AAV Gene Therapy for the Treatment of Nephrotic Syndrome

Abstract

The present invention provides an adeno-associated virus (AAV) vector gene therapy for treating monogenic forms of nephrotic syndrome, wherein the AAV vector comprises an NS-related transgene and a minimal nephrin promoter NPHS1 or a podocin promoter NPHS2.

Description

Field of the Invention

[0001] The present invention relates to gene therapy for the treatment of monogenic forms of nephrotic syndrome. Background of the Invention

[0003] Nephrotic syndrome (NS) is a chronic kidney disease characterized by marked proteinuria, hypoalbuminemia, edema, and hyperlipidemia, and is the most common primary glomerular disease in children, affecting 2 / 100,000 children under 16 years of age in Europe and the United States. NS is associated with different ages of onset, from less than 3 months old at diagnosis to early adulthood, and is divided into different patient groups according to its sensitivity to corticosteroids: approximately 80% of children with NS are classified as having steroid-sensitive nephrotic syndrome (SSNS) and can be successfully treated with corticosteroid therapy. A proportion of patients originally classified as part of SSNS relapse and require further steroid treatment, and an additional 10 - 15% of NS patients do not achieve remission after several weeks of corticosteroid treatment and are classified as steroid-resistant nephrotic syndrome (SRNS). Up to 50% of these SRNS patients develop end-stage renal disease within 10 years and generally face an increased risk of relapse after renal transplantation, highlighting the lack of suitable and effective treatment for these patients.

[0004] Podocyte dysfunction and the resulting disruption of the glomerular filtration barrier are central to the pathogenesis of NS. Podocytes branch out cellular processes to cover the exterior of glomerular capillaries, called foot processes, and their interdigitating junctions with adjacent foot processes form the glomerular slit diaphragm, which is crucial for the efficiency of the glomerular filtration barrier and the retention of proteins in the bloodstream. In the genetic forms of NS, mutations in genes encoding key podocyte processes, such as podocyte development, migration, basement membrane interaction, or regeneration, lead to loss of integrity of the glomerular slit diaphragm and the nephrotic syndrome phenotype. Approximately 30% of SRNS cases in children are genetic, and the most common mutation in childhood is in NPHS2 encoding podocin, accounting for 10 - 30% of sporadic genetic cases.

[0005] Podocin is a 42 kDa hairpin-like membrane-associated podocyte-specific protein and a key component of the protein complex at the slit diaphragm; the intercellular junction between adjacent podocyte foot processes. It localizes to lipid rafts and interacts with other important slit diaphragm proteins such as nephrin, CD2AP, and TRPC6. It is crucial in maintaining the slit diaphragm and thus the integrity of the glomerular filtration barrier. To date, 126 mutations have been reported, but the most common mutation is R138Q, which leads to mislocalization of podocin to the endoplasmic reticulum.

[0006] Since there is currently no effective treatment for patients with the monogenic form of NS, using gene therapy to transfer functional gene copies into diseased podocytes may constitute a promising new strategy to address the monogenic form of NS, reverse the NS phenotype, and correct renal dysfunction. In fact, US2003 / 0152954 generally recommends using viral vectors to deliver nucleic acids encoding polypeptides with podocin activity, but fails to disclose or test any specific gene therapy constructs. This may be because the kidney has a complex anatomy with specialized compartments consisting of glomeruli, renal tubules, vasculature, and small spaces, making it a difficult target for gene therapy vectors. To date, kidney-targeted gene therapy has been largely unsuccessful because the highly differentiated substructures of the kidney are difficult to target and specifically transduce with viral vectors (van der Wouden et al., 2004).

[0007] A recent study attempted to target the kidney using rAAV vectors conjugated with a CMV promoter and GFP or luciferase genes (administered via tail vein injection or renal vein injection) (Rocca et al 2014). However, tail vein injection proved unsuitable for kidney transduction, and although low levels of gene expression were observed in podocytes, extensive expression was also observed in the liver, even when using a purportedly kidney-specific promoter. The study additionally failed to demonstrate the successful transduction of NS-related transgenes, such as podocin, nor the long-term functional expression of such genes. The study also did not explore AAV serotypes suitable for human renal cell transduction.

[0008] The object of the present invention is to reverse the NS phenotype and correct podocyte-related renal dysfunction in patients with the monogenic form of NS by administering AAV gene therapy expressing an NS-related transgene under the control of a podocyte-specific promoter. Summary of the Invention

[0010] The present invention provides an adeno-associated virus (AAV) vector gene therapy for treating the monogenic form of nephrotic syndrome, wherein the AAV vector comprises: an NS-related transgene; and the minimal nephrin promoter NPHS1 or the podocin promoter NPHS2. This gene therapy vector can reverse the NS phenotype and correct podocyte-related renal dysfunction in patients with the monogenic form of NS.

[0011] AAV serotypes suitable for use in this vector include 2 / 9, LK03, and 3B.

[0012] The AAV2 / 9 serotype has shown significant tropism for the kidneys of neonatal and adult mice, localizing to glomeruli and renal tubules (Luo et al., 2011; Picconi et al., 2014; Schievenbusch et al., 2010), and AAV2 / 9 vector combined with renal vein injection has been shown to be suitable for kidney-targeted gene delivery (Rocca at al., 2014). Thus, AAV2 / 9 is a suitable vector for the gene therapy of the present invention.

[0013] Synthetic AAV capsids such as LK03 can also be suitable vectors for the gene therapy of the present invention. This vector has been shown to transduce primary human hepatocytes with high efficiency in vitro and in vivo. However, so far, it has not been used for kidney-targeted gene delivery. The inventors herein demonstrate that the AAV-LK03 vector can achieve a high transduction of nearly 100% in human podocytes in vitro and can be used to specifically transduce podocytes in vitro.

[0014] The AAV-LK03 cap sequence is composed of fragments from seven different wild-type serotypes (AAV1, 2, 3B, 4, 6, 8, 9), although AAV-3B represents 97.7% of the cap gene sequence and 98.9% of the amino acid sequence. AAV-3B is also known for its tropism for human hepatocytes and is another suitable vector for the gene therapy of the present invention. So far, it has not been used for kidney-targeted gene delivery.

[0015] The NS-related transgene used in the gene therapy is a gene associated with the monogenic form of NS and is expressed in podocytes, which encodes a protein of about 833 amino acids or less. This size limitation makes the NS-related transgene suitable for the gene therapy vectors of the present invention.

[0016] Suitable NS-related transgenes include NPHS2; ADCK4; ALG1; ARHGAP24; ARGHDIA; CD151; CD2AP; COQ2; COQ6; DGKE; E2F3; EMP2; KANK2; LAGE3; LMNA; LMX1B; MAFB; NUP85; NUP93; NXF5; OSGEP; PAX2; PDSS2; PMM2; PODXL; SCARB2; SGPL1; Smad7; TPRKB; VDR; WDR73; WT1; ZMPSTE24; or APOL1.

[0017] In embodiments of the present invention, the NS-related transgene can be an SRNS-related transgene, such as ADCK4; CD2AP; DGKE; EMP2; NPHS2; NUP86; NUP93; SGPL1; WDR73; or WT1.

[0018] In a preferred embodiment of the present invention, the NS-related transgene is NPHS2, which encodes podocin. An example of a suitable human NPHS2 transgene cDNA sequence is shown in Figure 6 .

[0019] The transgenic species is preferably matched to the patient species. For example, when treating a human patient, human transgenes are typically used. The transgene can be naturally occurring, such as wild-type, or it can be recombinant. The transgene is typically included as a cDNA sequence in a gene therapy vector.

[0020] Using a minimal nephrin promoter such as NPHS1 or the podocin promoter NPHS2 allows the gene therapy vector to specifically target podocytes (Moeller et al., 2002; Picconi et al., 2014). This enables transgenic expression to be specifically targeted to podocytes in the glomerular basement membrane of the kidney and minimizes off-target expression. Since podocytes are terminally differentiated and non-dividing cells, they can be targeted for stable transgene expression and the risk of any vector dilution effects can be reduced or avoided. In a preferred embodiment of the present invention, the promoter is NPHS1. An example of a suitable DNA sequence of the NPHS1 promoter is shown in Figure 5 . Similar to the transgene, the promoter species is preferably matched to the patient species. For example, human NHPS1 or human NPHS2 is typically used when treating a human patient.

[0021] The AAV vector can additionally contain the woodchuck hepatitis post-transcriptional regulatory element (WPRE). WPRE is a DNA sequence that, when transcribed, generates a tertiary structure that enhances expression. Inclusion of WPRE can increase the expression of the transgene delivered by the vector. The WPRE sequence can be mutated to reduce oncogenicity without significant loss of RNA enhancing activity (Schambach et al., 2005, incorporated herein by reference). An example of a suitable WPRE sequence is shown in Figure 7 .

[0022] The NS-related transgene can contain a hemagglutinin (HA) tag. HA can be used as an epitope tag and has been shown not to interfere with the biological activity or biodistribution of the added protein. The HA tag can facilitate the detection, isolation, and purification of the transgene.

[0023] The AAV vector may additionally contain a Kozak sequence between the promoter and the podocin transgene. The Kozak sequence is known to play an important role in the initiation of the translation process and thus can enhance the expression of the podocin transgene.

[0024] The AAV vector may additionally contain a polyadenylation signal, such as the bovine growth hormone (bGH) polyadenylation signal, for example, as Figure 8 shown. Polyadenylation is the addition of a poly(A) tail to messenger RNA. The poly(A) tail consists of multiple adenosine monophosphates; in other words, it is a segment of RNA that has only adenine bases. The poly(A) tail is very important for the nuclear export, translation, and stability of mRNA. Therefore, the inclusion of a polyadenylation signal can enhance the expression of the podocin transgene.

[0025] AAV vector gene therapy generally additionally includes terminal repeat (ITR) sequences at either end of the vector. For example, the vector construct can be in the order: ITR - promoter - transgene (with an optional HA tag) - optional WRPE - polyadenylation signal - ITR.

[0026] Thus, the gene therapy vector of the present invention can be used to treat or manage the single - gene form of NS in a patient. As used herein, the term "patient" can include any mammal, including humans. The patient can be an adult or a pediatric patient, such as a neonate or an infant. In an embodiment of the present invention, the patient can be a pediatric patient between about 1 year and about 16 years of age.

[0027] The patient has a monogenic form of NS. In other words, NS is caused by a mutation in a single gene. Preferably, the mutation is in a gene expressed in podocytes. For example, NS can be SRNS caused by a gene mutation in NPHS2 (which encodes podocin). Alternatively, the monogenic form of NS can be caused by one or more mutations in any one of ADCK4; ALG1; ARHGAP24; ARGHDIA; CD151; CD2AP; COQ2; COQ6; DGKE; E2F3; EMP2; KANK2; LAGE3; LMNA; LMX1B; MAFB; NUP85; NUP93; NXF5; OSGEP; PAX2; PDSS2; PMM2; PODXL; SCARB2; SGPL1; Smad7; TPRKB; VDR; WDR73; WT1; ZMPSTE24; or APOL1. In an embodiment of the present invention, the monogenic form of NS can be the monogenic form of SRNS caused by one or more mutations in any one of ADCK4; CD2AP; DGKE; EMP2; NPHS2; NUP86; NUP93; SGPL1; WDR73; or WT1.

[0028] The gene mutation causing SRNS can be an NPHS2 mutation affecting podocin expression, one or more of those listed in Table A below.

[0029] Table A: Non-exhaustive list of podocin (NPHS2) mutations.

[0030]

[0031]

[0032] In a preferred embodiment of the present invention, the gene mutation can be p.Arg138Gln, also known as R138Q. R138Q is the most common podocin mutation in children with SRNS in the Caucasian population. This mutation causes the retention of podocin in the endoplasmic reticulum, preventing it from reaching the slit diaphragm and interacting with other important slit diaphragm proteins to form a functional filtration barrier.

[0033] Since all NPHS2 mutations affect the same gene, any combination of these mutations can be treated by an AAV gene therapy vector containing the NPHS2 transgene in the present invention. In other words, the patient can have the p.Arg138Gln mutation and can have one or more of the other mutations identified in Table A above.

[0034] The presence or absence of the single-gene form of NS can be determined by laboratory tests, such as those provided by the Bristol Genetics Laboratory in the UK. Typically, genetic testing can be performed by analyzing a blood sample obtained from the patient.

[0035] The AAV vector gene therapy can be administered systemically, such as by intravenous injection. In an embodiment of the present invention, the AAV vector gene therapy can be administered by injection into the renal artery. In another embodiment of the present invention, the AAV vector gene therapy can be administered by retrograde administration, for example, using a catheter via the ureter.

[0036] The gene therapy can be administered in a single dose, in other words, subsequent doses of the vector may not be required. In cases where repeated doses are needed, different AAV serotypes can be used in the vector. For example, the vector used for the first dose can contain AAV-LK03 or AAV-3B, while the vector used for subsequent doses can contain AAV 2 / 9.

[0037] Optionally, the gene therapy can be administered in combination with temporary immunosuppression of the patient, for example, by administering the gene therapy either concurrently with or after oral steroid treatment. Immunosuppression may be desirable before and / or during gene therapy treatment to suppress the patient's immune response to the vector. However, the AAV capsid only transiently exists in the transduced cells as it is not encoded by the vector. Therefore, the capsid gradually degrades and is cleared, which means that a short-term immunosuppressive regimen that blocks the immune response to the capsid until the capsid sequence is cleared from the transduced cells can allow for long-term expression of the transgene. Thus, immunosuppression may be desirable for a period of about six weeks after the administration of the gene therapy.

[0038] The AAV vector gene therapy can be administered in the form of a pharmaceutical composition. In other words, the AAV vector gene therapy can be combined with one or more pharmaceutically acceptable carriers or excipients. Suitable pharmaceutical compositions are preferably sterile. Sequence Listing <110> University of Bristol <120> Therapy <130> P122719PCT <160> 7 <170> PatentIn version 3.5 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> ITR Forward Primer <400> 1 ggaaccccta gtgatggagt t 21 <210> 2 <211> 16 <212> DNA <213> Artificial sequence <220> <223> ITR reverse primer <400> 2 cggcctcagt gagcga 16 <210> 3 <211> 21 <212> DNA <213> Artificial sequence <220> <223> ITR probe <400> 3 cactccctct ctgcgcgctc g 21 <210> 4 <211> 1192 <212> DNA <213> Homo sapiens <400> 4 cacctgaggt caggagttcg agaccagcgt ggccaacatg atgaaacccc gtctctagta 60 aaaatacaaa aattagccag gcatggtgct atatacctgt agcaccagct acttgggaga 120 cagaggtggg agaattactt gaacctggga ggttcaagcc atgggaggtg gaagttgcag 180 tgagccgaga tgccactgca ctccagcctg agcaacagag caagactatc tcaagaaaag 240 aaagaaagaa agaaagagac ttgccaaggt catgtatcag ggcaaggaag agctgggggc 300 ccagctggct gctcccctgc tgagctggga gaccaccttg atctgacttc tcccatcttc 360 ccagctggct gctcccctgc tgagctggga gaccaccttg atctgacttc tcccatcttc 360 ccagcctaag ccaggccctg gggtcacgga ggctggggag gcaccgagga acgcgcctgg 420 ccagcctaag ccaggccctg gggtcacgga ggctggggag gcaccgagga acgcgcctgg 420 catgtgctga caggggattt tatgctccag ctgggccagc tgggaggagc ctgctgggca 480 catgtgctga caggggattt tatgctccag ctgggccagc tgggaggagc ctgctgggca 480 gaggccagag ctgggggctc tggaaggtac ctgggggagg ttgcactgtg agaatgagct 540 gaggccagag ctgggggctc tggaaggtac ctgggggagg ttgcactgtg agaatgagct 540 caagctgggt cagagagcag ggctgactct gccagtgcct gcatcagcct catcgctctc 600 caagctgggt cagagagcag ggctgactct gccagtgcct gcatcagcct catcgctctc 600 ctaggctcct ggcctgctgg actctgggct gcaggtcctt cttgaaaggc tgtgagtagt 660 ctaggctcct ggcctgctgg actctgggct gcaggtcctt cttgaaaggc tgtgagtagt 660 gagacaagga gcaggagtga ggggtggcag gagagaagat agagattgag agagagagag 720 gagacaagga gcaggagtga ggggtggcag gagagaagat agagattgag agagagagag 720 agagagagac agagagagag gaagagacag agacaaaagg agagagaacg gcttagacaa 780 agagagagac agagagagag gaagagacag agacaaaagg agagagaacg gcttagacaa 780 ggagagaaag atggaaagat aaagagactg ggcgcagtgg ctcacgcctg taatcccaac 840 ggagagaaag atggaaagat aaagagactg ggcgcagtgg ctcacgcctg taatcccaac 840 acttggggag gccaaggtgg gaggatggct tgaaggaaag agtctgagat caacctggcc 900 acttggggag gccaaggtgg gaggatggct tgaaggaaag agtctgagat caacctggcc 900 aacatagtga gaccccgtct ctaaaaaaaa aagaaaaaaa aaagaaaaaa gaaaaaaaag 960 aacatagtga gaccccgtct ctaaaaaaaa aagaaaaaaa aaagaaaaaa gaaaaaaaag 960 tttttttaaa gagacagaga aagagactca gagattgaga ctgagagcaa gacagagaga 1020 tttttttaaa gagacagaga aagagactca gagattgaga ctgagagcaa gacagagaga 1020 gatactcaca gggaagaggg gaagaggaaa acgagaaagg gaggagagta acggaaagag 1080 ataaaaaaga aaagcaggtg gcagagacac acagagaggg acccagagaa agccagacag 1140 acgcaggtgg ctggcagcgg gcgctgtggg ggtcacagta gggggacctg tg 1192 <210> 5 <211> 1149 <212> DNA <213> Homo sapiens <400> 5 atggagagga gggcgcggag ctcctccagg gagtcccgcg ggcgaggcgg caggactccg 60 cacaaggaga acaagagggc aaaggccgag aggagcggcg ggggccgcgg gcgccaggag 120 gctgggcccg agccgtcggg ctccggacgg gcggggaccc cgggggagcc ccgagcgccc 180 gccgccacgg tggtggacgt ggatgaggtc cgaggctccg gcgaggaggg caccgaggtg 240 gtggcgctgt tggagagcga gcggcccgag gaaggtacca aatcctccgg cttaggggcc 300 tgtgagtggc ttcttgtcct catttccctg ctcttcatca tcatgacctt ccctttttcc 360 atctggttct gcgtaaaggt tgtacaagag tatgaaagag taattatatt ccgactggga 420 catctgcttc ctggaagagc caaaggccct ggtcttttct tttttttgcc ctgcctggat 480 acctaccaca aggttgacct tcgtctccaa actctggaga taccttttca tgagatcgtg 540 accaaagaca tgtttataat ggagatagat gccatttgct actaccgaat ggaaaatgcc 600 tctcttctcc taagcagtct tgctcatgta tctaaagctg tgcaattcct tgtgcaaacc 660 actatgaagc gtctcctagc acatcgatcc ctcactgaaa ttcttctaga gaggaagagc 720 atcgcccaag atgcaaaggt tgccttggat tcagtgacct gtatttgggg aatcaaagtg 780 gagagaatag aaattaaaga tgtgaggttg ccagctgggc ttcagcactc actggctgtg 840 gaggctgaag cgcaaagaca agccaaagtg cggatgattg ctgcagaagc ggaaaaggct 900 gcttctgagt ccctgaggat ggcagctgag attctgtcag gcacccctgc tgctgttcag 960 cttcgatacc tccacaccct tcagtctctg tccacagaga agccttccac tgtggtttta 1020 cctttgccat ttgacctact gaattgcctg tcttctccca gcaacagaac tcagggaagc 1080 ctccccttcc caagtccttc caaacctgtt gagccactaa atcctaaaaa gaaagactct 1140 cccatgtta 1149 <210> 6 <211> 589 <212> DNA <213> Marmota hepatitis virus <400> 6 aatcaacctc tggattacaa aatttgtgaa agattgactg gtattcttaa ctatgttgct 60 ccttttacgc tatgtggata cgctgcttta atgcctttgt atcatgctat tgcttcccgt 120 atggctttca ttttctcctc cttgtataaa tcctggttgc tgtctcttta tgaggagttg 180 tggcccgttg tcaggcaacg tggcgtggtg tgcactgtgt ttgctgacgc aacccccact 240 ggttggggca ttgccaccac ctgtcagctc ctttccggga ctttcgcttt ccccctccct 300 attgccacgg cggaactcat cgccgcctgc cttgcccgct gctggacagg ggctcggctg 360 ttgggcactg acaattccgt ggtgttgtcg gggaaatcat cgtcctttcc ttggctgctc 420 gcctgtgttg ccacctggat tctgcgcggg acgtccttct gctacgtccc ttcggccctc 480 aatccagcgg accttccttc ccgcggcctg ctgccggctc tgcggcctct tccgcgtctt 540 cgccttcgcc ctcagacgag tcggatctcc ctttgggccg cctccccgc 589 <210> 7 <211> 225 <212> DNA <213> Artificial Sequence <220> <223> bGH poly(A) <400> 7 ctgtgccttc tagttgccag ccatctgttg tttgcccctc ccccgtgcct tccttgaccc 60 tggaaggtgc cactcccact gtcctttcct aataaaatga ggaaattgca tcgcattgtc 120 tgagtaggtg tcattctatt ctggggggtg gggtggggca ggacagcaag ggggaggatt 180 gggaagacaa tagcaggcat gctggggatg cggtgggctc tatgg 225 Brief Description of the Drawings

[0040] The present invention will now be described in detail, by way of example only, with reference to the accompanying drawings.

[0041] Figure 1 shows AAV 2 / 9 transduced kidneys administered by tail vein injection and expressing HA-tagged podocin in podocytes. A) AAV vectors used to express mouse or human podocin or GFP. All vectors contain a Kozak sequence between the promoter and the transgene, as well as the WPRE (woodchuck hepatitis post-transcriptional regulatory element) and the bovine growth hormone (bGH) polyadenylation signal. B) In 8-week-old iPod NPHS2 fl / fl mice, the vector or saline was injected via the tail vein and doxycycline induction was started 10 - 14 days later. C) qPCR shows the presence of AAV ITR in the mouse renal cortex of mice injected with the viral vector. D) Representative immunofluorescence shows the expression of HA-tagged podocin, the podocyte-specific protein nephrin, and podocin in iPod NPHS2 fl / fl mice injected with AAV 2 / 9. The control (saline) images are of mice without the intact iPodNPHS2 fl / fl genotype, so there is no proteinuria or diseased glomeruli, as mice with diseased glomeruli show a loss of podocyte markers.

[0042] Figure 2 shows that tail vein injection of AAV 2 / 9 expressing wild-type podocin under a podocyte-specific promoter improves the conditional podocin knockout mouse model (iPod NPHS2 fl / fl) Proteinuria in ( ). A) Urinary albumin:creatinine ratio of mice injected with AAV 2 / 9mNPHS1.mpod versus AAV 2 / 9hNPHS1.mpod versus saline (n = 9 per group, **p<0.01***p<0.001). B) Coomassie staining shows representative images of the degree of albuminuria in one mouse from each experimental group. The saline group showed proteinuria starting from day 14 and showed a large amount of albumin, while the vector-treated group showed a later onset and less albuminuria. C) Survival curves show improved survival in mice injected with AAV 2 / 9hNPHS1.mpod or AAV 2 / 9mNPHS1.mpod (log-rank (Mantel-Cox) test p = 0.049, n = 3 in each virus group and n = 4 in the saline group). D) The copy number of viral DNA per 50 ng of total DNA was negatively correlated with the urinary albumin:creatinine ratio at day 42 (Spearman r = -0.4596, p = 0.0477). E) Blood results 6 weeks after doxycycline, including cholesterol, albumin, urea, and creatinine. (n = at least 3 mice per group, except for cholesterol where n = at least 2 per group). F) Histology shows representative images from each group under light microscopy. The saline-injected group showed glomerular hypertrophy, increased collagen deposition and segmental sclerosis, accompanied by tubular dilation, which is consistent with FSGS. Those injected with AAV 2 / 9 expressing murine podocin showed a range of histological findings that were roughly correlated with the urinary albumin:creatinine ratio at the time of their death. Some mice had healthy normal glomeruli, while others showed mild signs of disease, such as pseudocrescent formation (arrow) seen in mice injected with AAV 2 / 9mNPHS1.mpodHA. G) iPod NPHS2 in mice injected with saline fl / fl mice showed podocin deficiency, while nephrin expression showed a change from predominantly membranous staining to a diffuse pattern.

[0043] Figure 3. AAV LK03 shows efficient transduction of human podocytes in vitro with the minimal human nephrin promoter. A, C, E) Immunofluorescence shows transduction of AAV LK03 CMV GFP into human podocytes (Pod), glomerular endothelial cells (GEnC), and proximal tubular epithelial cells (PTEC), with GFP expression only in podocytes when using the minimal nephrin promoter AAV LK03 hNPHS1 GFP. B) Western blot shows GFP expression in podocytes only when using the minimal human nephrin promoter utilizing AAV LK03. D) Flow cytometry shows efficient transduction of podocytes with AAV LK03 CMV GFP and confirms that GFP expression using the minimal nephrin promoter is seen only in podocytes. In contrast, AAV 2 / 9 CMV GFP shows low transduction efficiency in podocytes (n = 3). F) Bar graph shows the median fluorescence intensity in podocytes transduced with AAV LK03, and histograms show the degree of green fluorescence in podocytes transduced with AAV LK03 CMV GFP (right peak), AAV LK03 hNPHS1 GFP (middle peak), and untransduced cells (left peak).

[0044] Figure 4. AAV LK03 expressing wild-type human podocin shows functional rescue in the mutant podocin R138Q podocyte cell line. A) Western blot shows transduction of AAV LK03.CMV.hpodocinHA and AAVLK03.hNPHS1.hpodocinHA into R138Q podocytes and expression of HA-tagged podocin. B) Immunofluorescence shows expression of HA-tagged wild-type podocin in mutant podocin R138Q podocytes. C) Adhesion assay shows reduced adhesion of mutant podocin R138Q podocytes and rescue of adhesion in R138Q podocytes treated with AAV LK03.hNPHS1.hpodHA.WPRE.bGH. D) Confocal microscopy shows that HA-tagged podocin does not co-localize with calnexin, an endoplasmic reticulum marker. E) TIRF microscopy shows expression of HA-tagged podocin within 100 nm of the plasma membrane, with some co-localization with caveolin, a lipid raft marker.

[0045] Figure 5 Shown is an exemplary DNA sequence of the minimal human nephrin promoter (NPHS1).

[0046] Figure 6 Shown is an exemplary cDNA sequence of the human nephrin transgene.

[0047] Figure 7 An exemplary DNA sequence showing the WPRE sequence.

[0048] Figure 8 An exemplary DNA sequence showing the bGH poly(A) signal sequence.

[0049] Figure 9 Human podocytes transduced with HAVDR(A) or HASmad7(B) using AAV LK03 with a minimal human nephrin promoter are shown. Example

[0050] Method

[0051] Vector production

[0052] We prepared pAV.hNPHS1.mpodHA.WPRE.bGH, pAV.mNPHS1.mpodHA.WPRE.bGH, and pAV.hNPHS1.hpodHA.WPRE.bGH from the CMV eGFP L22Y pUC-AV2 construct (a kind gift from Amit Nathwani) using human ( Figure 6 ) and mouse (sequence not shown) podocin cDNA (Origene, Herford, Germany) and human VDR and Smad7 cDNA. Human embryonic kidney 293T cells were transfected with a capsid plasmid (pAAV9 from Penn Vector Core, pAAV LK03 is a kind gift from Mark Kay), a helper plasmid with adenoviral genes, and the transgene plasmid using polyethyleneimine. Cells and supernatants were harvested 72 hours after transfection. The cells were subjected to 5 freeze-thaw cycles, while the supernatant was subjected to PEG precipitation (8% PEG 0.5N NaCl). These were combined and incubated with 0.25% sodium deoxycholate and 70 units / ml Benzonase at 37 °C for 30 minutes. The vector was purified by iodixanol gradient ultracentrifugation and then concentrated in PBS. The vector was titrated by qPCR using the standard curve method with the following primers: Figure 1A ) pAV.mNPHS1.hHAVDR.WPRE.bGH and pAV.mNPHS1.hHASmad7.WPRE.bGH.

[0053] ITR F GGAACCCCTAGTGATGGAGTT,

[0054] ITR R CGGCCTCAGTGAGCGA,

[0055] ITR probe FAM-5'-CACTCCCTCTGCGCTCG-3'-TAMRA.

[0056] Animal

[0057] All animal experiments and procedures were approved by the UK Home Office under the Animals (Scientific Procedures) Act 1986 and were conducted in accordance with the Guide for the Care and Use of Laboratory Animals. NPHS2 flox / flox Mice (kind gift from Corinne Antignac, INSERM U983, Paris) were crossed with NPHS2-rtTA / Tet-On Cre mice to generate offspring with NPHS2-rtTA / Tet-On Cre / NPHS2 flox / flox Upon exposure to doxycycline, these mice developed podocyte-specific podocin knockout. From here on, these will be referred to as iPod NPHS2 fl / fl . Mice were on a mixed background and equal numbers of each sex were used. At 8 weeks of age, mice were administered AAV via tail vein injection. ( Figure 1B ) 10 to 14 days later, mice were provided with drinking water supplemented with 2 mg / ml doxycycline and 5% sucrose for 3 weeks. Urine was collected weekly. At 6 weeks after the start of doxycycline, mice were sacrificed by the method of Schedule 1. A few mice were retained for more than 6 weeks to test the effect on survival. All mice were re-genotyped on tissues obtained at death.

[0058] Cell culture

[0059] Conditionally immortalized human podocytes (Pod) were cultured in RPMI with L-glutamine and NaHCO3 and 10% fetal bovine serum (Sigma Aldrich, Gillingham, UK). Conditionally immortalized human glomerular endothelial cells (GEnC) were cultured in EBM™-2 Endothelial Cell Growth Basal Medium-2 supplemented with EGM™-2 Endothelial Cell Growth Medium-2 BulletKit TM (Lonza, Basel, Switzerland). Immortalized proximal tubular epithelial cells (ATCC, Teddington, UK) (PTEC) were cultured in DMEM / F12 supplemented with insulin, transferrin and selenium, hydrocortisone and 10% FBS.

[0060] AAV was used at 5x 10 5MOI-transduced cells. For GFP expression, cells were used 5 - 7 days after transduction to allow comparison between different cell lines. For podocin, VDR, and Smad7 expression, cells were used 10 - 14 days after transduction (when podocytes were maximally differentiated).

[0061] Quantitative PCR

[0062] DNA was extracted from mouse renal cortex using the DNeasy Blood and Tissue Kit (Qiagen, Manchester, UK). AAV DNA was detected using the above primers for virus titration and normalized against mouse beta-actin.

[0063] RNA was extracted using the RNeasy Mini Kit with RNase-Free DNase Set (Qiagen, Manchester, UK).

[0064] Immunofluorescence

[0065] 5-μm sections were fixed with 4% PFA and blocked with 3% BSA, 0.3% Triton X-100, and 5% goat or donkey serum. Primary antibodies were rat IgG1 anti-HA high affinity (Roche, Basel, Switzerland), guinea pig anti-nephrin (1243 - 1256) antibody (Origene, Herford, Germany), and rabbit anti-NPHS2 antibody (Proteintech, Manchester, UK).

[0066] Cells were fixed with 4% PFA and / or ice-cold methanol, incubated with 0.03 M glycine for 5 minutes, permeabilized with 0.3% Triton, and then blocked with 3% BSA. Primary antibodies were mouse HA.11 epitope tag antibody (Biolegend, San Diego, USA), mouse anti-GFP (Roche, Basel, Switzerland), rabbit anti-calnexin (Merck Millipore, Darmstadt, Germany), and rabbit anti-caveolin-1 (Cell Signaling, Danvers, USA).

[0067] The secondary antibodies were AlexaFluor 488 donkey anti-mouse, AlexaFluor 488 donkey anti-rabbit, AlexaFluor 488 goat anti-guinea pig, AlexaFluor 555 goat anti-rabbit, and AlexaFluor 633 goat anti-rat, as well as AlexaFluor 633 phalloidin (Invitrogen, Thermo Fisher Scientific, Waltham, USA). Sections were counterstained with DAPI and mounted with Mowiol. Images were acquired using LAS (Leica Application Suite) X software on a Leica SPE single-channel confocal laser scanning microscope attached to a Leica DMi8 inverted epifluorescence microscope, or a Leica SP5-II confocal laser scanning microscope attached to a Leica DMI 6000 inverted epifluorescence microscope, or a Leica AM TIRF MC (multicolor) system attached to a Leica DMI 6000 inverted epifluorescence microscope.

[0068] Western blot

[0069] Cells were lysed in SDS lysis buffer. Samples were run on a 12.5% gel and transferred to a PVDF membrane. The membrane was blocked in 5% milk in TBST 0.1%. The primary antibodies used were mouse HA.11 epitope tag antibody (Biolegend, San Diego, USA), mouse anti-GFP in 3% BSA in TBST 0.1% (Roche, Basel, Switzerland), or rabbit anti-NPHS2 antibody (Proteintech, Manchester, UK). The secondary antibody was anti-rabbit or anti-mouse IgG peroxidase in 3% BSA in TBST 0.1% (Sigma Aldrich, Gillingham, UK). The membrane was imaged on an Amersham Imager 600.

[0070] Flow cytometry

[0071] Live cells were stained with propidium iodide, and only live single cells were included in the analysis. Flow cytometry was performed on a NovoCyte flow cytometer.

[0072] Adhesion assay

[0073] Cells were trypsinized and seeded at 10 5Resuspend in / ml and allow to recover for 10 minutes, then plate 50 μl of cells diluted 1:2 with PBS in a 96-well plate. Use technically in triplicate. Let the cells adhere at 37 °C for approximately 1 hour. Wash the cells with PBS to remove non-adherent cells, then fix with 4% PFA for 20 minutes. Wash the cells with distilled water, then stain with 0.1% crystal violet in 2% ethanol at room temperature for 60 minutes. Wash the cells and incubate with 10% acetic acid on a shaker for 5 minutes. Measure the absorbance at 570 nm and normalize the results against wild-type cell lines transduced with AAV LK03 CMV GFP.

[0074] urine

[0075] Albumin levels were measured using a mouse albumin ELISA kit (Bethyl Laboratories Inc, Montgomery, USA), and creatinine levels were measured on a Konelab Prime 60i analyzer.

[0076] Blood test

[0077] Mouse plasma was processed using a Konelab Prime 60i analyzer or Roche Cobas system with reagents and protocols supplied by the manufacturer.

[0078] Statistical analysis

[0079] Unless otherwise stated, all data are presented as mean ± SEM. Statistical analysis was performed in GraphPad Prism (Graphpad softward, La Jolla, USA). Statistical tests used included two-tailed t-tests, one-way ANOVA with Tukey's multiple comparison post hoc analysis, two-way ANOVA with Tukey's multiple comparison post hoc analysis, and log-rank (Mantel-Cox) test for survival analysis.

[0080] Results

[0081] Tail vein injection of AAV serotype 9 demonstrated transduction of renal cells and expression in podocytes

[0082] At 8 weeks of age, mice were administered 1.5 × 10 12 vg of AAV2 / 9hNPHS1.mpod or AAV2 / 9mNPHS1.mpod, or saline, via the tail vein. Six weeks later, AAV ITR was detected in the renal cortex of AAV-injected mice (AAV 2 / 9hNPHS1.mpod = 39,067 ± 13,285 copies ssDNA, AAV 2 / 9mNPHS1mpod = 76,533.33 ± 32047 copies ssDNA, n = 5 - 6 / group) (Figure 1C )。Podocin with HA tag showed co - localization with the podocyte markers nephrin and podocin ( Figure 1D )

[0083] AAV2 / 9 expressing wild - type podocin reduced albuminuria in fl / fl iPod NPHS2 mice

[0084] The vector - treated groups showed a decrease in the urinary albumin:creatinine ratio (ACR) ( Figure 2A , 2B). The F - ratio for the effect of tail - vein injection of AAV 2 / 9 expressing podocin on urinary ACR was F(2,24)=9.61, P < 0.001 (n = 9 / group). Fourteen days after doxycycline, the urinary ACR in the saline group was higher than that in either vector - treated group, although this was not significant (AAV 2 / 9hNPHS1.mpod = 758.1±488.1 mg / mmol, AAV 2 / 9mNPHS1.mpod = 59.8±28.0 mg / mmol, saline = 3,770.1±1337.6 mg / mmol, AAV 2 / 9hNPHS1.mpod vs saline p = 0.40, AAV 2 / 9mNPHS1.mpod vs saline p = 0.25). The urinary ACR in the vector - treated groups decreased significantly at day 28 (AAV 2 / 9hNPHS1.mpod = 3,083.0±932.8 mg / mmol, AAV 2 / 9mNPHS1.mpod = 2,195.1±778.9 mg / mmol, saline = 10,198±3,189.5 mg / mmol, AAV 2 / 9hNPHS1.mpod vs saline p = 0.008, AAV 2 / 9mNPHS1.mpod vs saline p = 0.002) and day 42 (AAV2 / 9hNPHS1.mpod = 3,266.8±1,212.2 mg / mmol, AAV 2 / 9mNPHS1.mpod = 3,553.3±1,477.87 mg / mmol, saline = 13,488.8±3,877.3 mg / mmol, AAV 2 / 9hNPHS1.mpod vs saline p < 0.001, AAV 2 / 9mNPHS1.mpod vs saline p < 0.001). In the vector - treated groups, 2 out of 9 mice in the AAV 2 / 9hNPHS1.mpod group and 1 out of 9 mice in the AAV 2 / 9mNPHS1.mpod group had urinary ACR less than 30 mg / mmol at day 42.

[0085] Although the mice in the vector-treated groups showed improvement, there was a high degree of variability within each group, which we hypothesized might be attributed to the amount of vector reaching the kidneys after systemic injection. The amount of viral DNA detected in the renal cortex was negatively correlated with the degree of albuminuria at day 42 (Spearman r = -0.4596, p = 0.0477)( Figure 2D ).

[0086] AAV2 / 9 expressing wild-type podocin partially rescued the phenotype of fl / fl iPod NPHS2

[0087] Vector-treated mice showed a decrease in creatinine (saline = 39.0 ± 8.5 μmol / L, AAV 2 / 9hNPHS1.mpod = 27.3 ± 7.9 μmol / L, AAV 2 / 9mNPHS1.mpod = 18.6 ± 4.4 mmol / L, p = 0.1622), a decrease in urea (saline = 39.4 ± 17.6 mmol / L, AAV 2 / 9hNPHS1.mpod = 12.0 ± 2.0 mmol / L, AAV 2 / 9mNPHS1.mpod = 11.6 ± 1.6 mmol / L, p = 0.058), an increase in albumin (saline = 10.5 ± 5.4 g / L, AAV 2 / 9hNPHS1.mpod17.1 = 4.8 ± g / L, AAV 2 / 9mNPHS1.mpod = 17.1 ± 3.6 g / L, p = 0.5602) and a significant decrease in cholesterol (saline = 15.76 ± 1.75 mmol / L, AAV 2 / 9hNPHS1.mpod = 2.64 ± 0.60 mmol / L, AAV 2 / 9mNPHS2.mpod = 4.86 ± 0.76 mmol / L, p = 0009)( Figure 2E ).

[0088] Saline-treated mice developed histological features of FSGS by 6 weeks. Vector-treated mice did not show histological features of FSGS on light microscopy but showed a range of histological findings, from completely normal glomeruli to pseudocrescents or mesangial hypercellularity.( Figure 2F )

[0089] These mice also showed extended survival (n = 3 - 4 / group), with a median survival of 75.5 days (range 38 to 111 days) in the saline group, compared to a median survival of 192 days (range 74 to 206 days still alive) in AAV 2 / 9hNPHS1.mpod and a median survival of 192 days (range 131 to 206 days still alive) in AAV 2 / 9mNPHS1.mpod (p = 0.049).

[0090] Untreated mice showed absent podocin expression and the expression pattern of nephrin changed to a diffuse pattern ( Figure 2G ). This was in stark contrast to the predominantly membranous expression pattern of nephrin and podocin in vector-treated mice ( Figure 1D ).

[0091] AAV LK03 efficiently transduced human podocytes in vitro with the minimal human nephrin promoter

[0092] Human podocytes, glomerular endothelial cells, and proximal tubular epithelial cells were transduced with AAV LK03 with CMV GFP and AAV LK03 hNPHS1 GFP at an MOI of 5×10 5 . Flow cytometry (n = 3) showed that AAV LK03 CMV GFP had a high efficiency of transduction in podocytes (% GFP expression = 98.83 ± 0.84), AAV LK03 hNPHS1 GFP had a good transduction (% GFP expression = 71.3 ± 3.39), and the expression of non-transduced cells was not obvious (% GFP expression = 0.89 ± 0.36) ( Figure 3D ). This was reflected in immunofluorescence ( Figure 3A 、 3C 、3E) and Western blotting ( Figure 3B ). Although the proportion of cells with positive GFP expression was high in podocytes transduced with AAV LK03 hNPHS1 GFP, the fluorescence intensity of these cells was lower than that of cells transduced with AAV LK03 CMV GFP ( Figure 3F ).

[0093] Interestingly, AAV LK03 CMV GFP showed lower transduction in glomerular endothelial cells (% GFP expression = 7.35 ± 0.19). AAV LK03 hNPHS1 GFP showed minimal transduction in glomerular endothelial cells (% GFP expression = 0.59 ± 0.10), similar to the level of untransduced glomerular endothelial cells (% GFP expression = 0.23 ± 0.02). Since AAV2 / 9 is the best serotype for in vivo renal cell transduction in the rodent kidney, we tested the expression of AAV 2 / 9CMV GFP on human renal cell lines. AAV 2 / 9CMV GFP showed low transduction efficiency in both podocytes (% GFP expression = 13.9 ± 1.98) and glomerular endothelial cells (% GFP expression = 21.99 ± 4.35) Figure 3D ). Transduction of human podocytes with AAV LK03 and AAVLK03 hNPHS1 HAVDR and AAV LK03 hNPHS1 hSmad7 showed good expression of both proteins Figure 9 ).

[0094] AAV LK03 expressing human podocin under the minimal nephrin promoter showed functional rescue in the mutant podocin R138Q podocyte cell line

[0095] The R138Q podocin mutant causes mislocalization of podocin from the plasma membrane to the endoplasmic reticulum. The mutant podocin R138Q podocyte cell line was obtained from patient kidneys and conditionally immortalized using temperature-sensitive SV40T antigen. AAV LK03 hNPHS1 hpod transduced R138Q podocytes and expressed HA-tagged podocin Figure 4A , 4B). HA-tagged podocin was seen on the plasma membrane under confocal microscopy and co-localized with caveolin-1, a lipid raft protein, as seen under TIRF microscopy Figure 4B , 4E). Untransduced R138Q podocytes did not show any podocin expression at the plasma membrane Figure 4B ). HA-tagged podocin did not co-localize with calnexin, an endoplasmic reticulum marker Figure 4D ).

[0096] Podocytes show decreased or increased adhesion in disease states. Previous work in our laboratory has shown that the R138Q mutation leads to decreased podocyte adhesion. AAV transduction leads to decreased podocyte adhesion, but compared to wild-type podocytes, R138Q podocytes still show reduced adhesion, and transduction with AAV LK03 hNPHS1 hpod leads to rescue of the adhesion function of R138Q podocytesFigure 4C )。

[0097] Discussion

[0098] Here, we successfully targeted mouse podocytes with AAV 2 / 9 using the minimal nephrin promoter to express mouse podocin in a conditional mouse gene knockout model, and saw partial phenotypic rescue and improvement of albuminuria in vector-treated mice. As a first proof-of-concept study, we chose to inject the vector before doxycycline induction so that when podocin was knocked out, effective rescue by the vector was in place. The effects of doxycycline induction were rapid and progressed to severe nephropathy (8 - 14 days) and relatively quickly to FSGS (about 6 weeks). We show here that, in vitro, introduction of wild-type human podocin into R138Q podocytes enables podocin expression to reach the plasma membrane and rescues podocyte adhesion.

[0099] Although we have shown that the vector improves albuminuria and survival in these mice, there was a great deal of variability in the degree of albuminuria in both treated and untreated mice. The variability within treated mice could at least in part be explained by the amount of viral transduction in the kidney ( Figure 2D )。

[0100] AAV LK03 showed high transduction approaching 100% in human podocytes in vitro, which decreased to 72.3% when using the minimal human nephrin promoter. We have shown that we can specifically transduce podocytes in vitro using this serotype, and expression of wild-type podocin in R138Q mutant podocytes showed functional rescue. Use of AAV LK03 has potential implications for translation because such efficient transduction of human podocytes could significantly reduce the effective dose in humans. A recent UK study showed a low anti-AAV LK03 neutralizing antibody seropositivity rate of 23% and a nadir in late childhood (Perocheau, D.P. et al.), which makes this particular serotype a promising candidate for translational research.

[0101] We describe a first proof-of-concept study demonstrating that AAV transduction of podocytes with a podocyte-specific promoter improves albuminuria in the fl / fl iPod NPHS2 mouse model. We also show that a synthetic capsid AAV LK03 shows high efficiency transduction of human podocytes. Taken together, this work is the first step towards translation of AAV gene therapy for single-gene diseases targeting podocytes.

[0102] References

[0103] LUO,X., HALL,G., LI,S., BIRD,A., LAVIN,P.J., WINN,M.P., KEMPER,A.R., BROWN,T.T. & KOEBERL,D.D. 2011. Hepatorenal correction in murine glycogen storage disease type I with a double-stranded adeno-associated virus vector. Mol Ther, 19, 1961-70.

[0104] MOELLER,M.J., SANDEN,S.K., SOOFI,A., WIGGINS,R.C. & HOLZMAN,L.B. 2002. Two gene fragments that direct podocyte-specific expression in transgenic mice. J Am Soc Nephrol, 13, 1561-7.

[0105] PEROCHEAU,D.P. et al. Age-Related Seroprevalence of Antibodies Against AAV-LK03 in a UK Population Cohort. doi:10.1089 / hum.2018.098.

[0106] PICCONI,J.L., MUFF-LUETT,M.A., WU,D., BUNCHMAN,E., SCHAEFER,F. & BROPHY,P.D. 2014. Kidney-specific expression of GFP by in-utero delivery of pseudotyped adeno-associated virus 9. Molecular Therapy. Methods & Clinical Development, 1, 14014.

[0107] ROCCA,C.J.,UR,S.N.,HARRISON,F.&CHERQUI,S. 2014. rAAV9 combined with renal vein injection is optimal for kidney-targeted gene delivery: conclusion of a comparative study. Gene therapy, 21, 618-628.

[0108] SCHIEVENBUSCH,S.,STRACK,I.,SCHEFFLER,M.,NISCHT,R.,COUTELLE,O., M.,HALLEK,M.,FRIES,J.W.U.,DIENES,H.-P.,ODENTHAL,M.& H. 2010. Combined Paracrine and Endocrine AAV9 mediated Expression of Hepatocyte Growth Factor for the Treatment of Renal Fibrosis. Molecular Therapy, 18, 1302-1309.

[0109] SCHAMBACH,A.,BOHNE,J.,BAUM,C.,HERMANN,F.G.,EGERER,L.,VON LAER,D.&GIROGLOU,T. 2005. Woodchuck hepatitis virus post-transcriptional regulatory element deleted from X protein and promoter sequences enhances retroviral vector titer and expression. Gene Therapy, 13, 641.

[0110] VAN DER WOUDEN,E.A.,SANDOVICI,M.,HENNING,R.H.,DE ZEEUW,D.&DEELMAN,L.E. 2004. Approaches and methods in gene therapy for kidney disease. J Pharmacol Toxicol Methods, 50, 13-24.

[0111] Sequence Listing Free Text

[0112] [SEQ ID NO:1] shows the ITR forward primer.

[0113] [SEQ ID NO:2] shows the ITR reverse primer.

[0114] [SEQ ID NO:3] shows the DNA sequence of the ITR probe FAM-5'-CACTCCCTCTGCGCTCG-3'-TAMRA.

[0115] [SEQ ID NO:4] shows Figure 5 the exemplary DNA sequence of the minimal human nephrin promoter (NPHS1) shown in

[0116] [SEQ ID NO:5] shows Figure 6 the exemplary cDNA sequence of the human podocin transgene shown in

[0117] [SEQ ID NO:6] shows Figure 7 the exemplary DNA sequence of the WPRE sequence shown in

[0118] [SEQ ID NO:7] shows Figure 8 the exemplary DNA sequence of the bGH poly(A) signal sequence shown in

Claims

1. Use of an adeno-associated virus (AAV) vector in the preparation of a pharmaceutical composition for the treatment of monogenic forms of nephrotic syndrome, wherein the AAV vector comprises: an NS-related transgene; and the minimal nephrin promoter NPHS1 or the podocin promoter NPHS2, and wherein the AAV vector is AAV serotype LK03 or 3B; wherein the NS-related transgene is NPHS2 ; ADCK4 ; ALG1 ; ARHGAP24 ; ARGHDIA ; CD151 ; CD2AP ; COQ2 ; COQ6 ; DGKE ; E2F3 ; EMP2 ; KANK2 ; LAGE3 ; LMNA ; LMX1B ; MAFB ; NUP85 ; NUP93 ; NXF5 ; OSGEP ; PAX2 ; PDSS2 ; PMM2 ; PODXL ; SCARB2 ; SGPL1 ; Smad7 ; TP53RK ; TPRKB ; VDR ; WDR73 ; WT1 ; ZMPSTE24 ; or APOL1 。 2. The use according to claim 1, wherein the AAV vector is AAV serotype LK03.

3. The use according to claim 1 or 2, wherein the NS-related transgene is NPHS2 。 4. The use according to claim 1 or 2, wherein the AAV vector further comprises a woodchuck hepatitis post-transcriptional regulatory element (WPRE).

5. The use according to claim 1 or 2, wherein the NS-related transgene is human and / or comprises a hemagglutinin (HA) tag.

6. The use according to claim 1 or 2, wherein the AAV vector further comprises a Kozak sequence between the promoter and the NS-related transgene.

7. The use according to claim 1 or 2, wherein the AAV vector further comprises a polyadenylation signal.

8. The use according to claim 1 or 2, wherein the AAV vector will be administered to a human patient.

9. The use according to claim 8, wherein the patient is a pediatric patient.

10. The use according to claim 1 or 2, wherein the single-gene form of NS is the single-gene form of steroid-resistant nephrotic syndrome.

11. The use according to claim 1 or 2, wherein the AAV vector will be administered systemically.

12. The use according to claim 1 or 2, wherein the AAV vector will be administered by intravenous injection.

13. The use according to claim 1 or 2, wherein the AAV vector will be administered by injection into the renal artery.

14. The use according to claim 7, wherein the polyadenylation signal is the bovine growth hormone (bGH) polyadenylation signal.

15. An adeno-associated virus (AAV) vector for treating a single-gene form of nephrotic syndrome, the AAV vector comprising: an NS-related transgene; and the minimal nephrin promoter NPHS1 or the podocin promoter NPHS2, and wherein the AAV vector is AAV serotype LK03 or 3B; wherein the NS-related transgene is NPHS2 ; ADCK4 ; ALG1 ; ARHGAP24 ; ARGHDIA ; CD151 ; CD2AP ; COQ2 ; COQ6 ; DGKE ; E2F3 ; EMP2 ; KANK2 ; LAGE3 ; LMNA ; LMX1B ; MAFB ; NUP85 ; NUP93 ; NXF5 ; OSGEP ; PAX2 ; PDSS2 ; PMM2 ; PODXL ; SCARB2 ; SGPL1 ; Smad7 ; TP53RK ; TPRKB ;VDR ; WDR73 ; WT1 ; ZMPSTE24 ; or APOL1 。 16. The AAV vector according to claim 15, wherein the AAV vector is AAV serotype LK03.

17. The AAV vector according to claim 15 or 16, wherein the NS-related transgene is NPHS2 。 18. The AAV vector according to claim 15 or 16, wherein the AAV vector further comprises a woodchuck hepatitis post-transcriptional regulatory element (WPRE).

19. The AAV vector according to claim 15 or 16, wherein the NS-related transgene is human and / or comprises a hemagglutinin (HA) tag.

20. The AAV vector according to claim 15 or 16, wherein the AAV vector further comprises a Kozak sequence between the promoter and the NS-related transgene.

21. The AAV vector according to claim 15 or 16, wherein the AAV vector further comprises a polyadenylation signal.

22. The AAV vector according to claim 21, wherein the polyadenylation signal is a bovine growth hormone (bGH) polyadenylation signal.

Images