DCs and macrophages will be evaluated in vitro.

[0434] The effectiveness of the hybrid nuclease molecule is confirmed by the following comparison: comparing the test results of cells treated with the hybrid nuclease molecule of the present invention and the test results from cells treated with a control preparation. Relative to the level of the marker present before treatment, or relative to the level detected in the control group, in the group treated with the effective molecule, the levels of the various markers described above (e.g., cytokines, cell surface receptors, proliferation) are generally improved.

[0435] Example 26: Administration of hybrid nuclease molecules to the desired mammals.

[0436] Mammals (e.g., mice, rats, rodents, humans, guinea pigs) were used in this study. One or more hybrid nuclease molecules or controls were administered (e.g., intravenously) to the mammals, and the molecules comprise one or more sequences in Table 2. In certain examples, the molecule is SEQ ID NO: 161, 162, or 163. In certain examples, the molecule includes SEQ ID NO: 145 and SEQ ID NO: 149. In certain examples, the molecule is SEQ ID NO: 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 166, 167, 169, 170, 171, 173, 175, 177, 179, 181, 187, 189, 191, 193, 195, 197, 199, 201, 203, 205, or 207. The hybrid nuclease molecule can be any one disclosed in the present invention, and any one constructed from the sequences disclosed in the present invention (see Table 2), for example, taking a nuclease domain and linking it to an Fc domain; or for example, taking a nuclease domain and linking it to an Fc domain through a linker domain. A variety of linker domains (e.g., those described in the present invention) can be used to link the Fc domain and / or the nuclease domain. For example, linker domains with an amino acid length of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, or more can be used. In certain examples, the hybrid nuclease molecule is formulated into a pharmaceutically acceptable carrier. In certain examples, the molecule is formulated into the pharmaceutical composition described in the above section. The hybrid nuclease molecule is RNase- and / or DNase-targeted.

[0437] It is considered beneficial to use a method of multiple administrations. Monitor the effects on the following levels in animals: IFN-α level, IFN-α responsive gene level, autoantibody titer, renal function, and pathology and / or circulating immune complex level. Conduct similar studies using different treatment regimens and administration routes (e.g., intramuscular administration, etc.). The effectiveness of the hybrid nuclease molecule was confirmed by comparing the following levels in mammals treated with the hybrid nuclease molecule disclosed in the present invention and mammals treated with a control preparation: IFN-α level, IFN-α responsive gene level, autoantibody titer, renal function, and pathology and / or circulating immune complex level.

[0438] In one example, a human subject in need of treatment is selected or identified. The subject may need to reduce, for example, the causes or symptoms of systemic lupus erythematosus. The identification of the subject can be performed clinically or elsewhere, for example, by the subject himself / herself using a self-test kit at home.

[0439] At time zero, administer to the subject a suitable first dose of the hybrid nuclease molecule. Prepare the hybrid nuclease molecule formulation as described in the present invention. After a period of time following the first administration, such as 7 days, 14 days, and 21 days, evaluate the physical condition of the subject, for example, measure the IFN-α level, IFN-α responsive gene level, autoantibody titer, renal function, and pathology and / or circulating immune complex level. Other relevant criteria can also be detected. Adjust the number of administrations and the intensity according to the needs of the subject.

[0440] Relative to the levels present before treatment, or relative to the levels detected in a similar but untreated subject or a control subject, the following levels in the subject after administration are reduced and / or improved: IFN-α level, IFN-α responsive gene level, autoantibody titer, renal function, and pathology and / or circulating immune complex level.

[0441] In another example, a rodent subject in need of treatment is selected or identified. The identification of the subject can be performed in a laboratory or elsewhere.

[0442] At time zero, administer to the subject a suitable first dose of the hybrid nuclease molecule. Prepare the hybrid nuclease molecule formulation as described in the present invention. After a period of time following the first administration, such as 7 days, 14 days, and 21 days, evaluate the physical condition of the subject, for example, measure the IFN-α level, IFN-α responsive gene level, autoantibody titer, renal function, and pathology and / or circulating immune complex level. Other relevant criteria can also be detected. Adjust the number of administrations and the intensity according to the needs of the subject.

[0443] Relative to the level before treatment, or relative to the level detected in a subject in a similar condition but untreated or a control subject, the following levels in the subject after administration are reduced and / or improved: IFN-α level, IFN-α responsive gene level, autoantibody titer, renal function, and pathological and / or circulating immune complex level.

[0444] Although the present invention has been particularly shown and described by reference to preferred embodiments and various alternative embodiments, it should be understood by those skilled in the art that the above can be variously changed in form and detail without departing from the gist and scope of the disclosure of the present invention.

[0445] For any purpose, all references, issued patents, and patent applications cited in this specification are incorporated herein by reference in their entirety.

[0446] Table

[0447]

[0448]

[0449]

[0450]

[0451]

[0452]

[0453]

[0454]

[0455]

[0456]

[0457]

[0458]

[0459]

[0460]

[0461]

[0462]

[0463]

[0464]

[0465]

[0466]

[0467]

[0468]

[0469]

[0470]

[0471]

[0472]

[0473]

[0474]

[0475]

[0476]

[0477]

[0478]

[0479]

[0480]

[0481]

[0482]

[0483]

[0484]

[0485]

[0486]

[0487]

[0488]

[0489]

[0490]

[0491]

[0492]

[0493]

[0494]

[0495]

[0496]

[0497]

[0498]

[0499]

[0500]

[0501]

[0502]

[0503]

[0504]

[0505]

[0506]

[0507]

[0508]

[0509]

[0510]

[0511]

[0512]

[0513]

[0514]

[0515]

[0516]

[0517]

[0518]

Claims

1. A polypeptide comprising a first nuclease domain, a second nuclease domain, and a variant Fc domain, wherein the first nuclease domain and the second nuclease domain are optionally operably linked in series to each other via a linker to form a tandem array, wherein the tandem array of nuclease domains is optionally operably linked to the C-terminus or N-terminus of the variant Fc domain via a linker, wherein the first nuclease domain and the second nuclease domain are selected from RNase and DNase, and wherein the variant Fc domain is a variant human IgG1 Fc domain that comprises amino acid substitutions that result in reduced binding to Fcγ receptors or complement proteins or both compared to the wild type, wherein the polypeptide has reduced effector function; wherein the reduced effector function is selected from opsonization, phagocytosis, complement-dependent cytotoxicity, antibody-dependent cell-mediated cytotoxicity.

2. The polypeptide according to claim 1, wherein the RNase is wild-type RNase or mutant RNase.

3. The polypeptide according to claim 1, wherein the DNase is wild-type DNase or mutant DNase.

4. The polypeptide according to any one of claims 1 to 3, wherein the first nuclease domain and the second nuclease domain are selected from: (a) human RNase; and / or (b) human DNase, selected from human DNase I, human DNase 1L3, or human TREX1.

5. The polypeptide according to claim 4, wherein the human RNase is human pancreatic RNase.

6. The polypeptide according to any one of claims 1-3, wherein: (a) the variant Fc domain comprises a hinge domain, a CH2 domain, and a CH3 domain; and / or (b) the variant Fc domain comprises a mutated hinge domain that comprises at least one amino acid substitution; and / or (c) the variant Fc domain comprises a mutated CH2 domain, and the mutated CH2 domain comprises at least one substitution.

7. The polypeptide according to claim 6, wherein the mutated hinge domain comprises substitution of one or more of the three hinge cysteines with serine.

8. The polypeptide according to claim 7, wherein the substitution of one or more of the three hinge cysteines is SCC or SSS.

9. The polypeptide according to claim 6, wherein the mutated CH2 domain comprises at least one substitution selected from P238S, P331S, N297S, or a combination thereof.

10. The polypeptide according to any one of claims 1-3, wherein: the first nuclease domain or the second nuclease domain is operably linked to the N-terminus of the variant Fc domain via a linker; or the first nuclease domain or the second nuclease domain is operably linked to the N-terminus of the variant Fc domain without a linker.

11. The polypeptide according to any one of claims 1-3, wherein: wherein the first nuclease domain or the second nuclease domain is operably linked to the C-terminus of the variant Fc domain via a linker; or wherein the first nuclease domain or the second nuclease domain is not operably linked to the C-terminus of the variant Fc domain via a linker.

12. The polypeptide according to claim 10 or 11, wherein the linker is a polypeptide linker.

13. The polypeptide according to claim 12, wherein the polypeptide linker is a gly-ser linker.

14. The polypeptide according to any one of claims 1-3, wherein: (a) the RNase consists of the amino acid sequence shown in SEQ ID NO: 149, optionally without its leader sequence; and / or (b) the DNase consists of the amino acid sequence shown in SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 143 or SEQ ID NO: 144; and / or (c) the variant Fc domain consists of the amino acid sequence shown in SEQ ID NO:

145.

15. The polypeptide according to claim 14, wherein the variant Fc domain comprises a mutated hinge domain, and the mutated hinge domain comprises at least one amino acid substitution.

16. The polypeptide according to claim 15, wherein the mutated hinge domain comprises the substitution of one or more of the three hinge cysteines with serine.

17. The polypeptide according to claim 16, wherein the substitution of one or more of the three hinge cysteines is SCC or SSS.

18. The polypeptide according to claim 14, which comprises one or more Fc mutations selected from P238S, P331S, K322S and N297S.

19. The polypeptide according to any one of claims 1-3, wherein (a) the variant Fc domain is a mutated Fc domain with reduced binding ability to Fc receptors on human cells; and / or (b) the Fc domain is a mutated human IgG1 Fc domain, which comprises one or more mutations selected from P238S, P331S, K322S, N297S, wherein the numbering is based on the EU index; and / or (c) the Fc domain is a mutated Fc domain, which comprises the substitution of one or more of the three hinge domain cysteine residues with serine; and / or (d) the polypeptide comprises a linker domain.

20. A composition, which comprises the polypeptide according to any one of claims 1-19 and a pharmaceutically acceptable carrier.

21. A dimeric polypeptide, which comprises the polypeptide according to any one of claims 1-19.

22. The dimeric polypeptide according to claim 21, wherein the dimer is a homodimer.

23. A composition, which comprises the dimeric polypeptide according to claim 21 and a pharmaceutically acceptable carrier.

24. A composition comprising the dimeric polypeptide according to claim 22 and a pharmaceutically acceptable carrier.

25. A nucleic acid molecule comprising a nucleotide sequence encoding the polypeptide according to any one of claims 1-19.

26. A nucleic acid molecule encoding the dimeric polypeptide according to claim 21 or 22.

27. A recombinant expression vector comprising the nucleic acid molecule according to claim 25 or 26.

28. A host cell transformed with the recombinant expression vector according to claim 27, wherein the host cell is not a plant cell or an animal germ cell.

29. A method for preparing a polypeptide according to any one of claims 1-19, comprising: Providing a host cell comprising a nucleic acid sequence encoding the polypeptide; and maintaining the host cell under conditions for expressing the polypeptide.

30. The method according to claim 29, further comprising obtaining the polypeptide.

31. A method for preparing the dimer polypeptide according to claim 21 or 22, comprising: Providing a host cell comprising a nucleic acid sequence encoding the polypeptide; maintaining the host cell under conditions for expressing the dimeric polypeptide.

32. The method according to claim 31, comprising obtaining the dimeric polypeptide.

33. Use of the polypeptide according to any one of claims 1-18 or the dimeric polypeptide according to claim 21 or 22 in the preparation of a medicament for treating or preventing a condition associated with an autoimmune disease.

34. The use according to claim 33, wherein the autoimmune disease is SLE.

35. The use according to claim 33, wherein the autoimmune disease is Sjögren's syndrome.

36. The use according to claim 33, wherein the autoimmune disease is lupus nephritis.

37. Use of the polypeptide according to any one of claims 1-18, the composition according to claim 20, the dimeric polypeptide according to claim 21 or 22, or the composition according to claim 23 or 24 in the preparation of a medicament for treating systemic lupus erythematosus (SLE).

38. Use of the polypeptide according to any one of claims 1-18, the composition according to claim 20, the dimeric polypeptide according to claim 21 or 22, or the composition according to claim 23 or 24 in the preparation of a medicament for treating lupus nephritis.

39. Use of the polypeptide according to any one of claims 1-18, the composition according to claim 20, the dimeric polypeptide according to claim 21 or 22, or the composition according to claim 23 or 24 in the preparation of a medicament for treating Sjögren's syndrome.

Citation Information

Patent Citations

  • A provision FOR WASHING FLOORS CONTAMINATED WITH ORGANIC COMPOUNDS, MAINLY, HYDROCARBONS, AND A PROCEDURE FOR WASHING THE SAME

    AR048796A1

  • Therapeutic nuclease compositions and methods

    CN106399276B

  • Continuous release pharmaceutical compositions

    EP0058481A1

  • Regulating peptide-containing pharmaceutical preparations with retarded release, and process for their preparation

    EP0133988A2

  • Pharmaceutical composition containing urokinase

    EP0143949A1