A negative regulatory mechanism, experimental method and application of Agrin-MuSK-DOK7 signaling pathway

Abstract

The present invention discloses a negative regulation mechanism, experimental method and application of the Agrin-MuSK-DOK7 signaling pathway. After Agrin stimulates myotubes to activate MuSK, MuSK promotes phosphorylation of DOK7 Tyr106. With the help of CDH1, APC2 binds to DOK7 phosphorylated at Tyr106 and mediates ubiquitination of DOK7 Lys243 mainly in the form of K48 connection, promoting the degradation of DOK7 through the proteasome system, and ultimately leading to downregulation of DOK7 protein level, thereby achieving negative regulation of the Agrin-MuSK-DOK7 signaling pathway. In the present invention, APC2 CDH1 By promoting the ubiquitination and degradation of DOK7, negative regulation of the Agrin-MuSK-DOK7 signaling pathway is achieved, avoiding excessive activation of the Agrin-MuSK-DOK7 signaling pathway leading to abnormal NMJ development. The present invention provides a new theoretical basis for a deeper understanding of the molecular mechanism of neuromuscular junction development, and also provides new ideas for the development of treatment methods for related diseases.

Description

Technical Field

[0001] The present invention specifically relates to a negative regulation mechanism, experimental method and application of an Agrin-MuSK-DOK7 signaling pathway. Background Art

[0002] Neuromuscular junction (NMJ) is a structural unit where neurons control muscle movement. Under normal circumstances, only one mature NMJ is formed on each muscle fiber. Abnormal development of NMJ can lead to a variety of diseases, including congenital myasthenic syndrome (CMS), myasthenia gravis (MG) and amyotrophic lateral sclerosis (ALS). Studies have shown that the Agrin-MuSK-DOK7 signaling pathway (Agrin is secreted by presynaptic motor neurons and acts on postsynaptic muscle fibers as an extracellular ligand) plays an extremely important role in the development of vertebrate NMJ. Genetic studies have found that knocking out DOK7 will cause the signaling pathway to fail to activate and fail to induce AChR aggregation, ultimately leading to the inability of mice to form NMJs and death after birth due to inability to breathe. At the same time, studies have also shown that overexpression of DOK7 can lead to excessive activation of the pathway, resulting in the formation of multiple NMJs on each muscle fiber, accompanied by abnormalities such as a decrease in the number of synaptic vesicles of presynaptic motor neurons and a decrease in the area of ​​the active zone. These studies indicate that the activation level of the Agrin-MuSK-DOK7 signaling pathway needs to be precisely regulated to ensure normal development of the NMJ. Current studies have clearly revealed the activation mechanism of the Agrin-MuSK-DOK7 signaling pathway, but the negative regulatory mechanism that prevents overactivation of the signaling pathway is still unclear.

[0003] APC / C (Anaphase promoting complex / cyclosome) is a multi-subunit ubiquitin ligase involved in cell cycle regulation. APC / C is composed of fourteen core subunits, most of which play the role of scaffold proteins. The core subunit APC2 is a catalytic subunit. When APC / C mediates substrate ubiquitination, it also requires a subunit that recognizes the substrate. This subunit is usually one of CDC20 or CDH1 (also known as Fzr1). Although APC / C is a multi-subunit ubiquitination ligase, studies have found that overexpression of APC2 or CDH1 in cells can lead to increased ubiquitination levels of its substrates and decreased protein levels. Studies have shown that APC / C can regulate the protein level of glutamate receptor GLR-1 in nematode neurons. However, the function and mechanism of APC / C in the development of vertebrate NMJs remain to be studied. Summary of the invention

[0004] In view of the above situation, in order to overcome the defects of the prior art, the present invention provides a negative regulation mechanism, experimental method and application of the Agrin-MuSK-DOK7 signaling pathway.

[0005] In order to achieve the above object, the present invention provides the following technical solutions:

[0006] A negative regulation method for the Agrin-MuSK-DOK7 signaling pathway, wherein Agrin promotes the ubiquitination of DOK7 and its degradation through the proteasome system, ultimately leading to downregulation of DOK7 protein levels, thereby achieving negative regulation of the Agrin-MuSK-DOK7 signaling pathway.

[0007] Furthermore, MuSK can promote the ubiquitination and degradation of DOK7; MuSK regulation of DOK7 ubiquitination depends on its own kinase activity and binding to DOK7.

[0008] Furthermore, the ubiquitination site of DOK7 is lysine 243 of DOK7; ubiquitination of DOK7 Lys243 negatively regulates the aggregation of AChR.

[0009] Furthermore, overexpression of APC2 promoted the ubiquitination and degradation of DOK7; DOK7 ubiquitination depended on its own tyrosine phosphorylation at position 106; and DOK7 Tyr106 phosphorylation promoted DOK7 dimerization.

[0010] Furthermore, after Agrin stimulates myotubes to activate MuSK, MuSK promotes the phosphorylation of DOK7 Tyr106. With the help of CDH1, APC2 binds to DOK7 phosphorylated at Tyr106 and mediates the ubiquitination of DOK7 Lys243 mainly in the form of K48 linkage, promoting the degradation of DOK7 through the proteasome system, ultimately leading to the downregulation of DOK7 protein levels, thereby achieving negative regulation of the Agrin-MuSK-DOK7 signaling pathway.

[0011] An experimental method for studying the negative regulation mechanism of the Agrin-MuSK-DOK7 signaling pathway, which can be used to study the negative regulation method described above, comprises the following steps:

[0012] (1) To simulate the activation process of the Agrin-MuSK-DOK7 signaling pathway in vivo in vitro, C2C12 differentiated myotubes were stimulated with Agrin, and samples were collected at different stimulation time points for Western blot analysis;

[0013] (2) Q-PCR was used to detect the mRNA levels of LRP4, MuSK, and DOK7 before and after Agrin stimulation;

[0014] (3) Before agrin stimulation of myotubes, the myotubes were treated with the proteasome inhibitor MG132 and the autophagy-lysosome inhibitor CQ for 1 h. After agrin stimulation of myotubes, the samples were collected for Western blot analysis.

[0015] Furthermore, the ubiquitin linkage mode of DOK7 ubiquitination was detected by transfecting ubiquitin wild-type plasmid (HA-ubi-WT), ubiquitin mutant plasmid in which only lysine at position 48 was retained and the other six lysines were mutated to arginine (HA-ubi-K48), and ubiquitin mutant plasmid in which only lysine at position 63 was retained and the other six lysines were mutated to arginine (HA-ubi-K63).

[0016] Furthermore, whether DOK7 Tyr106 phosphorylation regulates APC2 CDH1 Detection of substrate recognition of DOK7: HEK 293T cells were transfected with the corresponding plasmids, and samples were collected 24 hours after transfection, and GFP-DOK7 was co-IPed with GFP antibody, and then the level of APC2 protein bound to DOK7 in the co-IP product was detected with Flag antibody.

[0017] Furthermore, we tested whether Agrin regulates the binding of endogenous DOK7 and APC2 in myotubes by using DOK7 antibody for co-IP and then using APC2 antibody to detect the level of APC2 protein bound to DOK7 in the co-IP product.

[0018] A negative regulatory mechanism of the Agrin-MuSK-DOK7 signaling pathway in maintaining normal AChR clustering and neuromuscular junction development.

[0019] The beneficial effects of the present invention are:

[0020] (1) In the present invention, Agrin stimulation can induce the binding of DOK7 to APC2, thereby leading to the ubiquitination of DOK7; the binding of MuSK to DOK7 and the phosphorylation modification of DOK7 Tyr106 by MuSK dependent on its own kinase activity are prerequisites for APC2-mediated ubiquitination of DOK7 Lys243; APC2 is enriched in the postsynaptic region of NMJ and negatively regulates AChR aggregation and NMJ development.

[0021] (2) The present invention focuses on exploring the negative regulatory mechanism of the Agrin-MuSK-DOK7 signaling pathway. First, the activation process of the Agrin-MuSK-DOK7 signaling pathway was simulated in in vitro cultured myotubes. It was found that Agrin activated MuSK, causing DOK7 to be ubiquitinated and degraded through the proteasome system, and the kinase activity of MuSK was necessary for regulating DOK7 ubiquitination. Secondly, combining overexpression and knockdown experiments, it was found that the core subunit APC2 and the substrate recognition subunit CDH1 of APC / C were necessary for mediating DOK7 ubiquitination. After DOK7Tyr106 was phosphorylated by MuSK, it enhanced the binding of DOK7 to APC2, thereby promoting the ubiquitination of DOK7 Lys243. Finally, functional detection of DOK7 ubiquitination in in vitro cultured myotubes and mouse tibialis anterior muscles found that knocking down APC2 to inhibit DOK7 ubiquitination can enhance AChR aggregation. In summary, the present invention discloses APC2 CDH1 By promoting the ubiquitination and degradation of DOK7, negative regulation of the Agrin-MuSK-DOK7 signaling pathway is achieved, and the over-activation of the Agrin-MuSK-DOK7 signaling pathway leading to abnormal NMJ development is avoided. The discovery of the present invention provides a new theoretical basis for a deeper understanding of the molecular mechanism of neuromuscular junction development, and also provides new ideas for the development of treatment methods for related diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1It is a schematic diagram of the results that Agrin promotes the ubiquitination modification of DOK7 and its degradation through the proteasome system; wherein, (A) is a schematic diagram of Agrin stimulation of myotubes leading to a decrease in DOK7 protein level; (B) is a schematic diagram of the results of the mRNA level detection of LRP4, MuSK and DOK7 in myotubes after Agrin stimulation for 4 hours; (C) is a schematic diagram of Agrin stimulation promoting the degradation of DOK7 through the proteasome system; (D) is the statistical result of Figure (C); (E) is a schematic diagram of Agrin stimulation-induced DOK7 ubiquitination.

[0023] Figure 2 The figure is a schematic diagram of the results of MuSK promoting the ubiquitination and degradation of DOK7, wherein (A) is a schematic diagram of MuSK promoting the ubiquitination of DOK7; (B) is a schematic diagram of MuSK promoting the degradation of DOK7; (C) is the statistical result of (B); (D) is a schematic diagram of MuSK promoting the degradation of DOK7 through the proteasome system; (E) is a schematic diagram of the ubiquitination level of DOK7 in IP samples.

[0024] Figure 3 Figure 1 is a schematic diagram of MuSK regulating DOK7 ubiquitination, which depends on its own kinase activity and binding to DOK7, wherein (A) is a schematic diagram of DOK7 ubiquitination levels in IP samples; (B) is a schematic diagram of DOK7 ubiquitination levels in co-IP samples and MuSK protein levels in co-IP samples; (C) is a schematic diagram of DOK7 ubiquitination levels in co-IP samples and MuSK protein levels; (D) is a schematic diagram of Western blot results after sampling at different CHX treatment time points after plasmid transfection; (E) is a schematic diagram of the statistical results of Figure (D).

[0025] Figure 4 In the figure, (A) is a schematic diagram of the ubiquitination level of DOK7 in IP samples, (B) is a schematic diagram showing that the common mutation of 8 lysines in the PH domain does not affect the ubiquitination of DOK7; (C) is a schematic diagram showing the ubiquitination level of DOK7 in IP samples detected by HA antibody; (D) is a schematic diagram showing the results of Western blot detection after HEK293T cells were transfected with the corresponding plasmids and samples were collected at different CHX treatment time points.

[0026] Figure 5 The diagram is a schematic diagram of the ubiquitination of DOK7 Lys243 that negatively regulates the aggregation of AChR, where (A) is the comparison result of DOK7K243 and its surrounding amino acid sequences in different species; the red mark indicates the conserved lysine; (B) is a schematic diagram of the results after sample staining, (C) is the statistical result of Figure (B); (D) is a schematic diagram of electroporation; (E) is a schematic diagram of the staining results of the tibialis anterior muscle; (F) is the statistical result of Figure (E).

[0027] Figure 6Schematic diagram of the results of APC2 promoting the ubiquitination and degradation of DOK7, (A) Schematic diagram of DOK7 protein level and E3 expression results; (B) is the statistical result of Figure (A); (C) Schematic diagram of the results of ubiquitination level of DOK7 in IP samples, (D) Schematic diagram of APC2 expression before and after C2C12 differentiation; (E) Schematic diagram of overexpression of APC2 leading to a decrease in endogenous DOK7 protein level in myotubes.

[0028] Figure 7 Schematic diagram of knocking down APC2 to inhibit DOK7 ubiquitination, (A) Schematic diagram of knocking down APC2 to inhibit MuSK-regulated DOK7 ubiquitination; (B) Schematic diagram of knocking down APC2 to inhibit Agrin-induced DOK7 ubiquitination.

[0029] Figure 8 Schematic diagram of CDH1 being the substrate recognition subunit mediating DOK7 ubiquitination; (A) Schematic diagram of knocking down CDH1 to inhibit DOK7 ubiquitination; (B) Schematic diagram of the results of detecting the knockdown efficiency of CDC20 shRNA by Q-PCR; (C) Schematic diagram of the results of detecting the knockdown efficiency of CDH1 shRNA by Q-PCR.

[0030] Fig. 9 Schematic diagram of the results of APC2 localization at NMJ and enrichment in postsynaptic myotubes, (A) Schematic diagram of APC2 localization at NMJ; (B) Schematic diagram of separation of synaptic and non-synaptic regions of mouse diaphragm; (C) Schematic diagram of fluorescence quantitative PCR detection of the enrichment of APC2 mRNA in synaptic and non-synaptic regions; (D) Schematic diagram of APC2 enrichment in synaptic regions.

[0031] Fig.10 Schematic diagram of the results of APC2 negatively regulating AChR aggregation and NMJ development, (A) Schematic diagram of overexpression of APC2 inhibiting AChR aggregation; (B) Statistical results of Figure (A); (C) Schematic diagram of knocking down APC2 promoting AChR aggregation; (D) Statistical results of Figure (C); (E) Schematic diagram of knocking down APC2 in mice promoting AChR aggregation; (F) is the statistical result of Figure (E); (G) Statistical results of Figure (E); The average area size of AChR aggregation in each group was statistically analyzed, with three mice in each group, and the values ​​are Mean±SEM, **p<0.01.

[0032] Fig.11 Schematic diagram of the results of phosphorylation of DOK7 Tyr106 regulating DOK7 ubiquitination, (A) Schematic diagram of the ubiquitination level of DOK7 in IP products; (B) Schematic diagram of DOK7 Tyr106 phosphorylation promoting DOK7 ubiquitination; (C) Schematic diagram of DOK7 Tyr106 phosphorylation promoting DOK7 degradation; (D) Schematic diagram of the tyrosine phosphorylation level of DOK7 in IP products.

[0033] Fig.12 Schematic diagram of DOK7 Tyr106 phosphorylation promoting DOK7 dimerization, (A) Schematic diagram of HA-DOK7 protein levels bound to Flag-DOK7 in co-IP products; (B) Schematic diagram of DOK7 Tyr106 phosphorylation promoting AChR aggregation; (C) Statistical results of (B); The figure shows the results of at least three independent repeated experiments, the values ​​are Mean±SEM, ***p<0.001.

[0034] Fig.13 The following is a schematic diagram of DOK7 Tyr106 phosphorylation promoting the binding of DOK7 to APC2. (A) Schematic diagram of the alignment of DOK7 amino acid sequences. (B) Schematic diagram of DOK7 Tyr106 phosphorylation promoting the binding of DOK7 to APC2. (C) Schematic diagram of APC2 specifically binding to DOK7. (D) Agrin stimulation promotes the binding of DOK7 to APC2. C2C12 myotubes were stimulated with Agrin after 5 days of differentiation. After 1 hour of stimulation, samples were collected and co-IPed with DOK7 antibody. APC2 antibody was then used to detect the level of APC2 protein bound to DOK7 in the co-IP product. DETAILED DESCRIPTION

[0035] The technical solution of the present invention is further described in detail below in conjunction with the accompanying drawings. It should be noted that the specific implementation is only a detailed description of the present invention and should not be regarded as a limitation of the present invention. The reagents, instruments, etc. used in the present invention can all be purchased through commercial channels.

[0036] 1.2 Reagents and consumables

[0037] High glucose DMEM cell culture medium C11995500CP; Gibco, fetal bovine serum FSP500; ExCell Bio; horse serum 100-508; GemCell; goat serum 16210064; Gibco; 10% penicillin / streptomycin solution SV30010; Hyclone; serum-free MEM medium 31985-070; Gibco; 0.05% trypsin 25300-054; Gibco; 1× PBS solution C10010500CP; Gibco; gelatin (Gelatin) G7041; Sigma-Aldrich; ubiquitin activating enzyme E1 inhibitor PYR-41S7129; Sell eck; Cycloheximide (CHX) 5087390001; Sigma-Aldrich; 26S proteasome inhibitor MG132C2211; Sigma-Aldrich; Chloroquine (CQ) C6628; Sigma-Aldrich; Liposome nucleic acid transfection reagent 40802ES02; Shanghai Yisheng Co., Ltd.; Puromycin A1113803; Thermo; 30% acrylamide / methylene bisacrylamide (29:1) B546017; Shanghai Shenggong Co., Ltd.; TEMED T9281; Sigma-Aldrich; SDS L3771; Sigma-Aldrich; APSA3678; Sigma-Aldrich; Tris A600194; Shanghai Bioengineering Co., Ltd.; Glycerol G5516; Sigma-Aldrich; Bromophenol blue A100449; Shanghai Bioengineering Co., Ltd.; BCA protein quantification kit C503021; ​​Shanghai Bioengineering Co., Ltd.; Skim milk powder A600669; Shanghai Bioengineering Co., Ltd.;

[0038] PMSF 93482; Sigma-Aldrich; Protease inhibitor cocktail tablets A32953; Thermo; Protein phosphatase inhibitor A32957; Thermo; Glycine A100167; Shanghai Bioengineering Co., Ltd.; Anhydrous methanol A601617; Shanghai Bioengineering Co., Ltd.; Anhydrous ethanol A500737; Shanghai Bioengineering Co., Ltd.; Triton X-100 T8787; Sigma-Aldrich; Tween-20 V900548; Sigma-Aldrich; Isopropanol A600918; Shanghai Bioengineering Co., Ltd.; Trizol 15596026; Thermo; cDNA synthesis kit 6210A; Takara; SYBR Green Mix A25780; Thermo; 2× PrimeStar MAX mix R045A; Takara; Xho I 1094A; Takara; Kpn I 1068S; Takara; Hind III1060S; Takara; Xba I 1093S; Takara; BamH I 1010S; Takara; Mlu I 1071A; DNA polymerase F531S; Thermo; paraformaldehyde (PFA) 158127; Sigma-Aldrich; sucrose A100335; Shanghai Bioengineering Co., Ltd.; sodium chloride A100241; Shanghai Bioengineering Co., Ltd.; bovine serum albumin V900933; Sigma-Aldrich; DAPI E607303; Shanghai Bioengineering Co., Ltd.; sealing medium E675005; Shanghai Bioengineering Co., Ltd.; peptone A505247; Shanghai Bioengineering Co., Ltd.; yeast extract A100850; Shanghai Bioengineering Co., Ltd.; agar powder A100637; Shanghai Bioengineering Co., Ltd.; plasmid mini-extraction kit D6943-02; Omega; plasmid midi-extraction kit D6905-03; Omega; OCT tissue embedding medium 4583; Sakura; Protein A / G Plus-agarose SC-2003, Santa-cruz; fluorescently labeled α-bungarotoxin Alomone Labs; PVDF membrane (0.45 μm) 88518; Thermo; Ponceau staining solution C520005; Shanghai Bioengineering Co., Ltd.; RIPA lysis buffer C500005; Shanghai Bioengineering Co., Ltd.;

[0039] 2×SDS loading P0015B; Bio-Tech Biotechnology Co., Ltd.; Ampicillin A100339; Shanghai Bio-Tech Co., Ltd.; Kanamycin A100408, Shanghai Bio-Tech Co., Ltd.; Chemiluminescent substrate 32132; Thermo; Ultrasensitive chemiluminescent substrate 34095; Thermo;

[0040] 1.3 Primer sequences and plasmid construction

[0041] The primer names and primer sequences (5'→3') are:

[0042] APC2-XhoI-F:ACTCGAGATGGAGGCCAGGTGTGGC;

[0043] APC2-KpnI-R:AGGTACCGTGTTGGAATTCTTAGGCAGGC;

[0044] DOK7-HindIII-F:AAAGCTTATGACCGAGGCGGCGC; DOK7-XbaI-R:ATCTAGAAGGAGGGGGGTTTAC;

[0045] DOK7-XhoI-F:ACTCGAGATGACCGAGGCGGCGCTGG;

[0046] DOK7-KpnI-R:AGGTACCGTAGGAGGGGGTTTACCTTGAG;

[0047] DOK7-R158 / 159A-F:TGTCTGACCTCGCCGCGTACGGGG;

[0048] DOK7-R158 / 159A-R:CGGCCCCGTACGCGGCGAGGTCAG;

[0049] DOK7-R174A-F:GAAGGCGGGACCGCCTGTGGGTAC;

[0050] DOK7-R174A-R:GTACCCACAGGCGGTCCCGCCTTC;

[0051] MuSK-K608R-F:CACTATGGTGGCCGTGGCGATGCTTAAGGAAGAG;

[0052] MuSK-K608R-R:CTCTTCCTTAAGCATCGCCACGGCCACCATAGTG;

[0053] MuSK-Y553F-F:CCATCCCAACCCCATGTTCCAGAGGATGCCACTCC;

[0054] MuSK-Y553F-R;GGAGTGGCATCCTCTGGAACATGGGGTTGGGATGG;

[0055] DOK7-K12R-F:GGTGGAGGGCCAGGTCAGGCTGCGGGACGGCAAG;

[0056] DOK7-K12R-R:CTTGCCGTCCCGCAGCCTGACCTGGCCCTCCACC;

[0057] DOK7-K17 / 18R-F:GCTGCGGGACGGCAGGAGGTGGAAGAGTAGGTG;

[0058] DOK7-K17 / 18R-F:CACCTACTCTTCCACCTCCTGCCGTCCCGCAGC;

[0059] DOK7-K17 / 18 / 20R-F:GACGGCAGGAGGTGGAGGAGTAGGTGGCTGGTG;

[0060] DOK7-K17 / 18 / 20R-R:CACCAGCCACCTACTCCTCCACCTCCTGCCGTC;

[0061] DOK7-K28R-F:TGGCTGGTGCTGCGGAGGCCGTCGCCCGTGGCAGAC;

[0062] DOK7-K28R-R:GTCTGCCACGGGCGACGGCCTCCGCAGCACCAGCCA;

[0063] DOK7-K42 / 44R-F:CTGGTCTACAGGGACAGGTCGGAGCGTATCAAG;

[0064] DOK7-K42 / 44R-R:CTTGATACGCTCCGACCTGTCCCTGTAGACCAG;

[0065] DOK7-K49R-F:GTCGGAGCGTATCAGGGGCCTGCGGGAGCGCAGCAG;

[0066] DOK7-K49R-R:CTGCTGCGCTCCCGCAGGCCCCTGATACGCTCCGAC;

[0067] DOK7-K123R-F:AGTGGCTCCAGGCACCAGGTTGGAGAGCGGCCCGG;

[0068] DOK7-K123R-R:CCGGGCCGCTCTCCAACCTGGTGCCTGGAGCCACT;

[0069] DOK7-K153R-F:GTCACGGGGCAGTGGAGGCTGTCTGACCTCCGGCG;

[0070] DOK7-K153R-R:CGCCGGAGGTCAGACAGCCTCCACTGCCCCGTGAC;

[0071] DOK7-K207R-F:GCATCTCCCCCACCAGGGGCCCCTTTGGGCTGCGG;

[0072] DOK7-K207R-R:CCGCAGCCCAAAGGGGCCCCTGGTGGGGGAGATGC;

[0073] DOK7-K243R-F;CCCTACAGCTGGAGAGGCGGCTGAGCCTCCTCTCA;

[0074] DOK7-K243R-R:TGAGAGGAGGCTCAGCCGCCTCTCCAGCTGTAGGG;

[0075] DOK7-Y41A-F:CCTGCTGATGCTGGTCGCAAAGGACAAGTCGGAGC;

[0076] DOK7-Y41A-R:GCTCCGACTTGTCCTTTGCGACCAGCATCAGCAGG;

[0077] DOK7-Y71A-F:GAGCCCGGCCTGCCCGCAGAGGGCCTGGTCCACAC;

[0078] <h2 style=";text-align:left;direction:ltr">DOK7-Y71A-R:GGCCCTCGCCGGCAGGCCGGGCTCCAGCCCGC;<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0079] <h2 style=";text-align:left;direction:ltr"> DOK7-Y106A-F:GGATGCCCGGATCCGCGCTGCGCTCGGCGAGGTG;<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0080] <h2 style=";text-align:left;direction:ltr"> DOK7-Y106A-R:CACCTCGCCCAGCGCAGCGCGGATCCGGCATCC;<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0081] <h2 style=";text-align:left;direction:ltr"> DOK7-Y160A-F:TCTGACCTCCGGCGCGCAGGGGCCGTGCCAAGCG;<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0082] <h2 style=";text-align:left;direction:ltr"> DOK7-Y160A-R:CGCTTGGCACGGCCCCTGCGCGCCGGAGGTCAGA;<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0083] <h2 style=";text-align:left;direction:ltr"> DOK7-Y177A-F:GGACCAGGGTGTGGGGCATGGGCTGGCGTCTTCTTC;<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0084] <h2 style=";text-align:left;direction:ltr"> DOK7-Y177A-R:GAAGAAGACGCCAGCCCATGCCCCACACCTGGTCC;<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0085] <h2 style=";text-align:left;direction:ltr"> DOK7-Y349A-F;CTCCTCTGGCTCCAGCAGCCTCTCGTCCCTACGC;<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0086] <h2 style=";text-align:left;direction:ltr"> DOK7-Y349A-R:TGCTGGAGCCAGAGGAGTGGCTGCCAGTGGCGATG;<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0087] <h2 style=";text-align:left;direction:ltr"> DOK7-Y355A-F;CTCGTCCGGCGCGGGCAGCAGCCTGGACCGTGTG;<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0088] <h2 style=";text-align:left;direction:ltr"> DOK7-Y355A-R:TGCCCGCGGCGGACGAGAGGCTGCTGGAGTAAGAG;<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0089] <h2 style=";text-align:left;direction:ltr"> DOK7-Y395A-F:CCGGGACAGTCGAGGCCCAGGTGCCCACCTCCCTG;<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0090] <h2 style=";text-align:left;direction:ltr"> DOK7-Y395A-R:GGAGGTGGGCACCTGGGCCTCGACTGTCCCGGGCA;<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0091] DOK7-Y405A-F:CCCTGCGGGCCCACGCCGACACACCACGCAGCCTT;

[0092] DOK7-Y405A-R:CTGCGTGGTGTGTCGGCGTGGGCCCGCAGGGAGGT;

[0093] q-PCR-GAPDH-F:ATGGTGAAGGTCGGTGTGAAC;qPCR-GAPDH-R:AGTGGAGTCATACTGGAACATG;qPCR-MuSK-F:TGAAGCTGGAAGTGGAGGTTTT;qPCR-MuSK-R:GCAGTAGGGTTACAAAGGAA;

[0094] qPCR-LRP4-F:GCTATGGCAGAGCCTAGAGAA;qPCR-LRP4-R:CGACCAGCGTAGTCGATGG;

[0095] qPCR-DOK7-F:ATGACCGAGGCGGCGCTGGTG;qPCR-DOK7-R:GACCAGCATCAGCAGGCAGTC;

[0096] qPCR-CDC20-F:GACCACTCCTAGCAAACCTGG;qPCR-CDC20-R:GGGCGTCTGGCTGTTTTCA;

[0097] qPCR-CDH1-F:GACCGCTGTATCCGCTTCTG;qPCR-CDH1-R:GGTCAGGGAGGGGTACTTCC;

[0098] qPCR-CDH1-F:GAGATGCGGAGAACCCTGAC;qPCR-CDH1-R:TGGAAGTTCACGCTCCAGTTG;

[0099] qPCR-APC1-F:AAGGGCAACGATGATTGCAG;qPCR-APC1-R:TGCACCATCAGAAGACCATAAC;

[0100] qPCR-APC2-F:AGCGCCTCTATGGTCGTTTC;qPCR-APC2-R:TACCGGCTATCTAGCTCACCC;

[0101] qPCR-APC3-F:ACCAGATAACGTCCCCCTTG;qPCR-APC3-R:CTCCAGGACTTGGGGTTTCT;

[0102] qPCR-APC4-F:CTGCGCTTTCCGACCTGTT;qPCR-APC4-R:AAAACCTCGCCTGTAGTGTTG;

[0103] qPCR-APC5-F:CCTGCGCCACATGATCTTG;qPCR-APC5-R:TTTTCTCCCCGTTCTGGAAGT;

[0104] qPCR-APC6-F:GCACCTCTGCAAAACTCCAC;qPCR-APC6-R:TGCTGTGGTCTGACATAGACG;

[0105] qPCR-APC7-F:TGAGCTGTTTTCCCCGTCG;qPCR-APC7-R:CCGCACTTTGGAAGTCTTACT;

[0106] qPCR-APC8-F:AGACACCCACCTCTGACACG;qPCR-APC8-R:ACTGAAGACAGGTTGAGTGGAG;

[0107] qPCR-APC10-F:ATGACCACACCGAACAAGACA;qPCR-APC10-R:TCCCGTAATTGATCCACTCCAA;

[0108] qPCR-APC11-F:GATGGCGTTTAATGGCTGCTG;qPCR-APC11-R:TCCACTCCTGGCGACACAT;

[0109] qPCR-APC12-F:GAAGGTGTAGGAACCAGCGAT;qPCR-APC12-R:GCGGTTGTTGCTCTTGAGTTG;

[0110] qPCR-APC13-F:TGAGGTACAGCGAGATGGAAG;qPCR-APC13-R:GGAAGCTCACTCAGTGGAATG;

[0111] qPCR-APC15-F:TGCAAGACATGGATGAGATGAATG;

[0112] qPCR-APC15-R:TCCTGTTCGTTGCCTTCCAT; qPCR-APC16-F:GTCACCGGATCTGGTTTCAGT;

[0113] qPCR-APC16-R:CACCGACTCACAGAGGAATCG;

[0114] The shRNA sequences in the present invention are all constructed between the BamHI and MluI restriction sites of the pU6-RFP (LT88024; Shandong Weizhen Biotechnology Co., Ltd.). The shRNA sequences targeting specific genes are as follows, human-APC2-shRNA1-F:

[0115] 5'-GATCGCGGCGTTCATCGGACATCATCTCGAGATGATGTCCGATGAACGCCGCTTTTT-3',

[0116] human-APC2-shRNA1-R:

[0117] 5'-CGCGAAAAAAGCGGCGTTCATCGGACATCATCTCGAGATGATGTCCGATGAACGCCGC-3';

[0118] human-APC2-shRNA2-F:

[0119] 5'-GATCCCTCTATATCTCTGCCATCAACTCGAGTTGATGGCAGAGATATAGAGGTTTTT-3',

[0120] human-APC2-shRNA2-R:

[0121] 5'-CGCGAAAAACCTCTATATCTCTGCCATCAACTCGAGTTGATGGCAGAGATATAGAGG-3';

[0122] mouse-APC2-shRNA1-F:

[0123] 5'-GATCCCACGTACAGAGATTCTTCTACTCGAGTAGAAGAATCTCTGTACGTGGTTTTT-3',

[0124] mouse-APC2-shRNA1-R:

[0125] 5'-CGCGAAAAACCACGTACAGAGATTCTTCTACTCGAGTAGAAGAATCTCTGTACGTGG-3';

[0126] mouse-APC2-shRNA2-F:

[0127] 5'-GATCACGACCTTCAAGGCAATATTGCTCGAGCAATATTGCCTTGAAGGTCGTTTTTT-3',

[0128] mouse-APC2-shRNA2-R:

[0129] 5'-CGCGAAAAAACGACCTTCAAGGCAATATTGCTCGAGCAATATTGCCTTGAAGGTCGT-3';

[0130] human-CDC20-shRNA1-F:

[0131] 5'-GATCAGACCAACCCATCACCTCAGTCTCGAGACTGAGGTGATGGGTTGGTCTTTTTT-3',

[0132] human-CDC20-shRNA1-R:

[0133] 5'-CGCGAAAAAAGACCAACCCATCACCTCAGTCTCGAGACTGAGGTGATGGGTTGGTCT-3';

[0134] human-CDC20-shRNA2-F:

[0135] 5'-GATCTGGTGGTAATGATAACTTGGTCTCGAGACCAAGTTATCATTACCACCATTTTT-3',

[0136] human-CDC20-shRNA2-R:

[0137] 5'-CGCGAAAAATGGTGGTAATGATAACTTGGTCTCGAGACCAAGTTATCATTACCACCA-3';

[0138] human-CDH1-shRNA1-F:

[0139] 5'-GATCGTGAACTTCCACAGGATTAACCTCGAGGTTAATCCTGTGGAAGTTCACTTTTT-3',

[0140] human-CDH1-shRNA1-R:

[0141] 5'-CGCGAAAAAAGTGAACTTCCACAGGATTAACCTCGAGGTTAATCCTGTGGAAGTTCAC-3';

[0142] human-CDH1-shRNA2-F:

[0143] 5'-GATCAGAAGGGTCTGTTCACGTATTCTCGAGAATACGTGAACAGACCCTTCTTTTTT-3',

[0144] human-CDH1-shRNA2-R:

[0145] 5'-CGCGAAAAAAGAAGGGTCGTTCACGTATTCTCGAGAATACGTGAACAGACCCTTCT-3'.

[0146] When constructing shRNA plasmid, first dilute the synthesized sequence with sterile ddH2O to a 100μM storage solution for later use. After annealing, the complementary positive and negative nucleotide chains form double strands and then connect them to the vector after enzyme digestion. The annealing reaction system is as follows:

[0147] The reagent names and reagent volumes (μl) are: ddH2O 8μl, F sequence 5μl, R sequence 5μl, 10× annealing buffer 2μl,

[0148] After adding the above reaction system, heat at 98°C for 10 minutes and then cool naturally to room temperature. The cooling process needs to be slow. You can cover the metal thermostat with gauze during cooling to prevent it from cooling too quickly.

[0149] Because there is no suitable double enzyme digestion system for BamHI and MluI, the pU6-RFP vector can only be digested twice by single enzyme digestion, and each single enzyme digestion requires tapping and recovery. The final tapping and recovery product can be used to connect with the above annealed product. The connection reaction system is as follows:

[0150] The reagent names and reagent amounts (μl) are ddH2O 4μl; rubber tapping recovery vector 1.5μl; annealing product 3μl; 10× ligation buffer 1μl; T4 ligase 0.5μl;

[0151] After adding the above system, gently mix and centrifuge, and then carry out the ligation reaction at 16°C. Generally, the ligation takes three hours.

[0152] The pcDNA3.1-DOK7-Flag plasmid was purchased from Changsha Youbao Biotechnology Co., Ltd.; the restriction sites used to insert the DOK7 sequence into the GFP-N1 vector were XhoI and KpnI, and the restriction sites used to insert the DOK7 sequence into the pKH3-HA vector were HindIII and XbaI. APC2-Flag, UBE3A-Flag, Nedd4-Flag, KLHL8-Flag and RNF31-Flag were purchased from Changsha Youbao Biotechnology Co., Ltd.; Trim63-Flag and PDZRN3-Flag were purchased from Miaoling Biotechnology Co., Ltd. The restriction sites used to construct the GFP-APC2 plasmid were XhoI and KpnI. The PCR reaction conditions for obtaining the target gene fragment are as follows:

[0153] The reagent names and reagent amounts (μl) are: ddH2O 29μl; mixed dNTP 2μl; F primer 2μl; R primer 2μl; 10×HF buffer 4μl; template plasmid 0.5μl; Phusion high-fidelity DNA polymerase 0.5μl;

[0154] After adding the above system, gently mix and centrifuge to carry out the PCR reaction. The PCR reaction conditions are as follows:

[0155] The temperature and time are: 98℃ 10min; 98℃ 30s; 55℃ 30s; 72℃ DOK7 setting 2min; APC2 setting 5min; 72℃ 10min;

[0156] Set the number of cycles to 35. After the PCR reaction is completed, the PCR product obtained needs to be subjected to agarose gel electrophoresis and then cut and recovered, and then double-digested. After double-digestion, the clean recovery can be used for ligation reaction. After double-digestion, the vector can be cut and recovered for use. The double-digestion system of XhoI and KpnI is as follows:

[0157] The reagent names and reagent amounts (μl) are: ddH2O 12μl; 10×M buffer 4μl; rubber tapping recovery product 20μl; XhoI 2μl; KpnI 2μl;

[0158] The double enzyme digestion system of HindIII and XbaI is as follows:

[0159] The reagent names and reagent amounts (μl) are ddH2O 12μl; 10×M buffer 4μl; rubber tapping recovery product 20μl; HindIII 2μl; XbaI 2μl;

[0160] When the vector is double-digested, just replace the rubber tapping recovery product in the reaction system with the vector. The dosage should not exceed 2μg, and the reaction volume should be filled up to 40μl with ddH2O. After adding according to the above system, gently mix and centrifuge, seal the EP tube cap with sealing film and place it in a 37℃ water bath for two hours. During the incubation period, centrifuge once or twice to centrifuge the solution evaporated on the tube cap and the tube wall to the bottom of the tube. The ligation reaction is the same as the construction of shRNA plasmid.

[0161] When constructing DOK7 and MuSK point mutation plasmids, the PCR reaction system is as follows:

[0162] The reagent names and reagent amounts (μl) are: ddH2O 7.5μl; F primer 1μl; R primer 1μl; 2× PrimeStar max mix 10μl; template plasmid 0.5μl;

[0163] After adding the above system, gently mix and centrifuge, cover the PCR tube tightly and start the PCR reaction. The PCR reaction conditions are set as follows:

[0164] The temperature and time are: 98℃ 10min; 98℃ 20s; 55℃ 20s; 72℃ 5min; 72℃ 10min;

[0165] Set the number of reaction cycles to 35. After the PCR reaction is completed, digest the PCR product with DpnI to transform into DH5α competent cells. The PCR product digestion reaction system is as follows:

[0166] The reagent names and reagent amounts are ddH2O 6μl; 10×Cutsmart buffer 2μl; PCR product 10μl; DpnI 2μl;

[0167] After adding the above system, gently mix and centrifuge, seal the EP tube cap with sealing film and incubate in a 37℃ water bath for two hours. During the incubation period, centrifuge once or twice to centrifuge the solution evaporated from the tube cap and tube wall to the bottom of the tube.

[0168] When constructing four multi-site mutation plasmids, DOK7-8KR, DOK7-3RA, DOK7-2YA and DOK7-3YA, mutations were performed in sequence according to the order of the mutation sites in the amino acid sequence. For example, when constructing DOK7-8KR, Lys at position 12 was first mutated to obtain the DOK7-K12R mutant. Lys17 / 18 was mutated on the basis of this mutation to obtain the triple mutant of DOK7-K12 / 17 / 18R. Lys20 was mutated on the basis of this mutant plasmid to obtain the quadruple mutant plasmid of DOK7-K12 / 17 / 18 / 20R, and so on, until the DOK7-8KR mutant was obtained. The plasmid obtained by each point mutation must be sequenced to confirm the correct sequence before it can be used in the next experiment.

[0169] 1.4 Reagent preparation and instructions

[0170] The reagent names, preparation methods and instructions for use are:

[0171] 0.3% gelatin: 0.3g gelatin, dissolved in ddH2O and diluted to 100ml. Stir until gelatin is fully dissolved and then sterilize under high temperature and high pressure. It can be stored at room temperature for two months. 1M Tris-HCl (pH 6.8): 12.11g Tris-base, dissolved in ddH2O, adjusted to pH 6.8 with concentrated hydrochloric acid and diluted to 100ml with ddH2O. It can be stored at room temperature for one month. 1.5M Tris-HCl (pH8.8): 18.17g Tris-base, dissolved in ddH2O, adjusted to pH 8.8 with concentrated hydrochloric acid and diluted to 100ml with ddH2O. It can be stored at room temperature for one month. Protein electrophoresis buffer: 1g SDS, 3.03g Tris-base, 14.4g glycine, dissolved in ddH2O and diluted to 1L. Prepare and use immediately.

[0172] Protein transfer buffer: 3.03g Tris-base, 14.4g glycine, 200ml anhydrous methanol, dilute to 1L with ddH2O. Prepare and use immediately; precool at 4℃ before use. 10×TBS buffer: 30g Tris-base, 80g sodium chloride, 2g potassium chloride, dissolve in ddH2O, adjust pH to 7.4 with concentrated hydrochloric acid and dilute to 1L with ddH2O. Store at room temperature. 1×TBS buffer: Measure 100ml of 10×TBS, dilute to 1L with ddH2O. Store at room temperature. 1×TBST buffer: Add 1ml Tween 20 to 1L 1×TBS and mix well. Store at room temperature. Western blot blocking solution: 5g skim milk powder, dissolve in 1×TBS and dilute to 100ml. Prepare and use immediately; if used to dilute the primary antibody and recycle, add a final concentration of 0.1% NaN3. Immunofluorescence staining blocking solution: 1g BSA, 10ml 1.5M sodium chloride solution, 0.5ml sheep serum, 0.1ml Triton X-100, 1×PBS to 100ml. Store at 4℃; if used to dilute the primary antibody and recycle, add a final concentration of 0.1% NaN3. 4% PFA:

[0173] 4g PFA, dissolved in 1×PBS, adjusted pH to 7.4 with concentrated hydrochloric acid, and then diluted to 100ml with 1×PBS. Stir until PFA powder is fully dissolved and filter; store at 4℃. 30% sucrose solution: 30g sucrose is dissolved in 1×PBS solution and diluted to 100ml. Store at 4℃. 10× annealing buffer: 1.17g sodium chloride, 1ml pH8.0 Tris-HCl (1M), diluted to 10ml with ddH2O. Store at room temperature. NETN buffer:

[0174] 50mM Tris (pH 8.0); 150mM sodium chloride, 1% NP-40, 1mM EDTA. Store at 4°C; add 1mM PMSF and protease inhibitor cocktail tablets when using.

[0175] 1.5 Antibodies

[0176] The antibody names and product numbers are:

[0177] Mouse anti-GAPDH 60004-1-Ig; Rabbit anti-p-MuSK(p-Tyr755)D151396;

[0178] Mouse anti-p-Tyrosine4G10; Rabbit anti-DOK7 D152405; Mouse anti-myc Sc-40;

[0179] Mouse anti-Flag66008-3-Ig; Rabbit anti-Flag 20543-1-AP; Mouse anti-ubiquitin Sc-8017;

[0180] Mouse anti-GFP Sc-9996; Mouse anti-SV2 SV2; Mouse anti-NF 2837S; Rabbitanti-APC2 13559-1-AP;

[0181] Rabbit anti-HA 51046-2-AP; Rabbit anti-LC3 14600-1-AP; Mouse anti-LRP4N207 / 27;

[0182] Rabbit anti-MuSK D221816; HRP labeled goat anti-Mouse IgG 31430;

[0183] HRP labeled goat anti-Rabbit IgG 31460; Goat anti-Mouse IgG(H+L)secondary antibody, Alexa Fluor 488 A11029; Goat anti-Mouse IgG(H+L)secondaryantibody, Alexa Fluor 633 A21052; Goat anti-Rabbit IgG(H+L)secondary antibody, Alexa Fluor 488 A11008;

[0184] 1.6 Animals

[0185] The mice used in this study were all C57 / B6 wild-type mice purchased from Shanghai Slake Laboratory Animal Co., Ltd. The animal husbandry and use were in compliance with the relevant regulations of the Experimental Animal Ethics Committee of Zhejiang University.

[0186] 1.7 Immunoprecipitation and co-immunoprecipitation (IP and co-IP)

[0187] 1) For this experiment, you need to prepare sterile cell scrapers and sterile EP tubes in advance and precool the centrifuge to 4°C. After taking the cells out of the incubator, use a vacuum pump to remove the culture medium, gently wash the residual culture medium on the cell surface with 5ml precooled 1X PBS, and then add 1ml precooled 1× PBS. Use a sterile cell scraper to scrape the cells from the culture dish, and pipette 1ml of the cell suspension containing the cells into a sterile EP tube and place it on ice.

[0188] 2) After all the cell suspensions were collected, centrifuged at 12,000 rpm for 1 min at 4°C, discarded the supernatant and kept the precipitate (i.e., cells). Add 600 μl of NETN solution (containing 1 mM PMSF and protease inhibitors; protein phosphatase inhibitors are also required when detecting DOK7 tyrosine phosphorylation) to the collected cells, gently pipette to resuspend the cells, and place them on ice for 15 min to lyse.

[0189] 3) Centrifuge at 14,000 rpm and 4°C for 20 min; pipette 50 μl of supernatant into a sterile EP tube for input and store at -20°C; pipette 500 μl of the remaining supernatant into a sterile EP tube for subsequent IP or co-IP, add 1 μg of antibody and 30 μl of Protein A / G Plus-agarose to this part of the supernatant, cover the tube tightly, seal it with sealing film, and incubate it with rotation at 4°C overnight.

[0190] 4) The next day, centrifuge at 1,200 rpm for 3 min at 4°C, gently remove the supernatant, and retain the precipitate (i.e., Protein A / G Plus-agarose); add 1 ml of NETN solution (containing 1 mM PMSF and protease inhibitors; protein phosphatase inhibitors are also required when detecting DOK7 tyrosine phosphorylation) to the tube, rotate at 4°C to wash non-specifically bound proteins, 10 min each time for a total of three times; after washing, centrifuge at 1,200 rpm for 3 min at 4°C, remove the supernatant, retain the Protein A / G Plus-agarose precipitate, and store at -20°C.

[0191] 5) Add 50 μl 2×SDS loading to the input sample and Protein A / G Plus-agarose collected after co-IP, respectively. Place the sample in a metal bath at 98°C for 15 min and then cool it down to room temperature. The input sample can be used for Western blot detection. The Protein A / G Plus-agarose sample collected after IP or co-IP needs to be centrifuged at 5,000 rpm for 3 min at room temperature. Pipette the supernatant into a sterile EP tube. This part of the supernatant can be used for Western blot.

[0192] 1.8 Protein immunoblotting (Western blot, WB)

[0193] 1) Sample preparation: This experiment requires the preparation of sterile cell scrapers and sterile EP tubes in advance and the precooling of the centrifuge to 4°C. When preparing cell samples, taking a 12-well plate as an example, add 300μl RIPA (containing 1mM PMSF and protease inhibitors) to the cells collected in each well, resuspend the cells by blowing, place them on ice for 15min, and then centrifuge them at a maximum speed of 4°C for 20min. Take 200μl of supernatant, which can be temporarily stored on ice until the concentration is determined and then transferred to -80°C for storage; when preparing tissue samples, grind and lyse the tissue samples according to the ratio of 0.1g tissue sample plus 1ml RIPA (containing 1mM PMSF and protease inhibitors) (the grinder is always placed in ice). After sufficient grinding, the tissue homogenate is taken into a sterile EP tube, centrifuged at a maximum speed of 4°C for 20min, and 400μl of supernatant is taken. It can be temporarily stored on ice until the concentration is determined and then transferred to -80°C for storage; the protein concentration is determined by the BCA method. For specific methods, refer to the instructions provided by the kit.

[0194] 2) Gel preparation: 15% separation gel is used for LC3 detection, 10% separation gel is used for other proteins detection; 4% concentration gel is used. The gel formula is as follows:

[0195] 4% stacking gel 10% separation gel 15% separation gel <![CDATA[ddH2O]]> 3.6ml 5.9ml 3.4ml 30% acrylamide solution 800μl 5ml 7.5ml 1.5M Tris-HCl (pH 8.8) none 3.8ml 3.8ml 1M Tris-HCl (pH 6.8) 1.5ml none none 10% SDS 60μl 150μl 150μl 10% APS 60μl 150μl 150μl TEMED 6μl 15μl 15μl

[0196] 3) Electrophoresis: Take an appropriate amount of total protein from the cell or tissue sample obtained in step 1) and add an equal volume of 2×SDS loading, place in a metal bath at 98°C for 15 min, then naturally cool to room temperature. After a short centrifugation at room temperature, the sample can be used for electrophoresis; adjust the loading volume of each sample according to the protein concentration determined by the BCA method; set the electrophoresis parameters to 60V constant voltage electrophoresis for the concentrated gel portion, and change to 100V constant voltage electrophoresis after the sample enters the separation gel.

[0197] 4) Transfer: Use wet transfer method for transfer; cut PVDF membrane of 8cm×9.5cm size, soak the PVDF membrane with appropriate amount of methanol for 30s, then transfer the PVDF membrane to protein transfer buffer and soak for 10min; remove the polyacrylamide gel from the glass module, and soak it in protein transfer buffer for 10min; soak the transfer sponge pad and transfer filter paper with protein transfer buffer until wet; place the black side of the transfer plastic clip at the bottom, and place the transfer sponge pad, a layer of transfer filter paper, polyacrylamide gel, PVDF membrane, a layer of transfer filter paper, and transfer sponge pad on it in sequence; clamp the transfer plastic clip and place it correctly in the transfer tank, with the black side of the plastic clip facing the black side of the transfer tank; the transfer tank needs to be ice-bathed during transfer; the transfer parameters are set to 100V constant voltage for 2h.

[0198] 5) Blocking and antibody incubation: After the transfer is completed, the membrane is stained with Ponceau red to check the transfer effect. If the bands are neat and there are no bubbles, it means that the transfer is successful. The PVDF membrane can be photographed and kept for later use; transfer the membrane to a suitable container, add an appropriate amount of Western blot blocking solution and block at room temperature for 1 hour, discard the blocking solution and wash the membrane with 1×TBS for 5 minutes, discard the 1×TBS, add the antibody diluted with the blocking solution (containing a final concentration of 0.1% NaN3) and incubate overnight at 4°C in a shaker. The antibody dilutions used were as follows: Mouse anti-GAPDH 1:10,000; Mouse anti-myc 1:1,000; Mouse anti-ubiquitin 1:1,000; Mouse anti-GFP 1:1,000; Rabbit anti-HA 1:5,000; Rabbit anti-Flag 1:5,000; Mouse anti-LRP4 1:500; Rabbit anti-MuSK 1:500; Rabbit anti-DOK7 1:500; Rabbitanti-APC2 1:1,000; Rabbit anti-LC3 1:1,000; Rabbit anti-p-MuSK 1:500; Mouseanti-p-Tyrosine 1:1,000; HRP labeled goat anti-Rabbit IgG 1:5,000; HRP labeledgoat anti-Mouse IgG 1:5,000;

[0199] 6) The next day, recover the solution containing the antibody and store it at 4°C; wash the membrane with 1×TBST for three times at room temperature, each time for 10 min; add HRP-labeled secondary antibody diluted in the blocking solution corresponding to the species of the primary antibody, and incubate at room temperature for 1 hour; discard the blocking solution containing the secondary antibody, wash the membrane with 1×TBST for three times at room temperature, each time for 10 min; wash the membrane with 1×TBS for one time at room temperature for 5 min.

[0200] 7) Development: ECL chemiluminescence method is used for development; the membrane is spread flat on a clean transparent plastic film, 2 ml of ECL developer mixture is gently added on the membrane, and then a layer of clean transparent plastic film is covered on the membrane before entering the darkroom for development; the pressing time is adjusted according to the strength of the target protein signal to be detected; after pressing, the X-Ray film is first soaked in the developer for 1 minute, rinsed with ddH2O for 30 seconds, and then soaked in the fixer for 1 minute before being transferred back to ddH2O.

[0201] 8) Dry the X-Ray film and record the results with a scanner. You can also use a Bio-Rad chemiluminescence analyzer to collect signals from PVDF.

[0202] 1.9 Electrotransduction of mouse tibialis anterior muscle

[0203] 1) The mice transfected with DOK7 plasmid were all two weeks old; the mice transfected with shRNA plasmid were all one week old; the plasmids used for electroporation were all medium-drawn, with a concentration of 1 μg / μl; the electroporation site was the tibialis anterior muscle (TA muscle), and the total amount of transfected plasmid was 5 μg.

[0204] 2) After the mouse is anesthetized, the tibialis anterior muscle is surgically exposed, and 5 μl of plasmid is drawn with a microsyringe and injected into the tibialis anterior muscle. The needle should be pushed slowly, usually within 30 seconds; the needle stays for 20 seconds before being pulled out to prevent the plasmid solution from leaking out of the muscle tissue. When injecting different plasmids, the syringe should be cleaned with ddH2O to prevent contamination.

[0205] 3) The electroporation parameters were set to 70 V, 5 pulses, 50 ms per pulse, and 1 s interval.

[0206] 4) After electroporation, the mice were returned to the cage for further feeding; samples were taken for testing one week later.

[0207] 1.10 Passaging and differentiation of mouse myoblasts and Agrin-induced AChR aggregation

[0208] 1) Mouse myoblast C2C12 cells should not be subcultured too many times (generally no more than ten generations). They need to be frozen in time. The cell density for freezing should not be too dense. It is best to ensure that there is no contact between cells. The subculture medium is high-glucose DMEM (containing 20% ​​FBS and 1% P / S); the differentiation medium is high-glucose DMEM (containing 2% HS and 1% P / S); before inducing cell differentiation, the culture equipment needs to be coated with 0.3% gelatin. For example, for a 12-well plate, add 1 ml of 0.3% gelatin to each well and place it in a cell culture incubator for 16 hours. Before planting cells, use a vacuum pump to suck out the 0.3% gelatin, wash with 1×PBS and suck out the PBS before using it for experiments.

[0209] 2) When inducing cell differentiation, the cells can be trypsinized when they reach about 40% confluence in the growth medium and then seeded into a 12-well plate coated with 0.3% gelatin. The number of cells seeded should ensure that the confluence of each well is about 80% after the cells adhere to the wall. After 24 hours, the cell confluence can reach 90%. At this time, the growth medium can be discarded and the differentiation medium can be re-added to induce cell differentiation.

[0210] 3) The differentiation medium was changed every 24 hours. Generally, differentiated myotubes could be seen in 3-4 days, and the peak was reached in 6 days. Agrin could be used to treat myotubes to induce AChR aggregation.

[0211] 4) When stimulating myotubes with Agrin, add 1.5 ml of fresh differentiation medium and 0.5 ml of Agrin solution to each well, mix gently and place in a cell culture incubator. Collect cell samples at different time points according to the purpose of the experiment. If staining is required to observe AChR aggregation, Agrin needs to stimulate myotubes for at least 16 hours.

[0212] 5) If plasmid transfection is performed on C2C12 cells, the transfection time point should be selected within 5 hours after plating, when the cells are attached to the wall. If the cell morphology is fully extended and pseudopodia are obvious, the transfection efficiency is extremely low.

[0213] 6) Liposome transfection reagent has a certain inhibitory effect on the differentiation of C2C12. The standard amount of liposome transfection C2C12 is no more than 3μl per well of a 12-well plate and no more than 8μl per 6cm culture dish. In addition, the medium should be changed in time after transfection, and the medium change time is controlled within about 6h.

[0214] 1.11 Expression and collection of Agrin

[0215] 1) Agrin required for the experiment was obtained by overexpressing Agrin in HEK 293T cells. When the confluence of HEK 293T cells reached 70%, transfection was performed. Taking a 10 cm culture dish as an example, 8 μg of Flag-Agrin plasmid was transfected.

[0216] 2) 24 hours after transfection, the culture medium was replaced with a secretion medium that induces Agrin secretion to the extracellular space, i.e., high-glucose DMEM (containing 0.5% FBS and 1% P / S). Since the cell confluence is high at this time, the secretion medium status needs to be monitored in time to ensure that fresh secretion medium is replaced in time to avoid the secretion medium turning yellow.

[0217] 3) Before replacing the secretion medium with fresh one each time, collect the secretion medium in the culture dish into a sterile tube, centrifuge at 3,000 rpm for 10 min at room temperature to remove cell debris, pipette the supernatant into a new sterile tube, and store it at -20°C. It can be stored for three months.

[0218] 4) Before the collected Agrin is used to stimulate myotubes, a small amount is taken for Western blot detection to confirm that it contains Agrin before use in subsequent experiments.

[0219] 1.12 Cell transfection and treatment

[0220] 1) Cell transfection was performed by liposome transfection. When transfecting overexpression plasmids, the ratio of plasmid to liposome was 1:2 (i.e., 2 μl liposomes were required for 1 μg of plasmid); when transfecting shRNA plasmids, the ratio of plasmid to liposome was 1:3 (i.e., 3 μl liposomes were required for 1 μg of plasmid). Before transfection, preheat the opti-MEM culture medium to 37°C; wipe the surface of the EP tube containing the plasmid, the centrifuge tube containing the preheated opti-MEM culture medium, and the liposome nucleic acid transfection reagent with alcohol cotton and place them on a sterile operating table; take two 1.5ml sterile EP tubes, add 100μl of preheated opti-MEM culture medium to each tube, add the calculated expected transfection plasmid amount to one tube, and add the corresponding amount of liposome nucleic acid transfection reagent to the other tube, mix gently, cover the tube cap, and let it stand at room temperature for 5 minutes, then add the opti-MEM culture medium solution mixed with the plasmid to the opti-MEM culture medium mixed with the liposome nucleic acid transfection reagent, mix gently, cover the tube cap, and incubate at room temperature for 15 minutes. During the incubation period, change the medium of the cells to be transfected. After removing the old medium, add an appropriate amount of preheated Opti-MEM medium and put it back into the incubator. In this experiment, add 2 ml to each well of the 12-well plate, 3 ml to each well of the 6-well plate, and 6 ml to each well of the 6-cm culture dish. After the incubation, gently drop the plasmid and liposome nucleic acid transfection reagent mixture in the EP tube into the cells that have just been replaced with the Opti-MEM medium. Gently tilt the culture dish to let the medium rotate back and forth several times to mix it well, and then put it back into the incubator.

[0221] 2) HEK 293T cells transfected with shRNA plasmids were treated with puromycin at a final concentration of 5 μM 36 hours after transfection, and puromycin was added again when the medium was changed every 12 hours; after continuous treatment for 36 hours, cell samples were collected for relevant detection.

[0222] 3) When treating cells with CHX, if multiple time-point treatments were performed, they were all performed 16 hours after transfection; if single time-point treatments were performed, they were performed 24 hours after transfection. The final concentration of CHX used to treat cells was 10 μM.

[0223] 4) PYR-41 treatment of cells was performed 8 hours after transfection. The final concentration of PYR-41 treatment of cells was 60 μM.

[0224] 5) MG132 and CQ treatment of cells were performed 24 hours after transfection. The final concentration of MG132 and CQ treatment of cells was 10 μM.

[0225] 6) When transfected cells were used for IP or co-IP experiments, except for cells transfected with shRNA, samples were collected 24 hours after transfection.

[0226] 1.13 Cell immunofluorescence staining

[0227] 1) The cell immunofluorescence staining involved is the staining of differentiated and fused myotubes of C2C12 cells; taking the staining of myotubes cultured in a 12-well plate as an example, first discard the culture medium, then add 1 ml of pre-cooled 1×PBS to each culture well to gently wash away the residual culture medium in the culture well, and then treat it on a horizontal shaker at room temperature at low speed for 5 minutes; discard the 1×PBS, then add 1 ml of pre-cooled 4% paraformaldehyde to each culture well to fix the cells, and then treat it on a horizontal shaker at room temperature at low speed for 15 minutes; discard the paraformaldehyde, wash with 1×PBS at room temperature for 5 minutes, then discard the 1×PBS, add 1 ml of 0.3% Triton X-100 to permeabilize the cells, and treat it on a horizontal shaker at room temperature at low speed for 10 minutes.

[0228] 2) Discard 0.3% Triton X-100, add 1 ml of immunofluorescence staining blocking solution to each culture well for blocking, and shake at low speed at room temperature for 1 hour; discard the blocking solution, add an appropriate amount of primary antibody diluted with immunofluorescence staining blocking solution to each culture well, cover the lid and incubate at low speed at 4°C on a horizontal shaker overnight. The dilution multiple of the mouse Flag antibody used for cell immunofluorescence staining is 1:1,000, and BTX is 1:5,000.

[0229] 3) Recover the blocking solution containing antibodies and store at 4°C; add 1 ml of 1×PBST to each culture well to wash away the residual antibodies that are not bound to the antigen, wash at low speed for 10 min on a horizontal shaker at room temperature, and repeat the wash three times.

[0230] 4) Add the corresponding fluorescent secondary antibody and fluorescently labeled BTX, incubate at low speed on a horizontal shaker at room temperature in the dark for 2 h; recover the fluorescent secondary antibody and fluorescently labeled BTX, and store at 4°C in the dark.

[0231] 5) Add 1 ml of 1×PBS to each culture well, and then add 1 μl of DAPI stock solution, and incubate at room temperature in a low-speed horizontal shaker in the dark for 10 minutes.

[0232] 6) Discard the DAPI staining solution; add 1 ml of 1×PBST to each culture well, wash at low speed for 10 min on a horizontal shaker at room temperature, and repeat the wash three times.

[0233] 7) Add 1 ml of 1× PBS to each well and collect images under a Zeiss inverted fluorescence microscope; the samples can be stored at 4°C in the dark. The lid of the culture dish needs to be removed when collecting images.

[0234] 1.14 Immunofluorescence staining of tissue sections

[0235] 1) The designed tissue sections are all tibialis anterior muscle sections; two-month-old mice were anesthetized and cardiac perfused; after the perfusion was completed, the tibialis anterior muscle was fixed in 4% PFA for 24 hours; the tibialis anterior muscle was taken out and placed in 30% sucrose solution for dehydration, and the tissue was ready when it changed from a suspended state to a bottom-sinking state, which usually took 24 hours.

[0236] 2) Place the muscle tissue horizontally in the embedding box and add OCT tissue embedding agent. At this time, the position of the muscle tissue can be adjusted to be parallel to the edge of the embedding box. Freeze at -80℃.

[0237] 3) After the OCT tissue embedding medium solidifies, its color changes from transparent before being placed in the refrigerator to white, which can be seen by the naked eye. Then it can be sliced. The thickness of the tissue slices is 25μm.

[0238] 4) Label the sample and air dry the tissue sections on the slide at room temperature, usually for 20 minutes. After drying, they can be stored at -80°C.

[0239] 5) When staining muscle sections, first place the slide with the tissue sections in a suitable container, gently add 1×PBS solution to the container to cover the slide and wash at room temperature for 10 minutes. This step is to wash away the OCT gel carried by the tissue sections, which can help avoid nonspecific staining results caused by nonspecific adsorption of OCT gel to antibodies. After washing, discard 1×PBS, add an appropriate amount of pre-cooled 4% paraformaldehyde solution, and fix at room temperature for 20 minutes; after fixation, discard the paraformaldehyde solution, add an appropriate amount of 0.5% Triton X-100 solution to permeabilize the tissue sections, and treat at room temperature for 20 minutes; after permeabilization, discard the 0.5% Triton X-100 solution, add an appropriate amount of immunofluorescence staining blocking solution, and block at room temperature for 1 hour; after blocking, discard the immunofluorescence staining blocking solution, and use absorbent paper to absorb the liquid on the edge of the slide, drop about 200μl of the primary antibody solution diluted with immunofluorescence staining blocking solution in the center of the slide, and then cut a sealing film with a length and width smaller than the slide, and gently stick the sealing film on the above 200μl primary antibody solution. Incubate at 4℃ overnight, and ensure that the slide is placed horizontally to prevent leakage from causing uneven antibody incubation and nonspecific staining caused by drying of the slices. The dilution multiple of APC2 antibody used for immunofluorescence staining of tissue sections is 1:500.

[0240] 6) Sealing: Gently drop an appropriate amount of sealing agent on the surface of the slide attached to the tissue section, place a cover glass on the sealing agent, and gently press the cover glass with round-tipped tweezers to allow the sealing agent to fill the joint surface of the slide and the cover glass. Add an appropriate amount of transparent nail polish around the cover glass to seal and fix it. Leave it at room temperature for 6 hours until the nail polish solidifies. After staining, the sample can be stored at 4°C away from light.

[0241] 7) Images were collected using a Nikon A1R inverted laser confocal microscope using the Z-stack program.

[0242] 1.15 Whole-mount immunofluorescence staining of muscle tissue

[0243] 1) After the mice were anesthetized and killed, the tibialis anterior muscle was removed by dissection and placed in pre-cooled 4% paraformaldehyde.

[0244] 2) The intact tibialis anterior muscle was fixed in 4% paraformaldehyde on a 4°C horizontal shaker for 24 h.

[0245] 3) Use ophthalmic forceps to separate the tibialis anterior muscle into muscle fiber bundles with a diameter not exceeding 1 mm and continue to fix them on a horizontal shaker at 4°C for 24 hours.

[0246] 4) Discard PFA, transfer the myofibers to a sterile 15 ml centrifuge tube, and add 10 ml 1× PBS to wash away the residual PFA.

[0247] 5) Discard PBS, add 5 ml of 0.5% Triton X-100 to a 15 ml centrifuge tube to permeabilize the muscle fibers, and place on a horizontal shaker at room temperature for 3 hours.

[0248] 6) Discard Triton X-100, transfer the muscle fibers to a sterile EP tube, add 1 ml of immunofluorescence staining blocking solution, and place on a rotating shaker at room temperature for 1 hour. The dilution multiple of APC2, NF and SV2 antibodies used for whole-mount immunofluorescence staining of muscle tissue is 1:500.

[0249] 7) Before sealing, the muscle fibers need to be further separated and separated into single fibers as much as possible; during the operation, 1× PBS needs to be used to keep the muscle fibers moist and protected from light.

[0250] 8) Spread the further separated muscle fibers evenly on the slide, evenly add a proper amount of sealing agent on the slide, add a cover glass on the sealing agent, press the cover glass gently with round-tipped tweezers to make the sealing agent evenly fill the space between the slide and the cover glass, and add a proper amount of transparent nail polish around the cover glass to fix it.

[0251] 9) After adding nail polish, place at room temperature for 16 hours until the nail polish solidifies before image acquisition. When acquiring images of electroporated shRNA myotubes, first use the 594nm red fluorescence channel under the microscope to find electroporated positive myotubes, and then collect the fluorescence signal of the field of view; when acquiring images of electroporated DOK7 plasmid myotubes, first use the 488nm green fluorescence channel under the microscope to find electroporated positive myotubes, and then collect the fluorescence signal of the field of view; when acquiring images of denervation myotubes, first use the 594nm red fluorescence channel under the microscope to find the BTX-positive area, and then collect the fluorescence signal of the area, and use the 633nm purple fluorescence channel NF / SV2 fluorescence signal to determine whether the myotube is successfully denervated. The control group BTX-positive area NF / SV2 also has a fluorescence signal; while the denervation group BTX-positive area has no NF / SV2 fluorescence signal.

[0252] 1.16 Separation of synaptic and non-synaptic regions and denervation surgery

[0253] 1) The tissue used in the experiment of separating synaptic and non-synaptic regions was the diaphragm of one-month-old mice; the area of ​​the diaphragm where the white nerve bundles were visible under a dissecting microscope was the synaptic region; the other nearby areas were the non-synaptic regions.

[0254] 2) All denervation surgeries involved were performed by sciatic nerve transection. The specific operation steps were as follows: After anesthetizing two-month-old mice, the backs were facing upwards, the limbs of the mice were fixed with medical tape, the hind limbs of the mice were disinfected with medical alcohol, the skin was cut near the rectus femoris, and the lower edge of the rectus femoris was gently cut with a scalpel to see the white sciatic nerve. The sciatic nerve was picked out with elbow forceps, and the denervation treatment was completed by cutting off the section of sciatic nerve picked out by the elbow forceps with scissors. The other leg was subjected to control surgery to expose the sciatic nerve. The surgical wound was sutured and returned to the original breeding cage; the samples could be taken for subsequent experiments after one week.

[0255] 1.17 RNA extraction and quantitative PCR

[0256] 1) Take the extraction of cell RNA and muscle tissue RNA as an example; when extracting RNA from cells cultured in a 6-well plate, add 1 ml of Trizol to each well, use a sterile cell scraper to scrape the cells off the culture dish, pipette the cell suspension into a sterile EP tube and place it in ice; when extracting RNA from muscle tissue, the tissue grinder needs to be sterilized and dried in advance. Because the grinding process will generate heat, the bottom of the grinder needs to be inserted into ice for grinding. First, place 0.1 g of muscle tissue on the upper edge of the grinder and then add 1 ml of pre-cooled Trizol to the grinder. Use the top of the grinding rod to stick to the glass wall of the grinder to push the tissue to the bottom of the grinder while rotating and grinding. When grinding tissue, do not place the tissue directly on the bottom of the grinder, as this can easily cause the muscle tissue to harden after contact with Trizol, ultimately resulting in insufficient grinding and failure to obtain RNA that meets experimental needs.

[0257] 2) After all cells are scraped, vortex the EP tube containing the cell suspension for 30 seconds to fully disperse the cells and help them lyse.

[0258] 3) Place in ice for lysis for 10 min, add 200 μl of chloroform, shake manually to mix, and place in ice. When obvious stratification is seen in the solution in the EP tube, centrifuge at 12,000 rpm and 4°C for 10 min.

[0259] 4) Aspirate 500 μl of the upper solution; do not aspirate the middle and lower solutions.

[0260] 5) Add an equal volume of chloroform to the above 500 μl solution, shake and mix manually, let stand at room temperature for two minutes until the solution is separated into layers, and centrifuge at 12,000 rpm and 4°C for 10 min.

[0261] 6) Aspirate 300 μl of the upper solution; do not aspirate the middle and lower solutions.

[0262] 7) Add an equal volume of isopropanol to the above 300 μl solution, shake manually to mix, and let stand at -20°C for 30 min.

[0263] 8) Centrifuge at 12,000 rpm and 4°C for 30 min. Gently remove the supernatant from the tube and keep the white RNA precipitate at the bottom.

[0264] 9) Add 750 μl of pre-cooled 75% ethanol, gently invert and mix manually, and centrifuge at 7,000 rpm and 4°C for 10 min.

[0265] 10) Gently remove the supernatant from the tube, centrifuge at 7,000 rpm at 4°C for 1 min, and remove the remaining solution from the tube.

[0266] 11) Open the tube cap and place the EP tube in a sterile operating table to dry for 10 minutes. The edge of the white RNA precipitate will become transparent.

[0267] 12) Add 40 μl ddH2O to dissolve RNA; after measuring RNA concentration by Nanodrop2000, RNA can be adjusted to a uniform concentration for subsequent use. RNA is stored at -80℃.

[0268] 13) The total amount of RNA used in each reverse transcription system is 2 μg; the specific reverse transcription reaction system is as follows: the reagent names and reagent amounts are: ddH2O, made up to 20 μl; 5×reaction mix, 4 μl; RNA, 2 μg; Maxima enzyme mix, 2 μl.

[0269] After adding the above system, gently mix and cover the tube tightly before placing it in the PCR instrument to start the reverse transcription reaction.

[0270] The reverse transcription reaction parameters were set as follows:

[0271] The temperature and time are: 25℃, 10min; 50℃, 30min; 85℃, 5min.

[0272] The product obtained after the reverse transcription reaction is cDNA, which can be diluted and used in subsequent fluorescent quantitative PCR.

[0273] 14) The fluorescence quantitative PCR reaction system is 10 μl; the amount of cDNA used is 1% of the cDNA obtained after reverse transcription, that is, the cDNA obtained from the above reverse transcription experiment is diluted to 100 μl, and 1 μl of the diluted cDNA is added to each fluorescence quantitative PCR reaction system. The amplification program selected is a two-step method. The specific PCR reaction system is as follows:

[0274] The reagent names and reagent amounts are: ddH2O 3μl; 2×SYBR green 5μl; F primer 0.5μl; R primer 0.5μl; diluted cDNA

[0275] 1μl;

[0276] According to actual operation requirements, some reagents in the reaction system can be premixed first, and then added to the reaction wells of the fluorescent quantitative PCR special plate; after adding samples to each reaction well, hold the edge of the fluorescent quantitative PCR special sealing film with both hands, tear off the protective paper of the sealing film neatly from one edge, and then align the torn edge of the sealing film with the side of the fluorescent quantitative PCR special plate and stick it to the fluorescent quantitative PCR special plate. Be sure not to touch the central area of ​​the special sealing film with your hands. After one side is aligned, slowly tear off the entire protective paper, so that the sealing film is completely attached to the fluorescent quantitative PCR special plate, and then use a special plastic plate to press the sealing film tightly around the fluorescent quantitative PCR special plate to make it tightly attached to the fluorescent quantitative PCR reaction special plate, and then perform a short centrifugation on the fluorescent quantitative PCR reaction special plate with the sample added before the fluorescent quantitative PCR reaction. The specific fluorescent quantitative PCR reaction conditions are set as follows:

[0277] The temperature and time are: 95℃2min; 95℃15s; 60℃30s;

[0278] Set the number of cycles to 40. After the fluorescence quantitative PCR is completed, the product is subjected to agarose gel electrophoresis to detect the specificity of the primers to determine whether the results are usable. The fluorescence quantitative PCR results of primers with a single band are credible and can be used for subsequent data analysis.

[0279] The abbreviations, English names and Chinese names in the present invention are: AchR, Acetylcholine receptor; ALS, Amyotrophic lateral sclerosis; Amp, Ampicillin; AMPA, α-amino-3-hydroxy-5-methyl-4-isoxazole-propionic acid; APC / C, Anaphase promoting complex / cyclosome; APS, Ammonium persulphate; BPB, Bromophenol blue; BSA, Bovineserum albumin; BTX, Bungarotoxin; CHX, Cycloheximide; CMS, Congenital myasthenic syndrome; co-IP, co-immunoprecipitation; CQ, Chloroquine; DMSO, Dimethyl sulfoxide; DOK7, Downstream of kinase 7; FBS, Fetal bovine serum; GluR, Glutamate receptor; HRP, Horseradish peroxidase; HS, Horse serum; IP, Immunoprecipitation; Kan, Kanamycin; LRP4, Low-density lipoprotein receptor-related protein 4; MN, Motor neuron; MuSK, Muscle specific kinase; NF, Neurofilament; NMJ, Neuromuscular junction; NSC, Neural stem cell; NSR, Non-synaptic region; P / S, Penicillin / streptomycin; PCR, Polymerase Chain Reaction;PFA, Paraformaldehyde; PMSF, Phenylmethylsulfonyl fluoride; PTB, Phosphorylated tyrosine binding; Puro, Puromycin; PVDF, Poly vinylidene fluoride; Q-PCR, Quantitative PCR; RTK, Receptor tyrosine kinase; SC, Schwann cell; SDS, Sodium dodecylsulfate; SR, Synaptic region; SV, Synaptic vesicle; TA, Tibialis anterior; UPS, Ubiquitin proteasome system; WB, Western blot; WT, Wild type; β-ME, β-Mercaptoethanol;

[0280] 1.18 Image analysis and data statistics:

[0281] Image J was used to analyze Western blot and immunofluorescence staining images. GraphPadprism 7.0 was used to perform statistical analysis. Data were expressed as mean ± standard error (Mean ± SEM). Two-tailed paired or unpaired Student's t-test was used for data analysis. p < 0.05 indicated statistically significant differences.

[0282] 1 Experimental results and analysis

[0283] Figure 1The figure shows that Agrin promotes the ubiquitination modification of DOK7 and its degradation through the proteasome system; (A) is a schematic diagram of Agrin stimulating myotubes, which leads to a decrease in DOK7 protein level. Agrin stimulated C2C12 differentiated myotubes, and samples were collected at different stimulation time points for Western blot detection. The results showed that the p-MuSK level and DOK7 protein level decreased, while the MuSK and LRP4 protein levels did not change significantly; (B) is a schematic diagram of Agrin stimulating myotubes for 4 hours without reducing the mRNA levels of LRP4, MuSK and DOK7; the figure shows the statistical results of three independent repeated experimental results, the values ​​are Mean±SEM, *p<0.05. (C) Agrin stimulation promotes the degradation of DOK7 through the proteasome system. C2C12 differentiated myotubes were treated with MG132 or CQ 1 hour before Agrin stimulation, and then stimulated with Agrin for 4 hours and then collected for Western blot detection. (D) is the statistical result of Figure (C). The figure shows the statistical results of three independent repeated experiments, the values ​​are Mean±SEM, ***p<0.001, **p<0.01. (E) is a schematic diagram of Agrin stimulation-induced DOK7 ubiquitination. C2C12 differentiated myotubes were treated with MG132 1 hour before Agrin stimulation, and then the samples were collected after Agrin stimulation for 1 hour. IP was performed with DOK7 antibody, and then Western blot was performed with ubiquitin antibody to detect the ubiquitination level of DOK7 in the IP samples.

[0284] Figure 2The figure shows that MuSK promotes the ubiquitination and degradation of DOK7. (A) is a schematic diagram of MuSK promoting the ubiquitination of DOK7. HEK 293T cells were transfected with the corresponding plasmids, and the amount of each plasmid was 2 μg. The total amount of plasmids in each group was 6 μg, and the amount less than 6 μg was supplemented with pcDNA3.1-Flag; the ubiquitin activating enzyme E1 inhibitor PYR-41 treatment group was added 8 hours after transfection. Samples were collected 24 hours after transfection and IP was performed with Flag antibody, and the ubiquitination level of DOK7 in the IP samples was detected with HA antibody. (B) is a schematic diagram of the results of MuSK promoting the degradation of DOK7. HEK 293T cells were transfected with the corresponding plasmids, and the amount of DOK7 and MuSK plasmids was 1 μg. The total amount of plasmids in the DOK7 single transfection group was supplemented with pcDNA3.1-Flag; CHX treatment was started 16 hours after transfection, and Western blot detection was performed after collecting samples at different CHX treatment time points. (C) Statistical results of Figure (B), the results are statistical results of three independent experiments, black is single transfection of DOK7, red is co-transfection of DOK7 and MuSK. Values ​​are Mean±SEM, *p<0.05, **p<0.01. (D) is a schematic diagram of MuSK promoting the degradation of DOK7 through the proteasome system; HEK 293T cells were transfected with the corresponding plasmids, and the plasmid dosage was 1μg; 24h after transfection, the cells were treated with MG132 or CQ for 1h, and then treated with CHX for 4h before collecting samples for Western blot detection. (E) Ubiquitin K48 connection is the main form of DOK7 ubiquitination. HEK 293T cells were transfected with corresponding plasmids, and the dosage of each plasmid was 2 μg. The total amount of plasmid in each group was 6 μg, and the amount less than 6 μg was supplemented with pcDNA3.1-Flag. Samples were collected 24 hours after transfection, and IP was performed with Flag antibody, and then HA antibody was used to detect the ubiquitination level of DOK7 in the IP samples.

[0285] Figure 3It shows that MuSK regulates DOK7 ubiquitination depending on its own kinase activity and binding to DOK7, where (A) MuSK kinase activity is necessary for its regulation of DOK7 ubiquitination. HEK 293T cells were transfected with the corresponding plasmids, and the amount of each plasmid was 2 μg. The total amount of plasmids in each group was 6 μg. The less than 6 μg was supplemented with pcDNA3.1-Flag plasmid; after 24 hours, the samples were collected and IP was performed with Flag antibody, and the DOK7 ubiquitination level in the IP samples was detected with HA antibody, and the inactivation of MuSK-K608R kinase was confirmed with p-MuSK antibody detection. (B) It shows that the binding of MuSK to DOK7 is necessary for its regulation of DOK7 ubiquitination. HEK 293T cells were transfected with the corresponding plasmids, and the amount of each plasmid was 2 μg. The total amount of plasmids in each group was 6 μg. The amount less than 6 μg was supplemented with pcDNA3.1-Flag; after 24 hours, the samples were collected and co-IPed with Flag antibody, and the DOK7 ubiquitination level in the co-IP samples was detected with HA antibody. The protein level of MuSK in the co-IP samples was detected with myc antibody to confirm that the MuSK-Y553F mutant weakened the binding of MuSK and DOK7. (C) shows that the binding of DOK7 to MuSK is necessary for MuSK to regulate its ubiquitination. HEK 293T cells were transfected with corresponding plasmids, and the dosage of each plasmid was 2 μg. The total amount of plasmid in each group was 6 μg, and the amount less than 6 μg was supplemented with pcDNA3.1-Flag; after 24 hours, the samples were collected and co-IPed with Flag antibody, the ubiquitination level of DOK7 in the co-IP samples was detected with HA antibody, and the protein level of MuSK in the co-IP samples was detected with myc antibody to confirm that the DOK7-3RA mutant weakened the binding of DOK7 and MuSK.

[0286] (D) It shows that the binding of MuSK to DOK7 is necessary for MuSK to promote the degradation of DOK7. HEK 293T cells were transfected with the corresponding plasmids, and the amount of each plasmid was 1 μg; CHX treatment was started 16 hours after transfection, and Western blot detection was performed after collecting samples at different CHX treatment time points. (E) Statistical results of Figure (D). The results shown in the figure are statistical results of three independent repeated experiments, and the values ​​are Mean±SEM, *p<0.05, **p<0.01.

[0287] Figure 4It shows that the ubiquitination site of DOK7 is lysine 243, among which (A) The most common DOK7 mutation in CMS does not affect DOK7 ubiquitination. The corresponding plasmids were transfected into HEK 293T cells, and the amount of each plasmid was 2 μg, and the total amount of plasmids in each group was 6 μg. The less than 6 μg was supplemented with pcDNA3.1-Flag; after 24 hours, the samples were collected and IP was performed with Flag antibody, and then the ubiquitination level of DOK7 in the IP samples was detected with HA antibody. (B) The common mutation of 8 lysines in the PH domain does not affect the ubiquitination of DOK7. The corresponding plasmids were transfected into HEK 293T cells, and the amount of each plasmid was 2 μg, and the total amount of plasmids in each group was 6 μg. The less than 6 μg was supplemented with pcDNA3.1-Flag; after 24 hours, the samples were collected and IP was performed with Flag antibody, and then the ubiquitination level of DOK7 in the IP samples was detected with HA antibody. (C) DOK7 Lys243 is the ubiquitination site of DOK7. The corresponding plasmids were transfected into HEK 293T cells. The amount of each plasmid was 2 μg. The total amount of plasmids in each group was 6 μg. The amount less than 6 μg was supplemented with pcDNA3.1-Flag. After 24 hours, the samples were collected and IP was performed with Flag antibody, and then the ubiquitination level of DOK7 in the IP samples was detected with HA antibody. (D) DOK7-K243R half-life extension. HEK 293T cells were transfected with the corresponding plasmids. The amount of each plasmid was 1 μg. CHX treatment was started 16 hours after transfection. Western blot detection was performed after collecting samples at different CHX treatment time points.

[0288] Figure 5The ubiquitination of DOK7 Lys243 negatively regulates the aggregation of AChR, where (A) the sequence alignment of DOK7K243 and its surrounding amino acids in different species. The sequence alignment results show that DOK7 K243 is highly conserved among multiple species. The red mark is the conserved lysine. (B) DOK7-K243R has a stronger ability to induce AChR aggregation in vitro. The corresponding plasmids were transfected before C2C12 cells differentiated, and samples were collected for staining observation 6 days after induction of differentiation. Green fluorescence marked the plasmid transfection-positive myotubes, and red fluorescence marked the aggregated AChR. (C) Statistical results of Figure (B). The figure shows the statistical results of at least three independent repeated experiments, and the values ​​are Mean±SEM, ***p<0.001. (D) Schematic diagram of electroporation. The plasmid injection site was the mouse tibialis anterior muscle. Two-week-old mice were selected for this experiment. The tibialis anterior muscle was taken one week after electroporation for whole-mount staining. (E) DOK7-K243R has a stronger ability to induce AChR aggregation in vivo. 5 μg of the corresponding plasmid was electroporated into the tibialis anterior muscle of two-week-old mice, and the tibialis anterior muscle was taken for staining observation one week later. Green fluorescence marks the myotubes positive for the electroporated plasmid, and red fluorescence marks AChR aggregation. The yellow arrow indicates the spot-like AChR aggregation. (F) Statistical results of Figure (E). The figure shows the statistical results of at least three independent repeated experiments, and the values ​​are Mean±SEM, ***p<0.001.

[0289] Figure 6It shows that APC2 promotes DOK7 ubiquitination and degradation, among which (A) overexpression of APC2 causes a decrease in DOK7 protein level. HEK 293T cells were transfected with the corresponding plasmids, and the amount of each plasmid was 1μg; samples were collected 24 hours after transfection for Western blot detection. GFP antibody was used to detect DOK7 protein level, Flag antibody was used to detect E3 expression, and the red arrow indicated the full-length E3 protein band. (B) Statistical results of Figure (A). The figure shows the statistical results of three independent repeated experiments, and the values ​​are Mean±SEM, ***p<0.001. (C) Overexpression of APC2 causes an increase in DOK7 ubiquitination level. HEK 293T cells were transfected with corresponding plasmids, with 1 μg of DOK7 and ubi plasmids, and 2 μg of MuSK and APC2 plasmids. The total amount of plasmids in each group was 6 μg, and the amount less than 6 μg was supplemented with pcDNA3.1-Flag; samples were collected 24 hours after transfection and IP was performed with Flag antibody, and the ubiquitination level of DOK7 in the IP samples was detected with HA antibody. (D) Expression of APC2 before and after C2C12 differentiation. Samples were collected at different time points of C2C12 differentiation for Western blot detection. (E) Overexpression of APC2 leads to a decrease in the endogenous DOK7 protein level in myotubes. C2C12 cells were cultured in 12-well plates, and 2 μg of the corresponding plasmids were transfected per well before differentiation. Samples were collected 3 days after differentiation for Western blot detection.

[0290] Figure 7 It was shown that knocking down APC2 inhibited DOK7 ubiquitination, where (A) knocking down APC2 inhibited MuSK-regulated DOK7 ubiquitination. HEK 293T cells were transfected with the corresponding plasmid combination, where the shRNA plasmid was used in an amount of 4 μg, DOK7, ubi and MuSK were all 1 μg, and the total amount of plasmid was 7 μg. The group with less than 7 μg was supplemented with pcDNA3.1-Flag plasmid; 72 hours after transfection, the samples were collected and IP was performed with Flag antibody, and then the ubiquitination level of DOK7 in the IP product was detected with HA antibody. (B) Knockdown of APC2 inhibited Agrin-induced DOK7 ubiquitination. The corresponding plasmids were transfected before C2C12 differentiation, and the plasmid dosage was 6 μg. C2C12 differentiation was induced 18 hours after transfection. Agrin stimulation was performed 4 days after differentiation. Myotubes were treated with MG132 1 hour before Agrin stimulation, and then samples were collected after 1 hour of Agrin stimulation and IP with DOK7 antibody. The ubiquitin antibody was used to detect the ubiquitination level of DOK7 in the IP product. In the figure, #1 and #2 are two shRNAs targeting APC2. The specific targeted sequences are different, but they target the same gene APC2.

[0291] Figure 8It was shown that CDH1 is a substrate recognition subunit that mediates DOK7 ubiquitination, where (A) knockdown of CDH1 inhibits DOK7 ubiquitination. The corresponding plasmid combination was transfected into HEK 293T cells, where the shRNA plasmid was used in an amount of 4 μg, DOK7, ubi and MuSK were all 1 μg, and the total amount of plasmid was 7 μg. The group with less than 7 μg was supplemented with pcDNA3.1-Flag; 72 hours after transfection, the samples were collected and IP was performed with Flag antibody, and then the ubiquitination level of DOK7 in the IP product was detected with HA antibody. (B) Q-PCR detection of CDC20 shRNA knockdown efficiency. The figure shows the statistical results of three independent repeated experiments, and the values ​​are Mean±SEM, ***p<0.001. The RNA sample is the RNA extracted from the cells in Figure (A) after the cells were resuspended and washed with 1 ml of pre-cooled PBS, and 300 μl of the cell suspension was centrifuged. (C) Q-PCR detection of CDH1 shRNA knockdown efficiency. The figure shows the statistical results of three independent repeated experiments, the values ​​are Mean±SEM, ***p<0.001. The RNA sample is the RNA extracted from the cells in Figure (A) when the cells were resuspended and washed with 1ml pre-cooled PBS, and 300μl of the cell suspension was centrifuged to obtain the cell-extracted RNA.

[0292] Fig. 9It shows that APC2 is localized at NMJ and enriched in postsynaptic myotubes, where (A) APC2 is localized at NMJ. The red BTX fluorescent signal marks NMJ, the green fluorescent signal marks APC2, and the arrow indicates the colocalization of the two. (B) Schematic diagram of the separation of synaptic and non-synaptic regions of mouse diaphragm. Green is motor neurons, red is AChR aggregation, the black dotted area is the synaptic region (SR), the yellow dotted area is the non-synaptic region (NSR), and the light blue part of the mouse diaphragm. (C) Fluorescence quantitative PCR detection of the enrichment of APC2 mRNA in the synaptic and non-synaptic regions. One-month-old mice were separated from the synaptic and non-synaptic regions according to Figure (B) and RNA was extracted for fluorescence quantitative PCR detection; the figure shows the statistical results of three independent repeated experiments, and the values ​​are shown as Mean±SEM. The mRNA levels of DOK7 and MuSK are higher in the synaptic region than in the non-synaptic region, indicating that the synaptic and non-synaptic regions were successfully separated. ***p<0.001, **p<0.01, *p<0.05. (D) APC2 is enriched in the synaptic area. After separating the synaptic area and non-synaptic area of ​​the diaphragm of one-month-old mice, proteins were extracted and detected by Western blot. MuSK and DOK7 were enriched in the synaptic area, indicating that the synaptic area and non-synaptic area were successfully separated. (E) APC2 is localized in the postsynaptic muscle fiber. The purple NF / SV2 fluorescent signal marks the presynaptic motor neuron, the red BTX marks the NMJ, and the green fluorescent signal marks APC2. It can be found that APC2 is still localized in the synaptic area where the presynaptic motor neuron disappears, indicating that APC2 is localized in the postsynaptic muscle fiber rather than the presynaptic motor neuron.

[0293] Fig.10The results show that APC2 negatively regulates AChR aggregation and NMJ development, where (A) overexpression of APC2 inhibits AChR aggregation. The corresponding plasmids were transfected before C2C12 differentiation, and Agrin stimulated myotubes to induce AChR aggregation and staining after 4 days of differentiation. The green fluorescent signal marks the plasmid-transfected positive myotubes, and the red fluorescent signal marks AChR aggregation. (B) Statistical results of Figure (A). The figure shows the results of at least three independent repeated experiments, and the values ​​are Mean±SEM, ***p<0.001. (C) Knockdown of APC2 promotes AChR aggregation. The corresponding plasmids were transfected before C2C12 differentiation, and Agrin stimulated myotubes to induce AChR aggregation and staining after 4 days of differentiation. The red fluorescent signal marks the transfected positive myotubes, and the green fluorescent signal marks AChR aggregation. (D) Statistical results of Figure (C). The figure shows the results of at least three independent repeated experiments, and the values ​​are Mean±SEM, ***p<0.001. (E) Knockdown of APC2 in mice promotes AChR aggregation. The corresponding plasmids were electroporated into the tibialis anterior muscle of one-week-old mice. One week after electroporation, the mice were killed and the tibialis anterior muscle was stained and observed. The red fluorescent signal marks the electroporated positive myotubes, and the green fluorescent signal marks the AChR aggregation. The white arrows indicate the AChR aggregation in the electroporated negative myotubes (i.e., the APC2 protein level is normal), and the yellow arrows indicate the AChR aggregation in the electroporated shRNA-targeted APC2-positive myotubes (i.e., the APC2 protein level is reduced). (F) is the statistical result of Figure (E). The area size of AChR aggregation in each treatment group is first counted, and then the proportion of AChR aggregation of a specified size in each treatment group is counted. Among them, small means that the AChR aggregation is less than 100μm. 2 , medium means AChR aggregation is greater than or equal to 100 μm 2 But less than 160μm 2 , large means AChR aggregation is greater than or equal to 160μm 2 (G) Statistical results of Figure (E). The average area of ​​AChR aggregation in each group was statistically analyzed, with three mice in each group. The values ​​are Mean±SEM, **p<0.01.

[0294] Fig.11It was shown that phosphorylation of DOK7 Tyr106 regulates DOK7 ubiquitination. Among them, (A) phosphorylation of DOK7 Tyr395 and Tyr405 is not necessary for DOK7 ubiquitination. The corresponding plasmids were transfected into HEK 293T cells. The amount of each plasmid in this experiment was 2μg, and the total amount of plasmid in each group was 6μg. The amount less than 6μg was supplemented with pcDNA3.1-Flag; 24h after transfection, the samples were collected and IP was performed with Flag antibody, and then the ubiquitination level of DOK7 in the IP product was detected with HA antibody. The results showed that the mutations of DOK7 Tyr395 and Tyr405 did not affect DOK7 ubiquitination. (B) Phosphorylation of DOK7 Tyr106 promoted DOK7 ubiquitination. HEK 293T cells were transfected with the corresponding plasmids. The amount of each plasmid in this experiment was 2 μg, and the total amount of plasmid in each group was 6 μg. The amount less than 6 μg was supplemented with pcDNA3.1-Flag. After 24 hours of transfection, samples were collected and IP was performed with Flag antibody, and then the ubiquitination level of DOK7 in the IP product was detected with HA antibody. The results showed that the DOK7 Tyr106 mutation inhibited DOK7 ubiquitination. (C) DOK7 Tyr106 phosphorylation promoted DOK7 degradation. HEK 293T cells were transfected with the corresponding plasmids. The amount of each plasmid in this experiment was 1 μg. After 16 hours of transfection, the cells were treated with CHX, and samples were collected at different time points for Western blot detection. The results showed that the DOK7 Tyr106 mutation inhibited DOK7 degradation. (D) DOK7Tyr106 can be phosphorylated by MuSK. HEK 293T cells were transfected with corresponding plasmids. In this experiment, the amount of DOK7 plasmid was 4 μg, the amount of MuSK plasmid was 2 μg, and the total amount of plasmid in each group was 6 μg. The amount less than 6 μg was supplemented with pcDNA3.1-Flag. 24 hours after transfection, the samples were collected and IP was performed with Flag antibody, and the tyrosine phosphorylation level of DOK7 in the IP product was detected with p-tyrosine antibody. The results showed that DOK7 Tyr106 could be phosphorylated at a detectable level.

[0295] Fig.12It shows that DOK7 Tyr106 phosphorylation promotes DOK7 dimerization, where (A) DOK7 Tyr106 phosphorylation promotes DOK7 dimerization. HEK 293T cells were transfected with the corresponding plasmids. The amount of each plasmid in this experiment was 2 μg, and the total amount of plasmids in each group was 6 μg. The amount less than 6 μg was supplemented with pcDNA3.1-Flag; 24 hours after transfection, samples were collected and co-IPed with Flag antibody, and then HA antibody was used to detect the level of HA-DOK7 protein bound to Flag-DOK7 in the co-IP product. (B) DOK7 Tyr106 phosphorylation promotes AChR aggregation. C2C12 cells were transfected with the corresponding plasmids before differentiation, and samples were collected for immunofluorescence staining after 6 days of differentiation. Green fluorescence indicates plasmid-transfected myotubes, and red fluorescence marks AChR aggregation. (C) Statistical results of Figure (B). The figure shows the results of at least three independent repeated experiments, and the values ​​are Mean±SEM, ***p<0.001.

[0296] Fig.13 It shows that DOK7 Tyr106 phosphorylation promotes the binding of DOK7 to APC2, where (A) DOK7 amino acid sequence alignment results. There is a conserved D-box amino acid sequence in the DOK7 amino acid sequence of different species. The red marks are the two conserved R and L amino acids in the D-box sequence. (B) DOK7 Tyr106 phosphorylation promotes the binding of DOK7 to APC2. HEK293T cells were transfected with the corresponding plasmids. The amount of each plasmid in this experiment was 2μg, and the total amount of plasmids treated in each group was 6μg. The less than 6μg was supplemented with GFP-N1 vector; 24h after transfection, the samples were collected and co-IPed with GFP antibody, and then the Flag antibody was used to detect the level of APC2 protein bound to DOK7 in the co-IP product. (C) APC2 specifically binds to DOK7. HEK 293T cells were transfected with the corresponding plasmids, with 4 μg of DOK7 and MuSK plasmids and 2 μg of APC2 plasmids; samples were collected 24 hours after transfection and co-IPed with Flag antibody, and then the GFP antibody was used to detect the level of APC2 protein bound to DOK7 or MuSK in the co-IP product. (D) Agrin stimulation promotes the binding of DOK7 to APC2. C2C12 myotubes were stimulated with Agrin after 5 days of differentiation, and samples were collected 1 hour after stimulation and co-IPed with DOK7 antibody, and then the APC2 antibody was used to detect the level of APC2 protein bound to DOK7 in the co-IP product.

[0297] 2.1 Agrin promotes DOK7 ubiquitination and degradation via the proteasome system

[0298] Current research has clearly revealed the activation mechanism of the Agrin-MuSK-DOK7 signaling pathway, but the negative regulatory mechanism of this pathway is still unclear. In order to study whether the Agrin-MuSK-DOK7 signaling pathway has a negative regulatory mechanism to prevent the pathway from being overactivated, first, the activation process of the Agrin-MuSK-DOK7 signaling pathway in vivo was simulated in vitro. Agrin was used to stimulate C2C12 differentiated myotubes, and samples were collected at different stimulation time points for Western blot detection. The test results showed that Agrin stimulation of myotubes for a short time (15 to 30 minutes) can induce MuSK phosphorylation (p-MuSK) ( Figure 1 A), and as the Agrin stimulation time prolonged, the p-MuSK level showed a downward trend while the MuSK protein level remained basically unchanged ( Figure 1 A), which indicates that Agrin stimulation of myotubes can activate MuSK but does not lead to its sustained or excessive activation.

[0299] At the same time, the protein levels of LRP4 and DOK7, which are necessary for inducing MuSK phosphorylation, were detected. The results showed that Agrin stimulation did not change the protein level of LRP4, but caused a significant decrease in the protein level of DOK7 ( Figure 1 A), which indicates that the protein level of DOK7 is negatively regulated by Agrin.

[0300] In order to determine whether Agrin negatively regulates DOK7 protein level by reducing DOK7 mRNA level or promoting DOK7 protein degradation, Q-PCR was first used to detect the mRNA levels of LRP4, MuSK and DOK7 before and after Agrin stimulation. The results showed that Agrin stimulation had no significant effect on the mRNA levels of LRP4 and MuSK, and the mRNA level of DOK7 was slightly increased after Agrin stimulation ( Figure 1 B), which indicates that Agrin does not negatively regulate DOK7 protein level by reducing DOK7 mRNA level.

[0301] The above results suggest that Agrin may negatively regulate the DOK7 protein level by promoting the degradation of DOK7 protein. The autophagy-lysosome system and the ubiquitin-proteasome system are the two most common ways of protein degradation. In order to detect whether Agrin negatively regulates the DOK7 protein level by promoting the degradation of DOK7 through these two pathways, the myotubes were treated with the proteasome inhibitor MG132 and the autophagy-lysosome inhibitor CQ for 1 hour before Agrin stimulation. Then, the myotubes were stimulated with Agrin and the samples were collected for Western blot detection. The results showed that the DOK7 protein level of the myotubes treated with MG132 before Agrin stimulation was slightly decreased, and there was almost no difference with the DOK7 protein level before Agrin stimulation; while the DOK7 protein level of the myotubes treated with CQ before Agrin stimulation was significantly decreased, which was similar to the decrease in the DOK7 protein level of the myotubes without any pretreatment after Agrin stimulation ( Figure 1 C, D); This indicates that the decrease in DOK7 protein level caused by Agrin stimulation can be inhibited by the proteasome inhibitor MG132. This result shows that Agrin negatively regulates the DOK7 protein level by promoting the degradation of DOK7 by the proteasome.

[0302] Polyubiquitination usually occurs before substrates are degraded by the proteasome. If Agrin promotes the degradation of DOK7 by the proteasome, then Agrin stimulation should promote the ubiquitination of DOK7. To verify this inference, C2C12 differentiated myotubes were stimulated with Agrin in vitro, and then endogenous DOK7 in myotubes was IPed with DOK7 antibody, and the ubiquitin level of DOK7 obtained by IP was detected by Western blot using Ubiquitin antibody. The results showed that after Agrin stimulation, the ubiquitination level of DOK7 increased significantly ( Figure 1 E), this result shows that Agrin stimulation can indeed enhance DOK7 ubiquitination. The above results collectively indicate that Agrin activates MuSK and enhances DOK7 ubiquitination, thereby promoting the degradation of DOK7 through the ubiquitin-proteasome system.

[0303] 2.2 MuSK regulates the ubiquitination of DOK7

[0304] 2.2.1 MuSK promotes DOK7 ubiquitination and degradation

[0305] In order to detect whether MuSK regulates the ubiquitination of DOK7, DOK7-Flag, MuSK-myc and HA-ubiquitin plasmids were transfected into HEK 293T cells. After 24 hours of transfection, samples were collected and IP was performed with Flag antibody, and then Western blot was performed with HA antibody to detect the ubiquitination level of DOK7 in IP samples. The results showed that the ubiquitination level of DOK7 was significantly increased in the samples co-transfected with MuSK, and the ubiquitination level of DOK7 could be inhibited by PYR-41, an inhibitor of ubiquitin activating enzyme E1 ( Figure 2 A), This result indicates that MuSK can promote the ubiquitination of DOK7.

[0306] Previous results have shown that Agrin stimulation-induced ubiquitination of DOK7 promotes its proteasome-dependent degradation. So, will MuSK-promoted ubiquitination of DOK7 affect the protein stability of DOK7? In order to test this, DOK7 was transfected alone and DOK7 and MuSK plasmids were co-transfected in HEK293T cells. After 16 hours of transfection, the cells were treated with the protein translation inhibitor CHX (Cycloheximide), and Western blot analysis was performed after sampling at different treatment time points. The results showed that after CHX treatment of cells, when DOK7 was expressed alone, its protein level showed a slow downward trend, that is, the protein stability was higher and the half-life was longer. When DOK7 and MuSK were expressed at the same time, the protein level of DOK7 decreased very sharply, that is, the protein stability was lower and the half-life was shorter ( Figure 2 B, C), this result indicates that MuSK-regulated DOK7 ubiquitination reduces DOK7 protein stability, promotes DOK7 degradation, and shortens the half-life of DOK7.

[0307] So does MuSK-promoted DOK7 degradation depend on the proteasome system? To answer this question, DOK7 and MuSK plasmids were co-transfected into HEK293T cells. After 24 hours of transfection, the cells were treated with MG132 or CQ for 1 hour, and then treated with CHX for 4 hours before collecting samples for Western blot analysis. The results showed that after 4 hours of CHX treatment, the DOK7 protein level in the cell protein samples without any pretreatment and pre-treated with the autophagy-lysosome inhibitor CQ decreased significantly, and the DOK7 protein level in the cell protein samples pre-treated with the proteasome inhibitor MG132 decreased slightly ( Figure 2 D) This result indicates that MuSK-promoted DOK7 degradation can be inhibited by the proteasome inhibitor MG132, indicating that MuSK promotes the degradation of DOK7 through the proteasome system.

[0308] Then, the ubiquitin chain connection mode of DOK7 ubiquitination was further detected. Ubiquitin has 7 lysines (Lysine, Lys, K), which means that there are seven possibilities when the latter ubiquitin is connected to the previous ubiquitin through its own lysine to form a ubiquitin chain. Current studies have shown that polyubiquitination of the K48 connection mode will promote protein degradation, while the K63 connection mode is mainly responsible for assisting signal transmission; the ubiquitin connection mode of DOK7 ubiquitination was detected by transfecting ubiquitin wild-type plasmid (HA-ubi-WT), ubiquitin mutant plasmid (HA-ubi-K48) that only retains the 48th lysine and the remaining six lysines are mutated to arginine, and ubiquitin mutant plasmid (HA-ubi-K63) that only retains the 63rd lysine and the remaining six lysines are mutated to arginine. The corresponding plasmids were transfected into HEK 293T cells, and IP was performed with Flag antibody 24 hours after transfection, and the ubiquitination level of DOK7 in the IP product was detected with HA antibody. It was found that HA-ubi-WT and HA-ubi-K48 could promote the ubiquitination of DOK7, while HA-ubi-K63 could hardly promote the ubiquitination of DOK7 ( Figure 2 E), this result indicates that the ubiquitination of DOK7 is mainly connected by K48. The above results collectively indicate that MuSK promotes the ubiquitination of DOK7 mainly by K48 connection, which promotes the degradation of DOK7 by the proteasome system, thereby shortening the half-life of DOK7 protein.

[0309] 2.2.2 MuSK regulates DOK7 ubiquitination by its own kinase activity and binding to DOK7

[0310] It has been determined above that MuSK can regulate DOK7 ubiquitination. Next, we want to determine whether MuSK regulation of DOK7 ubiquitination depends on its own kinase activity and binding to DOK7. First, according to literature reports, the MuSK kinase-inactive mutant MuSK-K608R-myc was constructed by mutating the lysine at position 608 of MuSK to arginine; DOK7-Flag and MuSK-myc-WT or DOK7-Flag and MuSK-K608R-myc were co-transfected in HEK 293T cells, and the cells were collected 24 hours after transfection and IP was performed with Flag antibody, and then the ubiquitination level of DOK7 in the IP sample was detected with HA antibody. The results showed that compared with the wild-type MuSK, the kinase-inactivated MuSK-K608R could only weakly promote DOK7 ubiquitination. The inactivation of the kinase activity of MuSK-K608R was also verified by detecting the p-MuSK level, and it was found that the phosphorylation level of MuSK-K608R was much lower than that of MuSK-WT ( Figure 3 A) This result indicates that the kinase activity of MuSK is essential for MuSK-regulated DOK7 ubiquitination.

[0311] Then, according to literature reports, the 553rd tyrosine (Tyrosine, Tyr, Y) of MuSK was mutated to phenylalanine (Phe, F) and the 158th, 159th and 174th arginine (Arginine, Arg, R) of DOK7 were mutated to alanine (Alanine, Ala, A) to construct a MuSK mutant and a DOK7 mutant that weakened the binding of MuSK to DOK7, namely MuSK-Y553F-myc and DOK7-3RA-Flag. The corresponding plasmid combination was transfected into HEK 293T cells, and the Flag antibody was used for IP 24 hours after transfection, and the ubiquitination level of DOK7 in the IP sample was detected with HA antibody. From the results, it can be found that compared with MuSK-WT-myc, MuSK-Y553F-myc can only weakly promote DOK7 ubiquitination ( Figure 3 B). At the same time, Western blot detection of the level of MuSK protein bound to DOK7 in IP samples using myc antibody confirmed that the binding of MuSK-Y553F-myc to DOK7 was weakened ( Figure 3 B). In addition, it was found that the ubiquitination level of DOK7-3RA mutant was significantly reduced compared with DOK7-WT ( Figure 3 C) These two test results indicate that the binding of MuSK to DOK7 is necessary for MuSK to regulate DOK7 ubiquitination.

[0312] According to the previous conclusion, DOK7 ubiquitination promotes DOK7 degradation and shortens the half-life of DOK7; therefore, the reduction of DOK7 ubiquitination level should prolong the half-life of DOK7. In order to verify the speculation, the half-life of DOK7-3RA mutant was tested, and the results showed that the half-life of this mutant was significantly prolonged compared with that of DOK7-WT ( Figure 3 D, E), the results verified the inference that DOK7 ubiquitination promotes DOK7 degradation and shortens the half-life of DOK7. The above results collectively indicate that the kinase activity of MuSK and its binding to DOK7 are necessary for MuSK to regulate DOK7 ubiquitination.

[0313] 2.3 The ubiquitination site of DOK7 is lysine 243

[0314] After confirming that MuSK regulates DOK7 ubiquitination, the ubiquitination sites of DOK7 were further studied. Current studies have shown that protein ubiquitination usually occurs at lysine sites. DOK7-dupTGCC is the most common DOK7 mutation in patients with congenital myasthenic syndrome (CMS). Because the mutation is caused by the duplication of four TGCC bases at positions 1124-1127 of DOK7, the mutation is named DOK7-dupTGCC. This mutation causes the open reading frame (ORF) of DOK7 to shift and terminate prematurely. The molecular weight of the DOK7 protein produced by translation is smaller than that of DOK7-WT, and because of the frameshift, DOK7-dupTGCC lacks the 499th lysine in DOK7-WT. In order to detect whether DOK7 ubiquitination is related to the pathogenicity of the mutation and whether Lys499 is the site of DOK7 ubiquitination, DOK7-dupTGCC-Flag and other corresponding plasmids were transfected into HEK 293T cells. 24 hours after transfection, IP was performed with Flag antibody, and then HA antibody was used to detect the ubiquitination level of DOK7 in the IP sample. The results showed that the ubiquitination level of DOK7-dupTGCC was comparable to that of DOK7-WT, with basically no difference ( Figure 4 A), indicating that DOK7 Lys499 is not a ubiquitination site.

[0315] The amino acids 1-100 of DOK7 constitute the Pleckstrin homology domain (PH domain). Literature has reported that this domain is important for the binding of DOK7 to the cell membrane (Buyan et al., 2016). In addition, this domain is rich in lysine, and the amino acids 12, 17, 18, 20, 28, 42, 44 and 49 are all lysine. Then, we tested whether these eight lysines are ubiquitination sites of DOK7. By mutating lysine to arginine (K to R), we constructed a DOK7 mutant with these eight lysines mutated together, namely DOK7-8KR-Flag. The mutant plasmid and the corresponding plasmid were transfected into HEK 293T cells. After 24 hours of transfection, the samples were collected and IP was performed with Flag antibody, and the DOK7 ubiquitination level in the IP sample was detected with HA antibody. The results showed that the ubiquitination level of DOK7-8KR was comparable to that of DOK7-WT, with basically no difference ( Figure 4B), indicating that these eight lysines in the DOK7 PH domain are not the sites of DOK7 ubiquitination. In order to identify the ubiquitination sites of DOK7, point mutations were performed on lysines at positions 123, 153, 207, and 243 in DOK7 to construct DOK7-K123R, DOK7-K153R, DOK7-K207R, and DOK7-K243R mutants. These mutant plasmids were transfected into HEK 293T cells with the corresponding plasmids. After 24 hours of transfection, samples were collected and IP was performed with Flag antibody, and the DOK7 ubiquitination level in the IP samples was detected with HA antibody. The results showed that compared with DOK7-WT, the ubiquitination level of the DOK7-K243R mutant decreased dramatically, while the ubiquitination levels of the DOK7 mutants with mutations at the other three sites remained basically unchanged ( Figure 4 C), indicating that lysine 243 of DOK7 is the ubiquitination site of DOK7.

[0316] As mentioned above, DOK7 ubiquitination promotes its degradation and shortens its half-life. So will DOK7-K243R with reduced ubiquitination level degrade more slowly? We transfected the corresponding plasmids into HEK 293T cells, treated the cells with CHX 16h after transfection, collected samples at different CHX treatment time points, and detected the protein level of DOK7 by Western blot. We found that the degradation rate of DOK7-K243R was indeed slower than that of DOK7-WT and the other three DOK7 mutants with unchanged ubiquitination levels ( Figure 4 D), which indicates that the ubiquitination of lysine 243 of DOK7 promotes the degradation of DOK7. The above results collectively indicate that the ubiquitination of lysine 243 of DOK7 shortens the half-life of DOK7 and promotes the degradation of DOK7.

[0317] 2.4 Ubiquitination of DOK7 Lys243 negatively regulates AChR aggregation

[0318] By comparing the amino acid sequences, it was found that DOK7 Lys243 is highly conserved among different species ( Figure 5A), which suggests that ubiquitination of this site may have important functions. Overexpression of DOK7 in C2C12 differentiated myotubes can induce acetylcholine receptor (AChR) aggregation, which is an important method to detect the function of DOK7. This method was used to detect whether DOK7 Lys243 ubiquitination affects the function of DOK7. First, plasmid transfection was performed before C2C12 differentiation. The medium was changed 6 hours after transfection. The cells continued to grow in the growth medium for 12 hours before changing to differentiation medium to induce myotube production. After 6 days of differentiation, samples were collected for cell immunofluorescence staining. Plasmid transfection-positive myotubes were labeled with Flag antibody, and aggregated AChRs were labeled with BTX-594 (Red). The results showed that there were very few aggregated AChRs in myotubes transfected with empty vectors, a small number of small spot-like AChR aggregates appeared in myotubes transfected with DOK7-WT, and a large number of sheet-like AChR aggregates appeared in myotubes transfected with DOK7-K143R ( Figure 5 B), the results of statistical analysis of the fluorescence signal intensity of BTX-594 that specifically labels AChR aggregation are consistent with the above results ( Figure 5 C, The AChR fluorescence intensity of the WT group was normalized to 1, and that of the K243R group was 4.93±0.39, p<0.001). This result indicates that the DOK7-K243R mutation has a stronger ability to induce AChR aggregation in vitro.

[0319] After in vitro experiments verified the effect of DOK7 ubiquitination on DOK7-induced AChR aggregation, the effect of DOK7 ubiquitination on DOK7-induced AChR aggregation was detected in mice by electroporation. 5 μg of the corresponding plasmid was electroporated into the tibialis anterior muscle (TA muscle) of two-week-old mice. After one week of electroporation, the mice were anesthetized and killed, and the tibialis anterior muscle was obtained for staining ( Figure 5 D). The results showed that the AChR in the myotubes electroporated with GFP vector showed a complete normal aggregation morphology. In the myotubes electroporated with GFP-DOK7-WT, a small amount of spot-like AChR aggregation appeared around the complete normal aggregation AChR, while in the myotubes electroporated with GFP-DOK7-K243R, a large amount of spot-like AChR aggregation appeared around the complete normal aggregation AChR ( Figure 5 E), the statistical results of the fluorescence intensity of BTX-594 specifically labeled AChR are also consistent with the above results ( Figure 5F, The fluorescence intensity of AChR in the GFP group was normalized to 1, that in the WT group was 1.62±0.12, and that in the K243R group was 2.64±0.15). This result indicates that the DOK7-K243R mutation also has a stronger ability to induce AChR aggregation in vivo. The above results collectively indicate that the ubiquitination of DOK7 Lys243 negatively regulates the aggregation of AChR.

[0320] 2.5 DOK7 ubiquitination depends on APC2 and CDH1

[0321] 2.5.1 Overexpression of APC2 promotes DOK7 ubiquitination and degradation

[0322] In order to find the ubiquitin ligase that mediates DOK7 ubiquitination, according to literature reports, seven ubiquitin ligases were found that are localized in the neuromuscular junction or may have a regulatory effect on the development of the neuromuscular junction. In order to conduct a preliminary screening of these seven ubiquitin ligases, DOK7 and these seven ubiquitin ligases were first co-transfected in HEK 293T cells, and the protein level of DOK7 was detected by Western blot 24 hours after transfection. The results showed that compared with the treatment groups transfected with empty vectors and transfected with other ubiquitin ligases, overexpression of APC2 can cause a sharp decrease in DOK7 protein levels ( Figure 6 A, B), suggesting that APC2 is likely the E3 that mediates DOK7 ubiquitination.

[0323] To further test whether APC2 is the E3 mediating DOK7 ubiquitination, APC2 and the corresponding plasmid combination were overexpressed in HEK 293T cells. After 24 hours of transfection, samples were collected for IP with Flag antibody, and the ubiquitination level of DOK7 in the IP product was detected with HA antibody. The results showed that overexpression of APC2 caused a sharp increase in the ubiquitination level of DOK7 ( Figure 6 C).

[0324] Next, we wanted to test whether overexpression of APC2 would cause a decrease in endogenous DOK7 protein levels in C2C12 differentiated myotubes. First, we detected the expression of APC2 before and after C2C12 differentiation. The results showed that APC2 was expressed before and after C2C12 differentiation ( Figure 6 D). After confirming that APC2 is expressed in myotubes, APC2 plasmid was transfected into C2C12 cells before differentiation. After differentiation into myotubes, samples were collected and the endogenous DOK7 protein level was detected by Western blot. The results showed that overexpression of APC2 caused the endogenous DOK7 protein level in myotubes to decrease ( Figure 6 E), the above results collectively indicate that overexpression of APC2 can promote the ubiquitination and degradation of DOK7.

[0325] 2.5.2 Knockdown of APC2 inhibits DOK7 ubiquitination

[0326] In the above experiment, APC2 was detected by overexpression to determine whether it was the E3 that mediated the ubiquitination of DOK7. The results showed that overexpression of APC2 could promote the ubiquitination of DOK7. So will knocking down APC2 inhibit the ubiquitination of DOK7? APC2 was knocked down using shRNA, and the effect of knocking down APC2 on the ubiquitination of DOK7 was detected. First, HEK 293T cells were transfected with the corresponding plasmids, and Flag antibody IP was used 72 hours after transfection, and then HA antibody was used to detect the ubiquitination level of DOK7 in the IP product. The results showed that compared with the control shRNA transfection group, the ubiquitination level of DOK7 in the samples transfected with APC2-shRNA decreased dramatically ( Figure 7 A). Then, the results were further verified in myotubes. The corresponding shRNA was transfected into C2C12 cells before differentiation. After 4 days of differentiation, myotubes were stimulated with Agrin for 1 hour and collected. The DOK7 ubiquitination level in the IP product was detected using DOK7 antibody IP and ubiquitin antibody. The results showed that knocking down APC2 in myotubes could inhibit Agrin-induced DOK7 ubiquitination ( Figure 7 B). The above results collectively indicate that knocking down APC2 can inhibit the ubiquitination of DOK7.

[0327] 2.5.3 CDH1 is a substrate recognition subunit that mediates DOK7 ubiquitination

[0328] APC2 is the catalytically active subunit of the ubiquitin ligase APC / C (Anaphase promoting complex / cyclosome). This E3 is a multi-subunit complex, in which two subunits are responsible for the specific recognition of substrates, namely CDC20 and CDH1.

[0329] In the above results, it has been found that APC2 is necessary for mediating DOK7 ubiquitination. Next, the substrate recognition subunit responsible for recognizing DOK7 and causing its ubiquitination was determined. The corresponding plasmids were transfected into HEK 293T cells, and shRNA was used to knock down CDC20 and CDH1. After 72 hours of transfection, the samples were collected and IP was performed with Flag antibody, and then the ubiquitination level of DOK7 in the IP product was detected with HA antibody. The test results showed that compared with the control group and the CDC20 knockdown group, CDH1 knockdown caused a sharp decrease in the ubiquitination level of DOK7 ( Figure 8 A). The knockdown effect of shRNA targeting CDC20 and CDH1 was also confirmed by Q-PCR assay ( Figure 8 B, C). The above results indicate that the substrate recognition subunit CDH1 of APC / C is essential for mediating DOK7 ubiquitination.

[0330] 2.6 Expression and localization of APC2 in muscle

[0331] The above results showed that APC2 was expressed in myotubes cultured in vitro and was involved in regulating the ubiquitination of DOK7, but the expression and localization of APC2 in mouse muscle is still not very clear.

[0332] The main function of DOK7 is to regulate the development of neuromuscular junctions, and DOK7 is located at the neuromuscular junction. If APC2 regulates the ubiquitination of DOK7, it is inferred that APC2 should also be located at the neuromuscular junction, so as to ensure that APC2 has the possibility of regulating DOK7 ubiquitination in space. In order to test whether the inference is correct, immunofluorescence staining was performed on mouse tibialis anterior muscle sections, and the results showed that the APC2 fluorescence signal and the BTX fluorescence signal marking the neuromuscular junction had strong co-localization ( Fig. 9 A), indicating that APC2 is localized at the neuromuscular junction.

[0333] Neuromuscular junctions are mainly distributed in the synaptic region (SR), and the adjacent areas that do not contain neuromuscular junctions are non-synaptic regions (NSR) ( Fig. 9 B). If APC2 is localized at the neuromuscular junction, then its mRNA and protein levels should be higher in the synaptic region than in the non-synaptic region. The synaptic and non-synaptic regions of mouse diaphragm were separated ( Fig. 9 B), RNA was extracted from some samples for fluorescence quantitative PCR detection. The results showed that the mRNA levels of DOK7 and MuSK were higher in the synaptic area than in the non-synaptic area, indicating that the separation of the synaptic area and the non-synaptic area was successful. On this basis, it was found that the mRNA level of APC2 was also higher in the synaptic area than in the non-synaptic area ( Fig. 9 C). After protein extraction from another part of the samples, Western blot analysis was performed. The results showed that MuSK and DOK7, two typical proteins enriched in synaptic regions, were indeed enriched in the synaptic region in the test results, indicating that the synaptic region and non-synaptic region were successfully separated ( Fig. 9 D). The test results also showed that the APC2 protein level was higher in the synaptic area than in the non-synaptic area ( Fig. 9 D) The above results collectively indicate that APC2 is enriched in the synaptic region.

[0334] The synaptic region can be structurally divided into presynaptic motor neurons and postsynaptic muscle fibers. The above results show that APC2 is enriched in the synaptic region, but it is unclear whether APC2 is localized in presynaptic motor neurons or postsynaptic muscle fibers. In order to distinguish whether APC2 is localized in presynaptic motor neurons or postsynaptic muscle fibers, sciatic nerve amputation surgery was performed on two-month-old mice. The surgery will cause the presynaptic motor neuron terminals to separate and retract from the postsynaptic muscle fibers, that is, only postsynaptic muscle fibers exist in the synaptic region one week after the surgery. One week after the surgery, the tibialis anterior muscles of the control group and the surgery group mice were stained. The results showed that in the control group, NF / SV2, which marks the presynaptic motor nerve, and BTX and APC2, which mark the neuromuscular junction, were strongly localized ( Fig. 9 E, Sham), which is consistent with the results of APC2 localization in the synaptic region mentioned above; in the surgical group, it can be found that the NF / SV2 signal marking the presynaptic motor neuron disappears, indicating that there are only postsynaptic muscle fibers but no presynaptic motor neurons in the synaptic region at this time. At this time, the APC2 fluorescence signal can still be detected, and this fluorescence signal has a strong co-localization with the BTX fluorescence signal marking the neuromuscular junction ( Fig. 9 E, Denervation), which indicates that APC2 is localized in postsynaptic muscle fibers. The above results collectively indicate that APC2 is localized in NMJ and is mainly distributed in postsynaptic myotubes.

[0335] 2.7 APC2 negatively regulates AChR aggregation and NMJ development

[0336] It is not very clear whether APC2 regulates the aggregation of AChR or the development of neuromuscular junctions in vertebrates. The experimental results in the above invention show that APC2 is localized in NMJ and enriched in postsynapses, which can mediate the ubiquitination of DOK7 and promote its degradation. DOK7 plays an important role in regulating AChR aggregation and the development of neuromuscular junctions, which leads to the exploration of whether APC2 regulates AChR aggregation or neuromuscular junction development in mice. First, APC2 was overexpressed in C2C12 differentiated myotubes, and after 4 days of differentiation, AChR aggregation was induced by Agrin stimulation. After 16 hours of Agrin stimulation, the samples were collected for immunofluorescence staining. The results showed that compared with the control group overexpressing GFP, the BTX fluorescence signal labeling AChR in the myotubes overexpressing GFP-APC2 was significantly weakened ( Figure 3 .7A, B, the BTX fluorescence signal intensity of the GFP overexpression group was 100.00±3.84%, and the BTX fluorescence signal intensity of the GFP-APC2 expression group was 57.77±3.75%, p<0.001), indicating that overexpression of APC2 inhibits AChR aggregation.

[0337] Then, APC2 was knocked down in C2C12 differentiated myotubes. After 4 days of differentiation, AChR aggregation was induced by Agrin stimulation. After 16 hours of Agrin stimulation, samples were collected for immunofluorescence staining. The results showed that compared with myotubes transfected with control shRNA, the BTX fluorescence signal of AChR labeled in myotubes transfected with shRNA targeting APC2 was enhanced ( Fig.10 C, D, the BTX fluorescence signal intensity in the control shRNA group was 100.00±5.97%, and that in the APC2 knockdown group was 137.60±7.03%, p<0.001), indicating that knockdown of APC2 promoted AChR aggregation.

[0338] After detecting the regulatory effect of APC2 on AChR aggregation in vitro, the effect of APC2 on AChR aggregation was also detected in mice. The tibialis anterior muscle of one-week-old mice was electroporated with control shRNA and shRNA targeting APC2. The tibialis anterior muscle was taken and stained one week after electroporation. The results showed that compared with the muscle fibers electroporated with control shRNA, the muscle fibers electroporated with shRNA targeting APC2 had a larger area of ​​BTX fluorescent signal labeled AChR ( Fig.10 E), and compared with myotubes electroporated with control shRNA, AChR in myotubes electroporated with shRNA targeting APC2 tended to form medium and large aggregates ( Fig.10 F), the statistical results of the average area of ​​AChR aggregation in myotubes electroporated with control shRNA and electroporated with shRNA targeting APC2 also show that the average area of ​​AChR aggregation in myotubes electroporated with shRNA targeting APC2 is larger ( Fig.10 G, the BTX fluorescence signal intensity of the electroporated control shRNA group was 100.00±7.68%, and the BTX fluorescence signal intensity of the electroporated mouse APC2 targeted shRNA group was 25.54±7.68%, p<0.01). The above results collectively indicate that APC2 negatively regulates AChR aggregation.

[0339] 2.8 DOK7 ubiquitination depends on its own tyrosine phosphorylation at position 106

[0340] As mentioned above, it has been found that MuSK kinase activity is necessary for regulating DOK7 ubiquitination. So which tyrosine phosphorylation site of DOK7 regulates DOK7 ubiquitination? Literature reports that DOK7 Tyr395 and Tyr405 are the sites where MuSK phosphorylates DOK7 (Hallock et al., 2010; Hamuro et al., 2008). First, these two sites were mutated from tyrosine to alanine (Y to A) to construct DOK7-Y395A and DOK7-Y405A. At the same time, the mutant DOK7-Y395 / 405A in which both sites were mutated to alanine was also constructed. Then, the corresponding plasmid combination was transfected into HEK293T cells. After 24 hours of transfection, samples were collected and IP was performed with Flag antibody, and the ubiquitination level of DOK7 in the IP product was detected with HA antibody. The results showed that compared with DOK7-WT, neither the single mutants DOK7-Y395A and DOK7-Y405A, nor the two-site mutation DOK7-Y395 / 405A did not affect the ubiquitination level of DOK7 ( Fig.11 A), indicating that phosphorylation of these two tyrosine sites is not necessary for regulating DOK7 ubiquitination.

[0341] Then, the remaining seven tyrosine sites in the DOK7 amino acid sequence were mutated to alanine, and the corresponding plasmid combination was transfected into HEK 293T cells. After 24 hours of transfection, samples were collected and IP was performed with Flag antibody, and then the ubiquitination level of DOK7 in the IP product was detected with HA antibody. The results showed that compared with DOK7-WT and other mutants, only the ubiquitination level of the mutant DOK7-Y106A, in which the tyrosine at position 106 of DOK7 was mutated to alanine, was significantly reduced ( Fig.11 B), indicating that the DOK7 Tyr106 site is very important for regulating DOK7 ubiquitination.

[0342] Experiments before the present invention demonstrated that ubiquitination of DOK7 promotes its degradation and shortens its half-life; if DOK7Tyr106 does affect the ubiquitination of DOK7, then the degradation of the DOK7-Y106A mutant with reduced ubiquitination level should be slower. In order to test this inference, HEK 293T cells were transfected with the corresponding plasmid combination, and the cells were treated with CHX 16 hours after transfection. Samples were collected at different time points and the DOK7 protein level was detected by Western blot. The results showed that compared with DOK7-WT, the degradation rate of the DOK-Y106A mutant with reduced ubiquitination level was indeed slower ( Fig.11 C), which suggests that DOK7 Tyr106 may promote DOK7 ubiquitination and degradation after being phosphorylated by MuSK.

[0343] So can DOK7 Tyr106 be phosphorylated by MuSK? In order to detect whether DOK7 Tyr106 is the site where MuSK phosphorylates DOK7, the 106th tyrosine in the DOK7-2YA mutant (i.e., DOK7-Y395 / 405A mentioned above) was mutated to alanine, and the DOK7-3YA mutant was constructed. The corresponding plasmid was transfected into HEK 293T cells, and the samples were collected 24 hours after transfection and IP was performed with Flag antibody. The tyrosine phosphorylation level of DOK7 in the IP sample was then detected with p-Tyrosine antibody. The results showed that when DOK7 existed alone, tyrosine phosphorylation basically did not occur. When MuSK was present, the tyrosine phosphorylation level of DOK7 increased significantly ( Fig.11 D), indicating that MuSK can phosphorylate tyrosine in DOK7. Compared with DOK7-WT, the tyrosine phosphorylation level of DOK7-2YA mutant decreased sharply, but still showed detectable levels of tyrosine phosphorylation ( Fig.11 D), indicating that in addition to Tyr395 and Tyr405 reported in the literature as the sites where MuSK phosphorylates DOK7, there are other tyrosine sites in DOK7 that are phosphorylated by MuSK. Compared with DOK7-2YA, the DOK7-3YA mutant lost the low level of phosphorylation of DOK7-2YA, indicating that the mutation of tyrosine 106 to alanine in DOK7 reduced the tyrosine phosphorylation level of DOK7 ( Fig.11 D), which indicates that tyrosine 106 of DOK7 can be phosphorylated. The results also showed that compared with DOK-WT, the ability of DOK7-2YA and DOK-3YA to bind to MuSK did not change, indicating that the decrease in DOK7 phosphorylation level caused by the DOK7 Tyr106 mutation is not due to the influence on the binding of DOK7 and MuSK ( Fig.11 D). The above results indicate that tyrosine 106 of DOK7 can be phosphorylated by MuSK, and phosphorylation of this site promotes the ubiquitination and degradation of DOK7.

[0344] 2.9 DOK7 Tyr106 phosphorylation promotes DOK7 dimerization

[0345] After identifying DOK7 Tyr106 as a new tyrosine phosphorylation site of DOK7, we continued to explore whether phosphorylation of this site affects the function of DOK7. First, we detected whether the phosphorylation of DOK7 Tyr106 affects the dimerization of DOK7 regulated by MuSK. HEK 293T cells were transfected with the corresponding plasmids, and samples were collected 24 hours after transfection and co-IPed with Flag antibody, and then the level of HA-DOK7 bound to DOK7-Flag in the co-IP product was detected with HA antibody. The results showed that the expression of MuSK can promote the binding of DOK7-Flag-WT and HA-DOK7-WT, that is, MuSK promotes DOK7 dimerization ( Fig.12 A). Compared with DOK7-WT, the dimerization ability of DOK7-Y106A was significantly reduced ( Fig.12 A), which indicates that phosphorylation of DOK7 Tyr106 may promote the formation of DOK7 dimers.

[0346] In the Agrin-MuSK-DOK7 signaling pathway, the dimerization of DOK7 is very important for the activation of MuSK kinase activity. Several common DOK7 mutations in congenital myasthenic syndrome are because DOK7 dimerization ability is weakened or even lost, which in turn cannot activate MuSK kinase activity, leading to abnormal AChR aggregation and ultimately causing disease (Bergamin et al., 2010; Hamuro et al., 2008). So will DOK7-Y106A with weakened dimerization ability weaken the ability of DOK7 to induce AChR aggregation? The corresponding plasmid was transfected into C2C12 differentiated myotubes for detection. The results showed that more BTX fluorescence signals labeled AChR could be observed in myotubes expressing DOK7-WT ( Fig.12 B, C), which indicates that overexpression of DOK7-WT can promote AChR aggregation, while only a very small amount of BTX fluorescence signal marking AChR aggregation can be observed in myotubes overexpressing DOK7-Y106A ( Fig.12 B, C), which indicates that the DOK7-Y106A mutation weakens the ability of DOK7 to promote AChR aggregation. The above results collectively indicate that the 106th tyrosine of DOK7 is a functional phosphorylation site, and phosphorylation of this site can promote the formation of DOK7 dimers, thereby leading to MuSK activation and promoting AChR aggregation.

[0347] 2.10 DOK7 Tyr106 phosphorylation promotes DOK7 binding to APC2

[0348] CDH1 usually recognizes an amino acid sequence in the substrate called D-box (Destruction box) or KEN motif. The shortest conserved amino acid sequence of D-box is RXXL. Sequence comparison revealed that DOK7 of different species has a D-box sequence of this type, and the D-box sequence surrounds DOK7 Tyr106 ( Fig.13 A) This leads to the question of whether DOK7 Tyr106 phosphorylation regulates APC2 CDH1 The substrate recognition of DOK7 was tested. The corresponding plasmids were transfected into HEK293T cells. After 24 hours of transfection, samples were collected and co-IP was performed on GFP-DOK7 using GFP antibody. The level of APC2 protein bound to DOK7 in the co-IP product was then detected using Flag antibody. The results showed that when DOK7 existed alone, that is, when DOK7 was not phosphorylated, DOK7-WT and DOK7-Y106A had almost the same background binding ability to APC2 ( Fig.13 B). In the presence of MuSK, that is, when DOK7 is phosphorylated, the binding ability of DOK7-WT to APC2 is significantly enhanced compared to when it is not phosphorylated, while DOK7-Y106A has no change ( Fig.13 B), indicating that phosphorylation of DOK7 Tyr106 can enhance the binding of DOK7 to APC2.

[0349] At the same time, in order to exclude the possibility that APC2 binds to MuSK, GFP-APC2 and DOK7-Flag or GFP-APC2 and MuSK-Flag were co-transfected into HEK 293T cells, and co-IP was performed with Flag antibody 24 hours after transfection. The APC2 protein level bound to DOK7 or MuSK in the co-IP product was then detected with GFP antibody. The results showed that APC2 specifically bound to DOK7 but not to MuSK ( Fig.13 C). We then tested whether Agrin regulates the binding of endogenous DOK7 to APC2 in myotubes by co-IP with DOK7 antibody and then using APC2 antibody to detect the level of APC2 protein bound to DOK7 in the co-IP product. The results showed that Agrin stimulation enhanced the binding of DOK7 to APC2 without changing the level of APC2 protein ( Fig.13 D). The results also showed that Agrin stimulation enhanced DOK7 ubiquitination ( Fig.13 D), which is consistent with the previous results of the present invention, and also shows that Agrin stimulation is effective in this experiment. The above results together show that phosphorylation of DOK7 Tyr106 promotes the binding of DOK7 to APC2.

[0350] The normal development of neuromuscular junctions depends on the precise regulation of the activation level of the Agrin-MuSK-DOK7 signaling pathway by the body. Current research has clearly revealed the activation mechanism of the Agrin-MuSK-DOK7 signaling pathway, but it is unclear whether there is a negative regulatory mechanism in this pathway to prevent excessive activation of the pathway. The present invention reports a negative regulatory mechanism of the Agrin-MuSK-DOK7 signaling pathway. After Agrin stimulates myotubes, MuSK is activated to phosphorylate DOK7 Tyr106. The catalytic subunit APC2 of the postsynaptically enriched ubiquitin ligase APC / C recognizes and binds to Tyr106-phosphorylated DOK7 with the help of the substrate recognition subunit CDH1, mediating its Lys243 to undergo polyubiquitination mainly in the form of K48 connection, thereby promoting the degradation of DOK7 through the proteasome system, and ultimately leading to a decrease in the level of DOK7 protein, thereby achieving negative regulation of the Agrin-MuSK-DOK7 signaling pathway.

[0351] In the present invention, it was found that Agrin stimulation can quickly (15 to 30 minutes) activate MuSK and lead to MuSK phosphorylation, but it will not continuously lead to high-level phosphorylation of MuSK. After 60 minutes of Agrin stimulation, the phosphorylation level of MuSK begins to decay ( Figure 1 ), which is consistent with existing literature reports, suggesting that there is a negative regulatory mechanism in the Agrin-MuSK-DOK7 signaling pathway to prevent overactivation of the pathway. So far, this negative regulatory mechanism is not understood.

[0352] In the study, it was found that Agrin stimulation of myotubes promoted DOK7 ubiquitination and led to a decrease in DOK7 protein levels ( Figure 1 ), and DOK7 is an intracellular adaptor protein of the Agrin-MuSK-DOK7 signaling pathway. Its protein level is very important for regulating the phosphorylation level of MuSK, that is, the activation level of the Agrin-MuSK-DOK7 signaling pathway. Studies have shown that too low or too high DOK7 protein levels have a very important effect on the activation and function of the Agrin-MuSK-DOK7 signaling pathway. Therefore, after discovering that Agrin promotes the ubiquitination of DOK7 and its degradation through the proteasome system, it is speculated that this may be a mechanism for negatively regulating the Agrin-MuSK-DOK7 signaling pathway.

[0353] MuSK functions as a receptor tyrosine kinase in the Agrin-MuSK-DOK7 signaling pathway, and DOK7 serves as its intracellular adaptor protein. The present invention expresses MuSK and DOK7 in HEK 293T cells and detects them, and finds that the kinase activity of MuSK and its binding to DOK7 are both necessary for regulating DOK7 ubiquitination ( Figure 3). It was also found that DOK7 Lys243 is the main site of ubiquitination ( Figure 4 ), the mutation of this site leads to a decrease in the ubiquitination level of DOK7. Functional experiments have shown that this mutant (DOK7-K243R) exhibits a stronger induction of AChR aggregation than wild-type DOK7 (DOK7-WT) ( Figure 5 ).

[0354] It is still unclear whether APC / C regulates the development of the neuromuscular junction in vertebrates. In the present invention, it was found that the catalytically active subunit APC2 of APC / C is enriched in the postsynaptic region of the neuromuscular junction in mice ( Fig. 9 Agrin stimulation of myotubes can enhance the specific binding of APC2 and DOK7 ( Fig.13 ), and with the help of the substrate recognition subunit CDH1, it catalyzes the K48-linked ubiquitination of DOK7 ( Figure 2 and Figure 8 ), leading to the degradation of DOK7 through the proteosome system ( Figure 1 and Figure 2 ), which ultimately caused DOK7 protein levels to be downregulated after Agrin stimulated myotubes ( Figure 1 ). We also tested whether APC2 regulates AChR aggregation and the development of mouse neuromuscular junctions. The results showed that overexpression of APC2 inhibited AChR aggregation, while knocking down APC2 promoted AChR aggregation and caused the neuromuscular junctions in mice to become larger ( Fig.10 ). In the present invention, the research results show that APC2 downregulates DOK7 protein level by promoting DOK7 ubiquitination and degradation, and finally negatively regulates AChR aggregation, thereby participating in regulating the development of vertebrate neuromuscular junctions.

[0355] MuSK is a receptor tyrosine kinase, and its kinase activity is essential for its regulation of ubiquitination of the intracellular adaptor protein DOK7 ( Figure 2 ), which means that DOK7 ubiquitination will only occur after a certain tyrosine site in the DOK7 protein is phosphorylated by MuSK. DOK7 Tyr395 and Tyr405 are the sites where MuSK phosphorylates DOK7 reported in the literature. However, the detection found that the phosphorylation of these two sites does not participate in regulating the ubiquitination of DOK7 ( Fig.11 ). After mutating these two sites, it was found that DOK7 still showed detectable levels of tyrosine phosphorylation, suggesting that other tyrosine sites in DOK7 were phosphorylated by MuSK, and the phosphorylation of these sites regulated the ubiquitination of DOK7. By mutating all tyrosine sites in DOK7, it was finally found that DOK7Tyr106 could be phosphorylated by MuSK and regulated the ubiquitination of DOK7 ( Fig.11). Previous studies have found through mass spectrometry that DOK7 Tyr395 and Tyr405 are the main tyrosine phosphorylation sites in DOK7. The test found that after the two sites were mutated, the tyrosine phosphorylation level of DOK7 did drop sharply, and only weak Tyr106 phosphorylation was retained. This may be because the phosphorylation level of Tyr106 is relatively low, which exceeds the sensitivity range of mass spectrometry detection. Phosphorylation of DOK7 Tyr395 and Tyr405 promotes the binding of DOK7 to Crk / Crk-L, and helps the Agrin-MuSK-DOK7 signaling pathway to transmit signals downward. So what is the function of DOK7 Tyr106 phosphorylation? It was found that after the mutation of this site (DOK7-Y106A), DOK7 lost the ability to promote AChR aggregation ( Fig.12 ), which indicates that DOK7-Y106A has lost the ability to activate the Agrin-MuSK-DOK7 signaling pathway. Through testing, it was found that the ability of DOK7-Y106A to form dimers was greatly weakened ( Fig.12 ), which may be the reason why DOK7-Y106A cannot activate the Agrin-MuSK-DOK7 signaling pathway and induce AChR aggregation. Since the phosphorylation of DOK7 Tyr106 regulates DOK7 ubiquitination, does it regulate the binding of DOK7 to ubiquitin ligases? When APC / C mediates substrate ubiquitination, CDC20 or CDH1 is required to be responsible for substrate recognition and help the substrate bind to APC / C. CDH1 has been identified as the substrate recognition subunit of DOK7 ubiquitination ( Figure 8 ), CDH1 substrate recognition depends on a segment in the substrate called a D-box motif, the conserved form of the D-box motif is RXXL. Through sequence comparison, it was found that DOK7 proteins of different species all have a conserved D-box motif, and DOK7Tyr106 happens to be located in this conserved D-box motif. Through detection, it was found that the phosphorylation of DOK7 Tyr106 can promote the binding of DOK7 to APC2 ( Fig.13 ).

[0356] The present invention can provide new ideas for developing treatment methods for such diseases. Overexpression will cause the DOK7 or MuSK protein level in myotubes to be much higher than the endogenously expressed protein level, thereby causing abnormal and sustained high-level activation of the Agrin-MuSK-DOK7 signaling pathway. If DOK7 ubiquitination and degradation are inhibited by knocking down APC2, thereby maintaining the endogenous DOK7 protein level, and then maintaining the activation level of the Agrin-MuSK-DOK7 signaling pathway, it may promote the development and maintenance of neuromuscular junctions.

[0357] In general, the present invention discloses a negative regulation mechanism of the Agrin-MuSK-DOK7 signaling pathway. After Agrin stimulates myotubes, MuSK promotes phosphorylation of DOK7 Tyr106. With the help of CDH1, APC2 binds to DOK7 phosphorylated at Tyr106 and mediates ubiquitination of DOK7 Lys243 mainly in the form of K48 connection, promoting the degradation of DOK7 through the proteasome system, and ultimately leading to downregulation of DOK7 protein levels, thereby achieving negative regulation of the Agrin-MuSK-DOK7 signaling pathway. This mechanism is very important for maintaining the normal activation level of the Agrin-MuSK-DOK7 signaling pathway, and also plays a key regulatory role in maintaining normal AChR aggregation and neuromuscular junction development. The present invention helps to have a more comprehensive understanding of the molecular mechanism of regulating the development of neuromuscular junctions, and also helps to broaden the ideas in developing treatment methods for related diseases.

[0358] Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work should fall within the scope of protection of the present invention.

Claims

1. An experimental method for studying the negative regulatory mechanism of the Agrin-MuSK-DOK7 signaling pathway, characterized in that: include: (1) To simulate the activation process of the Agrin-MuSK-DOK7 signaling pathway in vivo in vitro, C2C12 differentiated myotubes were stimulated with Agrin, and samples were collected at different stimulation time points for Western blot detection of LRP4, MuSK, p-MuSK, and DOK7 protein levels; (2) Q-PCR was used to detect the mRNA levels of LRP4, MuSK, and DOK7 before and after Agrin stimulation; (3) Before agrin stimulation of myotubes, myotubes were treated with proteasome inhibitor MG132 and autophagy-lysosome inhibitor CQ for 1 h, and then samples were collected after agrin stimulation for Western blot detection of DOK7 protein levels; (4) The ubiquitin-linked mode of DOK7 ubiquitination was detected by transfecting ubiquitin wild-type plasmid, ubiquitin mutant plasmid that only retained lysine at position 48 and mutated the other six lysines to arginine, and ubiquitin mutant plasmid that only retained lysine at position 63 and mutated the other six lysines to arginine. The corresponding plasmids were transfected into HEK293T cells, and IP detection was performed with Flag antibody 24 hours after transfection. The ubiquitination level of DOK7 in the IP product was then detected with HA antibody; (5) The lysine 243 in DOK7 was point mutated to construct the DOK7-K243R mutant, and the corresponding plasmid was transfected into HEK 293T cells. The samples were collected 24 hours after transfection and IP was detected using Flag antibody. The ubiquitination level of DOK7 in the IP product was then detected using HA antibody; (6) The tyrosine at position 106 in the amino acid sequence of DOK7 was mutated to alanine, and the corresponding plasmid was transfected into HEK 293T cells. Samples were collected 24 hours after transfection, and IP detection was performed using Flag antibody. The ubiquitination level of DOK7 in the IP product was then detected using HA antibody; (7) Does DOK7 Tyr106 phosphorylation regulate APC2? CDH1 To detect the substrate recognition of DOK7: the 106th tyrosine in the amino acid sequence of DOK7 was mutated to alanine, and the corresponding plasmid was transfected into HEK293T cells. The samples were collected 24 hours after transfection, and the GFP-DOK7 was co-IP detected with GFP antibody, and the APC2 protein level bound to DOK7 in the co-IP product was detected with Flag antibody. (8) Detect whether Agrin regulates the binding of endogenous DOK7 and APC2 in myotubes: perform co-IP detection with DOK7 antibody, and then use APC2 antibody to detect the level of APC2 protein bound to DOK7 in the co-IP product; When constructing the DOK7 point mutation plasmid, the PCR reaction system was as follows: ddH2O 7.5μl; F primer 1μl; R primer 1μl; 2× PrimeStar max mix 10μl; template plasmid 0.5μl; primer sequences were: DOK7-Y106A-F: GGATGCCCGGATCCGCGCTGCGCTCGGCGAGGTG; DOK7-Y106A-R:CACCTCGCCCAGCGCAGCGCGGATCCGGGCATCC; DOK7-K243R-F;CCCTACAGCTGGAGAGGCGGCTGAGCCTCCTCTCA; DOK7-K243R-R: TGAGAGGAGGCTCAGCCGCCTCTCCAGCTGTAGGG.

Images