CRISPR / Cas Screening Platform for Identifying Genetic Modifiers of Tau Seeding or Aggregation

Abstract

Provided are Cas protein-ready tau biosensor cells, CRISPR / Cas synergistic activation mediator (SAM)-ready tau biosensor cells, and methods of preparing and using such cells to screen for tau seeding or aggregation gene modifiers. Also provided are reagents and methods for sensitizing such cells to tau seeding activity or tau aggregation or for causing tau aggregation.

Description

[0001] Cross - Reference to Related Applications

[0002] This application claims the benefit of U.S. Application No. 62 / 820,086, filed Mar. 18, 2019, which is hereby incorporated by reference in its entirety for all purposes.

[0003] Reference to a Sequence Listing Submitted as a Text File via EFS - WEB

[0004] The Sequence Listing filed as a text file named 544635SEQLIST.txt, which is 75.7 kilobytes in size, was created on Mar. 16, 2020, and is hereby incorporated by reference. BACKGROUND OF THE INVENTION

[0005] Aberrant aggregation or fibrillation of proteins is a defining feature of many diseases, particularly several neurodegenerative diseases such as Alzheimer's disease (AD), Parkinson's disease (PD), frontotemporal dementia (FTD), amyotrophic lateral sclerosis (ALS), chronic traumatic encephalopathy (CTE), Creutzfeldt-Jakob disease (CJD), and others. In many of these diseases, the protofibrillation of certain proteins into insoluble aggregates is not only a hallmark of the disease but is also thought to be a causative factor of neurotoxicity. In addition, these diseases are characterized by the propagation of aggregation pathology through the central nervous system in a stereotypical pattern, a process that correlates with disease progression. Thus, identifying genes and genetic pathways that modify the abnormal protein aggregation process or the intercellular propagation of aggregates has important value for better understanding the etiology of neurodegenerative diseases and for developing therapeutic intervention strategies. SUMMARY OF THE INVENTION

[0006] Provided herein are methods for screening tau aggregation gene modifiers, methods for generating conditioned media for inducing or sensitizing tau aggregation, and methods for generating tau aggregation-positive cell populations. Also provided herein are Cas-tau biosensor cells or such cell populations and in vitro cultures of Cas-tau biosensor cells and conditioned media. Also provided herein are CRISPR / Cas synergistic activation mediator (SAM) tau biosensor cells or such cell populations and in vitro cultures of SAM-tau biosensor cells and conditioned media.

[0007] On the one hand, methods for screening tau aggregation gene modifiers are provided. Some such methods (CRISPRn) can include: (a) providing a cell population comprising a Cas protein, a first tau repeat domain linked to a first reporter gene, and a second tau repeat domain linked to a second reporter gene; (b) introducing a library comprising a plurality of unique guide RNAs targeting a plurality of genes into the cell population; (c) culturing the cell population to allow genome editing and amplification, wherein the plurality of unique guide RNAs form a complex with the Cas protein, and the Cas protein cleaves the plurality of genes, thereby resulting in gene function knockout to produce a genetically modified cell population; (d) contacting the genetically modified cell population with a tau inoculum to produce an inoculated cell population; (e) culturing the inoculated cell population to allow the formation of tau aggregates, wherein aggregates of the first tau repeat domain and the second tau repeat domain form in a subset of the inoculated cell population to produce an aggregation-positive cell population; and (f) determining the abundance of each unique guide RNA among the plurality of unique guide RNAs in the aggregation-positive cell population identified in step (e) relative to the genetically modified cell population in step (c), wherein enrichment of the guide RNA in the aggregation-positive cell population identified in step (e) relative to the cultured cell population in step (c) indicates that the gene targeted by the guide RNA is a tau aggregation gene modifier, wherein disruption of the gene targeted by the guide RNA enhances tau aggregation, or is a candidate gene modifier of tau aggregation (e.g., for further testing by secondary screening), wherein disruption of the gene targeted by the guide RNA is expected to enhance tau aggregation.

[0008] In some such methods, the first tau repeat domain and / or the second tau repeat domain is a human tau repeat domain. In some such methods, the first tau repeat domain and / or the second tau repeat domain comprises an aggregation-promoting mutation. Optionally, the first tau repeat domain and / or the second tau repeat domain comprises a tau P301S mutation.

[0009] In some such methods, the first tau repeat domain and / or the second tau repeat domain comprise a tau four-repeat domain. In some such methods, the first tau repeat domain and / or the second tau repeat domain comprise SEQ ID NO:11. In some such methods, the first tau repeat domain and the second tau repeat domain are the same. In some such methods, the first tau repeat domain and the second tau repeat domain are the same and each comprise a tau four-repeat domain containing the tau P301S mutation.

[0010] In some such methods, the first reporter gene and the second reporter gene are fluorescent proteins. Optionally, the first reporter gene and the second reporter gene are a fluorescence resonance energy transfer (FRET) pair. Optionally, the first reporter gene is cyan fluorescent protein (CFP), and the second reporter gene is yellow fluorescent protein (YFP).

[0011] In some such methods, the Cas protein is a Cas9 protein. Optionally, the Cas protein is Streptococcus pyogenes Cas9. Optionally, the Cas protein comprises SEQ ID NO:21. Optionally, the Cas protein is encoded by a coding sequence comprising the sequence shown in SEQ ID NO:22.

[0012] In some such methods, the Cas protein, the first tau repeat domain linked to the first reporter gene, and the second tau repeat domain linked to the second reporter gene are stably expressed in the cell population. In some such methods, the nucleic acids encoding the Cas protein, the first tau repeat domain linked to the first reporter gene, and the second tau repeat domain linked to the second reporter gene are genomically integrated in the cell population.

[0013] In some such methods, the cell is a eukaryotic cell. Optionally, the cell is a mammalian cell. Optionally, the cell is a human cell. Optionally, the cell is a HEK293T cell.

[0014] In some such methods, the plurality of unique guide RNAs are introduced at a selected concentration such that most cells receive only one of the unique guide RNAs. In some such methods, the plurality of unique guide RNAs target 100 or more genes, 1000 or more genes, or 10000 or more genes. In some such methods, the library is a genome-wide library.

[0015] In some such methods, multiple target sequences are targeted, on average, in each of the multiple genes being targeted. Optionally, at least three target sequences are targeted, on average, in each of the multiple targeted genes. Optionally, from about three to about six target sequences (e.g., about three, about four, or about six) are targeted, on average, in each of the multiple targeted genes.

[0016] In some such methods, each guide RNA targets a constitutive exon. Optionally, each guide RNA targets a 5' constitutive exon. In some such methods, each guide RNA targets a first exon, a second exon, or a third exon.

[0017] In some such methods, the multiple unique guide RNAs are introduced into the cell population by viral transduction. Optionally, each of the multiple unique guide RNAs is in a separate viral vector. Optionally, the multiple unique guide RNAs are introduced into the cell population by lentiviral transduction. In some such methods, the cell population is infected at a multiplicity of infection of less than about 0.3.

[0018] In some such methods, the multiple unique guide RNAs are introduced into the cell population together with a selection marker, and step (b) further comprises selecting cells that contain the selection marker. Optionally, the selection marker confers resistance to a drug. Optionally, the selection marker confers resistance to puromycin or geneticin. Optionally, the selection marker is selected from neomycin phosphotransferase, hygromycin B phosphotransferase, puromycin-N-acetyltransferase, and blasticidin S deaminase. Optionally, the selection marker is selected from neomycin phosphotransferase, hygromycin B phosphotransferase, puromycin-N-acetyltransferase, blasticidin S deaminase, and bleomycin resistance protein.

[0019] In some such methods, the cell population into which the multiple unique guide RNAs are introduced in step (b) comprises greater than about 300 cells / unique guide RNA.

[0020] In some such methods, step (c) is from about 3 days to about 9 days. Optionally, step (c) is about 6 days.

[0021] In some such methods, step (d) includes culturing the genetically modified cell population in the presence of conditioned medium harvested from cultured tau aggregation-positive cells, wherein the tau repeat domain stably exists in an aggregated state. Optionally, the conditioned medium is harvested after about 1 day to about 7 days on confluent tau aggregation-positive cells. Optionally, the conditioned medium is harvested after about 4 days on confluent tau aggregation-positive cells. Optionally, step (d) includes culturing the genetically modified cell population in about 75% conditioned medium and about 25% fresh medium. In some such methods, the genetically modified cell population is not co-cultured with the tau aggregation-positive cells, wherein the tau repeat domain stably exists in an aggregated state.

[0022] In some such methods, step (e) is from about 2 days to about 6 days. Optionally, step (e) is about 4 days. In some such methods, the first reporter gene and the second reporter gene are a fluorescence resonance energy transfer (FRET) pair, and the aggregation-positive cell population in step (e) is identified by flow cytometry.

[0023] In some such methods, the abundance is determined by next-generation sequencing. In some such methods, if the abundance of a guide RNA in the aggregation-positive cell population in step (e) is at least 1.5-fold that in the cultured cell population in step (c) relative to the total population of the plurality of unique guide RNAs, then the guide RNA is considered enriched.

[0024] In some such methods, step (f) includes determining the abundance of each unique guide RNA among the plurality of unique guide RNAs in the aggregation-positive cell population in step (e) relative to the cultured cell population in step (c) at the first time point in step (c) and / or the second time point in step (c). Optionally, the first time point in step (c) is at the first passage of culturing the cell population, and the second time point is in the middle of culturing the cell population to allow genome editing and amplification. Optionally, the first time point in step (c) is after culturing for about three days, and the second time point in step (c) is after culturing for about six days.

[0025] In some such methods, a gene is considered to be a tau aggregation gene modifier, where disruption of the gene enhances tau aggregation (or a candidate gene modifier of tau aggregation, where disruption of the gene is expected to enhance tau aggregation), if the following occurs: (1) at both the first time point in step (c) and the second time point in step (c), the abundance of the guide RNA targeting the gene relative to the total population of the plurality of unique guide RNAs is at least 1.5-fold in the aggregation-positive cell population in step (e) compared to the cultured cell population in step (c); and / or (2) at the first time point in step (c) or the second time point in step (c), the abundance of at least two unique guide RNAs targeting the gene relative to the total population of the plurality of unique guide RNAs is at least 1.5-fold in the aggregation-positive cell population in step (e) compared to the cultured cell population in step (c).

[0026] In some such methods, the following steps are taken in step (f) to identify a gene as a tau aggregation gene modifier, where disruption of the gene enhances tau aggregation (or a candidate gene modifier of tau aggregation, where disruption of the gene is expected to enhance tau aggregation): (1) identify which of the plurality of unique guide RNAs are present in the aggregation-positive cell population generated in step (e); (2) calculate the random chance of the presence of the guide RNAs identified in step (f)(1) using the formula nCn'*(x - n')C(m - n) / xCm, where x is the variety of unique guide RNAs introduced into the cell population in step (b), where m is the variety of unique guide RNAs identified in step (f)(1), where n is the variety of unique guide RNAs targeting the gene introduced into the cell population in step (b), and where n' is the variety of unique guide RNAs targeting the gene identified in step (f)(1); (3) calculate the average enrichment score of the guide RNAs identified in step (f)(1), where the enrichment score of a guide RNA is the relative abundance of the guide RNA in the aggregation-positive cell population generated in step (e) divided by the relative abundance of the guide RNA in the cultured cell population in step (c), and where the relative abundance is the read count of the guide RNA divided by the read count of the total population of the plurality of unique guide RNAs; and (4) if the guide RNAs targeting the gene are significantly lower than the random chance of presence and higher than a threshold enrichment score, then select the gene.

[0027] Some such methods (CRISPRa) can include: (a) providing a cell population that includes a chimeric Cas protein comprising a nuclease-inactivated Cas protein fused to one or more transcriptional activation domains, a chimeric adaptor protein comprising an adaptor protein fused to one or more transcriptional activation domains, a first tau repeat domain linked to a first reporter gene, and a second tau repeat domain linked to a second reporter gene; (b) introducing a library of multiple unique guide RNAs targeting multiple genes into the cell population; (c) culturing the cell population to allow transcriptional activation and amplification, wherein the multiple unique guide RNAs form a complex with the chimeric Cas protein and the chimeric adaptor protein, and the complex activates transcription of the multiple genes resulting in increased gene expression to produce a genetically modified cell population; (d) contacting the genetically modified cell population with a tau inoculum to produce an inoculated cell population; (e) culturing the inoculated cell population to allow formation of tau aggregates, wherein aggregates of the first tau repeat domain and the second tau repeat domain form in a subset of the inoculated cell population to produce an aggregate-positive cell population; and (f) determining the abundance of each unique guide RNA among the multiple unique guide RNAs in the aggregate-positive cell population identified in step (e) relative to the genetically modified cell population in step (c), wherein enrichment of the guide RNA in the aggregate-positive cell population identified in step (e) relative to the cultured cell population in step (c) indicates that the gene targeted by the guide RNA is a tau aggregation gene modifier, wherein transcriptional activation of the gene targeted by the guide RNA enhances tau aggregation, or is a candidate gene modifier of tau aggregation (e.g., for further testing by secondary screening), wherein transcriptional activation of the gene targeted by the guide RNA is expected to enhance tau aggregation.

[0028] In some such methods, the first tau repeat domain and / or the second tau repeat domain is a human tau repeat domain. In some such methods, the first tau repeat domain and / or the second tau repeat domain includes an aggregation-promoting mutation. Optionally, the first tau repeat domain and / or the second tau repeat domain includes the tau P301S mutation.

[0029] In some such methods, the first tau repeat domain and / or the second tau repeat domain comprises a tau four-repeat domain. In some such methods, the first tau repeat domain and / or the second tau repeat domain comprises SEQ ID NO:11. In some such methods, the first tau repeat domain and the second tau repeat domain are the same. In some such methods, the first tau repeat domain and the second tau repeat domain are the same and each comprises a tau four-repeat domain containing the tau P301S mutation.

[0030] In some such methods, the first reporter gene and the second reporter gene are fluorescent proteins. Optionally, the first reporter gene and the second reporter gene are a fluorescence resonance energy transfer (FRET) pair. Optionally, the first reporter gene is cyan fluorescent protein (CFP), and the second reporter gene is yellow fluorescent protein (YFP).

[0031] In some such methods, the Cas protein is a Cas9 protein. Optionally, the Cas protein is Streptococcus pyogenes Cas9. In some such methods, the chimeric Cas protein comprises the nuclease-inactivated Cas protein fused to a VP64 transcriptional activation domain, optionally wherein the chimeric Cas protein comprises, from the N-terminus to the C-terminus: the nuclease-inactivated Cas protein; a nuclear localization signal; and the VP64 transcriptional activation domain. In some such methods, the adaptor protein is an MS2 coat protein, and wherein one or more transcriptional activation domains in the chimeric adaptor protein comprise a p65 transcriptional activation domain and an HSF1 transcriptional activation domain, optionally wherein the chimeric adaptor protein comprises, from the N-terminus to the C-terminus: the MS2 coat protein; a nuclear localization signal; the p65 transcriptional activation domain; and the HSF1 transcriptional activation domain. In some such methods, the chimeric Cas protein comprises SEQ ID NO:36, optionally wherein the chimeric Cas protein is encoded by a coding sequence comprising the sequence shown in SEQ ID NO:38. In some such methods, the chimeric adaptor protein comprises SEQ ID NO:37, optionally wherein the chimeric adaptor protein is encoded by a coding sequence comprising the sequence shown in SEQ ID NO:39.

[0032] In some such methods, the chimeric Cas protein, the chimeric adaptor protein, the first tau repeat domain linked to the first reporter gene, and the second tau repeat domain linked to the second reporter gene are stably expressed in the cell population. In some such methods, the nucleic acids encoding the chimeric Cas protein, the chimeric adaptor protein, the first tau repeat domain linked to the first reporter gene, and the second tau repeat domain linked to the second reporter gene are genomically integrated in the cell population.

[0033] In some such methods, the cell is a eukaryotic cell. Optionally, the cell is a mammalian cell. Optionally, the cell is a human cell. Optionally, the cell is a HEK293T cell.

[0034] In some such methods, the plurality of unique guide RNAs are introduced at a selected concentration such that most cells receive only one of the unique guide RNAs. In some such methods, the plurality of unique guide RNAs target 100 or more genes, 1000 or more genes, or 10000 or more genes. In some such methods, the library is a genome-wide library.

[0035] In some such methods, multiple target sequences are targeted on average in each of the plurality of genes being targeted. Optionally, at least three target sequences are targeted on average in each of the plurality of targeted genes. Optionally, from about three to about six target sequences (e.g., about three, about four, or about six) are targeted on average in each of the plurality of targeted genes. Optionally, about three target sequences are targeted on average in each of the plurality of targeted genes.

[0036] In some such methods, each guide RNA targets a guide RNA target sequence within 200 bp upstream of the transcription start site. In some such methods, each guide RNA includes one or more adaptor-binding elements to which the chimeric adaptor protein can specifically bind. Optionally, each guide RNA includes two adaptor-binding elements to which the chimeric adaptor protein can specifically bind. Optionally, the first adaptor-binding element is within the first loop of each of the one or more guide RNAs, and the second adaptor-binding element is within the second loop of each of the one or more guide RNAs. Optionally, the adaptor-binding element includes the sequence shown in SEQ ID NO:33. In some such methods, each of the one or more guide RNAs is a single guide RNA comprising a CRISPR RNA (crRNA) portion fused to a trans-activating CRISPR RNA (tracrRNA) portion, and the first loop is a tetraloop corresponding to residues 13-16 of SEQ ID NO:17, and the second loop is stem-loop 2 corresponding to residues 53-56 of SEQ ID NO:17.

[0037] In some such methods, the plurality of unique guide RNAs are introduced into the cell population by viral transduction. Optionally, each of the plurality of unique guide RNAs is in a separate viral vector. Optionally, the plurality of unique guide RNAs are introduced into the cell population by lentiviral transduction. In some such methods, the cell population is infected at a multiplicity of infection of less than about 0.3.

[0038] In some such methods, the plurality of unique guide RNAs are introduced into the cell population together with a selection marker, and step (b) further includes selecting cells comprising the selection marker. Optionally, the selection marker confers resistance to a drug. Optionally, the selection marker confers resistance to puromycin or geneticin. Optionally, the selection marker is selected from neomycin phosphotransferase, hygromycin B phosphotransferase, puromycin-N-acetyltransferase, and blasticidin S deaminase. Optionally, the selection marker is selected from neomycin phosphotransferase, hygromycin B phosphotransferase, puromycin-N-acetyltransferase, blasticidin S deaminase, and bleomycin resistance protein.

[0039] In some such methods, the cell population into which the plurality of unique guide RNAs are introduced in step (b) includes greater than about 300 cells / unique guide RNA.

[0040] In some such methods, step (c) is from about 3 days to about 9 days. Optionally, step (c) is about 6 days.

[0041] In some such methods, step (d) includes culturing the genetically modified cell population in the presence of conditioned medium harvested from cultured tau aggregation-positive cells, wherein the tau repeat domain stably exists in an aggregated state. Optionally, the conditioned medium is harvested after about 1 day to about 7 days on confluent tau aggregation-positive cells. Optionally, the conditioned medium is harvested after about 4 days on confluent tau aggregation-positive cells. Optionally, step (d) includes culturing the genetically modified cell population in about 75% conditioned medium and about 25% fresh medium. In some such methods, the genetically modified cell population is not co-cultured with the tau aggregation-positive cells, wherein the tau repeat domain stably exists in an aggregated state.

[0042] In some such methods, step (e) is from about 2 days to about 6 days. Optionally, step (e) is about 4 days. In some such methods, the first reporter gene and the second reporter gene are a fluorescence resonance energy transfer (FRET) pair, and the aggregation-positive cell population in step (e) is identified by flow cytometry.

[0043] In some such methods, the abundance is determined by next-generation sequencing. In some such methods, if the abundance of a guide RNA in the aggregation-positive cell population in step (e) is at least 1.5-fold that in the cultured cell population in step (c) relative to the total population of the plurality of unique guide RNAs, then the guide RNA is considered enriched.

[0044] In some such methods, step (f) includes determining the abundance of each unique guide RNA among the plurality of unique guide RNAs in the aggregation-positive cell population in step (e) relative to the cultured cell population in step (c) at the first time point in step (c) and / or the second time point in step (c). Optionally, the first time point in step (c) is at the first passage of culturing the cell population, and the second time point is in the middle of culturing the cell population to allow genome editing and amplification. Optionally, the first time point in step (c) is after culturing for about three days, and the second time point in step (c) is after culturing for about six days.

[0045] In some such methods, a gene is considered to be a tau aggregation gene modifier where transcriptional activation of the gene enhances tau aggregation (or a candidate gene modifier of tau aggregation where transcriptional activation of the gene is expected to enhance tau aggregation) if: (1) at both the first time point in step (c) and the second time point in step (c), the abundance of the guide RNA targeting the gene relative to the total population of the plurality of unique guide RNAs is at least 1.5-fold in the aggregation-positive cell population in step (e) compared to the cultured cell population in step (c); and / or (2) at either the first time point in step (c) or the second time point in step (c), the abundance of at least two unique guide RNAs targeting the gene relative to the total population of the plurality of unique guide RNAs is at least 1.5-fold in the aggregation-positive cell population in step (e) compared to the cultured cell population in step (c).

[0046] In some such methods, the following steps are taken in step (f) to identify a gene as a tau aggregation gene modifier where transcriptional activation of the gene enhances tau aggregation (or a candidate gene modifier of tau aggregation where transcriptional activation of the gene is expected to enhance tau aggregation): (1) identify which of the plurality of unique guide RNAs are present in the aggregation-positive cell population generated in step (e); (2) calculate the random chance of the presence of the guide RNAs identified in step (f)(1) using the formula nCn'*(x - n')C(m - n) / xCm, where x is the variety of unique guide RNAs introduced into the cell population in step (b), where m is the variety of unique guide RNAs identified in step (f)(1), where n is the variety of unique guide RNAs targeting the gene introduced into the cell population in step (b), and where n' is the variety of unique guide RNAs targeting the gene identified in step (f)(1); (3) calculate the average enrichment score of the guide RNAs identified in step (f)(1), where the enrichment score of a guide RNA is the relative abundance of the guide RNA in the aggregation-positive cell population generated in step (e) divided by the relative abundance of the guide RNA in the cultured cell population in step (c), and where the relative abundance is the read count of the guide RNA divided by the read count of the total population of the plurality of unique guide RNAs; and (4) if the guide RNAs targeting the gene are significantly lower than the random chance of presence and higher than a threshold enrichment score, then select the gene.

[0047] On the other hand, additional methods for screening tau aggregation gene modifiers are provided. Some such methods (CRISPRn) can include: (a) providing a cell population comprising a Cas protein, a first tau repeat domain linked to a first reporter gene, and a second tau repeat domain linked to a second reporter gene; (b) introducing a library comprising a plurality of unique guide RNAs targeting a plurality of genes into the cell population; (c) culturing the cell population to allow genome editing and amplification, wherein the plurality of unique guide RNAs form a complex with the Cas protein, and the Cas protein cleaves the plurality of genes, thereby causing gene function knockout to produce a genetically modified cell population; (d) contacting the genetically modified cell population with a tau inoculum to produce an inoculated cell population; (e) culturing the inoculated cell population to allow the formation of tau aggregates, wherein aggregates of the first tau repeat domain and the second tau repeat domain form in a first subset of the inoculated cell population to produce an aggregation-positive cell population, and do not form in a second subset of the inoculated cell population to produce an aggregation-negative cell population;(f) Determine the abundance of each of the plurality of unique guide RNAs in the aggregation-positive cell population identified in step (e) relative to the aggregation-negative cell population identified in step (e) and / or the inoculated cell population in step (d), and / or determine the abundance of each of the plurality of unique guide RNAs in the aggregation-negative cell population identified in step (e) relative to the aggregation-positive cell population identified in step (e) and / or the inoculated cell population in step (d), wherein enrichment of the guide RNA in the aggregation-negative cell population identified in step (e) relative to the aggregation-positive cell population identified in step (e) and / or the inoculated cell population in step (d), or depletion of the guide RNA in the aggregation-positive cell population identified in step (e) relative to the aggregation-negative cell population identified in step (e) and / or the inoculated cell population in step (d), indicates that the gene targeted by the guide RNA is a tau aggregation gene modifier, wherein disruption of the gene targeted by the guide RNA prevents tau aggregation, or is a candidate gene modifier of tau aggregation (e.g., for further testing by secondary screening), wherein disruption of the gene targeted by the guide RNA is expected to prevent tau aggregation, and / or wherein enrichment of the guide RNA in the aggregation-positive cell population identified in step (e) relative to the aggregation-negative cell population identified in step (e) and / or the inoculated cell population in step (d), or depletion of the guide RNA in the aggregation-negative cell population identified in step (e) relative to the aggregation-positive cell population identified in step (e) and / or the inoculated cell population in step (d), indicates that the gene targeted by the guide RNA is a tau aggregation gene modifier, wherein disruption of the gene targeted by the guide RNA promotes or enhances tau aggregation, or is a candidate gene modifier of tau aggregation (e.g., for further testing by secondary screening), wherein disruption of the gene targeted by the guide RNA is expected to promote or enhance tau aggregation.;

[0048] In some such methods, the Cas protein is a Cas9 protein. Optionally, the Cas protein is Streptococcus pyogenes Cas9. In some such methods, the Cas protein comprises SEQ ID NO:21, optionally wherein the Cas protein is encoded by a coding sequence comprising the sequence shown in SEQ ID NO:22.

[0049] In some such methods, the Cas protein, the first tau repeat domain linked to the first reporter gene, and the second tau repeat domain linked to the second reporter gene are stably expressed in the cell population. In some such methods, the nucleic acids encoding the Cas protein, the first tau repeat domain linked to the first reporter gene, and the second tau repeat domain linked to the second reporter gene are genomically integrated in the cell population.

[0050] In some such methods, each guide RNA targets a constitutive exon. Optionally, each guide RNA targets a 5' constitutive exon. In some such methods, each guide RNA targets a first exon, a second exon, or a third exon.

[0051] Some such methods (CRISPRa) include: (a) providing a cell population comprising a chimeric Cas protein comprising a nuclease-inactivated Cas protein fused to one or more transcriptional activation domains, a chimeric adaptor protein comprising an adaptor protein fused to one or more transcriptional activation domains, a first tau repeat domain linked to a first reporter gene, and a second tau repeat domain linked to a second reporter gene; (b) introducing a library comprising a plurality of unique guide RNAs targeting a plurality of genes into the cell population; (c) culturing the cell population to allow transcriptional activation and amplification, wherein the plurality of unique guide RNAs form a complex with the chimeric Cas protein and the chimeric adaptor protein, and the complex activates transcription of the plurality of genes resulting in increased gene expression to produce a genetically modified cell population; (d) contacting the genetically modified cell population with a tau inoculum to produce an inoculated cell population; (e) culturing the inoculated cell population to allow formation of tau aggregates, wherein aggregates of the first tau repeat domain and the second tau repeat domain form in a first subset of the inoculated cell population to produce an aggregate-positive cell population and do not form in a second subset of the inoculated cell population to produce an aggregate-negative cell population;(f) Determine the abundance of each of the plurality of unique guide RNAs in the aggregation-positive cell population identified in step (e) relative to the aggregation-negative cell population identified in step (e) and / or the inoculated cell population in step (d), and / or determine the abundance of each of the plurality of unique guide RNAs in the aggregation-negative cell population identified in step (e) relative to the aggregation-positive cell population identified in step (e) and / or the inoculated cell population in step (d), wherein enrichment of the guide RNA in the aggregation-negative cell population identified in step (e) relative to the aggregation-positive cell population identified in step (e) and / or the inoculated cell population in step (d) or depletion of the guide RNA in the aggregation-positive cell population identified in step (e) relative to the aggregation-negative cell population identified in step (e) and / or the inoculated cell population in step (d) indicates that the gene targeted by the guide RNA is a tau aggregation gene modifier, wherein transcriptional activation of the gene targeted by the guide RNA prevents tau aggregation, or is a candidate gene modifier for tau aggregation (e.g., for further testing by secondary screening), wherein transcriptional activation of the gene targeted by the guide RNA is expected to prevent tau aggregation, and / or wherein enrichment of the guide RNA in the aggregation-positive cell population identified in step (e) relative to the aggregation-negative cell population identified in step (e) and / or the inoculated cell population in step (d) or depletion of the guide RNA in the aggregation-negative cell population identified in step (e) relative to the aggregation-positive cell population identified in step (e) and / or the inoculated cell population in step (d) indicates that the gene targeted by the guide RNA is a tau aggregation gene modifier, wherein transcriptional activation of the gene targeted by the guide RNA promotes or enhances tau aggregation, or is a candidate gene modifier for tau aggregation (e.g., for further testing by secondary screening), wherein transcriptional activation of the gene targeted by the guide RNA is expected to promote or enhance tau aggregation.;

[0052] In some such methods, the Cas protein is a Cas9 protein. Optionally, the Cas protein is Streptococcus pyogenes Cas9. In some such methods, the chimeric Cas protein comprises the nuclease-inactivated Cas protein fused to a VP64 transcriptional activation domain, optionally wherein the chimeric Cas protein comprises, from the N-terminus to the C-terminus: the nuclease-inactivated Cas protein; a nuclear localization signal; and the VP64 transcriptional activation domain. In some such methods, the adaptor protein is an MS2 coat protein, and wherein the one or more transcriptional activation domains in the chimeric adaptor protein comprise a p65 transcriptional activation domain and an HSF1 transcriptional activation domain, optionally wherein the chimeric adaptor protein comprises, from the N-terminus to the C-terminus: the MS2 coat protein; a nuclear localization signal; the p65 transcriptional activation domain; and the HSF1 transcriptional activation domain. In some such methods, the chimeric Cas protein comprises SEQ ID NO:36, optionally wherein the chimeric Cas protein is encoded by a coding sequence comprising the sequence shown in SEQ ID NO:38. In some such methods, the chimeric adaptor protein comprises SEQ ID NO:37, optionally wherein the chimeric adaptor protein is encoded by a coding sequence comprising the sequence shown in SEQ ID NO:39.

[0053] In some such methods, the chimeric Cas protein, the chimeric adaptor protein, the first tau repeat domain linked to the first reporter gene, and the second tau repeat domain linked to the second reporter gene are stably expressed in the cell population. In some such methods, the nucleic acids encoding the chimeric Cas protein, the chimeric adaptor protein, the first tau repeat domain linked to the first reporter gene, and the second tau repeat domain linked to the second reporter gene are genomically integrated in the cell population.

[0054] In some such methods, each guide RNA targets a guide RNA target sequence within 200 bp upstream of the transcription start site. In some such methods, each guide RNA includes one or more adaptor binding elements to which the chimeric adaptor protein can specifically bind. Optionally, each guide RNA includes two adaptor binding elements to which the chimeric adaptor protein can specifically bind. Optionally, the first adaptor binding element is within the first loop of each of the one or more guide RNAs, and the second adaptor binding element is within the second loop of each of the one or more guide RNAs. Optionally, the adaptor binding element includes the sequence shown in SEQ ID NO:33. Optionally, each of the one or more guide RNAs is a single guide RNA comprising a CRISPR RNA (crRNA) portion fused to a trans-activating CRISPR RNA (tracrRNA) portion, and the first loop is a tetraloop corresponding to residues 13 - 16 of SEQ ID NO:17, and the second loop is stem-loop 2 corresponding to residues 53 - 56 of SEQ ID NO:17.

[0055] In some such methods, step (c) is from about 3 days to about 13 days. In some such methods, step (c) is from about 7 days to about 10 days, is about 7 days or is about 10 days.

[0056] In some such methods, step (d) includes culturing the genetically modified cell population in the presence of a culture medium comprising a cell lysate from cultured tau aggregation-positive cells, wherein the tau repeat domain stably exists in an aggregated state. Optionally, the concentration of the cell lysate in the culture medium is from about 1 to about 5 μg / mL. In some such methods, the culture medium comprising the cell lysate further comprises liposomes or another transfection reagent. Optionally, the culture medium comprising the cell lysate comprises liposomes at a concentration of from about 1.5 to about 4 μL / mL. In some such methods, the genetically modified cell population is not co-cultured with the tau aggregation-positive cells, wherein the tau repeat domain stably exists in an aggregated state.

[0057] In some such methods, step (e) is from about 1 day to about 3 days. Optionally, step (e) is about 2 days. In some such methods, the first reporter gene and the second reporter gene are a fluorescence resonance energy transfer (FRET) pair, and the aggregated positive cell population and the aggregated negative cell population in step (e) are identified by flow cytometry. In some such methods, the abundance is determined by next-generation sequencing.

[0058] In some such methods, if the abundance of a guide RNA relative to the total population of the plurality of unique guide RNAs is at least 1.5-fold in the aggregated negative cell population in step (e) compared to the aggregated positive cell population in step (e) and / or the inoculated cell population in step (d), then the guide RNA is considered enriched in the aggregated negative cell population in step (e), and wherein if the abundance of a guide RNA relative to the total population of the plurality of unique guide RNAs is at least 1 / 1.5 in the aggregated positive cell population in step (e) compared to the aggregated negative cell population in step (e) and / or the inoculated cell population in step (d), then the guide RNA is considered depleted in the aggregated positive cell population in step (e), or wherein if the abundance of a guide RNA relative to the total population of the plurality of unique guide RNAs is at least 1.5-fold in the aggregated positive cell population in step (e) compared to the aggregated negative cell population in step (e) and / or the inoculated cell population in step (d), then the guide RNA is considered enriched in the aggregated positive cell population in step (e), and wherein if the abundance of a guide RNA relative to the total population of the plurality of unique guide RNAs is at least 1 / 1.5 in the aggregated negative cell population in step (e) compared to the aggregated positive cell population in step (e) and / or the inoculated cell population in step (d), then the guide RNA is considered depleted in the aggregated negative cell population in step (e).

[0059] In some such methods, step (f) includes determining the abundance of each unique guide RNA among the plurality of unique guide RNAs in the aggregated negative cell population in step (e) relative to the aggregated positive cell population in step (e), the cultured cell population in step (c) at a first time point, and the inoculated cell population in step (d) at a second time point, and / or wherein step (f) includes determining the abundance of each unique guide RNA among the plurality of unique guide RNAs in the aggregated positive cell population in step (e) relative to the aggregated negative cell population in step (e), the cultured cell population in step (c) at a first time point, and the inoculated cell population in step (d) at a second time point. Optionally, the first time point in step (c) is at the first passage of culturing the cell population. Optionally, the first time point in step (c) is after culturing for about 3 days, and the second time point in step (c) is after culturing for about 7 days or about 10 days.

[0060] In some such methods, a gene is considered to be a tau aggregation gene modifier if the following occurs, where disruption (CRISPRn) or transcriptional activation (CRISPRa) of the gene prevents tau aggregation (or a candidate gene modifier of tau aggregation, where disruption or transcriptional activation of the gene is expected to prevent tau aggregation): (1) the abundance of the guide RNA targeting the gene relative to the total population of the plurality of unique guide RNAs is at least 1.5 times that in the aggregation-positive cell population in step (e), the cultured cell population in step (c) at the first time point, and the seeded cell population in step (d) at the second time point in the aggregation-negative cell population; and / or (2) the abundance of the guide RNA targeting the gene relative to the total population of the plurality of unique guide RNAs is at least 1.5 times that in the aggregation-positive cell population in step (e) and the seeded cell population in step (d) at the second time point in the aggregation-negative cell population; and / or (3) the abundance of the guide RNA targeting the gene relative to the total population of the plurality of unique guide RNAs is at least 1 / 1.5 that in the aggregation-negative cell population, the cultured cell population in step (c) at the first time point, and the seeded cell population in step (d) at the second time point in the aggregation-positive cell population; and / or (4) the abundance of the guide RNA targeting the gene relative to the total population of the plurality of unique guide RNAs is at least 1 / 1.5 that in the aggregation-negative cell population and the seeded cell population in step (d) at the second time point in the aggregation-positive cell population.In some such methods, a gene is considered to be a tau aggregation gene modifier if the following occurs, where disruption (CRISPRn) or transcriptional activation (CRISPRa) of the gene promotes or enhances tau aggregation (or a candidate gene modifier of tau aggregation, where disruption or transcriptional activation of the gene is expected to promote or enhance tau aggregation): (1) the abundance of the guide RNA targeting the gene relative to the total population of the plurality of unique guide RNAs is at least 1.5 times in the aggregation-positive cell population in step (e) than in the aggregation-negative cell population in step (e), the cultured cell population in step (c) at the first time point, and the seeded cell population in step (d) at the second time point; and / or (2) the abundance of the guide RNA targeting the gene relative to the total population of the plurality of unique guide RNAs is at least 1.5 times in the aggregation-positive cell population in step (e) than in the aggregation-negative cell population in step (e) and the seeded cell population in step (d) at the second time point; and / or (3) the abundance of the guide RNA targeting the gene relative to the total population of the plurality of unique guide RNAs is at least 1 / 1.5 in the aggregation-negative cell population in step (e) than in the aggregation-positive cell population in step (e), the cultured cell population in step (c) at the first time point, and the seeded cell population in step (d) at the second time point; and / or (4) the abundance of the guide RNA targeting the gene relative to the total population of the plurality of unique guide RNAs is at least 1 / 1.5 in the aggregation-negative cell population in step (e) than in the aggregation-positive cell population in step (e) and the seeded cell population in step (d) at the second time point;.

[0061] In some such methods, the following steps are taken in step (f) to identify genes as tau aggregation gene modifiers, where disruption (CRISPRn) or transcriptional activation (CRISPRa) of the gene prevents tau aggregation (or as candidate gene modifiers of tau aggregation, where disruption (CRISPRn) or transcriptional activation (CRISPRa) of the gene is expected to prevent tau aggregation): (1) identify which of the plurality of unique guide RNAs are present in the aggregation-negative cell population generated in step (e); (2) use the formula nCn'*(x-n')C(m-n) / xCm to calculate the random chance of the guide RNAs identified in step (f)(1) being present, where x is the variety of unique guide RNAs introduced into the cell population in step (b), where m is the variety of unique guide RNAs identified in step (f)(1), where n is the variety of unique guide RNAs targeting the gene introduced into the cell population in step (b), and where n' is the variety of unique guide RNAs targeting the gene identified in step (f)(1); (3) calculate the average enrichment score of the guide RNAs identified in step (f)(1), where the enrichment score of a guide RNA is the relative abundance of the guide RNA in the aggregation-negative cell population generated in step (e) divided by the relative abundance of the guide RNA in the aggregation-positive cell population generated in step (e) or in the inoculated cell population in step (d), and where the relative abundance is the read count of the guide RNA divided by the read count of the total population of the plurality of unique guide RNAs; and (4) if the guide RNAs targeting the gene are significantly lower than the random chance of being present and higher than a threshold enrichment score, then select the gene.In some such methods, the following steps are taken in step (f) to identify genes as tau aggregation gene modifiers, where disruption (CRISPRn) or transcriptional activation (CRISPRa) of the gene promotes or enhances tau aggregation (or as candidate gene modifiers of tau aggregation, where disruption or transcriptional activation of the gene is expected to promote or enhance tau aggregation): (1) identify which of the plurality of unique guide RNAs are present in the aggregation-positive cell population generated in step (e); (2) calculate the random chance of the presence of the guide RNAs identified in step (f)(1) using the formula nCn'*(x-n')C(m-n) / xCm, where x is the variety of unique guide RNAs introduced into the cell population in step (b), where m is the variety of unique guide RNAs identified in step (f)(1), where n is the variety of unique guide RNAs targeting the gene introduced into the cell population in step (b), and where n' is the variety of unique guide RNAs targeting the gene identified in step (f)(1); (3) calculate the average enrichment score of the guide RNAs identified in step (f)(1), where the enrichment score of a guide RNA is the relative abundance of the guide RNA in the aggregation-positive cell population generated in step (e) divided by the relative abundance of the guide RNA in the aggregation-negative cell population generated in step (e) or in the inoculated cell population in step (d), and where the relative abundance is the read count of the guide RNA divided by the read count of the total population of the plurality of unique guide RNAs; and (4) if the guide RNAs targeting the gene are significantly lower than the random chance of presence and higher than a threshold enrichment score, then select the gene.

[0062] In some such methods, the first tau repeat domain and / or the second tau repeat domain are human tau repeat domains. In some such methods, the first tau repeat domain and / or the second tau repeat domain include pro-aggregation mutations. Optionally, the first tau repeat domain and / or the second tau repeat domain include the tau P301S mutation.

[0063] In some such methods, the first tau repeat domain and / or the second tau repeat domain comprises a tau four-repeat domain. In some such methods, the first tau repeat domain and / or the second tau repeat domain comprises SEQ ID NO:11. In some such methods, the first tau repeat domain and the second tau repeat domain are the same. In some such methods, the first tau repeat domain and the second tau repeat domain are the same and each comprises a tau four-repeat domain containing the tau P301S mutation.

[0064] In some such methods, the first reporter gene and the second reporter gene are fluorescent proteins. Optionally, the first reporter gene and the second reporter gene are a fluorescence resonance energy transfer (FRET) pair. Optionally, the first reporter gene is a cyan fluorescent protein (CFP), and the second reporter gene is a yellow fluorescent protein (YFP).

[0065] In some such methods, the cell is a eukaryotic cell. Optionally, the cell is a mammalian cell. Optionally, the cell is a human cell. Optionally, the cell is a HEK293T cell.

[0066] In some such methods, the plurality of unique guide RNAs are introduced at a selected concentration such that most cells receive only one of the unique guide RNAs. In some such methods, the plurality of unique guide RNAs target 100 or more genes, 1000 or more genes, or 10000 or more genes. In some such methods, the library is a genome-wide library.

[0067] In some such methods, a plurality of target sequences are targeted on average in each of the plurality of genes being targeted. Optionally, at least three target sequences are targeted on average in each of the plurality of targeted genes. Optionally, from about three to about six target sequences (e.g., about three, about four, or about six) are targeted on average in each of the plurality of targeted genes. Optionally, about three target sequences are targeted on average in each of the plurality of targeted genes.

[0068] In some such methods, the plurality of unique guide RNAs are introduced into the cell population by viral transduction. Optionally, each of the plurality of unique guide RNAs is in a separate viral vector. Optionally, the plurality of unique guide RNAs are introduced into the cell population by lentiviral transduction. In some such methods, the cell population is infected at a multiplicity of infection of less than about 0.3.

[0069] In some such methods, the plurality of unique guide RNAs are introduced into the cell population together with a selection marker, and step (b) further comprises selecting cells that comprise the selection marker. Optionally, the selection marker confers resistance to a drug. Optionally, the selection marker confers resistance to puromycin or geneticin. Optionally, the selection marker is selected from neomycin phosphotransferase, hygromycin B phosphotransferase, puromycin-N-acetyltransferase, and blasticidin S deaminase. Optionally, the selection marker is selected from neomycin phosphotransferase, hygromycin B phosphotransferase, puromycin-N-acetyltransferase, blasticidin S deaminase, and bleomycin resistance protein.

[0070] In some such methods, the cell population into which the plurality of unique guide RNAs are introduced in step (b) comprises greater than about 300 cells / unique guide RNA.

[0071] On the other hand, methods for screening genetic modifiers of tau aggregation and / or disaggregation are provided. Some such methods (CRISPRn) include: (a) providing a cell population comprising a Cas protein, a first tau repeat domain linked to a first reporter gene, and a second tau repeat domain linked to a second reporter gene, wherein the cells are tau aggregation-positive cells, and wherein the tau repeat domains are stably present in an aggregated state; (b) introducing a library of multiple unique guide RNAs targeting multiple genes into the cell population; (c) culturing the cell population to allow genome editing and amplification, wherein the multiple unique guide RNAs form a complex with the Cas protein, and the Cas protein cleaves the multiple genes, thereby resulting in gene function knockdown to produce a genetically modified cell population, and wherein the culturing produces an aggregation-positive cell population and an aggregation-negative cell population; (d) identifying the aggregation-positive cell population and the aggregation-negative cell population;(e) Determine the abundance of each of the plurality of unique guide RNAs in the aggregation-positive cell population identified in step (d) relative to the aggregation-negative cell population identified in step (d) and / or the cultured cell populations at one or more time points in step (c), and / or determine the abundance of each of the plurality of unique guide RNAs in the aggregation-negative cell population identified in step (d) relative to the aggregation-positive cell population identified in step (d) and / or the cultured cell populations at one or more time points in step (c), wherein enrichment of the guide RNA in the aggregation-negative cell population identified in step (d) relative to the aggregation-positive cell population identified in step (d) and / or the cultured cell populations at one or more time points in step (c) or depletion of the guide RNA in the aggregation-positive cell population identified in step (d) relative to the aggregation-negative cell population identified in step (d) and / or the cultured cell populations at one or more time points in step (c) indicates that the gene targeted by the guide RNA is a tau-dissociation gene modifier, wherein disruption of the gene targeted by the guide RNA promotes tau dissociation, or is a candidate gene modifier for tau dissociation (e.g., for further testing by secondary screening), wherein disruption of the gene targeted by the guide RNA is expected to promote tau dissociation, and / or wherein enrichment of the guide RNA in the aggregation-positive cell population identified in step (d) relative to the aggregation-negative cell population identified in step (d) and / or the cultured cell populations at one or more time points in step (c) or depletion of the guide RNA in the aggregation-negative cell population identified in step (d) relative to the aggregation-positive cell population identified in step (d) and / or the cultured cell populations at one or more time points in step (c) indicates that the gene targeted by the guide RNA is a tau-aggregation gene modifier, wherein disruption of the gene targeted by the guide RNA promotes or enhances tau aggregation, or is a candidate gene modifier for tau aggregation (e.g., for further testing by secondary screening), wherein disruption of the gene targeted by the guide RNA is expected to promote or enhance tau aggregation.;

[0072] In some such methods, the Cas protein is a Cas9 protein. Optionally, the Cas protein is Streptococcus pyogenes Cas9. In some such methods, the Cas protein comprises SEQ ID NO:21, optionally wherein the Cas protein is encoded by a coding sequence comprising the sequence shown in SEQ ID NO:22.

[0073] In some such methods, the Cas protein, the first tau repeat domain linked to the first reporter gene, and the second tau repeat domain linked to the second reporter gene are stably expressed in the cell population. In some such methods, the nucleic acids encoding the Cas protein, the first tau repeat domain linked to the first reporter gene, and the second tau repeat domain linked to the second reporter gene are genomically integrated in the cell population.

[0074] In some such methods, each guide RNA targets a constitutive exon. Optionally, each guide RNA targets a 5' constitutive exon. In some such methods, each guide RNA targets the first exon, the second exon, or the third exon.

[0075] Some such methods (CRISPRa) include: (a) providing a cell population that includes a chimeric Cas protein comprising a nuclease-inactivated Cas protein fused to one or more transcriptional activation domains, a chimeric adaptor protein comprising an adaptor protein fused to one or more transcriptional activation domains, a first tau repeat domain linked to a first reporter gene, and a second tau repeat domain linked to a second reporter gene, wherein the cells are tau aggregation-positive cells and wherein the tau repeat domains are stably present in an aggregated state; (b) introducing a library comprising a plurality of unique guide RNAs targeting a plurality of genes into the cell population; (c) culturing the cell population to allow transcriptional activation and amplification, wherein the plurality of unique guide RNAs form a complex with the chimeric Cas protein and the chimeric adaptor protein, and the complex activates transcription of the plurality of genes resulting in increased gene expression to produce a gene-modified cell population, and wherein the culturing produces an aggregation-positive cell population and an aggregation-negative cell population; (d) identifying the aggregation-positive cell population and the aggregation-negative cell population;(e) Determine the abundance of each of the plurality of unique guide RNAs in the aggregation-positive cell population identified in step (d) relative to the aggregation-negative cell population identified in step (d) and / or the cultured cell population at one or more time points in step (c), and / or determine the abundance of each of the plurality of unique guide RNAs in the aggregation-negative cell population identified in step (d) relative to the aggregation-positive cell population identified in step (d) and / or the cultured cell population at one or more time points in step (c), wherein enrichment of a guide RNA in the aggregation-negative cell population identified in step (d) relative to the aggregation-positive cell population identified in step (d) and / or the cultured cell population at one or more time points in step (c) or depletion of a guide RNA in the aggregation-positive cell population identified in step (d) relative to the aggregation-negative cell population identified in step (d) and / or the cultured cell population at one or more time points in step (c) indicates that the gene targeted by the guide RNA is a tau-dissociation gene modifier, wherein transcriptional activation of the gene targeted by the guide RNA promotes tau dissociation, or is a candidate gene modifier for tau dissociation (e.g., for further testing by secondary screening), wherein transcriptional activation of the gene targeted by the guide RNA is expected to promote tau dissociation, and / or wherein enrichment of a guide RNA in the aggregation-positive cell population identified in step (d) relative to the aggregation-negative cell population identified in step (d) and / or the cultured cell population at one or more time points in step (c) or depletion of a guide RNA in the aggregation-negative cell population identified in step (d) relative to the aggregation-positive cell population identified in step (d) and / or the cultured cell population at one or more time points in step (c) indicates that the gene targeted by the guide RNA is a tau-aggregation gene modifier, wherein transcriptional activation of the gene targeted by the guide RNA promotes or enhances tau aggregation, or is a candidate gene modifier for tau aggregation (e.g., for further testing by secondary screening), wherein transcriptional activation of the gene targeted by the guide RNA is expected to promote or enhance tau aggregation.;

[0076] In some such methods, the Cas protein is a Cas9 protein. Optionally, the Cas protein is Streptococcus pyogenes Cas9. In some such methods, the chimeric Cas protein comprises the nuclease-inactivated Cas protein fused to a VP64 transcriptional activation domain, optionally wherein the chimeric Cas protein comprises, from the N-terminus to the C-terminus: the nuclease-inactivated Cas protein; a nuclear localization signal; and the VP64 transcriptional activation domain. In some such methods, the adaptor protein is an MS2 coat protein, and wherein one or more transcriptional activation domains in the chimeric adaptor protein comprise a p65 transcriptional activation domain and an HSF1 transcriptional activation domain, optionally wherein the chimeric adaptor protein comprises, from the N-terminus to the C-terminus: the MS2 coat protein; a nuclear localization signal; the p65 transcriptional activation domain; and the HSF1 transcriptional activation domain. In some such methods, the chimeric Cas protein comprises SEQ ID NO:36, optionally wherein the chimeric Cas protein is encoded by a coding sequence comprising the sequence shown in SEQ ID NO:38. In some such methods, the chimeric adaptor protein comprises SEQ ID NO:37, optionally wherein the chimeric adaptor protein is encoded by a coding sequence comprising the sequence shown in SEQ ID NO:39.

[0077] In some such methods, the chimeric Cas protein, the chimeric adaptor protein, the first tau repeat domain linked to the first reporter gene, and the second tau repeat domain linked to the second reporter gene are stably expressed in the cell population. In some such methods, the nucleic acids encoding the chimeric Cas protein, the chimeric adaptor protein, the first tau repeat domain linked to the first reporter gene, and the second tau repeat domain linked to the second reporter gene are genomically integrated in the cell population.

[0078] In some such methods, each guide RNA targets a guide RNA target sequence within 200 bp upstream of the transcription start site. In some such methods, each guide RNA comprises one or more adaptor binding elements to which the chimeric adaptor protein can specifically bind. Optionally, each guide RNA comprises two adaptor binding elements to which the chimeric adaptor protein can specifically bind. Optionally, the first adaptor binding element is within the first loop of each of the one or more guide RNAs, and the second adaptor binding element is within the second loop of each of the one or more guide RNAs. Optionally, the adaptor binding element comprises the sequence shown in SEQ ID NO:33. Optionally, each of the one or more guide RNAs is a single guide RNA comprising a CRISPR RNA (crRNA) portion fused to a trans-activating CRISPR RNA (tracrRNA) portion, and the first loop is a four-loop corresponding to residues 13-16 of SEQ ID NO:17, and the second loop is a stem-loop 2 corresponding to residues 53-56 of SEQ ID NO:17.

[0079] In some such methods, step (c) is from about 3 days to about 14 days. Optionally, step (c) is from about 10 days to about 14 days or from about 12 days to about 14 days.

[0080] In some such methods, step (d) comprises synchronizing cell cycle progression to obtain a cell population that is predominantly enriched in the S phase. Optionally, the synchronization is achieved by double thymidine block.

[0081] In some such methods, the first reporter gene and the second reporter gene are a fluorescence resonance energy transfer (FRET) pair, and the aggregated positive cell population and the aggregated negative cell population in step (d) are identified by flow cytometry. In some such methods, the abundance is determined by next-generation sequencing.

[0082] In some such methods, if the abundance of a guide RNA relative to the total population of the plurality of unique guide RNAs is at least 1.5-fold in the aggregated negative cell population in step (d) compared to the aggregated positive cell population in step (d) and / or the cultured cell population at one or more time points in step (c), then the guide RNA is considered enriched in the aggregated negative cell population in step (d), and wherein if the abundance of a guide RNA relative to the total population of the plurality of unique guide RNAs is at least 1 / 1.5 in the aggregated positive cell population in step (d) compared to the aggregated negative cell population in step (d) and / or the cultured cell population at one or more time points in step (c), then the guide RNA is considered depleted in the aggregated positive cell population in step (d), or wherein if the abundance of a guide RNA relative to the total population of the plurality of unique guide RNAs is at least 1.5-fold in the aggregated positive cell population in step (d) compared to the aggregated negative cell population in step (d) and / or the cultured cell population at one or more time points in step (c), then the guide RNA is considered enriched in the aggregated positive cell population in step (d), and wherein if the abundance of a guide RNA relative to the total population of the plurality of unique guide RNAs is at least 1 / 1.5 in the aggregated negative cell population in step (d) compared to the aggregated positive cell population in step (d) and / or the cultured cell population at one or more time points in step (c), then the guide RNA is considered depleted in the aggregated negative cell population in step (d).

[0083] In some such methods, step (e) includes determining the abundance of each unique guide RNA of the plurality of unique guide RNAs in the aggregated negative cell population in step (d) relative to the aggregated positive cell population in step (d), the cultured cell population in step (c) at a first time point, and the cultured cell population in step (c) at a second time point, and / or wherein step (e) includes determining the abundance of each unique guide RNA of the plurality of unique guide RNAs in the aggregated positive cell population in step (d) relative to the aggregated negative cell population in step (e), the cultured cell population in step (c) at a first time point, and the cultured cell population in step (c) at a second time point. Optionally, the first time point in step (c) is at the first passage of culturing the cell population, and the second time point is in the middle of culturing the cell population to allow genome editing and amplification or transcriptional activation and amplification. Optionally, the first time point in step (c) is after culturing for about 7 days, and the second time point in step (c) is after culturing for about 10 days.

[0084] In some such methods, a gene is considered to be a tau depolymerization gene modifier if the following occurs, where disruption (CRISPRn) or transcriptional activation (CRISPRa) of the gene promotes tau depolymerization (or a candidate gene modifier of tau depolymerization, where disruption or transcriptional activation of the gene is expected to promote tau depolymerization): (1) the abundance of the guide RNA targeting the gene relative to the total population of the plurality of unique guide RNAs is at least 1.5-fold in the aggregation-negative cell population in step (d) compared to the aggregation-positive cell population in step (d), the cultured cell population in step (c) at the first time point, and the cultured cell population in step (c) at the second time point; and / or (2) the abundance of the guide RNA targeting the gene relative to the total population of the plurality of unique guide RNAs is at least 1.5-fold in the aggregation-negative cell population in step (d) compared to the aggregation-positive cell population in step (d) and the cultured cell population in step (c) at the second time point; and / or (3) the abundance of the guide RNA targeting the gene relative to the total population of the plurality of unique guide RNAs is at least 1 / 1.5 in the aggregation-positive cell population in step (d) compared to the aggregation-negative cell population in step (d), the cultured cell population in step (c) at the first time point, and the cultured cell population in step (c) at the second time point; and / or (4) the abundance of the guide RNA targeting the gene relative to the total population of the plurality of unique guide RNAs is at least 1 / 1.5 in the aggregation-positive cell population in step (d) compared to the aggregation-negative cell population in step (d) and the cultured cell population in step (c) at the second time point.In some such methods, a gene is considered to be a tau aggregation gene modifier if the following occurs, where disruption (CRISPRn) or transcriptional activation (CRISPRa) of the gene promotes or enhances tau aggregation (or a candidate gene modifier of tau aggregation, where disruption or transcriptional activation of the gene is expected to promote or enhance tau aggregation): (1) the abundance of the guide RNA targeting the gene relative to the total population of the plurality of unique guide RNAs is at least 1.5-fold in the aggregation-positive cell population in step (d) compared to the aggregation-negative cell population in step (d), the cultured cell population in step (c) at the first time point, and the cultured cell population in step (c) at the second time point; and / or (2) the abundance of the guide RNA targeting the gene relative to the total population of the plurality of unique guide RNAs is at least 1.5-fold in the aggregation-positive cell population in step (d) compared to the aggregation-negative cell population in step (d) and the cultured cell population in step (c) at the second time point; and / or (3) the abundance of the guide RNA targeting the gene relative to the total population of the plurality of unique guide RNAs is at least 1 / 1.5 in the aggregation-negative cell population in step (d) compared to the aggregation-positive cell population in step (d), the cultured cell population in step (c) at the first time point, and the cultured cell population in step (c) at the second time point; and / or (4) the abundance of the guide RNA targeting the gene relative to the total population of the plurality of unique guide RNAs is at least 1 / 1.5 in the aggregation-negative cell population in step (d) compared to the aggregation-positive cell population in step (d) and the cultured cell population in step (c) at the second time point.

[0085] In some such methods, the following steps are taken in step (e) to identify genes that act as tau depolymerization gene modifiers, where disruption (CRISPRn) or transcriptional activation (CRISPRa) of the gene promotes tau depolymerization (or as candidate gene modifiers of tau depolymerization, where disruption or transcriptional activation of the gene is expected to promote tau depolymerization): (1) identify which of the plurality of unique guide RNAs are present in the aggregation-negative cell population identified in step (d); (2) use the formula nCn'*(x-n')C(m-n) / xCm to calculate the random chance of the presence of the guide RNAs identified in step (e)(1), where x is the variety of unique guide RNAs introduced into the cell population in step (b), where m is the variety of unique guide RNAs identified in step (e)(1), where n is the variety of unique guide RNAs targeting the gene introduced into the cell population in step (b), and where n' is the variety of unique guide RNAs targeting the gene identified in step (e)(1); (3) calculate the average enrichment score of the guide RNAs identified in step (e)(1), where the enrichment score of a guide RNA is the relative abundance of the guide RNA in the aggregation-negative cell population identified in step (d) divided by the relative abundance of the guide RNA in the aggregation-positive cell population identified in step (d) or in the cultured cell population in step (c) at the first or second time point, and where the relative abundance is the read count of the guide RNA divided by the read count of the total population of the plurality of unique guide RNAs; and (4) if the guide RNAs targeting the gene are significantly lower than the random chance of presence and higher than a threshold enrichment score, then select the gene.In some such methods, the following steps are taken in step (e) to identify genes as tau aggregation gene modifiers, where disruption (CRISPRn) or transcriptional activation (CRISPRa) of the gene promotes or enhances tau aggregation (or a candidate gene modifier of tau aggregation, where disruption or transcriptional activation of the gene is expected to promote or enhance tau aggregation): (1) identify which of the plurality of unique guide RNAs are present in the aggregation-positive cell population identified in step (d); (2) calculate the random chance of the presence of the guide RNAs identified in step (e)(1) using the formula nCn'*(x - n')C(m - n) / xCm, where x is the variety of unique guide RNAs introduced into the cell population in step (b), where m is the variety of unique guide RNAs identified in step (e)(1), where n is the variety of unique guide RNAs targeting the gene introduced into the cell population in step (b), and where n' is the variety of unique guide RNAs targeting the gene identified in step (e)(1); (3) calculate the average enrichment score of the guide RNAs identified in step (e)(1), where the enrichment score of a guide RNA is the relative abundance of the guide RNA in the aggregation-positive cell population identified in step (d) divided by the relative abundance of the guide RNA in the aggregation-negative cell population identified in step (d) or in the cultured cell population in step (c) at the first time point or the second time point, and where the relative abundance is the read count of the guide RNA divided by the read count of the total population of the plurality of unique guide RNAs; and (4) if the guide RNAs targeting the gene are significantly lower than the random chance of presence and higher than a threshold enrichment score, then select the gene.

[0086] In some such methods, the first tau repeat domain and / or the second tau repeat domain are human tau repeat domains. In some such methods, the first tau repeat domain and / or the second tau repeat domain comprise pro-aggregation mutations. Optionally, the first tau repeat domain and / or the second tau repeat domain comprise the tau P301S mutation.

[0087] In some such methods, the first tau repeat domain and / or the second tau repeat domain comprises a tau four-repeat domain. In some such methods, the first tau repeat domain and / or the second tau repeat domain comprises SEQ ID NO:11. In some such methods, the first tau repeat domain and the second tau repeat domain are the same. In some such methods, the first tau repeat domain and the second tau repeat domain are the same and each comprises a tau four-repeat domain containing the tau P301S mutation.

[0088] In some such methods, the first reporter gene and the second reporter gene are fluorescent proteins. Optionally, the first reporter gene and the second reporter gene are a fluorescence resonance energy transfer (FRET) pair. Optionally, the first reporter gene is cyan fluorescent protein (CFP), and the second reporter gene is yellow fluorescent protein (YFP).

[0089] In some such methods, the cell is a eukaryotic cell. Optionally, the cell is a mammalian cell. Optionally, the cell is a human cell. Optionally, the cell is a HEK293T cell.

[0090] In some such methods, the plurality of unique guide RNAs are introduced at a selected concentration such that most cells receive only one of the unique guide RNAs. In some such methods, the plurality of unique guide RNAs target 100 or more genes, 1000 or more genes, or 10000 or more genes. In some such methods, the library is a genome-wide library.

[0091] In some such methods, a plurality of target sequences are targeted on average in each of the plurality of genes being targeted. Optionally, at least three target sequences are targeted on average in each of the plurality of targeted genes. Optionally, from about three to about six target sequences (e.g., about three, about four, or about six) are targeted on average in each of the plurality of targeted genes. Optionally, about three target sequences are targeted on average in each of the plurality of targeted genes.

[0092] In some such methods, the plurality of unique guide RNAs are introduced into the cell population by viral transduction. Optionally, each of the plurality of unique guide RNAs is in a separate viral vector. Optionally, the plurality of unique guide RNAs are introduced into the cell population by lentiviral transduction. In some such methods, the cell population is infected at a multiplicity of infection of less than about 0.3.

[0093] In some such methods, the plurality of unique guide RNAs are introduced into the cell population together with a selection marker, and step (b) further comprises selecting cells that comprise the selection marker. Optionally, the selection marker confers resistance to a drug. Optionally, the selection marker confers resistance to puromycin or geneticin. Optionally, the selection marker is selected from neomycin phosphotransferase, hygromycin B phosphotransferase, puromycin-N-acetyltransferase, and blasticidin S deaminase. Optionally, the selection marker is selected from neomycin phosphotransferase, hygromycin B phosphotransferase, puromycin-N-acetyltransferase, blasticidin S deaminase, and bleomycin resistance protein.

[0094] In some such methods, the cell population into which the plurality of unique guide RNAs are introduced in step (b) comprises greater than about 300 cells / unique guide RNA.

[0095] On the other hand, provided are Cas-tau biosensor cells or a population of such cells. Some such cells comprise a population of one or more cells, the cell population comprising a Cas protein, a first tau repeat domain linked to a first reporter gene, and a second tau repeat domain linked to a second reporter gene.

[0096] In some such cells, the first tau repeat domain and / or the second tau repeat domain is a human tau repeat domain. In some such cells, the first tau repeat domain and / or the second tau repeat domain comprises an aggregation-promoting mutation. Optionally, the first tau repeat domain and / or the second tau repeat domain comprises a tau P301S mutation.

[0097] In some such cells, the first tau repeat domain and / or the second tau repeat domain comprises a tau four-repeat domain. In some such cells, the first tau repeat domain and / or the second tau repeat domain comprises SEQ ID NO:11. In some such cells, the first tau repeat domain and the second tau repeat domain are the same. In some such cells, the first tau repeat domain and the second tau repeat domain are the same and each comprises a tau four-repeat domain comprising a tau P301S mutation.

[0098] In some such cells, the first reporter gene and the second reporter gene are fluorescent proteins. Optionally, the first reporter gene and the second reporter gene are a fluorescence resonance energy transfer (FRET) pair. Optionally, the first reporter gene is cyan fluorescent protein (CFP), and the second reporter gene is yellow fluorescent protein (YFP).

[0099] In some such cells, the Cas protein is a Cas9 protein. Optionally, the Cas protein is Streptococcus pyogenes Cas9. Optionally, the Cas protein comprises SEQ ID NO:21. Optionally, the Cas protein is encoded by a coding sequence comprising the sequence shown in SEQ ID NO:22.

[0100] In some such cells, the Cas protein, the first tau repeat domain linked to the first reporter gene, and the second tau repeat domain linked to the second reporter gene are stably expressed in the cell. In some such cells, the nucleic acids encoding the Cas protein, the first tau repeat domain linked to the first reporter gene, and the second tau repeat domain linked to the second reporter gene are genomically integrated in the cell.

[0101] In some such cells, the cell is a eukaryotic cell. Optionally, the cell is a mammalian cell. Optionally, the cell is a human cell. Optionally, the cell is a HEK293T cell. Some such cells are in vitro.

[0102] In some such cells, the first tau repeat domain linked to the first reporter gene and the second tau repeat domain linked to the second reporter gene do not stably exist in an aggregated state. In some such cells, the first tau repeat domain linked to the first reporter gene and the second tau repeat domain linked to the second reporter gene stably exist in an aggregated state.

[0103] On the other hand, an in vitro culture of Cas-tau biosensor cells and conditioned medium is provided. Some such in vitro cultures comprise any cell population from the cell populations described above or elsewhere herein and conditioned medium collected from cultured tau aggregation-positive cells, wherein the tau repeat domain stably exists in an aggregated state.

[0104] In some such in vitro cultures, the conditioned medium is collected after being on confluent tau aggregation-positive cells for about 1 day to about 7 days. Optionally, the conditioned medium is collected after being on confluent tau aggregation-positive cells for about 4 days.

[0105] In some such in vitro cultures, the medium comprises about 75% conditioned medium and about 25% fresh medium. In some such in vitro cultures, the cell population is not co-cultured with the cultured tau aggregation-positive cells, wherein the tau repeat domain stably exists in an aggregated state.

[0106] On the other hand, SAM-tau biosensor cells or populations of such cells are provided. Some such cells include a population of one or more cells, the cell population including a chimeric Cas protein comprising a nuclease-inactivated Cas protein fused to one or more transcriptional activation domains, a chimeric adaptor protein comprising an adaptor protein fused to one or more transcriptional activation domains, a first tau repeat domain linked to the first reporter gene, and a second tau repeat domain linked to the second reporter gene.

[0107] In some such cells, the first tau repeat domain and / or the second tau repeat domain is a human tau repeat domain. In some such cells, the first tau repeat domain and / or the second tau repeat domain includes an aggregation-promoting mutation. Optionally, the first tau repeat domain and / or the second tau repeat domain includes the tau P301S mutation.

[0108] In some such cells, the first tau repeat domain and / or the second tau repeat domain includes a tau four-repeat domain. In some such cells, the first tau repeat domain and / or the second tau repeat domain includes SEQ ID NO:11. In some such cells, the first tau repeat domain and the second tau repeat domain are the same. In some such cells, the first tau repeat domain and the second tau repeat domain are the same and each includes a tau four-repeat domain comprising the tau P301S mutation.

[0109] In some such cells, the first reporter gene and the second reporter gene are fluorescent proteins. Optionally, the first reporter gene and the second reporter gene are a fluorescence resonance energy transfer (FRET) pair. Optionally, the first reporter gene is cyan fluorescent protein (CFP), and the second reporter gene is yellow fluorescent protein (YFP).

[0110] In some such cells, the Cas protein is a Cas9 protein. Optionally, the Cas protein is Streptococcus pyogenes Cas9. In some such cells, the chimeric Cas protein comprises the nuclease-inactivated Cas protein fused to a VP64 transcriptional activation domain, optionally wherein the chimeric Cas protein comprises, from the N-terminus to the C-terminus: the nuclease-inactivated Cas protein; a nuclear localization signal; and the VP64 transcriptional activation domain. In some such cells, the adaptor protein is an MS2 coat protein, and wherein one or more transcriptional activation domains in the chimeric adaptor protein comprise a p65 transcriptional activation domain and an HSF1 transcriptional activation domain, optionally wherein the chimeric adaptor protein comprises, from the N-terminus to the C-terminus: the MS2 coat protein; a nuclear localization signal; the p65 transcriptional activation domain; and the HSF1 transcriptional activation domain. In some such cells, the chimeric Cas protein comprises SEQ ID NO:36, optionally wherein the chimeric Cas protein is encoded by a coding sequence comprising the sequence shown in SEQ ID NO:38. In some such cells, the chimeric adaptor protein comprises SEQ ID NO:37, optionally wherein the chimeric adaptor protein is encoded by a coding sequence comprising the sequence shown in SEQ ID NO:39.

[0111] In some such cells, the chimeric Cas protein, the chimeric adaptor protein, the first tau repeat domain linked to the first reporter gene, and the second tau repeat domain linked to the second reporter gene are stably expressed in the cell. In some such cells, the nucleic acids encoding the chimeric Cas protein, the chimeric adaptor protein, the first tau repeat domain linked to the first reporter gene, and the second tau repeat domain linked to the second reporter gene are genomically integrated in the cell.

[0112] In some such cells, the cell is a eukaryotic cell. Optionally, the cell is a mammalian cell. Optionally, the cell is a human cell. Optionally, the cell is a HEK293T cell. Some such cells are in vitro.

[0113] In some such cells, the first tau repeat domain linked to the first reporter gene and the second tau repeat domain linked to the second reporter gene do not stably exist in an aggregated state. In some such cells, the first tau repeat domain linked to the first reporter gene and the second tau repeat domain linked to the second reporter gene stably exist in an aggregated state.

[0114] On the other hand, in vitro cultures of SAM-tau biosensor cells and conditioned media are provided. Some such in vitro cultures include any cell population among the cell populations described above or elsewhere herein and conditioned media collected from cultured tau aggregation-positive cells, wherein the tau repeat domain stably exists in an aggregated state.

[0115] In some such in vitro cultures, the conditioned media are collected after being on confluent tau aggregation-positive cells for about 1 day to about 7 days. Optionally, the conditioned media are collected after being on confluent tau aggregation-positive cells for about 4 days.

[0116] In some such in vitro cultures, the media include about 75% conditioned media and about 25% fresh media. In some such in vitro cultures, the cell population is not co-cultured with the cultured tau aggregation-positive cells, wherein the tau repeat domain stably exists in an aggregated state.

[0117] On the other hand, in vitro cultures of Cas-tau biosensor cells or SAM-tau biosensor cells and media including cell lysates from cultured tau aggregation-positive cells are provided, wherein the tau repeat domain stably exists in an aggregated state. Some such in vitro cultures include any cell population among the cell populations described above or elsewhere herein.

[0118] In some such in vitro cultures, the concentration of the cell lysate in the media is about 1 to about 5 μg / mL. In some such in vitro cultures, the media including the cell lysate further include liposomes or another transfection reagent. Optionally, the media including the cell lysate include liposomes at a concentration of about 1.5 to about 4 μL / mL. In some such in vitro cultures, the cell lysate is produced by sonication of the tau aggregation-positive cells for about 2 minutes to about 4 minutes after collecting the cells in a buffer including protease inhibitors.

[0119] On the other hand, methods for producing conditioned media for inducing or sensitizing tau aggregation are provided. Some such methods include: (a) providing a cell population of tau aggregation-positive cells, wherein the tau repeat domain stably exists in an aggregated state; (b) culturing the cell population of tau aggregation-positive cells in a medium to produce conditioned media; and (c) collecting the conditioned media.

[0120] In some such methods, the tau aggregation-positive cells are cultured to confluence in step (b). Optionally, the conditioned medium is harvested in step (c) after being incubated on the confluent tau aggregation-positive cells for about 1 day to about 7 days. Optionally, the conditioned medium is harvested in step (c) after being incubated on the confluent tau aggregation-positive cells for about 4 days.

[0121] On the other hand, methods for generating a population of tau aggregation-positive cells are provided. Some such methods include: (a) generating a conditioned medium for inducing tau aggregation according to any of the methods described above or elsewhere herein; and (b) culturing a population of cells comprising a protein containing a tau repeat domain in a medium comprising the conditioned medium to generate the population of tau aggregation-positive cells.

[0122] In some such methods, the medium comprises about 75% conditioned medium and about 25% fresh medium. In some such methods, the population of cells is not co-cultured with the tau aggregation-positive cells used in the method for generating the conditioned medium.

[0123] In some such methods, the tau repeat domain comprises an aggregation-promoting mutation. In some such methods, the tau repeat domain comprises the tau P301S mutation. In some such methods, the tau repeat domain comprises the tau four-repeat domain. In some such methods, the tau repeat domain comprises SEQ ID NO:11.

[0124] On the other hand, methods for generating a medium for inducing tau aggregation comprising a cell lysate from cultured tau aggregation-positive cells are provided. Some such methods include: (a) providing a population of tau aggregation-positive cells in which the tau repeat domain stably exists in an aggregated state; (b) harvesting the tau aggregation-positive cells in a buffer comprising a protease inhibitor; (c) sonicating the tau aggregation-positive cells for about 2 minutes to about 4 minutes to generate the cell lysate; and (d) adding the cell lysate to a growth medium.

[0125] In some such methods, the concentration of the cell lysate in the growth medium is about 1 to about 5 μg / mL. Some such methods further include adding a liposome or another transfection reagent to the growth medium in step (d). Optionally, step (d) includes adding liposomes at a concentration of about 1.5 to about 4 μL / mL.

[0126] On the other hand, methods for generating a tau aggregation-positive cell population are provided. Some such methods include: (a) generating a culture medium comprising a cell lysate from cultured tau aggregation-positive cells according to any of the methods described above; and (b) culturing a cell population comprising a protein comprising a tau repeat domain in a culture medium comprising a cell lysate from cultured tau aggregation-positive cells.

[0127] In some such methods, the cell population is not co-cultured with the tau aggregation-positive cells used in the method for generating the conditioned medium.

[0128] In some such methods, the tau repeat domain comprises an aggregation-promoting mutation. In some such methods, the tau repeat domain comprises the tau P301S mutation. In some such methods, the tau repeat domain comprises the tau four-repeat domain. In some such methods, the tau repeat domain comprises SEQ ID NO:11. BRIEF DESCRIPTION OF THE DRAWINGS

[0129] Figure 1 (not drawn to scale) shows a schematic diagram of the tau isoform 2N4R. The tau biosensor line contains only tau4RD-YFP and tau4RD-CFP as transgenes, rather than the full 2N4R.

[0130] Figure 2 Shows a schematic diagram of how aggregate formation can be monitored in a tau biosensor cell line by fluorescence resonance energy transfer (FRET). tau 4RD -CFP protein is excited by violet light and emits blue light. tau 4RD -YFP fusion protein is excited by blue light and emits yellow light. If there is no aggregation, then excitation by violet light will not result in FRET. If there is tau aggregation, then excitation by violet light will result in FRET and yellow light emission.

[0131] Figure 3A Shows the relative Cas9 mRNA expression in tau 4RD -CFP / tau 4RD -YFP (TCY) biosensor cell clones transduced with a lentiviral Cas9 expression construct, where the clone Cas9H1 is a previously isolated control that performed poorly relative to the TCY clone with respect to Cas9 expression.

[0132] Figure 3B Shows the cleavage efficiency at the PERK locus and the SNCA locus in Cas9 TCY clones three and seven days after transduction with sgRNAs targeting PERK and SNCA, respectively.

[0133] Figure 4 Shows a schematic diagram of a strategy for disrupting target genes in Cas9 TCY biosensor cells using a genome-wide CRISPR / Cas9 sgRNA library.

[0134] Figure 5 Is a diagram showing that when seeding tau 4RD fibrils into tau 4RD -YFP cells, a schematic of the derivation of tau 4RD -YFP Agg[+] subclones containing stably propagated tau aggregates. Also shown are fluorescence microscopy images of subclones with tau aggregates.

[0135] Figure 6 Is a diagram showing that conditioned medium collected three days after seeding on confluent cells from tau 4RD -YFP Agg[+] subclones can provide a source of tau aggregation activity, while medium from tau 4RD -YFP Agg[-] subclones cannot. The conditioned medium is applied to recipient cells in the form of 75% conditioned medium and 25% fresh medium. Each shows fluorescence-activated cell sorting (FACS) analysis images. The x-axis shows CFP (excitation by 405 nm laser), and the y-axis shows FRET (excitation from CFP emission). The upper right quadrant is FRET[+], the lower right quadrant is CFP[+], and the lower left quadrant is double negative.

[0136] Figure 7 Is a schematic diagram of a genome-wide CRISPR nuclease (CRISPRn) screening strategy for identifying modifier genes that promote tau aggregation.

[0137] Figure 8 Is a schematic diagram showing the concepts of abundance and enrichment for next-generation sequencing (NGS) analysis using genome-wide CRISPRn screening.

[0138] Figure 9 Shows a schematic diagram of secondary screening of target genes 1 - 14 identified in a genome-wide screen for modifier genes that promote tau aggregation.

[0139] Figure 10 Is a graph showing that tau aggregation conditioned medium induces FRET in Cas9 TCY biosensor cells transduced with lentiviral expression constructs of sgRNAs targeting target genes 1 - 14. Secondary screening confirmed that target genes 2 and 8 regulate cellular sensitivity to tau seeding / aggregation.

[0140] Figure 11Shown are FACS analysis images of Cas9 TCY biosensor cells transduced with lentiviral expression constructs of target gene 2 gRNA1, target gene 8 gRNA5, non-targeting gRNA, and no gRNA. The cells were cultured in conditioned medium or fresh medium. The x-axis shows CFP (excitation with 405 nm laser), and the y-axis shows FRET (excitation from CFP emission). The upper right quadrant is FRET[+], the lower right quadrant is CFP[+], and the lower left quadrant is double negative. Disruption of target gene 2 or 8 increases the formation of tau aggregates in response to tau-aggregating conditioned medium rather than fresh medium.

[0141] Figure 12 Shown is a schematic of secondary screening (including mRNA expression analysis, protein expression analysis, and FRET analysis) in Cas9 TCY biosensor cells transduced with lentiviral expression constructs of sgRNAs targeting target genes 2 and 8. Two sgRNAs were used against target gene 2 (g1 and g3), one sgRNA was used against target gene 8 (g5), and non-targeting sgRNA (g3) was used as a non-targeting control.

[0142] Figure 13 Shown is the relative expression of target gene 2 and target gene 8 in Cas9 TCY biosensor cells as evaluated by qRT-PCR on day 6 after transduction with lentiviral sgRNA expression constructs.

[0143] Figure 14 Shown is the expression of protein 2 (encoded by target gene 2) and protein 8 (encoded by target gene 8) in Cas9 TCY biosensor cells as evaluated by Western blot on day 13 after transduction with lentiviral sgRNA expression constructs.

[0144] Figure 15 Shown is tau aggregation measured by the percentage of FRET[+] cells in Cas9 TCY biosensor cells on day 10 after transduction with lentiviral sgRNA expression constructs. Lipofectamine was not used.

[0145] Figure 16 Shown is the expression of target gene 2 and target gene 8 in knockdown Cas9 TCY cell clones as evaluated by Western blot.

[0146] Figure 17 Shown is the expression of tau aggregation in target gene 2 and target gene 8 knockdown Cas9 TCY cell clones as evaluated by FRET.

[0147] Figure 18Shows the expression of target gene 2 and target gene 8 in Cas9 TCY cell clones with knockdown as evaluated by Western blot and the phosphorylation of tau at positions S262 and S356 in those clones as evaluated by Western blot.

[0148] Figure 19 Shows that whole cell lysates from tau-YFP Agg[+] clone 18 can induce tau aggregation and FRET signals in tau biosensor cells. Different amounts of whole cell lysates were tested, and different sonication conditions used for generating the lysates were tested.

[0149] Figure 20 Shows that whole cell lysates from tau-YFP Agg[+] clone 18 can induce tau aggregation and FRET signals in tau biosensor cells. Different amounts of whole cell lysates were tested, and different amounts of liposomes were tested.

[0150] Figure 21 Shows that whole cell lysates from tau-YFP Agg[+] clone 18 can induce tau aggregation and FRET signals in tau biosensor cells, but whole cell lysates from Agg[-] clones cannot. Different amounts of whole cell lysates were tested, and different amounts of liposomes were tested.

[0151] Figure 22 Shows a schematic diagram of a genome-wide CRISPR nuclease (CRISPRn) screening strategy for identifying modified genes that prevent tau aggregation.

[0152] Figure 23 Is a figure showing the identification of genes with uniquely enriched sgRNAs in FRET[-] samples.

[0153] Figure 24 Is a figure showing the identification of genes with uniquely depleted sgRNAs in FRET[-] samples.

[0154] Figure 25 Shows a schematic diagram of a secondary screening strategy for confirming the identified modified genes that prevent tau aggregation.

[0155] Figure 26 Shows a schematic diagram of a genome-wide CRISPR activation (CRISPRa) screening strategy for identifying modified genes that prevent tau aggregation.

[0156] Figure 27 Shows a schematic diagram of a genome-wide CRISPR nuclease (CRISPRn) screening strategy for identifying modified genes that promote tau disassembly.

[0157] Figure 28 Gating for sorting Agg[+], speckle[+], and Agg[-] cell populations is shown.

[0158] Figure 29 A schematic of the thymidine block strategy used in a genome-wide CRISPR nuclease (CRISPRn) screen for identifying modifier genes that promote tau depolymerization is shown.

[0159] Definitions

[0160] The terms “protein,” “polypeptide,” and “peptide,” which may be used interchangeably herein, include amino acids in polymeric form of any length, including coded and non-coded amino acids, as well as amino acids modified chemically or biochemically or derived chemically or biochemically. These terms also include polymers that have been modified, such as polypeptides having a modified peptide backbone. The term “domain” refers to any portion of a protein or polypeptide that has a specific function or structure.

[0161] A protein is considered to have an “N-terminus” and a “C-terminus.” The term “N-terminus” refers to the beginning of a protein or polypeptide, which terminates at an amino acid having a free amine group (-NH2). The term “C-terminus” refers to the end of an amino acid chain (protein or polypeptide), which terminates at a free carboxyl group (-COOH).

[0162] The terms “nucleic acid” and “polynucleotide,” which may be used interchangeably herein, include nucleotides in polymeric form of any length, including ribonucleotides, deoxyribonucleotides, or analogs or modified versions thereof. The nucleotides include single-stranded, double-stranded, and multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, and polymers comprising purine bases, pyrimidine bases, or other natural, chemically modified, biochemically modified, unnatural, or derived nucleobases.

[0163] A nucleic acid is considered to have a “5'-end” and a “3'-end” because nucleotides react to form oligonucleotides in such a way that the 5'-phosphate of one pentose ring of a nucleotide is linked to the 3'-oxygen of an adjacent pentose ring of a nucleotide in one direction. If the 5'-phosphate of an oligonucleotide is not linked to the 3'-oxygen of a pentose ring of a nucleotide, then the end of the oligonucleotide is called the “5'-end.” If the 3'-oxygen of an oligonucleotide is not linked to the 5'-phosphate of another pentose ring of a nucleotide, then the end of the oligonucleotide is called the “3'-end.” Even if a nucleic acid sequence is internal to a larger oligonucleotide, the nucleic acid sequence can be considered to have a 5'-end and a 3'-end. In a linear or circular DNA molecule, discrete elements are referred to as “downstream” or 3'- or “upstream” or 5'- of an element.

[0164] The term "genomically integrated" refers to a nucleic acid that has been introduced into a cell such that the nucleotide sequence is integrated into the genome of the cell. Any protocol can be used to stably incorporate the nucleic acid into the genome of the cell.

[0165] The term "targeting vector" refers to a recombinant nucleic acid that can be introduced into a target location in the genome of a cell by homologous recombination, ligation mediated by non-homologous end joining, or any other recombination means.

[0166] The term "viral vector" refers to a recombinant nucleic acid that contains at least one element of viral origin and contains elements sufficient or allowing packaging into viral vector particles. The vector and / or particle can be used for the purpose of transferring DNA, RNA, or other nucleic acids into cells in vitro or in vivo. Multiple forms of viral vectors are known.

[0167] The term "wild-type" encompasses an entity having a structure and / or activity found in the normal (as compared to mutant, diseased, altered, etc.) state or situation. Wild-type genes and polypeptides typically exist in multiple different forms (e.g., alleles).

[0168] The term "endogenous sequence" refers to a nucleic acid sequence that naturally occurs within a cell or organism. For example, the endogenous MAPT sequence of a cell or organism refers to the native MAPT sequence at the MAPT locus that naturally occurs within the cell or organism.

[0169] "Exogenous" molecules or sequences encompass molecules or sequences that do not normally exist in the cell in the stated form. Normal existence encompasses existence with respect to a particular developmental stage and environmental conditions of the cell. For example, an exogenous molecule or sequence can contain a mutant version of the corresponding endogenous sequence within the cell (such as a humanized version of the endogenous sequence), or can contain a sequence corresponding to the endogenous sequence within the cell but in a different form (i.e., not within the chromosome). In contrast, an endogenous molecule or sequence encompasses a molecule or sequence that normally exists in a particular cell at a particular developmental stage under particular environmental conditions in the stated form.

[0170] When used in the context of nucleic acids or proteins, the term "heterologous" indicates that the nucleic acid or protein comprises at least two segments that are not naturally found together in the same molecule. For example, the term "heterologous", when used to refer to a nucleic acid segment or a protein segment, indicates that the nucleic acid or protein comprises two or more subsequences (e.g., joined together) that are not found in nature to have the same relationship to each other. As an example, a "heterologous" region of a nucleic acid vector is a nucleic acid segment that is within or attached to another nucleic acid molecule that is not found in nature to be associated with the other molecule. For example, a heterologous region of a nucleic acid vector can comprise a coding sequence flanked by sequences that are not found in nature to be associated with the coding sequence. Similarly, a "heterologous" region of a protein is a segment of amino acids that is within or attached to another peptide molecule (e.g., a fusion protein or a protein with a tag) that is not found in nature to be associated with the other peptide molecules. Similarly, a nucleic acid or protein can comprise a heterologous label or a heterologous secretion or localization sequence.

[0171] The term "locus" refers to the specific location of a gene (or significant sequence), a DNA sequence, a polypeptide coding sequence, or a chromosomal position of the genome of an organism. For example, the "MAPT locus" can refer to the specific location of the MAPT gene, the MAPT DNA sequence, the microtubule-associated protein tau coding sequence, or the MAPT position on the chromosome of the genome of an organism that has been identified as the location of such a sequence. The "MAPT locus" can include regulatory elements of the MAPT gene, including, for example, enhancers, promoters, 5' and / or 3' untranslated regions (UTRs), or combinations thereof.

[0172] The term "gene" refers to a DNA sequence in a chromosome that encodes a product (e.g., an RNA product and / or a polypeptide product) and contains coding regions interrupted by non-coding introns and sequences located near the coding regions at both the 5' end and the 3' end such that the gene corresponds to a full-length mRNA (including 5' and 3' untranslated sequences). The term "gene" also encompasses other non-coding sequences, including regulatory sequences (e.g., promoters, enhancers, and transcription factor binding sites), polyadenylation signals, internal ribosome entry sites, silencers, insulator sequences, and matrix attachment regions. These sequences can be near the coding region of the gene (e.g., within 10 kb) or at distant sites, and the sequences affect the level or rate of transcription and translation of the gene.

[0173] The term "allele" refers to variant forms of a gene. Some genes have multiple different forms, which are located at the same position or gene locus on a chromosome. A diploid organism has two alleles at each genetic locus. Each pair of alleles represents the genotype of a specific genetic locus. If two identical alleles are present at a particular locus, the genotype is described as homozygous, and if the two alleles are different, it is described as heterozygous.

[0174] A "promoter" is a regulatory region of DNA that typically includes a TATA box capable of directing RNA polymerase II to initiate RNA synthesis at an appropriate transcription start site of a specific polynucleotide sequence. A promoter can additionally include other regions that affect the rate of transcription initiation. The promoter sequences disclosed herein regulate the transcription of operably linked polynucleotides. A promoter can be active in one or more of the cell types disclosed herein (e.g., human cells, pluripotent cells, single-cell stage embryos, differentiated cells, or combinations thereof). A promoter can be, for example, a constitutively active promoter, a conditional promoter, an inducible promoter, a time-limited promoter (e.g., a developmentally regulated promoter), or a spatially restricted promoter (e.g., a cell-specific or tissue-specific promoter). Examples of promoters can be found, for example, in WO 2013 / 176772, which is incorporated herein by reference in its entirety for all purposes.

[0175] "Operably linked" or "operably connected" encompasses juxtaposing two or more components (e.g., a promoter and another sequence element) such that the two components function properly and such that at least one component is capable of mediating the function exerted on at least one other component. For example, if a promoter controls the transcription level of a coding sequence in response to the presence or absence of one or more transcriptional regulatory factors, the promoter can be operably linked to the coding sequence. Operable linkage can encompass sequences that are adjacent to each other or act in trans (e.g., a regulatory sequence can act at a distance to control the transcription of a coding sequence).

[0176] The term "variant" refers to a nucleotide sequence that is different (e.g., by one nucleotide) from the most prevalent sequence in a population or a protein sequence that is different (e.g., by one amino acid) from the most prevalent sequence in a population.

[0177] When referring to a protein, the term "fragment" means a protein that is shorter or has fewer amino acids than the full-length protein. When referring to a nucleic acid, the term "fragment" means a nucleic acid that is shorter or has fewer nucleotides than the full-length nucleic acid. A fragment can be, for example, an N-terminal fragment (i.e., a portion of the C-terminus of the protein is removed), a C-terminal fragment (i.e., a portion of the N-terminus of the protein is removed), or an internal fragment.

[0178] "Sequence identity" or "identity" in the context of two polynucleotide or polypeptide sequences refers to the residues that are identical in the two sequences when aligned for maximum correspondence over a specified comparison window. When referring to the percentage of sequence identity of a protein, the positions of non-identical residues typically differ by conservative amino acid substitutions, where an amino acid residue is replaced by another amino acid residue with similar chemical properties (e.g., charge or hydrophobicity), thus not altering the functional properties of the molecule. When the conservative substitutions of a sequence differ, the percentage sequence identity can be adjusted upward to correct for the conservative nature of the substitution. Sequences that differ by such conservative substitutions are considered to have "sequence similarity" or "similarity." Methods for making such adjustments are well known. Typically, this involves counting conservative substitutions as partial mismatches rather than complete mismatches, thereby increasing the percentage sequence identity. Thus, for example, when the score for an identical amino acid is 1 and the score for a non-conservative substitution is zero, the score for a conservative substitution is between zero and 1. For example, the score for conservative substitutions is calculated by the implementation in the program PC / GENE (Intelligenetics, Mountain View, California).

[0179] "Percentage of sequence identity" includes the value determined by comparing two optimally aligned sequences over a comparison window (the maximum number of perfectly matching residues), where the polynucleotide sequence portion in the comparison window may include additions or deletions (i.e., gaps) as compared to the reference sequence (excluding additions or deletions) to achieve the optimal alignment of the two sequences. The percentage of matching positions is obtained by determining the number of positions at which the same nucleic acid base or amino acid residue occurs in the two sequences, dividing the number of matching positions by the total number of positions in the comparison window, and multiplying the result by 100 to obtain the percentage of sequence identity. Unless otherwise stated (e.g., a shorter sequence contains a linked heterologous sequence), the comparison window is the full length of the shorter of the two sequences being compared.

[0180] Unless otherwise stated, sequence identity / similarity values include those obtained using the following parameters with Version 10 of GAP: the percentage of identity and percentage of similarity for nucleotide sequences using a GAP weight of 50, a length weight of 3, and the nwsgapdna.cmp scoring matrix; the percentage of identity and percentage of similarity for amino acid sequences using a GAP weight of 8 and a length weight of 2, and the BLOSUM62 scoring matrix; or any equivalent program. "Equivalent program" includes any sequence comparison program that, when compared to the corresponding alignment generated by Version 10 of GAP, produces an alignment with the same nucleotide or amino acid residue matches and the same percentage sequence identity for any two sequences under discussion.

[0181] The term "conservative amino acid substitution" refers to the replacement of an amino acid that is normally present in a sequence with a different amino acid having similar size, charge, or polarity. Examples of conservative substitutions include the replacement of one nonpolar (hydrophobic) residue, such as isoleucine, valine, or leucine, with another nonpolar residue. Similarly, examples of conservative substitutions include the replacement of one polar (hydrophilic) residue with another polar residue, such as a polar residue between arginine and lysine, a polar residue between glutamine and asparagine, or a polar residue between glycine and serine. In addition, the replacement of one basic residue, such as lysine, arginine, or histidine, with another basic residue or the replacement of one acidic residue, such as aspartic acid or glutamic acid, with another acidic residue is another example of a conservative substitution. Examples of non-conservative substitutions include the replacement of a polar (hydrophilic) residue, such as cysteine, glutamine, glutamic acid, or lysine, with a nonpolar (hydrophobic) amino acid residue, such as isoleucine, valine, leucine, alanine, or methionine, and / or the replacement of a nonpolar residue with a polar residue. A summary of the typical amino acid classifications is provided below.

[0182] Table 1. Amino Acid Classification.

[0183]

[0184] A "homologous" sequence (e.g., a nucleic acid sequence) includes a sequence that is identical or substantially similar to a known reference sequence such that it has, for example, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the known reference sequence. Homologous sequences can include, for example, orthologous sequences and paralogous sequences. For example, homologous genes typically descend from a common ancestral DNA sequence through a speciation event (orthologous genes) or a gene duplication event (paralogous genes). "Orthologous" genes include genes in different species that have evolved from a common ancestral gene through speciation. Orthologs generally retain the same function during evolution. "Paralogous" genes include genes related by duplication within a genome. Paralogs can evolve new functions during evolution.

[0185] The term "in vitro" includes an artificial environment and processes or reactions that occur within an artificial environment (e.g., a test tube or isolated cells or cell lines). The term "in vivo" includes a natural environment (e.g., a cell, an organism, or a body) and processes or reactions that occur within a natural environment. The term "ex vivo" includes cells that have been removed from an individual's body and processes or reactions that occur within such cells.

[0186] The term "reporter gene" refers to a nucleic acid having a sequence encoding a gene product (usually an enzyme) that can be readily and quantitatively assayed when a construct comprising the reporter gene sequence operably linked to a heterologous promoter and / or enhancer element is introduced into a cell that contains (or can be made to contain) the factors necessary for activation of the promoter and / or enhancer element. Examples of reporter genes include, but are not limited to, the gene encoding β-galactosidase (lacZ), the bacterial chloramphenicol acetyltransferase (cat) gene, the firefly luciferase gene, the gene encoding β-glucuronidase (GUS), and genes encoding fluorescent proteins. A "reporter protein" refers to a protein encoded by a reporter gene.

[0187] As used herein, the term "fluorescent reporter protein" means a fluorescence-detectable reporter protein, where the fluorescence can be directly from the reporter protein, the activity of the reporter protein on a fluorescent substrate, or a protein having an affinity for binding to a fluorescently labeled compound. Examples of fluorescent proteins include green fluorescent proteins (e.g., GFP, GFP-2, tagGFP, turboGFP, eGFP, Emerald, Azami Green, monomeric Azami Green, CopGFP, AceGFP, and ZsGreen1), yellow fluorescent proteins (e.g., YFP, eYFP, Citrine, Venus, YPet, PhiYFP, and ZsYellow1), blue fluorescent proteins (e.g., BFP, eBFP, eBFP2, Shijin, mKalamal, GFPuv, Sapphire, and T-Sapphire), cyan fluorescent proteins (e.g., CFP, eCFP, Cerulean, CyPet, AmCyan1, and Midoriishi-Cyan), red fluorescent proteins (e.g., RFP, mKate, mKate2, mPlum, DsRed monomer, mCherry, mRFP1, DsRed-Express, DsRed2, DsRed-monomer, HcRed-Tandem, HcRed1, AsRed2, eqFP611, mRaspberry, mStrawberry, and Jred), orange fluorescent proteins (e.g., mOrange, mKO, Kusabira-Orange, monomeric Kusabira-Orange, mTangerine, and tdTomato), and any other suitable fluorescent protein whose presence in a cell can be detected by flow cytometry methods.

[0188] Repair in response to double-strand breaks (DSBs) occurs primarily through two conserved DNA repair pathways: homologous recombination (HR) and non-homologous end joining (NHEJ). See Kasparek and Humphrey (2011) Seminars in Cell & Dev. Biol. 22:886-897, which is incorporated herein by reference in its entirety for all purposes. Similarly, target nucleic acid repair mediated by an exogenous donor nucleic acid can encompass any process that involves an exchange of genetic information between two polynucleotides.

[0189] The term "recombination" encompasses any process that involves an exchange of genetic information between two polynucleotides and can occur by any mechanism. Recombination can occur by homology-directed repair (HDR) or homologous recombination (HR). HDR or HR encompasses forms of nucleic acid repair that may require nucleotide sequence homology, use a "donor" molecule as a template to repair a "target" molecule (i.e., the molecule that has undergone a double-strand break), and results in the transfer of genetic information from the donor to the target. Without wishing to be bound by any particular theory, such transfer can involve mismatch correction of heteroduplex DNA formed between the broken target and the donor and / or synthesis-dependent strand annealing, where the donor is used to resynthesize genetic information that will become part of the target and / or related processes. In some cases, the donor polynucleotide, a portion of the donor polynucleotide, a copy of the donor polynucleotide, or a portion of a copy of the donor polynucleotide is integrated into the target DNA. See Wang et al., (2013) Cell 153:910-918; Mandalos et al. (2012) PLOS ONE 7:e45768:1-9; and Wang et al. (2013) Nat Biotechnol. 31:530-532, each of which is incorporated herein by reference in its entirety for all purposes.

[0190] Non-homologous end joining (NHEJ) involves repairing double-strand breaks in nucleic acids by directly ligating the broken ends to each other or to exogenous sequences without the need for a homologous template. NHEJ ligation of non-contiguous sequences often results in deletions, insertions, or translocations near the double-strand break site. For example, NHEJ can also result in targeted integration of an exogenous donor nucleic acid by direct ligation of the broken ends to the ends of the exogenous donor nucleic acid (i.e., NHEJ-based capture). Such NHEJ-mediated targeted integration can be preferably used to insert an exogenous donor nucleic acid when the homologous directed repair (HDR) pathway is not readily available (e.g., in non-dividing cells, primary cells, and cells that perform poorly in homology-based DNA repair). Additionally, in contrast to homologous directed repair, knowledge of large regions of sequence identity with respect to the flanking cleavage sites is not required, which can be beneficial when attempting targeted insertion into an organism with limited genomic sequence knowledge. Integration can be carried out by ligating blunt ends between the exogenous donor nucleic acid and the cleaved genomic sequence, or by using the exogenous donor nucleic acid to ligate sticky ends (i.e., having 5' or 3' overhangs), the exogenous donor nucleic acid being flanked by overhangs compatible with the overhangs generated by the nuclease reagent in the cleaved genomic sequence. See, e.g., US 2011 / 020722, WO 2014 / 033644, WO 2014 / 089290, and Maresca et al. (2013) Genome Res. 23(3):539-546, each of which is incorporated herein by reference in its entirety for all purposes. If blunt ends are ligated, resection of the target and / or donor may be required to generate the microhomology regions required for fragment ligation, which may result in unwanted alterations in the target sequence.

[0191] A composition or method that "comprises" or "includes" one or more of the recited elements may contain other elements not specifically recited. For example, a composition that "comprises" or "includes" a protein may contain the protein alone or the protein in combination with other components. The transitional phrase "consisting essentially of" means that the scope of the claim should be interpreted to cover the specified elements recited in the claim and those elements that do not materially affect one or more of the basic and novel characteristics of the claimed invention. Thus, when used in the claims of the present invention, the term "consisting essentially of" should not be interpreted as equivalent to "comprising".

[0192] "Optional" or "optionally" means that the subsequent described event or circumstance may or may not occur and the description includes instances where the event or circumstance occurs and instances where it does not occur.

[0193] The specification of a numerical range encompasses all integers within or defining the range and all sub-ranges defined by the integers within the range.

[0194] Unless clearly apparent from the context, the term "about" encompasses values within the standard measurement error range (e.g., SEM) of a specified value.

[0195] The term "and / or" means and encompasses any and all possible combinations of one or more of the associated listed items and the absence of combinations when interpreted in the alternative ("or").

[0196] The term "or" means any one member of a particular list and also includes any combination of members of the list.

[0197] Unless the context clearly indicates otherwise, the singular forms "a / an" and "the" in this document include plural references. For example, the term "protein" or "at least one protein" can include multiple proteins, including mixtures thereof.

[0198] Statistically significant means p ≤ 0.05. Detailed Description

[0199] I. Overview

[0200] Provided are Cas protein-ready tau biosensor cells and methods of preparing and using such cells to screen for tau seeding or aggregation gene modifiers. Provided are CRISPR / Cas synergistic activation mediator (SAM)-ready tau biosensor cells and methods of preparing and using such cells to screen for tau seeding or aggregation gene modifiers. Provided are Cas protein-ready tau biosensor cells and methods of preparing and using such cells to screen for tau disaggregation gene modifiers. Provided are CRISPR / Cas synergistic activation mediator (SAM)-ready tau biosensor cells and methods of preparing and using such cells to screen for tau disaggregation gene modifiers. Also provided are reagents and methods for sensitizing such cells to tau seeding activity or tau aggregation. Also provided are reagents and methods for inducing tau aggregation.

[0201] To identify genes and pathways that modify the abnormal tau protein aggregation process, a platform was developed for screening using a CRISPR (e.g., CRISPR / Cas9) nuclease (CRISPRn) sgRNA library to identify genes that regulate the potential of cells to be "seeded" with tau disease-related protein aggregates (e.g., genes that, when disrupted, cause cells to be more prone to forming tau aggregates when exposed to a source of tau protofibrillar protein). To further identify genes and pathways that modify the abnormal tau protein aggregation process, a platform was developed for screening using a CRISPR activation (CRISPRa) sgRNA library to identify genes that regulate the potential of cells to be "seeded" with tau disease-related protein aggregates (e.g., genes that, when transcriptionally activated, cause cells to be more prone to forming tau aggregates when exposed to a source of tau protofibrillar protein). Similarly, a platform was developed for screening using a CRISPR (e.g., CRISPR / Cas9) nuclease (CRISPRn) sgRNA library to identify genes that, when disrupted, prevent tau aggregation or promote tau disassembly. Similarly, a platform was developed for screening using a CRISPR activation (CRISPRa) sgRNA library to identify genes that, when transcriptionally activated, prevent tau aggregation or promote tau disassembly. A "seed" is one or more proteins that nucleate the aggregation of other proteins with similar aggregation domains. The seeding activity of a sample refers to the ability of the sample to nucleate (i.e., induce) the aggregation of proteins with similar aggregation domains. The identification of such genes can elucidate the mechanisms of intercellular tau aggregate propagation and the genetic pathways that control the sensitivity of neurons to form tau aggregates in the context of neurodegenerative diseases.

[0202] The screening uses a tau biosensor cell line (e.g., a human cell line or HEK293T), which consists of cells stably expressing a tau repeat domain (e.g., a tau four-repeat domain, tau_4RD) with a pathogenic mutation (e.g., the P301S pathogenic mutation), linked to a unique reporter gene, which together can serve as an intracellular biosensor that produces a detectable signal upon aggregation. In one non-limiting example, the cell line contains two transgenes that stably express a disease-related protein variant fused to a fluorescent protein CFP (e.g., eCFP) or a fluorescent protein YFP (e.g., eYFP): tau 4RD -CFP / tau 4RD-YFP(TCY), where the tau repeat domain (4RD) includes the P301S pathogenic mutation. In these biosensor systems, tau-CFP / tau-YFP protein aggregation generates a fluorescence resonance energy transfer (FRET) signal, which is the result of fluorescence energy transfer from the donor CFP to the acceptor YFP. The term CFP (cyan fluorescent protein) as used herein includes eCFP (enhanced cyan fluorescent protein), and the term YFP (yellow fluorescent protein) as used herein includes eYFP (enhanced yellow fluorescent protein). FRET-positive cells containing tau aggregates can be sorted and isolated by flow cytometry. At baseline, unstimulated cells express the reporter gene in a stable, soluble state, with minimal FRET signal. Upon stimulation (e.g., lipofection of seed particles), the reporter proteins form aggregates, generating a FRET signal. Cells containing aggregates can be isolated by FACS. A cell line Agg[+] stably propagating cells containing aggregates can be isolated by serial dilution cloning of the Agg[-] cell line.

[0203] Several modifications were made to this tau biosensor cell line to make it useful for gene screening using a CRISPRn library. First, these tau biosensor cells were modified by introducing a transgene expressing Cas (e.g., Cas9 or SpCas9) for CRISPRn screening. Second, reagents and methods were developed to sensitize cells to tau seeding activity and tau aggregation. A cell line was developed in which tau aggregates stably persisted and were passaged multiple times over time in all cells. These cells were used to generate conditioned media by collecting the media that had been on confluent cells for a period of time. This conditioned media could then be applied to naive tau biosensor tau cells at a ratio such that tau aggregation could be induced in a subset of these recipient cells, thereby sensitizing the cells to tau seeding activity and tau aggregation. Conditioned media without co-culture has not been used as an inoculum in this context before. However, conditioned media is particularly useful for large-scale genome-wide screening because in vitro-generated tau fibrils are a limited resource. Additionally, conditioned media is more physiologically relevant because it is produced and secreted by cells, rather than being generated and secreted in vitro.

[0204] These cell lines were used to develop a screening method in which Cas-expressing tau biosensor cells without aggregates (Agg[–]) were transduced with a CRISPR guide RNA library to introduce knockout mutations at each target gene. After culturing the cells to allow for genome editing and expansion, the cells were grown in conditioned media to sensitize them to seeding activity, and cells in which tau aggregation occurred were identified. During genome editing and expansion, guide RNAs enriched in the aggregation-positive subpopulation relative to earlier time points were identified to identify genes that could modulate the cells' sensitivity to tau seeding when exposed to an external source of tau seeding activity.

[0205] Similarly, several modifications were made to this tau biosensor cell line to make it useful for gene screening using a CRISPRa library (e.g., for use with the CRISPR / Cas synergistic activation mediator (SAM) system). In an exemplary SAM system, several activation domains interact to cause greater transcriptional activation than can be induced by any one factor alone. For example, an exemplary SAM system includes a chimeric Cas protein comprising a nuclease-inactivated Cas protein fused to one or more transcriptional activation domains (e.g., VP64); and a chimeric adaptor protein comprising an adaptor protein (e.g., MS2 coat protein (MCP)) fused to one or more transcriptional activation domains (e.g., fused to p65 and HSF1). MCP naturally binds to the MS2 stem-loop. In the exemplary SAM system, MCP interacts with the MS2 stem-loop engineered into the CRISPR-associated sgRNA and thereby delivers the bound transcription factors to the appropriate genomic locus.

[0206] First, these tau biosensor cells were modified by introducing one or more transgenes expressing a chimeric Cas protein comprising a nuclease-inactivated Cas protein fused to one or more transcriptional activation domains (e.g., VP64); and a chimeric adaptor protein comprising an adaptor protein (e.g., MS2 coat protein (MCP)) fused to one or more transcriptional activation domains (e.g., fused to p65 and HSF1). Although the SAM system is described herein, other CRISPRa systems can also be used, such as a nuclease-inactivated Cas protein fused to one or more transcriptional activation domains, where such systems do not also include a chimeric adaptor protein. In such cases, the tau biosensor cells would be modified by introducing a transgene expressing the chimeric Cas protein.

[0207] Second, reagents and methods were developed to sensitize cells to tau seeding activity and tau aggregation. A cell line was developed in which tau aggregates stably continued to grow over time in all cells and were passaged multiple times. These cells were used to generate conditioned media by collecting the media that had been on confluent cells for a period of time. This conditioned media could then be applied to primary tau biosensor tau cells at a ratio such that tau aggregation could be induced in a subset of these recipient cells, thereby sensitizing the cells to tau seeding activity and tau aggregation. Conditioned media without co-culture had not been used as a seeding agent in this context before. However, conditioned media is particularly useful for large-scale genome-wide screening because in vitro-generated tau fibrils are a limited resource. Additionally, conditioned media is more physiologically relevant as it is produced and secreted by cells rather than being generated and secreted in vitro.

[0208] These cell lines were used to develop a screening method in which tau biosensor cells expressing SAM without aggregates (Agg[–]) were transduced with a CRISPRa guide RNA library to transcriptionally activate each target gene. After culturing the cells to allow for genome editing and expansion, the cells were grown in conditioned media to sensitize them to seeding activity, and the cells in which tau aggregation occurred were identified. During genome editing and expansion, guide RNAs enriched in the aggregation-positive subpopulation relative to an earlier time point were identified to identify genes that could modulate the sensitivity of cells to tau seeding when exposed to an external source of tau seeding activity.

[0209] II. Cas / tau biosensor and SAM / tau biosensor cell lines and production methods

[0210] A. Cas / tau biosensor cells and SAM / tau biosensor cells

[0211] The cells disclosed herein not only express a first tau repeat domain (e.g., including the tau microtubule binding domain (MBD)) linked to a first reporter gene and a second tau repeat domain linked to a second reporter gene, but also express a Cas protein, such as Cas9. The cells also disclosed herein not only express a first tau repeat domain (e.g., including the tau microtubule binding domain (MBD)) linked to a first reporter gene and a second tau repeat domain linked to a second reporter gene, but also express a chimeric Cas protein comprising a nuclease-inactivated Cas protein fused to one or more transcriptional activation domains and a chimeric adaptor protein comprising an adaptor protein fused to one or more transcriptional activation domains. The first tau repeat domain linked to the first reporter gene can be stably expressed, and the second tau repeat domain linked to the second reporter gene can be stably expressed. For example, DNA encoding the first tau repeat domain linked to the first reporter gene can be integrated into the genome, and DNA encoding the second tau repeat domain linked to the second reporter gene can be integrated into the genome. Similarly, the Cas protein can be stably expressed in the Cas / tau biosensor cells. For example, DNA encoding the Cas protein can be integrated into the genome. Similarly, the chimeric Cas protein and / or the chimeric adaptor protein can be stably expressed in the SAM / tau biosensor cells. For example, DNA encoding the chimeric Cas protein can be integrated into the genome and / or DNA encoding the chimeric adaptor protein can be integrated into the genome. The cells can be tau aggregation negative or can be tau aggregation positive.

[0212] 1. Tau and Tau Repeat Domains Linked to Reporter Genes

[0213] The microtubule-associated protein tau is a protein that promotes microtubule assembly and stability and is mainly expressed in neurons. Tau has the effect of stabilizing neuronal microtubules and thus promotes axon growth. In Alzheimer's disease (AD) and related neurodegenerative disease families known as tauopathies, the tau protein is abnormally hyperphosphorylated and aggregates into bundles of filaments (paired helical filaments), which appear as neurofibrillary tangles. Tauopathies are a heterogeneous group of neurodegenerative conditions characterized by the deposition of abnormal tau in the brain.

[0214] The tau repeat domain can be from tau protein of any animal or mammal (such as human, mouse or rat). In a specific example, the tau repeat domain is from human tau protein. The exemplary human tau protein is designated as UniProt accession number P10636. Tau protein is the product of alternative splicing of a single gene, which is called MAPT (microtubule-associated protein tau) in humans. The tau repeat domain carries sequence motifs responsible for aggregation (i.e., the repeat domain is the aggregation-prone domain from tau). Depending on splicing, the repeat domain of tau protein has three or four repeat regions, which constitute the aggregation-prone core of the protein, and is usually referred to as the repeat domain (RD). Specifically, the repeat domain of tau represents the core of the microtubule-binding region and contains the hexapeptide motifs in R2 and R3 responsible for Tau aggregation. In the human brain, there are six tau isoforms with lengths in the range of 352 to 441 amino acids. These isoforms vary at the carboxyl terminus according to the presence of three or four repeat domains (R1-R4), in addition to the presence or absence of one or two insert domains at the amino terminus. The repeat domain located in the carboxyl-terminal half of tau is considered important for microtubule binding and for the pathological aggregation of tau into paired helical filaments (PHF), which is the core component of neurofibrillary tangles found in proteinopathies. The exemplary sequences of the four repeat domains (R1-R4) are provided in SEQ ID NO:1-4 respectively. The exemplary coding sequences of the four repeat domains (R1-R4) are provided in SEQ ID NO:5-8. The exemplary sequence of the Tau four-repeat domain is provided in SEQID NO:9. The exemplary coding sequence of the Tau four-repeat domain is provided in SEQ ID NO:10. The exemplary sequence of the Tau four-repeat domain with P301S mutation is provided in SEQ ID NO:11. The exemplary coding sequence of the Tau four-repeat domain with P301S mutation is provided in SEQ ID NO:12.

[0215] The tau repeat domain used in a Cas / tau biosensor cell or a SAM / tau biosensor cell can include a tau microtubule binding domain (MBD). The tau repeat domain used in a Cas / tau biosensor cell or a SAM / tau biosensor cell can include one or more or all of the four repeat domains (R1-R4). For example, the tau repeat domain can comprise, consist essentially of, or consist of: SEQ ID NO:1, 2, 3, and 4 or one or more or all of the sequences that are at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:1, 2, 3, and 4. In one specific instance, the tau repeat domain is the tau four-repeat domain (R1-R4) found in a number of tau isoforms. The tau four-repeat domain can be used in place of full-length tau because the four-repeat domain can reliably form fibrils in cultured cells. For example, the tau repeat domain can comprise, consist essentially of, or consist of: SEQ ID NO:9 or SEQ ID NO:11 or the sequences that are at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:9 or SEQ ID NO:11. In one specific instance, the nucleic acid encoding the tau repeat domain can comprise, consist essentially of, or consist of: SEQ ID NO:12 or the sequences that are at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:12, optionally wherein the nucleic acid encodes a protein that comprises, consist essentially of, or consist of: SEQ ID NO:11. In another specific instance, the nucleic acid encoding the second tau repeat domain linked to a second reporter gene can comprise, consist essentially of, or consist of: SEQ ID NO:10 or the sequences that are at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:10, optionally wherein the nucleic acid encodes a protein that comprises, consist essentially of, or consist of: SEQ ID NO:9. The first tau repeat domain and the second tau repeat domain in the cells disclosed herein can be the same, similar, or different.

[0216] One or both of the first tau repeat domain linked to the first reporter gene and the second tau repeat domain linked to the second reporter gene can be stably expressed in cells. For example, the nucleic acid encoding one or both of the first tau repeat domain linked to the first reporter gene and the second tau repeat domain linked to the second reporter gene can be genomically integrated in a cell population and operably linked to a promoter that is active in the cells.

[0217] The tau repeat domains used in the cells disclosed herein can also include tau pathogenic mutations, such as aggregation-promoting mutations. Such mutations can be, for example, mutations associated with (e.g., isolated from) or causative of tauopathies. As an example, the mutation can be an aggregation-sensitizing mutation that sensitizes tau to seeding but does not cause tau to readily aggregate on its own. For example, the mutation can be the disease-associated P301S mutation. The P301S mutation refers to the human tau P301S mutation or the corresponding mutation in another tau protein when optimally aligned with the human tau protein. The P301S mutation in tau exhibits a high sensitivity to seeding, but it does not readily aggregate on its own. Thus, although the tau reporter protein comprising the P301S mutation is present in a stable, soluble form inside the cell at baseline, exposure to exogenous tau seeds causes the tau reporter protein to aggregate. Other tau mutations include, for example, K280del, P301L, V337M, P301L / V337M, and K280del / I227P / I308P.

[0218] The first tau repeat domain can be linked to the first reporter gene by any means, and the second tau repeat domain can be linked to the second reporter gene. For example, the reporter gene can be fused to the tau repeat domain (e.g., as part of a fusion protein).

[0219] The first reporter gene and the second reporter gene can be a pair of unique reporter genes, which can together serve as an intracellular biosensor that generates a detectable signal when the first protein and the second protein aggregate. For example, the reporter genes can be fluorescent proteins, and fluorescence resonance energy transfer (FRET) can be used to measure protein aggregation. Specifically, the first reporter gene and the second reporter gene can be an FRET pair. Examples of FRET pairs (donor and acceptor fluorophores) are well known. See, for example, Bajar et al. (2016) Sensors Basel 16(9):1488, which is incorporated herein by reference in its entirety for all purposes. Typical fluorescence microscopy techniques rely on the absorption of a fluorophore by one wavelength (excitation) of light, followed by the subsequent emission of secondary fluorescence at a longer wavelength. The mechanism of fluorescence resonance energy transfer involves a donor fluorophore in an excited electronic state, which can non-radiatively transfer its excitation energy to a nearby acceptor chromophore through long-range dipole-dipole interactions. For example, the FRET energy donor can be the first reporter gene, and the FRET energy acceptor can be the second reporter gene. Alternatively, the FRET energy donor can be the second reporter gene, and the FRET energy acceptor can be the first reporter gene. In a specific example, the first reporter gene and the second reporter gene are CFP and YFP. For example, exemplary proteins and coding sequences of CFP are provided in SEQ ID NOs: 13 and 14, respectively. For example, exemplary proteins and coding sequences of YFP are provided in SEQ ID NOs: 15 and 16, respectively. As a specific example, CFP can comprise, consist essentially of, or consist of SEQ ID NO: 13 or a sequence that is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 13. As another specific example, YFP can comprise, consist essentially of, or consist of SEQ ID NO: 15 or a sequence that is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 15.

[0220] As another example, protein fragment complementation strategies can be used to detect aggregation. For example, split luciferases can be used to generate bioluminescence from a substrate, and the first reporter gene and the second reporter gene can be the amino- (NLuc) and carboxyl- (CLuc) terminal fragments of luciferase. Examples of luciferases include Renilla, firefly, beetle, and Metridia luciferases.

[0221] In a non-limiting example, the biosensor cells disclosed herein contain two transgenes (tau 4RD -CFP / tau 4RD -YFP (TCY)) that stably express, respectively, a disease-related tau protein variant fused to the fluorescent protein CFP or the fluorescent protein YFP, wherein the tau four-repeat domain (4RD) includes the P301S pathogenic mutation. In these biosensor lines, tau-CFP / tau-YFP protein aggregation generates a FRET signal, which is the result of the transfer of fluorescent energy from the donor CFP to the acceptor YFP. FRET-positive cells containing tau aggregates can be sorted and isolated by flow cytometry. At baseline, unstimulated cells express the reporter gene in a stable, soluble state, with minimal FRET signal. Upon stimulation (e.g., lipofection of seed particles), the reporter proteins form aggregates, generating a FRET signal.

[0222] The Cas / tau biosensor cells disclosed herein can be aggregation-positive (Agg[+]) cells, in which the tau repeat domain stably exists in an aggregated state, meaning that tau repeat domain aggregates stably exist in all cells, which grow over time and are passaged multiple times. Alternatively, the Cas / tau biosensor cells disclosed herein can be aggregation-negative (Agg[-]).

[0223] 2. Cas proteins and chimeric Cas proteins

[0224] The Cas / tau biosensor cells disclosed herein further comprise a nucleic acid (DNA or RNA) encoding a Cas protein. Optionally, the Cas protein is stably expressed. Optionally, the cell comprises a Cas-encoding sequence integrated into the genome. Similarly, the SAM / tau biosensor cells disclosed herein further comprise a nucleic acid (DNA or RNA) encoding a chimeric Cas protein, which comprises a nuclease-inactivated Cas protein fused to one or more transcriptional activation domains (e.g., VP64). Optionally, the chimeric Cas protein is stably expressed. Optionally, the cell comprises a chimeric Cas-encoding sequence integrated into the genome.

[0225] Cas proteins are part of the clustered regularly interspaced short palindromic repeats (CRISPR) / CRISPR-associated (Cas) system. The CRISPR / Cas system includes transcripts and other elements involved in the expression of Cas genes or directing their activity. The CRISPR / Cas system can be, for example, a type I, type II, type III system or a type V system (e.g., V-A subtype or V-B subtype). The methods and compositions disclosed herein can employ the CRISPR / Cas system for site-specific binding or cleavage of nucleic acids by utilizing a CRISPR complex (including a guide RNA (gRNA) complexed with a Cas protein).

[0226] The CRISPR / Cas system used in the compositions and methods disclosed herein can be non-naturally occurring. A "non-naturally occurring" system encompasses anything that indicates involvement of the artificial, such as one or more components of the system being altered or mutated from their naturally occurring state, being at least substantially free of at least one other component with which the component is naturally associated in nature or being associated with at least one other component with which the component is not naturally associated. For example, some CRISPR / Cas systems employ a non-naturally occurring CRISPR complex that includes a gRNA and a Cas protein that do not occur together naturally, employ a Cas protein that does not occur naturally, or employ a gRNA that does not occur naturally.

[0227] Cas proteins generally include at least one RNA recognition or binding domain that can interact with a guide RNA. Cas proteins can also include a nuclease domain (e.g., a DNase domain or an RNase domain), a DNA binding domain, a helicase domain, a protein-protein interaction domain, a dimerization domain, and other domains. Some such domains (e.g., a DNase domain) can be from a native Cas protein. Other such domains can be added to prepare a modified Cas protein. The nuclease domain has catalytic activity for nucleic acid cleavage, which involves the breaking of covalent bonds in a nucleic acid molecule. The cleavage can produce blunt ends or staggered ends, and it can be single-stranded or double-stranded. For example, wild-type Cas9 protein generally produces blunt cleavage products. Alternatively, wild-type Cpf1 protein (e.g., FnCpf1) can produce a cleavage product with a 5-nucleotide 5' overhang, where the cleavage occurs after the 18th base pair of the PAM sequence on the non-target strand and after the 23rd base on the target strand. A Cas protein can have full cleavage activity to produce a double-strand break (e.g., a double-strand break with blunt ends) at a target genomic locus, or it can be a nickase that produces a single-strand break at a target genomic locus.

[0228] Examples of Cas proteins include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas5e (CasD), Cas6, Cas6e, Cas6f, Cas7, Cas8a1, Cas8a2, Cas8b, Cas8c, Cas9 (Csn1 or Csx12), Cas10, Cas10d, CasF, CasG, CasH, Csy1, Csy2, Csy3, Cse1 (CasA), Cse2 (CasB), Cse3 (CasE), Cse4 (CasC), Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4 and Cu1966, as well as homologs or modified versions thereof.

[0229] Exemplary Cas proteins are Cas9 proteins or proteins derived from Cas9 proteins. Cas9 proteins come from type II CRISPR / Cas systems and generally share four key motifs with a conserved structure. Motifs 1, 2, and 4 are RuvC-like motifs, and motif 3 is an HNH motif. Exemplary Cas9 proteins are from Streptococcus pyogenes, Streptococcus thermophilus, Streptococcus sp., Staphylococcus aureus, Nocardiopsis dassonvillei, Streptomyces pristinaespiralis, Streptomyces viridochromogenes, Streptomyces viridochromogenes, Streptosporangium roseum, Streptosporangium roseum, Alicyclobacillus acidocaldarius, Bacillus pseudomycoides, Bacillus selenitireducens, Exiguobacterium sibiricum, Lactobacillus delbrueckii, Lactobacillus salivarius, Microscilla marina, Burkholderiales bacterium, Polaromonas naphthalenivorans, Polaromonas sp., Crocosphaera watsonii, Cyanothece sp., Microcystis aeruginosa, Synechococcus sp.) Acetohalobium arabaticum, Ammonifex degensii, Caldicelulosiruptor becscii, Candidatus Desulforudis, Clostridium botulinum, Clostridium difficile, Finegoldia magna, Natranaerobius thermophilus, Pelotomaculum thermopropionicum, Acidithiobacillus caldus, Acidithiobacillus ferrooxidans, Allochromatium vinosum, Marinobacter sp., Nitrosococcus halophilus, Nitrosococcus watsoni, Pseudoalteromonas haloplanktis, Ktedonobacter racemifer, Methanohalobium evestigatum, Anabaena variabilis, Nodularia spumigena, Nostoc sp., Arthrospira maxima, Arthrospira platensis, Arthrospira sp., Lyngbya sp., Microcoleus chthonoplastes, Oscillatoria sp.) Petrotoga mobilis, Thermosipho africanus, Acaryochloris marina, Neisseria meningitidis, or Campylobacter jejuni. Additional examples of Cas9 family members are described in WO2014 / 131833, which is incorporated herein by reference in its entirety for all purposes. Cas9 from Streptococcus pyogenes (SpCas9) (designated SwissProt accession number Q99ZW2) is an exemplary Cas9 protein. Exemplary SpCas9 protein and coding sequence are shown in SEQ ID NO:21 and 22, respectively. Cas9 from Staphylococcus aureus (SaCas9) (designated UniProt accession number J7RUA5) is another exemplary Cas9 protein. Cas9 from Campylobacter jejuni (CjCas9) (designated UniProt accession number Q0P897) is another exemplary Cas9 protein. See, e.g., Kim et al. (2017) Nat. Comm. 8:14500, which is incorporated herein by reference in its entirety for all purposes. SaCas9 is smaller than SpCas9, and CjCas9 is smaller than SaCas9 and SpCas9. Cas9 from Neisseria meningitidis (Nme2Cas9) is another exemplary Cas9 protein. See, e.g., Edraki et al. (2019) Mol. Cell 73(4):714-726, which is incorporated herein by reference in its entirety for all purposes. Cas9 proteins from Streptococcus thermophilus (e.g., Streptococcus thermophilus LMD-9 Cas9 (St1Cas9) encoded by the CRISPR1 locus or Streptococcus thermophilus Cas9 (St3Cas9) from the CRISPR3 locus) are other exemplary Cas9 proteins. Cas9 from Francisella novicida (FnCas9) or Francisella novicida Cas9 variant that recognizes an alternative PAM (E1369R / E1449H / R1556A substitution) are other exemplary Cas9 proteins. These and other exemplary Cas9 proteins are reviewed, e.g., in Cebrian-Serrano and Davies (2017) Mamm. Genome 28(7):247-261, which is incorporated herein by reference in its entirety for all purposes..

[0230] As an example, the Cas protein can be a Cas9 protein. For example, the Cas9 protein can be Streptococcus pyogenes Cas9 protein. As a specific example, the Cas protein can comprise, consist essentially of, or consist of: SEQ ID NO:21 or a sequence that is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:21. As another specific example, a chimeric Cas protein comprising a nuclease-inactivated Cas protein and one or more transcriptional activation domains can comprise, consist essentially of, or consist of: SEQ ID NO:36 or a sequence that is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:36.

[0231] Another example of a Cas protein is the Cpf1 (CRISPR from Prevotella and Francisella 1) protein. Cpf1 is a large protein (about 1300 amino acids) containing an RuvC-like nuclease domain homologous to the corresponding domain of Cas9 and a counterpart of the characteristic arginine-rich Cas9 cluster. However, Cpf1 lacks the HNH nuclease domain present in the Cas9 protein, and the RuvC-like domain is continuous in the Cpf1 sequence, whereas Cas9, in contrast, contains a long insertion encompassing the HNH domain. See, for example, Zetsche et al. (2015) Cell 163(3):759-771, which is incorporated herein by reference in its entirety for all purposes. Exemplary Cpf1 proteins are from Francisella tularensis 1, Francisella tularensis subsp. novicida, Prevotella albensis, Lachnospiraceae bacterium MC2017 1, Butyrivibrio proteoclasticus, Peregrinibacteria bacterium GW2011_GWA2_33_10, Parcubacteria bacterium GW2011_GWC2_44_17, Smithella sp. SCADC, Acidaminococcus sp. BV3L6, Lachnospiraceae bacterium MA2020, Candidatus Methanoplasma termitum, Eubacterium eligens, Moraxella bovoculi 237, Leptospira inadai, Lachnospiraceae bacterium ND2006, Porphyromonas crevioricanis 3, Prevotella disiens, and Porphyromonas macacae. Cpf1 from Francisella novicida U112 (FnCpf1; designated UniProt accession number A0Q7Q2) is an exemplary Cpf1 protein.

[0232] A Cas protein can be a wild-type protein (i.e., those proteins that exist in nature), a modified Cas protein (i.e., a Cas protein variant), or a fragment of a wild-type or modified Cas protein. With respect to the catalytic activity of a wild-type or modified Cas protein, the Cas protein can also be an active variant or fragment. With respect to catalytic activity, the active variant or fragment can include at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a wild-type or modified Cas protein or a portion thereof, wherein the active variant retains the ability to cleave at a desired cleavage site and thus retains double-strand break-inducing activity. Assays for double-strand break-inducing activity are known and generally measure the overall activity and specificity of a Cas protein against a DNA substrate containing the cleavage site.

[0233] An example of a modified Cas protein is the modified SpCas9-HF1 protein, which is a high-fidelity variant of Streptococcus pyogenes Cas9 and has alterations (N497A / R661A / Q695A / Q926A) designed to reduce non-specific DNA contacts. See, e.g., Kleinstiver et al. (2016) Nature 529(7587):490-495, which is incorporated herein by reference in its entirety for all purposes. Another example of a modified Cas protein is the modified eSpCas9 variant (K848A / K1003A / R1060A) designed to reduce off-target effects. See, e.g., Slaymaker et al. (2016) Science 351(6268):84-88, which is incorporated herein by reference in its entirety for all purposes. Other SpCas9 variants include K855A and K810A / K1003A / R1060A. These and other modified Cas proteins are reviewed, e.g., in Cebrian-Serrano and Davies (2017) Mammalian Genome 28(7):247-261, which is incorporated herein by reference in its entirety for all purposes. An example of another modified Cas9 protein is xCas9, which is a SpCas9 variant that can recognize an expanded range of PAM sequences. See, e.g., Hu et al. (2018) Nature 556:57-63, which is incorporated herein by reference in its entirety for all purposes.

[0234] The Cas protein can be modified to increase or decrease one or more of nucleic acid binding affinity, nucleic acid binding specificity, and enzymatic activity. The Cas protein can also be modified to alter any other activity or property of the protein, such as stability. For example, the Cas protein can be truncated to remove domains that are not essential for the function of the protein or to optimize (e.g., enhance or reduce) the activity or property of the Cas protein. As another example, one or more nuclease domains of the Cas protein can be modified, deleted, or inactivated (e.g., for use in SAM / tau biosensor cells that include nuclease-inactivated Cas proteins).

[0235] The Cas protein can include at least one nuclease domain, such as a DNase domain. For example, wild-type Cpf1 protein typically includes a RuvC-like domain that cleaves both strands of the target DNA, which may be in a dimeric configuration. The Cas protein can also include at least two nuclease domains, such as DNase domains. For example, wild-type Cas9 protein typically includes a RuvC-like nuclease domain and an HNH-like nuclease domain. The RuvC domain and the HNH domain can each cleave a different strand of double-stranded DNA to create a double-strand break in the DNA. See, e.g., Jinek et al. (2012) Science 337:816-821, which is incorporated herein by reference in its entirety for all purposes.

[0236] One or more or all of the nuclease domains can be deleted or mutated such that the nuclease domain no longer has function or has reduced nuclease activity. For example, if one of the nuclease domains in a Cas9 protein is deleted or mutated, the resulting Cas9 protein can be referred to as a nickase and can generate a single-strand break within double-stranded target DNA, but not a double-strand break (i.e., it can cleave the complementary or non-complementary strand, but not both simultaneously). If two of the nuclease domains are deleted or mutated, the ability of the resulting Cas protein (e.g., Cas9) to cleave both strands of double-stranded DNA will be reduced (e.g., a nuclease-null or nuclease-inactivated Cas protein, or a catalytically dead Cas protein (dCas)). An example of a mutation that converts Cas9 to a nickase is the D10A (aspartic acid to alanine at position 10 of Cas9) mutation in the RuvC domain of Cas9 from Streptococcus pyogenes. Similarly, H939A (histidine to alanine at amino acid position 839), H840A (histidine to alanine at amino acid position 840), or N863A (asparagine to alanine at amino acid position N863) in the HNH domain of Cas9 from Streptococcus pyogenes can convert Cas9 to a nickase. Other examples of mutations that convert Cas9 to a nickase include corresponding mutations in Cas9 from Streptococcus thermophilus. See, e.g., Sapranauskas et al., (2011) Nucleic Acids Res. 39(21):9275-9282 and WO 2013 / 141680, each of which is incorporated herein by reference in its entirety for all purposes. Such mutations can be generated using methods such as site-directed mutagenesis, PCR-mediated mutagenesis, or total gene synthesis. Other examples of mutations that generate nickases can be found in, e.g., WO 2013 / 176772 and WO 2013 / 142578, each of which is incorporated herein by reference in its entirety for all purposes. If all of the nuclease domains in a Cas protein are deleted or mutated (e.g., both nuclease domains in a Cas9 protein are deleted or mutated), the ability of the resulting Cas protein (e.g., Cas9) to cleave both strands of double-stranded DNA will be reduced (e.g., a nuclease-null or nuclease-inactivated Cas protein). A specific example is the D10A / H840A Streptococcus pyogenes Cas9 double mutant or the corresponding double mutant in Cas9 from another species when optimally aligned with Streptococcus pyogenes Cas9. Another specific example is the D10A / N863A Streptococcus pyogenes Cas9 double mutant or the corresponding double mutant in Cas9 from another species when optimally aligned with Streptococcus pyogenes Cas9.

[0237] Examples of inactivating mutations in the catalytic domain of xCas9 are the same as those described above for SpCas9. Examples of inactivating mutations in the catalytic domain of Staphylococcus aureus Cas9 protein are also known. For example, the Staphylococcus aureus Cas9 enzyme (SaCas9) can include substitutions at position N580 (e.g., N580A substitution) and position D10 (e.g., D10A substitution) for generating a nuclease-inactive Cas protein. See, e.g., WO 2016 / 106236, which is incorporated herein by reference in its entirety for all purposes. Examples of inactivating mutations in the catalytic domain of Nme2Cas9 are also known (e.g., a combination of D16A and H588A). Examples of inactivating mutations in the catalytic domain of St1Cas9 are also known (e.g., a combination of D9A, D598A, H599A, and N622A). Examples of inactivating mutations in the catalytic domain of St3Cas9 are also known (e.g., a combination of D10A and N870A). Examples of inactivating mutations in the catalytic domain of CjCas9 are also known (e.g., a combination of D8A and H559A). Examples of inactivating mutations in the catalytic domain of FnCas9 and RHA FnCas9 are also known (e.g., N995A).

[0238] Examples of inactivating mutations in the catalytic domain of Cpf1 proteins are also known. Referring to Cpf1 proteins from Francisella novicida U112 (FnCpf1), Acidaminococcus BV3L6 (AsCpf1), Lachnospiraceae bacterium ND2006 (LbCpf1), and Moraxella bovoculi 237 (MbCpf1 Cpf1), such mutations can include mutations at position 908, 993, or 1263 of AsCpf1 or corresponding positions in Cpf1 orthologs, or at position 832, 925, 947, or 1180 of LbCpf1 or corresponding positions in Cpf1 orthologs. Such mutations can include, for example, one or more of the mutations D908A, E993A, and D1263A of AsCpf1 or corresponding mutations in Cpf1 orthologs or D832A, E925A, D947A, and D1180A of LbCpf1 or corresponding mutations in Cpf1 orthologs. See, e.g., US 2016 / 0208243, which is incorporated herein by reference in its entirety for all purposes.

[0239] Cas proteins can also be operably linked to heterologous polypeptides as fusion proteins. For example, a Cas protein can be fused to a cleavage domain, an epigenetic modification domain, a transcriptional activation domain, or a transcriptional repressor domain. See WO 2014 / 089290, which is incorporated herein by reference in its entirety for all purposes. For example, a Cas protein can be operably linked or fused to a transcriptional activation domain for use in SAM / tau biosensor cells. Examples of transcriptional activation domains include the herpes simplex virus VP16 activation domain, VP64 (which is a tetrameric derivative of VP16), the NFκB p65 activation domain, the p53 activation domains 1 and 2, the CREB (cAMP response element binding protein) activation domain, the E2A activation domain, and the NFAT (nuclear factor of activated T cells) activation domain. Other examples include activation domains from Oct1, Oct-2A, SP1, AP-2, CTF1, P300, CBP, PCAF, SRC1, PvALF, ERF-2, OsGAI, HALF-1, C1, AP1, ARF-5, ARF-6, ARF-7, ARF-8, CPRF1, CPRF4, MYC-RP / GP, TRAB1PC4, and HSF1. See, e.g., US 2016 / 0237456, EP3045537, and WO 2011 / 146121, each of which is incorporated herein by reference in its entirety for all purposes. In some cases, a transcriptional activation system including a dCas9-VP64 fusion protein paired with MS2-p65-HSF1 can be used. The guide RNA in such systems can be designed to have an aptamer sequence appended to the sgRNA tetraloop and stem loop 2, which is designed to bind the dimerized MS2 bacteriophage coat protein. See, e.g., Konermann et al. (2015) Nature 517(7536):583-588, which is incorporated herein by reference in its entirety for all purposes. Examples of transcriptional repressor domains include the inducible cAMP early repressor (ICER) domain, the Kruppel-associated box A (KRAB-A) repressor domain, the YY1 glycine-rich repressor domain, the Sp1-like repressor, the E(spl) repressor, the ΙκΒ repressor, and MeCP2. Other examples include transcriptional repressor domains from A / B, KOX, TGF-β-inducible early gene (TIEG), v-erbA, SID, SID4X, MBD2, MBD3, DNMT1, DNMG3A, DNMT3B, Rb, ROM2. See, e.g., EP3045537 and WO 2011 / 146121, each of which is incorporated herein by reference in its entirety for all purposes. Cas proteins can also be fused to heterologous polypeptides to provide increased or decreased stability.The fusion domain or heterologous polypeptide can be located at the N-terminus, C-terminus, or within the Cas protein.

[0240] The Cas protein can also be operably linked to a heterologous polypeptide as a fusion protein. As an example, the Cas protein can be fused to one or more heterologous polypeptides that provide subcellular localization. Such heterologous polypeptides can include, for example, one or more nuclear localization signals (NLSs), such as the monopartite SV40 NLS and / or bipartite α-importin NLS for targeting the nucleus, a mitochondrial localization signal for targeting mitochondria, an ER retention signal, etc. See, for example, Lange et al. (2007) J. Biol. Chem. 282:5101-5105, which is incorporated herein by reference in its entirety for all purposes. Such subcellular localization signals can be located at the N-terminus, C-terminus, or anywhere within the Cas protein. The NLS can include a stretch of basic amino acids and can be a monopartite or bipartite sequence. Optionally, the Cas protein can include two or more NLSs, including an NLS at the N-terminus (e.g., α-importin NLS or monopartite NLS) and an NLS at the C-terminus (e.g., SV40 NLS or bipartite NLS). The Cas protein can also include two or more NLSs at the N-terminus and / or two or more NLSs at the C-terminus.

[0241] The Cas protein can also be operably linked to a cell-penetrating domain or protein transduction domain. For example, the cell-penetrating domain can be derived from the HIV-1 TAT protein, the TLM cell-penetrating motif from human hepatitis B virus, MPG, Pep-1, VP22, a cell-penetrating peptide from herpes simplex virus, or a polyarginine peptide sequence. See, for example, WO 2014 / 089290 and WO 2013 / 176772, each of which is incorporated herein by reference in its entirety for all purposes. The cell-penetrating domain can be located at the N-terminus, C-terminus, or anywhere within the Cas protein.

[0242] The Cas protein can also be operably linked to a heterologous polypeptide for tracking or purification, such as a fluorescent protein, a purification tag, or an epitope tag. Examples of fluorescent proteins include green fluorescent protein (e.g., GFP, GFP-2, tagGFP, turboGFP, eGFP, Emerald, Azami Green, monomeric Azami Green, CopGFP, AceGFP, ZsGreen1), yellow fluorescent protein (e.g., YFP, eYFP, Citrine, Venus, YPet, PhiYFP, ZsYellow1), blue fluorescent protein (e.g., eBFP, eBFP2, Sapphire, mKalamal, GFPuv, SkyBlue, T-Sapphire), cyan fluorescent protein (e.g., eCFP, Cerulean, CyPet, AmCyan1, Midoriishi-Cyan), red fluorescent protein (e.g., mKate, mKate2, mPlum, DsRed monomer, mCherry, mRFP1, DsRed-Express, DsRed2, DsRed-monomer, HcRed-Tandem, HcRed1, AsRed2, eqFP611, mRaspberry, mStrawberry, Jred), orange fluorescent protein (e.g., mOrange, mKO, Kusabira-Orange, monomeric Kusabira-Orange, mTangerine, tdTomato), and any other suitable fluorescent protein. Examples of tags include glutathione-S-transferase (GST), chitin binding protein (CBP), maltose binding protein, thioredoxin (TRX), poly(NANP), tandem affinity purification (TAP) tag, myc, AcV5, AU1, AU5, E, ECS, E2, FLAG, hemagglutinin (HA), nus, Softag 1, Softag3, Strep, SBP, Glu-Glu, HSV, KT3, S, S1, T7, V5, VSV-G, histidine (His), biotin carboxyl carrier protein (BCCP), and calmodulin.

[0243] The Cas protein can be provided in any form. For example, the Cas protein can be provided in the form of a protein. For example, the Cas protein can be provided as a Cas protein complexed with a gRNA. Alternatively, the Cas protein can be provided in the form of a nucleic acid encoding the Cas protein, such as RNA (e.g., messenger RNA (mRNA)) or DNA. Optionally, the nucleic acid encoding the Cas protein can be codon-optimized for efficient translation into protein in a particular cell or organism. For example, compared to a naturally occurring polynucleotide sequence, the nucleic acid encoding the Cas protein can be modified to substitute codons that have a higher usage frequency in a bacterial cell, yeast cell, human cell, non-human cell, mammalian cell, rodent cell, mouse cell, rat cell, or any other host cell of interest. For example, the nucleic acid encoding the Cas protein can be codon-optimized for expression in human cells. When the nucleic acid encoding the Cas protein is introduced into a cell, the Cas protein can be transiently, conditionally, or constitutively expressed in the cell.

[0244] The Cas protein provided as mRNA can be modified to enhance stability and / or immunogenic properties. One or more nucleosides within the mRNA can be modified. Examples of chemical modifications of mRNA nucleobases include pseudouridine, 1-methyl-pseudouridine, and 5-methyl-cytidine. For example, a capped and polyadenylated Cas mRNA containing N1-methylpseudouridine can be used. Similarly, Cas mRNA can be modified by deleting uridines using synonymous codons.

[0245] The nucleic acid encoding the Cas protein can be stably integrated into the genome of the cell and is operably linked to a promoter that is active in the cell. In one specific instance, the nucleic acid encoding the Cas protein can comprise, consist essentially of, or consist of: SEQ ID NO:22 or a sequence that is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:22, optionally wherein the nucleic acid encodes a protein that comprises, consists essentially of, or consists of: SEQ ID NO:21. In another specific instance, the nucleic acid encoding a chimeric Cas protein comprising a nuclease-inactivated Cas protein and one or more transcriptional activation domains can comprise, consist essentially of, or consist of: SEQ ID NO:38 or a sequence that is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:38, optionally wherein the nucleic acid encodes a protein that comprises, consists essentially of, or consists of: SEQ ID NO:36. Alternatively, the nucleic acid encoding the Cas protein can be operably linked to a promoter in an expression construct. An expression construct is any nucleic acid construct capable of directing the expression of a gene or other nucleic acid sequence of interest (e.g., the Cas gene) and can transfer such nucleic acid sequence of interest to a target cell. Promoters that can be used for the expression construct include promoters that are active in one or more of, for example, eukaryotic cells, human cells, non-human cells, mammalian cells, non-human mammalian cells, rodent cells, mouse cells, rat cells, pluripotent cells, embryonic stem (ES) cells, adult stem cells, developmentally restricted progenitor cells, induced pluripotent stem (iPS) cells, or single-cell stage embryos. Such promoters can be, for example, conditional promoters, inducible promoters, constitutive promoters, or tissue-specific promoters.

[0246] 3. Chimeric adaptor protein

[0247] The SAM / tau biosensor cells disclosed herein may not only include nucleic acids (DNA or RNA) encoding chimeric Cas proteins, where the chimeric Cas proteins include nuclease-inactivated Cas proteins fused to one or more transcriptional activation domains (e.g., VP64); but may also optionally include nucleic acids (DNA or RNA) encoding chimeric adaptor proteins, where the chimeric adaptor proteins include adaptor proteins (e.g., MS2 coat protein (MCP)) fused to one or more transcriptional activation domains (e.g., fused to p65 and HSF1). Optionally, the chimeric Cas proteins and / or chimeric adaptor proteins are stably expressed. Optionally, the cells include genomically integrated chimeric Cas protein coding sequences and / or genomically integrated chimeric adaptor protein coding sequences.

[0248] Such chimeric adaptor proteins include: (a) an adaptor (i.e., an adaptor domain or adaptor protein) that specifically binds to an adaptor-binding element within a guide RNA; and (b) one or more heterologous transcriptional activation domains. For example, such fusion proteins may include 1, 2, 3, 4, 5, or more transcriptional activation domains (e.g., two or more heterologous transcriptional activation domains or three or more heterologous transcriptional activation domains). In one example, such chimeric adaptor proteins may include: (a) an adaptor (i.e., an adaptor domain or adaptor protein) that specifically binds to an adaptor-binding element within a guide RNA; and (b) two or more transcriptional activation domains. For example, the chimeric adaptor protein may include: (a) an MS2 coat protein adaptor that specifically binds to one or more MS2 aptamers within a guide RNA (e.g., two MS2 aptamers in separate locations within the guide RNA); and (b) one or more (e.g., two or more transcriptional activation domains). For example, the two transcriptional activation domains may be p65 and HSF1 transcriptional activation domains or functional fragments or variants thereof. However, chimeric adaptor proteins are also provided where the transcriptional activation domain includes other transcriptional activation domains or functional fragments or variants thereof.

[0249] One or more transcriptional activation domains may be directly fused to the adaptor. Alternatively, one or more transcriptional activation domains may be linked to the adaptor via a linker or linker combination or via one or more additional domains. Similarly, if there are two or more transcriptional activation domains, the domains may be directly fused to each other or may be linked to each other via a linker or linker combination or via one or more additional domains. Linkers that may be used for these fusion proteins may contain any sequence that does not interfere with the function of the fusion protein. Exemplary linkers are short (e.g., 2-20 amino acids) and are generally flexible (e.g., include amino acids with high degrees of freedom such as glycine, alanine, and serine).

[0250] One or more transcriptional activation domains and the linker can be in any order within the chimeric adaptor protein. As an option, one or more transcriptional activation domains can be at the C-terminus of the linker and the linker can be at the N-terminus of one or more transcriptional activation domains. For example, one or more transcriptional activation domains can be at the C-terminus of the chimeric adaptor protein and the linker can be at the N-terminus of the chimeric adaptor protein. However, one or more transcriptional activation domains can be at the C-terminus of the linker and not at the C-terminus of the chimeric adaptor protein (e.g., if a nuclear localization signal is at the C-terminus of the chimeric adaptor protein). Similarly, the linker can be at the N-terminus of one or more transcriptional activation domains and not at the N-terminus of the chimeric adaptor protein (e.g., if a nuclear localization signal is at the N-terminus of the chimeric adaptor protein). As another option, one or more transcriptional activation domains can be at the N-terminus of the linker and the linker can be at the C-terminus of one or more transcriptional activation domains. For example, one or more transcriptional activation domains can be at the N-terminus of the chimeric adaptor protein and the linker can be at the C-terminus of the chimeric adaptor protein. As another option, if the chimeric adaptor protein comprises two or more transcriptional activation domains, the two or more transcriptional activation domains can flank the linker.

[0251] The chimeric adaptor protein can also be operably linked or fused to an additional heterologous polypeptide. The fused or linked heterologous polypeptide can be located at the N-terminus, C-terminus, or anywhere within the chimeric adaptor protein. For example, the chimeric adaptor protein can further comprise a nuclear localization signal. Specific examples of such proteins include the MS2 coat protein (linker) linked to the C-terminus of the p65 transcriptional activation domain and the C-terminus of the HSF1 transcriptional activation domain of the p65 transcriptional activation domain (directly or via an NLS) of the MS2 coat protein. Such proteins can comprise, consist essentially of, or consist of, from the N-terminus to the C-terminus: MCP; nuclear localization signal; p65 transcriptional activation domain; and HSF1 transcriptional activation domain. For example, the chimeric adaptor protein can comprise, consist essentially of, or consist of an amino acid sequence that is at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the MCP-p65-HSF1 chimeric adaptor protein sequence shown in SEQ ID NO:37. Similarly, the nucleic acid encoding the chimeric adaptor protein can comprise, consist essentially of, or consist of a sequence that is at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the MCP-p65-HSF1 chimeric adaptor protein coding sequence shown in SEQ ID NO:39.

[0252] An adaptor (i.e., an adaptor domain or adaptor protein) is a nucleic acid-binding domain (e.g., a DNA-binding domain and / or an RNA-binding domain) that specifically recognizes and binds to different sequences (e.g., binds to different DNA and / or RNA sequences, such as an aptamer in a sequence-specific manner). An aptamer comprises a nucleic acid that can bind to a target molecule with high affinity and specificity through its ability to adopt a specific three-dimensional conformation. For example, such adaptors can bind to specific RNA sequences and secondary structures. These sequences (i.e., adaptor-binding elements) can be engineered into a guide RNA. For example, the MS2 aptamer can be engineered into a guide RNA to specifically bind to the MS2 coat protein (MCP). For example, an adaptor can comprise, consist essentially of, or consist of: an amino acid sequence that is at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the MCP sequence shown in SEQ ID NO:40. Similarly, a nucleic acid encoding an adaptor can comprise, consist essentially of, or consist of: an amino acid sequence that is at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the MCP-encoding sequence shown in SEQ ID NO:41. Specific examples of adaptors and targets include, for example, RNA-binding protein / aptamer combinations present within the diversity of phage coat proteins. See, for example, US 2019-0284572 and WO 2019 / 183123, each of which is incorporated herein by reference in its entirety for all purposes.

[0253] The chimeric adaptor proteins disclosed herein include one or more transcriptional activation domains. Such transcriptional activation domains can be naturally occurring transcriptional activation domains, functional fragments or functional variants of naturally occurring transcriptional activation domains, or can be engineered or synthetic transcriptional activation domains. Transcriptional activation domains that can be used include, for example, those described in US2019-0284572 and WO 2019 / 183123, each of which is incorporated herein by reference in its entirety for all purposes.

[0254] 4. Cell type

[0255] The Cas / tau biosensor cells disclosed herein can be any type of cell and can be in vitro, ex vivo, or in vivo. The Cas / tau biosensor cell line or cell population can be a monoclonal cell line or cell population. Similarly, the SAM / tau biosensor cells disclosed herein can be any type of cell and can be in vitro, ex vivo, or in vivo. The SAM / tau biosensor cell line or cell population can be a monoclonal cell line or cell population. The cells can be from any source. For example, the cells can be eukaryotic cells, animal cells, plant cells, or fungal (e.g., yeast) cells. Such cells can be fish cells or bird cells, or such cells can be mammalian cells, such as human cells, non-human mammalian cells, rodent cells, mouse cells, or rat cells. Mammals include, for example, humans, non-human primates, monkeys, apes, cats, dogs, horses, bulls, deer, bison, sheep, rodents (e.g., mice, rats, hamsters, guinea pigs), livestock (e.g., bovine species such as cows and bulls; ovine species such as sheep and goats; and porcine species such as pigs and wild boars). Birds include, for example, chickens, turkeys, ostriches, geese, and ducks. Also included are domestic and agricultural animals. The term "non-human animal" excludes humans. In a specific example, the Cas / tau biosensor cells are human cells (e.g., HEK293T cells). Similarly, in a specific example, the SAM / tau biosensor cells are human cells (e.g., HEK293T cells).

[0256] The cells can be, for example, totipotent or pluripotent cells (e.g., embryonic stem (ES) cells such as rodent ES cells, mouse ES cells, or rat ES cells). Totipotent cells include undifferentiated cells that can give rise to any cell type, and pluripotent cells include undifferentiated cells that have the ability to develop into more than one differentiated cell type. Such pluripotent and / or totipotent cells can be, for example, ES cells or ES-like cells, such as induced pluripotent stem (iPS) cells. ES cells include embryo-derived totipotent or pluripotent cells that are capable of contributing to any tissue of the developing embryo when introduced into the embryo. ES cells can be derived from the inner cell mass of a blastocyst and are capable of differentiating into cells of any of the three vertebrate germ layers (endoderm, ectoderm, and mesoderm).

[0257] The cell can also be a primary somatic cell, or a cell that is not a primary somatic cell. Somatic cells can include any cell that is not a gamete, germ cell, gametocyte, or undifferentiated stem cell. The cell can also be a primary cell. Primary cells include cells or cell cultures directly isolated from an organism, organ, or tissue. Primary cells include cells that are neither transformed nor immortalized. The primary cells include any cells obtained from an organism, organ, or tissue that have not been passaged in tissue culture previously, or that have been passaged in tissue culture previously but cannot be passaged indefinitely in tissue culture. Such cells can be isolated by conventional techniques and include, for example, somatic cells, hematopoietic cells, endothelial cells, epithelial cells, fibroblasts, mesenchymal cells, keratinocytes, melanocytes, monocytes, mononuclear cells, adipocytes, preadipocytes, neurons, glial cells, hepatocytes, skeletal muscle myoblasts, and smooth muscle cells. For example, primary cells can be derived from connective tissue, muscle tissue, nervous system tissue, or epithelial tissue.

[0258] Such cells also include cells that do not normally proliferate indefinitely but can continue to divide due to mutations or alterations that escape normal cellular senescence. Such mutations or alterations can be naturally occurring or intentionally induced. Examples of immortalized cells include Chinese hamster ovary (CHO) cells, human embryonic kidney cells (e.g., HEK293T cells), and mouse embryonic fibroblasts (e.g., 3T3 cells). Many types of immortalized cells are well known. Immortalized or primary cells include cells that are commonly used for culturing or expressing recombinant genes or proteins.

[0259] The cell can also be a differentiated cell, such as a neuronal cell (e.g., a human neuronal cell).

[0260] B. Methods for generating Cas / tau biosensor cells and SAM / tau biosensor cells

[0261] The Cas / tau biosensor cells disclosed herein can be generated by any known means. The first tau repeat domain linked to the first reporter gene, the second tau repeat domain linked to the second reporter gene, and the Cas protein can be introduced into the cell in any form (e.g., DNA, RNA, or protein) by any known means. Similarly, the SAM / tau biosensor cells disclosed herein can be generated by any known means. The first tau repeat domain linked to the first reporter gene, the second tau repeat domain linked to the second reporter gene, the chimeric Cas protein, and the chimeric adaptor protein can be introduced into the cell in any form (e.g., DNA, RNA, or protein) by any known means. "Introducing" includes presenting a nucleic acid or protein to a cell in a manner that causes the sequence to enter the interior of the cell. The methods provided herein do not depend on a particular method for introducing nucleic acids or proteins into cells, only on the entry of the nucleic acid or protein into the interior of at least one cell. Methods for introducing nucleic acids and proteins into various cell types are known and include, for example, stable transfection methods, transient transfection methods, and virus-mediated methods. Optionally, a targeting vector can be used.

[0262] The transfection protocol and the protocol for introducing nucleic acids or proteins into cells can vary. Non-limiting transfection methods include chemically based transfection methods using: liposomes; nanoparticles; calcium phosphate (Graham et al. (1973) Virology 52(2):456–67, Bacchetti et al. (1977) Proc. Natl. Acad. Sci. USA 74(4):1590-4, and Kriegler, M (1991) Transfer and Expression: A Laboratory Manual. New York: W.H. Freeman and Company. pp. 96-97); dendrimers; or cationic polymers such as DEAE-dextran or polyethyleneimine. Non-chemical methods include electroporation, sonoporation, and optoporation. Particle-based transfection includes using a gene gun or magnet-assisted transfection (Bertram (2006) Current Pharmaceutical Biotechnology 7, 277–28). Viral methods can also be used for transfection.

[0263] Nucleic acids or proteins can also be introduced into cells by electroporation, intracytoplasmic injection, viral infection, adenovirus, adeno-associated virus, lentivirus, retrovirus, transfection, lipid-mediated transfection, or by nucleofection. Nucleofection is an improved electroporation technique that enables nucleic acid substrates to be delivered not only to the cytoplasm but also into the nucleus through the nuclear membrane. Additionally, nucleofection typically requires far fewer cells (e.g., only about 2 million compared to 7 million for conventional electroporation) when used in the methods disclosed herein. In one example, nucleofection is performed using NUCLEOFECTOR TM system.

[0264] Nucleic acids or proteins can also be introduced into cells by microinjection. Microinjection of mRNA is preferably into the cytoplasm (e.g., to directly deliver mRNA to the translation machinery), while microinjection of proteins or DNA encoding proteins is preferably into the nucleus. Alternatively, microinjection can be performed by injecting into both the nucleus and cytoplasm: the needle can first be introduced into the nucleus and a first volume injected, and when the needle is removed from the cell, a second volume can be injected into the cytoplasm. Methods for performing microinjection are well known. See, for example, Nagy et al. (Nagy A, Gertsenstein M, Vintersten K, Behringer R., 2003, Manipulating the Mouse Embryo. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press); Meyer et al. (2010) Proceedings of the National Academy of Sciences 107:15022 - 15026 and Meyer et al. (2012) Proceedings of the National Academy of Sciences 109:9354 - 9359.

[0265] Other methods for introducing nucleic acids or proteins into cells can include, for example, vector delivery, particle-mediated delivery, exosome-mediated delivery, lipid nanoparticle-mediated delivery, cell-penetrating peptide-mediated delivery, or implant device-mediated delivery. Methods for administering nucleic acids or proteins to a subject to modify cells in vivo are disclosed elsewhere herein.

[0266] In one example, a first tau repeat domain linked to a first reporter gene, a second tau repeat domain linked to a second reporter gene, and a Cas protein can be introduced by viral transduction such as lentiviral transduction.

[0267] Screening for cells comprising a first tau repeat domain linked to a first reporter gene, a second tau repeat domain linked to a second reporter gene, and a Cas protein can be performed by any known means.

[0268] For example, reporter genes can be used to screen for cells having a Cas protein, a first tau repeat domain linked to a first reporter gene, or a second tau repeat domain linked to a second reporter gene. Exemplary reporter genes include those encoding luciferase, β-galactosidase, green fluorescent protein (GFP), enhanced green fluorescent protein (eGFP), cyan fluorescent protein (CFP), yellow fluorescent protein (YFP), enhanced yellow fluorescent protein (eYFP), blue fluorescent protein (BFP), enhanced blue fluorescent protein (eBFP), DsRed, ZsGreen, MmGFP, mPlum, mCherry, tdTomato, mStrawberry, J-Red, mOrange, mKO, mCitrine, Venus, YPet, Emerald, CyPet, SkyBlue, T-Sapphire, and alkaline phosphatase. For example, if the first and second reporter genes are fluorescent proteins (e.g., CFP and YFP), cells comprising these reporter genes can be selected by flow cytometry to select double-positive cells. The double-positive cells can then be combined to generate a polyclonal line, or a monoclonal line can be generated from a single double-positive cell.

[0269] As another example, selectable markers can be used to screen for cells having a Cas protein, a first tau repeat domain linked to a first reporter gene, or a second tau repeat domain linked to a second reporter gene. Exemplary selectable markers include neomycin phosphotransferase (neo r ), hygromycin B phosphotransferase (hyg r ), puromycin-N-acetyltransferase (puro r ), blasticidin S deaminase (bsr r ), xanthine / guanine phosphoribosyltransferase (gpt), or herpes simplex virus thymidine kinase (HSV-k). Another exemplary selectable marker is the bleomycin resistance protein, encoded by the Sh ble gene (bleomycin gene of Streptoalloteichus hindustanus), which confers resistance to zeocin (phleomycin D1).

[0270] For example, aggregation-positive (Agg[+]) cells in which the tau repeat domain stably exists in an aggregated state can be generated, for example, by seeding with tau aggregates, which means that tau repeat domain aggregates stably exist in all cells that grow over time and are passaged multiple times. For example, the originally aggregation-negative (Agg[-]) Cas / tau biosensor cells disclosed herein can be treated with recombinant prefibrillar tau (e.g., recombinant prefibrillar tau repeat domain) to seed the aggregation of the tau repeat domain protein stably expressed by these cells. Similarly, the originally aggregation-negative (Agg[-]) SAM / tau biosensor cells disclosed herein can be treated with recombinant prefibrillar tau (e.g., recombinant prefibrillar tau repeat domain) to seed the aggregation of the tau repeat domain protein stably expressed by these cells. The prefibrillar tau repeat domain can be the same as, similar to, or different from the tau repeat domain stably expressed by the cells. Optionally, the recombinant prefibrillar tau can be mixed with a liposome reagent. The seeded cells can then be serially diluted to obtain single-cell-derived clones, and clonal cell lines can be identified in which tau repeat domain aggregates stably exist in all cells that grow over time and are passaged multiple times.

[0271] As another example, aggregation-positive (Agg[+]) cells in which the tau repeat domain stably exists in an aggregated state can be generated, for example, by seeding cells (e.g., tau aggregation-negative cells) with cell lysates from tau aggregation-positive cells, which means that tau repeat domain aggregates stably exist in all cells that grow over time and are passaged multiple times. This is the "maximal seeding" described in the examples herein. For example, cells can be seeded with a culture medium comprising the cell lysate (e.g., fresh culture medium comprising the cell lysate). "Maximal seeding" can refer to the seeding itself inducing tau aggregation in most aggregation-negative tau biosensor cells. "Minimal seeding" can refer to the seeding itself being insufficient to induce tau aggregation (or only minimally inducing tau aggregation) in aggregation-negative tau biosensor cells but sensitizing such cells to aggregation induction.

[0272] The amount or concentration of cell lysate in the culture medium can be any suitable amount or concentration. For example, the concentration of cell lysate in the culture medium can be between about 0.1 μg / mL and about 50 μg / mL, between about 0.1 μg / mL and about 25 μg / mL, between about 0.1 μg / mL and about 10 μg / mL, between about 0.1 μg / mL and about 5 μg / mL, between about 0.1 μg / mL and about 4.5 μg / mL, between about 0.1 μg / mL and about 4 μg / mL, between about 0.1 μg / mL and about 3.5 μg / mL, between about 0.1 μg / mL and about 3 μg / mL, between about 0.1 μg / mL and about 2.5 μg / mL, between about 0.1 μg / mL and about 2 μg / mL, between about 0.1 μg / mL and about 1.5 μg / mL, between about 0.1 μg / mL and about 1 μg / mL, between about 0.5 μg / mL and about 50 μg / mL, between about 0.5 μg / mL and about 25 μg / mL, between about 0.5 μg / mL and about 10 μg / mL, between about 0.5 μg / mL and about 5 μg / mL, between about 0.5 μg / mL and about 4.5 μg / mL, between about 0.5 μg / mL and about 4 μg / mL, between about 0.5 μg / mL and about 3.5 μg / mL, between about 0.5 μg / mL and about 3 μg / mL, between about 0.5 μg / mL and about 2.5 μg / mL, between about 0.5 μg / mL and about 2 μg / mL, between about 0.5 μg / mL and about 1.5 μg / mL, between about 0.5 μg / mL and about 1 μg / mL, between about 1 μg / mL and about 50 μg / mL, between about 1 μg / mL and about 25 μg / mL, between about 1 μg / mL and about 10 μg / mL, between about 1 μg / mL and about 5 μg / mL, between about 1 μg / mL and about 4.5 μg / mL, between about 1 μg / mL and about 4 μg / mL, between about 1 μg / mL and about 3.5 μg / mL, between about 1 μg / mL and about 3 μg / mL, between about 1 μg / mL and about 2.5 μg / mL, between about 1 μg / mL and about 2 μg / mL, between about 1 μg / mL and about 1.5 μg / mL, between about 1.5 μg / mL and about 50 μg / mL, between about 1.5 μg / mL and about 25 μg / mL, between about 1.5 μg / mL and about 10 μg / mL, between about 1.5 μg / mL and about 5 μg / mL, between about 1.5 μg / mL and about 4.5 μg / mL, between about 1.5 μg / mL and about 4 μg / mL, between about 1.5 μg / mL and about 3.5 μg / mL, between about 1.Between 5 μg / mL and about 3 μg / mL, between about 1.5 μg / mL and about 2.5 μg / mL, between about 1.5 μg / mL and about 2 μg / mL, between about 2 μg / mL and about 50 μg / mL, between about 2 μg / mL and about 25 μg / mL, between about 2 μg / mL and about 10 μg / mL, between about 2 μg / mL and about 5 μg / mL, between about 2 μg / mL and about 4.5 μg / mL, between about 2 μg / mL and about 4 μg / mL, between about 2 μg / mL and about 3.5 μg / mL, between about 2 μg / mL and about 3 μg / mL, between about 2 μg / mL and about 2.5 μg / mL, between about 2.5 μg / mL and about 50 μg / mL, between about 2.5 μg / mL and about 25 μg / mL, between about 2.5 μg / mL and about 10 μg / mL, between about 2.5 μg / mL and about 5 μg / mL, between about 2.5 μg / mL and about 4.5 μg / mL, between about 2.5 μg / mL and about 4 μg / mL, between about 2.5 μg / mL and about 3.5 μg / mL or between about 2.5 μg / mL and about 3 μg / mL of a culture medium (e.g., fresh medium). For example, the concentration of cell lysate in the culture medium can be between about 1 μg / mL and about 5 μg / mL or the concentration can be about 1.5 μg / mL, about 2 μg / mL, about 2.5 μg / mL, about 3 μg / mL, about 3.5 μg / mL, about 4 μg / mL, about 4.5 μg / mL or about 5 μg / mL. Optionally, the cell lysate can be in a buffer such as phosphate buffered saline. Optionally, the buffer can include protease inhibitors. Examples of protease inhibitors include but are not limited to AEBSF, aprotinin, bestatin, E-64, leupeptin, pepstatin A and ethylenediaminetetraacetic acid (EDTA). The buffer can include any one or any combination of these inhibitors (e.g., the buffer can include all of these protease inhibitors).

[0273] Cells used to produce the lysate can be collected in a buffer such as phosphate buffered saline. Optionally, the buffer can include protease inhibitors. Examples of protease inhibitors include but are not limited to AEBSF, aprotinin, bestatin, E-64, leupeptin, pepstatin A and ethylenediaminetetraacetic acid (EDTA). The buffer can include any one or any combination of these inhibitors (e.g., the buffer can include all of these protease inhibitors).

[0274] Cell lysates can be collected, for example, by sonication of tau aggregation-positive cells (e.g., cells collected in buffer and protease inhibitor as described above) for any suitable amount of time. For example, the cells can be sonicated for about 1 minute to about 6 minutes, about 1 minute to about 5 minutes, about 1 minute to about 4 minutes, about 1 minute to about 3 minutes, about 2 minutes to about 6 minutes, about 2 minutes to about 5 minutes, about 2 minutes to about 4 minutes, about 2 minutes to about 3 minutes, about 2 minutes to about 6 minutes, about 3 minutes to about 5 minutes, or about 3 minutes to 4 minutes. For example, the cells can be sonicated for about 2 minutes to about 4 minutes or about 3 minutes.

[0275] Optionally, the culture medium comprises liposomes or lipoproteosomes (e.g., cationic liposomes) or phospholipids or another transfection agent. Optionally, the culture medium comprises liposomes. Optionally, the culture medium does not comprise liposomes or lipoproteosomes (e.g., cationic liposomes) or phospholipids or another transfection agent. Optionally, the culture medium does not comprise liposomes. The amount or concentration of liposomes or lipoproteosomes (e.g., cationic liposomes) or phospholipids or other transfection agents in the culture medium can be any suitable amount or concentration. For example, the concentration of liposomes or lipoproteosomes (e.g., cationic liposomes) or phospholipids or other transfection agents in the culture medium can be between about 0.5 μL / mL and about 10 μL / mL, between about 0.5 μL / mL and about 5 μL / mL, between about 0.5 μL / mL and about 4.5 μL / mL, between about 0.5 μL / mL and about 4 μL / mL, between about 0.5 μL / mL and about 3.5 μL / mL, between about 0.5 μL / mL and about 3 μL / mL, between about 0.5 μL / mL and about 2.5 μL / mL, between about 0.5 μL / mL and about 2 μL / mL, between about 0.5 μL / mL and about 1.5 μL / mL, between about 0.5 μL / mL and about 1 μL / mL, between about 1 μL / mL and about 10 μL / mL, between about 1 μL / mL and about 5 μL / mL, between about 1 μL / mL and about 4.5 μL / mL, between about 1 μL / mL and about 4 μL / mL, between about 1 μL / mL and about 3.5 μL / mL, between about 1 μL / mL and about 3 μL / mL, between about 1 μL / mL and about 2.5 μL / mL, between about 1 μL / mL and about 2 μL / mL, between about 1 μL / mL and about 1.5 μL / mL, between about 1.5 μL / mL and about 10 μL / mL, between about 1.5 μL / mL and about 5 μL / mL, between about 1.5 μL / mL and about 4.5 μL / mL, between about 1.5 μL / mL and about 4 μL / mL, between about 1.5 μL / mL and about 3.5 μL / mL, between about 1.5 μL / mL and about 3 μL / mL, between about 1.5 μL / mL and about 2.5 μL / mL, between about 1.5 μL / mL and about 2 μL / mL, between about 2 μL / mL and about 10 μL / mL, between about 2 μL / mL and about 5 μL / mL, between about 2 μL / mL and about 4.5 μL / mL, between about 2 μL / mL and about 4 μL / mL, between about 2 μL / mL and about 3.5 μL / mL, between about 2 μL / mL and about 3 μL / mL, or between about 2 μL / mL and about 2.5 μL / mL of the culture medium (e.g., fresh culture medium).For example, the concentration of liposomes or lipopolymers (e.g., cationic lipopolymers) or phospholipids or other transfection agents in the culture medium can be between about 1.5 μL / mL and about 4 μL / mL or can be about 1.5 μL / mL, about 2 μL / mL, about 2.5 μL / mL, about 3 μL / mL, about 3.5 μL / mL, or about 4 μL / mL.

[0276] Tau intercellular propagation may also be caused by tau aggregation activity secreted by cells containing aggregates. For example, Agg[+] cells, or cells sensitized to become Agg[+] cells (e.g., sensitized to tau seeding or tau aggregation activity) can be generated by co-culturing Agg[-] Cas / tau biosensors with Agg[+] cells. Similarly, Agg[+] cells, or cells sensitized to become Agg[+] cells (e.g., sensitized to tau seeding or tau aggregation activity) can be generated by co-culturing Agg[-] SAM / tau biosensors with Agg[+] cells.

[0277] Agg[+] cells, or cells sensitized to become Agg[+] cells (e.g., sensitized to tau seeding or tau aggregation activity) can also be generated using conditioned medium collected from cultured tau aggregation-positive cells, wherein, as described herein, the tau repeat domain stably exists in an aggregated state. This is the "minimal seeding" disclosed in the examples herein. Conditioned medium refers to used medium collected from cultured cells. The conditioned medium contains metabolites, growth factors, and extracellular matrix proteins secreted by the cultured cells into the medium. The use of conditioned medium does not involve co-culturing with Agg[+] cells (i.e., primary Agg[-] cells are not co-cultured with Agg[+] cells). As an example, conditioned medium can be generated by collecting the medium on confluent Agg[+] cells. The medium can be on confluent Agg[+] cells for about 12 hours, about 24 hours, about 2 days, about 3 days, about 4 days, about 5 days, about 6 days, about 7 days, about 8 days, about 9 days, or about 10 days. For example, the medium can be on confluent Agg[+] cells for about 1 to about 7 days, about 2 to about 6 days, about 3 to about 5 days, or about 4 days. The conditioned medium can then be applied to primary (Agg[-]) Cas / tau biosensor cells together with fresh medium. Similarly, the conditioned medium can then be applied to primary (Agg[-]) SAM / tau biosensor cells together with fresh medium. The ratio of conditioned medium to fresh medium can be, for example, about 10:1, about 9:1, about 8:1, about 7:1, about 6:1, about 5:1, about 4:1, about 3:1, about 2:1, about 1:1, about 1:2, about 1:3, about 1:4, about 1:5, about 1:6, about 1:7, about 1:8, about 1:9, or about 1:10. For example, the ratio of conditioned medium to fresh medium can be about 5:1 to about 1:1, about 4:1 to about 2:1, or about 3:1.For example, the use of conditioned medium can include culturing a genetically modified cell population in: approximately 90% conditioned medium and approximately 10% fresh medium, approximately 85% conditioned medium and approximately 15% fresh medium, approximately 80% conditioned medium and approximately 20% fresh medium, approximately 75% conditioned medium and approximately 25% fresh medium, approximately 70% conditioned medium and approximately 30% fresh medium, approximately 65% conditioned medium and approximately 35% fresh medium, approximately 60% conditioned medium and approximately 40% fresh medium, approximately 55% conditioned medium and approximately 45% fresh medium, approximately 50% conditioned medium and approximately 50% fresh medium, approximately 45% conditioned medium and approximately 55% fresh medium, approximately 40% conditioned medium and approximately 60% fresh medium, approximately 35% conditioned medium and approximately 65% fresh medium, approximately 30% conditioned medium and approximately 70% fresh medium, approximately 25% conditioned medium and approximately 75% fresh medium, approximately 20% conditioned medium and approximately 80% fresh medium, approximately 15% conditioned medium and approximately 85% fresh medium, or approximately 10% conditioned medium and approximately 90% fresh medium. In one example, the use of conditioned medium can include culturing a genetically modified cell population in a medium comprising at least approximately 50% conditioned medium and no more than approximately 50% fresh medium. In a specific example, the use of conditioned medium can include culturing a genetically modified cell population in approximately 75% conditioned medium and approximately 25% fresh medium. Optionally, the conditioned medium is applied to naïve Agg[-] cells that are free of liposomes or free of liposomes (e.g., cationic liposomes) or free of phospholipids. Optionally, the genetically modified cell population is not co-cultured with the tau aggregation positive cells, where the tau repeat domain stably exists in an aggregated state.

[0278] Conditioned medium without co-culture has not been used as an inoculum in this context before. However, conditioned medium is particularly useful for large-scale genome-wide screening because in vitro generated tau fibrils are a limited resource. Additionally, conditioned medium is more physiologically relevant because it is produced and secreted by cells rather than being generated and secreted in vitro. The use of conditioned medium as described herein provides an enhancement of tau seeding activity (e.g., approximately 0.1% as measured by FRET induction as disclosed elsewhere herein) to sensitize cells to tau aggregation.

[0279] C. In Vitro Culture and Conditioned Medium

[0280] The present disclosure also provides in vitro cultures or compositions comprising the Cas / tau biosensor cells disclosed herein and a culture medium for culturing those cells. The present disclosure also provides in vitro cultures or compositions comprising the SAM / tau biosensor cells disclosed herein and a culture medium for culturing those cells. The cells can be Agg[-] cells or Agg[+] cells. For example, the culture or composition can comprise Agg[-] cells. In one instance, the culture medium comprises conditioned medium from Agg[+] cells as disclosed elsewhere herein. Optionally, the cells in the culture or composition are Agg[-] cells and are not co-cultured with Agg[+] cells. The culture medium can comprise a mixture of conditioned medium and fresh medium. As an example, the ratio of conditioned medium to fresh medium can be, for example, about 10:1, about 9:1, about 8:1, about 7:1, about 6:1, about 5:1, about 4:1, about 3:1, about 2:1, about 1:1, about 1:2, about 1:3, about 1:4, about 1:5, about 1:6, about 1:7, about 1:8, about 1:9, or about 1:10. For example, the ratio of conditioned medium to fresh medium can be from about 5:1 to about 1:1, from about 4:1 to about 2:1, or about 3:1. For example, the use of conditioned medium can comprise culturing a genetically modified cell population in about 90% conditioned medium and about 10% fresh medium, about 85% conditioned medium and about 15% fresh medium, about 80% conditioned medium and about 20% fresh medium, about 75% conditioned medium and about 25% fresh medium, about 70% conditioned medium and about 30% fresh medium, about 65% conditioned medium and about 35% fresh medium, about 60% conditioned medium and about 40% fresh medium, about 55% conditioned medium and about 45% fresh medium, about 50% conditioned medium and about 50% fresh medium, about 45% conditioned medium and about 55% fresh medium, about 40% conditioned medium and about 60% fresh medium, about 35% conditioned medium and about 65% fresh medium, about 30% conditioned medium and about 70% fresh medium, about 25% conditioned medium and about 75% fresh medium, about 20% conditioned medium and about 80% fresh medium, about 15% conditioned medium and about 85% fresh medium, or about 10% conditioned medium and about 90% fresh medium. In one instance, the use of conditioned medium can comprise culturing a genetically modified cell population in a culture medium comprising at least about 50% conditioned medium and no more than about 50% fresh medium. In a specific instance, the use of conditioned medium can comprise culturing a genetically modified cell population in about 75% conditioned medium and about 25% fresh medium. Optionally, the culture medium comprises liposomes or lipoplexes (e.g., cationic liposomes) or phospholipids. Optionally, the culture medium does not comprise liposomes or lipoplexes (e.g., cationic liposomes) or phospholipids. Optionally, the culture medium does not comprise liposomes.

[0281] D. In vitro cultures and media comprising lysates from tau aggregation-positive cells

[0282] Also disclosed herein are in vitro cultures or compositions comprising the Cas / tau biosensor cells disclosed herein and media for culturing those cells. Also disclosed herein are in vitro cultures or compositions comprising the SAM / tau biosensor cells disclosed herein and media for culturing those cells. In one example, the medium comprises a cell lysate from cultured tau aggregation-positive cells, wherein the tau repeat domain is stably present in an aggregated state. The cells can be Agg[-] cells or Agg[+] cells. For example, the culture or composition can comprise Agg[-] cells. Optionally, the cells in the culture or composition are Agg[-] cells and are not co-cultured with Agg[+] cells. The medium can comprise a mixture of fresh medium and cell lysate.

[0283] The amount or concentration of cell lysate in the culture medium can be any suitable amount or concentration. For example, the concentration of cell lysate in the culture medium can be between about 0.1 μg / mL and about 50 μg / mL, between about 0.1 μg / mL and about 25 μg / mL, between about 0.1 μg / mL and about 10 μg / mL, between about 0.1 μg / mL and about 5 μg / mL, between about 0.1 μg / mL and about 4.5 μg / mL, between about 0.1 μg / mL and about 4 μg / mL, between about 0.1 μg / mL and about 3.5 μg / mL, between about 0.1 μg / mL and about 3 μg / mL, between about 0.1 μg / mL and about 2.5 μg / mL, between about 0.1 μg / mL and about 2 μg / mL, between about 0.1 μg / mL and about 1.5 μg / mL, between about 0.1 μg / mL and about 1 μg / mL, between about 0.5 μg / mL and about 50 μg / mL, between about 0.5 μg / mL and about 25 μg / mL, between about 0.5 μg / mL and about 10 μg / mL, between about 0.5 μg / mL and about 5 μg / mL, between about 0.5 μg / mL and about 4.5 μg / mL, between about 0.5 μg / mL and about 4 μg / mL, between about 0.5 μg / mL and about 3.5 μg / mL, between about 0.5 μg / mL and about 3 μg / mL, between about 0.5 μg / mL and about 2.5 μg / mL, between about 0.5 μg / mL and about 2 μg / mL, between about 0.5 μg / mL and about 1.5 μg / mL, between about 0.5 μg / mL and about 1 μg / mL, between about 1 μg / mL and about 50 μg / mL, between about 1 μg / mL and about 25 μg / mL, between about 1 μg / mL and about 10 μg / mL, between about 1 μg / mL and about 5 μg / mL, between about 1 μg / mL and about 4.5 μg / mL, between about 1 μg / mL and about 4 μg / mL, between about 1 μg / mL and about 3.5 μg / mL, between about 1 μg / mL and about 3 μg / mL, between about 1 μg / mL and about 2.5 μg / mL, between about 1 μg / mL and about 2 μg / mL, between about 1 μg / mL and about 1.5 μg / mL, between about 1.5 μg / mL and about 50 μg / mL, between about 1.5 μg / mL and about 25 μg / mL, between about 1.5 μg / mL and about 10 μg / mL, between about 1.5 μg / mL and about 5 μg / mL, between about 1.5 μg / mL and about 4.5 μg / mL, between about 1.5 μg / mL and about 4 μg / mL, between about 1.5 μg / mL and about 3.5 μg / mL, between about 1.Between 5 μg / mL and about 3 μg / mL, between about 1.5 μg / mL and about 2.5 μg / mL, between about 1.5 μg / mL and about 2 μg / mL, between about 2 μg / mL and about 50 μg / mL, between about 2 μg / mL and about 25 μg / mL, between about 2 μg / mL and about 10 μg / mL, between about 2 μg / mL and about 5 μg / mL, between about 2 μg / mL and about 4.5 μg / mL, between about 2 μg / mL and about 4 μg / mL, between about 2 μg / mL and about 3.5 μg / mL, between about 2 μg / mL and about 3 μg / mL, between about 2 μg / mL and about 2.5 μg / mL, between about 2.5 μg / mL and about 50 μg / mL, between about 2.5 μg / mL and about 25 μg / mL, between about 2.5 μg / mL and about 10 μg / mL, between about 2.5 μg / mL and about 5 μg / mL, between about 2.5 μg / mL and about 4.5 μg / mL, between about 2.5 μg / mL and about 4 μg / mL, between about 2.5 μg / mL and about 3.5 μg / mL or between about 2.5 μg / mL and about 3 μg / mL of a culture medium (e.g., fresh medium). For example, the concentration of cell lysate in the culture medium can be between about 1 μg / mL and about 5 μg / mL or the concentration can be about 1.5 μg / mL, about 2 μg / mL, about 2.5 μg / mL, about 3 μg / mL, about 3.5 μg / mL, about 4 μg / mL, about 4.5 μg / mL or about 5 μg / mL. Optionally, the cell lysate can be in a buffer, such as phosphate buffered saline. Optionally, the buffer can include protease inhibitors. Examples of protease inhibitors include but are not limited to AEBSF, aprotinin, bestatin, E-64, leupeptin, pepstatin A and ethylenediaminetetraacetic acid (EDTA). The buffer can include any one or any combination of these inhibitors (e.g., the buffer can include all of these protease inhibitors).

[0284] The cells used to generate the lysate can be collected in a buffer, such as phosphate buffered saline. Optionally, the buffer can include protease inhibitors. Examples of protease inhibitors include but are not limited to AEBSF, aprotinin, bestatin, E-64, leupeptin, pepstatin A and ethylenediaminetetraacetic acid (EDTA). The buffer can include any one or any combination of these inhibitors (e.g., the buffer can include all of these protease inhibitors).

[0285] Cell lysates can be collected, for example, by sonication of tau aggregation positive cells (e.g., cells collected in buffer and protease inhibitor as described above) for any suitable amount of time. For example, the cells can be sonicated for about 1 minute to about 6 minutes, about 1 minute to about 5 minutes, about 1 minute to about 4 minutes, about 1 minute to about 3 minutes, about 2 minutes to about 6 minutes, about 2 minutes to about 5 minutes, about 2 minutes to about 4 minutes, about 2 minutes to about 3 minutes, about 2 minutes to about 6 minutes, about 3 minutes to about 5 minutes, or about 3 minutes to 4 minutes. For example, the cells can be sonicated for about 2 minutes to about 4 minutes or about 3 minutes.

[0286] Optionally, the culture medium comprises liposomes or lipoparticles (e.g., cationic lipoparticles) or phospholipids or another transfection agent. Optionally, the culture medium comprises liposomes. Optionally, the culture medium does not comprise liposomes or lipoparticles (e.g., cationic lipoparticles) or phospholipids or another transfection agent. Optionally, the culture medium does not comprise liposomes. The amount or concentration of liposomes or lipoparticles (e.g., cationic lipoparticles) or phospholipids or other transfection agents in the culture medium can be any suitable amount or concentration. For example, the concentration of liposomes or lipoparticles (e.g., cationic lipoparticles) or phospholipids or other transfection agents in the culture medium can be between about 0.5 μL / mL and about 10 μL / mL, between about 0.5 μL / mL and about 5 μL / mL, between about 0.5 μL / mL and about 4.5 μL / mL, between about 0.5 μL / mL and about 4 μL / mL, between about 0.5 μL / mL and about 3.5 μL / mL, between about 0.5 μL / mL and about 3 μL / mL, between about 0.5 μL / mL and about 2.5 μL / mL, between about 0.5 μL / mL and about 2 μL / mL, between about 0.5 μL / mL and about 1.5 μL / mL, between about 0.5 μL / mL and about 1 μL / mL, between about 1 μL / mL and about 10 μL / mL, between about 1 μL / mL and about 5 μL / mL, between about 1 μL / mL and about 4.5 μL / mL, between about 1 μL / mL and about 4 μL / mL, between about 1 μL / mL and about 3.5 μL / mL, between about 1 μL / mL and about 3 μL / mL, between about 1 μL / mL and about 2.5 μL / mL, between about 1 μL / mL and about 2 μL / mL, between about 1 μL / mL and about 1.5 μL / mL, between about 1.5 μL / mL and about 10 μL / mL, between about 1.5 μL / mL and about 5 μL / mL, between about 1.5 μL / mL and about 4.5 μL / mL, between about 1.5 μL / mL and about 4 μL / mL, between about 1.5 μL / mL and about 3.5 μL / mL, between about 1.5 μL / mL and about 3 μL / mL, between about 1.5 μL / mL and about 2.5 μL / mL, between about 1.5 μL / mL and about 2 μL / mL, between about 2 μL / mL and about 10 μL / mL, between about 2 μL / mL and about 5 μL / mL, between about 2 μL / mL and about 4.5 μL / mL, between about 2 μL / mL and about 4 μL / mL, between about 2 μL / mL and about 3.5 μL / mL, between about 2 μL / mL and about 3 μL / mL, or between about 2 μL / mL and about 2.5 μL / mL of the culture medium (e.g., fresh culture medium).For example, the concentration of liposomes or lipoplexes (e.g., cationic liposomes) or phospholipids or other transfection agents in the culture medium can be between about 1.5 μL / mL and about 4 μL / mL or can be about 1.5 μL / mL, about 2 μL / mL, about 2.5 μL / mL, about 3 μL / mL, about 3.5 μL / mL, or about 4 μL / mL.

[0287] III. Guide RNA Knockout Library

[0288] The CRISPRn screening methods disclosed herein utilize CRISPR guide RNA (gRNA) knockout libraries, such as genome-wide gRNA knockout libraries. Cas nucleases such as Cas9 can be programmed to induce double-strand breaks at specific genomic loci by gRNAs designed to target specific target sequences. Since the targeting specificity of the Cas protein is conferred by the short gRNA, pooled genome-scale functional screens can be performed. Such libraries have several advantages compared to libraries such as shRNA libraries, which reduce protein expression by targeting mRNA. In contrast, gRNA libraries achieve knockout by introducing frameshift mutations in the genomic coding regions of genes.

[0289] The CRISPRa screening methods disclosed herein utilize CRISPR guide RNA (gRNA) transcriptional activation libraries, such as genome-wide gRNA transcriptional activation libraries. The SAM system can be programmed to activate the transcription of genes at specific genomic loci by gRNAs designed to target specific target sequences. Since the targeting specificity of the Cas protein is conferred by the short gRNA, pooled genome-scale functional screens can be performed.

[0290] The gRNAs in the library can target any number of genes. For example, the gRNAs can target about 50 or more genes, about 100 or more genes, about 200 or more genes, about 300 or more genes, about 400 or more genes, about 500 or more genes, about 1000 or more genes, about 2000 or more genes, about 3000 or more genes, about 4000 or more genes, about 5000 or more genes, about 10000 or more genes, or about 20000 or more genes. In some libraries, the gRNAs can be selected to target genes in a specific signaling pathway. Some libraries are genome-wide libraries.

[0291] A whole-genome library contains one or more gRNAs (e.g., sgRNAs) that target each gene in a target genome. The target genome can be any type of genome. For example, the genome can be a eukaryotic genome, a mammalian genome, a non-human mammalian genome, a rodent genome, a mouse genome, a rat genome, or a human genome. In one instance, the target genome is a human genome.

[0292] The gRNAs can target any number of sequences in each individual target gene. In some libraries, multiple target sequences are evenly targeted in each of the multiple genes being targeted. For example, about 2 to about 10, about 2 to about 9, about 2 to about 8, about 2 to about 7, about 2 to about 6, about 2 to about 5, about 2 to about 4, or about 2 to about 3 unique target sequences can be evenly targeted in each of the multiple targeted genes. For example, at least about 2, at least about 3, at least about 4, at least about 5, or at least about 6 unique target sequences can be evenly targeted in each of the multiple targeted genes. As a specific example, about 6 target sequences can be evenly targeted in each of the multiple targeted genes. As another specific example, about 3 to about 6 or about 4 to about 6 target sequences are evenly targeted in each of the multiple targeted genes.

[0293] For example, the library can target genes with an average coverage of about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, or about 10 gRNAs per gene. In a specific instance, the library can target genes with an average coverage of about 3-4 gRNAs per gene or about 6 gRNAs per gene.

[0294] The gRNAs can target any desired location in the target gene. CRISPRn gRNAs can be designed to target the coding region of a gene such that cleavage by the corresponding Cas protein will result in a frameshift insertion / deletion (indel) mutation, leading to a loss-of-function allele. More specifically, the frameshift mutation can be achieved by targeting a DNA double-strand break and subsequent mutagenic repair via the non-homologous end joining (NHEJ) pathway, which generates indels at the break site. The indels introduced into the DSB are random, and some of the indels will result in frameshift mutations, leading to premature termination of the gene.

[0295] In some CRISPRn libraries, each gRNA targets a constitutive exon, if possible. In some CRISPRn libraries, each gRNA targets the 5' constitutive exon, if possible. In some methods, each gRNA targets the first exon, the second exon, or the third exon (from the 5' end of the gene), if possible.

[0296] For example, the gRNAs in a CRISPRn library can target constitutive exons. Constitutive exons are exons that are always conserved after splicing. Exons expressed across all tissues can be considered constitutive exons targeted by gRNAs. The gRNAs in the library can target constitutive exons near the 5' end of each gene. Optionally, the first and last exons of each gene can be excluded as potential targets. Optionally, any exon containing an alternative splicing site can be excluded as a potential target. Optionally, the two earliest exons meeting the above criteria are selected as potential targets. Optionally, exons 2 and 3 are selected as potential targets (e.g., if no constitutive exons are identified). Additionally, the gRNAs in the library can be selected and designed to minimize off-target effects.

[0297] In a specific example, one or more genome-wide CRISPRn gRNA libraries include sgRNAs targeting the 5' constitutive exons of >18,000 genes in the human genome, with an average coverage of approximately 6 sgRNAs per gene, where each target site is selected to minimize off-target modifications.

[0298] CRISPRa gRNAs can be designed to target sequences adjacent to the transcription start site of a gene. For example, the target sequence can be within 1000, 900, 800, 700, 600, 500, 400, 300, 200, 190, 180, 170, 160, 150, 140, 130, 120, 110, 100, 90, 80, 70, 60, 50, 40, 30, 20, 10, 5, or 1 base pairs of the transcription start site. For example, each gRNA in a CRISPRa library can target a sequence within 200 bp upstream of the transcription start site. Optionally, the target sequence is within the region from 200 base pairs upstream of the transcription start site to 1 base pair downstream of the transcription start site (-200 to +1).

[0299] The gRNAs in the whole genome library can be in any form. For example, the gRNA library can be packaged in a viral vector, such as a retroviral vector, a lentiviral vector, or an adenoviral vector. In a specific example, the gRNA library is packaged in a lentiviral vector. The vector can further include a reporter gene or a selection marker for facilitating the selection of cells that receive the vector. Examples of such reporter genes and selection markers are disclosed elsewhere herein. As an example, the selection marker can be a selection marker that confers drug resistance, such as neomycin phosphotransferase, hygromycin B phosphotransferase, puromycin-N-acetyltransferase, and blasticidin S deaminase. Another exemplary selection marker is the bleomycin resistance protein, encoded by the Sh ble gene (the bleomycin gene of Streptoalloteichus hindustanus), which confers resistance to zeocin (phleomycin D1). For example, cells can be selected with a drug (e.g., puromycin) such that only the cells transduced with the guide RNA construct are preserved for screening.

[0300] A. Guide RNA

[0301] A "guide RNA" or "gRNA" is an RNA molecule that binds to a Cas protein (e.g., Cas9 protein) and targets the Cas protein to a specific location within a target DNA. The guide RNA can include two segments: a "DNA targeting segment" and a "protein binding segment". A "segment" encompasses a part or region of a molecule, such as a continuous segment of nucleotides in an RNA. Some gRNAs, such as those for Cas9, can include two separate RNA molecules: an "activator RNA" (e.g., tracrRNA) and a "targeting RNA" (e.g., CRISPR RNA or crRNA). Other gRNAs are single RNA molecules (single RNA polynucleotides), which can also be referred to as "single molecule gRNAs", "single guide RNAs", or "sgRNAs". See, for example, WO 2013 / 176772, WO 2014 / 065596, WO 2014 / 089290, WO 2014 / 093622, WO2014 / 099750, WO 2013 / 142578, and WO 2014 / 131833, each of which is incorporated by reference in its entirety for all purposes. For example, for Cas9, the single guide RNA can include (e.g., via a linker) a crRNA fused to a tracrRNA. For example, for Cpf1, only a crRNA is required to achieve binding to the target sequence. The terms "guide RNA" and "gRNA" encompass both bimolecular (i.e., modular) gRNAs and single molecule gRNAs.

[0302] Exemplary dual molecule gRNAs include crRNA-like (“CRISPR RNA” or “targeting factor RNA” or “crRNA” or “crRNA repeat”) molecules and corresponding tracrRNA-like (“trans-acting CRISPR RNA” or “activating factor RNA” or “tracrRNA”) molecules. The crRNA includes the DNA targeting segment (single-stranded) of the gRNA and a nucleotide segment that forms one half of the dsRNA duplex of the protein-binding segment of the gRNA. Examples of crRNA tails located downstream (3') of the DNA targeting segment include GUUUUAGAGCUAUGCU (SEQ ID NO:23), consisting essentially of or consisting of the same. Any DNA targeting segment among the DNA targeting segments disclosed herein can be ligated to the 5' end of SEQ ID NO:23 to form a crRNA.

[0303] The corresponding tracrRNA (activating factor RNA) includes a nucleotide segment that forms the other half of the dsRNA duplex of the protein-binding segment of the gRNA. The nucleotide segment of the crRNA is complementary to and hybridizes with the nucleotide segment of the tracrRNA to form the dsRNA duplex of the protein-binding domain of the gRNA. Thus, each crRNA can be considered to have a corresponding tracrRNA. Examples of tracrRNA sequences include AGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUU (SEQ ID NO:24), consisting essentially of or consisting of the same. Other examples of tracrRNA sequences include any one of AAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO:28) or GUUGGAACCAUUCAAAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC (SEQ ID NO:29), consisting essentially of or consisting of the same.

[0304] In systems that require both crRNA and tracrRNA, the crRNA and the corresponding tracrRNA hybridize to form the gRNA. In systems that require only crRNA, the crRNA can be the gRNA. The crRNA additionally provides a single-stranded DNA targeting segment that hybridizes to a complementary strand of the target DNA. If used for intracellular modification, the exact sequence of a given crRNA or tracrRNA molecule can be designed to be specific for the species that will use the RNA molecule. See, e.g., Mali et al. (2013) Science 339:823-826; Jinek et al. (2012) Science 337:816-821; Hwang et al. (2013) Nat. Biotechnol. 31:227-229; Jiang et al. (2013) Nat. Biotechnol. 31:233-239; and Cong et al. (2013) Science 339:819-823, each of which is incorporated herein by reference in its entirety for all purposes.

[0305] The DNA targeting segment (crRNA) of a given gRNA comprises a nucleotide sequence that is complementary to a sequence on the complementary strand of the target DNA, as described in more detail below. The DNA targeting segment of the gRNA interacts with the target DNA in a sequence-specific manner by hybridization (i.e., base pairing). Thus, the nucleotide sequence of the DNA targeting segment can vary and determines the location within the target DNA with which the gRNA and the target DNA will interact. The DNA targeting segment of the subject gRNA can be modified to hybridize to any desired sequence within the target DNA. Naturally occurring crRNAs vary depending on the CRISPR / Cas system and the organism, but typically contain a targeting segment flanked by two direct repeats (DRs) that are 21 to 46 nucleotides in length (see, e.g., WO 2014 / 131833, which is incorporated herein by reference in its entirety for all purposes). In the case of Streptococcus pyogenes, the DRs are 36 nucleotides long and the targeting segment is 30 nucleotides long. The DR located at the 3' end is complementary to and hybridizes with the corresponding tracrRNA, which in turn binds to the Cas protein.

[0306] The length of the DNA targeting segment can be, for example, at least about 12, 15, 17, 18, 19, 20, 25, 30, 35, or 40 nucleotides. The length of such DNA targeting segments can be, for example, from about 12 to about 100, from about 12 to about 80, from about 12 to about 50, from about 12 to about 40, from about 12 to about 30, from about 12 to about 25, or from about 12 to about 20 nucleotides. For example, the DNA targeting segment can be from about 15 to about 25 nucleotides (e.g., from about 17 to about 20 nucleotides or about 17, 18, 19, or 20 nucleotides). See, e.g., US 2016 / 0024523, which is incorporated herein by reference in its entirety for all purposes. For Cas9 from Streptococcus pyogenes, the typical length of the DNA targeting segment is between 16 and 20 nucleotides or between 17 and 20 nucleotides. For Cas9 from Staphylococcus aureus, the typical length of the DNA targeting segment is between 21 and 23 nucleotides. For Cpf1, the typical length of the DNA targeting segment is at least 16 nucleotides or at least 18 nucleotides.

[0307] The tracrRNA can be in any form (e.g., full-length tracrRNA or an active portion tracrRNA) and can have different lengths. The tracrRNA can comprise a primary transcript or a processed form. For example, the tracrRNA (as part of a single guide RNA or as a separate molecule as part of a dual molecule gRNA) can include a wild-type tracrRNA sequence (e.g., about or more than about 20, 26, 32, 45, 48, 54, 63, 67, 85, or more nucleotides of a wild-type tracrRNA sequence), consist essentially of, or consist of. Examples of wild-type tracrRNA sequences from Streptococcus pyogenes include 171-nucleotide, 89-nucleotide, 75-nucleotide, and 65-nucleotide versions. See, e.g., Deltcheva et al. (2011) Nature 471:602-607; WO 2014 / 093661, each of which is incorporated herein by reference in its entirety for all purposes. Examples of tracrRNA within a single guide RNA (sgRNA) include the tracrRNA segments found in the +48, +54, +67, and +85 versions of the sgRNA, where “+n” indicates up to +n nucleotides of the wild-type tracrRNA are included in the sgRNA. See US8,697,359, which is incorporated herein by reference in its entirety for all purposes.

[0308] The percentage of complementarity between the DNA targeting segment of the guide RNA and the complementary strand of the target DNA can be at least 60% (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99% or 100%). The percentage of complementarity between the DNA targeting segment and the complementary strand of the target DNA can be at least 60% over about 20 consecutive nucleotides. As an example, the percentage of complementarity between the DNA targeting segment and the complementary strand of the target DNA can be 100% over 14 consecutive nucleotides at the 5' end of the complementary strand of the target DNA and as low as 0% for the remainder. In such cases, the DNA targeting segment can be considered to be 14 nucleotides in length. As another example, the percentage of complementarity between the DNA targeting segment and the complementary strand of the target DNA can be 100% over seven consecutive nucleotides at the 5' end of the complementary strand of the target DNA and as low as 0% for the remainder. In such cases, the DNA targeting segment can be considered to be 7 nucleotides in length. In some guide RNAs, at least 17 nucleotides within the DNA targeting segment are complementary to the complementary strand of the target DNA. For example, the length of the DNA targeting segment can be 20 nucleotides and can include 1, 2 or 3 mismatches with the complementary strand of the target DNA. In one example, the mismatch is not adjacent to the region corresponding to the complementary strand of the protospacer adjacent motif (PAM) sequence (i.e., the reverse complement of the PAM sequence) (e.g., the mismatch is in the 5' end of the DNA targeting segment of the guide RNA, or the mismatch is at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 or 19 base pairs from the region corresponding to the complementary strand of the PAM sequence).

[0309] The protein-binding segment of the gRNA can include two nucleotide segments that are complementary to each other. The complementary nucleotides of the protein-binding segment hybridize to form a double-stranded RNA duplex (dsRNA). The protein-binding segment of the subject gRNA interacts with the Cas protein, and the gRNA directs the bound Cas protein to a specific nucleotide sequence within the target DNA via the DNA targeting segment.

[0310] The single-guide RNA can include a DNA targeting segment and a scaffold sequence (i.e., the protein-binding or Cas-binding sequence of the guide RNA). For example, such a guide RNA can have a 5' DNA targeting segment linked to a 3' scaffold sequence. Exemplary scaffold sequences include, consist essentially of, or consist of: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU (version 1; SEQ ID NO:17); GUUGGAACCAUUCAAAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC (version 2; SEQ ID NO:18); GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC (version 3; SEQ ID NO:19); and GUUUAAGAGCUAUGCUGGAAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC (version 4; SEQ ID NO:20). Other exemplary scaffold sequences include, consist essentially of, or consist of: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU (version 5; SEQ ID NO:30); GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (version 6; SEQ ID NO:31); or GUUUAAGAGCUAUGCUGGAAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUU (version 7; SEQ ID NO:32). A guide RNA targeting any guide RNA target sequence among the guide RNA target sequences disclosed herein can include, for example, a DNA targeting segment at the 5' end of the guide RNA fused to any of the scaffold sequences in the exemplary guide RNA scaffolds at the 3' end of the guide RNA.That is, any DNA targeting segment in the DNA targeting segments disclosed herein can be ligated to the 5' end of any scaffold sequence in the above-described scaffold sequences to form a single guide RNA (chimeric guide RNA).

[0311] The guide RNA can include modifications or sequences that provide additional desired features (e.g., modified or regulated stability; subcellular targeting; tracking with a fluorescent label; binding sites for proteins or protein complexes; etc.). Examples of such modifications include, for example, a 5' cap (e.g., 7-methylguanylate cap (m7G)); a 3' polyadenylation tail (i.e., 3' poly(A) tail); riboswitch sequences (e.g., that allow proteins and / or protein complexes to regulate stability and / or accessibility); stability control sequences; sequences that form dsRNA duplexes (i.e., hairpins); modifications or sequences that target the RNA to a subcellular location (e.g., nucleus, mitochondrion, chloroplast, etc.); modifications or sequences that provide tracking (e.g., direct conjugation to a fluorescent molecule, conjugation to a moiety that facilitates fluorescence detection, sequences that allow fluorescence detection, etc.); modifications or sequences that provide binding sites for proteins (e.g., proteins that act on DNA, including transcriptional activators, transcriptional repressors, DNA methyltransferases, DNA demethylases, histone acetyltransferases, histone deacetylases, etc.); and combinations thereof. Other examples of modifications include engineered stem-loop duplex structures, engineered bulge regions, engineered hairpins at the 3' of stem-loop duplex structures, or any combination thereof. See, e.g., US 2015 / 0376586, which is incorporated herein by reference in its entirety for all purposes. A bulge can be an unpaired region of nucleotides within a duplex composed of a crRNA-like region and a minimal tracrRNA-like region. The bulge can include an unpaired 5′-XXXY-3′ on one side of the duplex, where X is any purine and Y can be a nucleotide that can form a wobble pair with a nucleotide on the opposite strand; and an unpaired nucleotide region on the other side of the duplex.

[0312] In some cases, a transcriptional activation system including a dCas9-VP64 fusion protein paired with MS2-p65-HSF1 can be used. The guide RNA in such systems can be designed to have an aptamer sequence appended to the sgRNA tetraloop and stem-loop 2, which is designed to bind the dimeric MS2 bacteriophage coat protein. See, e.g., Konermann et al. (2015) Nature 517(7536):583-588, which is incorporated herein by reference in its entirety for all purposes.

[0313] Unmodified nucleic acids are prone to degradation. Exogenous nucleic acids can also induce innate immune responses. Modifications can help introduce stability and reduce immunogenicity. Guide RNAs can include modified nucleosides and modified nucleotides, including, for example, one or more of the following: (1) alteration or replacement of one or two of the non-bridging phosphate oxygens and / or one or more of the bridging phosphate oxygens in the phosphodiester backbone bond; (2) alteration or replacement of the ribose moiety, such as alteration or replacement of the 2'-hydroxy group on ribose; (3) replacement of the phosphate moiety with a dephospho linker; (4) modification or replacement of naturally occurring nucleobases; (5) replacement or modification of the ribose phosphate backbone; (6) modification of the 3' or 5' end of the oligonucleotide (e.g., removal, modification, or replacement of the terminal phosphate group or conjugation of a moiety); and (7) modification of the sugar. Other possible guide RNA modifications include modification or replacement of uracil or polyuracil tracts. See, for example, WO 2015 / 048577 and US 2016 / 0237455, each of which is incorporated by reference in its entirety for all purposes. Similar modifications can be made to Cas-encoding nucleic acids such as Cas mRNA. For example, Cas mRNA can be modified by deletion of uridine using synonymous codons.

[0314] As an example, the nucleotides at the 5' or 3' end of a guide RNA can include phosphorothioate bonds (e.g., the bases can have a modified phosphate group, i.e., a phosphorothioate group). For example, a guide RNA can include phosphorothioate bonds between 2, 3, or 4 terminal nucleotides at the 5' or 3' end of the guide RNA. As another example, the nucleotides at the 5' and / or 3' end of a guide RNA can have 2'-O-methyl modifications. For example, a guide RNA can include 2'-O-methyl modifications at 2, 3, or 4 terminal nucleotides at the 5' and / or 3' end (e.g., the 5' end) of the guide RNA. See, for example, WO 2017 / 173054 A1 and Finn et al. (2018) Cell Reports 22:1-9, each of which is incorporated by reference in its entirety for all purposes. Other possible modifications are described in more detail elsewhere herein. In a specific example, the guide RNA includes 2'-O-methyl analogs and 3'-phosphorothioate internucleotide bonds at the first three 5' and 3' terminal RNA residues. Such chemical modifications can, for example, provide greater stability and protection against exonucleases for the guide RNA, allowing the guide RNA to persist intracellularly for longer than an unmodified guide RNA. Such chemical modifications can also, for example, prevent innate intracellular immune responses that can actively degrade the RNA or trigger an immune cascade leading to cell death.

[0315] In some guide RNAs (e.g., single guide RNAs), at least one loop (e.g., two loops) of the guide RNA is modified by inserting a distinct RNA sequence that binds to one or more adaptors (i.e., adapter proteins or domains). Such adapter proteins can be used to further recruit one or more heterologous functional domains, such as transcriptional activation domains (e.g., for CRISPRa screening in SAM / tau biosensor cells). Examples of fusion proteins that include such adapter proteins (i.e., chimeric adapter proteins) are disclosed elsewhere herein. For example, the MS2-binding loop ggccAACAUGAGGAUCACCCAUGUCUGCAGggcc (SEQ ID NO:33) can replace the sgRNA scaffold (backbone) shown in SEQ ID NO:17 or SEQ ID NO:19 (or SEQ ID NO:30 or 31) or the sgRNA backbone of the Streptococcus pyogenes CRISPR / Cas9 system described in WO 2016 / 049258 and Konermann et al. (2015) Nature 517(7536):583-588, each of which is incorporated herein by reference in its entirety for all purposes. See also US 2019-0284572 and WO 2019 / 183123, each of which is incorporated herein by reference in its entirety for all purposes. The guide RNA numbering used herein refers to the nucleotide numbering in the guide RNA scaffold sequence (i.e., the sequence downstream of the DNA targeting segment of the guide RNA). For example, the first nucleotide of the guide RNA scaffold is +1, the second nucleotide of the scaffold is +2, and so on. The residues corresponding to nucleotides +13 to +16 in SEQ ID NO:17 or SEQ ID NO:19 (or SEQ ID NO:30 or 31) are the loop sequences in the region spanning nucleotides +9 to +21 in SEQ ID NO:17 or SEQ ID NO:19 (or SEQ ID NO:30 or 31) (the region referred to herein as the tetraloop). The residues corresponding to nucleotides +53 to +56 in SEQ ID NO:17 or SEQ ID NO:19 (or SEQ ID NO:30 or 31) are the loop sequences in the region spanning nucleotides +48 to +61 in SEQ ID NO:17 or SEQ ID NO:19 (or SEQ ID NO:30 or 31) (the region referred to herein as stem-loop 2). Other stem-loop sequences in SEQ ID NO:17 or SEQ ID NO:19 (or SEQ ID NO:30 or 31) include stem-loop 1 (nucleotides +33 to +41) and stem-loop 3 (nucleotides +63 to +75). The resulting structure is an sgRNA scaffold in which each of the tetraloop and stem-loop 2 sequences is replaced by the MS2-binding loop.The tetraloop and stem-loop 2 protrude from the Cas9 protein in such a way that the addition of the MS2 binding loop should not interfere with any Cas9 residues. Additionally, the proximity of the tetraloop and stem-loop 2 sites to DNA suggests that targeting to these locations may result in a high degree of interaction between the DNA and any recruited proteins such as transcription activators. Thus, in some sgRNAs, the nucleotides corresponding to +13 to +16 of the guide RNA scaffold shown in SEQ ID NO:17 or SEQ ID NO:19 (or SEQ ID NO:30 or 31) and / or the nucleotides corresponding to +53 to +56 or corresponding residues are replaced with different RNA sequences capable of binding to one or more adaptor proteins or domains when optimally aligned with any of these scaffolds / backbones. Alternatively or additionally, an adaptor binding sequence can be added to the 5' end or 3' end of the guide RNA. Exemplary guide RNA scaffolds that include an MS2 binding loop in the tetraloop and stem-loop 2 region can include the sequence shown in SEQ ID NO:34, consist essentially of said sequence, or consist of said sequence. Exemplary universal single guide RNAs that include an MS2 binding loop in the tetraloop and stem-loop 2 region can include the sequence shown in SEQ ID NO:35, consist essentially of said sequence, or consist of said sequence.

[0316] The guide RNA can be provided in any form. For example, the gRNA can be provided in the form of RNA, as two molecules (separate crRNA and tracrRNA) or as one molecule (sgRNA), and optionally in the form of a complex with a Cas protein. The gRNA can also be provided in the form of DNA encoding the gRNA. The DNA encoding the gRNA can encode a single RNA molecule (sgRNA) or separate RNA molecules (e.g., separate crRNA and tracrRNA). In the latter case, the DNA encoding the gRNA can be provided as one DNA molecule or as separate DNA molecules encoding the crRNA and tracrRNA, respectively.

[0317] When the gRNA is provided in the form of DNA, the gRNA can be transiently, conditionally or constitutively expressed in cells. The DNA encoding the gRNA can be stably integrated into the genome of the cell and operably linked to a promoter that is active in the cell. Alternatively, the DNA encoding the gRNA can be operably linked to a promoter in an expression construct. For example, the DNA encoding the gRNA can be in a vector that includes a heterologous nucleic acid such as a nucleic acid encoding a Cas protein. Alternatively, the DNA encoding the gRNA can be in a vector or plasmid separate from the vector that includes the nucleic acid encoding a Cas protein. Promoters that can be used for such expression constructs include promoters that are active in one or more of, for example, eukaryotic cells, human cells, non-human cells, mammalian cells, non-human mammalian cells, rodent cells, mouse cells, rat cells, pluripotent cells, embryonic stem (ES) cells, adult stem cells, developmentally restricted progenitor cells, induced pluripotent stem (iPS) cells or single cell stage embryos. Such promoters can be, for example, conditional promoters, inducible promoters, constitutive promoters or tissue-specific promoters. Such promoters can also be, for example, bidirectional promoters. Specific examples of suitable promoters include RNA polymerase III promoters such as the human U6 promoter, the rat U6 polymerase III promoter or the mouse U6 polymerase III promoter.

[0318] Alternatively, the gRNA can be prepared by a variety of other methods. For example, the gRNA can be prepared by in vitro transcription using, for example, T7 RNA polymerase (see, for example, WO 2014 / 089290 and WO 2014 / 065596, each of which is incorporated by reference in its entirety for all purposes). The guide RNA can also be a synthetically produced molecule prepared by chemical synthesis. For example, the guide RNA can be chemically synthesized to include 2'-O-methyl analogs and 3'-thio-phosphate nucleotide internucleotide bonds at the first three 5' and 3' terminal RNA residues.

[0319] The guide RNA (or the nucleic acid encoding the guide RNA) can be in a composition that includes a vector that includes one or more guide RNAs (e.g., 1, 2, 3, 4 or more guide RNAs) and that increases the stability of the guide RNA (e.g., extends the time that degradation products remain below a threshold, such as below 0.5% of the starting nucleic acid or protein weight, under a given storage condition (e.g., -20°C, 4°C or ambient temperature); or increases in vivo stability). Non-limiting examples of such vectors include poly(lactic acid) (PLA) microspheres, poly(D,L-lactic-co-glycolic acid) (PLGA) microspheres, liposomes, micelles, reverse micelles, lipid helices and lipid nanotubes. Such compositions can further include a Cas protein, such as Cas9 protein, or a nucleic acid encoding a Cas protein.

[0320] B. Guide RNA Target Sequence

[0321] The target DNA for a guide RNA contains a nucleic acid sequence in the DNA to which the DNA targeting segment of the gRNA will bind, provided that sufficient binding conditions exist. Suitable DNA / RNA binding conditions include the physiological conditions normally present in a cell. Other suitable DNA / RNA binding conditions (e.g., conditions in a cell-free system) are known in the art (see, e.g., Molecular Cloning: A Laboratory Manual, 3rd ed. (Sambrook et al., Cold Spring Harbor Laboratory Press 2001), which is incorporated herein by reference in its entirety for all purposes). The strand of the target DNA that is complementary and hybridizes to the gRNA may be referred to as the "complementary strand," and the strand of the target DNA that is complementary to the "complementary strand" (and thus not complementary to the Cas protein or the gRNA) may be referred to as the "non-complementary strand" or the "template strand."

[0322] The target DNA contains both the sequence on the complementary strand to which the guide RNA hybridizes and the corresponding sequence on the non-complementary strand (e.g., adjacent to the protospacer adjacent motif (PAM)). As used herein, the term "guide RNA target sequence" specifically refers to the sequence on the non-complementary strand that corresponds (i.e., its reverse complement) to the sequence to which the guide RNA hybridizes on the complementary strand. That is, the guide RNA target sequence refers to the sequence on the non-complementary strand that is adjacent to the PAM (e.g., upstream or 5' of the PAM in the case of Cas9). The guide RNA target sequence is equivalent to the DNA targeting segment of the guide RNA, but has thymine instead of uracil. As an example, the guide RNA target sequence for the SpCas9 enzyme may refer to the sequence upstream of the 5'-NGG-3' PAM on the non-complementary strand. The guide RNA is designed to have complementarity to the complementary strand of the target DNA, where hybridization between the DNA targeting segment of the guide RNA and the complementary strand of the target DNA promotes the formation of the CRISPR complex. Complete complementarity is not necessarily required, provided that there is sufficient complementarity to cause hybridization and promote the formation of the CRISPR complex. If a guide RNA is referred to herein as targeting a guide RNA target sequence, this means that the guide RNA hybridizes to the complementary strand sequence of the target DNA, which is the reverse complement of the guide RNA target sequence on the non-complementary strand.

[0323] The target DNA or guide RNA target sequence can include any polynucleotide and can be located, for example, in the nucleus or cytoplasm of a cell or within cell organelles such as mitochondria or chloroplasts. The target DNA or guide RNA target sequence can be any nucleic acid sequence that is endogenous or exogenous to the cell. The guide RNA target sequence can be a sequence encoding a gene product (e.g., a protein) or a non-coding sequence (e.g., a regulatory sequence) or can contain both.

[0324] For CRISPRa and SAM systems, it may be preferred that the target sequence is adjacent to the transcription start site of the gene. For example, the target sequence can be within 1000, 900, 800, 700, 600, 500, 400, 300, 200, 190, 180, 170, 160, 150, 140, 130, 120, 110, 100, 90, 80, 70, 60, 50, 40, 30, 20, 10, 5 or 1 base pairs of the transcription start site. Optionally, the target sequence is within the region from 200 base pairs upstream of the transcription start site to 1 base pair downstream of the transcription start site (-200 to +1).

[0325] Site-specific binding and cleavage of target DNA by a Cas protein can occur at a location determined by both (i) base-pairing complementarity between a guide RNA and the complementary strand of the target DNA and (ii) a short motif in the non-complementary strand of the target DNA, referred to as the protospacer adjacent motif (PAM). The PAM can flank the guide RNA target sequence. Optionally, the guide RNA target sequence can flank the PAM at the 3' end (e.g., for Cas9). Alternatively, the guide RNA target sequence can flank the PAM at the 5' end (e.g., for Cpf1). For example, the cleavage site of the Cas protein can be about 1 to about 10 or about 2 to about 5 base pairs (e.g., 3 base pairs) upstream or downstream of the PAM sequence (e.g., within the guide RNA target sequence). In the case of SpCas9, the PAM sequence (i.e., on the non-complementary strand) can be 5'-N1GG-3', where N1 is any DNA nucleotide, and the PAM immediately follows the 3' of the guide RNA target sequence on the non-complementary strand of the target DNA. Thus, the sequence corresponding to the PAM on the complementary strand (i.e., reverse complement) will be 5'-CCN2-3', where N2 is any DNA nucleotide and immediately follows the 5' of the sequence to which the DNA targeting segment of the guide RNA hybridizes on the complementary strand of the target DNA. In some such cases, N1 and N2 can be complementary, and the N1-N2 base pair can be any base pair (e.g., N1 = C and N2 = G; N1 = G and N2 = C; N1 = A and N2 = T; or N1 = T, and N2 = A). For Cas9 from Staphylococcus aureus, the PAM can be NNGRRT or NNGRR, where N can be A, G, C, or T, and R can be G or A. In the case of Cas9 from Campylobacter jejuni, the PAM can be, for example, NNNNACAC or NNNNRYAC, where N can be A, G, C, or T, and R can be G or A. In some cases (e.g., for FnCpf1), the PAM sequence can be upstream of the 5' end and have the sequence 5'-TTN-3'.

[0326] An example of a guide RNA target sequence is a 20-nucleotide DNA sequence immediately preceding the NGG motif recognized by the SpCas9 protein. For example, two examples of the guide RNA target sequence plus PAM are GN 19 NGG (SEQ ID NO:25) or N 20 NGG (SEQ ID NO:26). See, for example, WO 2014 / 165825, which is incorporated herein by reference in its entirety for all purposes. The guanine at the 5' end can facilitate transcription by RNA polymerase in cells. Other examples of the guide RNA target sequence plus PAM can contain two guanine nucleotides at the 5' end (e.g., GGN 20NGG; SEQ ID NO:27) is used to promote efficient transcription of T7 polymerase in vitro. See, for example, WO 2014 / 065596, which is incorporated herein by reference in its entirety for all purposes. Other guide RNA target sequences plus PAM can have SEQ ID NO:25 - 27 with a length of 4 - 22 nucleotides, including 5'G or GG and 3'GG or NGG. Still other guide RNA target sequences plus PAM can have SEQ ID NO:25 - 27 with lengths of 14 and 20 nucleotides.

[0327] The formation of the CRISPR complex hybridized to the target DNA can result in cleavage of one or both strands of the target DNA within or near the region corresponding to the guide RNA target sequence (i.e., the guide RNA target sequence on the non - complementary strand of the target DNA and the reverse complement to which the guide RNA hybridizes on the complementary strand). For example, the cleavage site can be within the guide RNA target sequence (e.g., at a defined position relative to the PAM sequence). A "cleavage site" includes the position on the target DNA where the Cas protein produces a single - strand break or a double - strand break. The cleavage site can be on only one strand of the double - stranded DNA (e.g., when using a nickase) or on both strands. The cleavage site can be at the same position on both strands (producing blunt ends; e.g., Cas9) or can be at different sites on each strand (producing staggered ends (i.e., overhangs); e.g., Cpf1). For example, staggered ends can be produced by using two Cas proteins, each of which produces a single - strand break at a different cleavage site on a different strand, thereby producing a double - strand break. For example, a first nickase can produce a single - strand break on the first strand of double - stranded DNA (dsDNA), and a second nickase can produce a single - strand break on the second strand of dsDNA, such that an overhanging sequence is produced. In some cases, the guide RNA target sequence or cleavage site of the nickase on the first strand is separated from the guide RNA target sequence or cleavage site of the nickase on the second strand by at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 75, 100, 250, 500, or 1,000 base pairs.

[0328] IV. Methods for screening tau seeding or aggregation gene modifiers

[0329] The Cas / tau biosensor cell lines disclosed herein can be used in methods for screening tau seeding or aggregation gene modifiers. Such methods can include providing a population of Cas / tau biosensor cells as disclosed elsewhere herein, introducing a library comprising a plurality of unique guide RNAs, and assessing tau seeding or aggregation in the targeted cells.

[0330] As an example, the method can include providing a Cas / tau biosensor cell population (e.g., a cell population comprising a Cas protein, a first tau repeat domain linked to a first reporter gene, and a second tau repeat domain linked to a second reporter gene), introducing a library of multiple unique guide RNAs targeting multiple genes into the cell population, and culturing the cell population to allow genome editing and amplification. The multiple unique guide RNAs form a complex with the Cas protein, and the Cas protein cleaves the multiple genes resulting in gene function knockdown to produce a genetically modified cell population. The genetically modified cell population can then be contacted with a tau inoculum to produce an inoculated cell population. The inoculated cell population can be cultured to allow formation of tau aggregates, wherein aggregates of the first tau repeat domain and the second tau repeat domain form in a subset of the inoculated cell population to produce an aggregate-positive cell population. Finally, the abundance of each unique guide RNA among the multiple unique guide RNAs can be determined in the aggregate-positive cell population relative to the cell population cultured after introduction of the guide RNA library. Enrichment of the guide RNAs in the aggregate-positive cell population relative to the cell population cultured after introduction of the guide RNA library indicates that the gene targeted by the guide RNA is a tau aggregation gene modifier, wherein disruption of the gene targeted by the guide RNA enhances tau aggregation, or is a candidate gene modifier of tau aggregation (e.g., for further testing by secondary screening), wherein disruption of the gene targeted by the guide RNA is expected to enhance tau aggregation.

[0331] Similarly, the SAM / tau biosensor cell lines disclosed herein can be used in methods for screening tau inoculation or aggregation gene modifiers. Such methods can include providing a SAM / tau biosensor cell population as disclosed elsewhere herein, introducing a library comprising multiple unique guide RNAs, and assessing tau inoculation or aggregation in the targeted cells.

[0332] As an example, the method can include providing a SAM / tau biosensor cell population (e.g., a cell population comprising a chimeric Cas protein comprising a nuclease-inactivated Cas protein fused to one or more transcriptional activation domains, a chimeric adaptor protein comprising an adaptor protein fused to one or more transcriptional activation domains, a first tau repeat domain linked to a first reporter gene, and a second tau repeat domain linked to a second reporter gene), introducing a library of multiple unique guide RNAs targeting multiple genes into the cell population and culturing the cell population to allow transcriptional activation and amplification. The multiple unique guide RNAs form a complex with the chimeric Cas protein and the chimeric adaptor protein, and the complex activates transcription of the multiple genes resulting in increased gene expression and a modified cell population. The modified cell population can then be contacted with a tau inoculum to produce an inoculated cell population. The inoculated cell population can be cultured to allow formation of tau aggregates, wherein aggregates of the first tau repeat domain and the second tau repeat domain form in a subset of the inoculated cell population to produce an aggregate-positive cell population. Finally, the abundance of each unique guide RNA among the multiple unique guide RNAs in the aggregate-positive cell population can be determined relative to the cell population cultured after introduction of the guide RNA library. Enrichment of the guide RNA in the aggregate-positive cell population relative to the cell population cultured after introduction of the guide RNA library indicates that the gene targeted by the guide RNA is a tau aggregation gene modifier, wherein transcriptional activation of the gene targeted by the guide RNA enhances tau aggregation, or is a candidate gene modifier of tau aggregation (e.g., for further testing by secondary screening), wherein transcriptional activation of the gene targeted by the guide RNA is expected to enhance tau aggregation.

[0333] The Cas / tau biosensor cells used in the method can be any of the biosensor cells of the Cas / tau biosensor cells disclosed elsewhere herein. Similarly, the SAM / tau biosensor cells used in the method can be any of the SAM / tau biosensor cells disclosed elsewhere herein. The first tau repeat domain and the second tau repeat domain can be different or can be similar or identical. The tau repeat domain can be any of the repeat domains of the tau repeat domains disclosed elsewhere herein. For example, the first tau repeat domain and / or the second tau repeat domain can be a wild-type tau repeat domain or can include an aggregation-promoting mutation (e.g., a pathogenic aggregation-promoting mutation), such as the tau P301S mutation. The first tau repeat domain and / or the second tau repeat domain can include a tau four-repeat domain. As a specific example, the first tau repeat domain and / or the second tau repeat domain can comprise, consist essentially of, or consist of: SEQ ID NO:11 or a sequence that is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:11. In a specific example, the nucleic acid encoding the tau repeat domain can comprise, consist essentially of, or consist of: SEQ ID NO:12 or a sequence that is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:12, optionally wherein the nucleic acid encodes a protein that comprises, consist essentially of, or consist of: SEQ ID NO:11.

[0334] The first tau repeat domain can be linked to the first reporter gene in any manner, and the second tau repeat domain can be linked to the second reporter gene. For example, the reporter gene can be fused to the tau repeat domain (e.g., as part of a fusion protein). The reporter proteins can be any pair of reporter proteins that produce a detectable signal when the first tau repeat domain linked to the first reporter gene aggregates with the second tau repeat domain linked to the second reporter gene. As an example, the first reporter gene and the second reporter gene can be split luciferase proteins. As another example, the first reporter protein and the second reporter protein can be a fluorescence resonance energy transfer (FRET) pair. FRET is a physical phenomenon in which a donor fluorophore in its excited state non-radiatively transfers its excitation energy to an adjacent acceptor fluorophore, causing the acceptor to emit its characteristic fluorescence. Examples of FRET pairs (donor and acceptor fluorophores) are well known. See, for example, Bajar et al. (2016) Sensors Basel 16(9):1488, which is incorporated herein by reference in its entirety for all purposes. As a specific example of a FRET pair, the first reporter gene can be cyan fluorescent protein (CFP), and the second reporter gene can be yellow fluorescent protein (YFP). As a specific example, CFP can comprise, consist essentially of, or consist of SEQ ID NO:13 or a sequence that is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:13. As another specific example, YFP can comprise, consist essentially of, or consist of SEQ ID NO:15 or a sequence that is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:15.

[0335] For the Cas / tau biosensor cell, the Cas protein can be any Cas protein disclosed elsewhere herein. As an example, the Cas protein can be a Cas9 protein. For example, the Cas9 protein can be Streptococcus pyogenes Cas9 protein. As a specific example, the Cas protein can comprise, consist essentially of, or consist of SEQ ID NO:21 or a sequence that is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:21.

[0336] One or more or all of the Cas protein, the first tau repeat domain linked to the first reporter gene, and the second tau repeat domain linked to the second reporter gene are stably expressed in the cell population. For example, the nucleic acid encoding one or more or all of the Cas protein, the first tau repeat domain linked to the first reporter gene, and the second tau repeat domain linked to the second reporter gene can be genomically integrated in the cell population. In a specific example, the nucleic acid encoding the Cas protein can comprise, consist essentially of, or consist of: SEQ ID NO: 22 or a sequence that is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 22, optionally wherein the nucleic acid encodes a protein that comprises, consists essentially of, or consists of: SEQ ID NO: 21.

[0337] For SAM / tau biosensor cells, the Cas protein can be any Cas protein disclosed elsewhere herein. As an example, the Cas protein can be a Cas9 protein. For instance, the Cas9 protein can be Streptococcus pyogenes Cas9 protein. As a specific example, the chimeric Cas protein can comprise a nuclease-inactivated Cas protein fused to a VP64 transcriptional activation domain. For example, the chimeric Cas protein can comprise, from the N-terminus to the C-terminus: the nuclease-inactivated Cas protein; a nuclear localization signal; and the VP64 transcriptional activation domain. As a specific example, the adaptor protein can be an MS2 coat protein, and one or more transcriptional activation domains in the chimeric adaptor protein can comprise a p65 transcriptional activation domain and an HSF1 transcriptional activation domain. For example, the chimeric adaptor protein can comprise, from the N-terminus to the C-terminus: the MS2 coat protein; a nuclear localization signal; the p65 transcriptional activation domain; and the HSF1 transcriptional activation domain. In a specific example, the nucleic acid encoding the chimeric Cas protein can comprise, consist essentially of, or consist of: SEQ ID NO:38 or a sequence that is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:38, optionally wherein the nucleic acid encodes a protein that comprises, consists essentially of, or consists of: SEQ ID NO:36. In a specific example, the nucleic acid encoding the chimeric adaptor protein can comprise, consist essentially of, or consist of: SEQ ID NO:39 or a sequence that is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:39, optionally wherein the nucleic acid encodes a protein that comprises, consists essentially of, or consists of: SEQ ID NO:37.

[0338] One or more or all of the chimeric Cas protein, the chimeric adaptor protein, the first tau repeat domain linked to the first reporter gene, and the second tau repeat domain linked to the second reporter gene are stably expressed in the cell population. For example, the nucleic acid encoding one or more or all of the chimeric Cas protein, the chimeric adaptor protein, the first tau repeat domain linked to the first reporter gene, and the second tau repeat domain linked to the second reporter gene can be genomically integrated in the cell population.

[0339] As disclosed elsewhere herein, the cell can be any type of cell. For example, the cell can be a eukaryotic cell, a mammalian cell, or a human cell (e.g., HEK293T cell or neuron cell).

[0340] Multiple unique guide RNAs can be introduced into a cell population by any known means. In some methods, the guide RNAs are introduced into the cell population by viral transduction such as retroviral, adenoviral, or lentiviral transduction. In a specific example, the guide RNAs can be introduced by lentiviral transduction. Each of the multiple unique guide RNAs can be in a separate viral vector. The cell population can be infected at any multiplicity of infection. For example, the multiplicity of infection can be between about 0.1 and about 1.0, between about 0.1 and about 0.9, between about 0.1 and about 0.8, between about 0.1 and about 0.7, between about 0.1 and about 0.6, between about 0.1 and about 0.5, between about 0.1 and about 0.4, or between about 0.1 and about 0.3. Alternatively, the multiplicity of infection can be less than about 1.0, less than about 0.9, less than about 0.8, less than about 0.7, less than about 0.6, less than about 0.5, less than about 0.4, less than about 0.3, or less than about 0.2. In a specific example, the multiplicity of infection can be less than about 0.3.

[0341] The guide RNAs can be introduced into the cell population together with a selection marker or a reporter gene to select cells having the guide RNAs, and the method can further include selecting cells comprising the selection marker or the reporter gene. Examples of selection markers and reporter genes are provided elsewhere herein. As an example, the selection marker can be a selection marker conferring drug resistance, such as neomycin phosphotransferase, hygromycin B phosphotransferase, puromycin-N-acetyltransferase, and blasticidin S deaminase. Another exemplary selection marker is the bleomycin resistance protein, encoded by the Sh ble gene (bleomycin gene of Streptoalloteichus hindustanus), which confers resistance to zeocin (phleomycin D1). For example, cells can be selected with a drug (e.g., puromycin) such that only cells transduced with the guide RNA construct are preserved for screening. For example, the drug can be puromycin or zeocin (phleomycin D1).

[0342] In some methods, the multiple unique guide RNAs are introduced at a selected concentration such that most cells receive only one of the unique guide RNAs. For example, if the guide RNAs are introduced by viral transduction, the cells can be infected at a low multiplicity of infection to ensure that most cells receive only one viral construct with a high probability. As a specific example, the multiplicity of infection can be less than about 0.3.

[0343] The cell population into which multiple distinct guide RNAs are introduced can be any suitable number of cells. For example, the cell population can include greater than about 50, greater than about 100, greater than about 200, greater than about 300, greater than about 400, greater than about 500, greater than about 600, greater than about 700, greater than about 800, greater than about 900, or greater than about 1000 cells per distinct guide RNA. In a specific example, the cell population includes greater than about 300 cells or greater than about 500 cells per distinct guide RNA.

[0344] Multiple distinct guide RNAs can target any number of genes. For example, multiple distinct guide RNAs can target about 50 or more genes, about 100 or more genes, about 200 or more genes, about 300 or more genes, about 400 or more genes, about 500 or more genes, about 1000 or more genes, about 2000 or more genes, about 3000 or more genes, about 4000 or more genes, about 5000 or more genes, about 10000 or more genes, or about 20000 or more genes. In some methods, guide RNAs can be selected to target genes in a specific signaling pathway. In some methods, the distinct guide RNA library is a genome-wide library.

[0345] Multiple distinct guide RNAs can target any number of sequences in each individually targeted gene. In some methods, multiple target sequences are targeted on average in each of the multiple genes being targeted. For example, about 2 to about 10, about 2 to about 9, about 2 to about 8, about 2 to about 7, about 2 to about 6, about 2 to about 5, about 2 to about 4, or about 2 to about 3 distinct target sequences can be targeted on average in each of the multiple targeted genes. For example, at least about 2, at least about 3, at least about 4, at least about 5, or at least about 6 distinct target sequences can be targeted on average in each of the multiple targeted genes. As a specific example, about 6 target sequences can be targeted on average in each of the multiple targeted genes. As another specific example, about 3 to about 6 or about 4 to about 6 target sequences are targeted on average in each of the multiple targeted genes.

[0346] The guide RNA can target any desired locus in the target gene. In some CRISPRn methods using Cas / tau biosensor cells, each guide RNA targets a constitutive exon if possible. In some methods, each guide RNA targets the 5' constitutive exon if possible. In some methods, each guide RNA targets the first exon, the second exon, or the third exon (from the 5' end of the gene) if possible. In some CRISPRa methods using SAM / tau biosensor cells, each guide RNA can target a guide RNA target sequence within 200 bp upstream of the transcription start site if possible. In some CRISPRa methods using SAM / tau biosensor cells, each guide RNA can include one or more adaptor-binding elements to which a chimeric adaptor protein can specifically bind. In one example, each guide RNA includes two adaptor-binding elements to which a chimeric adaptor protein can specifically bind, optionally where the first adaptor-binding element is within the first loop of each of the one or more guide RNAs, and the second adaptor-binding element is within the second loop of each of the one or more guide RNAs. For example, the adaptor-binding element can include the sequence shown in SEQ ID NO:33. In a specific example, each of the one or more guide RNAs is a single guide RNA comprising a CRISPR RNA (crRNA) portion fused to a trans-activating CRISPR RNA (tracrRNA) portion, and the first loop is a tetraloop corresponding to residues 13-16 of SEQ ID NO:17, 19, 30, or 31, and the second loop is stem-loop 2 corresponding to residues 53-56 of SEQ ID NO:17, 19, 30, or 31.

[0347] The step of culturing a cell population to allow genome editing and amplification can be any suitable period of time. For example, the culturing can last between about 2 days and about 10 days, between about 3 days and about 9 days, between about 4 days and about 8 days, between about 5 days and about 7 days, or about 6 days. Similarly, the step of culturing a cell population to allow transcriptional activation and amplification can be any suitable period of time. For example, the culturing can last between about 2 days and about 10 days, between about 3 days and about 9 days, between about 4 days and about 8 days, between about 5 days and about 7 days, or about 6 days.

[0348] Any suitable tau inoculum can be used to generate an inoculated cell population. Suitable tau inocula are disclosed elsewhere herein. Some suitable inocula include tau repeat domains that can be, for example, different or similar or identical to the first tau repeat domain and / or the second tau repeat domain. In one example, the inoculation step comprises culturing the genetically modified cell population in the presence of conditioned medium collected from cultured tau aggregation-positive cells, wherein the tau repeat domain is stably present in an aggregated state. For example, the conditioned medium can be collected from confluent tau aggregation-positive cells after about 1 to about 7 days, about 2 to about 6 days, about 3 to about 5 days, or about 4 days on confluent cells. The inoculation step can comprise culturing the genetically modified cell population at any suitable ratio of conditioned medium to fresh medium. For example, the use of conditioned medium can comprise culturing the genetically modified cell population in about 90% conditioned medium and about 10% fresh medium, about 85% conditioned medium and about 15% fresh medium, about 80% conditioned medium and about 20% fresh medium, about 75% conditioned medium and about 25% fresh medium, about 70% conditioned medium and about 30% fresh medium, about 65% conditioned medium and about 35% fresh medium, about 60% conditioned medium and about 40% fresh medium, about 55% conditioned medium and about 45% fresh medium, about 50% conditioned medium and about 50% fresh medium, about 45% conditioned medium and about 55% fresh medium, about 40% conditioned medium and about 60% fresh medium, about 35% conditioned medium and about 65% fresh medium, about 30% conditioned medium and about 70% fresh medium, about 25% conditioned medium and about 75% fresh medium, about 20% conditioned medium and about 80% fresh medium, about 15% conditioned medium and about 85% fresh medium, or about 10% conditioned medium and about 90% fresh medium. In one example, the use of conditioned medium can comprise culturing the genetically modified cell population in a medium comprising at least about 50% conditioned medium and no more than about 50% fresh medium. In a specific example, the use of conditioned medium can comprise culturing the genetically modified cell population in about 75% conditioned medium and about 25% fresh medium. Optionally, the genetically modified cell population is not co-cultured with the tau aggregation-positive cells, wherein the tau repeat domain is stably present in an aggregated state.

[0349] The step of culturing the inoculated cell population to allow the formation of tau aggregates can be for any suitable length of time, wherein aggregates of the first tau repeat domain and the second tau repeat domain form in a subset of the inoculated cell population to produce an aggregate-positive cell population. For example, the culturing can last between about 1 day and about 7 days, between about 2 days and about 6 days, between about 3 days and about 5 days, or about 4 days. Aggregation can be assayed by any suitable means, depending on the reporter gene used. For example, in a method where the first reporter gene and the second reporter gene are a fluorescence resonance energy transfer (FRET) pair, the aggregate-positive cell population can be identified by flow cytometry.

[0350] The abundance of the guide RNA can be assayed by any suitable means. In a specific example, the abundance is assayed by next-generation sequencing. Next-generation sequencing refers to high-throughput DNA sequencing technologies that are not Sanger-based. For example, assaying the abundance of the guide RNA can include measuring the read count of the guide RNA.

[0351] In some methods, if the abundance of the guide RNA relative to the total population of a plurality of unique guide RNAs is at least about 1.5-fold in the aggregate-positive cell population compared to the cell population cultured after introduction of the guide RNA library, then the guide RNA is considered to be enriched. Different enrichment thresholds can also be used. For example, the enrichment threshold can be set higher to be more stringent (e.g., at least about 1.6-fold, at least about 1.7-fold, at least about 1.8-fold, at least about 1.9-fold, at least about 2-fold, at least about 2.5-fold, or at least about 3-fold). Alternatively, the enrichment threshold can be set lower to be less stringent (e.g., at least about 1.4-fold, at least about 1.3-fold, or at least about 1.2-fold).

[0352] In one example, the step of determining abundance can include determining the abundance of multiple unique guide RNAs in the aggregate positive population relative to the cell population cultured after introduction of the guide RNA library at a first time point during the culture and / or a second time point during the culture. For example, the first time point can be at the first passage of culturing the cell population, and the second time point can be in the middle of culturing the cell population to allow genome editing and amplification. For example, the first time point can be after a sufficient amount of time for the guide RNA to form a complex with the Cas protein and for the Cas protein to cleave multiple genes resulting in gene function knockout (CRISPRn) or transcriptional activation of multiple genes (CRISPRa). However, the first time point should ideally be at the first cell passage to determine the gRNA library representation soon after infection (i.e., before further amplification and genome editing), and to determine whether the representation of each gRNA has evolved from the first time point to the second time point and any additional time points to the final time point. This allows for the exclusion of enriched gRNAs / targets due to cell growth advantages during the screening process by verifying that the gRNA abundance has not changed between the first and second time points. As a specific example, the first time point can be after culturing and amplification for about 1 day, about 2 days, about 3 days, or about 4 days, and the second time point can be after culturing and amplification for about 3 days, about 4 days, about 5 days, or about 6 days. For example, the first time point can be after culturing and amplification for about 3 days, and the second time point can be after culturing and amplification for about 6 days. In some methods, a gene can then be considered a tau aggregation gene modifier, where disruption (CRISPRn) or transcriptional activation (CRISPRa) of the gene enhances (or is expected to enhance) tau aggregation if the abundance of the guide RNA for the targeted gene relative to the total population of multiple unique guide RNAs is at least 1.5-fold (or above a different selected enrichment threshold) in the cell population cultured after introduction of the guide RNA library at both the first and second time points in the aggregate positive cell population. Alternatively or additionally, a gene can be considered a tau aggregation gene modifier, where disruption (CRISPRn) or transcriptional activation (CRISPRa) of the gene enhances (or is expected to enhance) tau aggregation if the abundance of at least two unique guide RNAs for the targeted gene relative to the total population of multiple unique guide RNAs is at least 1.5-fold (or above a different selected enrichment threshold) in the cell population cultured after introduction of the guide RNA library at either the first or second time point in the aggregate positive cell population.

[0353] In some CRISPRn methods, the following steps are taken to identify genes as tau aggregation gene modifiers, where disruption (CRISPRn) or transcriptional activation (CRISPRa) of the gene enhances (or is expected to enhance) tau aggregation. Similarly, in some CRISPRa methods, the following steps are taken to identify genes as tau aggregation gene modifiers, where transcriptional activation of the gene enhances tau aggregation. The first step includes identifying which of the plurality of unique guide RNAs are present in the aggregation-positive cell population. The second step includes calculating the random chance of the identified guide RNAs using the formula nCn'*(x-n')C(m-n) / xCm, where x is the variety of unique guide RNAs introduced into the cell population, m is the variety of unique guide RNAs identified in step (1), n is the variety of unique guide RNAs introduced into the cell population that target the gene, and n' is the variety of unique guide RNAs identified in step (1) that target the gene. The third step includes calculating the average enrichment score of the guide RNAs identified in step (1). The enrichment score of a guide RNA is the relative abundance of the guide RNA in the aggregation-positive cell population divided by the relative abundance of the guide RNA in the cell population cultured after introduction of the guide RNA library. The relative abundance is the read count of the guide RNA divided by the read count of the total population of the plurality of unique guide RNAs. The fourth step includes selecting the gene if the guide RNAs targeting the gene are significantly lower than the random chance of being present and higher than a threshold enrichment score. Possible threshold enrichment scores were discussed above. As a specific example, the threshold enrichment score can be set to about 1.5-fold.

[0354] As used in the phrase "number of unique guide RNAs", "number" means the quantity of unique guide RNA sequences. The number is not abundance, but rather a qualitative "presence" or "absence". The number of unique guide RNAs means the quantity of unique guide RNA sequences. The number of unique guide RNAs is determined by next-generation sequencing (NGS) to identify all unique guide RNAs present in a cell population. The determination is accomplished by using two primers that recognize the constant region of a viral vector to amplify the gRNA between the constant regions and a primer that recognizes one constant region for sequencing. Each unique guide RNA present in a sample will generate read counts using the sequencing primer. The NGS results will contain the sequences and also the number of reads corresponding to the sequences. The read counts will be used for the enrichment score calculation for each guide RNA, and the presence of each unique sequence will inform which guide RNAs are present. For example, if there are three unique guide RNAs for a gene before selection and all three are retained after selection, then both n and n' are 3. These numbers are used for calculating statistics, rather than the actual read counts. However, the read counts for each guide RNA (in one example, 100, 200, 50, corresponding to each of the 3 unique guide RNAs) will be used for calculating the enrichment score.

[0355] V. Methods for Screening Tau Aggregation Gene Modifiers that Prevent Tau Aggregation

[0356] The Cas / tau biosensor cell lines disclosed herein can be used in methods for screening tau aggregation gene modifiers (e.g., that prevent or are expected to prevent tau aggregation). Such methods can include providing a population of Cas / tau biosensor cells as disclosed elsewhere herein, introducing a library comprising a plurality of unique guide RNAs, and assessing tau aggregation in the targeted cells.

[0357] As an example, the method can include providing a population of Cas / tau biosensor cells (e.g., a population of cells comprising a Cas protein, a first tau repeat domain linked to a first reporter gene, and a second tau repeat domain linked to a second reporter gene), introducing a library of multiple unique guide RNAs targeting multiple genes into the population of cells and culturing the population of cells to allow genome editing and amplification. The multiple unique guide RNAs form a complex with the Cas protein, and the Cas protein cleaves the multiple genes resulting in gene function knockout to produce a genetically modified population of cells. The genetically modified population of cells can then be contacted with a tau inoculum to produce an inoculated population of cells. For example, the tau inoculum can be a "maximal inoculum" agent as described elsewhere herein, such as a cell lysate from tau aggregation-positive cells. The inoculated population of cells can be cultured to allow the formation of tau aggregates, wherein aggregates of the first tau repeat domain and the second tau repeat domain form in a subset of the inoculated population of cells to produce an aggregation-positive population of cells, and wherein aggregates do not form in a second subset of the inoculated population of cells to produce an aggregation-negative population of cells. Finally, the abundance of each unique guide RNA among the multiple unique guide RNAs can be determined in the aggregation-positive population of cells relative to the aggregation-negative population of cells and / or relative to the population of cells after inoculation and / or relative to the population of cells cultured after introduction of the guide RNA library. Enrichment of the guide RNA in the aggregation-negative population of cells relative to the aggregation-positive population of cells and / or relative to the population of cells after inoculation and / or relative to the population of cells cultured after introduction of the guide RNA library indicates that the gene targeted by the guide RNA is a tau aggregation gene modifier, wherein disruption of the gene targeted by the guide RNA prevents tau aggregation, or is a candidate gene modifier of tau aggregation (e.g., for further testing by secondary screening), wherein disruption of the gene targeted by the guide RNA is expected to prevent tau aggregation. Similarly, depletion of the guide RNA in the aggregation-positive population of cells relative to the aggregation-negative population of cells and / or relative to the population of cells after inoculation and / or relative to the population of cells cultured after introduction of the guide RNA library indicates that the gene targeted by the guide RNA is a tau aggregation gene modifier, wherein disruption of the gene targeted by the guide RNA prevents tau aggregation, or is a candidate gene modifier of tau aggregation (e.g., for further testing by secondary screening), wherein disruption of the gene targeted by the guide RNA is expected to prevent tau aggregation.Enrichment of guide RNAs in the aggregated positive cell population relative to the aggregated negative cell population and / or relative to the cell population after seeding and / or relative to the cell population cultured after introduction of the guide RNA library indicates that the gene targeted by the guide RNA is a tau aggregation gene modifier, wherein disruption of the gene targeted by the guide RNA promotes or enhances tau aggregation, or is a candidate gene modifier of tau aggregation (e.g., for further testing by secondary screening), wherein disruption of the gene targeted by the guide RNA is expected to promote or enhance tau aggregation. Similarly, depletion of guide RNAs in the aggregated negative cell population relative to the aggregated positive cell population and / or relative to the cell population after seeding and / or relative to the cell population cultured after introduction of the guide RNA library indicates that the gene targeted by the guide RNA is a tau aggregation gene modifier, wherein disruption of the gene targeted by the guide RNA promotes or enhances tau aggregation, or is a candidate gene modifier of tau aggregation (e.g., for further testing by secondary screening), wherein disruption of the gene targeted by the guide RNA is expected to promote or enhance tau aggregation.

[0358] Similarly, the SAM / tau biosensor cell lines disclosed herein can be used in methods for screening for tau aggregation gene modifiers (e.g., that prevent or are expected to prevent tau aggregation). Such methods can include providing a population of SAM / tau biosensor cells as disclosed elsewhere herein, introducing a library comprising a plurality of unique guide RNAs, and assessing tau aggregation in the targeted cells.

[0359] As an example, the method can include providing a population of SAM / tau biosensor cells (e.g., a population of cells that includes a chimeric Cas protein comprising a nuclease-inactivated Cas protein fused to one or more transcriptional activation domains, a chimeric adaptor protein comprising an adaptor protein fused to one or more transcriptional activation domains, a first tau repeat domain linked to a first reporter gene, and a second tau repeat domain linked to a second reporter gene), introducing a library of multiple unique guide RNAs targeting multiple genes into the population of cells and culturing the population of cells to allow transcriptional activation and amplification. The multiple unique guide RNAs form a complex with the chimeric Cas protein and the chimeric adaptor protein, and the complex activates transcription of the multiple genes resulting in increased gene expression and a modified population of cells. The modified population of cells can then be contacted with a tau inoculum to produce an inoculated population of cells. For example, the tau inoculum can be a "maximal inoculum" agent as described elsewhere herein, such as a cell lysate from tau aggregation-positive cells. The inoculated population of cells can be cultured to allow formation of tau aggregates, wherein aggregates of the first tau repeat domain and the second tau repeat domain form in a subset of the inoculated population of cells to produce an aggregation-positive population of cells, and wherein aggregates do not form in a second subset of the inoculated population of cells to produce an aggregation-negative population of cells. Finally, the abundance of each unique guide RNA among the multiple unique guide RNAs can be determined in the aggregation-positive population of cells relative to the aggregation-negative population of cells and / or relative to the population of cells after inoculation and / or relative to the population of cells cultured after introduction of the guide RNA library. Enrichment of the guide RNA in the aggregation-negative population of cells relative to the aggregation-positive population of cells and / or relative to the population of cells after inoculation and / or relative to the population of cells cultured after introduction of the guide RNA library indicates that the gene targeted by the guide RNA is a tau aggregation gene modifier, wherein transcriptional activation of the gene targeted by the guide RNA prevents tau aggregation, or is a candidate gene modifier of tau aggregation (e.g., for further testing by secondary screening), wherein transcriptional activation of the gene targeted by the guide RNA is expected to prevent tau aggregation. Similarly, depletion of the guide RNA in the aggregation-positive population of cells relative to the aggregation-negative population of cells and / or relative to the population of cells after inoculation and / or relative to the population of cells cultured after introduction of the guide RNA library indicates that the gene targeted by the guide RNA is a tau aggregation gene modifier, wherein transcriptional activation of the gene targeted by the guide RNA prevents tau aggregation, or is a candidate gene modifier of tau aggregation (e.g., for further testing by secondary screening), wherein transcriptional activation of the gene targeted by the guide RNA is expected to prevent tau aggregation.Enrichment of guide RNAs in the aggregated positive cell population relative to the aggregated negative cell population and / or relative to the cell population after seeding and / or relative to the cell population cultured after introduction of the guide RNA library indicates that the gene targeted by the guide RNA is a tau aggregation gene modifier, where transcriptional activation of the gene targeted by the guide RNA promotes or enhances tau aggregation, or is a candidate gene modifier of tau aggregation (e.g., for further testing by secondary screening), where transcriptional activation of the gene targeted by the guide RNA is expected to promote or enhance tau aggregation. Similarly, depletion of guide RNAs in the aggregated negative cell population relative to the aggregated positive cell population and / or relative to the cell population after seeding and / or relative to the cell population cultured after introduction of the guide RNA library indicates that the gene targeted by the guide RNA is a tau aggregation gene modifier, where transcriptional activation of the gene targeted by the guide RNA promotes or enhances tau aggregation, or is a candidate gene modifier of tau aggregation (e.g., for further testing by secondary screening), where transcriptional activation of the gene targeted by the guide RNA is expected to promote or enhance tau aggregation.

[0360] The Cas / tau biosensor cells used in the method can be any of the biosensor cells of the Cas / tau biosensor cells disclosed elsewhere herein. Similarly, the SAM / tau biosensor cells used in the method can be any of the SAM / tau biosensor cells disclosed elsewhere herein. The first tau repeat domain and the second tau repeat domain can be different or can be similar or identical. The tau repeat domain can be any of the repeat domains of the tau repeat domains disclosed elsewhere herein. For example, the first tau repeat domain and / or the second tau repeat domain can be a wild-type tau repeat domain or can include an aggregation-promoting mutation (e.g., a pathogenic aggregation-promoting mutation), such as the tau P301S mutation...

Claims

1. A method for screening tau aggregation gene modifiers, the method comprising: (a) providing a cell population comprising a Cas9 protein, a first tau repeat domain linked to a first reporter gene, and a second tau repeat domain linked to a second reporter gene, wherein the cells are mammalian cells, wherein the first reporter gene and the second reporter gene are fluorescent proteins, and wherein the first reporter gene and the second reporter gene are a fluorescence resonance energy transfer (FRET) pair; (b) introducing a library comprising a plurality of unique guide RNAs targeting a plurality of genes into the cell population; (c) culturing the cell population to allow genome editing and amplification, wherein the plurality of unique guide RNAs form a complex with the Cas9 protein, and the Cas9 protein cleaves the plurality of genes, thereby causing gene function knockout to produce a gene-modified cell population; (d) contacting the gene-modified cell population with a tau inoculum to produce an inoculated cell population, wherein step (d) comprises culturing the gene-modified cell population in the presence of conditioned medium collected from cultured tau aggregation-positive cells, wherein the tau repeat domains stably exist in an aggregated state, and wherein the conditioned medium is collected after 1 to 7 days on confluent tau aggregation-positive cells; (e) culturing the inoculated cell population to allow the formation of tau aggregates, wherein aggregates of the first tau repeat domain and the second tau repeat domain form in a subset of the inoculated cell population to produce an aggregation-positive cell population; and (f) determining the abundance of each unique guide RNA among the plurality of unique guide RNAs in the aggregation-positive cell population identified in step (e) relative to the gene-modified cell population in step (c), wherein enrichment of the guide RNA in the aggregation-positive cell population identified in step (e) relative to the cultured cell population in step (c) indicates that the gene targeted by the guide RNA is a tau aggregation gene modifier, and disruption of the gene targeted by the guide RNA enhances tau aggregation.

2. The method according to claim 1, wherein the Cas9 protein is Streptococcus pyogenes Cas9 protein.

3. The method according to claim 2, wherein the Cas9 protein comprises SEQ ID NO:

21.

4. The method according to claim 3, wherein the Cas9 protein is encoded by a coding sequence comprising the sequence shown in SEQ ID NO:

22.

5. The method according to claim 1, wherein the Cas9 protein, the first tau repeat domain linked to the first reporter gene, and the second tau repeat domain linked to the second reporter gene are stably expressed in the cell population, or The nucleic acids encoding the Cas9 protein, the first tau repeat domain linked to the first reporter gene, and the second tau repeat domain linked to the second reporter gene are genomically integrated in the cell population.

6. The method according to claim 1, wherein each guide RNA targets a constitutive exon or a 5' constitutive exon.

7. The method according to claim 1, wherein each guide RNA targets the first exon, the second exon, or the third exon.

8. A method for screening modifiers of tau aggregation, the method comprising: (a) providing a cell population comprising a chimeric Cas9 protein comprising a nuclease-inactivated Cas9 protein fused to one or more transcriptional activation domains, a chimeric adaptor protein comprising an adaptor protein fused to one or more transcriptional activation domains, a first tau repeat domain linked to a first reporter gene, and a second tau repeat domain linked to a second reporter gene, wherein the cells are mammalian cells, wherein the first reporter gene and the second reporter gene are fluorescent proteins, and wherein the first reporter gene and the second reporter gene are a fluorescence resonance energy transfer (FRET) pair; (b) introducing a library comprising a plurality of unique guide RNAs targeting a plurality of genes into the cell population; (c) culturing the cell population to allow transcriptional activation and amplification, wherein the plurality of unique guide RNAs form a complex with the chimeric Cas9 protein and the chimeric adaptor protein, and the complex activates transcription of the plurality of genes, resulting in increased gene expression to produce a genetically modified cell population; (d) contacting the genetically modified cell population with a tau inoculum to produce an inoculated cell population, wherein step (d) comprises culturing the genetically modified cell population in the presence of conditioned medium collected from cultured tau aggregation-positive cells, wherein the tau repeat domains stably exist in an aggregated state, and wherein the conditioned medium is collected after 1 to 7 days on confluent tau aggregation-positive cells; (e) culturing the inoculated cell population to allow formation of tau aggregates, wherein aggregates of the first tau repeat domain and the second tau repeat domain form in a subset of the inoculated cell population to produce an aggregation-positive cell population; and (f) determining the abundance of each unique guide RNA among the plurality of unique guide RNAs in the aggregation-positive cell population identified in step (e) relative to the genetically modified cell population in step (c), wherein enrichment of the guide RNA in the aggregation-positive cell population identified in step (e) relative to the cultured cell population in step (c) indicates that the gene targeted by the guide RNA is a modifier of tau aggregation, and transcriptional activation of the gene targeted by the guide RNA enhances tau aggregation.

9. The method according to claim 8, wherein the Cas9 protein is Streptococcus pyogenes Cas9 protein.

10. The method according to claim 8, wherein the chimeric Cas9 protein comprises the nuclease-inactivated Cas9 protein fused to the VP64 transcriptional activation domain.

11. The method according to claim 10, wherein the chimeric Cas9 protein comprises, from the N-terminus to the C-terminus: The nuclease-inactivated Cas9 protein; a nuclear localization signal; and the VP64 transcriptional activation domain.

12. The method according to claim 8, wherein the adaptor protein is the MS2 coat protein, and wherein the one or more transcriptional activation domains in the chimeric adaptor protein comprise the p65 transcriptional activation domain and the HSF1 transcriptional activation domain.

13. The method according to claim 12, wherein the chimeric adaptor protein comprises, from the N-terminus to the C-terminus: The MS2 coat protein; a nuclear localization signal; the p65 transcriptional activation domain; and the HSF1 transcriptional activation domain.

14. The method according to claim 11, wherein the chimeric Cas9 protein comprises SEQ ID NO:

36.

15. The method according to claim 14, wherein the chimeric Cas9 protein is encoded by a coding sequence comprising the sequence shown in SEQ ID NO:

38.

16. The method according to claim 13, wherein the chimeric adaptor protein comprises SEQ ID NO:

37.

17. The method according to claim 16, wherein the chimeric adaptor protein is encoded by a coding sequence comprising the sequence shown in SEQ ID NO:

39.

18. The method according to any one of claims 8-17, wherein the chimeric Cas9 protein, the chimeric adaptor protein, the first tau repeat domain linked to the first reporter gene, and the second tau repeat domain linked to the second reporter gene are stably expressed in the cell population, or wherein the nucleic acids encoding the chimeric Cas9 protein, the chimeric adaptor protein, the first tau repeat domain linked to the first reporter gene, and the second tau repeat domain linked to the second reporter gene are genomically integrated in the cell population.

19. The method according to any one of claims 8-17, wherein each guide RNA targets a guide RNA target sequence within 200 bp upstream of the transcription start site.

20. The method according to any one of claims 8-17, wherein each guide RNA comprises one or more adaptor binding elements to which the chimeric adaptor protein can specifically bind.

21. The method according to claim 20, wherein each guide RNA comprises two adaptor binding elements to which the chimeric adaptor protein can specifically bind.

22. The method according to claim 21, wherein the first adaptor binding element is within the first loop of each guide RNA in the plurality of unique guide RNAs, and the second adaptor binding element is within the second loop of each guide RNA in the plurality of unique guide RNAs.

23. The method according to claim 22, wherein the adaptor binding element comprises the sequence shown in SEQ ID NO:

33.

24. The method according to claim 22, wherein each of the plurality of unique guide RNAs is a single guide RNA comprising a CRISPR RNA (crRNA) portion fused to a trans-activating CRISPR RNA (tracrRNA) portion, and the first loop is a tetraloop corresponding to residues 13-16 of SEQ ID NO:17, and the second loop is stem-loop 2 corresponding to residues 53-56 of SEQ ID NO:

17.

25. The method according to claim 1 or 8, wherein step (c) is from 3 days to 9 days.

26. The method according to claim 25, wherein step (c) is 6 days.

27. The method according to claim 1 or 8, wherein the conditioned medium is harvested after 4 days on tau aggregation-positive cells that are confluent.

28. The method according to claim 1 or 8, wherein step (d) comprises culturing the genetically modified cell population in 75% conditioned medium and 25% fresh medium.

29. The method according to claim 1 or 8, wherein the genetically modified cell population is not co-cultured with the tau aggregation-positive cells.

30. The method according to claim 1 or 8, wherein step (e) is from 2 days to 6 days.

31. The method according to claim 30, wherein step (e) is 4 days.

32. The method according to claim 1 or 8, wherein the abundance is determined by next-generation sequencing.

33. The method according to claim 1 or 8, wherein a guide RNA is considered enriched if the abundance of the guide RNA in the aggregation-positive cell population in step (e) is at least 1.5-fold that in the cultured cell population in step (c) relative to the total population of the plurality of unique guide RNAs.

34. The method according to claim 1 or 8, wherein step (f) comprises determining the abundance of each unique guide RNA among the plurality of unique guide RNAs in the aggregation-positive cell population in step (e) relative to the cultured cell population in step (c) at a first time point in step (c) and / or a second time point in step (c).

35. The method according to claim 34, wherein the first time point in step (c) is at the first passage of culturing the cell population, and the second time point is in the middle of culturing the cell population to allow genome editing and amplification or transcriptional activation and amplification.

36. The method according to claim 35, wherein the first time point in step (c) is after culturing for three days, and the second time point in step (c) is after culturing for six days.

37. The method according to claim 34, wherein a gene is considered a tau aggregation gene modifier if the following occurs, wherein disruption or transcriptional activation of the gene enhances tau aggregation: (1) At both the first time point in step (c) and the second time point in step (c), the abundance of the guide RNAs targeting the gene relative to the total population of the plurality of unique guide RNAs is at least 1.5-fold in the aggregated positive cell population in step (e) compared to the cultured cell population in step (c); and / or (2) At the first time point in step (c) or the second time point in step (c), the abundance of at least two unique guide RNAs targeting the gene relative to the total population of the plurality of unique guide RNAs is at least 1.5-fold in the aggregated positive cell population in step (e) compared to the cultured cell population in step (c).

38. The method according to any one of claims 1, 8, and 37, wherein in step (f), the following steps are taken to identify a gene as a tau aggregation gene modifier, wherein disruption or transcriptional activation of the gene enhances tau aggregation: (1) Identify which of the plurality of unique guide RNAs are present in the aggregated positive cell population generated in step (e); (2) Calculate the random chance of the presence of the guide RNAs identified in step (f)(1) using the formula nCn'*(x - n')C(m - n) / xCm, where x is the number of types of unique guide RNAs introduced into the cell population in step (b), where m is the number of types of unique guide RNAs identified in step (f)(1), where n is the number of types of unique guide RNAs targeting the gene introduced into the cell population in step (b), and where n' is the number of types of unique guide RNAs targeting the gene identified in step (f)(1); (3) Calculate the average enrichment score of the guide RNAs identified in step (f)(1), where the enrichment score of a guide RNA is the relative abundance of the guide RNA in the aggregated positive cell population generated in step (e) divided by the relative abundance of the guide RNA in the cultured cell population in step (c), and where the relative abundance is the read count of the guide RNA divided by the read count of the total population of the plurality of unique guide RNAs; and (4) If the guide RNAs targeting the gene are significantly lower than the random chance of presence and higher than a threshold enrichment score, then select the gene.

39. The method according to any one of claims 1, 8, and 37, wherein the first tau repeat domain and / or the second tau repeat domain is a human tau repeat domain, and / or wherein the first tau repeat domain and / or the second tau repeat domain comprises an aggregation-promoting mutation; and / or wherein the first tau repeat domain and / or the second tau repeat domain comprises a tau four-repeat domain; and / or wherein the first tau repeat domain and / or the second tau repeat domain comprises SEQ ID NO:11; and / or Wherein the first tau repeat domain and the second tau repeat domain are the same.

40. The method according to claim 39, wherein the first tau repeat domain and / or the second tau repeat domain comprises a tau P301S mutation.

41. The method according to any one of claims 1, 8 and 37, wherein the first tau repeat domain and the second tau repeat domain are the same and each comprises a tau four-repeat domain containing a tau P301S mutation.

42. The method according to any one of claims 1, 8 and 37, wherein the first reporter gene is cyan fluorescent protein (CFP), and the second reporter gene is yellow fluorescent protein (YFP).

43. The method according to any one of claims 1, 8 and 37, wherein the cell is a human cell.

44. The method according to claim 43, wherein the cell is a HEK293T cell.

45. The method according to any one of claims 1, 8 and 37, wherein the plurality of unique guide RNAs are introduced at a selected concentration such that most cells receive only one of the unique guide RNAs.

46. The method according to any one of claims 1, 8 and 37, wherein the plurality of unique guide RNAs target 100 or more genes, 1000 or more genes or 10000 or more genes, or wherein the library is a genome-wide library.

47. The method according to any one of claims 1, 8 and 37, wherein a plurality of target sequences are targeted on average in each of the plurality of genes targeted.

48. The method according to claim 47, wherein at least three target sequences are targeted on average in each of the plurality of genes targeted.

49. The method according to claim 48, wherein three to six target sequences are targeted on average in each of the plurality of genes targeted.

50. The method according to any one of claims 1, 8 and 37, wherein the plurality of unique guide RNAs are introduced into the cell population by viral transduction.

51. The method according to claim 50, wherein each unique guide RNA of the plurality of unique guide RNAs is in a separate viral vector.

52. The method according to claim 51, wherein the plurality of unique guide RNAs are introduced into the cell population by lentiviral transduction.

53. The method according to claim 52, wherein the cell population is infected at a multiplicity of infection less than 0.

3.

54. The method according to any one of claims 1, 8 and 37, wherein the plurality of unique guide RNAs are introduced into the cell population together with a selection marker, and step (b) further comprises selecting cells comprising the selection marker.

55. The method according to claim 54, wherein the selection marker confers resistance to a drug.

56. The method according to claim 55, wherein the selection marker confers resistance to puromycin or zeocin.

57. The method according to claim 55, wherein the selection marker is selected from neomycin phosphotransferase, hygromycin B phosphotransferase, puromycin-N-acetyltransferase, and blasticidin S deaminase.

58. The method according to any one of claims 1, 8, and 37, wherein the cell population into which the plurality of unique guide RNAs are introduced in step (b) comprises greater than 300 cells / unique guide RNA.

Images