Modified non-natural NKG2D ligands that selectively deliver attached heterologous molecules to non-natural NKG2D receptors on CAR cells

Abstract

The present application generally relates to the generation of modified non-natural α1-α2 domains of NKG2D ligands having attached polypeptides with specific target binding properties, such as antibodies or variable fragments of antibodies, which are selectively delivered to chimeric antigen receptors (CARs) comprising modified non-natural NKG2D receptors on engineered mammalian cells. Targeting of surface expressed molecules includes targeting of virally infected cells, which can then be attacked and eliminated by engineered cells of the immune system expressing CARs homologous to the modified non-natural α1-α2 domains of NKG2D ligands with attached polypeptides.

Description

Technical Field

[0001] The present application generally relates to modified non-natural α1-α2 domains of NKG2D ligands having attached polypeptides having specific target binding properties (e.g., antibodies or antibody fragments) that are selectively delivered to chimeric antigen receptors (CARs) comprising the modified non-natural NKG2D receptor on engineered mammalian cells. Background Art

[0002] Antibodies (Ab), Figure 1 , also known as immunoglobulins (Ig), are large, Y-shaped proteins used by the immune system in many mammals (including humans) to recognize and neutralize foreign substances such as bacteria and viruses (Charles Janeway (2001). Immunobiology. (5th ed.), Chapter 3. Garland Publishing. ISBN 0-8153-3642-X. (Electronic full text via NCBI Bookshelf)). Antibodies recognize a unique part of a foreign target, called an antigen. Each tip of the two arms of the antibody "Y" contains an antigen-binding site, or paratope (a structure similar to a lock), which is specific for a particular epitope of the antigen (similar to a key), allowing the two structures to fit together precisely. Using this binding mechanism, antibodies can mark microorganisms or infected cells for attack by other parts of the immune system, or can directly neutralize their target, for example by blocking a part that is critical for microbial invasion and survival. The production of antibodies is a major function of the humoral or "adaptive" immune system. Antibodies are secreted by plasma cells. Antibodies in nature can appear in two physical forms: a soluble form that is secreted from cells and a membrane-bound form that is attached to the surface of B cells via the "stem" of the Y.

[0003] Antibodies are glycoproteins belonging to the immunoglobulin superfamily and are generally composed of a basic structural unit, each having two large heavy chains and two small light chains. There are several different types of antibody heavy chains, and several different types of antibodies, which are grouped into different isotypes based on the heavy chains they possess. Five different antibody isotypes are known in mammals (Market E, Papavasiliou FN (October 2003). "V (D) J recombination and the evolution of the adaptive immune system". PLoS Biol. 1 (1): E16. doi: 10.1371 / journal.pbio.0000016.PMC 212695. PMID 14551913). Although the general structure of all antibodies is very similar, the small area at the tip of each arm of the Y-shaped protein is extremely variable, resulting in millions of antibodies with slightly different tip structures or antigen binding sites. This area is called a hypervariable region or variable region. Each of these natural variants can bind to a different antigen. This enormous diversity of antibodies allows the immune system to adapt and recognize a similarly wide range of antigens (Hozumi N, Tonegawa S (1976). "Evidence for somatic rearrangement of immunoglobulin genes coding for variable and constant regions". Proc. Natl. Acad. Sci. USA 73 (10): 3628–3632. doi: 10.1073 / pnas.73.10.3628. PMC 431171. PMID 824647.).

[0004] The natural "Y"-shaped Ig molecule is composed of four polypeptide chains; two identical heavy chains and two identical light chains connected by disulfide bonds. Each heavy chain has two major regions, a constant region (CH) and a variable region (VH). The constant region is essentially the same in all antibodies of the same isotype, but varies in antibodies of different isotypes. The light chain also has two consecutive domains: a smaller constant region (CL) and a variable region (VL) (Woof J, Burton D (2004). "Human antibody-Freceptor interactions illuminated by crystal structures." Nat Rev Immunol 4(2):89–99. doi:10.1038 / nri1266. PMID 15040582).

[0005] Some parts of antibodies have the same function. Each of the two arms of a Y, for example, contains a site that can bind to an antigen and thus recognize a specific foreign substance. This region of the antibody is called the Fv (fragment variable) region. It consists of one of the antibody's heavy chain variable regions (V H ) and a light chain variable region (V L ) composition (Hochman J, Inbar D, Givol D (1973). An active antibody fragment (Fv) composed of the variable portions of heavy and light chains. Biochemistry 12 (6): 1130–1135. doi: 10.1021 / bi00730a018. PMID 45697699). The paratope is formed at one end of the Fv and is the region for binding to the antigen. It contains the variable loop of the β-strand, V L and V H There are three on each side of the ribosome, responsible for antigen binding. These six loops are called complementarity determining regions (CDRs) (North B, Lehmann A, Dunbrack RL (2010). “A new clustering of antibody CDRloop conformations”. J Mol Biol 406(2):228–256. doi:10.1016 / j.jmb.2010.10.030.PMC 3065967.PMID 21035459).

[0006] Useful polypeptides with specific antigen binding function can be derived from the CDRs of the antibody variable region. L ) and one from the heavy chain (V H ), each with three CDRs, can be fused in tandem in either order using a single short linker peptide of 10 to about 25 amino acids to produce a linear single-chain variable fragment (scFv) polypeptide comprising one heavy chain and one light chain variable domain (Bird, R.E., Hardman, K.D., Jacobson, J.W., Johnson, S., Kaufman, B.M., Lee, S.M., Lee, T., Pope, S.H., Riordan, G.S., and Whitlow, M. (1988). Single-chain antigen-binding proteins. Science 242, 423-426; Huston, J.S., Levinson, D., Mudgett-Hunter, M., Tai, M.S., Novotny, J., Margolies, M.N., Ridge, R., Bruccoleri, R.E., Haber, E., Crea, R., and Opperman, H. (1988). Protein engineering of antibody binding sites: Recovery of specific activity in an anti-digoxin single-chain Fv analogue produced in Escherichia coli. PNAS 85:5879-5883).

[0007] The linker is usually rich in glycine to provide flexibility, and serine, threonine or charged amino acids to provide solubility, and can be V H The N-terminus and V LThe C-terminus of the parent protein is linked to the C-terminus of the parent protein, or vice versa. Despite the removal of the constant region and the introduction of a single linker, the protein retains the specificity of the original immunoglobulin. This format enables ordinary technicians in the field of recombinant DNA technology to genetically fuse the linear scFv to the N- or C-terminus of the parent protein in order to confer the antigen binding properties of the parent protein scFv. There are many other proposed or created arrangements of multivalent and tandem scFv regions, but the important thing is that, as described below, they all have at least two spatially distant ends (Le Gall, F.; Kipriyanov, SM; Moldenhauer, G; Little, M (1999). "Di-, tri- and tetrameric single chain Fv antibody fragments against human CD19: effect of valency on cell binding". FEBS Letters 453(1):164–168. doi:10.1016 / S0014-5793(99)00713-9. PMID 10403395). Summary of the Invention

[0008] The present disclosure relates to modified α1-α2 domains of NKG2D ligands attached to heterologous polypeptides (in some embodiments, antibodies or antibody fragments). The modified ligand selectively attaches to a homologous non-natural NKG2D receptor, which in turn selectively binds to its homologously modified ligand. Non-natural NKG2D receptors can be expressed on the cell surface of the immune system and produce chimeric receptors on the surface of the effector cells. The heterologous molecules attached to the ligands can also bind to specific molecules on the surface of the target cells, thereby delivering immune effector cells to the target cells. These effector cells include lymphocytes, B cells, plasma cells, monocytes, macrophages and dendritic cells.

[0009] In some embodiments, the present disclosure relates to a modified non-natural ligand of a modified non-natural NKG2D receptor, wherein the ligand has an attached heterologous molecule that selectively binds to HIV proteins presented on the surface of cells infected with HIV, wherein the modified ligand with the heterologous molecule can selectively bind to the modified non-natural NKG2D receptor of a CAR cell and cause destruction of the HIV-infected cell.

[0010] In a further embodiment, the HIV protein to which the heterologous molecule selectively binds is an HIV envelope protein.

[0011] In still further embodiments, the epitope of the envelope protein to which the heterologous molecule selectively binds comprises SEQ ID NO:169 or SEQ ID NO:170.

[0012] In some embodiments of the present disclosure, the modified non-natural ligand comprises SEQ ID NO: 68, 69, 70, 71 or 72.

[0013] In a further embodiment, the modified non-natural NKG2D receptor comprises SEQ ID NO: 54 or 154.

[0014] In some embodiments of the present disclosure, HIV proteins are expressed on HIV-infected cells that have been shocked or activated by a mechanism or agent known to cause expression of HIV proteins on latently HIV-infected cells, or a latency reactivating agent.

[0015] In some embodiments of the present disclosure, the CAR cells have incorporated multiple modified non-natural ligands having different, unique heterologous molecules that bind to different epitopes, proteins, or other molecules on the surface of HIV-infected cells.

[0016] In some embodiments of the present disclosure, a modified non-natural NKG2D receptor comprising SEQ ID NO: 54 or 154 is presented on a CAR cell, wherein the modified NKG2D receptor binds a modified non-natural ligand comprising SEQ ID NO: 68, 69, 70, 71 or 72 to which is attached a heterologous molecule or atom that does not bind to an HIV protein.

[0017] In further embodiments, the heterologous molecules or atoms regulate the function of CAR cells. In further embodiments, the cell functions include proliferation, differentiation, ablation, imaging, antagonism of immunosuppression, homing or cell lysis of cells not infected by HIV. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] This patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

[0019] Figure 1 Cartoon representation of a typical mammalian antibody showing the Y-shaped structure and structural components.

[0020] Figure 2 .Anatomy of a typical CAR (Gill & June, 2015, supra).

[0021] Figure 3Structure-directed mutagenesis of the α1-α2 domain of MICA to enhance its affinity for NKG2D. The structure of the α1-α2 domain of MICA (PDB 1HYR) and its NKG2D-binding surface (colored dark gray), in which 57 specific amino acid positions were extensively mutagenized.

[0022] Figure 4 Tyrosine residues Y152 and Y199 in the native NKG2D homodimer.

[0023] Figure 5 Protein sequence alignment of the α1-α2 domains of MICA and ULBPs 1-6. Amino acids highlighted in gray were selected for NNK mutagenesis in ULBP2 (60 amino acids) and ULBP3 (36 amino acids). Residues highlighted in black were identified as key positions selected for mutations that modulate binding affinity for NKG2D (Tables 6 and 7).

[0024] Figure 6 ELISA results of R3 antibody fusion pairs with non-native α1-α2 domains selected for binding to Y152A NKG2D-Fc. (A) The R3 HC25 antibody fusion is non-selective for Y152A NKG2D. (B) The R3 HC25.17 (SEQ ID NO: 73) antibody fusion is selective for Y152A NKG2D compared to native NKG2D-Fc. (C) The R3 HC.U2RW antibody fusion is not selective for Y152A NKG2D compared to native NKG2D-Fc. (D) The R3 HC.U2S3 (SEQ ID NO: 74) antibody fusion is selective for Y152A NKG2D compared to native NKG2D-Fc.

[0025] Figure 7 Evaluation of the effector:target (E:T) cell ratio of HIV-infected primary CD4 T cells killed by CAR-T cells with different concentrations of specific HIV-targeting MicAbodies. One million primary tonsil-derived cells infected with Bal-GFP R5 virus (approximately 10% infected; 1×10 4 infected cells) with 1×10 5 Untransduced CD8 (0:1) or with 1×10 4 (1:1) or 2×10 5Figure 5: CAR-T cells were incubated with 1:1 (20:1) CAR-T cells. After 24 hours, cells were stained and evaluated by flow cytometry. Cells were gated on single / live / CD3+ / CD8- cells expressing or not expressing GFP. Results are shown as the average of three studies.

[0026] Figure 8 .R5 virus-infected primary CD4 cells were specifically killed by CAR-T cells combined with specific HIV MicAbody. One million primary tonsil-derived cells (about 1×10) infected with Bal-GFP R5 virus were cultured in the presence of different concentrations of HIV-specific MicAbody, B cell-specific CD20-targeted MicAbody, or HER2-targeted MicAbody (Her2). 4 infected cells) with 1×10 5 CAR-T cells were incubated together. After 24 hours, cells were stained and analyzed by flow cytometry. Cells were gated on single cells, live cells, CD3+ / CD8-, and GFP+ or GFP-. Results from four studies are shown.

[0027] Figure 9 Primary CD4 cells infected with the F4 transmitted / founder virus were specifically killed by CAR-T cells bound to specific HIV MicAbodies. One million primary tonsil-derived cells (approximately 1×10) infected with F4-GFP (T / F) virus were cultured in the presence of different concentrations of four different HIV-specific MicAbodies, CD20-targeted MicAbody (Ritux), or HER2-targeted MicAbody (Her2). 4 infected cells) with 1×10 5 The cells were incubated with convertibleCAR-T cells. After 24 hours, the cells were stained and subsequently subjected to flow cytometry. Cells were gated on single cells, live cells, CD3+ / CD8-, and GFP+ or GFP-.

[0028] Figure 10.CAR-T and MicAbody kill reactivated latently infected reservoir cells from patients with chronic HIV infection and no viremia receiving ART therapy. CD4+ T cells were isolated from PBMCs by contactless negative selection, and the PBMCs were collected from known HIV-infected patients receiving ART therapy and reactivated for 72 hours using 100nM phorbol myristate acetate (PMA) + 1μM ionomycin. The cells were then washed twice and incubated with convertibleCAR-T cells or untransduced CD8T cells for 48 hours in the presence of an equal concentration of 0.1 or 1nM HIV bNAb-based MicAbody (3BNC60, 3BNC117, PGT121 and 10-1074) mixture (called MIX). The cells were then centrifuged and RNA was extracted from the cell pellet. Cell-associated HIV RNA was measured by ddPCR. DETAILED DESCRIPTION

[0029] Natural killer (NK) cells, cells of the monocyte-macrophage lineage, and certain (CD8+ αβ and γδ) T cells of the immune system play an important role in humans and other mammals as the first line of innate defense against tumor cells and virus-infected cells (Cerwenka, A., and LLLanier. 2001. NK cells, viruses and cancer. Nat. Rev. Immunol. 1:41-49). NK cells and certain T cells express NKG2D, a prominent homodimeric surface immune receptor on their surface that is responsible for recognizing target cells and activating innate defense against pathological cells (Lanier, LL, 1998. NK cell receptors. Ann. Rev. Immunol. 16:359-393; Houchins JP et al. 1991. DNA sequence analysis of NKG2, a family of related cDNA clones encoding type II integral membrane proteins on human NK cells. J. Exp. Med. 173:1017-1020; Bauer, S et al., 1999. Activation of NK cells and T cells by NKG2D, areceptor for stress-inducible MICA. Science 285:727-730).Human NKG2D molecules possess a C-type lectin-like extracellular domain that binds to their cognate ligands, monomeric MICA and MICB (polymorphic analogs of major histocompatibility complex (MHC) class I chain-associated glycoproteins (MICs)) with 84% sequence identity or homology (Weis et al. 1998. The C-type lectin superfamily of the immune system. Immunol. Rev. 163: 19-34; Bahram et al. 1994. A second lineage of mammalian MHC class I genes. PNAS 91: 6259-6263; Bahram et al. 1996a. Nucleotide sequence of the human MHC class I MICA gene. Immunogenetics 44: 80-81; Bahram and Spies TA. 1996. Nucleotide sequence of human MHC class I MICB cDNA. Immunogenetics Non-pathological expression of MIC proteins is usually limited to intestinal epithelium, keratinocytes, endothelial cells, and monocytes, but abnormal surface expression of these MIC proteins occurs in response to various types of cellular stress, such as proliferation, oxidation, viral infection, and heat shock, and marks the cells as pathological (Groh et al. 1996. Cell stress-regulated human MHC class I gene expressed in GI epithelium. PNAS 93: 12445-12450; Groh et al. 1998. Recognition of stress-induced MHC molecules by intestinal γδ T cells. Science 279: 1737-1740; Zwirner et al. 1999. Differential expression of MICA by endothelial cells, fibroblasts, keratinocytes and monocytes. Human Immunol. 60: 323-330).Pathological expression of MIC proteins also appears to be involved in some autoimmune diseases (Ravetch, JV and Lanier LL. 2000. Immune Inhibitory Receptors. Science 290: 84-89; Burgess, SJ. 2008. Immunol. Res. 40: 18-34). Differential regulation of NKG2D ligands, such as polymorphic MICA and MICB, is important for providing the immune system with a means to recognize and respond to a wide range of emergency signals while still protecting healthy cells from harmful attacks (Stephens HA, (2001) MICA and MICB genes: can the enigma of their polymorphism be resolved? Trends Immunol. 22: 378-85; Spies, T. 2008. Regulation of NKG2D ligands: a purposeful but delicate affair. Nature Immunol. 9: 1013-1015).

[0030] Viral infection is a common inducer of MIC protein expression and recognizes virus-infected cells for NK cell or T cell attack (Groh et al. 1998; Groh et al. 2001. Co-stimulation of CD8+αβT-cells by NKG2D via engagement by MIC induced on virus-infected cells. Nat. Immunol. 2:255-260; Cerwenka, A., and LLLanier. 2001). In fact, to avoid this attack on their host cells, cytomegalovirus and other viruses have evolved mechanisms to prevent the expression of MIC proteins on the surface of the cells they infect, in order to evade the disorder of the innate immune system (Lodoen, M., K. Ogasawara, JA Hamerman, H. Arase, JP Choucins, ES Mocarski, and LL Lanier. 2003. NKG2D-mediated NK cell protection against cytomegalovirus is impaired by gp40 modulation of RAE-1 molecules. J. Exp. Med. 197: 1245-1253; Stern-Ginossar et al., (2007) Host immune system gene targeting by viral miRNA. Science 317: 376-381; Stern-Ginossar et al., (2008) Human microRNAs regulate stress-induced immune responses mediated by the receptor NKG2D. Nature Immunology 9:1065-73;Slavuljica,IA Busche,MBabic,M Mitrovic,I E Markova Car,EP Pugel,A Cikovic,VJ Lisnic,WJ Britt,U Koszinowski,M Messerle,A Krmpotic and S Jonjic.2010.Recombinantmouse cytomegalovirus expressing a ligand for the NKG2D receptor isattenuated and has improved vaccine properties.J.Clin.Invest.120:4532-4545)。

[0031] Despite their stress, many malignant cells, such as those of lung cancer and glioblastoma brain cancer, also avoid expression of MIC proteins and, as a result, may be particularly aggressive because they also evade the innate immune system (Busche, A et al. 2006, NK cell mediated rejection of experimental human lung cancer by genetic overexpression of MHC class I chain-related gene A. Human Gene Therapy 17:135-146; Doubrovina, ES, MM Doubrovin, E Vider, RB Sisson, RJ O'Reilly, B Dupont, and YM Vyas, 2003. Evasion from NK Cell Immunity by MHC Class I Chain-Related Molecules Expressing Colon Adenocarcinoma (2003) J. Immunology 6891-99; Friese, M. et al. 2003. MICA / NKG2D-mediated immunogene therapy of experimental gliomas. Cancer Research 63:8996-9006; Fuertes, MB, MV Girart, LL Molinero, CI Domaica, LE Rossi, MM Barrio, J Mordoh, GA Rabinovich and NW Zwirner. (2008) Intracellular Retention of the NKG2D Ligand MHC Class I Chain-RelatedGene A in Human Melanomas Confers Immune Privilege and Prevents NK Cell-Mediated Cytotoxicity. J. Immunology, 180:4606-4614).

[0032] The high-resolution structure of human MICA bound to NKG2D has been resolved, demonstrating that the α3 domain of MICA does not directly interact with NKG2D (Li et al. 2001. Complex structure of the activating immunoreceptor NKG2D and its MHC class I-like ligand MICA. Nature Immunol. 2:443-451; Protein Data Bank accession code 1HYR). The α3 domain of MICA, like the α3 domain of MICB, is linked to the α1-α2 platform domain via a short, flexible linker peptide and naturally serves as a "spacer" between the platform and the surface of MIC-expressing cells. The three-dimensional structures of the α3 domains of human MICA and MICB are nearly identical (root mean square distance < 0.001 on 94C-αα). ) and are functionally interchangeable (Holmes et al. 2001. Structural Studies of Allelic Diversity of the MHC Class I Homolog MICB, a Stress-Inducible Ligand for the Activating Immunoreceptor NKG2D. J Immunol. 169: 1395-1400).

[0033] Certain non-natural α1-α2 domains of NKG2D ligands have been described that have been modified to bind to the native human NKG2D receptor with higher affinity than the native α1-α2 domain (Candice SELengyel, Lindsey J. Willis, Patrick Mann, David Baker, Tanja Kortemme, Roland K. Strong and Benjamin J. McFarland. Mutations Designed to Destabilize the Receptor-Bound Conformation Increase MICA-NKG2D Association Rate and Affinity. Journal of Biological Chemistry Vol. 282, no. 42, pp. 30658–30666, 2007; Samuel H. Henager, Melissa A. Hale, Nicholas J. Maurice, Erin C. Dunnington, Carter J. Swanson, Megan J. Peterson, Joseph J. Ban, David J. Culpepper, Luke D. Davies, Lisa K. Sanders, and Benjamin J. McFarland. Combining different design strategies for rational affinity maturation of the MICA-NKG2D interface. Protein Science 2012 VOL 21:1396-1402).Herein, we describe non-native α1-α2 domains of NKG2D ligands that have been modified to bind to non-native NKG2D receptors, which themselves are mutated at sites that result in impaired or lost binding to the native α1-α2 domains of NKG2D ligands (David J. Culpepper, Michael K. Maddox, Andrew B. Caldwell, and Benjamin J. McFarland. Systematic mutation and thermodynamic analysis of central tyrosine pairs in polyspecific NKG2D receptor interactions. Mol Immunol. 2011 January; 48(4): 516–523; USPTO patent application 14 / 562,534; USPTO provisional application 62 / 088,456). The present invention produces bispecific molecules comprising a specifically modified non-natural α1-α2 domain and a specifically targeted heterologous molecule, including but not limited to a heterologous peptide or polypeptide, which binds to a chimeric antigen receptor (CAR), wherein the receptor of the CAR comprises a non-natural NKG2D receptor extracellular domain that binds to the modified α1-α2 domain with greater affinity than the native α1-α2 domain.Genetically engineered cells of the immune system, such as B cells, T cells, NK cells, and macrophages, composed of such CARs may overcome many of the shortcomings of current CAR-T and CAR-NK cell therapies, including known severe systemic toxicity and antigen escape, as described below (Kalos M, Levine, BL, Porter, DL, Katz, S, Grupp, SA, Bagg, A and June, C.. T Cells with chimeric antigen receptors have potent antitumor effects and can establish memory in patients with advanced leukemia. Sci Transl Med 2011; 3:95ra73; Morgan RA, Yang JC, Kitano M, Dudley ME, Laurencot CM, Rosenberg SA. Case report of a serious adverse event following the administration of T cells transduced with a chimeric antigen receptor recognizing ERBB2. Mol Ther 2010, 18:843–851; Gill and June 2015).

[0034] T cells, NK cells, and macrophages can be modified using gene transfer technology to directly and stably express the binding domains of antibodies that confer specificity for neoantigens on their surface (Saar Gill & Carl H. June. Going viral: chimeric antigen receptor T-cell therapy for hematological malignancies. Immunological Reviews 2015. Vol. 263: 68–89; Wolfgang Glienke, Ruth Esser, Christoph Priesner, Julia D. Suerth, Axel Schambach, Winfried S. Wels, Manuel Grez, Stephan Kloess, Lubomir Arseniev and Ulrike Koehl. 2015. Advantages and applications of CAR-expressing natural killer cells. Front. Pharmacol. doi: 10.3389 / fphar.2015.00021). CAR-T cells are an application of this approach, which combines the antigen recognition domain of a specific antibody with the intracellular domain of the CD3-ζ chain (which is the main transmitter of signals from the endogenous T cell receptor (TCR)), and with costimulatory molecules such as CD27, CD28, ICOS, 4-1BB or OX40 ( Figure 2 )) are combined together into a single chimeric protein. The CAR constructed in this way can trigger T cell activation in a manner similar to endogenous T cell receptors but independent of the major histocompatibility complex (MHC) when binding to the target antigen.

[0035] As used herein, "soluble MIC protein", "soluble MICA" and "soluble MICB" refer to MIC proteins containing α1-α2 domains, with or without the α3 domain of the MIC protein, but without a membrane attachment motif, a transmembrane domain or an intracellular domain. The NKG2D ligands ULBP1-6 do not naturally have an α3 domain (Cerwenka A, Lanier LL. 2004. NKG2D ligands: unconventional MHC class I-like molecules exploited by viruses and cancer. Tissue Antigens 61(5):335–43. doi:10.1034 / j.1399-0039.2003.00070.x. PMID12753652). The "α1-α2 domain" of an NKG2D ligand refers to the protein domain of a ligand that binds to the NKG2D receptor.

[0036] In some embodiments, the α1-α2 domain of a non-natural NKG2D ligand protein of the invention is at least 80% identical or homologous to the native or natural α1-α2 domain of an NKG2D ligand, SEQ ID NOs: 1-19. In other embodiments, the modified α1-α2 domain is 85% identical to the native or natural α1-α2 domain of an NKG2D ligand. In other embodiments, the modified α1-α2 domain is 90% identical to the native or natural α1-α2 domain of a native NKG2D ligand protein and binds to the non-natural NKG2D.

[0037] The α1-α2 platform domain of the soluble MIC protein is diffusible in the intercellular or intravascular space of mammals. Preferably, the α1-α2 platform domain of the non-natural MIC protein of the present invention is at least 80% identical or homologous to the native or native α1-α2 domain of the human MICA or MICB protein and binds to a native NKG2D, or in certain embodiments, a modified non-natural NKG2D receptor. In some embodiments, the α1-α2 platform domain is 85% identical to the native or native α1-α2 platform domain of human MICA, human MICB, or human ULBP1-6 protein and binds to a native NKG2D or a modified non-natural NKG2D. In other embodiments, the α1-α2 platform domain is 90%, 95%, 96%, 97%, 98%, or 99% identical to the native or native α1-α2 platform domain of human MICA, human MICB, or human ULBP1-6 protein and binds to a native NKG2D receptor or a modified non-natural NKG2D receptor.

[0038] In certain embodiments, a heterologous peptide tag can be fused to the N-terminus or C-terminus of the α1-α2 domain or another soluble MIC protein to facilitate purification of the soluble MIC protein. Tag sequences include peptides (e.g., polyhistidine), myc peptides, or FLAG tags. After isolation of the MIC molecule, these tags can be removed by methods known to those skilled in the art.

[0039] In other embodiments of the present invention, specific mutations in the α1-α2 domains of NKG2D ligands can be performed to produce non-natural α1-α2 domains that bind to non-natural NKG2D receptors, which themselves are engineered to have reduced affinity for natural NKG2D ligands. This can be accomplished by, for example, genetic engineering. The non-natural NKG2D receptors modified in this way can be used to produce chimeric antigen receptors (CARs) based on non-natural NKG2D on the surface of NK cells, T cells, macrophages, or stem cells of the immune system, which can preferentially bind to molecules comprising non-natural α1-α2 domains of the present invention and be activated by molecules comprising non-natural α1-α2 domains of the present invention. As described below, compared to current CAR-T cells and CAR-NK cells, these non-natural NKG2D receptor pairs and their invented homologous non-natural NKG2D ligands will provide important safety, efficacy, and manufacturing advantages for treating cancer and viral infections.

[0040] Engineering T cells with CAR has become a promising method for adoptive T cell therapy of cancer, and CAR targeting many different molecules has been tested as a treatment for malignant tumors in CAR-T cells (Porter DL, Levine BL, Kalos M, Bagg A, June CH.Chimeric antigen receptor-modified T cells inchronic lymphoid leukemia. N Engl J Med. 365: 725-733). Although significant clinical efficacy has been observed in hundreds of patients receiving adoptive transfer of T cells expressing CD19-specific chimeric antigen receptors, custom engineered CARs are used to target specific antigens, separate autologous T cells from patients, genetically engineer autologous T cells to express personalized CAR, in vitro amplification of modified cells, and methods for controlling the quality of their production are all onerous and expensive. Currently, this is only feasible in the context of large academic centers with extensive expertise and resources (Gill & June, 2015).

[0041] Once autologous CAR-T cells are infused back into the donor patient, their expansion in vivo cannot be controlled—“living therapy”—and there is no dose-response relationship for efficacy (Gill & June, 2015). In addition, tumor escape from CAR T cells can occur through antigen loss (Stephan A. Grupp, MD, Ph.D., Michael Kalos, Ph.D., David Barrett, MD, Ph.D., Richard Aplenc, MD, Ph.D., David L. Porter, MD, Susan R. Rheingold, MD, David T. Teachey, MD, Anne Chew, Ph.D., Bernd Hauck, Ph.D., J. Fraser Wright, Ph.D., Michael C. Milone, MD, Ph.D., Bruce L. Levine, Ph.D., and Carl H. June, MD. Chimeric Antigen Receptor–Modified T Cells for Acute Lymphoid Leukemia. N Engl J Med 2013;368:1509–1518), this escape pathway is most easily addressed by sequential therapy with differently targeted CAR-T cells or by initial infusion of a T-cell product containing CARs with two or more specificities, which further complicates the manufacturing process and quality control.

[0042] In addition to CAR-T cells targeting tumors with single-chain antibody binding domains (scFv), CAR-T cells using the ligand binding domain of the NKG2D receptor have been studied in animals and recently in humans (Sentman CL, Meehan KR. NKG2D CARs as cell therapy for cancer. Cancer J. 2014 Mar-Apr; 20(2):156-9. doi:10.1097 / PPO.0000000000000029; Manfred Lehner, Gabriel Julia Proff, Niels Schaft, Jan floral 2012|PLOS ONE 10.1371 / journal.pone.0031210; www.clinicaltrials.gov NCT02203825). Since NKG2D ligands are expressed more on the surface of stressed cells, such as tumor cells and virus-infected cells, this family of natural NKG2D ligands is of great significance as targets for viral infection and cancer immunotherapy (Spear P, Wu MR, Sentman ML, Sentman CL. NKG2D ligands as therapeutic targets. Cancer Immun. 2013 May 1; 13: 8.; Song DG, Ye Q, Santoro S, Fang C, Best A, Powell DJ Jr., Chimeric NKG2D CAR-expressing T cell-mediated attack of human ovarian cancer is enhanced by histone deacetylase inhibition. Hum Gene Ther. 2013 Mar; 24(3): 295-305). One NKG2D CAR is a fusion of the full-length NKG2D receptor and CD3ζ (NKG2Dζ); the other is a fusion of only the extracellular domain of NKG2D in the opposite orientation with a second-generation CAR scaffold composed of the transmembrane and intracellular domains from CD28 and the signaling domain of CD3ζ (NKG2D28ζ). Because NKG2D activation depends on the presence of DAP10, CAR-T cells were also constructed in which DAP10 is co-expressed with NKG2Dζ (NKG2Dζ10).T cells expressing any of the above NKG2D CARs produce IFNγ and TNFα in response to NKG2D ligand stimulation and effectively kill tumor targets expressing NKG2D ligands in vitro (Heather VanSeggelen, Joanne A. Hammill, Anna Dvorkin-Gheva, Daniela GMTantalo, Jacek M. Kwiecien, Galina F. Denisova, Brian Rabinovich, Yonghong Wan, Jonathan L. Bramson, T cells engineered with chimeric antigen receptors targeting NKG2D ligands display lethal toxicity in mice, Molecular Therapy accepted article preview online 30 June 2015; doi:10.1038 / mt.2015.119). The cytotoxic potential of NK cells against a broad spectrum of tumor subtypes can also be significantly enhanced by expressing CAR based on NKG2D-DAP10-CD3ζ (Yu-Hsiang Chang, John Connolly, Noriko Shimasaki, Kousaku Mimura, Koji Kono, and Dario Campana. Chimeric Receptor with NKG2D Specificity Enhances Natural Killer Cell Activation and Killing of Tumor Cells. Cancer Res; 73(6) March 15, 2013).

[0043] However, after infusion into syngeneic murine hosts, these CAR-T constructs exhibited significant toxicity, which bind to and are activated by the natural ligands of the native NKG2D receptor. Signs of toxicity, including poor body condition, hunched posture, difficulty breathing, and decreased core body temperature, were observed in tumor-bearing and tumor-free mice treated with NKG2D-based CAR-T cells compared to untreated control mice. The severity of NKG2D CAR-T cell toxicity varied, with NKG2Dζ10 being severely toxic, NKG2D28ζ showing moderate toxicity, and NKG2Dζ being tolerable. Clinical symptoms of toxicity and mortality were exacerbated when mice received chemotherapy before adoptive transfer of T cells expressing any NKG2D CAR (Van Seggelen et al. 2015).Chemotherapy and radiation therapy are known to induce NKG2D ligands on otherwise healthy tissues (Xiulong Xu, Geetha S Rao, Veronika Groh, Thomas Spies, Paolo Gattuso, Howard L Kaufman, Janet Plate and Richard A Prinz. Major histocompatibility complex class I-related chain A / B (MICA / B) expression in tumor tissue and serum of pancreatic cancer: Role ofuric acid accumulation in gemcitabine-induced MICA / B expression. BMC Cancer 2011, 11: 194 doi: 10.1186 / 1471-2407-11-194; Gannagé M, Buzyn A, Bogiatzi SI, Lambert M, Soumelis V, Dal Cortivo L, Cavazzana-Calvo M, Brousse N, Caillat-Zucman. Induction of NKG2D ligands by gamma radiation and tumor necrosis Factor-alpha may participate in the tissue damage during acute graft-versus-host disease. Transplantation. 2008 Mar 27; 85(6): 911-5. doi: 10.1097 / TP.0b013e31816691ef.). Further characterization showed that toxicity was consistent with lethal levels of systemic cytokine storm and lung inflammation. These data warn that extreme caution must be exercised when using natural NKG2D ligands for targeted immunotherapy and demonstrate that enhancing T cell expression of strongly activated CARs in vivo may be harmful (Van Seggelen et al., 2015).

[0044] CAR-T cells, CAR-NK cells, and macrophages containing extracellular domains composed of non-native NKG2D receptors that do not bind or only poorly bind to the native NKG2D ligand will not undergo the above-mentioned forms of activation and therefore will not be as toxic as cells expressing CARs based on the native NKG2D receptor. Furthermore, the extracellular domain of the non-natural NKG2D receptor on cells will not be subject to downregulation by soluble forms of the natural NKG2D ligand or myeloid-derived suppressor cells (MDSCs) (Deng W, Gowen BG, Zhang L, Wang L, Lau S, Iannello A, Xu J, Rovis TL, Xiong N, Raulet DH, 2015. Antitumor immunity. A shed NKG2D ligand that promotes natural killer cell activation and tumor rejection. Science. 2015 Apr 3; 348(6230): 136-9. doi: 10.1126 / science.1258867. Epub 2015 Mar 5). However, when such a CAR cell carrying a non-natural NKG2D receptor extracellular domain is engaged by a bispecific molecule having a homologous non-natural α1-α2 domain of the present invention and a heterologous targeting motif thereof, wherein the heterologous targeting motif has been found and bound to its intended target, CAR will be activated and the effector function of the CAR cell will be expressed. The effector function of CAR-T cells, CAR-NK cells, and CAR-macrophages can eliminate or impair the vitality or function of target cells. Target cells can include malignant cells, immunosuppressive cells of tumors, cells causing autoimmune diseases, cells infected by viruses, such as but not limited to HIV, hepatitis viruses, HTLV-1, CMV, EBV, and other herpes viruses.

[0045] Because CAR-T or CAR-NK cells comprising the extracellular domain of non-natural NKG2D receptors are not activated except when there is a bispecific molecule comprising a homologous non-natural α1-α2 domain, their activation can be controlled by the bispecific molecules administered, which will exhibit pharmacokinetics and pharmacodynamics well known in the art as a biopharmaceutical. In the event of an adverse event, the physician can simply change the dosing regimen of the bispecific molecules administered, rather than having to use an induced suicide mechanism to destroy the infused CAR cells (Monica Casucci and Attilio Bondanza. Suicide Gene Therapy to Increase the Safety of Chimeric Antigen Receptor-Redirected T Lymphocytes. J Cancer. 2011; 2: 378–382). In addition, such bispecific molecules with different specific targeting motifs can be administered simultaneously or sequentially to help address the resistance and escape of tumor cells or virus-infected cells due to loss of target antigens, without having to create, amplify, and infuse multiple different autologous CAR cells (Gill & June, 2015). Since all CAR constructs can be identical for all CAR cells, and the targeting specificity is simply determined by the targeting motif of the generated bispecific molecule of the invention, the manufacturing process will be simplified and cheaper.

[0046] Many viruses have evolved mechanisms to avoid killing their host cells by the innate immune surveillance system, especially the NKG2D-dependent components. For example, adenovirus, cytomegalovirus (CMV), herpes viruses, HIV, human T-cell lymphoma virus-1 (HTLV-1), and papillomaviruses all have one or more mechanisms. These viruses can express viral antigens on the surface of the host cells they infect, and their epitopes can serve as virus-specific molecular targets that bind to antibodies, antibody fragments, or other molecular targeting motifs. These cell-surface exposed molecular targets are attractive as targets for antibodies or adoptive cell therapy (ACT) to prevent the spread of viral infection or treat viral infection by eliminating virus-infected cells.

[0047] HIV-1 latency is established in the early stages of acute infection and is mainly found in memory CD4+ T cells. Although almost transcriptionally silent, when antigen or cytokine stimulation or when antiretroviral therapy (ART) is interrupted to reactivate host cells, the reservoir is fully capable of producing infectious viruses. Latent HIV reservoirs are mainly found in lymphoid tissues, where> 98% of CD4+ T cells exist. Although ART can suppress viral replication, it cannot eradicate latent reservoirs (Ruelas, DSand WCGreene, An integrated overview of HIV-1 latency. Cell, 2013.155(3): p.519-29.). Efforts to eliminate latent HIV-1 initially focused on reactivating latent proviruses with cytokines or T cell receptor activators. However, these strategies result in serious side effects and have low efficacy. In contrast, the so-called "shock and kill" strategy involves reactivating the transcriptionally silent provirus by administering a latency reversal agent (LRA), a compound that can induce HIV-1 transcription (Cary, DC, K. Fujinaga, and B.M. Peterlin, Molecular mechanisms of HIV latency. J Clin Invest, 2016. 126(2): p. 448-54.). Upon reactivation of latent virus, the HIV envelope glycoprotein gp160 is expressed on the surface of activated cells and processed into gp120 and gp41. The V1, V2, V3, C1, C2 domains and the N segment of gp120 provide attractive targets for attacking HIV-infected cells with neutralizing antibodies and, as described herein, provide attractive targets for CAR-T cells.

[0048] After latently infected cells are reactivated, it is predicted that these cells will produce virus (which will be stopped by administering ART) and these cells will die by apoptosis due to the viral cytopathic effect, thereby reducing the size of the latent reservoir. Tests of this hypothesis showed that the reactivated cells did not die and the latent reservoir size did not shrink (Shan L, Deng K, Shroff NS, Durand CM, Rabi SA, Yang HC, Zhang H, Margolick JB, Blankson JN, Siliciano RF, Stimulation of HIV-1-specific cytolytic T lymphocytes facilitates elimination of latent viral reservoir after virus reactivation. Immunity. 2012; 36 (3) p. 491-501.). There are still two major problems after the reservoir is reactivated. The first involves the emergence of viruses resistant to CTL killing (Deng K, Pertea M, Rongvaux A, Wang L, Durand CM, Ghiaur G, Lai J, McHugh HL, Hao H, Zhang H,, JB, Gurer C, Murphy AJ, Valenzuela DM, Yancopoulos GD, Deeks SG, Strowig T, Kumar P, Siliciano JD, Salzberg SL, Flavell RA, Shan L, Siliciano RF Broad CTL response is required to clear latent HIV-1 due to dominance of escape mutations. Nature. 2015 Jan 15; 517(7534) p.381-5.). This is a common problem in chronically infected individuals who are not treated with ART during the first 6 months of infection (the majority of chronically infected individuals).The second problem stems from the exposure of CTLs to HIV-associated chronic inflammation, which leads to CTL exhaustion (Cella M, Presti R, Vermi W, Lavender K, Turnbull E, Ochsenbauer-Jambor C, Kappes JC, Ferrari G, Kessels L, Williams I; CHAVI Clinical Core B, McMichael AJ, Haynes BF, Borrow P, Colonna M; NIAID Center for HIV / AIDS Vaccine Immunology. Loss of DNAM-1 contributes to CD8+T-cell exhaustion in chronic HIV-1 infection. Eur J Immunol. 2010 Apr; 40(4): p. 949-54.). It seems that new methods are needed to kill reactivated reservoir cells to avoid the problems of viral resistance and cell exhaustion. We propose to construct convertible CAR-T cells that use broadly neutralizing HIV antibodies to target CTLs to kill reactivated reservoir cells.

[0049] Thus, the present invention expands the diversity and utility of this remarkable and very promising immunological approach to control cancer or viral infection with CAR-T cells, CAR-NK cells and / or macrophages, while overcoming many of these currently recognized difficulties of ACT.

[0050] As used herein, "peptide," "polypeptide," and "protein" are used interchangeably; a "heterologous molecule," "heterologous peptide," "heterologous sequence," or "heterologous atom" is a molecule, peptide, nucleic acid, or amino acid sequence, or atom, respectively, that is not naturally occurring or normally found in physical association with a host molecule. As used herein, "non-natural" and "modified" are used interchangeably. As used herein, "natural" and "native" are used interchangeably, and "NKG2D" and "NKG2D receptor" are used interchangeably. The term "antibody" herein is used in the broadest sense and specifically encompasses monoclonal antibodies, multispecific antibodies (e.g., bispecific antibodies), and antibody fragments, so long as they exhibit the desired biological activity. "Antibody fragment" comprises a portion of an intact antibody, preferably comprising its antigen binding region. Examples of antibody fragments include Fab, Fab', F(ab')2, and Fv fragments; diabodies; linear antibodies; single-chain antibody molecules; and multispecific antibodies formed from antibody fragments.

[0051] The terms "comprising," which are used interchangeably with "including," "containing," or "characterized by," are inclusive or open-ended language and do not exclude additional, unrecited elements or method steps. The phrase "consisting of excludes any element, step, or ingredient not specified in the claim. The phrase "consisting essentially of limits the scope of a claim to the specified materials or steps and those that do not materially affect the basic and novel characteristics of the claimed invention. The present disclosure contemplates embodiments of the compositions and methods of the present invention that correspond to the scope of each of these phrases. Thus, a composition or method comprising the recited elements or steps contemplates specific embodiments in which the composition or method consists essentially of or consists of those elements or steps.

[0052] All references cited herein are hereby incorporated by reference in their entirety, whether or not previously specifically incorporated.As used herein, the terms "a," "an," and "any" are intended to include both the singular and the plural.

[0053] The present invention has now been fully described, and it will be appreciated by those skilled in the art that, without departing from the spirit and scope of the present invention and without excessive experimentation, the present invention can be carried out under equivalent parameters, concentration and conditions over a wide range. Although the present invention has been described in conjunction with specific embodiments of the present invention, it will be appreciated that the present invention can be further modified. The application is intended to encompass any variation, use or modification of the present invention, which generally follows the principles of the present invention, and is included in the deviation from the present disclosure within the scope of known or conventional practice within the field to which the present invention pertains, and can be applied to basic features described above.

[0054] Example 1 (Modified α1-α2 Domain of NKG2D Ligand) These examples illustrate the attachment of polypeptides to NKG2DLs that have been modified to significantly enhance their binding affinity for the human NKG2D receptor. The α1-α2 domain of the MIC protein is the NKG2DL for the NKG2D receptor. This affinity is sufficient to physiologically activate NK cells and stimulate lysis of cells expressing the native, full-length MIC protein, which is irreversibly tethered to the two-dimensional plasma membrane surface of "target cells" (Bauer S, Groh V, Wu J, Steinle A, Phillips JH, Lanier LL, Spies T., Science. 1999 July 30; 285(5428):727-9). However, because the engineered soluble MIC proteins of the present invention reversibly bind to specific target antigens on the surface of target cells, the binding affinity of the engineered soluble MIC proteins to NKG2D will directly affect the stability of the soluble MIC-dependent complex formed between NK cells and cells expressing the target antigen. In particular, the dissociation rate or off-rate of the modified sMICA from NKG2D is significantly reduced. If the affinity between sMICA and NKG2D is increased, it is expected that NK cell-based killing will be greater when the density of soluble MIC molecules bound to target cells is low. Prior to the present invention, no α1-α2 mutations that alter the killing activity of soluble MIC proteins or significantly reduce the binding and dissociation rate to enhance the affinity of MIC proteins for NKG2D have been identified.Computational design work has shown that three mutations in the α1-α2 domain of wild-type MICA: N69W, K152E and K154D (WED-MICA) can affect the stability of unbound MICA, thereby affecting its association rate or dissociation rate with NKG2D, and moderately affecting the NKG2D binding affinity (Lengyel CS, Willis LJ, Mann P, Baker D, Kortemme T, Strong RK, McFarland BJ. J Biol Chem. 2007 Oct 19; 282(42):30658-66. Epub 2007 Aug 8); Based on the published structural description, the same group subsequently conducted extensive computational design work and iteratively calculated the 22 amino acid positions where MICA theoretically contacts NKG2D (LiP, Morris DL, Willcox BE, Steinle A, Spies T, Strong RK., Nat Chem. 2007 Oct 19; 282(42):30658-66. Epub 2007 Aug 8). Immunol. 2001 May; 2(5): 443-451), experiments showed that further rational, iterative computational design of MICA qualitatively altered its affinity for NKG2D from weak (Kd ~ 2.5 μM) to moderately tight (Kd = 51 nM) when combined with three changes from the earlier design, with a total of seven combinatorial mutations (Henager, Samuel H., Melissa A. Hale, Nicholas J. Maurice, Erin C. Dunnington, Carter J. Swanson, Megan J. Peterson, Joseph J. Ban, David J. Culpepper, Luke D. Davies, Lisa K. Sanders, and Benjamin J. McFarland, 2102, Combining different design strategies for rational affinity maturation of the MICA-NKG2D interface. Protein Science 21: 1396-1402).In contrast, the experimental approach described in the present invention experimentally selected amino acid modifications of MICA that were shown to slow the dissociation rate between the α1-α2 domains of MICA and NKG2D, starting from MICA stabilized by three WED changes of Lengyel et al. (Lengyel CS, Willis LJ, Mann P, Baker D, Kortemme T, Strong RK, McFarland BJ., J Biol Chem. 2007 Oct 19; 282(42):30658-66. Epub 2007 Aug 8).

[0055] This example involves altering the NKG2D binding affinity of soluble MIC proteins by engineering specific mutations at selected amino acid positions within the α1-α2 domain, which affect the dissociation rate binding kinetics, thereby altering the NK cell-mediated killing activity of the non-natural targeted MIC molecules of the present invention.

[0056] To engineer a soluble non-natural α1-α2 domain with altered affinity for NKG2D, 57 residues in the α1-α2 domain were selected for extensive mutagenesis ( Figure 12 ). A synthetic DNA library encoding the α1-α2 domain and containing the NNK mutagenesis codon at each of the 57 amino acid positions was synthesized and individually cloned as a fusion to the pill minor coat protein of M13 phage. Phage particles displaying the mutagenized α1-α2 variants were produced in SS320 E. coli cells according to standard methods ( Andris-Widhopf, J., Steinberger, P., Fuller, R., Rader, C., and Barbas, CF, 3rd. (2011) Generation of human Fab antibody libraries: PCR amplification and assembly of light- and heavy-chain coding sequences, Cold Spring Harbor protocols 2011). Using recombinant biotinylated NKG2D as the target antigen, the α1-α2 phage library was sorted based on increased binding affinity and circulated through repeated cycles of intentionally prolonged binding, prolonged washing, and elution of phage clones to select for enrichment of high-affinity variants with slow dissociation rates or dissociation rates. A specific set of amino acid mutations occurred at high frequencies at six positions in α1-α2 and were selected as preferred amino acid substitutions with enhanced NKG2D binding affinity ( Figure 3 , Table 1).

[0057] Table 1. Selected affinity mutations at the designated six amino acid positions of the α1-α2 domain of MIC. The amino acids of SEQ ID NO: 20 are shown in bold in the first row of the table at each of the six positions. The identified affinity mutations are listed in decreasing frequency from top to bottom. All amino acids are represented by single-letter IUPAC abbreviations.

[0058] S20 G68 K125 E152 H161 Q166 P L L T R F T F R V S S D S F G A H A A T F K Y L Y A Y G W N I N A L V E V Q F L T Y D Y M W I I S N S H M P

[0059] We synthesized DNA polynucleotides (SEQ ID NOs: 21-24) encoding the α1-α2 domains of four representative variants 15, 16, 17, 18 containing different combinations of specifically discovered mutations (Table 2).

[0060] Table 2. Sequences of specific α1-α2 domain variants. Specific amino acid substitutions for variants 15, 16, 17, and 18 (SEQ ID NOs: 25-28, respectively) are listed in bold relative to SEQ ID NO: 20. All amino acids are represented by single-letter IUPAC abbreviations.

[0061] Variants SEQ ID NO: S20 G68 K125 H161 15 31 S G N R 16 32 S G L R 17 33 S L L R 18 34 P L L R

[0062] For the NKG2DLs described in the above examples, we used linker peptides to directly attach heterologous molecules (e.g., polypeptides) to each of the four modified α1-α2 NKG2DLs. Four His-tagged proteins (SEQ ID NOs: 25-28), consisting of modified NKG2DLs linked to heterologous molecules, were expressed in insect cells and purified to characterize their NKG2D binding affinities and kinetic binding parameters. Using a competitive binding ELISA, we determined the relative NKG2D binding affinities of the four modified α1-α2 variants. Soluble wild-type (WT) NKG2DL, sMICA protein, was coated in all wells of a Maxisorp ELISA plate to provide a binding partner for the human NKG2D-Fc reagent. Solutions of the four α1-α2 variants, along with the WT and WED-α1-α2 domains (SEQ ID NO: 20), were titrated in the ELISA wells and allowed to competitively inhibit 2 nM human NKG2D-Fc binding to the plate-coated WT sMICA. The level of human NKG2D-Fc binding to WT NKG2DL was detected using anti-Fc-HRP antibody. Figure 13 Panel A shows that variants 16, 17 and 18 exhibited IC values ​​of 0.7, 0.6 and 0.5 nM. 50 value, while variant 15 showed an IC of 1.7 nM 50Based on the values ​​obtained for the WT NKG2DL, all variants had significantly better (27, 32, 38 and 11-fold better) binding to NKG2D than WT NKG2DL, respectively, and significantly better binding than WED-MICA (Table 3).

[0063] Table 3. Equilibrium and kinetic binding parameters for a1-a2 variants. 50 The values ​​were obtained from a four-parameter fit of the competitive binding titration (Figure 12), and the kinetic binding parameters were obtained from a single exponential fit of the binding kinetics (Figure 13). The equilibrium binding constant (K d ) Using equation K d =k OFF / k ON Obtained from kinetic binding parameters.

[0064]

[0065]

[0066] Importantly, the relative IC 50 The differences also translated into better binding to murine NKG2D-Fc and demonstrated the ability to improve binding of the soluble modified α1-α2 domains in both human and non-human NKG2D receptors, an important property for preclinical drug development.

[0067] To understand the kinetic basis of the altered affinity, the association and dissociation rates of the α1-α2 variant NKG2DL binding to surface-coated biotinylated human NKG2D were measured using biolayer interferometry (Octet) at 100 nM of each modified α1-α2 protein. 50 The results of the ELISA were consistent, with variants 16, 17, and 18 each showing a significant decrease in off-rate (18-fold relative to WT), which was the main reason for the increased affinity (approximately 30-fold relative to WT a1-a2; Table 3). Although variant 15 showed a slow off-rate similar to 16, 17, and 18, its on-rate was reduced, resulting in an affinity that was stronger than WT but weaker than variants 16, 17, and 18. Because the only difference between variants 15 (SEQ ID NO: 25) and 16 (SEQ ID NO: 26) was K125N versus K125L, the mutation at position 125 significantly altered the on-rate, while the reduced off-rate was attributed to the H161R mutation. Therefore, although the selected NKG2DL mutation group (Table 1) was used to increase the affinity of α1-α2 to NKG2D by a significant reduction in off-rate, certain substitutions also altered the on-rate, resulting in a series of incremental increases in affinity, which we show in the present invention to have different activities in the NK cell-mediated killing assay described below.

[0068] The ability of the α1-α2 affinity variants to redirect NK cell-mediated lysis of FGFR3-expressing target cells was demonstrated in an in vitro calcein release assay. The human natural killer (NK) cell line NKL was co-cultured with P815 target cells loaded with calcein that ectopically expressed FGFR3 and titrated with soluble modified MIC proteins. The results in Figure 15 show that the killing activity of the FGFR3-specific soluble MIC variants is related to their engineered α1-α2 affinity. Specifically, variants 16, 17, and 18 showed a killing power approximately 15 times higher than WT at 0.78nM. WED-MICA (SEQ ID NO: 20) was only slightly better than WT. Therefore, the present invention describes amino acid substitutions within the α1-α2 domain that increase NKG2D binding affinity by reducing the dissociation rate of the soluble MIC protein bound to human NKG2D, thereby resulting in a predictably increased killing efficacy. WED-MICA, which exhibited slightly higher affinity for NKG2D than WT MICA by increasing the on-rate rather than decreasing the off-rate, did not show substantial improvement in target cell killing. Furthermore, WED-MICA exhibited significantly weaker binding to murine NKG2D than even WT MICA, whereas variants 15, 16, 17, and 18 each exhibited greater affinity for both human and murine NKG2D.

[0069] These α1-α2 NKG2DL affinity variants 15, 16, 17 and 18 enhance the binding affinity of the attached polypeptide to the NKG2D receptor and thereby enhance NK cell-mediated lysis of target cells.

[0070] Example 2. (Non-natural α1-α2 domains of NKG2D ligands and their bound homologous non-natural NKG2D receptors)

[0071] The α1-α2 domain of MICA and other NKG2D ligands bind to the NKG2D receptor at known specific sites (Li et al. 2001; Benjamin J. McFarland, Tanja Kortemme, Shuyuarn F. Yu, David Baker, and Roland K. Strong. Symmetry Recognizing Asymmetry: Analysis of the Interactions between the C-Type Lectin-like Immunoreceptor NKG2D and MHC Class I-like Ligands. Structure, Vol. 11, 411–422, April 2003) and drive activation of immune cells bearing the NKG2D receptor, which in turn kill target cells displaying MICA or other ligands. We used phage display to engineer a non-native α1-α2 domain of MICA by extensive mutagenesis at 57 specific sites potentially involved in binding to NKG2D ( Figure 16 ). A synthetic DNA library encoding the α1-α2 domain and containing an NNK mutagenic codon at each of the 57 amino acid positions was synthesized and individually cloned as a fusion to the pill minor coat protein of M13 phage, and phage particles displaying the mutagenized α1-α2 variants were produced in SS320 E. coli cells according to standard methods (Andris-Widhopf, J., Steinberger, P., Fuller, R., Rader, C., and Barbas, CF, 3rd. (2011) Generation of human Fab antibody libraries: PCR amplification and assembly of light- and heavy-chain coding sequences, Cold Spring Harbor protocols 2011). Using recombinant biotinylated NKG2D as the target antigen, an α1-α2 phage library was sorted based on increased binding affinity and cycled through repeated cycles of intentionally prolonged binding, extended washing, and elution of phage clones to select for enrichment of high-affinity variants with slow off-rates or dissociation rates. A specific set of amino acid mutations at nine positions in the α1-α2 domains was selected as preferred sites for amino acid substitutions with enhanced NKG2D binding affinity.We synthesized DNA polynucleotides encoding the α1-α2 domains of eight representative variants (SEQ ID NOs: 29-36) containing different combinations of specific mutations (Table 4).

[0072] Table 4. Selected non-natural α1-α2 domain variants with increased affinity for the native NKG2D receptor and previously described MICWED variants (McFarland et al., 2003). The positions of the designated amino acid changes are provided with reference to the residue positions in SEQ ID NO: 7, along with the common names of the variants and their SEQ ID NOs.

[0073]

[0074] DNA polynucleotides encoding eight variant α1-α2 domains were amplified using PCR primers (SEQ ID NOs: 37-38). Each was subcloned into a His-tagged α1-α2-α3-Fv fusion expression construct (SEQ ID NO: 39) using Blp1 and Sap1 restriction enzymes to replace the sequence encoding the native (wt) α1-α2 sequence with the mutant α1-α2 sequence. The construct was cultured in 293 cells (Expi293 from Life Technologies, Thermo Fisher, Inc.). TM Nine fusion proteins (SEQ ID NOs: 40-48) were expressed using the Fabry-270 Expression System) and affinity purified using Ni affinity chromatography (HisTrapHP from GE Healthcare Life Sciences).

[0075] To construct the NKG2D receptor protein, we synthesized DNA encoding the wild-type receptor extracellular domain ("ectodomain") (SEQ ID NO: 49) and cloned the synthesized DNA into an N-terminal His-Avitag expression vector (SEQ ID NO: 78) using PCR primers (SEQ ID NO: 50-51) and XbaI and BamHI sites. His-Avitag-native NKG2D (SEQ ID NO: 52) was transiently expressed in 293 cells and purified using Ni affinity chromatography. Following purification, the NKG2D protein was site-specifically biotinylated using BirA to attach the biotin group to the Avitag sequence (BirA biotin-protein ligase standard reaction kit, Avidity, LLC, Aurora, Colorado).

[0076] To characterize and compare the kinetic binding parameters of the native and eight variant α1-α2 domains to native NKG2D, we measured their binding to the surface-coated biotinylated native NKG2D extracellular domain using biolayer interferometry (Octet) at 100 nM of each α1-α2-α3-Fv fusion protein. The results are listed in Table 5.

[0077] Table 5: Kinetic parameters for binding to native NKG2D of wild-type (wt or native) and eight variant α1-α2 domain α3-Fv fusion proteins. MICwed-Fv was studied here in two separate Octet assays, one compared to the wt α1-α2 domain α3-Fv fusion and the other compared to seven other non-native α1-α2 domain α3-Fv fusions. The common name of the SEQ ID NO for each α1-α2 domain variant and its α3-Fv fusion protein is provided, along with their affinity (Kd) values ​​(expressed in moles (M)), association rates (k on ) expressed in reciprocal mole seconds (1 / Ms), and dissociation rates or dissociation rates (kdis) expressed in reciprocal seconds.

[0078]

[0079] As shown in Table 5, the selected α1-α2 domain mutations as fusions with the heterologous polypeptide α3-Fv of SEQ ID NOs: 42-48 increased the affinity of the α1-α2 domain for native NKG2D by significantly reducing the off-rate. The off-rate ranged from 20-fold to over 100-fold slower than that of the wt (SEQ ID NO: 40) and the previously described MICwed α1-α2 domain variant (SEQ ID NO: 41).

[0080] In this example of the present invention, we further demonstrated that the non-natural α1-α2 domain (DSM25, SEQ ID NO: 31, Table 4) as an α1-α2-α3-Fv fusion has high affinity for natural NKG2D (Table 2; SEQ ID NO: 43) and a very slow dissociation rate from natural NKG2D, showing tight binding affinity for non-natural NKG2D receptors containing specific mutations that abolish their binding to natural NKG2D ligands. Others have demonstrated that mutations of tyrosine 152 and tyrosine 199 in human NKG2D, NKG2D extracellular domain (SEQ ID NOs. 49 and 50) bind to the non-natural NKG2D receptor. Figure 4) at positions 73 and 120, abolishing binding to the natural ligand MICA (David J. Culpepper, Michael K. Maddox1, Andrew B. Caldwell, and Benjamin J. McFarland. Systematic mutation and thermodynamic analysis of central tyrosine pairs in polyspecific NKG2D receptor interactions. Mol Immunol. 2011 January; 48(4): 516–523).

[0081] To construct non-natural NKG2D receptor proteins, we cloned DNA encoding the natural NKG2D extracellular domain (SEQ ID NO: 49) using PCR primers (SEQ ID NO: 50-51) and inserted it into the N-terminal His-Avitag expression vector SEQ ID NO: 52 to generate His-Avitag-NKG2D (SEQ ID NO: 53). Site-directed mutagenesis was performed on the natural NKG2D extracellular domain DNA construct to introduce Y152A, Y199A, or Y152A plus Y199A mutations, generating three non-natural variants of human NKG2D (SEQ ID NO: 54-56, respectively). Natural NKG2D and three non-natural NKG2D mutants with His-avitags were transiently expressed in 293 cells and purified using Ni affinity chromatography. After purification, the NKG2D protein was site-specifically biotinylated using BirA to attach the biotin group to the Avitag sequence (BirAbiotin-protein ligase standard reaction kit, Avidity, LLC, Aurora, CO).

[0082] To generate fusions of the α3-Fc heterologous polypeptide with the α1-α2 domains of MICwed (SEQ ID NO: 29) and the DSM25 α1-α2 domains (SEQ ID NO: 31), DNA polynucleotides encoding the α1-α2 domains were amplified using PCR primers (SEQ ID NO: 37-38). Each restriction enzyme was subcloned into an α1-α2-α3-Fc fusion expression construct (SEQ ID NO: 57) using XbaI and NcoI restriction enzymes to replace the sequence encoding the native (wt) α1-α2 sequence with the mutated α1-α2 sequence. Expression was performed in 293 cells (Life Technologies Expi293 from Thermo Fisher, Inc.).TM The three fusion proteins, MICA-Fc (SEQ ID NO: 58), MICwed-Fc (SEQ ID NO: 59), and MICv25-Fc (SEQ ID NO: 60), were expressed in a Fab Expression System and affinity purified using Protein A affinity chromatography (Pierce Biotechnology, Rockford, IL, Cat. No. 20334).

[0083] In addition to the purification of the three Fc fusion proteins described above, NKG2D ligand-Fc fusion proteins: MICB-Fc, ULBP1-Fc, ULBP2-Fc, ULBP3-Fc, and ULBP4-Fc were purchased from R&D Systems, Inc. (Minneapolis, MN). A plate-based ELISA method was used to analyze the binding of different α1-α2 domain-Fc fusions to native and non-native NKG2D extracellular domain proteins. All native and non-native α1-α2 domain-Fc fusions were coated overnight at 4°C using a coating concentration of 2 μg / ml in phosphate-buffered saline (PBS) on separate wells of a Maxisorp 96-well plate. The plates were washed three times in PBS / 0.05% Tween 20 at 20-22°C and blocked with 0.5% bovine serum albumin for 2 hours. Biotinylated native and non-native NKG2D receptor proteins were titrated against plate-bound NKG2D ligands at 20-22°C for 2 hours, washed three times with PBS / 0.05% Tween20 at 20-22°C, and bound NKG2D proteins were detected using a streptavidin-HRP secondary detection step and developed using a 1-Step Ultra TMB Elisa. The native form of the NKG2D extracellular domain (SEQ ID NO: 49) was able to bind to all tested α1-α2 domain-Fc fusions. The non-native MIC-v25 α1-α2 domain ligand bound with the highest affinity (EC50 = 14 nM), which was 8-fold better than MICwed and more than 100-fold better than all tested native α1-α2 domain ligands. All tested ligands, including native and non-native α1-α2 domains, lost binding to the Y199A (SEQ ID NO: 55; Figure 18, Panel B) and double Y152A plus Y199A (SEQ ID NO: 56) mutant NKG2D receptor. However, of all tested native and non-native α1-α2 domain ligands, only the non-native α1-α2 domain (SEQ ID NO: 31) of MICv25-Fc (SEQ ID NO: 60) retained binding to the Y152A mutant NKG2D extracellular domain (SEQ ID NO: 54) with an EC50 of 50 nM.

[0084] Although the binding specificity of natural NKG2D shows a preference for high-affinity non-natural ligands, its effective binding to natural NKG2D ligands present on certain healthy tissues and many stressed tissues has resulted in extreme toxicity risks using current NKG2D CAR approaches (VanSeggelen et al. 2015). The Y152A non-natural NKG2D receptor only specifically binds to proteins containing high-affinity and non-natural α1-α2 domains engineered to significantly reduce the dissociation rate. This prototype embodiment highlights the ability of non-natural α1-α2 domains to bind to non-natural NKG2D receptors, thereby providing selective control of non-natural NKG2D CARs using bispecific proteins containing non-natural α1-α2 domains of the present invention that contain NKG2D ligands.

[0085] Example 3 (Modified α1-α2 domains of NKG2D ligands).

[0086] This embodiment relates to additional α1-α2 NKG2DL affinity variants derived by engineering the α1-α2 domain of the ULBP protein. The ULBP protein contains an α1-α2 domain, which is a NKG2D ligand capable of binding to the NKG2D receptor (Cerwenka A, Lanier LL (2004). NKG2D ligands: unconventional MHC class I-like molecules exploited by viruses and cancer. Tissue Antigens 61(5):335–43. doi:10.1034 / j.1399-0039.2003.00070.x. PMID 12753652). This affinity of NKG2D binding is sufficient to physiologically activate NK cells and stimulate natural lysis of cells expressing native full-length MIC proteins, which are irreversibly tethered to the two-dimensional plasma membrane surface of "target cells" (Cerwenka A, Lanier LL (2004). NKG2D ligands: unconventional MHC class I-like molecules exploited by viruses and cancer. Tissue Antigens 61(5):335–43. doi:10.1034 / j.1399-0039.2003.00070.x. PMID12753652). However, because in certain embodiments of the present invention, the engineered soluble α1-α2 domain fused to a heterologous polypeptide reversibly binds to a specific target antigen on the surface of a target cell, the binding affinity of the engineered ULBP α1-α2 domain to NKG2D will directly affect the stability of the artificial synapse formed between NK cells and cells expressing the target antigen, as has been shown by engineered soluble MIC proteins (Example 21-2). In order to diversify the repertoire of engineered non-natural α1-α2 domains as NKG2D ligands, ULBP proteins were used as substrates or starting points for phage display-based engineering of their NKG2D binding affinity.Although structural homology is observed between ULBP and MICA (Radaev, S., Rostro, B., Brooks, AG., Colonna, M., Sun, PD. (2001) Conformational plasticity revealed by the cocrystal structure of NKG2D and its class I MHC-like Ligand ULBP3. Immunity 15, 1039-49.), the sequence homology of the ULBPα1-α2 domain relative to MICA is less than 50%. Therefore, we sought to identify codon positions within the ULBPα1-α2 domain that enhance NKG2D binding affinity.

[0087] To engineer soluble, non-native α1-α2 domains from ULBP proteins, ULBP2 and ULBP3 were selected for phage display and mutants with high-affinity NKG2D binding were selected. Sixty amino acid positions in the α1-α2 domain of ULBP2 (SEQ ID NO: 61) and thirty-six amino acid positions in the α1-α2 domain of ULBP3 (SEQ ID NO: 62) were extensively mutagenized. In addition, conservative cysteine-to-serine mutations were performed at C8S in ULBP2 (SEQ ID NO: 61) and C103S in ULBP3 (SEQ ID NO: 62), eliminating unpaired free cysteines to increase the stability and function of the NKG2D ligand with the attached polypeptide and improve the phage panning process. Synthetic DNA libraries encoding these cysteine ​​to serine modified α1-α2 domains and containing an NNK mutagenic codon at each selected amino acid position were synthesized separately; cloned as fusions with the pill minor coat protein of M13 phage; and phage particles displaying the mutagenized α1-α2 ULBP2 or ULBP3 variants were produced in SS320 E. coli cells according to standard methods (Andris-Widhopf, J., Steinberger, P., Fuller, R., Rader, C., and Barbas, CF, 3rd. (2011). Generation of human Fab antibody libraries: PCR amplification and assembly of light- and heavy-chain coding sequences, Cold Spring Harbor protocols 2011). Using human NKG2D-Fc as the target protein, the α1-α2 phage display library was sorted based on increased binding affinity to NKG2D and circulated through repeated cycles of intentionally prolonged binding, prolonged washing, and elution of phage clones to select for high-affinity variants enriched for slow or off-rate dissociation. For ULBP2, specific amino acid mutations at positions R80, V151, V152, and A153 in α1-α2 were found to be highly frequent and identified as preferred amino acid substitutions with enhanced NKG2D binding affinity (Figure 19, Panel A; and Table 6).

[0088] Table 6. Selected affinity mutations at the designated four amino acid positions in the α1-α2 domain of ULBP2. The amino acids at each of the four positions of SEQ ID NO: 61 are shown in bold in the first row of the table. The identified affinity mutations are listed in descending frequency from top to bottom. All amino acids are represented by single-letter IUPAC abbreviations.

[0089] R80 V151 V152 A153 L D L E W E W K V Q G F K P I N S R A T E P T

[0090] For ULBP3, specific amino acid mutations were found at different positions relative to ULBP2 with high frequency. Positions R162 and K165 in the α1-α2 domain of ULBP3 contain specific mutations that were identified as preferred amino acid substitutions with enhanced NKG2D binding affinity (Table 7). These modified non-native α1-α2 domains derived from ULBP2 and ULBP3 can be used as single proteins or fusions with heterologous peptides or polypeptides to enhance NKG2D binding in various therapeutic formats.

[0091] Table 7. Selected affinity mutations at the designated two amino acid positions in the α1-α2 domain of ULBP3. The amino acids at each of the four positions of SEQ ID NO: 61 are shown in bold in the first row of the table. The identified affinity mutations are listed in descending frequency from top to bottom. All amino acids are represented by single-letter IUPAC abbreviations.

[0092]

[0093]

[0094] Example 4 (Binding and Cell Lysis of Modified α1-α2 Domain of ULBP Fused with Antibody Peptide)

[0095] The following examples involve attaching antibody polypeptides to NKG2DLs that have been modified to significantly enhance their binding affinity for human and murine NKG2D receptors. The α1-α2 domain of each ULBP protein is the natural ligand for the NKG2D receptor, i.e., NKG2DL. Antibodies are highly stable glycoproteins composed of two large heavy chains and two small light chains ( Figure 1 ). There is no IgG antibody format here that can directly activate immune cells using non-native ULBPα1-α2 domains that bind to the NKG2D receptor more tightly than native ULBP domains. In addition, the ULBPα1-α2 domains provide alternative NKG2DLs to construct antibody fusions with different in vivo properties relative to the MICAα1-α2 domains. For example, in vivo anti-drug antibody responses to the MICAα1-α2 domains in the antibody fusion may not react or interfere with the modified ULBPα1-α2 domains due to the low sequence homology between the ULBP and MICAα1-α2 domains ( Figure 5This example shows that the engineered ULBPα1-α2 NKG2D ligand (Tables 6 and 7) is fused to the heavy chain of an IgG molecule, which has enhanced NKG2D binding and target cell killing relative to the native ULBPα1-α2 NKG2D ligand. This further demonstrates the utility of fusions of modified α1-α2 domains with heterologous proteins or peptides.

[0096] To generate engineered α1-α2 domains fused to antibodies, DNA sequences encoding the C8S-modified α1-α2 domains of ULBP2 (SEQ ID NO:61) variants R80W and V151D (SEQ ID NOs:63 and 64, respectively) and the C103S-modified α1-α2 domain of ULBP3 (SEQ ID NO:62) variant R162G (SEQ ID NO:65) were synthesized and cloned as C-terminal fusions into the heavy chain sequence of a Her2-specific antibody (Carter, P., Presta, L., Gorman, CM., Ridgway, JB., Henner, D., Wong, WL., Rowland, AM., Kotts, C., Carver, ME., Shepard, HM. (1992) Proc Natl Acad Sci 15, 4285-9.). The resulting fusions were cloned into the mammalian expression vector pD2509 and expressed as paired complete IgG antibodies together with the light chain of the parental antibody. Transient expression was performed in HEK293 cells using the Expi293 expression system according to the manufacturer's protocol (Life Technologies) and purified using standard protein A affinity chromatography. Binding ELISAs performed on ULBP2 and ULBP3 α1-α2 antibody heavy chain fusions demonstrated that the modified ULBP2 fusions (HC_R80W and HC_V151D) and ULBP3 fusions (HC_R162G) bound to human NKG2D with higher affinity than their respective native α1-α2 domains fused to the same heavy chain.

[0097] In order to characterize the target cell killing properties of the modified ULBP antibody fusion, the human natural killer (NK) cell line NKL was co-cultured with calcein-loaded Her2-expressing SKBR3 target cells and titrated with engineered antibody fusion proteins. The results showed that the enhanced cell lysis (killing) activity of Her2-specific non-natural ULBP2 and non-natural ULBP3 α1-α2-antibody fusions reflected the enhanced affinity of their engineered α1-α2 domains for NKG2D. Specifically, ULBP2 variant fusions HC_R80W and HC_V151D, as well as ULBP3 variant fusions HC_R162G, killed SKBR3 cells more effectively than antibody fusions containing natural α1-α2 domains. These data further show that modified α1-α2 variant-antibody fusions are a universal platform that enables IgG molecules to bind tightly to NKG2D and direct antigen-specific cell lysis.

[0098] Example 5 (Construction of an orthogonal non-natural α1-α2 domain that selectively binds to the Y152A non-natural NKG2D)

[0099] Methods for selectively controlling CAR-T cell therapy are strongly sought to reduce toxicity and improve anti-tumor efficacy (Gilland June, in the aforementioned literature). Previously, attempts have been made to develop CAR using the extracellular domain of CD16, which can then be engaged by the Fc domain of therapeutic monoclonal antibodies, allowing antibody-based CAR-T targeting control (Changet al., in the aforementioned literature). However, CD16-based CAR-T cells can recognize all endogenous antibody molecules in blood and tissues, and the therapeutic antibodies used to control these cells will encounter interference from endogenous CD16 receptors on NK cells. These two features produce off-tumor toxicity and poor pharmacokinetic problems, respectively.

[0100] To address these issues, we have engineered non-natural NKG2D CAR-T cells that lack binding to all natural NKG2D ligands and can be controlled by binding of a high-affinity non-natural α1-α2 domain, as demonstrated in Example 2. An additional requirement is that the non-natural α1-α2 domain retains high affinity for the non-natural NKG2D and avoids binding to the natural NKG2D domain. Therefore, engineered α1-α2 domains that exhibit greater selectivity for non-natural NKG2D receptors than for natural NKG2D represent an ideal system for selectively controlling non-natural NKG2D CAR receptors, or any receptor or protein fused to the non-natural NKG2D extracellular domain that can be selectively engaged by the non-natural α1-α2 domain.

[0101] We used phage display to engineer orthogonal non-natural α1-α2 domains that exhibited selective binding to the Y152A NKG2D receptor. As a starting point, three non-natural α1-α2 domains with high affinity for native NKG2D were selected as parental domains for further mutagenesis and screening by phage display. Synthetic DNA libraries were generated for individual α1-α2 domain variants DSM 25, ULBP2R80W, and ULBP3R162G (SEQ ID NOs: 31, 63, and 65), in which the codons for the amino acid residues located near the Y152 position on the NKG2D receptor in the bound state were replaced with NNK codons. The DSM25 library consisted of residues at NNK positions 71-75 and 155-159, a ULBP2R80W library with NNK codons at positions 154-159, and a ULBP3R162G library with NNK codons at positions 155-159. The library was cloned as a fusion to the M13 phage pill minor coat protein; phage particles displaying the mutagenized α1-α2 domain variants were produced in SS320 E. coli cells according to standard methods (Andris-Widhopf, J., Steinberger, P., Fuller, R., Rader, C., and Barbas, CF, 3rd. (2011). Generation of human Fab antibody libraries: PCR amplification and assembly of light- and heavy-chain coding sequences, Cold Spring Harbor protocols 2011). The α1-α2 phage display library was sorted for high binding affinity to the non-natural Y152A NKG2D receptor by selectively capturing phage clones that bound to the biotinylated Y152AN NKG2D-Fc protein in the presence of a non-biotinylated native NKG2D-Fc competitor protein. Selected clones were enriched by multiple rounds of competitive selection with increasing concentrations of non-biotinylated native NKG2D-Fc.

[0102] After four rounds of selection, phage clones were sequenced to identify specific mutations within the NNK mutagenized region. Tables 8, 9, and 10 show the selected amino acid residues prevalent in each α1-α2 domain generated by the Y152ANKG2D selectivity screen.

[0103] Table 8. Selected mutations that generated Y152A-specific phage clones in DSM 25.

[0104] K71 D72 L73 R74 M75 T155 H156 Y157 H158 A159 T T L L R I G G G L L F L R S S S I D R H R L L R W

[0105] Table 9. Selected mutations in ULBP2R80W that generated Y152A-specific phage clones.

[0106] M154 S155 F156 H157 Y158 F159 T M L E L W K M T V I W S I L Q T T Y R

[0107] Table 10. Selected mutations in ULBP3 R162G that generated Y152A-specific phage clones.

[0108] F155 F156 K157 M158 V159 D L I R R W M Y L I R V T W Y L K L

[0109] To confirm that the phage clones exhibited the correct selective binding, phage was generated for each clone: ​​MICA25.17, MICA25.18, ULBP2.S1, ULBP2.S2, ULBP2.S3, ULBP3.S1, and ULBP3.S2 (SEQ ID NOs: 66, 67, 68, 69, 70, 71, and 72, respectively) and titrated against Y152A or native NKG2D in a binding ELISA format. Figure 23, Panels AC, demonstrates that all seven phage clones exhibited greater than 10-fold selective binding to the non-native Y152A NKG2D over native or wild-type NKG2D.

[0110] To confirm that the Y152A selective α1-α2 domain variant retained specific binding properties in the context of an antibody fusion, we cloned MICA25.17 and ULBP2.S3 as C-terminal fusions to the heavy chain of a previously described FGFR3-specific antibody (Qing et al., 2009, supra; SEQ ID NOs: 73 and 74). The resulting fusions were cloned into the mammalian expression vector pD2509 and co-expressed with the light chain of the parental antibody as a paired intact IgG antibody (R3 HC25.17 and R3 HC.U2S3). Transient expression was performed in HEK293 cells using the Expi293 expression system according to the manufacturer's protocol (Life Technologies) and purified using standard protein-A affinity chromatography. ELISAs measuring the binding of R3 HC25.17 and R3 HC.U2S3 α1-α2 antibody heavy chain fusions to non-native Y152A NKG2D and native NKG2D showed that they had significantly higher binding affinity to Y152A NKG2D relative to native NKG2D ( Figure 6 Panels B and D). In contrast, antibodies fused to DSM 25 and ULBP2R80W showed preferential binding to native NKG2D-Fc ( Figure 6Figures A and C). Taken together, these data demonstrate that the non-natural orthogonal α1-α2 domains of the present invention have high-affinity binding to non-natural NKG2D receptors and significantly reduced binding affinity to natural NKG2D receptors. Furthermore, fusions of orthogonal α1-α2 domains to antibody polypeptides retain their selective binding properties and can be used to redirect non-natural NKG2D receptors to new antigens, such as in the context of CAR-T cells.

[0111] Example 6 (Control of targeting and killing activity of CAR-T cells with non-natural NKG2D extracellular domains using orthogonal α1-α2 domains fused to targeting antibodies).

[0112] To demonstrate selective control of CAR-T cells constructed with chimeric receptors constructed using the non-natural NKG2D ectodomain, we constructed CARs with either the natural NKG2D or the non-natural Y152A NKG2D ectodomain, building on previous work using the 4-1BB / CD3zeta CAR construct (Campana patent 8,399,645), by fusing the respective NKG2D ectodomains to the CD8 hinge region of the CAR ( Figure 2 ). These constructs were cloned into lentiviral vectors and expressed in primary human CD8-positive T cells using lentiviral transduction. The resulting natural NKG2D CAR-T cells exhibited specific cell killing activity in vitro, consistent with recognition of the natural MICA ligand expressed on the target cells. Specifically, the results showed that although natural NKG2D CAR-T cells killed P1 cells expressing the natural MICA ligand, non-natural Y152A NKG2D CAR-T cells were significantly inactivated and exhibited greatly reduced MICA killing of P1 cells. In addition, the heavy chain fusion of orthogonal α1-α2 antibodies, R3 HC25.17 and R3 HC.U2S3, selectively activated non-natural Y152A CAR-T cells to kill FGFR3 expressing P1 target cells, but could not redirect the killing activity of natural NKG2D CAR-T cells. This is in contrast to the R3HC25 and R3HC.U2R80W α1-α2 antibody heavy chain fusions, which had no selectivity for the non-natural Y152A NKG2D and activated both native and non-natural CAR-T cells to kill P1 target cells. These data demonstrate that the non-natural orthogonal α1-α2 domains, engineered to selectively bind to the non-natural Y152A NKG2D, specifically activate non-natural Y152A NKG2D CAR-T cells while avoiding the native NKG2D receptor.

[0113] Example 7 (Construction of an orthogonal non-natural α1-α2 domain that selectively binds to the Y152A / Y199F non-natural NKG2D)

[0114] Others have shown that mutations in human NKG2D at tyrosine 152 or at tyrosine 199, the equivalents of positions 73 and 120 of the NKG2D extracellular domain (SEQ ID NO: 49), greatly reduce binding to the natural ligand MICA (David J. Culpepper, Michael K. Maddox, Andrew B. Caldwell, and Benjamin J. McFarland. Systematic mutation and thermodynamic analysis of central tyrosine pairs in polyspecific NKG2D receptor interactions. Mol Immunol. 2011 January; 48(4): 516–523). We reasoned that, although mutation of either tyrosine residue greatly affects the ability of NKG2D to bind its natural ligand, simultaneous mutation of both tyrosine 152 (Y152) and tyrosine 199 (Y199) would virtually eliminate the receptor's ability to bind all natural ligands. Therefore, we sought to explore individual and combined Y152 and Y199 substitutions and characterize their biochemical behavior, with the goal of identifying single and double mutant variants that were unable to bind to any natural ligand. Variants that expressed and assembled well were of particular interest, as these apparently inert ligands could be more easily generated for analysis.

[0115] The native NKG2D (wild-type) extracellular domain (NKG2D.wt, SEQ ID NO:49) and candidate non-native NKG2D variant extracellular domains (SEQ ID NOs:75-92) - also referred to as "engineered NKG2D" or "eNKG2D" were cloned as short Factor Xa fused to the C-terminus of human IgG1 Fc (without the Fab domain) via a recognizable Ile-Glu-Gly-Arg linker (SEQ ID NO:93) and are interchangeably referred to as Fc-NKG2D.wt or NKG2D.wt and Fc-eNKG2D or eNKG2D (SEQ ID NOs:94-112). DNA fragments (Integrated DNA Technologies, San Diego, CA) corresponding to the MHCI signal sequence (SEQ ID NOs: 113 and 114), human IgG1 Fc with a linker (SEQ ID NO: 115), and NKG2D extracellular domain variants (SEQ ID NOs: 116-124) were synthesized and inserted into pD2610-V12 (ATUM, Newark, CA). DNA constructs substituted at Y152, Y199, or a combination of Y152 / Y199 mutations (Table 1) were transiently expressed in Expi293™ cells (ThermoFisher Scientific, Waltham, MA), and secreted proteins were purified by protein A affinity chromatography (Pierce Biotechnology, Rockford, IL, Cat. No. 20334). The eluted material was characterized by size exclusion chromatography (SEC) on an Akta PurSuperdex column and correctly assembled, and the appropriately sized material was fractionated and separated from the aggregate peak before participating in the assay.

[0116] SEC characterization of the purified NKG2D.Y199A-Fc fusion showed that it was composed mainly of aggregated material ( Figure 2 In contrast, native Fc-NKG2D fusion and Fc-NKG2D.Y152A fusion materials were characterized by discrete, non-aggregated peaks that were easily distinguished from more rapidly migrating aggregates. The effect of the Y199A mutation on aggregation was also evident in the Y152A / Y199A double mutant Fc-NKG2D fusion variant, suggesting that it has a significant impact on protein misfolding ( Figure 2 ). Therefore, this aspect of including any combination of Y199A and Y152 mutations in NKG2D variants poses a challenge to producing the materials necessary for subsequent engineering work and raises concerns about assembly and presentation on the cell surface. Therefore, efforts have been made to explore other substitutions of Y152 and Y199 that could be combined to produce more robust molecules. The eNKG2D combination Y152 and Y199 candidate mutants were tested as Fc fusions and are detailed in Table 1. In addition, all purified and expressed Fc-eNKG2D fusion candidates were plotted by SEC and their chromatograms revealed different levels of aggregate formation ( Figure 2 and 3, Table 1). Of the single amino acid substitutions explored at residue 152, alanine, serine, threonine, and valine, none affected the assembly of the Fc-NKG2D molecule, although Y152-leucine (Y152L) produced highly aggregated material. Similar to alanine, at position 199, neither glutamate nor aspartate was tolerated, although phenylalanine only modestly increased aggregate formation. Among the mutation combinations studied, Y152A / Y199F, Y152S / Y199F, Y152T / Y199F, and Y152F / Y199F did not negatively affect the desired dimer formation, while other combinations resulted in increased aggregation.

[0117] Example 8: (Generation of Antibody-Based Bispecific Molecules "MicAbodies" with Non-Natural NKG2D Ligand Variants)

[0118] To generate non-natural MicA variants fused to human IgG1, DNA polynucleotides encoding the α1-α2 domains of, for example, MICwed (SEQ ID NO: 7) and MIC25 (SEQ ID NO: 31) were PCR amplified using primers that also introduced a polynucleotide encoding an APTSSSGGGGS linker for fusion with the C-terminal kappa light chain of human IgG1 (SEQ ID NO: 136) or a GGGS linker for fusion with the C-terminal heavy chain. In addition, two mutations, D265A / N297A (Kabat numbering), were introduced into the CH2 domain of the heavy chain. These mutations reduced binding to all FcγR receptors, thereby abolishing antibody-dependent cellular cytotoxicity (ADCC) function (Shields et al., 2001 JBC, 276: 6591-6604). The polynucleotide encoding the α1-α2 domain of wild-type ULBP2 (ULBP2.wt) without GPI linkage (SEQ ID NO: 61) was similarly cloned and fused to DNA polynucleotides encoding a linker and an IgG1 heavy or light chain. These bispecific antibodies (singularly referred to as "MicAbody TM", plural "MicAbodies") are bivalent with respect to the fused α1-α2 domains. Examples of antibodies used to generate MicAbodies for exploring eNKG2D engineering include, but are not limited to, trastuzumab (SEQ ID NOs: 137 and 138) and rituximab (SEQ ID NOs: 139 and 140), subsequently referred to as "trastuzumab-MicAbody" and "rituximab-MicAbody," respectively. The fusion constructs were inserted into pD2610-V12 (ATUM, Newark, CA) by Gibson cloning (New England Biolabs Inc., Ipswich, MA). For a given antibody recognizing a specific antigen, a plasmid encoding a heavy chain fused to a natural or non-natural NKG2D ligand and a plasmid encoding a light chain fused to a natural or non-natural NKG2D ligand were co-transfected to produce antibodies in Expi293. TM The bispecific antibodies were transiently expressed in NK cells (ThermoFisher Scientific, Waltham, MA). Alternatively, plasmids encoding the heavy chain fused to a natural or non-natural NKG2D ligand and light chain plasmids were co-transfected. The secreted bispecific antibodies were purified by protein A affinity chromatography (Pierce Biotechnology, Rockford, IL, Cat. No. 20334), and the eluted material was characterized by size exclusion chromatography (SEC) on an Akta Pur Superdex column and fractionated as needed. In addition, the purified samples were subjected to SDS-PAGE analysis to verify the expected molecular weight of the fused heavy chain and fused light chain species.

[0119] Example 9: (Identification of modified NK2GD variants that are unable to bind to natural NKG2D-binding ligands or unable to bind to non-natural ligands with enhanced binding to wild-type NKG2D)

[0120] The binding affinity of the α1-α2 variants to the extracellular domains of native (wild-type) NKG2D and non-native eNKG2D proteins was analyzed using a plate-based ELISA method. Each of the SEC-separated native Fc-NKG2D and non-native Fc-eNKG2D fusions was coated overnight at 4°C on separate wells of a NuncMaxisorp 96-well plate (Thermo Fisher Scientific, Waltham, MA) using a coating concentration of 1 μg / mL in phosphate-buffered saline (PBS). The plates were washed three times in PBS / 0.05% Tween-20 (PBS-T) at 20–22°C and blocked for 2 hours at 20–22°C with 0.5% bovine serum albumin in PBS (PBS-B). MicAbodies were titrated against plate-bound native or non-native Fc-NKG2D fusions in PBS / 0.5% bovine serum albumin (BSA) / 0.05% Tween-20 (PBS-BT) at 20–22°C for 60 min, washed three times with PBS-T at 20–22°C, and bound bispecific proteins were detected using HRP-conjugated anti-human kappa (Abcam, Cambridge, MA) in PBS-BT and stained with 1-Step TM Ultra TMB ELISA substrate solution (ThermoFisher Scientific, Waltham, MA) was used for development. Binding of ULBP2.wt rituximab-MicAbody (SEQ ID NOs: 139 and 141) distinguished between wild-type NKG2D and eNKG2D variants, to which binding was reduced, and ligand variants—MICwed (SEQ ID NOs: 20 and 78) and MIC25 (SEQ ID NOs: 138 and 80)—were more stringent in identifying eNKG2D variants with abrogated ligand binding. The binding behavior of each eNKG2D variant against all three dual-specific ligands revealed the combination of NKG2D modifications that resulted in the greatest reduction in binding of wild-type and variant ligands and enabled selection of lead Laziness sex NKG2D variants.

[0121] Other biophysical analyses of eNKG2D variants binding to ligands were also performed using the FortéBio Octet system (All FortéBio LLC, Fremont, CA) using biolayer interferometry (BLI). For these experiments, human NKG2D ligands MICA-Fc, MICB-Fc, ULBP1-Fc, ULBP2-Fc, ULBP3-Fc, and ULBP4-Fc were purchased from R&D Systems, Inc. (Minneapolis, MN). The ligands in the form of MicA bodies were captured on an anti-human IgG Fc capture (AHC) biosensor tip. After establishing a baseline, the tip was exposed to a titration series of Fc-eNKG2D fusion proteins ranging from 300 nM to 0.41 nM, and association / dissociation kinetics were monitored using all steps performed in PBS-BT. Subsequently, the Fc-eNKG2D fusion protein was captured on the AHC tip, and the MicA bodies were titrated to characterize the binding kinetics.

[0122] To determine the maximum response defined by native NKG2D binding to MICwed or MIC25, native Fc-NKG2D fusions were captured onto AHC biosensors and incubated with 20 nM trastuzumab-MICwed or 20 nM trastuzumab-MIC25 MicAbody for two minutes, followed by observation of dissociation kinetics for 30 seconds. Binding assays were then performed under the same conditions using the Fc-eNKG2D fusion receptor as a capture agent, and the binding level of each eNKG2D was ranked as a percentage of the maximum binding response established by Fc-NKG2D.wt (Table 2). For MICwed, all single-mutation Fc-eNKG2D variants, except Y199F, showed a 50% reduction in response. Y199F maintained a 100% binding response. However, all double-mutation Fc-eNKG2D variants completely abolished binding to MICwed. For MIC25, all single-mutant Fc-eNKG2D variants and Y152V / Y199F maintained a 100% binding response relative to wild-type Fc-NKG2D binding. However, binding was reduced to 50% for several double-mutant Fc-eNKG2D variants, including Y152A / Y199F, Y152S / Y199F, and Y152T / Y199F.

[0123] ELISA assays using Fc-eNKG2D fusions as capture agents were performed with ULBP2.wt, MICwed, and MIC25 MicAbody, titrated starting at 300 nM. EC values ​​were calculated using GraphPad Prism when possible. 50 Values ​​(Table 11).

[0124] Table 11: EC50 values ​​(nM) of Fc-eNKG2D ELISA. nt = not tested; nb = no binding or very low binding even at 300 nM, so EC50 not calculated 50 value

[0125]

[0126] Native NKG2D bound to ULBP2-, MICWED-, and MIC25-based MicAbodies with calculated affinities, Kds, of 1.4, 0.007, and 0.005 nM, respectively. While the ULBP2 and MICWED MicAbodies had reduced affinity for all single-mutant eNKG2D candidates, binding of MIC25 to the eNKG2D candidates was retained. However, all double-mutant eNKG2D candidates had abolished or significantly reduced binding to all three ligands in the MicAbody format—ULBP2, MICWED, and MIC25.

[0127] By Octet analysis and ELISA, the binding of eNKG2D variants eNKG2D5 (Y152A / Y199F), eNKG2D7 (Y152S / Y199F), eNKG2D8 (Y152T / Y199F), and eNKG2D9 (Y152V / Y199F) to MicAbodies based on ULBP2, MICWED, and MIC25 was reduced or abolished (Tables 2 and 3). In addition, eNKG2Ds 5, 7, and 8 had minimal aggregation, suggesting stronger protein assembly upon 293T expression (Table 1). Binding of eNKG2D5 (SEQ ID NO: 102) to wild-type ligands was examined more closely, as was MicAbodies captured on Octet AHC tips. Relative to native (SEQ ID NO: 94) NKG2D, the single mutant Fc-NKG2D.Y152A (SEQ ID NO: 95) had reduced binding to all native ligands ( Figure 5 The response curve for binding of eNKG2D5 (Y152A / Y199F) was even further reduced relative to Y152A eNKG2D. eNKG2D5 (Y152A / Y199F, hereinafter referred to as "AF" or "NKG2D.AF") was selected as the lead NKG2D variant for engineering of a homologous selective, orthogonal, non-natural ligand.

[0128] Example 10: (Construction of an orthogonal non-natural α1-α2 domain that selectively binds to the non-natural NKG2D.AF extracellular domain)

[0129] We used phage display to engineer orthogonal non-natural α1-α2 domains that exhibited selective binding to the NKG2D.AF (SEQ ID NO: 102) receptor. As a starting point, the non-natural ULBP2.R80W α1-α2 domain ( Figure 1 B; SEQ ID NO: 142) served as the parental domain for further mutagenesis and screening by phage display. A synthetic DNA library was generated for the α1-α2 domain of ULBP2.R80W (SEQ ID NO: 108), which additionally had a C8S mutation to eliminate a potential disulfide bond. Codons for amino acid residues on the ligand that are immediately adjacent to positions Y152 and Y199 on the native NKG2D receptor in the ligand-bound state were replaced with NNK codons; the library consisted of NNK codons at positions 154-159. The library was cloned as a fusion with the pill minor coat protein of M13 phage, and phage particles displaying the mutagenized α1-α2 domain variants were produced in SS320 E. coli cells according to standard methods (Andris-Widhopf, J., Steinberger, P., Fuller, R., Rader, C., and Barbas, CF, 3rd. (2011)). These α1-α2 phage display libraries were sorted for high binding affinity to the non-natural NKG2D.AF receptor by selectively capturing phage clones that bound to the biotinylated Fc-NKG2D.AF protein in the presence of the non-biotinylated native Fc-NKG2D.wt competitor protein. Selective clones were enriched by multiple rounds of competitive selection using increasing concentrations of non-biotinylated native Fc-NKG2D.

[0130] After four rounds of selection, phage clones were arranged into a 96-well format and spot ELISA was performed to verify the preferred differential binding of non-natural NKG2D.AF to NKG2D.wt bound to the plate. Biotinylated M13 phage coat protein monoclonal antibody E1 (ThermoFisher Scientific, Waltham, MA), streptavidin-HRP detection (R&D Systems, Minneapolis, MN) and 1-Step Ultra TMB ELISA development (ThermoFisher Scientific, Waltham, MA) were used to detect the bound phage. The spot ELISA signal for each clone was expressed as the ratio of phage binding to NKG2D.AF to phage binding to NKG2D.wt. Those phages with a ratio greater than or equal to 14 were sequenced to identify specific mutations within the NNK mutagenesis region. In the case of identifying multiple clones representing the same sequence, the ratio of the ELISA signal was plotted and the consistency of the phage clones was verified by clustering of the data points (data not shown).

[0131] Thirty variants identified in ELISA were amplified in separate monocultures to generate high titer microbatches of phage. Purified phage concentrations were normalized to OD 268 = 0.5, followed by 1:3 serial dilutions against plate-bound Fc-NKG2D.AF or Fc-NKG2D.wt, and phage detection and ELISA development were performed as described above. All thirty variants assayed in this manner consistently demonstrated selective binding to NKG2D.AF, with little to no binding to NKG2D.wt even at the highest phage concentration assayed. Selected phage also showed a shift of two or more logs of phage concentration to achieve half-maximal binding between NKG2D.AF and NKG2D.wt.

[0132] To confirm that the NKG2D.AF-selective α1-α2 domain variants retained their specific binding properties in antibody fusions, 21 variants (Table 5; e.g., SEQ ID NOs: 143-150) were cloned into the light chain of the rituximab antibody as C-terminal fusions with an APTSSSGGGGS linker. The resulting fusions were cloned into the mammalian expression vector pD2610-V12 (ATUM, Newark, CA) by Gibson cloning (New England Biolabs Inc., Ipswich, MA) and co-expressed with the heavy chain of the parental antibody as paired complete IgG antibodies. The heavy chain was expressed in Expi293 according to the manufacturer's protocol. TMThe fusion proteins were transiently expressed in WT cells (ThermoFisher Scientific, Waltham, MA) and purified using standard protein-A affinity chromatography (Pierce Biotechnology, Rockford, IL, Cat. No. 20334). Binding of each variant ULBP2α1-α2 antibody fusion to non-natural Fc-NKG2D.AF and natural Fc-NKG2D.wt was measured by ELISA, showing that they had significantly higher binding affinity to NKG2D.AF relative to natural NKG2D.wt (Table 12).

[0133] Table 12: Specificity of NKG2D.AF selected ULBP2 variants in rituximab-MicAbody format retain their binding to NKG2D.AF by quantitative ELISA. The specific amino acid modifications of each ULBP2 variant are shown as their binding ratio to Fc-NKG2D.wt fusion versus Fc-NKG2D.AF fusion.

[0134]

[0135]

[0136] In summary, these data demonstrate that the non-natural orthogonal α1-α2 domains of the present invention have high affinity binding to non-natural NKG2D.AF receptors and significantly reduced binding affinity to natural NKG2D receptors. In addition, the fusions of these orthogonal α1-α2 domains with antibody polypeptides retain their selective binding properties and are used, for example, in the context of chimeric antigen receptor (CAR) T cells to redirect non-natural NKG2D.AF receptors to specific antigens.

[0137] Example 11: (Identification of non-natural NKG2D ligands that can distinguish non-natural NKG2D receptor variants by selectively binding to one or another)

[0138] As described above, phage display was performed using the non-natural ULBP2.R80w α1-α2 domain (SEQ ID NO: 142) as a starting point to engineer orthogonal non-natural α1-α2 domains with selective binding to the NKG2D.Y152A (hereinafter referred to as NKG2D.YA) receptor. The α1-α2 phage display library was panned for high binding affinity to the non-natural Fc-NKG2D.YA receptor by selectively capturing phage clones that bound to the biotinylated Fc-NKG2D.YA (SEQ ID NO: 95) protein in the presence of the non-biotinylated native Fc-NKG2D.wt (SEQ ID NO: 94) competitor protein. Additional phage clone validation work led to the identification of variants that preferentially bound to Fc-NKG2D.YA compared to Fc-NKG2D.wt (Table 13).

[0139] Table 13: Selected mutations at the indicated amino acid positions of ULBP2.R80W (SEQ ID NO: 132) resulted in Y152A-specific phage clones. For example, ULBP2.S3 (SEQ ID NO: 151) was consistently shown to selectively bind to the non-natural NKG2Dd.YA relative to the natural NKG2Dd.wt by ELISA and Octet analysis (both in monomeric His-tagged and bispecific antibody fusion formats).

[0140] M154 S155 F156 H157 Y158 F159 T M L E L W K M T V I W S I L Q T T Y R

[0141] For example, ULBP2.S3 (SEQ ID NO: 151) was consistently demonstrated to selectively bind to the non-natural NKG2Dd.YA relative to the native NKG2Dd.wt by ELISA and Octet analysis (both in monomeric His-tagged and bispecific antibody fusion formats). This represents a unique form of the present invention of a non-natural orthogonal α1-α2 domain that has high affinity binding to the non-natural NKG2D receptor (NKG2D.YA in this case as opposed to NKG2D.AF in Example 2). Furthermore, fusions of the orthogonal α1-α2 domains with antibody polypeptides retain their selective binding properties and are used to selectively redirect the non-natural NKG2D receptor to specific molecules defined by the fused heterologous peptide (e.g., antibody).

[0142] To determine whether the non-natural α1-α2 domains that selectively bind to NKG2D.YA (ULBP2.S3, SEQ ID NO: 151) and the non-natural α1-α2 domains that selectively bind to NKG2D.AF could distinguish these two non-natural receptor variants, a titration ELISA was performed. All 21 selected α1-α2 variants that bind to NKG2D.AF were directly compared for binding to NKG2D.AF and NKG2D.YA. Of these, four exhibited a lack of binding to NKG2D.wt, strong affinity for NKG2D.AF, and greatly reduced (15-20-fold) or eliminated binding to NKG2D.YA relative to NKG2D.AF. The four non-natural ULBP2 α1-α2 variants, ULBP2.C, ULBP2.R, ULBP2.AA, and ULBP2.AB (SEQ ID NOs: 143, 145, 147, and 149), were also examined for changes in predicted immunogenicity profiles relative to the wild-type ULBP2 peptide sequence (SEQ ID NO: 61) using the NetMHC 4.0 server (for peptide-MHC class I binding, 9-mer peptide analysis was queried against all HLA supertype representatives; http: / / www.cbs.dtu.dk / services / NetMHC / ) and the NetMHC II 2.3 server (for peptide-MHC class II binding, 15-mer peptide analysis was queried against HLA-DR, HLA-DQ, and HLA-DP haplotypes; http: / / www.cbs.dtu.dk / services / NetMHCII / ), both algorithms developed at the Technical University of Denmark (http: / / www.bioinformatics.dtu.dk / ; Andreatta M and Nielsen et al., 2012). M, Gapped sequence alignment using artificial neural networks: application to the MHC class Isystem, 2016 Bioinformatics, 32: 511, PMID: 26515819; Jensen KK, Andreatta M, Marcatili P, Buus S, Greenbaum JA, Yan Z, Sette A, Peters B, and Nielsen M, Improved methods for predicting peptide binding affinity to MHC class I molecules, 2018 Immunology, PMID: 29315598).Mutations incorporated into ULBP2.C, ULBP2.R, and ULBP2.AB did not increase predicted immunogenicity, whereas mutations in ULPB2.AA slightly increased it for some haplotypes (. Figure 8 and 9 Due to the specificity of ULBP2.R for NKG2D.AF and its lack of predictable immunogenicity, ULBP2.R was selected for further ELISA analysis to directly compare its binding behavior with ULBP2.S3 (a non-natural orthogonal ligand selected by NKG2D.YA), ULBP2.R80W (a non-natural ligand with enhanced affinity for wild-type NKG2D), and wild-type ULBP2 (ULBP2.wt). Binding of four rituximab-MicAbody reagents (SEQ ID NOs: 139 and 151, 139 and 152, 153 and 140, and 139 and 141 as the heavy and light chains of ULBP2.R, ULBP2.S3, ULBP2.R80W, and ULBP2.wt, respectively) was determined for wild-type NKG2D (NKG2D.wt) and two inert non-natural variants NKG2D.YA and NKG2D.AF. The data demonstrate that the NKG2D.YA-selected variant ULBP2.S3 is a MicAbody that binds to NKG2D.YA with high affinity, but does not bind to NKG2D.AF or native NKG2D. Furthermore, the NKG2D.AF-selected variant ULBP2.R binds to NKG2D.AF with high affinity as a MicAbody, but does not bind to NKG2D.YA or native NKG2D. These results demonstrate the tremendous potential of exploring the NKG2D-MIC ligand axis and developing uniquely paired novel, selective, non-native NKG2D receptors and their respective cognate non-native MIC ligand binding partners.

[0143] Example 12: (Targeting and killing activity of CAR-T cells expressing non-natural NKG2D.AF extracellular domains is controlled by orthogonal α1-α2 domains fused to heterologous targeting polypeptides)

[0144] Methods for selectively controlling CAR-T cell therapy are strongly sought to reduce toxicity and improve anti-tumor efficacy (Gilland June, in the aforementioned literature). Previously, attempts have been made to develop CAR using the extracellular domain of CD16, which can then be engaged by the Fc domain of therapeutic monoclonal antibodies, allowing antibody-based CAR-T targeting control (Changet al., in the aforementioned literature). However, CD16-based CAR-T cells can recognize almost all endogenous antibody molecules in blood and tissues, and therapeutic antibodies for controlling these cells will encounter competition from endogenous CD16 receptors on NK cells, PMNs, monocytes, and macrophages. These two features produce off-tumor toxicity and poor pharmacokinetic problems, respectively.

[0145] Natural NKG2D ligands are present in some healthy tissues and many stressed tissues, resulting in a high risk of toxicity using current NKG2D CAR approaches (Van Seggelen et al. 2015). The Y152A non-natural NKG2D receptor specifically binds to a non-natural α1-α2 domain NKG2D ligand, constituting an example of a means by which the activity of a non-natural NKG2D CAR can be selectively controlled using a bispecific protein comprising a non-natural α1-α2 domain of a NKG2D ligand of the present invention.

[0146] We engineered CAR-T cells with receptors containing a modified Y152A / Y199F ("AF") extracellular domain of NKG2D that lacks binding to all natural NKG2D ligands, or a previously described non-natural α1-α2 domain that is orthogonal and homologous to the Y152A-modified NKG2D (NKG2D.YA). The homologous non-natural α1-α2 domains of the present invention bind to the non-natural NKG2D.AF extracellular domain with high affinity and avoid binding to the natural NKG2D extracellular domain and the NKG2D.YA extracellular domain. Thus, the engineered α1-α2 domain exhibits strong selectivity for the non-natural NKG2D.AF extracellular domain relative to natural NKG2D and non-natural NKG2D.YA, representing an ideal system for selectively controlling non-natural NKG2D CAR receptors, or any receptor or protein that can be fused to the non-natural NKG2D extracellular domain selectively engaged by the non-natural α1-α2 domain of the present invention. The present invention further enables a single cell to express two different CARs—one comprising NKG2D.YA and the other comprising NKG2D.AF—each using a distinctly different intracellular domain for signal transduction. These different CARs will have independent dual control of cellular activity by extracellular exposure to their respective cognate orthogonal MicAbody or another non-antibody fusion polypeptide.

[0147] To demonstrate the selective control of CAR-T cells constructed with a chimeric receptor using a non-natural NKG2D.AF extracellular domain, we used a 4-1BB / CD3-ζCAR construct (Campana patent 8,399,645) based on previous work to fuse the respective NKG2D extracellular domains to the CD8 hinge region of CAR (SEQ ID NO: 155, 157, 159) and constructed CARs with natural NKG2D.wt (SEQ ID NO: 49), non-natural NKG2D.YA (SEQ ID NO: 54) or non-natural NKG2D.AF (SEQ ID NO: 154) extracellular domains. These constructs (SEQ ID NO: 156, 158, 160) were cloned into lentiviral vectors and expressed in primary human CD8 positive T cells using lentiviral transduction. HeLa cells have constitutively upregulated levels of MIC ligands on their surface, including MICA, MICB, ULBP3, and ULBP2 / 5 / 6 (the antibodies used to determine this do not distinguish between these three ULBPs; human ULBP-2 / 5 / 6 antibodies, R&D Systems, Minneapolis, MN). HeLa cells were also transfected to overexpress native ULBP1 or the NKG2D.AF-selected variant ULBP2.R on their surface, and these cells were used as targets for in vitro killing assays. HeLa target cells were pre-loaded with calcein and exposed to NKG2D.wt-CAR, NKG2D.YA-CAR, or NKG2D.AF-CAR CD8 cells at increasing effector to target (E:T) ratios for five hours, after which the amount of calcein released into the supernatant was quantified and normalized to the total calcein released after detergent treatment. Because levels of the MIC ligand naturally expressed on the HeLa cell surface are elevated, CD8 T cells expressing native NKG2D (NKG2D.wt) act as CARs to bind to HeLa cells via this overexpressed native ligand and achieve cytolysis. However, even at high E:T ratios, both NKG2D.YA- and NKG2D.AF-CAR-transduced CD8 T cells displayed very little lysis of native HeLa cells, comparable to the activity levels of untransduced CD8 T cells. When ULBP1 was overexpressed on the HeLa cell surface, only NKG2D.wt-CAR CD8 T cells significantly lysed them. NKG2D.YA-CAR cells, but not NKG2D.AF-CAR cells, exhibited some additional killing at high E:T ratios, suggesting that the double Y152A / Y199F mutation renders NKG2D more inert than the single Y152A mutation.In HeLa cells overexpressing the NKG2D.AF-selective non-native ULBP2.R, NKG2D.wt-CAR cells directed lysis (due to recognition of endogenous MIC ligands), while NKG2D.AF-CAR cells directed significant levels of lysis, consistent with engagement of the receptor with its selective ligand.

[0148] To demonstrate that lysis of NKG2D.YA- or NKG2D.AF-CAR cells can only be induced by the appropriate cognate targeting MicAbody, Ramos cells were used as targets for cytolysis with rituximab-based MicAbodies linked to orthogonal ligands of non-natural ULBP2.S3 or ULBP2.R. Rituximab-ULBP2.S3 MicAbody elicited cell-killing activity against NKG2D.YA-CAR CD8 cells, but not NKG2D.AF-CAR cells, whereas rituximab-ULBP2.R MicAbody elicited activity against NKG2D.AF-CAR cells, but not NKG2D.YA-CAR cells. This further demonstrates the selectivity of the two non-natural ULBP2 variants for their cognate non-natural NKG2D variants, where they were engineered as preferred partners. To demonstrate the specificity of the MicAbody antibody portion, NKG2D.AF-CAR CD8 T cells pretreated with rituximab-ULBP2.R, trastuzumab-ULPB2.R (SEQ ID NO: 95 and 133, heavy and light chains, respectively) or an equimolar combination of the two were incubated at a saturating total concentration of MicAbody, and an in vitro killing assay was performed. After washing to remove unbound MicAbody, CD8 cells were applied to Ramos cells (expressing CD20, a target of rituximab) or CT26-Her2 (a mouse cell line transfected to express human Her2) that had been pre-loaded with calcein. After two hours of incubation at two different E:T ratios, the amount of calcein released was quantified. When the cells were pre-armed with rituximab-MicAbody, only Ramos cells were lysed, while trastuzumab-MicAbody caused cell lysis activity only for CT26-Her2 cells. However, when NKG2D.AF-CAR CD8 cells were pre-equipped with both rituximab- and trastuzumab-ULBP2.R MicAbodies, both target cell lines were lysed, demonstrating that these CAR cells—due to engineered selective preferential pairing between receptor and ligand—can be easily multiplexed to be directed to simultaneously engage different tumor targets.

[0149] Example 13: (Killing of human tonsil CD4 T cells infected with HIV effectively) CD8+ T cells were isolated from PBMCs of healthy donors, activated by anti-CD3 / CD28 beads, and transduced with a CAR comprising an inert NKG2D, CD8 hinge and transmembrane domains, a co-stimulatory 4-1BB domain, and CD3ζ. These CAR-T cells are referred to as convertibleCAR cells. These convertibleCAR-T cells are only able to indirectly bind to broadly neutralizing HIV antibodies fused to modified non-natural ligands that are homologous to the inert NKG2D receptor of convertibleCAR. Non-transduced CD8 T cells from the same donor were also prepared in parallel as a negative control. Four HIV-specific MicAbodies, broadly neutralizing antibodies, were prepared based on the sequences of 3BNC60, 3BNC117, PGT121, and 10-1074 (SEQ ID NOs. 161 and 162 (3BNC60), MicAbody heavy and light chains, respectively; 163 and 164 (3BNC117), MicAbody heavy and light chains, respectively; 165 and 166 (PGT121), MicAbody heavy and light chains, respectively; 167 and 168 (10-1074), MicAbody heavy and light chains, respectively). These MicAbodies bind to specific epitopes of the HIV gp160 envelope molecule. The target epitope bound by 3BNC60 and 3BNC117 is SEQ ID NO: 169; the target epitope bound by PGF12 and 10-1074 is SEQ ID NO: 170; (Deng K, Pertea M, Rongvaux A, Wang L, Durand CM, Ghiaur G, Lai J, McHugh HL, Hao H, Zhang H,, JB, Gurer C, Murphy AJ, Valenzuela DM, Yancopoulos GD, Deeks SG, Strowig T, Kumar P, Siliciano JD, Salzberg SL, Flavell RA, Shan L, Siliciano RF Broad CTL response is required to clear latent HIV-1 due to dominance of escape mutations. Nature. 2015 Jan 15; 517(7534) p. 381-5). MicAbodies targeting CD20 or HER2 were also used as negative controls.

[0150] Human tonsil cells from 4 healthy donors are processed to produce human lymphoid aggregate cultures (HLAC). HLAC cells are overlaid on 293T cells pre-transfected with DNA corresponding to R5-tropic HIV-1 and GFP reporter genes. After 24 hours, HLAC cells are removed and the HIV infection of the spread is continued for another 4 days. GFP-positive infected HLAC cells are then exposed to untransduced CD8 T cells or to convertibleCAR-T cells equipped with the MicAbody shown, and cultured for 48 hours in the presence of 5 μM saquinavir to prevent further viral spread. Cells are then collected by centrifugation, washed, and stained using LSRII flow cytometer to assess the viability of infected and uninfected cells.

[0151] Evaluation of the effector:target (E:T) cell ratio of HIV-infected primary CD4 T cells killed by CAR-T cells using different concentrations of specific HIV-targeting MicAbodies. As described above, one million primary tonsil-derived cells infected with Bal-GFP R5 virus (approximately 10% infected; 1×10 4 infected cells) with 1×10 5 Untransduced CD8 (0:1) or with 1×10 4 (1:1) or 2×10 5 The cells were incubated with CAR-T cells (20:1). After 24 hours, the cells were stained and evaluated by flow cytometry. Cells were gated on single cells / live / CD3+ / CD8- cells expressing or not expressing GFP. The average results of 4 studies are shown in Figure 7 In these studies, the combination of HIV-specific MicAbody and convertibleCAR-T cells resulted in specific killing of tonsil cells infected with R5 HIV virus. The optimal effector: target ratio for killing ranged from 1:1 to 10:1, while the viability of uninfected cells was not reduced. Killing was highly limited to infected cells, i.e., those expressing GFP. GFP- cells present in the same culture showed little or no reduction in cell number (Figures B and C; GFP+ vs. GFP-). In addition, when donor-matched untransduced CD8 T cells or non-HIV-targeted MicAbody (e.g., CD20-targeted MicAbody or Her2-targeted MicAbody) were used, no killing of uninfected cells occurred and no killing of infected cells occurred.

[0152] Primary CD4 R5 virus-infected cells were specifically killed by CAR-T cells combined with specific HIV MicAbody. In the presence of different concentrations of HIV-specific MicAbody, or B cell-specific CD20-targeted MicAbody, or HER2-targeted MicAbody (Her2), one million primary tonsil-derived cells (about 1×10 4 infected cells) with 1×10 5 CAR-T cells were incubated together. After 24 hours, cells were stained and analyzed by flow cytometry. Cells were gated on single cells / live / CD3+ / CD8- and GFP+ or GFP-. The average results of 4 studies are shown in Figure 8 middle.

[0153] Primary CD4 cells infected with F4 initial transmission virus were specifically killed by CAR-T combined with specific HIV MicAbody. One million primary tonsil-derived cells (about 1×10 4 infected cells) with 1×10 5 The cells were incubated with convertibleCAR-T cells. After 24 hours, the cells were stained and then subjected to flow cytometry. Cells were gated on single cells / live / CD3+ / CD8- and GFP+ or GFP-. The results are shown in Figure 2. Figure 9 As shown, efficient killing was observed when cells were infected with R5 virus or with F4-primed HIV virus, which represents a strain that successfully spreads horizontally from one person to another.

[0154] Example 14 (CAR-T and MicAbody kill reactivated latently infected reservoir cells from patients with chronic HIV infection and aviremia receiving ART therapy.)

[0155] Peripheral blood mononuclear cells (PBMCs) from 6 HIV-positive individuals without viremia undergoing ART were obtained by continuous flow centrifugation leukocyte separation followed by density centrifugation of cells on a Ficoll-Hypaque gradient. Resting CD4+ T lymphocytes were then isolated by “no contact” negative antibody depletion. The cells were cultured in RPMI medium supplemented with 10% fetal bovine serum and penicillin / streptomycin. 10 million resting CD4+ lymphocytes were stimulated with 80nM PMA+1μM ionomycin for 72 hours. After reactivation, the cells were incubated with CAR-T or donor-matched untransduced CD8 cells with different MicAbodies for 48 hours in the presence of 5μM saquinavir. The cells were collected by centrifugation at 300g for 10 minutes. The cell pellet was then lysed and RNA was extracted using an RNeasy kit (Qiagen). The Superscript III One-Step RT-PCR system was used to generate cDNA, accompanied by pre-amplification of viral mRNA (i.e., 10 cycles of pre-amplification), which was then analyzed and quantified by droplet digital PCR (ddPCR). CD4+ T cells were isolated by contactless negative selection from PBMCs collected from known HIV-infected patients receiving ART and reactivated for 72 hours using 100nM phorbol myristate (PMA) + 1μM ionomycin. The cells were then washed twice and incubated with convertibleCAR-T cells or untransduced CD8 T cells for 48 hours in the presence of an equal concentration of a mixture of HIV bNAb-based MicAbodies (3BNC60, 3BNC117, PGT121, and 10-1074) at 0.1 or 1nM (referred to as MIX in the figure). The cells were then centrifuged and RNA was extracted from the cell pellet. Cell-associated HIV RNA was measured by ddPCR. The results are described in Figure 10 middle.

[0156] In this study of reactivated latent reservoir cells (treated with PMA + ionomycin for 3 days) from non-viremic infected individuals undergoing ART (n = 6), we observed that CAR-T cells were able to effectively reduce the number of these reactivated reservoir cells by approximately 50% compared to donor-matched untransduced CD8 T cells + MicAbody mixture. The inducible reservoir size was assessed by quantifying cell-associated HIV RNA using ddPCR in the presence and absence of inducer and effector cells.

[0157] Together, these findings in Examples 13 and 14 provide ex vivo proof of concept that convertibleCAR-T cells coupled with cognate MicAbodies constructed with broadly neutralizing human IgG1 antibodies can be used as a novel, potent, and highly selective killing strategy for eliminating successfully reactivated HIV-infected cells within latent HIV-1 reservoirs. Sequence Listing <110> XYPHOS BIOSCIENCES INC. <120> Modified non-natural NKG2D ligands that selectively deliver attached heterologous molecules to non-natural NKG2D receptors on CAR cells <130> F252863 <150> US 62 / 797,644 <151> 2019-01-28 <160> 170 <170> PatentIn version 3.5 <210> 1 <211> 274 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide MICA <400> 1 Glu Pro His Ser Leu Arg Tyr Asn Leu Thr Val Leu Ser Trp Asp Gly 1 5 10 15 Ser Val Gln Ser Gly Phe Leu Thr Glu Val His Leu Asp Gly Gln Pro 20 25 30 Phe Leu Arg Cys Asp Arg Gln Lys Cys Arg Ala Lys Pro Gln Gly Gln 35 40 45 Trp Ala Glu Asp Val Leu Gly Asn Lys Thr Trp Asp Arg Glu Thr Arg 50 55 60 Asp Leu Thr Gly Asn Gly Lys Asp Leu Arg Met Thr Leu Ala His Ile 65 70 75 80 Lys Asp Gln Lys Glu Gly Leu His Ser Leu Gln Glu Ile Arg Val Cys 85 90 95 Glu Ile His Glu Asp Asn Ser Thr Arg Ser Ser Gln His Phe Tyr Tyr 100 105 110 Asp Gly Glu Leu Phe Leu Ser Gln Asn Leu Glu Thr Glu Glu Trp Thr 115 120 125 Met Pro Gln Ser Ser Arg Ala Gln Thr Leu Ala Met Asn Val Arg Asn 130 135 140 Phe Leu Lys Glu Asp Ala Met Lys Thr Lys Thr Leu Tyr His Ala Met 145 150 155 160 His Ala Asp Cys Leu Gln Glu Leu Arg Arg Tyr Leu Lys Ser Gly Val 165 170 175 Val Leu Arg Arg Thr Val Pro Pro Met Val Asn Val Thr Arg Ser Glu 180 185 190 Ala Ser Glu Gly Asn Ile Thr Val Thr Cys Arg Ala Ser Gly Phe Tyr 195 200 205 Pro Trp Asn Ile Thr Leu Ser Trp Arg Gln Asp Gly Val Ser Leu Ser 210 215 220 His Asp Thr Gln Gln Trp Gly Asp Val Leu Pro Asp Gly Asn Gly Thr 225 230 235 240 Tyr Gln Thr Trp Val Ala Thr Arg Ile Cys Gln Gly Glu Glu Gln Arg 245 250 255 Phe Thr Cys Tyr Met Glu His Ser Gly Asn His Ser Thr His Pro Val 260 265 270 Pro Ser <210> 2 <211> 274 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide MICA <400> 2 Glu Pro His Ser Leu Arg Tyr Asn Leu Thr Val Leu Ser Trp Asp Gly 1 5 10 15 Ser Val Gln Ser Gly Phe Leu Ala Glu Val His Leu Asp Gly Gln Pro 20 25 30 Phe Leu Arg Cys Asp Arg Gln Lys Cys Arg Ala Lys Pro Gln Gly Gln 35 40 45 0]Trp Ala Glu Asp Val Leu Gly Asn Lys Thr Trp Asp Arg Glu Thr Arg 50 55 60 Asp Leu Thr Gly Asn Gly Lys Asp Leu Arg Met Thr Leu Ala His Ile 65 70 75 80 Lys Asp Gln Lys Glu Gly Leu His Ser Leu Gln Glu Ile Arg Val Cys 85 90 95 Glu Ile His Glu Asp Asn Ser Thr Arg Ser Ser Gln His Phe Tyr Tyr 100 105 110 Asp Gly Glu Leu Phe Leu Ser Gln Asn Leu Glu Thr Glu Glu Trp Thr 115 120 125 Met Pro Gln Ser Ser Arg Ala Gln Thr Leu Ala Met Asn Ile Arg Asn 130 135 140 Phe Leu Lys Glu Asp Ala Met Lys Thr Lys Thr His Tyr His Ala Met 145 150 155 160 His Ala Asp Cys Leu Gln Glu Leu Arg Arg Tyr Leu Lys Ser Gly Val 165 170 175 Val Leu Arg Arg Thr Val Pro Pro Met Val Asn Val Thr Arg Ser Glu 180 185 190 Ala Ser Glu Gly Asn Ile Thr Val Thr Cys Arg Ala Ser Gly Phe Tyr 195 200 205 Pro Trp Asn Ile Thr Leu Ser Trp Arg Gln Asp Gly Val Ser Leu Ser 210 215 220 His Asp Thr Gln Gln Trp Gly Asp Val Leu Pro Asp Gly Asn Gly Thr 225 230 235 240 Tyr Gln Thr Trp Val Ala Thr Arg Ile Cys Gln Gly Glu Glu Gln Arg 245 250 255 Phe Thr Cys Tyr Met Glu His Ser Gly Asn His Ser Thr His Pro Val 260 265 270 Pro Ser <210> 3 <211> 274 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide MICA <400> 3 Glu Pro His Ser Leu Pro Tyr Asn Leu Thr Val Leu Ser Trp Asp Gly 1 5 10 15 Ser Val Gln Ser Gly Phe Leu Ala Glu Val His Leu Asp Gly Gln Pro 20 25 30 Phe Leu Arg Tyr Asp Arg Gln Lys Cys Arg Ala Lys Pro Gln Gly Gln 35 40 45 Trp Ala Glu Asp Val Leu Gly Asn Lys Thr Trp Asp Arg Glu Thr Arg 50 55 60 Asp Leu Thr Gly Asn Gly Lys Asp Leu Arg Met Thr Leu Ala His Ile 65 70 75 80 Lys Asp Gln Lys Glu Gly Leu His Ser Leu Gln Glu Ile Arg Val Cys 85 90 95 Glu Ile His Glu Asp Asn Ser Thr Arg Ser Ser Gln His Phe Tyr Tyr 100 105 110 Asp Gly Glu Leu Phe Leu Ser Gln Asn Leu Glu Thr Glu Glu Trp Thr 115 120 125 Met Pro Gln Ser Ser Arg Ala Gln Thr Leu Ala Met Asn Val Arg Asn 130 135 140 Phe Leu Lys Glu Asp Ala Met Lys Thr Lys Thr His Tyr His Ala Met 145 150 155 160 His Ala Asp Cys Leu Gln Glu Leu Arg Arg Tyr Leu Lys Ser Gly Val 165 170 175 Val Leu Arg Arg Thr Val Pro Pro Met Val Asn Val Thr Arg Ser Glu 180 185 190 Ala Ser Glu Gly Asn Ile Thr Val Thr Cys Arg Ala Ser Gly Phe Tyr 195 200 205 Pro Trp Asn Ile Thr Leu Ser Trp Arg Gln Asp Gly Val Ser Leu Ser 210 215 220 His Asp Thr Gln Gln Trp Gly Asp Val Leu Pro Asp Gly Asn Gly Thr 225 230 235 240 Tyr Gln Thr Trp Val Ala Thr Arg Ile Cys Gln Gly Glu Glu Gln Arg 245 250 255 Phe Thr Cys Tyr Met Glu His Ser Gly Asn His Ser Thr His Pro Val 260 265 270 Pro Ser <210> 4 <211> 274 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide MICA <400> 4 Glu Pro His Ser Leu Arg Tyr Asn Leu Thr Val Leu Ser Trp Asp Gly 1 5 10 15 Ser Val Gln Ser Gly Phe Leu Ala Glu Val His Leu Asp Gly Gln Pro 20 25 30 Phe Leu Arg Tyr Asp Arg Gln Lys Cys Arg Ala Lys Pro Gln Gly Gln 35 40 45 Trp Ala Glu Asp Val Leu Gly Asn Lys Thr Trp Asp Arg Glu Thr Arg 50 55 60 Asp Leu Thr Gly Asn Gly Lys Asp Leu Arg Met Thr Leu Ala His Ile 65 70 75 80 Lys Asp Gln Lys Glu Gly Leu His Ser Leu Gln Glu Ile Arg Val Cys 85 90 95 Glu Ile His Glu Asp Asn Ser Thr Arg Ser Ser Gln His Phe Tyr Tyr 100 105 110 Asp Gly Glu Leu Phe Leu Ser Gln Asn Leu Glu Thr Glu Glu Trp Thr 115 120 125 Val Pro Gln Ser Ser Arg Ala Gln Thr Leu Ala Met Asn Val Arg Asn 130 135 140 Phe Leu Lys Glu Asp Ala Met Lys Thr Lys Thr His Tyr His Ala Met 145 150 155 160 His Ala Asp Cys Leu Gln Glu Leu Arg Arg Tyr Leu Glu Ser Gly Val 165 170 175 Val Leu Arg Arg Thr Val Pro Pro Met Val Asn Val Thr Arg Ser Glu 180 185 190 Ala Ser Glu Gly Asn Ile Thr Val Thr Cys Arg Ala Ser Ser Phe Tyr 195 200 205 Pro Arg Asn Ile Thr Leu Thr Trp Arg Gln Asp Gly Val Ser Leu Ser 210 215 220 His Asp Thr Gln Gln Trp Gly Asp Val Leu Pro Asp Gly Asn Gly Thr 225 230 235 240 Tyr Gln Thr Trp Val Ala Thr Arg Ile Cys Gln Gly Glu Glu Gln Arg 245 250 255 Phe Thr Cys Tyr Met Glu His Ser Gly Asn His Ser Thr His Pro Val 260 265 270 Pro Ser <210> 5 <211> 274 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide MICA <400> 5 Glu Pro His Ser Leu Arg Tyr Asn Leu Thr Val Leu Ser Trp Asp Gly 1 5 10 15 Ser Val Gln Ser Gly Phe Leu Thr Glu Val His Leu Asp Gly Gln Pro 20 25 30 Phe Leu Arg Cys Asp Arg Gln Lys Cys Arg Ala Lys Pro Gln Gly Gln 35 40 45 Trp Ala Glu Asp Val Leu Gly Asn Lys Thr Trp Asp Arg Glu Thr Arg 50 55 60 Asp Leu Thr Gly Asn Gly Lys Asp Leu Arg Met Thr Leu Ala His Ile 65 70 75 80 Lys Asp Gln Lys Glu Gly Leu His Ser Leu Gln Glu Ile Arg Val Cys 85 90 95 Glu Ile His Glu Asp Asn Ser Thr Arg Ser Ser Gln His Phe Tyr Tyr 100 105 110 Asp Gly Glu Leu Phe Leu Ser Gln Asn Leu Glu Thr Glu Glu Trp Thr 115 120 125 Met Pro Gln Ser Ser Arg Ala Gln Thr Leu Ala Met Asn Val Arg Asn 130 135 140 Phe Leu Lys Glu Asp Ala Met Lys Thr Lys Thr His Tyr His Ala Met 145 150 155 160 His Ala Asp Cys Leu Gln Glu Leu Arg Arg Tyr Leu Lys Ser Gly Val 165 170 175 Val Leu Arg Arg Thr Val Pro Pro Met Val Asn Val Thr Arg Ser Glu 180 185 190 Ala Ser Glu Gly Asn Ile Thr Val Thr Cys Arg Ala Ser Gly Phe Tyr 195 200 205 Pro Trp Asn Ile Thr Leu Ser Trp Arg Gln Asp Gly Val Ser Leu Ser 210 215 220 His Asp Thr Gln Gln Trp Gly Asp Val Leu Pro Asp Gly Asn Gly Thr 225 230 235 240 Tyr Gln Thr Trp Val Ala Thr Arg Ile Cys Gln Gly Glu Glu Gln Arg 245 250 255 Phe Thr Cys Tyr Met Glu His Ser Gly Asn His Ser Thr His Pro Val 260 265 270 Pro Ser <210> 6 <211> 274 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide MICA <400> 6 Glu Pro His Ser Leu Arg Tyr Asn Leu Thr Val Leu Ser Trp Asp Gly 1 5 10 15 Ser Val Gln Ser Gly Phe Leu Ala Glu Val His Leu Asp Gly Gln Pro 20 25 30 Phe Leu Arg Cys Asp Arg Gln Lys Cys Arg Ala Lys Pro Gln Gly Gln 35 40 45 Trp Ala Glu Asp Val Leu Gly Asn Lys Thr Trp Asp Arg Glu Thr Arg 50 55 60 Asp Leu Thr Gly Asn Gly Lys Asp Leu Arg Met Thr Leu Ala His Ile 65 70 75 80 Lys Asp Gln Lys Glu Gly Leu His Ser Leu Gln Glu Ile Arg Val Cys 85 90 95 Glu Ile His Glu Asp Asn Ser Thr Arg Ser Ser Gln His Phe Tyr Tyr 100 105 110 Asp Gly Glu Leu Phe Leu Ser Gln Asn Leu Glu Thr Glu Glu Trp Thr 115 120 125 Met Pro Gln Ser Ser Arg Ala Gln Thr Leu Ala Met Asn Val Arg Asn 130 135 140 Phe Leu Lys Glu Asp Ala Met Lys Thr Lys Thr His Tyr His Ala Met 145 150 155 160 His Ala Asp Cys Leu Gln Glu Leu Arg Arg Tyr Leu Lys Ser Gly Val 165 170 175 Val Leu Arg Arg Thr Val Pro Pro Met Val Asn Val Thr Arg Ser Glu 180 185 190 Ala Ser Glu Gly Asn Ile Thr Val Thr Cys Arg Ala Ser Gly Phe Tyr 195 200 205 Pro Trp Asn Ile Thr Leu Ser Trp Arg Gln Asp Gly Val Ser Leu Ser 210 215 220 His Asp Thr Gln Gln Trp Gly Asp Val Leu Pro Asp Gly Asn Gly Thr 225 230 235 240 Tyr Gln Thr Trp Val Ala Thr Arg Ile Cys Gln Gly Glu Glu Gln Arg 245 250 255 Phe Thr Cys Tyr Met Glu His Ser Gly Asn His Ser Thr His Pro Val 260 265 270 Pro Ser <210> 7 <211> 276 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide MICA <400> 7 Glu Pro His Ser Leu Arg Tyr Asn Leu Thr Val Leu Ser Trp Asp Gly 1 5 10 15 Ser Val Gln Ser Gly Phe Leu Thr Glu Val His Leu Asp Gly Gln Pro 20 25 30 Phe Leu Arg Cys Asp Arg Gln Lys Cys Arg Ala Lys Pro Gln Gly Gln 35 40 45 Trp Ala Glu Asp Val Leu Gly Asn Lys Thr Trp Asp Arg Glu Thr Arg 50 55 60 Asp Leu Thr Gly Asn Gly Lys Asp Leu Arg Met Thr Leu Ala His Ile 65 70 75 80 Lys Asp Gln Lys Glu Gly Leu His Ser Leu Gln Glu Ile Arg Val Cys 85 90 95 Glu Ile His Glu Asp Asn Ser Thr Arg Ser Ser Gln His Phe Tyr Tyr 100 105 110 Asp Gly Glu Leu Phe Leu Ser Gln Asn Leu Glu Thr Lys Glu Trp Thr 115 120 125 Met Pro Gln Ser Ser Arg Ala Gln Thr Leu Ala Met Asn Val Arg Asn 130 135 140 Phe Leu Lys Glu Asp Ala Met Lys Thr Lys Thr His Tyr His Ala Met 145 150 155 160 His Ala Asp Cys Leu Gln Glu Leu Arg Arg Tyr Leu Lys Ser Gly Val 165 170 175 Val Leu Arg Arg Thr Val Pro Pro Met Val Asn Val Thr Arg Ser Glu 180 185 190 Ala Ser Glu Gly Asn Ile Thr Val Thr Cys Arg Ala Ser Gly Phe Tyr 195 200 205 Pro Trp Asn Ile Thr Leu Ser Trp Arg Gln Asp Gly Val Ser Leu Ser 210 215 220 His Asp Thr Gln Gln Trp Gly Asp Val Leu Pro Asp Gly Asn Gly Thr 225 230 235 240 Tyr Gln Thr Trp Val Ala Thr Arg Ile Cys Gln Gly Glu Glu Gln Arg 245 250 255 Phe Thr Cys Tyr Met Glu His Ser Gly Asn His Ser Thr His Pro Val 2,60 265 270 Pro Ser Gly Lys 275 <210> 8 <211> 306 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide MICB <400> 8 Glu Pro His Ser Leu Arg Tyr Asn Leu Met Val Leu Ser Gln Asp Gly 1 5 10 15 Ser Val Gln Ser Gly Phe Leu Ala Glu Gly His Leu Asp Gly Gln Pro 20 25 30 Phe Leu Arg Tyr Asp Arg Gln Lys Arg Arg Ala Lys Pro Gln Gly Gln 35 40 45 Trp Ala Glu Asp Val Leu Gly Ala Lys Thr Trp Asp Thr Glu Thr Glu 50 55 60 Asp Leu Thr Glu Asn Gly Gln Asp Leu Arg Arg Thr Leu Thr His Ile 65 70 75 80 Lys Asp Gln Lys Gly Gly Leu His Ser Leu Gln Glu Ile Arg Val Cys 85 90 95 Glu Ile His Glu Asp Ser Ser Thr Arg Gly Ser Arg His Phe Tyr Tyr 100 105 110 Asp Gly Glu Leu Phe Leu Ser Gln Asn Leu Glu Thr Gln Glu Ser Thr 115 120 125 Val Pro Gln Ser Ser Arg Ala Gln Thr Leu Ala Met Asn Val Thr Asn 130 135 140 Phe Trp Lys Glu Asp Ala Met Lys Thr Lys Thr His Tyr Arg Ala Met 145 150 155 160 Gln Ala Asp Cys Leu Gln Lys Leu Gln Leu Pro Pro Met Val Asn Val 165 170 175 Ile Cys Ser Glu Val Ser Glu Gly Asn Ile Thr Val Thr Cys Arg Ala 180 185 190 Ser Ser Phe Tyr Pro Arg Asn Ile Thr Leu Thr Trp Arg Gln Asp Gly 195 200 205 Val Ser Leu Ser His Asn Thr Gln Gln Trp Gly Asp Val Leu Pro Asp 210 215 220 Gly Asn Gly Thr Tyr Gln Thr Trp Val Ala Thr Arg Ile Arg Gln Gly 225 230 235 240 Glu Glu Gln Arg Phe Thr Cys Tyr Met Glu His Ser Gly Asn His Gly 245 250 255 Thr His Pro Val Pro Ser Gly Lys Ala Leu Val Leu Gln Ser Gln Arg 260 265 270 Thr Asp Phe Pro Tyr Val Ser Ala Ala Met Pro Cys Phe Val Ile Ile 275 280 285 Ile Ile Leu Cys Val Pro Cys Cys Lys Lys Lys Thr Ser Ala Ala Glu 290 295 300 Gly Pro 305 <210> 9 <211> 318 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide MICB <400> 9 Glu Pro His Ser Leu Arg Tyr Asn Leu Met Val Leu Ser Gln Asp Gly 1 5 10 15 Ser Val Gln Ser Gly Phe Leu Ala Glu Gly His Leu Asp Gly Gln Pro 20 25 30 Phe Leu Arg Tyr Asp Arg Gln Lys Arg Arg Ala Lys Pro Gln Gly Gln 35 40 45 Trp Ala Glu Asp Val Leu Gly Ala Glu Thr Trp Asp Thr Glu Thr Glu 50 55 60 Asp Leu Thr Glu Asn Gly Gln Asp Leu Arg Arg Thr Leu Thr His Ile 65 70 75 80 Lys Asp Gln Lys Gly Gly Leu His Ser Leu Gln Glu Ile Arg Val Cys 85 90 95 Glu Met His Glu Asp Ser Ser Thr Arg Gly Ser Arg His Phe Tyr Tyr 100 105 110 Asn Gly Glu Leu Phe Leu Ser Gln Asn Leu Glu Thr Gln Glu Ser Thr 115 120 125 Val Pro Gln Ser Ser Arg Ala Gln Thr Leu Ala Met Asn Val Thr Asn 130 135 140 Phe Trp Lys Glu Asp Ala Met Lys Thr Lys Thr His Tyr Arg Ala Met 145 150 155 160 Gln Ala Asp Cys Leu Gln Lys Leu Gln Arg Tyr Leu Lys Ser Gly Val 165 170 175 Ala Ile Arg Arg Thr Val Pro Pro Met Val Asn Val Thr Cys Ser Glu 180 185 190 Val Ser Glu Gly Asn Ile Thr Val Thr Cys Arg Ala Ser Ser Phe Tyr 195 200 205 Pro Arg Asn Ile Thr Leu Thr Trp Arg Gln Asp Gly Val Ser Leu Ser 210 215 220 His Asn Thr Gln Gln Trp Gly Asp Val Leu Pro Asp Gly Asn Gly Thr 225 230 235 240 Tyr Gln Thr Trp Val Ala Thr Arg Ile Arg Gln Gly Glu Glu Gln Arg 245 250 255 Phe Thr Cys Tyr Met Glu His Ser Gly Asn His Gly Thr His Pro Val 260 265 270 Pro Ser Gly Lys Ala Leu Val Leu Gln Ser Gln Arg Thr Asp Phe Pro 275 280 285 Tyr Val Ser Ala Ala Met Pro Cys Phe Val Ile Ile Ile Ile Leu Cys 290 295 300 Val Pro Cys Cys Lys Lys Lys Thr Ser Ala Ala Glu Gly Pro 305 310 315 <210> 10 <211> 318 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide MICB <400> 10 Glu Pro His Ser Leu Arg Tyr Asn Leu Met Val Leu Ser Gln Asp Gly 1 5 10 15 Ser Val Gln Ser Gly Phe Leu Ala Glu Gly His Leu Asp Gly Gln Pro 20 25 30 Phe Leu Arg Tyr Asp Arg Gln Lys Arg Arg Ala Lys Pro Gln Gly Gln 35 40 45 Trp Ala Glu Asp Val Leu Gly Ala Lys Thr Trp Asp Thr Glu Thr Glu 50 55 60 Asp Leu Thr Glu Asn Gly Gln Asp Leu Arg Arg Thr Leu Thr His Ile 65 70 75 80 Lys Asp Gln Lys Gly Gly Leu His Ser Leu Gln Glu Ile Arg Val Cys 85 90 95 Glu Ile His Glu Asp Ser Ser Thr Arg Gly Ser Arg His Phe Tyr Tyr 100 105 110 Asp Gly Glu Leu Phe Leu Ser Gln Asn Leu Glu Thr Gln Glu Ser Thr 115 120 125 Val Pro Gln Ser Ser Arg Ala Gln Thr Leu Ala Met Asn Val Thr Asn 130 135 140 Phe Trp Lys Glu Asp Ala Met Lys Thr Lys Thr His Tyr Arg Ala Met 145 150 155 160 Gln Ala Asp Cys Leu Gln Lys Leu Gln Arg Tyr Leu Lys Ser Gly Val 165 170 175 Ala Ile Arg Arg Thr Val Pro Pro Met Val Asn Val Ile Cys Ser Glu 180 185 190 Val Ser Glu Gly Asn Ile Thr Val Thr Cys Arg Ala Ser Ser Phe Tyr 195 200 205 Pro Arg Asn Ile Thr Leu Thr Trp Arg Gln Asp Gly Val Ser Leu Ser 210 215 220 His Asn Thr Gln Gln Trp Gly Asp Val Leu Pro Asp Gly Asn Gly Thr 225 230 235 240 Tyr Gln Thr Trp Val Ala Thr Arg Ile Arg Gln Gly Glu Glu Gln Arg 245 250 255 Phe Thr Cys Tyr Met Glu His Ser Gly Asn His Gly Thr His Pro Val 260 265 270 Pro Ser Gly Lys Ala Leu Val Leu Gln Ser Gln Arg Thr Asp Phe Pro 275 280 285 Tyr Val Ser Ala Ala Met Pro Cys Phe Val Ile Ile Ile Ile Leu Cys 290 295 300 Val Pro Cys Cys Lys Lys Lys Thr Ser Ala Ala Glu Gly Pro 305 310 315 <210> 11 <211> 318 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide MICB <400> 11 Glu Pro His Ser Leu Arg Tyr Asn Leu Met Val Leu Ser Gln Asp Gly 1 5 10 15 Ser Val Gln Ser Gly Phe Leu Ala Glu Gly His Leu Asp Gly Gln Pro 20 25 30 Phe Leu Arg Tyr Asp Arg Gln Lys Arg Arg Ala Lys Pro Gln Gly Gln 35 40 45 Trp Ala Glu Asn Val Leu Gly Ala Lys Thr Trp Asp Thr Glu Thr Glu 50 55 60 Asp Leu Thr Glu Asn Gly Gln Asp Leu Arg Arg Thr Leu Thr His Ile 65 70 75 80 Lys Asp Gln Lys Gly Gly Leu His Ser Leu Gln Glu Ile Arg Val Cys 85 90 95 Glu Ile His Glu Asp Ser Ser Thr Arg Gly Ser Arg His Phe Tyr Tyr 100 105 110 Asp Gly Glu Leu Phe Leu Ser Gln Asn Leu Glu Thr Gln Glu Ser Thr 115 120 125 Val Pro Gln Ser Ser Arg Ala Gln Thr Leu Ala Met Asn Val Thr Asn 130 135 140 Phe Trp Lys Glu Asp Ala Met Lys Thr Lys Thr His Tyr Arg Ala Met 145 150 155 160 Gln Ala Asp Cys Leu Gln Lys Leu Gln Arg Tyr Leu Lys Ser Gly Val 165 170 175 Ala Ile Arg Arg Thr Val Pro Pro Met Val Asn Val Thr Cys Ser Glu 180 185 190 Val Ser Glu Gly Asn Ile Thr Val Thr Cys Arg Ala Ser Ser Phe Tyr 195 200 205 Pro Arg Asn Ile Thr Leu Thr Trp Arg Gln Asp Gly Val Ser Leu Ser 210 215 220 His Asn Thr Gln Gln Trp Gly Asp Val Leu Pro Asp Gly Asn Gly Thr 225 230 235 240 Tyr Gln Thr Trp Val Ala Thr Arg Ile Arg Gln Gly Glu Glu Gln Arg 245 250 255 Phe Thr Cys Tyr Met Glu His Ser Gly Asn His Gly Thr His Pro Val 260 265 270 Pro Ser Gly Lys Ala Leu Val Leu Gln Ser Gln Arg Thr Asp Phe Pro 275 280 285 Tyr Val Ser Ala Ala Met Pro Cys Phe Val Ile Ile Ile Ile Leu Cys 290 295 300 Val Pro Cys Cys Lys Lys Lys Thr Ser Ala Ala Glu Gly Pro 305 310 315 <210> 12 <211> 318 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide MICB <400> 12 Glu Pro His Ser Leu Arg Tyr Asn Leu Met Val Leu Ser Gln Asp Gly 1 5 10 15 Ser Val Gln Ser Gly Phe Leu Ala Glu Gly His Leu Asp Gly Gln Pro 20 25 30 Phe Leu Arg Tyr Asp Arg Gln Lys Arg Arg Ala Lys Pro Gln Gly Gln 35 40 45 Trp Ala Glu Asp Val Leu Gly Ala Glu Thr Trp Asp Thr Glu Thr Glu 50 55 60 Asp Leu Thr Glu Asn Gly Gln Asp Leu Arg Arg Thr Leu Thr His Ile 65 70 75 80 Lys Asp Gln Lys Gly Gly Leu His Ser Leu Gln Glu Ile Arg Val Cys 85 90 95 Glu Ile His Glu Asp Ser Ser Thr Arg Gly Ser Arg His Phe Tyr Tyr 100 105 110 Asn Gly Glu Leu Phe Leu Ser Gln Asn Leu Glu Thr Gln Glu Ser Thr 115 120 125 Val Pro Gln Ser Ser Arg Ala Gln Thr Leu Ala Met Asn Val Thr Asn 130 135 140 Phe Trp Lys Glu Asp Ala Met Lys Thr Lys Thr His Tyr Arg Ala Met 145 150 155 160 Gln Ala Asp Cys Leu Gln Lys Leu Gln Arg Tyr Leu Lys Ser Gly Val 165 170 175 Ala Ile Arg Arg Thr Val Pro Pro Met Val Asn Val Thr Cys Ser Glu 180 185 190 Val Ser Glu Gly Asn Ile Thr Val Thr Cys Arg Ala Ser Ser Phe Tyr 195 200 205 Pro Arg Asn Ile Thr Leu Thr Trp Arg Gln Asp Gly Val Ser Leu Ser 210 215 220 His Asn Thr Gln Gln Trp Gly Asp Val Leu Pro Asp Gly Asn Gly Thr 225 230 235 240 Tyr Gln Thr Trp Val Ala Thr Arg Ile Arg Gln Gly Glu Glu Gln Lys 245 250 255 Phe Thr Cys Tyr Met Glu His Ser Gly Asn His Gly Thr His Pro Val 260 265 270 Pro Ser Gly Lys Ala Leu Val Leu Gln Ser Gln Arg Thr Asp Phe Pro 275 280 285 Tyr Val Ser Ala Ala Met Pro Cys Phe Val Ile Ile Ile Ile Leu Cys 290 295 300 Val Pro Cys Cys Lys Lys Lys Thr Ser Ala Ala Glu Gly Pro 305 310 315 <210> 13 <211> 318 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide MICB <400> 13 Glu Pro His Ser Leu Arg Tyr Asn Leu Met Val Leu Ser Gln Asp Gly 1 5 10 15 Ser Val Gln Ser Gly Phe Leu Ala Glu Gly His Leu Asp Gly Gln Pro 20 25 30 Phe Leu Arg Tyr Asp Arg Gln Lys Arg Arg Ala Lys Pro Gln Gly Gln 35 40 45 Trp Ala Glu Asp Val Leu Gly Ala Glu Thr Trp Asp Thr Glu Thr Glu 50 55 60 Asp Leu Thr Glu Asn Gly Gln Asp Leu Arg Arg Thr Leu Thr His Ile 65 70 75 80 Lys Asp Gln Lys Gly Gly Leu His Ser Leu Gln Glu Ile Arg Val Cys 85 90 95 Glu Ile His Glu Asp Ser Ser Thr Arg Gly Ser Arg His Phe Tyr Tyr 100 105 110 Asn Gly Glu Leu Phe Leu Ser Gln Asn Leu Glu Thr Gln Glu Ser Thr 115 120 125 Val Pro Gln Ser Ser Arg Ala Gln Thr Leu Ala Met Asn Val Thr Asn 130 135 140 Phe Trp Lys Glu Asp Ala Met Lys Thr Lys Thr His Tyr Arg Ala Met 145 150 155 160 Gln Ala Asp Cys Leu Gln Lys Leu Gln Arg Tyr Leu Lys Ser Gly Val 165 170 175 Ala Ile Arg Arg Thr Val Pro Pro Met Val Asn Val Thr Cys Ser Glu 180 185 190 Val Ser Glu Gly Asn Ile Thr Val Thr Cys Arg Ala Ser Ser Phe Tyr 195 200 205 Pro Arg Asn Ile Thr Leu Thr Trp Arg Gln Asp Gly Val Ser Leu Ser 210 215 220 His Asn Thr Gln Gln Trp Gly Asp Val Leu Pro Asp Gly Asn Gly Thr 225 230 235 240 Tyr Gln Thr Trp Val Ala Thr Arg Ile Arg Gln Gly Glu Glu Gln Arg 245 250 255 [[ID=l6]]Phe Thr Cys Tyr Met Glu His Ser Gly Asn His Gly Thr His Pro Val 260 265 270 Pro Ser Gly Lys Ala Leu Val Leu Gln Ser Gln Arg Thr Asp Phe Pro 275 280 285 Tyr Val Ser Ala Ala Met Pro Cys Phe Val Ile Ile Ile Ile Leu Cys 290 295 300 Val Pro Cys Cys Lys Lys Lys Thr Ser Ala Ala Glu Gly Pro 305 310 315 <210> 14 <211> 244 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide ULBP-1 (ACCESSION NO Q9BZM6) <400> 14 Met Ala Ala Ala Ala Ser Pro Ala Phe Leu Leu Cys Leu Pro Leu Leu 1 5 10 15 His Leu Leu Ser Gly Trp Ser Arg Ala Gly Trp Val Asp Thr His Cys 20 25 30 Leu Cys Tyr Asp Phe Ile Ile Thr Pro Lys Ser Arg Pro Glu Pro Gln 35 40 45 Trp Cys Glu Val Gln Gly Leu Val Asp Glu Arg Pro Phe Leu His Tyr 50 55 60 Asp Cys Val Asn His Lys Ala Lys Ala Phe Ala Ser Leu Gly Lys Lys 65 70 75 80 Val Asn Val Thr Lys Thr Trp Glu Glu Gln Thr Glu Thr Leu Arg Asp 85 90 95 Val Val Asp Phe Leu Lys Gly Gln Leu Leu Asp Ile Gln Val Glu Asn 100 105 110 Leu Ile Pro Ile Glu Pro Leu Thr Leu Gln Ala Arg Met Ser Cys Glu 115 120 125 His Glu Ala His Gly His Gly Arg Gly Ser Trp Gln Phe Leu Phe Asn 130 135 140 Gly Gln Lys Phe Leu Leu Phe Asp Ser Asn Asn Arg Lys Trp Thr Ala 145 150 155 160 Leu His Pro Gly Ala Lys Lys Met Thr Glu Lys Trp Glu Lys Asn Arg 165 170 175 Asp Val Thr Met Phe Phe Gln Lys Ile Ser Leu Gly Asp Cys Lys Met 180 185 190 Trp Leu Glu Glu Phe Leu Met Tyr Trp Glu Gln Met Leu Asp Pro Thr 195 200 205 Lys Pro Pro Ser Leu Ala Pro Gly Thr Thr Gln Pro Lys Ala Met Ala 210 215 220 Thr Thr Leu Ser Pro Trp Ser Leu Leu Ile Ile Phe Leu Cys Phe Ile 225 230 235 240 Leu Ala Gly Arg <210> 15 <211> 246 <212> PRT <213> Artificial Sequence <220> <223> Synthesis of ULBP-2 (ACCESSION NO Q9BZM5) <400> 15 Met Ala Ala Ala Ala Ala Thr Lys Ile Leu Leu Cys Leu Pro Leu Leu 1 5 10 15 Leu Leu Leu Ser Gly Trp Ser Arg Ala Gly Arg Ala Asp Pro His Ser 20 25 30 Leu Cys Tyr Asp Ile Thr Val Ile Pro Lys Phe Arg Pro Gly Pro Arg 35 40 45 Trp Cys Ala Val Gln Gly Gln Val Asp Glu Lys Thr Phe Leu His Tyr 50 55 60 Asp Cys Gly Asn Lys Thr Val Thr Pro Val Ser Pro Leu Gly Lys Lys 65 70 75 80 Leu Asn Val Thr Thr Ala Trp Lys Ala Gln Asn Pro Val Leu Arg Glu 85 90 95 Val Val Asp Ile Leu Thr Glu Gln Leu Arg Asp Ile Gln Leu Glu Asn 100 105 110 Tyr Thr Pro Lys Glu Pro Leu Thr Leu Gln Ala Arg Met Ser Cys Glu 115 120 125 Gln Lys Ala Glu Gly His Ser Ser Gly Ser Trp Gln Phe Ser Phe Asp 130 135 140 Gly Gln Ile Phe Leu Leu Phe Asp Ser Glu Lys Arg Met Trp Thr Thr 145 150 155 160 Val His Pro Gly Ala Arg Lys Met Lys Glu Lys Trp Glu Asn Asp Lys 165 170 175 Val Val Ala Met Ser Phe His Tyr Phe Ser Met Gly Asp Cys Ile Gly 180 185 190 Trp Leu Glu Asp Phe Leu Met Gly Met Asp Ser Thr Leu Glu Pro Ser 195 200 205 Ala Gly Ala Pro Leu Ala Met Ser Ser Gly Thr Thr Gln Leu Arg Ala 210 215 220 Thr Ala Thr Thr Leu Ile Leu Cys Cys Leu Leu Ile Ile Leu Pro Cys 225 230 235 240 Phe Ile Leu Pro Gly Ile 245 <210> 16 <211> 244 <212> PRT <213> Artificial Sequence <220> <223> ULBP-3 synthesis (ACCESSION NO NP_078794) <400> 16 Met Ala Ala Ala Ala Ser Pro Ala Ile Leu Pro Arg Leu Ala Ile Leu 1 5 10 15 Pro Tyr Leu Leu Phe Asp Trp Ser Gly Thr Gly Arg Ala Asp Ala His 20 25 30 Ser Leu Trp Tyr Asn Phe Thr Ile Ile His Leu Pro Arg His Gly Gln 35 40 45 Gln Trp Cys Glu Val Gln Ser Gln Val Asp Gln Lys Asn Phe Leu Ser 50 55 60 Tyr Asp Cys Gly Ser Asp Lys Val Leu Ser Met Gly His Leu Glu Glu 65 70 75 80 Gln Leu Tyr Ala Thr Asp Ala Trp Gly Lys Gln Leu Glu Met Leu Arg 85 90 95 Glu Val Gly Gln Arg Leu Arg Leu Glu Leu Ala Asp Thr Glu Leu Glu 100 105 110 Asp Phe Thr Pro Ser Gly Pro Leu Thr Leu Gln Val Arg Met Ser Cys 115 120 125 Glu Cys Glu Ala Asp Gly Tyr Ile Arg Gly Ser Trp Gln Phe Ser Phe 130 135 140 Asp Gly Arg Lys Phe Leu Leu Phe Asp Ser Asn Asn Arg Lys Trp Thr 145 150 155 160 Val Val His Ala Gly Ala Arg Arg Met Lys Glu Lys Trp Glu Lys Asp 165 170 175 Ser Gly Leu Thr Thr Phe Phe Lys Met Val Ser Met Arg Asp Cys Lys 180 185 190 Ser Trp Leu Arg Asp Phe Leu Met His Arg Lys Lys Arg Leu Glu Pro 195 200 205 Thr Ala Pro Pro Thr Met Ala Pro Gly Leu Ala Gln Pro Lys Ala Ile 210 215 220 Ala Thr Thr Leu Ser Pro Trp Ser Phe Leu Ile Ile Leu Cys Phe Ile 225 230 235 240 Leu Pro Gly Ile <210> 17 <211> 263 <212> PRT <213> Artificial Sequence <220> <223> Synthesis ULBP-4 / RAET1E (ACCESSION NO Q8TD07) <400> 17 Met Arg Arg Ile Ser Leu Thr Ser Ser Pro Val Arg Leu Leu Leu Phe 1 5 10 15 Leu Leu Leu Leu Leu Ile Ala Leu Glu Ile Met Val Gly Gly His Ser 20 25 30 Leu Cys Phe Asn Phe Thr Ile Lys Ser Leu Ser Arg Pro Gly Gln Pro 35 40 45 Trp Cys Glu Ala Gln Val Phe Leu Asn Lys Asn Leu Phe Leu Gln Tyr 50 55 60 Asn Ser Asp Asn Asn Met Val Lys Pro Leu Gly Leu Leu Gly Lys Lys 65 70 75 80 Val Tyr Ala Thr Ser Thr Trp Gly Glu Leu Thr Gln Thr Leu Gly Glu 85 90 95 Val Gly Arg Asp Leu Arg Met Leu Leu Cys Asp Ile Lys Pro Gln Ile 100 105 110 Lys Thr Ser Asp Pro Ser Thr Leu Gln Val Glu Met Phe Cys Gln Arg 115 120 125 Glu Ala Glu Arg Cys Thr Gly Ala Ser Trp Gln Phe Ala Thr Asn Gly 130 135 140 Glu Lys Ser Leu Leu Phe Asp Ala Met Asn Met Thr Trp Thr Val Ile 145 150 155 160 Asn His Glu Ala Ser Lys Ile Lys Glu Thr Trp Lys Lys Asp Arg Gly 165 170 175 Leu Glu Lys Tyr Phe Arg Lys Leu Ser Lys Gly Asp Cys Asp His Trp 180 185 190 Leu Arg Glu Phe Leu Gly His Trp Glu Ala Met Pro Glu Pro Thr Val 195 200 205 Ser Pro Val Asn Ala Ser Asp Ile His Trp Ser Ser Ser Ser Leu Pro 210 215 220 Asp Arg Trp Ile Ile Leu Gly Ala Phe Ile Leu Leu Val Leu Met Gly 225 230 235 240 Ile Val Leu Ile Cys Val Trp Trp Gln Asn Gly Glu Trp Gln Ala Gly<000…​​​​​​​​​​​​​ <220> <223> Synthetic peptide ULBP-5 (ACCESSION NO Q6H3X3) <400> 18 Met Ala Ala Ala Ala Ser Pro Ala Phe Leu Leu Arg Leu Pro Leu Leu 1 5 10 15 Leu Leu Leu Ser Ser Trp Cys Arg Thr Gly Leu Ala Asp Pro His Ser 20 25 30 Leu Cys Tyr Asp Ile Thr Val Pro Lys Phe Arg Pro Gly Pro Arg Trp 35 40 45 Cys Ala Val Gln Gly Gln Val Asp Glu Lys Thr Phe Leu His Tyr Asp 50 55 60 Cys Gly Ser Lys Thr Val Thr Pro Val Ser Pro Leu Gly Lys Lys Leu 65 70 75 80 Asn Val Thr Thr Ala Trp Lys Ala Gln Asn Pro Val Leu Arg Glu Val 85 90 95 Val Asp Leu Thr Glu Gln Leu Leu Asp Ile Gln Leu Glu Asn Tyr Ile 100 105 110 Pro Lys Glu Pro Leu Thr Leu Gln Ala Arg Met Ser Cys Glu Gln Lys 115 120 125 Ala Glu Gly His Gly Ser Gly Ser Trp Gln Leu Ser Phe Asp Gly Gln 130 135 140 Ile Phe Leu Leu Phe Asp Ser Glu Asn Arg Met Trp Thr Thr Val His 145 150 155 160 Pro Gly Ala Arg Lys Met Lys Glu Lys Trp Glu Asn Asp Lys Asp Met 165 170 175 Thr Met Ser Phe His Tyr Ile Ser Met Gly Asp Cys Thr Gly Trp Leu 180 185 190 Glu Asp Phe Leu Met Gly Met Asp Ser Thr Leu Glu Pro Ser Ala Gly 195 200 205 Ala Pro Pro Thr Met Ser Ser Gly Thr Ala Gln Pro Arg Ala Thr Ala 210 215 220 Thr Thr Leu Ile Leu Cys Cys Leu Leu Ile Met Cys Leu Leu Ile Cys 225 230 235 240 Ser Arg His Ser Leu Thr Gln Ser His Gly His His Pro Gln Ser Leu 245 250 255 Gln Pro Pro Pro His Pro Pro Leu Leu His Pro Thr Trp Leu Leu Arg 260 265 270 Arg Val Leu Trp Ser Asp Ser Tyr Gln Ile Ala Lys Arg Pro Leu Ser 275 280 285 Gly Gly His Val Thr Arg Val Thr Leu Pro Ile Ile Gly Asp Asp Ser 290 295 300 His Ser Leu Pro Cys Pro Leu Ala Leu Tyr Thr Ile Asn Asn Gly Ala 305 310 315 320 Ala Arg Tyr Ser Glu Pro Leu Gln Val Ser Ile Ser 325 330 <210> 19 <211> 246 <212> PRT <213> Artificial Sequence <220> <223> Synthesis of ULBP-6 (ACCESSION NO NP_570970) <400> 19 Met Ala Ala Ala Ala Ile Pro Ala Leu Leu Leu Cys Leu Pro Leu Leu 1 5 10 15 Phe Leu Leu Phe Gly Trp Ser Arg Ala Arg Arg Asp Asp Pro His Ser 20 25 30 Leu Cys Tyr Asp Ile Thr Val Ile Pro Lys Phe Arg Pro Gly Pro Arg 35 40 45 Trp Cys Ala Val Gln Gly Gln Val Asp Glu Lys Thr Phe Leu His Tyr 50 55 60 Asp Cys Gly Asn Lys Thr Val Thr Pro Val Ser Pro Leu Gly Lys Lys 65 70 75 80 Leu Asn Val Thr Met Ala Trp Lys Ala Gln Asn Pro Val Leu Arg Glu 85 90 95 Val Val Asp Ile Leu Thr Glu Gln Leu Leu Asp Ile Gln Leu Glu Asn 100 105 110 Tyr Thr Pro Lys Glu Pro Leu Thr Leu Gln Ala Arg Met Ser Cys Glu 115 120 125 Gln Lys Ala Glu Gly His Ser Ser Gly Ser Trp Gln Phe Ser Ile Asp 130 135 140 Gly Gln Thr Phe Leu Leu Phe Asp Ser Glu Lys Arg Met Trp Thr Thr 145 150 155 160 Val His Pro Gly Ala Arg Lys Met Lys Glu Lys Trp Glu Asn Asp Lys 165 170 175 Asp Val Ala Met Ser Phe His Tyr Ile Ser Met Gly Asp Cys Ile Gly 180 185 190 Trp Leu Glu Asp Phe Leu Met Gly Met Asp Ser Thr Leu Glu Pro Ser 195 200 205 Ala Gly Ala Pro Leu Ala Met Ser Ser Gly Thr Thr Gln Leu Arg Ala 210 215 220 Thr Ala Thr Thr Leu Ile Leu Cys Cys Leu Leu Ile Ile Leu Pro Cys 225 230 235 240 Phe Ile Leu Pro Gly Ile 245 <210> 20 <211> 558 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide MICA-WED <400> 20 Glu Pro His Ser Leu Arg Tyr Asn Leu Thr Val Leu Ser Trp Asp Gly 1 5 10 15 Ser Val Gln Ser Gly Phe Leu Thr Glu Val His Leu Asp Gly Gln Pro 20 25 30 Phe Leu Arg Cys Asp Arg Gln Lys Cys Arg Ala Lys Pro Gln Gly Gln 35 40 45 Trp Ala Glu Asp Val Leu Gly Asn Lys Thr Trp Asp Arg Glu Thr Arg 50 55 60 Asp Leu Thr Gly Trp Gly Lys Asp Leu Arg Met Thr Leu Ala His Ile 65 70 75 80 Lys Asp Gln Lys Glu Gly Leu His Ser Leu Gln Glu Ile Arg Val Cys 85 90 95 Glu Ile His Glu Asp Asn Ser Thr Arg Ser Ser Gln His Phe Tyr Tyr 100 105 110 Asp Gly Glu Leu Phe Leu Ser Gln Asn Leu Glu Thr Lys Glu Trp Thr 115 120 125 Met Pro Gln Ser Ser Arg Ala Gln Thr Leu Ala Met Asn Val Arg Asn 130 135 140 Phe Leu Lys Glu Asp Ala Met Glu Thr Asp Thr His Tyr His Ala Met 145 150 155 160 His Ala Asp Cys Leu Gln Glu Leu Arg Arg Tyr Leu Lys Ser Gly Val 165 170 175 Val Leu Arg Arg Thr Val Pro Pro Met Val Gln Val Thr Arg Ser Glu 180 185 190 Ala Ser Gly Gly Ser Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser 195 200 205 Gln Asp Val Ser Thr Ala Val Ala Trp Tyr Gln Gln Lys Pro Gly Lys 210 215 220 Ala Pro Lys Leu Leu Ile Tyr Ser Ala Ser Phe Leu Tyr Ser Gly Val 225 230 235 240 Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr 245 250 255 Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln 260 265 270 Ser Tyr Thr Thr Pro Pro Thr Phe Gly Gln Gly Thr Lys Val Glu Ile 275 280 285 Lys Gly Gly Ser Ser Arg Ser Ser Ser Ser Gly Gly Gly Gly Ser Gly 290 295 300 Gly Gly Gly Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln 305 310 315 320 Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe 325 330 335 Thr Ser Thr Gly Ile Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 340 345 350 Glu Trp Val Gly Arg Ile Tyr Pro Thr Asn Gly Ser Thr Asn Tyr Ala 355 360 365 Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Ala Asp Thr Ser Lys Asn 370 375 380 Thr Ala Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val 385 390 395 400 Tyr Tyr Cys Ala Arg Thr Tyr Gly Ile Tyr Asp Leu Tyr Val Asp Tyr 405 410 415 Thr Glu Tyr Val Met Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val 420 425 430 Ser Ser Gly Gly Ser Ser Arg Ser Ser Ser Ser Gly Gly Gly Gly Ser 435 440 445 Gly Gly Gly Gly Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser 450 455 460 Ala Ser Gly Gly Ser Gly Gln Ile Thr Val Thr Cys Arg Ala Ser Gly 465 470 475 480 Phe Tyr Pro Trp Asn Ile Thr Leu Ser Trp Arg Gln Asp Gly Val Ser 485 490 495 Leu Ser His Asp Thr Gln Gln Trp Gly Asp Val Leu Pro Asp Gly Gln 500 505 510 Gly Thr Tyr Gln Thr Trp Val Ala Thr Arg Ile Ser Gln Gly Glu Glu 515 520 525 [[ID= 19]] Gln Arg Phe Thr Cys Tyr Met Glu His Ser Gly Gln His Ser Thr His 530 535 540 Pro Val Pro Ser Gly Lys Gly Ser His His His His His His 545 550 555 <210> 21 <211> 507 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide, encoding α1-α2 variant 15 <400> 21 gctgctgagc cacacagtct ccgctacaac cttacggtgt tgagctggga cggctctgtc 60 cagagtggct ttctgactga ggtacatctc gatggtcagc ccttcctccg atgcgacaga 120 caaaagtgca gggccaagcc acagggccaa tgggccgaag atgtacttgg caataagact 180 tgggacagag aaaccagaga tctgactggc tggggtaagg acttacgcat gactctcgca 240 cacattaaag accagaagga aggtcttcat tcgctccagg aaattagagt ctgtgaaatc 300 catgaagaca acagcacaag aagttcccaa catttctact acgacggcga gctgttctta 360 tcacagaatt tagagaccaa cgagtggaca atgccccaaa gctcgagggc ccagaccctc 420 gctatgaatg tgaggaattt ccttaaggag gacgctatgg aaactgacac ccactaccat 480 gcgatgcgcg ccgattgcct gcaggaa 507 <210> 22 <211> 507 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide, encoding α1-α2 variant 16 <400> 22 gctgctgagc cacacagtct ccgctacaac cttacggtgt tgagctggga cggctctgtc 60 cagagtggct ttctgactga ggtacatctc gatggtcagc ccttcctccg atgcgacaga 120 caaaagtgca gggccaagcc acagggccaa tgggccgaag atgtacttgg caataagact 180 tgggacagag aaaccagaga tctgactggc tggggtaagg acttacgcat gactctcgca 240 cacattaaag accagaagga aggtcttcat tcgctccagg aaattagagt ctgtgaaatc 300 catgaagaca acagcacaag aagttcccaa catttctact acgacggcga gctgttctta 360 tcacagaatt tagagaccct cgagtggaca atgccccaaa gctcgagggc ccagaccctc 420 gctatgaatg tgaggaattt ccttaaggag gacgctatgg aaactgacac ccactaccat 480 gcgatgcgcg ccgattgcct gcaggaa 507 <210> 23 <211> 507 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide, encoding α1-α2 variant 17 <400> 23 gctgctgagc cacacagtct ccgctacaac cttacggtgt tgagctggga cggctctgtc 60 cagagtggct ttctgactga ggtacatctc gatggtcagc ccttcctccg atgcgacaga 120 caaaagtgca gggccaagcc acagggccaa tgggccgaag atgtacttgg caataagact 180 tgggacagag aaaccagaga tctgactctc tggggtaagg acttacgcat gactctcgca 240 cacattaaag accagaagga aggtcttcat tcgctccagg aaattagagt ctgtgaaatc 300 catgaagaca acagcacaag aagttcccaa catttctact acgacggcga gctgttctta 360 tcacagaatt tagagaccct cgagtggaca atgccccaaa gctcgagggc ccagaccctc 420 gctatgaatg tgaggaattt ccttaaggag gacgctatgg aaactgacac ccactaccat 480 gcgatgcgcg ccgattgcct gcaggaa 507 <210> 24 <211> 507 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide, encoding α1-α2 variant 18 <400> 24 gctgctgagc cacacagtct ccgctacaac cttacggtgt tgagctggga cggctctgtc 60 cagcccggct ttctgactga ggtacatctc gatggtcagc ccttcctccg atgcgacaga 120 caaaagtgca gggccaagcc acagggccaa tgggccgaag atgtacttgg caataagact 180 tgggacagag aaaccagaga tctgactctc tggggtaagg acttacgcat gactctcgca 240 cacattaaag accagaagga aggtcttcat tcgctccagg aaattagagt ctgtgaaatc 300 catgaagaca acagcacaag aagttcccaa catttctact acgacggcga gctgttctta 360 tcacagaatt tagagaccct cgagtggaca atgccccaaa gctcgagggc ccagaccctc 420 gctatgaatg tgaggaattt ccttaaggag gacgctatgg aaactgacac ccactaccat 480 gcgatgcgcg ccgattgcct gcaggaa 507 <210> 25 <211> 558 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide MICA α1-α2 variant 15 <400> 25 Glu Pro His Ser Leu Arg Tyr Asn Leu Thr Val Leu Ser Trp Asp Gly 1 5 10 15 Ser Val Gln Ser Gly Phe Leu Thr Glu Val His Leu Asp Gly Gln Pro 20 25 30 Phe Leu Arg Cys Asp Arg Gln Lys Cys Arg Ala Lys Pro Gln Gly Gln 35 40 45 Trp Ala Glu Asp Val Leu Gly Asn Lys Thr Trp Asp Arg Glu Thr Arg 50 55 60 Asp Leu Thr Gly Trp Gly Lys Asp Leu Arg Met Thr Leu Ala His Ile 65 70 75 80 Lys Asp Gln Lys Glu Gly Leu His Ser Leu Gln Glu Ile Arg Val Cys 85 90 95 Glu Ile His Glu Asp Asn Ser Thr Arg Ser Ser Gln His Phe Tyr Tyr 100 105 110 Asp Gly Glu Leu Phe Leu Ser Gln Asn Leu Glu Thr Asn Glu Trp Thr 115 120 125 Met Pro Gln Ser Ser Arg Ala Gln Thr Leu Ala Met Asn Val Arg Asn 130 135 140 Phe Leu Lys Glu Asp Ala Met Glu Thr Asp Thr His Tyr His Ala Met 145 150 155 160 Arg Ala Asp Cys Leu Gln Glu Leu Arg Arg Tyr Leu Lys Ser Gly Val 165 170 175 Val Leu Arg Arg Thr Val Pro Pro Met Val Gln Val Thr Arg Ser Glu 180 185 190 Ala Ser Gly Gly Ser Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser 195 200 205 Gln Asp Val Ser Thr Ala Val Ala Trp Tyr Gln Gln Lys Pro Gly Lys 210 215 220 Ala Pro Lys Leu Leu Ile Tyr Ser Ala Ser Phe Leu Tyr Ser Gly Val 225 230 235 240 Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr 245 250 255 Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln 260 265 270 Ser Tyr Thr Thr Pro Pro Thr Phe Gly Gln Gly Thr Lys Val Glu Ile 275 280 285 Lys Gly Gly Ser Ser Arg Ser Ser Ser Ser Gly Gly Gly Gly Ser Gly 290 295 300 Gly Gly Gly Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln 305 310 315 320 Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe 325 330 335 Thr Ser Thr Gly Ile Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 340 345 350 Glu Trp Val Gly Arg Ile Tyr Pro Thr Asn Gly Ser Thr Asn Tyr Ala 355 360 365 Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Ala Asp Thr Ser Lys Asn 370 375 380 Thr Ala Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val 385 390 395 400 Tyr Tyr Cys Ala Arg Thr Tyr Gly Ile Tyr Asp Leu Tyr Val Asp Tyr 405 410 415 Thr Glu Tyr Val Met Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val 420 425 430 Ser Ser Gly Gly Ser Ser Arg Ser Ser Ser Ser Gly Gly Gly Gly Ser 435 440 445 Gly Gly Gly Gly Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser 450 455 460 Ala Ser Gly Gly Ser Gly Gln Ile Thr Val Thr Cys Arg Ala Ser Gly 465 470 475 480 Phe Tyr Pro Trp Asn Ile Thr Leu Ser Trp Arg Gln Asp Gly Val Ser 485 490 495 Leu Ser His Asp Thr Gln Gln Trp Gly Asp Val Leu Pro Asp Gly Gln 500 505 510 Gly Thr Tyr Gln Thr Trp Val Ala Thr Arg Ile Ser Gln Gly Glu Glu 515 520 525 Gln Arg Phe Thr Cys Tyr Met Glu His Ser Gly Gln His Ser Thr His 530 535 540 Pro Val Pro Ser Gly Lys Gly Ser His His His His His His 545 550 555 <210> 26 <211> 558 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide MICA α1-α2 variant 16 <400> 26 Glu Pro His Ser Leu Arg Tyr Asn Leu Thr Val Leu Ser Trp Asp Gly 1 5 10 15 Ser Val Gln Ser Gly Phe Leu Thr Glu Val His Leu Asp Gly Gln Pro 20 25 30 Phe Leu Arg Cys Asp Arg Gln Lys Cys Arg Ala Lys Pro Gln Gly Gln 35 40 45 Trp Ala Glu Asp Val Leu Gly Asn Lys Thr Trp Asp Arg Glu Thr Arg 50 55 60 Asp Leu Thr Gly Trp Gly Lys Asp Leu Arg Met Thr Leu Ala His Ile 65 70 75 80 Lys Asp Gln Lys Glu Gly Leu His Ser Leu Gln Glu Ile Arg Val Cys 85 90 95 Glu Ile His Glu Asp Asn Ser Thr Arg Ser Ser Gln His Phe Tyr Tyr 100 105 110 Asp Gly Glu Leu Phe Leu Ser Gln Asn Leu Glu Thr Leu Glu Trp Thr 115 120 125 Met Pro Gln Ser Ser Arg Ala Gln Thr Leu Ala Met Asn Val Arg Asn 130 135 140 Phe Leu Lys Glu Asp Ala Met Glu Thr Asp Thr His Tyr His Ala Met 145 150 155 160 Arg Ala Asp Cys Leu Gln Glu Leu Arg Arg Tyr Leu Lys Ser Gly Val 165 170 175 Val Leu Arg Arg Thr Val Pro Pro Met Val Gln Val Thr Arg Ser Glu 180 185 190 Ala Ser Gly Gly Ser Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser 195 200 205 Gln Asp Val Ser Thr Ala Val Ala Trp Tyr Gln Gln Lys Pro Gly Lys 210 215 220 Ala Pro Lys Leu Leu Ile Tyr Ser Ala Ser Phe Leu Tyr Ser Gly Val 225 230 235 240 Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr 245 250 255 Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln 260 265 270 Ser Tyr Thr Thr Pro Pro Thr Phe Gly Gln Gly Thr Lys Val Glu Ile 275 280 285 Lys Gly Gly Ser Ser Arg Ser Ser Ser Ser Gly Gly Gly Gly Ser Gly 290 295 300 Gly Gly Gly Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln 305 310 315 320 Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe 325 330 335 Thr Ser Thr Gly Ile Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 340 345 350 Glu Trp Val Gly Arg Ile Tyr Pro Thr Asn Gly Ser Thr Asn Tyr Ala 355 360 365 Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Ala Asp Thr Ser Lys Asn 370 375 380 Thr Ala Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val 385 390 395 400 Tyr Tyr Cys Ala Arg Thr Tyr Gly Ile Tyr Asp Leu Tyr Val Asp Tyr 405 410 415 Thr Glu Tyr Val Met Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val 420 425 430 Ser Ser Gly Gly Ser Ser Arg Ser Ser Ser Ser Gly Gly Gly Gly Ser 435 440 445 Gly Gly Gly Gly Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser 450 455 460 Ala Ser Gly Gly Ser Gly Gln Ile Thr Val Thr Cys Arg Ala Ser Gly 465 470 475 480 Phe Tyr Pro Trp Asn Ile Thr Leu Ser Trp Arg Gln Asp Gly Val Ser 485 490 495 Leu Ser His Asp Thr Gln Gln Trp Gly Asp Val Leu Pro Asp Gly Gln 500 505 510 Gly Thr Tyr Gln Thr Trp Val Ala Thr Arg Ile Ser Gln Gly Glu Glu 515 520 525 Gln Arg Phe Thr Cys Tyr Met Glu His Ser Gly Gln His Ser Thr His 530 535 540 Pro Val Pro Ser Gly Lys Gly Ser His His His His His His 545 550 555 <210> 27 <211> 558 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide MICA α1-α2 variant 17 <400> 27 Glu Pro His Ser Leu Arg Tyr Asn Leu Thr Val Leu Ser Trp Asp Gly 1 5 10 15 Ser Val Gln Ser Gly Phe Leu Thr Glu Val His Leu Asp Gly Gln Pro 20 25 30 Phe Leu Arg Cys Asp Arg Gln Lys Cys Arg Ala Lys Pro Gln Gly Gln 35 40 45 Trp Ala Glu Asp Val Leu Gly Asn Lys Thr Trp Asp Arg Glu Thr Arg 50 55 60 Asp Leu Thr Leu Trp Gly Lys Asp Leu Arg Met Thr Leu Ala His Ile 65 70 75 80 Lys Asp Gln Lys Glu Gly Leu His Ser Leu Gln Glu Ile Arg Val Cys 85 90 95 Glu Ile His Glu Asp Asn Ser Thr Arg Ser Ser Gln His Phe Tyr Tyr 100 105 110 Asp Gly Glu Leu Phe Leu Ser Gln Asn Leu Glu Thr Leu Glu Trp Thr 115 120 125 Met Pro Gln Ser Ser Arg Ala Gln Thr Leu Ala Met Asn Val Arg Asn 130 135 140 Phe Leu Lys Glu Asp Ala Met Glu Thr Asp Thr His Tyr His Ala Met 145 150 155 160 Arg Ala Asp Cys Leu Gln Glu Leu Arg Arg Tyr Leu Lys Ser Gly Val 165 170 175 Val Leu Arg Arg Thr Val Pro Pro Met Val Gln Val Thr Arg Ser Glu 180 185 190 Ala Ser Gly Gly Ser Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser 195 200 205 Gln Asp Val Ser Thr Ala Val Ala Trp Tyr Gln Gln Lys Pro Gly Lys 210 215 220 Ala Pro Lys Leu Leu Ile Tyr Ser Ala Ser Phe Leu Tyr Ser Gly Val 225 230 235 240 Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr 245 250 255 Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln 260 265 270 Ser Tyr Thr Thr Pro Pro Thr Phe Gly Gln Gly Thr Lys Val Glu Ile 275 280 285 Lys Gly Gly Ser Ser Arg Ser Ser Ser Ser Gly Gly Gly Gly Ser Gly 290 295 300 Gly Gly Gly Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln 305 310 315 320 Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe 325 330 335 Thr Ser Thr Gly Ile Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 340 345 350 Glu Trp Val Gly Arg Ile Tyr Pro Thr Asn Gly Ser Thr Asn Tyr Ala 355 360 365 Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Ala Asp Thr Ser Lys Asn 370 375 380 Thr Ala Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val 385 390 395 400 Tyr Tyr Cys Ala Arg Thr Tyr Gly Ile Tyr Asp Leu Tyr Val Asp Tyr 405 410 415 Thr Glu Tyr Val Met Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val 420 425 430 Ser Ser Gly Gly Ser Ser Arg Ser Ser Ser Ser Gly Gly Gly Gly Ser 435 440 445 Gly Gly Gly Gly Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser 450 455 460 Ala Ser Gly Gly Ser Gly Gln Ile Thr Val Thr Cys Arg Ala Ser Gly 465 470 475 480 Phe Tyr Pro Trp Asn Ile Thr Leu Ser Trp Arg Gln Asp Gly Val Ser 485 490 495 Leu Ser His Asp Thr Gln Gln Trp Gly Asp Val Leu Pro Asp Gly Gln 500 505 510 Gly Thr Tyr Gln Thr Trp Val Ala Thr Arg Ile Ser Gln Gly Glu Glu 515 520 525 Gln Arg Phe Thr Cys Tyr Met Glu His Ser Gly Gln His Ser Thr His 530 535 540 Pro Val Pro Ser Gly Lys Gly Ser His His His His His His 545 550 555 <210> 28 <211> 558 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide MICA α1-α2 variant 18 <400> 28 Glu Pro His Ser Leu Arg Tyr Asn Leu Thr Val Leu Ser Trp Asp Gly 1 5 10 15 Ser Val Gln Pro Gly Phe Leu Thr Glu Val His Leu Asp Gly Gln Pro 20 25 30 Phe Leu Arg Cys Asp Arg Gln Lys Cys Arg Ala Lys Pro Gln Gly Gln 35 40 45 Trp Ala Glu Asp Val Leu Gly Asn Lys Thr Trp Asp Arg Glu Thr Arg 50 55 60 Asp Leu Thr Leu Trp Gly Lys Asp Leu Arg Met Thr Leu Ala His Ile 65 70 75 80 Lys Asp Gln Lys Glu Gly Leu His Ser Leu Gln Glu Ile Arg Val Cys 85 90 95 Glu Ile His Glu Asp Asn Ser Thr Arg Ser Ser Gln His Phe Tyr Tyr 100 105 110 Asp Gly Glu Leu Phe Leu Ser Gln Asn Leu Glu Thr Leu Glu Trp Thr 115 120 125 Met Pro Gln Ser Ser Arg Ala Gln Thr Leu Ala Met Asn Val Arg Asn 130 135 140 Phe Leu Lys Glu Asp Ala Met Glu Thr Asp Thr His Tyr His Ala Met 145 150 155 160 Arg Ala Asp Cys Leu Gln Glu Leu Arg Arg Tyr Leu Lys Ser Gly Val 165 170 175 Val Leu Arg Arg Thr Val Pro Pro Met Val Gln Val Thr Arg Ser Glu 180 185 190 Ala Ser Gly Gly Ser Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser 195 200 205 Gln Asp Val Ser Thr Ala Val Ala Trp Tyr Gln Gln Lys Pro Gly Lys 210 215 220 Ala Pro Lys Leu Leu Ile Tyr Ser Ala Ser Phe Leu Tyr Ser Gly Val 225 230 235 240 Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr 245 250 255 Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln 260 265 270 Ser Tyr Thr Thr Pro Pro Thr Phe Gly Gln Gly Thr Lys Val Glu Ile 275 280 285 Lys Gly Gly Ser Ser Arg Ser Ser Ser Ser Gly Gly Gly Gly Ser Gly 290 295 300 Gly Gly Gly Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln 305 310 315 320 Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe 325 330 335 Thr Ser Thr Gly Ile Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 340 345 350 Glu Trp Val Gly Arg Ile Tyr Pro Thr Asn Gly Ser Thr Asn Tyr Ala 355 360 365 Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Ala Asp Thr Ser Lys Asn 370 375 380 Thr Ala Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val 385 390 395 400 Tyr Tyr Cys Ala Arg Thr Tyr Gly Ile Tyr Asp Leu Tyr Val Asp Tyr 405 410 415 Thr Glu Tyr Val Met Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val 420 425 430 Ser Ser Gly Gly Ser Ser Arg Ser Ser Ser Ser Gly Gly Gly Gly Ser 435 440 445 Gly Gly Gly Gly Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser 450 455 460 Ala Ser Gly Gly Ser Gly Gln Ile Thr Val Thr Cys Arg Ala Ser Gly 465 470 475 480 Phe Tyr Pro Trp Asn Ile Thr Leu Ser Trp Arg Gln Asp Gly Val Ser 485 490 495 Leu Ser His Asp Thr Gln Gln Trp Gly Asp Val Leu Pro Asp Gly Gln 500 505 510 Gly Thr Tyr Gln Thr Trp Val Ala Thr Arg Ile Ser Gln Gly Glu Glu 515 520 525 Gln Arg Phe Thr Cys Tyr Met Glu His Ser Gly Gln His Ser Thr His 530 535 540 Pro Val Pro Ser Gly Lys Gly Ser His His His His His His 545 550 555 <210> 29 <211> 182 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide MICwed α1-α2 <400> 29 Glu Pro His Ser Leu Arg Tyr Asn Leu Thr Val Leu Ser Trp Asp Gly 1 5 10 15 Ser Val Gln Ser Gly Phe Leu Thr Glu Val His Leu Asp Gly Gln Pro 20 25 30 Phe Leu Arg Cys Asp Arg Gln Lys Cys Arg Ala Lys Pro Gln Gly Gln 35 40 45 Trp Ala Glu Asp Val Leu Gly Asn Lys Thr Trp Asp Arg Glu Thr Arg 50 55 60 Asp Leu Thr Gly Trp Gly Lys Asp Leu Arg Met Thr Leu Ala His Ile 65 70 75 80 Lys Asp Gln Lys Glu Gly Leu His Ser Leu Gln Glu Ile Arg Val Cys 85 90 95 Glu Ile His Glu Asp Asn Ser Thr Arg Ser Ser Gln His Phe Tyr Tyr 100 105 110 Asp Gly Glu Leu Phe Leu Ser Gln Asn Leu Glu Thr Lys Glu Trp Thr 115 120 125 Met Pro Gln Ser Ser Arg Ala Gln Thr Leu Ala Met Asn Val Arg Asn 130 135 140 Phe Leu Lys Glu Asp Ala Met Glu Thr Asp Thr His Tyr His Ala Met 145 150 155 160 His Ala Asp Cys Leu Gln Glu Leu Arg Arg Tyr Leu Lys Ser Gly Val 165 170 175 Val Leu Arg Arg Thr Val 180 <210> 30 <211> 182 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide DSM20 α1-α2 <400> 30 Glu Pro His Ser Leu Arg Tyr Asn Leu Thr Val Leu Ser Trp Asp Gly 0 1 5 10 15 Ser Val Gln Ser Gly Phe Leu Thr Glu Val His Leu Asp Gly Gln Pro 20 25 30 [[ID=]]Phe Leu Arg Cys Asp Arg Gln Lys Cys Arg Ala Lys Pro Gln Gly Gln 35 40 45 Trp Ala Glu Asp Val Leu Gly Asn Lys Thr Trp Asp Arg Glu Thr Arg 50 55 60 Asp Leu Thr Ala Trp Gly Lys Asp Leu Arg Met Thr Leu Ala His Ile 65 70 75 80 Lys Asp Gln Lys Glu Gly Leu His Ser Leu Gln Glu Ile Arg Val Cys 85 90 95 Glu Ile His Glu Asp Asn Ser Thr Arg Ser Ser Gln His Phe Tyr Tyr 100 105 110 Asp Gly Glu Leu Phe Leu Ser Gln Asn Leu Glu Thr Leu Glu Trp Thr 115 120 125 Met Pro Gln Ser Ser Arg Ala Gln Thr Leu Ala Met Asn Val Arg Asn 130 135 140 Phe Leu Lys Glu Asp Ala Met Gln Thr Asp Thr His Tyr Arg Ala Met 145 150 155 160 His Ala Asp Cys Leu Phe Glu Leu Arg Arg Tyr Leu Lys Ser Gly Val 165 170 175 Val Leu Arg Arg Thr Val 180 <210> 31 <211> 182 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide DSM25 α1-α2 <400> 31 Glu Pro His Ser Leu Arg Tyr Asn Leu Thr Val Leu Ser Trp Asp Gly 1 5 10 15 Ser Val Gln Ser Gly Phe Leu Thr Glu Val His Leu Asp Gly Gln Pro 20 25 30 Phe Leu Arg Cys Asp Arg Gln Lys Cys Arg Ala Lys Pro Gln Gly Gln 35 40 45 并在需要的地方添加换行符以保持格式一致 Trp Ala Glu Asp Val Leu Gly Asn Lys Thr Trp Asp Arg Glu Thr Arg 50 55 60 Asp Leu Thr Gly Trp Gly Lys Asp Leu Arg Met Thr Leu Ala His Ile 65 70 75 80 Lys Asp Gln Lys Glu Gly Leu His Ser Leu Gln Glu Ile Arg Val Cys 85 90 95 Glu Ile His Glu Asp Asn Ser Thr Arg Ser Ser Gln His Phe Tyr Tyr 100 105 110 Asp Gly Glu Leu Phe Leu Ser Gln Asn Leu Glu Thr Leu Glu Trp Thr 115 120 125 Met Pro Gln Ser Ser Arg Ala Gln Thr Leu Ala Met Asn Val Arg Asn 130 135 140 Phe Leu Lys Glu Asp Ala Met Glu Thr Asp Thr His Tyr His Ala Met 145 150 155 160 Arg Ala Asp Cys Leu Ser Glu Leu Arg Arg Tyr Leu Lys Ser Gly Val 165 170 175 Val Leu Arg Arg Thr Val 180 <210> 32 <211> 182 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide DSM27 α1-α2 <400> 32 Glu Pro His Ser Leu Arg Tyr Asn Leu Thr Val Leu Ser Trp Asp Gly 1 5 10 15 Ser Val Gln Ser Gly Phe Leu Thr Glu Val His Leu Asp Gly Gln Pro 20 25 30 Phe Leu Arg Cys Asp Arg Gln Lys Cys Arg Ala Lys Pro Gln Gly Gln 35 40 45 Trp Ala Glu Asp Val Leu Gly Asn Lys Thr Trp Asp Arg Glu Thr Arg 50 55 60 Asp Leu Thr Gly Trp Gly Lys Asp Leu Arg Met Thr Leu Ala His Ile 65 70 75 80 Lys Asp Gln Lys Glu Gly Leu His Ser Leu Gln Glu Ile Arg Val Cys 85 90 95 Glu Ile His Glu Asp Asn Ser Thr Arg Ser Ser Gln His Phe Tyr Tyr 100 105 110 Asp Gly Glu Leu Phe Leu Ser Gln Asn Leu Glu Thr Leu Glu Trp Thr 115 120 125 Met Pro Gln Ser Ser Arg Ala Gln Thr Leu Ala Met Asn Val Arg Asn 130 135 140 Phe Leu Lys Glu Asp Ala Met Lys Thr Lys Thr His Tyr His Ala Met 145 150 155 160 Arg Ala Asp Cys Leu Ser Glu Leu Arg Arg Tyr Leu Lys Ser Gly Val 165 170 175 Val Leu Arg Arg Thr Val 180 <210> 33 <211> 182 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide DSM28 α1-α2 <400> 33 Glu Pro His Ser Leu Arg Tyr Asn Leu Thr Val Leu Ser Trp Asp Gly 1 5 10 15 Ser Val Gln Ser Gly Phe Leu Thr Glu Val His Leu Asp Gly Gln Pro 20 25 30 Phe Leu Arg Cys Asp Arg Gln Lys Cys Arg Ala Lys Pro Gln Gly Gln 35 40 45 Trp Ala Glu Asp Val Leu Gly Asn Lys Thr Trp Asp Arg Glu Thr Arg 50 55 60 Asp Leu Thr Gly Asn Gly Lys Asp Leu Arg Met Thr Leu Ala His Ile 65 70 75 80 Lys Asp Gln Lys Glu Gly Leu His Ser Leu Gln Glu Ile Arg Val Cys 85 90 95 Glu Ile His Glu Asp Asn Ser Thr Arg Ser Ser Gln His Phe Tyr Tyr 100 105 110 Asp Gly Glu Leu Phe Leu Ser Gln Asn Leu Glu Thr Leu Glu Trp Thr 115 120 125 Met Pro Gln Ser Ser Arg Ala Gln Thr Leu Ala Met Asn Val Arg Asn 130 135 140 Phe Leu Lys Glu Asp Ala Met Lys Thr Lys Thr His Tyr His Ala Met 145 150 155 160 Arg Ala Asp Cys Leu Ser Glu Leu Arg Arg Tyr Leu Lys Ser Gly Val 165 170 175 Val Leu Arg Arg Thr Val 180 <210> 34 <211> 182 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide DSM42 α1-α2 <400> 34 Glu Pro His Ser Leu Arg Tyr Asn Leu Thr Val Leu Ser Trp Asp Gly 1 5 10 15 Ser Val Gln Ser Gly Phe Leu Thr Glu Val His Leu Asp Gly Gln Pro 20 25 30 Phe Leu Arg Cys Asp Arg Gln Lys Cys Arg Ala Lys Pro Gln Gly Gln 35 40 45 Trp Ala Glu Asp Val Leu Gly Asn Lys Thr Trp Asp Arg Glu Thr Arg 50 55 60 Asp Leu Thr Gly Trp Gly Lys Asp Leu Arg Met Thr Leu Ala His Ile 65 70 75 80 Lys Asp Gln Lys Glu Gly Leu His Ser Leu Gln Glu Ile Arg Val Cys 85 90 95 Glu Ile His Glu Asp Asn Ser Thr Arg Ser Ser Gln His Phe Tyr Tyr 100 105 110 Asp Gly Glu Leu Phe Leu Ser Gln Asn Leu Glu Thr Leu Glu Trp Thr 115 120 125 Met Pro Gln Ser Ser Arg Ala Gln Thr Leu Ala Met Asn Val Arg Asn 130 135 140 Phe Leu Lys Glu Asp Ala Met Glu Thr Asp Thr His Tyr His Ala Met 145 150 155 160 Arg Ala Asp Cys Leu Gln Glu Leu Arg Arg Tyr Leu Lys Ser Gly Val 165 170 175 Val Leu Arg Arg Thr Val 180 <210> 35 <211> 182 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide DSM48 α1-α2 <400> 35 Glu Pro His Ser Leu Arg Tyr Asn Leu Thr Val Leu Ser Trp Asp Gly 1 5 10 15 Ser Val Gln Ser Gly Phe Leu Thr Glu Val His Leu Asp Gly Gln Pro 20 25 30 Phe Leu Arg Cys Asp Arg Gln Lys Cys Arg Ala Lys Pro Gln Gly Gln 35 40 45 Trp Ala Glu Asp Val Leu Gly Asn Lys Thr Trp Asp Arg Glu Thr Arg 50 55 60 Asp Leu Thr Gly Trp Gly Lys Asp Leu Arg Met Thr Leu Ala His Ile 65 70 75 80 Lys Asp Gln Lys Glu Gly Leu His Ser Leu Gln Glu Ile Arg Val Cys 85 90 95 Glu Ile His Glu Asp Asn Ser Thr Arg Ser Ser Gln His Phe Tyr Tyr 100 105 110 Asp Gly Glu Leu Phe Leu Ser Gln Asn Leu Glu Thr Leu Glu Trp Thr 115 120 125 Met Pro Gln Ser Ser Arg Ala Gln Thr Leu Ala Met Asn Val Arg Asn 130 135 140 Phe Leu Lys Glu Asp Ala Met Ala Thr Asp Thr His Tyr Ile Ala Met 145 150 155 160 Arg Ala Asp Cys Leu Ala Glu Leu Arg Arg Tyr Leu Lys Ser Gly Val 165 170 175 Val Leu Arg Arg Thr Val 180 <210> 36 <211> 182 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide DSM49 α1-α2 <400> 36 Glu Pro His Ser Leu Arg Tyr Asn Leu Thr Val Leu Ser Trp Asp Gly 1 5 10 15 Ser Val Gln Thr Gly Phe Leu Thr Glu Val His Leu Asp Gly Gln Pro 20 25 30 Phe Leu Arg Cys Asp Arg Gln Lys Cys Arg Ala Lys Pro Gln Gly Gln 35 40 45 Trp Ala Glu Asp Val Leu Gly Asn Lys Thr Trp Asp Arg Glu Thr Arg 50 55 60 Asp Leu Thr Gln Trp Gly Lys Asp Leu Arg Met Thr Leu Ala His Ile 65 70 75 80 Lys Asp Gln Lys Glu Gly Leu His Ser Leu Gln Glu Ile Arg Val Cys 85 90 95 Glu Ile His Glu Asp Asn Ser Thr Arg Ser Ser Gln His Phe Tyr Tyr 100 105 110 Asp Gly Glu Leu Phe Leu Ser Gln Asn Leu Glu Thr Lys Glu Trp Thr 115 120 125 Met Pro Gln Ser Ser Arg Ala Gln Thr Leu Ala Met Asn Val Arg Asn 130 135 140 Phe Leu Lys Glu Asp Ala Met Phe Thr Asp Thr His Tyr Arg Ala Met 145 150 155 160 Thr Ala Asp Cys Leu Thr Glu Leu Arg Arg Tyr Leu Lys Ser Gly Val 165 170 175 Val Leu Arg Arg Thr Val 180 <210> 37 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Synthetic oligonucleotide primers <400> 37 atctataatg ctgagcccca cagtcttcg 29 <210> 38 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Synthetic oligonucleotide primers <400> 38 cttgctcttc agatatcgcc gtagttc 27 <210> 39 <211> 7556 <212> DNA <213> Artificial Sequence <220> <223> Synthetic DNA construct expressing wt α1α2 domain-Fv <400> 39 ggagagacca cacccaagct gtctagagcc gccacgatgg ggctgggccc ggtcttcctg 60 cttctggctg gcatcttccc ttttgcacct ccggggagctg ctgctgagcc ccacagtctt 120 cgttataacc tcacggtgct gtcctgggat ggatctgtgc agtcagggtt tctcactgag 180 gtacatctgg atggtcagcc cttcctgcgc tgtgacaggc agaaatgcag ggcaaagccc 240 cagggacagt gggcagaaga tgtcctggga aataagacat gggacagaga gaccagagac 300 ttgacaggga atggaaagga cctcaggatg accctggctc atatcaagga ccagaaagaa 360 ggcttgcatt ccctccagga gattagggtc tgtgagatcc atgaagacaa cagcaccagg 420 agctcccagc atttctacta cgatggggag ctctttctct cccaaaacct ggagactaag 480 gaatggacaa tgccccagtc ctccagagct cagaccttgg ccatgaacgt caggaatttc 540 ttgaaggaag atgcaatgaa gaccaagaca cactatcacg ctatgcatgc agactgcctg 600 caggaactac ggcgatatct aaaatccggc gtagtcctga ggagaacagt gccccccatg 660 gtgcaggtga ctcgctctga ggcctctggc ggatctgggg accgtgtgac aatcacctgc 720 agagcctccc aggacgtctc cactgccgtg gcgtggtacc aacagaagcc cgggaaggca 780 cccaaactgc tcatttacag cgcatccttt ctctactctg gcgtgccgtc tcgctttagc 840 gggtccggca gcggtacaga ctttactctg accatctcct ctctgcaacc ggaggatttt 900 gcaacctatt attgccagca atcctacaca acccccccca cctttggcca gggcaccaag 960 gtggagatca agggaggttc tagccgctcc agcagctctg gaggtggagg ctctggcgga 1020 ggaggcgagg tgcaactggt ggagtctggg ggcggcctgg tccagcccgg cggaagcttg 1080 cgcctgagct gtgccgcctc cggttttacc ttcaccagca ctggaatctc ctgggtgcgc 1140 caagctcccg gcaaagggct cgaatgggtg ggccgtatct accccaccaa cggaagcacc 1200 aactatgcag acagcgtgaa ggggcgcttc actatctccg ccgacaccag caaaaacacc 1260 gcgtacctgc agatgaattc tttgagggca gaggatactg ccgtgtacta ctgcgcgagg 1320 acatacggca tttacgatct gtatgtggat tacaccgaat acgtgatgga ctattggggc 1380 cagggcactc tggtcacagt gtctagcggt ggcagctccc gcagctccag cagcggtggt 1440 ggcggtagcg gaggcggagg cgatatccag atgactcaga gtccctcttc tctgagtgct 1500 tctggcggaa gtgggcagat caccgtcaca tgtcgcgcaa gcggctttta tccttggaac 1560 atcaccctga gctggcggca ggacggcgtc agcctgtccc atgataccca acagtgggga 1620 gatgtgctcc cggacggtca gggaacttac cagacctggg ttgcaactcg catctcccag 1680 ggggaggagc agcgtttcac atgttatatg gagcactctg gccagcacag cactcatccg 1740 gtgccgtccg gaaagggatc tcatcaccat caccaccact aggatccgtt gaggtctcta 1800 aaagcgtctt cctgttctca tcacatcata tcaaggttat ataccatcaa tattgccaca 1860 gatgttactt agccttttaa tatttctcta atttagtgta tatgcaatga tagttctctg 1920 atttctgaga ttgagtttct catgtgtaat gattatttag agtttctctt tcatctgttc 1980 aaatttttgt ctagttttat tttttactga tttgtaagac ttctttttat aatctgcata 2040 ttacaattct ctttactggg gtgttgcaaa tattttctgt cattctatgg cctgactttt 2100 cttaatggtt ttttaatttt aaaaataagt cttaatattc atgcaatcta attaacaatc 2160 ttttctttgt ggttaggact ttgagtcata agaaattttt ctctacactg aagtcatgat 2220 ggcatgcttc tatattattt tctaaaagat ttaaagtttt gccttctcca tttagactta 2280 taattcactg gaattttttt gtgtgtatgg tatganot gggttccctt ttatttttta 2340 catataaata tatttccctg tttttctaaa aaagaaaaag atcatcattt tcccattgta 2400 aaatgccata tttttttcat aggtcactta catatatcaa tgggtctgtt tctgagctct 2460 actctatttt atcagcctca ctgtctatcc ccacacatct catgctttgc tctaaatctt 2520 gatatttagt ggaacattct ttcccatttt gttctacaag aatatttttg ttattgtctt 2580 tgggctttct atatacattt tgaaatgagg ttgacaagtt aataatcaac ctctggatta 2640 caaaatttgt gaaagattga ctggtattct taactatgtt gctcctttta cgctatgtgg 2700 atacgctgct ttaatgcctt tgtatcatgc tattgcttcc cgtatggctt tcattttctc 2760 ctccttgtat aaatcctggt tgctgtctct ttatgaggag ttgtggcccg ttgtcaggca 2820 acgtggcgtg gtgtgcactg tgtttgctga cgcaaccccc actggttggg gcattgccac 2880 cacctgtcag ctcctttccg ggactttcgc tttccccctc cctattgcca cggcggaact 2940 catcgccgcc tgccttgccc gctgctggac aggggctcgg ctgttgggca ctgacaattc 3000 cgtggtgttg tcggggaaat catcgtcctt tccttggctg ctcgcctgtg ttgccacctg 3060 gattctgcgc gggacgtcct tctgctacgt cccttcggcc ctcaatccag cggaccttcc 3120 ttcccgcggc ctgctgccgg ctctgcggcc tcttccgcct cttcgccttc gccctcagac 3180 gagtcggatc tccctttggg ccgcctcccc gcatctgtgc cttctagttg ccagccatct 3240 gttgtttgcc cctccccgt gccttccttg accctggaag gtgccactcc cactgtcctt 3300 tcctaataaa atgaggaaat tgcatcgcat tgtctgagta ggtgtcattc tattctgggg 3360 ggtggggtgg ggcaggacag caaggggag gattggcaag acaatagcag gctttgcatt 3420 tttagacatt tagaagccta tatcttgtta cagaattgga attacacaaa aattctacca 3480 tattttgaaa gcttaggttg ttctgaaaaa aacaatatat tgttttcctg ggtaaactaa 3540 aagtcccctc gaggaaaggc ccctaaagtg aaacagtgca aaacgttcaa aaactgtctg 3600 gcaatacaag ttccactttg accaaaacgg ctggcagtaa aagggttaag aagactgtca 3660 gccttgagcg gtatcagctc actcaaaggc ggtaatacgg ttatccacag aatcagggga 3720 taacgcagga aagaacatgt gagcaaaagg ccagcaaaag gccaggaacc gtaaaaaggc 3780 cgcgttgctg gcgtttttcc ataggctccg cccccctgac gagcatcaca aaaatcgacg 3840 ctcaagtcag aggtggcgaa acccgacagg actataaaga taccaggcgt ttccccctgg 3900 aagctccctc gtgcgctctc ctgttccgac cctgccgctt accggatacc tgtccgcctt 3960 tctcccttcg ggaagcgtgg cgctttctca tagctcacgc tttaggtatc tcagttcggt 4020 gtaggtcgtt cgctccaagc tgggctgtgt gcacgaaccc cccgttcagc ccgaccgctg 4080 cgccttatcc ggtaactatc gtcttgagtc caacccggta agacacgact tatcgccact 4140 ggcagcagcc actggtaaca ggattagcag agcgaggtat gtaggcggtg ctacagagtt 4200 cttgaagtgg tgggctaact acggctcac tagagaaca gtatttggta tctgcgctct 4260 gctgaagcca gttaccttcg gaaaaagagt tggtagctct tgatccggca aacaaaccac 4320 cgctggtagc ggtggttttt ttgtttgcaa gcagcagatt acgcgcagaa aaaaaggatc 4380 tcaagaagat cctttgatct tttctacggg gtctgacgct cagtggaacg acgcgcgcgt 4440 aactcacgtt aagggatttt ggtcatgagt tagaaaaact catcgagcat caaatgaaac 4500 tgcaatttat tcatatcagg attatcaata ccatattttt gaaaaagccg tttctgtaat 4560 gaaggagaaa actcaccgag gcagttccat aggatggcaa gatcctggta tcggtctgcg 4620 attccgactc gtccaacatc aatacaacct attaatttcc cctcgtcaaa aataaggtta 4680 tcaagtgaga aatcaccatg agtgacgact gaatccggtg agaatggcaa aagtttatgc 4740 atttctttcc agacttgttc aacaggccag ccattacgct cgtcatcaaa atcactcgca 4800 tcaaccaaac cgttattcat tcgtgattgc gcctgagcga ggcgaaatac gcgatcgctg 4860 ttaaaaggac aattacaaac aggaatcgag tgcaaccggc gcaggaacac tgccagcgca 4920 tcaacaatat tttcacctga atcaggatat tcttctaata cctggaacgc tgtttttccg 4980 gggatcgcag tggtgagtaa ccatgcatca tcaggagtac ggataaaatg cttgatggtc 5040 ggaagtggca taaattccgt cagccagttt agtctgacca tctcatctgt aacatcattg 5100 gcaacgctac ctttgccatg tttcagaaac aactctggcg catcgggctt cccatacaag 5160 cgatagattg tcgcacctga ttgcccgaca ttatcgcgag cccatttata cccatataaa 5220 tcagcatcca tgttggaatt taatcgcggc ctcgacgttt cccgttggat atggctcatt 5280 ttttacttcc tcaccttgtc gtattatact atgccgatat actatgccga tgattaattg 5340 tcgacactgc gggggctctg tgtggtaagc aggtcttaac ctttttactg ccaatgacgc 5400 atgggatacg tcgtggcagt aaaagggctt aaatgccaac gacgcgtccc atacgttgtt 5460 ggcattttaa ttcttctctc tgcagcggca gcatgtgccg ccgctgcaga gagtttctag 5520 cgatgacagc ccctctgggc aacgagccgg gggggctgtc tttctttatg ttttaaatgc 5580 actgacctcc cacattccct ttttagtaaa atattcagaa ataatttaaa tacatcattg 5640 caatgaaaat aaatgttttt tattaggcag aatccagatg ctcaaggccc ttcataatat 5700 cccccagttt agtagttgga cttagggaac aaaggaacct ttaatagaaa ttggacagca 5760 agaaagcgag tcaggcaccg ggcttgcggg tcatgcacca ggtgcgcggt ccttcgggca 5820 cctcgacgtc ggcggtgacg gtgaagccga gccgctcgta gaaggggagg ttgcggggcg 5880 cggatgtctc caggaaggcg ggcaccccgg cgcgctcggc cgcctccact ccggggagca 5940 cgacggcgct gcccagaccc ttgccctggt ggtcgggcga cacgccgacg gtggccagga 6000 accacgcggg ctccttgggc cggtgcggcg ccaggaggcc ttccatctgt tgctgcgcgg 6060 ccagccggga accgctcaac tcggccatgc gcgggccgat ctcggcgaac accgcccccg 6120 cttcgacgct ctccggcgtg gtccagaccg ccaccgcggc gccgtcgtcc gcgacccaca 6180 ccttgccgat gtcgagcccg acgcgcgtga ggaagagttc ttgcagctcg gtgacccgct 6240 cgatgtggcg gtccggatcg acggtgtggc gcgtggcggg gtagtcggcg aacgcggcgg 6300 cgagggtgcg tacggccctg gggacgtcgt cgcgggtggc gaggcgcacc gtgggcttgt 6360 actcggtcat ggtggcggac gaaaggcccg gagatgagga agaggagaac agcgcggcag 6420 acgtgcgctt ttgaagcgtg cagaatgccg ggcctccgga ggaccttcgg gcgcccgccc 6480 cgcccctgag cccgcccctg agcccgcccc cggacccacc ccttcccagc ctctgagccc 6540 agaaagcgaa ggagcaaagc tgctattggc cgctgcccca aaggcctacc cgcttccatt 6600 gctcagcggt gctgtccatc tgcacgagac tagtgagtcg tgctacttcc atttgtcacg 6660 tcctgcacga cgcgagctgc ggggcggggg ggaacttcct gactagggga ggagtagaag 6720 gtggcgcgaa ggggccacca aagaacggag ccggttggcg cctaccggtg gatgtggaat 6780 gtgtgcgagg ccagaggcca cttgtgtagc gccaagtgcc cagcggggct gctaaagcgc 6840 atgctccaga ctgccttggg aaaagcgcct cccctacccg gtagagaaac ttgatctgtc 6900 gccgcaattc aaacttcgtg aggctccggt gcccgtcagt gacctgctat actctggaga 6960 cgacttacgg taaatggccc gcctggctga ccgcccaacg acccccgccc attgacgtca 7020 ataatgacgt atgttcccat agtaacgcca atagggactt tccattgacg tcaatgggtg 7080 gagtatttac ggtaaactgc ccacttggca gtacatcaag tgtatcatat gccaagtccg 7140 ccccctattg acgtcaatga cggtaaatgg cccgcctggc attatgccca gtacatgacc 7200 ttacgggact ttcctacttg gcagtacatc tacgtattag tcatcgctat taccatgctg 7260 atgcggtttt ggcagtacac caatgggcgt ggatagcggt ttgactcacg gggatttcca 7320 agtctccacc ccattgacgt caatgggagt ttgttttggc accaaaatca acgggacttt 7380 ccaaaatgtc gtaataaccc cgccccgttg acgcaaatgg gcggtaggcg tgtacggtgg 7440 gaggtctata taagcagagc tcgtttagtg aaccgtcaga tcgcctggag aggccatcca 7500 cgctgttttg acctccatag tggacaccgg gaccgatcca gcctccgcgt ctcagg 7556 <210> 40 <211> 558 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide wt MICA-Fv <400> 40 Glu Pro His Ser Leu Arg Tyr Asn Leu Thr Val Leu Ser Trp Asp Gly 1 5 10 15 Ser Val Gln Ser Gly Phe Leu Thr Glu Val His Leu Asp Gly Gln Pro 20 25 30 Phe Leu Arg Cys Asp Arg Gln Lys Cys Arg Ala Lys Pro Gln Gly Gln 35 40 45 Trp Ala Glu Asp Val Leu Gly Asn Lys Thr Trp Asp Arg Glu Thr Arg 50 55 60 Asp Leu Thr Gly Asn Gly Lys Asp Leu Arg Met Thr Leu Ala His Ile 65 70 75 80 Lys Asp Gln Lys Glu Gly Leu His Ser Leu Gln Glu Ile Arg Val Cys 85 90 95 Glu Ile His Glu Asp Asn Ser Thr Arg Ser Ser Gln His Phe Tyr Tyr 100 105 110 Asp Gly Glu Leu Phe Leu Ser Gln Asn Leu Glu Thr Lys Glu Trp Thr 115 120 125 Met Pro Gln Ser Ser Arg Ala Gln Thr Leu Ala Met Asn Val Arg Asn 130 135 140 Phe Leu Lys Glu Asp Ala Met Lys Thr Lys Thr His Tyr His Ala Met 145 150 155 160 His Ala Asp Cys Leu Gln Glu Leu Arg Arg Tyr Leu Lys Ser Gly Val 165 170 175 Val Leu Arg Arg Thr Val Pro Pro Met Val Gln Val Thr Arg Ser Glu 180 185 190 Ala Ser Gly Gly Ser Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser 195 200 205 Gln Asp Val Ser Thr Ala Val Ala Trp Tyr Gln Gln Lys Pro Gly Lys 210 215 220 Ala Pro Lys Leu Leu Ile Tyr Ser Ala Ser Phe Leu Tyr Ser Gly Val 225 230 235 240 Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr 245 250 255 Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln 260 265 270 Ser Tyr Thr Thr Pro Pro Thr Phe Gly Gln Gly Thr Lys Val Glu Ile 275 280 285 Lys Gly Gly Ser Ser Arg Ser Ser Ser Ser Gly Gly Gly Gly Ser Gly 290 295 300 Gly Gly Gly Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln 305 310 315 320 Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe 325 330 335 Thr Ser Thr Gly Ile Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 340 345 350 Glu Trp Val Gly Arg Ile Tyr Pro Thr Asn Gly Ser Thr Asn Tyr Ala 355 360 365 Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Ala Asp Thr Ser Lys Asn 370 375 380 Thr Ala Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val 385 390 395 400 Tyr Tyr Cys Ala Arg Thr Tyr Gly Ile Tyr Asp Leu Tyr Val Asp Tyr 405 410 415 Thr Glu Tyr Val Met Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val 420 425 430 Ser Ser Gly Gly Ser Ser Arg Ser Ser Ser Ser Gly Gly Gly Gly Ser 435 440 445 Gly Gly Gly Gly Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser 450 455 460 Ala Ser Gly Gly Ser Gly Gln Ile Thr Val Thr Cys Arg Ala Ser Gly 465 470 475 480 Phe Tyr Pro Trp Asn Ile Thr Leu Ser Trp Arg Gln Asp Gly Val Ser 485 490 495 Leu Ser His Asp Thr Gln Gln Trp Gly Asp Val Leu Pro Asp Gly Gln [[ID=​​​​​​​​​​​​​​​​​​​​​​​​​​​Glu Pro His Ser Leu Arg Tyr Asn Leu Thr Val Leu Ser Trp Asp Gly 1 5 10 15 Ser Val Gln Ser Gly Phe Leu Thr Glu Val His Leu Asp Gly Gln Pro 20 25 30 Phe Leu Arg Cys Asp Arg Gln Lys Cys Arg Ala Lys Pro Gln Gly Gln 35 40 45 Trp Ala Glu Asp Val Leu Gly Asn Lys Thr Trp Asp Arg Glu Thr Arg 50 55 60 Asp Leu Thr Gly Trp Gly Lys Asp Leu Arg Met Thr Leu Ala His Ile 65 70 75 80 Lys Asp Gln Lys Glu Gly Leu His Ser Leu Gln Glu Ile Arg Val Cys 85 90 95 Glu Ile His Glu Asp Asn Ser Thr Arg Ser Ser Gln His Phe Tyr Tyr 100 105 110 Asp Gly Glu Leu Phe Leu Ser Gln Asn Leu Glu Thr Lys Glu Trp Thr 115 120 125 Met Pro Gln Ser Ser Arg Ala Gln Thr Leu Ala Met Asn Val Arg Asn 130 135 140 Phe Leu Lys Glu Asp Ala Met Glu Thr Asp Thr His Tyr His Ala Met 145 150 155 160 His Ala Asp Cys Leu Gln Glu Leu Arg Arg Tyr Leu Lys Ser Gly Val 165 170 175 Val Leu Arg Arg Thr Val Pro Pro Met Val Gln Val Thr Arg Ser Glu 180 185 190 Ala Ser Gly Gly Ser Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser 195 200 205 Gln Asp Val Ser Thr Ala Val Ala Trp Tyr Gln Gln Lys Pro Gly Lys 210 215 220 Ala Pro Lys Leu Leu Ile Tyr Ser Ala Ser Phe Leu Tyr Ser Gly Val 225 230 235 240 Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr 245 250 255 Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln 260 265 270 Ser Tyr Thr Thr Pro Pro Thr Phe Gly Gln Gly Thr Lys Val Glu Ile 275 280 285 Lys Gly Gly Ser Ser Arg Ser Ser Ser Ser Gly Gly Gly Gly Ser Gly 290 295 300 Gly Gly Gly Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln 305 310 315 320 Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe 325 330 335 Thr Ser Thr Gly Ile Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 340 345 350 Glu Trp Val Gly Arg Ile Tyr Pro Thr Asn Gly Ser Thr Asn Tyr Ala 355 360 365 Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Ala Asp Thr Ser Lys Asn 370 375 380 Thr Ala Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val 385 390 395 400 Tyr Tyr Cys Ala Arg Thr Tyr Gly Ile Tyr Asp Leu Tyr Val Asp Tyr 405 410 415 Thr Glu Tyr Val Met Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val 420 425 430 Ser Ser Gly Gly Ser Ser Arg Ser Ser Ser Ser Gly Gly Gly Gly Ser 435 440 445 Gly Gly Gly Gly Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser 450 455 460 Ala Ser Gly Gly Ser Gly Gln Ile Thr Val Thr Cys Arg Ala Ser Gly 465 470 475 480 Phe Tyr Pro Trp Asn Ile Thr Leu Ser Trp Arg Gln Asp Gly Val Ser 485 490 495 Leu Ser His Asp Thr Gln Gln Trp Gly Asp Val Leu Pro Asp Gly Gln 500 505 510 Gly Thr Tyr Gln Thr Trp Val Ala Thr Arg Ile Ser Gln Gly Glu Glu 515 520 525 Gln Arg Phe Thr Cys Tyr Met Glu His Ser Gly Gln His Ser Thr His 530 535 540 Pro Val Pro Ser Gly Lys Gly Ser His His His His His His 545 550 555 <210> 42 <211> 558 <212> PRT <213> Artificial Sequence <220> <22​​​​​​​​​​​​​​​Trp Ala Glu Asp Val Leu Gly Asn Lys Thr Trp Asp Arg Glu Thr Arg 50 55 60 Asp Leu Thr Ala Trp Gly Lys Asp Leu Arg Met Thr Leu Ala His Ile 65 70 75 80 Lys Asp Gln Lys Glu Gly Leu His Ser Leu Gln Glu Ile Arg Val Cys 85 90 95 Glu Ile His Glu Asp Asn Ser Thr Arg Ser Ser Gln His Phe Tyr Tyr 100 105 110 Asp Gly Glu Leu Phe Leu Ser Gln Asn Leu Glu Thr Leu Glu Trp Thr 115 120 125 Met Pro Gln Ser Ser Arg Ala Gln Thr Leu Ala Met Asn Val Arg Asn 130 135 140 Phe Leu Lys Glu Asp Ala Met Gln Thr Asp Thr His Tyr Arg Ala Met 145 150 155 160 His Ala Asp Cys Leu Phe Glu Leu Arg Arg Tyr Leu Lys Ser Gly Val 165 170 175 Val Leu Arg Arg Thr Val Pro Pro Met Val Gln Val Thr Arg Ser Glu 180 185 190 Ala Ser Gly Gly Ser Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser 195 200 205 Gln Asp Val Ser Thr Ala Val Ala Trp Tyr Gln Gln Lys Pro Gly Lys 210 215 220 Ala Pro Lys Leu Leu Ile Tyr Ser Ala Ser Phe Leu Tyr Ser Gly Val 225 230 235 240 Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr 245 250 255 Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln 260 265 270 Ser Tyr Thr Thr Pro Pro Thr Phe Gly Gln Gly Thr Lys Val Glu Ile 275 280 285 Lys Gly Gly Ser Ser Arg Ser Ser Ser Ser Gly Gly Gly Gly Ser Gly 290 295 300 Gly Gly Gly Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln 305 310 315 320 Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe 325 330 335 Thr Ser Thr Gly Ile Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 340 345 350 Glu Trp Val Gly Arg Ile Tyr Pro Thr Asn Gly Ser Thr Asn Tyr Ala 355 360 365 Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Ala Asp Thr Ser Lys Asn 370 375 380 Thr Ala Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val 385 390 395 400 Tyr Tyr Cys Ala Arg Thr Tyr Gly Ile Tyr Asp Leu Tyr Val Asp Tyr 405 410 415 Thr Glu Tyr Val Met Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val 420 425 430 Ser Ser Gly Gly Ser Ser Arg Ser Ser Ser Ser Gly Gly Gly Gly Ser 435 440 445 Gly Gly Gly Gly Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser 450 455 460 Ala Ser Gly Gly Ser Gly Gln Ile Thr Val Thr Cys Arg Ala Ser Gly 465 470 475 480 Phe Tyr Pro Trp Asn Ile Thr Leu Ser Trp Arg Gln Asp Gly Val Ser 485 490 495 Leu Ser His Asp Thr Gln Gln Trp Gly Asp Val Leu Pro Asp Gly Gln 500 505 510 Gly Thr Tyr Gln Thr Trp Val Ala Thr Arg Ile Ser Gln Gly Glu Glu 515 520 525 Gln Arg Phe Thr Cys Tyr Met Glu His Ser Gly Gln His Ser Thr His 530 535 540 Pro Val Pro Ser Gly Lys Gly Ser His His His His His His 545 550 555 <210> 43 <211> 558 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide MICv25-Fv <400> 43 Glu Pro His Ser Leu Arg Tyr Asn Leu Thr Val Leu Ser Trp Asp Gly 1 5 10 15 Ser Val Gln Ser Gly Phe Leu Thr Glu Val His Leu Asp Gly Gln Pro 20 25 30 Phe Leu Arg Cys Asp Arg Gln Lys Cys Arg Ala Lys Pro Gln Gly Gln 35 40 45 Trp Ala Glu Asp Val Leu Gly Asn Lys Thr Trp Asp Arg Glu Thr Arg 50 55 60 Asp Leu Thr Gly Trp Gly Lys Asp Leu Arg Met Thr Leu Ala His Ile 65 70 75 80 Lys Asp Gln Lys Glu Gly Leu His Ser Leu Gln Glu Ile Arg Val Cys 85 90 95 Glu Ile His Glu Asp Asn Ser Thr Arg Ser Ser Gln His Phe Tyr Tyr 100 105 110 Asp Gly Glu Leu Phe Leu Ser Gln Asn Leu Glu Thr Leu Glu Trp Thr 115 120 125 Met Pro Gln Ser Ser Arg Ala Gln Thr Leu Ala Met Asn Val Arg Asn 130 135 140 Phe Leu Lys Glu Asp Ala Met Glu Thr Asp Thr His Tyr His Ala Met 145 150 155 160 Arg Ala Asp Cys Leu Ser Glu Leu Arg Arg Tyr Leu Lys Ser Gly Val 165 170 175 Val Leu Arg Arg Thr Val Pro Pro Met Val Gln Val Thr Arg Ser Glu 180 185 190 Ala Ser Gly Gly Ser Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser 195 200 205 Gln Asp Val Ser Thr Ala Val Ala Trp Tyr Gln Gln Lys Pro Gly Lys 210 215 220 Ala Pro Lys Leu Leu Ile Tyr Ser Ala Ser Phe Leu Tyr Ser Gly Val 225 230 235 240 Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr 245 250 255 Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln 260 265 270 Ser Tyr Thr Thr Pro Pro Thr Phe Gly Gln Gly Thr Lys Val Glu Ile 275 280 285 Lys Gly Gly Ser Ser Arg Ser Ser Ser Ser Gly Gly Gly Gly Ser Gly 290 295 300 Gly Gly Gly Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln 305 310 315 320 Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe 325 330 335 Thr Ser Thr Gly Ile Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 340 345 350 Glu Trp Val Gly Arg Ile Tyr Pro Thr Asn Gly Ser Thr Asn Tyr Ala 355 360 365 Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Ala Asp Thr Ser Lys Asn 370 375 380 Thr Ala Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val 385 390 395 400 Tyr Tyr Cys Ala Arg Thr Tyr Gly Ile Tyr Asp Leu Tyr Val Asp Tyr 405 410 415 Thr Glu Tyr Val Met Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val 420 425 430 Ser Ser Gly Gly Ser Ser Arg Ser Ser Ser Ser Gly Gly Gly Gly Ser 435 440 445 Gly Gly Gly Gly Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser 450 455 460 Ala Ser Gly Gly Ser Gly Gln Ile Thr Val Thr Cys Arg Ala Ser Gly 465 470 475 480 Phe Tyr Pro Trp Asn Ile Thr Leu Ser Trp Arg Gln Asp Gly Val Ser 485 490 495 Leu Ser His Asp Thr Gln Gln Trp Gly Asp Val Leu Pro Asp Gly Gln 500 505 510 Gly Thr Tyr Gln Thr Trp Val Ala Thr Arg Ile Ser Gln Gly Glu Glu 515 520 525 Gln Arg Phe Thr Cys Tyr Met Glu His Ser Gly Gln His Ser Thr His 530 535 540 Pro Val Pro Ser Gly Lys Gly Ser His His His His His His 545 550 555 <210> 44 <211> 558 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide MICv27-Fv <400> 44 Glu Pro His Ser Leu Arg Tyr Asn Leu Thr Val Leu Ser Trp Asp Gly 1 5 10 15 Ser Val Gln Ser Gly Phe Leu Thr Glu Val His Leu Asp Gly Gln Pro 20 25 30 Phe Leu Arg Cys Asp Arg Gln Lys Cys Arg Ala Lys Pro Gln Gly Gln 35 40 45 Trp Ala Glu Asp Val Leu Gly Asn Lys Thr Trp Asp Arg Glu Thr Arg 50 55 60 Asp Leu Thr Gly Trp Gly Lys Asp Leu Arg Met Thr Leu Ala His Ile 65 70 75 80 Lys Asp Gln Lys Glu Gly Leu His Ser Leu Gln Glu Ile Arg Val Cys 85 90 95 Glu Ile His Glu Asp Asn Ser Thr Arg Ser Ser Gln His Phe Tyr Tyr 100 105 110 Asp Gly Glu Leu Phe Leu Ser Gln Asn Leu Glu Thr Leu Glu Trp Thr 115 120 125 Met Pro Gln Ser Ser Arg Ala Gln Thr Leu Ala Met Asn Val Arg Asn 130 135 140 Phe Leu Lys Glu Asp Ala Met Lys Thr Lys Thr His Tyr His Ala Met 145 150 155 160 Arg Ala Asp Cys Leu Ser Glu Leu Arg Arg Tyr Leu Lys Ser Gly Val 165 170 175 Val Leu Arg Arg Thr Val Pro Pro Met Val Gln Val Thr Arg Ser Glu 180 185 190 Ala Ser Gly Gly Ser Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser 195 200 205 Gln Asp Val Ser Thr Ala Val Ala Trp Tyr Gln Gln Lys Pro Gly Lys 210 215 220 Ala Pro Lys Leu Leu Ile Tyr Ser Ala Ser Phe Leu Tyr Ser Gly Val 225 230 235 240 Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr 245 250 255 Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln 260 265 270 Ser Tyr Thr Thr Pro Pro Thr Phe Gly Gln Gly Thr Lys Val Glu Ile 275 280 285 Lys Gly Gly Ser Ser Arg Ser Ser Ser Ser Gly Gly Gly Gly Ser Gly 290 295 300 Gly Gly Gly Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln 305 310 315 320 Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe 325 330 335 Thr Ser Thr Gly Ile Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 340 345 350 Glu Trp Val Gly Arg Ile Tyr Pro Thr Asn Gly Ser Thr Asn Tyr Ala 355 360 365 Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Ala Asp Thr Ser Lys Asn 370 375 380 Thr Ala Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val 385 390 395 400 Tyr Tyr Cys Ala Arg Thr Tyr Gly Ile Tyr Asp Leu Tyr Val Asp Tyr 405 410 415 Thr Glu Tyr Val Met Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val 420 425 430 Ser Ser Gly Gly Ser Ser Arg Ser Ser Ser Ser Gly Gly Gly Gly Ser 435 440 445 Gly Gly Gly Gly Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser 450 455 460 Ala Ser Gly Gly Ser Gly Gln Ile Thr Val Thr Cys Arg Ala Ser Gly 465 470 475 480 Phe Tyr Pro Trp Asn Ile Thr Leu Ser Trp Arg Gln Asp Gly Val Ser 485 490 495 Leu Ser His Asp Thr Gln Gln Trp Gly Asp Val Leu Pro Asp Gly Gln 500 505 510 Gly Thr Tyr Gln Thr Trp Val Ala Thr Arg Ile Ser Gln Gly Glu Glu 515 520 525 Gln Arg Phe Thr Cys Tyr Met Glu His Ser Gly Gln His Ser Thr His 530 535 540 Pro Val Pro Ser Gly Lys Gly Ser His His His His His His 545 550 555 <210> 45 <211> 558 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide MICv28-Fv <400> 45 Glu Pro His Ser Leu Arg Tyr Asn Leu Thr Val Leu Ser Trp Asp Gly 1 5 10 15 Ser Val Gln Ser Gly Phe Leu Thr Glu Val His Leu Asp Gly Gln Pro 20 25 30 Phe Leu Arg Cys Asp Arg Gln Lys Cys Arg Ala Lys Pro Gln Gly Gln 35 40 45 Trp Ala Glu Asp Val Leu Gly Asn Lys Thr Trp Asp Arg Glu Thr Arg 50 55 60 Asp Leu Thr Gly Asn Gly Lys Asp Leu Arg Met Thr Leu Ala His Ile 65 70 75 80 Lys Asp Gln Lys Glu Gly Leu His Ser Leu Gln Glu Ile Arg Val Cys 85 90 95 Glu Ile His Glu Asp Asn Ser Thr Arg Ser Ser Gln His Phe Tyr Tyr 100 105 110 Asp Gly Glu Leu Phe Leu Ser Gln Asn Leu Glu Thr Leu Glu Trp Thr 115 120 125 Met Pro Gln Ser Ser Arg Ala Gln Thr Leu Ala Met Asn Val Arg Asn 130 135 140 Phe Leu Lys Glu Asp Ala Met Lys Thr Lys Thr His Tyr His Ala Met 145 150 155 160 Arg Ala Asp Cys Leu Ser Glu Leu Arg Arg Tyr Leu Lys Ser Gly Val 165 170 175 Val Leu Arg Arg Thr Val Pro Pro Met Val Gln Val Thr Arg Ser Glu 180 185 190 Ala Ser Gly Gly Ser Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser 195 200 205 Gln Asp Val Ser Thr Ala Val Ala Trp Tyr Gln Gln Lys Pro Gly Lys 210 215 220 Ala Pro Lys Leu Leu Ile Tyr Ser Ala Ser Phe Leu Tyr Ser Gly Val 225 230 235 240 Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr 245 250 255 Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln 260 265 270 Ser Tyr Thr Thr Pro Pro Thr Phe Gly Gln Gly Thr Lys Val Glu Ile 275 280 285 Lys Gly Gly Ser Ser Arg Ser Ser Ser Ser Gly Gly Gly Gly Ser Gly 290 295 300 Gly Gly Gly Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln 305 310 315 320 Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe 325 330 335 Thr Ser Thr Gly Ile Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 340 345 350 Glu Trp Val Gly Arg Ile Tyr Pro Thr Asn Gly Ser Thr Asn Tyr Ala 355 360 365 Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Ala Asp Thr Ser Lys Asn 370 375 380 Thr Ala Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val 385 390 395 400 Tyr Tyr Cys Ala Arg Thr Tyr Gly Ile Tyr Asp Leu Tyr Val Asp Tyr 405 410 415 Thr Glu Tyr Val Met Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val 420 425 430 Ser Ser Gly Gly Ser Ser Arg Ser Ser Ser Ser Gly Gly Gly Gly Ser 435 440 445 Gly Gly Gly Gly Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser 450 455 460 Ala Ser Gly Gly Ser Gly Gln Ile Thr Val Thr Cys Arg Ala Ser Gly 465 470 475 480 Phe Tyr Pro Trp Asn Ile Thr Leu Ser Trp Arg Gln Asp Gly Val Ser 485 490 495 Leu Ser His Asp Thr Gln Gln Trp Gly Asp Val Leu Pro Asp Gly Gln 500 505 510 Gly Thr Tyr Gln Thr Trp Val Ala Thr Arg Ile Ser Gln Gly Glu Glu 515 520 525 Gln Arg Phe Thr Cys Tyr Met Glu His Ser Gly Gln His Ser Thr His 530 535 540 Pro Val Pro Ser Gly Lys Gly Ser His His His His His His 545 550 555 <210> 46 <211> 558 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide MICv42-Fv <400> 46 Glu Pro His Ser Leu Arg Tyr Asn Leu Thr Val Leu Ser Trp Asp Gly 1 5 10 15 Ser Val Gln Ser Gly Phe Leu Thr Glu Val His Leu Asp Gly Gln Pro 20 25 30 Phe Leu Arg Cys Asp Arg Gln Lys Cys Arg Ala Lys Pro Gln Gly Gln 35 40 45 Trp Ala Glu Asp Val Leu Gly Asn Lys Thr Trp Asp Arg Glu Thr Arg 50 55 60 Asp Leu Thr Gly Trp Gly Lys Asp Leu Arg Met Thr Leu Ala His Ile 65 70 75 80 Lys Asp Gln Lys Glu Gly Leu His Ser Leu Gln Glu Ile Arg Val Cys 85 90 95 Glu Ile His Glu Asp Asn Ser Thr Arg Ser Ser Gln His Phe Tyr Tyr 100 105 110 Asp Gly Glu Leu Phe Leu Ser Gln Asn Leu Glu Thr Leu Glu Trp Thr 115 120 125 Met Pro Gln Ser Ser Arg Ala Gln Thr Leu Ala Met Asn Val Arg Asn 130 135 140 Phe Leu Lys Glu Asp Ala Met Glu Thr Asp Thr His Tyr His Ala Met 145 150 155 160 Arg Ala Asp Cys Leu Gln Glu Leu Arg Arg Tyr Leu Lys Ser Gly Val 165 170 175 Val Leu Arg Arg Thr Val Pro Pro Met Val Gln Val Thr Arg Ser Glu 180 185 190 Ala Ser Gly Gly Ser Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser 195 200 205 Gln Asp Val Ser Thr Ala Val Ala Trp Tyr Gln Gln Lys Pro Gly Lys 210 215 220 Ala Pro Lys Leu Leu Ile Tyr Ser Ala Ser Phe Leu Tyr Ser Gly Val 225 230 235 240 Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr 245 250 255 Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln 260 265 270 Ser Tyr Thr Thr Pro Pro Thr Phe Gly Gln Gly Thr Lys Val Glu Ile 275 280 285 Lys Gly Gly Ser Ser Arg Ser Ser Ser Ser Gly Gly Gly Gly Ser Gly 290 295 300 Gly Gly Gly Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln 305 310 315 320 Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe 325 330 335 Thr Ser Thr Gly Ile Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 340 345 350 Glu Trp Val Gly Arg Ile Tyr Pro Thr Asn Gly Ser Thr Asn Tyr Ala 355 360 365 Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Ala Asp Thr Ser Lys Asn 370 375 380 Thr Ala Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val 385 390 395 400 Tyr Tyr Cys Ala Arg Thr Tyr Gly Ile Tyr Asp Leu Tyr Val Asp Tyr 405 410 415 Thr Glu Tyr Val Met Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val 420 425 430 Ser Ser Gly Gly Ser Ser Arg Ser Ser Ser Ser Gly Gly Gly Gly Ser 435 440 445 Gly Gly Gly Gly Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser 450 455 460 Ala Ser Gly Gly Ser Gly Gln Ile Thr Val Thr Cys Arg Ala Ser Gly 465 470 475 480 Phe Tyr Pro Trp Asn Ile Thr Leu Ser Trp Arg Gln Asp Gly Val Ser 485 490 495 Leu Ser His Asp Thr Gln Gln Trp Gly Asp Val Leu Pro Asp Gly Gln 500 505 510 Gly Thr Tyr Gln Thr Trp Val Ala Thr Arg Ile Ser Gln Gly Glu Glu 515 520 525 Gln Arg Phe Thr Cys Tyr Met Glu His Ser Gly Gln His Ser Thr His 530 535 540 Pro Val Pro Ser Gly Lys Gly Ser His His His His His His 545 550 555 <210> 47 <211> 558 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide MICv48-Fc <400> 47 Glu Pro His Ser Leu Arg Tyr Asn Leu Thr Val Leu Ser Trp Asp Gly 1 5 10 15 Ser Val Gln Ser Gly Phe Leu Thr Glu Val His Leu Asp Gly Gln Pro 20 25 30 Phe Leu Arg Cys Asp Arg Gln Lys Cys Arg Ala Lys Pro Gln Gly Gln 35 40 45 Trp Ala Glu Asp Val Leu Gly Asn Lys Thr Trp Asp Arg Glu Thr Arg 50 55 60 Asp Leu Thr Gly Trp Gly Lys Asp Leu Arg Met Thr Leu Ala His Ile 65 70 75 80 Lys Asp Gln Lys Glu Gly Leu His Ser Leu Gln Glu Ile Arg Val Cys 85 90 95 Glu Ile His Glu Asp Asn Ser Thr Arg Ser Ser Gln His Phe Tyr Tyr 100 105 110 Asp Gly Glu Leu Phe Leu Ser Gln Asn Leu Glu Thr Leu Glu Trp Thr 115 120 125 Met Pro Gln Ser Ser Arg Ala Gln Thr Leu Ala Met Asn Val Arg Asn 130 135 140 Phe Leu Lys Glu Asp Ala Met Ala Thr Asp Thr His Tyr Ile Ala Met 145 150 155 160 Arg Ala Asp Cys Leu Ala Glu Leu Arg Arg Tyr Leu Lys Ser Gly Val 165 170 175 Val Leu Arg Arg Thr Val Pro Pro Met Val Gln Val Thr Arg Ser Glu 180 185 190 Ala Ser Gly Gly Ser Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser 195 200 205 Gln Asp Val Ser Thr Ala Val Ala Trp Tyr Gln Gln Lys Pro Gly Lys 210 215 220 Ala Pro Lys Leu Leu Ile Tyr Ser Ala Ser Phe Leu Tyr Ser Gly Val 225 230 235 240 Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr 245 250 255 Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln 260 265 270 Ser Tyr Thr Thr Pro Pro Thr Phe Gly Gln Gly Thr Lys Val Glu Ile 275 280 285 Lys Gly Gly Ser Ser Arg Ser Ser Ser Ser Gly Gly Gly Gly Ser Gly 290 295 300 Gly Gly Gly Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln 305 310 315 320 Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe 325 330 335 Thr Ser Thr Gly Ile Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 340 345 350 Glu Trp Val Gly Arg Ile Tyr Pro Thr Asn Gly Ser Thr Asn Tyr Ala 355 360 365 Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Ala Asp Thr Ser Lys Asn 370 375 380 Thr Ala Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val 385 390 395 400 Tyr Tyr Cys Ala Arg Thr Tyr Gly Ile Tyr Asp Leu Tyr Val Asp Tyr 405 410 415 Thr Glu Tyr Val Met Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val 420 425 430 Ser Ser Gly Gly Ser Ser Arg Ser Ser Ser Ser Gly Gly Gly Gly Ser 435 440 445 Gly Gly Gly Gly Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser 450 455 460 Ala Ser Gly Gly Ser Gly Gln Ile Thr Val Thr Cys Arg Ala Ser Gly 465 470 475 480 Phe Tyr Pro Trp Asn Ile Thr Leu Ser Trp Arg Gln Asp Gly Val Ser 485 490 495 Leu Ser His Asp Thr Gln Gln Trp Gly Asp Val Leu Pro Asp Gly Gln 500 505 510 Gly Thr Tyr Gln Thr Trp Val Ala Thr Arg Ile Ser Gln Gly Glu Glu 515 520 525 Gln Arg Phe Thr Cys Tyr Met Glu His Ser Gly Gln His Ser Thr His 530 535 540 Pro Val Pro Ser Gly Lys Gly Ser His His His His His His 545 550 555 <210> 48 <211> 558 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide MICv49 - Fv <400> 48 Glu Pro His Ser Leu Arg Tyr Asn Leu Thr Val Leu Ser Trp Asp Gly 1 5 10 15 Ser Val Gln Thr Gly Phe Leu Thr Glu Val His Leu Asp Gly Gln Pro 20 25 30 Phe Leu Arg Cys Asp Arg Gln Lys Cys Arg Ala Lys Pro Gln Gly Gln 35 40 45 Trp Ala Glu Asp Val Leu Gly Asn Lys Thr Trp Asp Arg Glu Thr Arg 50 55 60 Asp Leu Thr Gln Trp Gly Lys Asp Leu Arg Met Thr Leu Ala His Ile 65 70 75 80 Lys Asp Gln Lys Glu Gly Leu His Ser Leu Gln Glu Ile Arg Val Cys 85 90 95 Glu Ile His Glu Asp Asn Ser Thr Arg Ser Ser Gln His Phe Tyr Tyr 100 105 110 Asp Gly Glu Leu Phe Leu Ser Gln Asn Leu Glu Thr Lys Glu Trp Thr 115 120 125 Met Pro Gln Ser Ser Arg Ala Gln Thr Leu Ala Met Asn Val Arg Asn 130 135 140 Phe Leu Lys Glu Asp Ala Met Phe Thr Asp Thr His Tyr Arg Ala Met 145 150 155 160 Thr Ala Asp Cys Leu Thr Glu Leu Arg Arg Tyr Leu Lys Ser Gly Val 165 170 175 Val Leu Arg Arg Thr Val Pro Pro Met Val Gln Val Thr Arg Ser Glu 180 185 190 Ala Ser Gly Gly Ser Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser 195 200 205 Gln Asp Val Ser Thr Ala Val Ala Trp Tyr Gln Gln Lys Pro Gly Lys 210 215 220 Ala Pro Lys Leu Leu Ile Tyr Ser Ala Ser Phe Leu Tyr Ser Gly Val 225 230 235 240 Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr 245 250 255 Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln 260 265 270 Ser Tyr Thr Thr Pro Pro Thr Phe Gly Gln Gly Thr Lys Val Glu Ile 275 280 285 Lys Gly Gly Ser Ser Arg Ser Ser Ser Ser Gly Gly Gly Gly Ser Gly 290 295 300 Gly Gly Gly Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln 305 310 315 320 Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe 325 330 335 Thr Ser Thr Gly Ile Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 340 345 350 Glu Trp Val Gly Arg Ile Tyr Pro Thr Asn Gly Ser Thr Asn Tyr Ala 355 360 365 Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Ala Asp Thr Ser Lys Asn 370 375 380 Thr Ala Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val 385 390 395 400 Tyr Tyr Cys Ala Arg Thr Tyr Gly Ile Tyr Asp Leu Tyr Val Asp Tyr 405 410 415 Thr Glu Tyr Val Met Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val 420 425 430 Ser Ser Gly Gly Ser Ser Arg Ser Ser Ser Ser Gly Gly Gly Gly Ser 435 440 445 Gly Gly Gly Gly Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser 450 455 460 Ala Ser Gly Gly Ser Gly Gln Ile Thr Val Thr Cys Arg Ala Ser Gly 465 470 475 480 Phe Tyr Pro Trp Asn Ile Thr Leu Ser Trp Arg Gln Asp Gly Val Ser 485 490 495 Leu Ser His Asp Thr Gln Gln Trp Gly Asp Val Leu Pro Asp Gly Gln 500 505 510 Gly Thr Tyr Gln Thr Trp Val Ala Thr Arg Ile Ser Gln Gly Glu Glu 515 520 525 Gln Arg Phe Thr Cys Tyr Met Glu His Ser Gly Gln His Ser Thr His 530 535 540 Pro Val Pro Ser Gly Lys Gly Ser His His His His His His 545 550 555 <210> 49 <211> 137 <212> PRT <213> Artificial Sequence <220> <223> Synthetic NKG2D extracellular domain <400> 49 Asn Ser Leu Phe Asn Gln Glu Val Gln Ile Pro Leu Thr Glu Ser Tyr 1 5 10 15 Cys Gly Pro Cys Pro Lys Asn Trp Ile Cys Tyr Lys Asn Asn Cys Tyr 20 25 30 Gln Phe Phe Asp Glu Ser Lys Asn Trp Tyr Glu Ser Gln Ala Ser Cys 35 40 45 Met Ser Gln Asn Ala Ser Leu Leu Lys Val Tyr Ser Lys Glu Asp Gln 50 55 60[[ID=_{}47]] Asp Leu Leu Lys Leu Val Lys Ser Tyr His Trp Met Gly Leu Val His 65 70 75 80 Ile Pro Thr Asn Gly Ser Trp Gln Trp Glu Asp Gly Ser Ile Leu Ser 85 90 95 Pro Asn Leu Leu Thr Ile Ile Glu Met Gln Lys Gly Asp Cys Ala Leu 100 105 110 Tyr Ala Ser Ser Phe Lys Gly Tyr Ile Glu Asn Cys Ser Thr Pro Asn 115 120 125 Thr Tyr Ile Cys Met Gln Arg Thr Val 130 135 <210> 50 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Synthetic oligonucleotides <400> 50 ctgtctagag ccgccaacat ggggctgggc ccggtcttcc 40 <210> 51 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic oligonucleotides <400> 51 aacggatcctacacagtcctttgcatgcag 30 <210> 52 <211> 6362 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide, pD2509-CMV-Avi-His-natural NKG2D Extracellular domain <400> 52 ggagagacca cacccaagct gtctagagcc gccaacatgg ggctgggccc ggtcttcctg 60 cttctggctg gcatcttccc ttttgcacct ccgggagctg ctgctgagcc ccaccatcat 120 caccaccatg gccttaacga catcttcgaa gctcaaaaga tcgaatggca tgaaaactca 180 ttattcaacc aagaagttca aattcccttg accgaaagtt actgtggccc atgtcctaaa 240 aactggatat gttacaaaaa taactgctac caattttttg atgagagtaa aaactggtat 300 gagagccagg cttcttgtat gtctcaaaat gccagccttc tgaaagtata cagcaaagag 360 gaccaggatt tacttaaact ggtgaagtca tatcattgga tgggactagt acacattcca 420 acaaatggat cttggcagtg ggaagatggc tccattctct cacccaacct actaacaata 480 attgaaatgc agaagggaga ctgtgcactc tatgcctcga gctttaaagg ctatatagaa 540 aactgttcaa ctccaaatac atacatctgc atgcaaagga ctgtgtagga tccgttgagg 600 tctctaaaag cgtcttcctg ttctcatcac atcatatcaa ggttatatac catcaatatt 660 gccacagatg ttacttagcc ttttaatatt tctctaattt agtgtatatg caatgatagt 720 tctctgattt ctgagattga gtttctcatg tgtaatgatt atttagagtt tctctttcat 780 ctgttcaaat ttttgtctag ttttattttt tactgatttg taagacttct ttttataatc 840 tgcatattac aattctcttt actggggtgt tgcaaatatt ttctgtcatt ctatggcctg 900 acttttctta atggtttttt aattttaaaa ataagtctta atattcatgc aatctaatta 960 acaatctttt ctttgtggtt aggactttga gtcataagaa atttttctct acactgaagt 1020 catgatggca tgcttctata ttattttcta aaagatttaa agttttgcct tctccattta 1080 gacttataat tcactggaat ttttttgtgt gtatggtatg acatatgggt tcccttttat 1140 tttttacata taaatatatt tccctgtttt tctaaaaaag aaaaagatca tcattttccc 1200 attgtaaaat gccatatttt tttcataggt cacttacata tatcaatggg tctgtttctg 1260 agctctactc tattttatca gcctcactgt ctatccccac acatctcatg ctttgctcta 1320 aatcttgata tttagtggaa cattctttcc cattttgttc tacaagaata tttttgttat 1380 tgtctttggg ctttctatat acattttgaa atgaggttga caagttaata atcaacctct 1440 ggattacaaa atttgtgaaa gattgactgg tattcttaac tatgttgctc cttttacgct 1500 atgtggatac gctgctttaa tgcctttgta tcatgctatt gcttcccgta tggctttcat 1560 tttctctcc ttgtataaat cctggttgct gtctctttat gaggagttgt ggcccgttgt 1620 caggcaacgt ggcgtggtgt gcactgtgtt tgctgacgca accccactg gttggggcat 1680 tgccaccacc tgtcagctcc tttccgggac tttcgctttc cccctcccta ttgccacggc 1740 ggaactcatc gccgcctgcc ttgcccgctg ctggacaggg gctcggctgt tgggcactga 1800 caattccgtg gtgttgtcgg ggaaatcatc gtcctttcct tggctgctcg cctgtgttgc 1860 cacctggatt ctgcgcggga cgtccttctg ctacgtccct tcggccctca atccagcgga 1920 ccttcttcc cgcggcctgc tgccggctct gcggcctctt ccgcctcttc gccttgccc 1980 tcagacgagt cggatctccc tttgggccgc ctccccgcat ctgtgccttc tagttgccag 2040 ccatctgttg tttgcccctc ccccgtgcct tccttgaccc tggaaggtgc cactccact 2100 gtcctttcct aataaatga ggaaattgca tcgcattgtc tgagtaggtg tcattctatt 2160 ctgggggtg gggtggggca ggacagcaag gggaggatt ggcaagacaa tagcaggctt 2220 tgcattttta gacatttaga agcctatatc ttgttacaga attggaatta caaaaaatt 2280 ctaccatatt ttgaaagctt aggttgttct gaaaaaaaaca atatattgtt ttcctgggta 2340 aactaaaagt cccctcgagg aaaggcccct aaagtgaaac agtgcaaaac gttcaaaaac 2400 tgtctggcaa tacaagttcc actttgacca aaacggctgg cattaaaagg gttaagaaga 2460 ctgtcagcct tgagcggtat cagctcactc aaaggcggta atacggttat ccacagaatc 2520 aggggataac gcaggaaaga acatgtgagc aaaaggccag caaaaggcca ggaaccgtaa 2580 aaaggccgcg ttgctggcgt ttttccatag gctccgcccc cctgacgagc atcacaaaaa 2640 tcgacgctca agtcagaggt ggcgaaaccc gacaggacta taaagatacc aggcgtttcc 2700 ccctggaagc tccctcgtgc gctctcctgt tccgaccctg ccgcttaccg gatacctgtc 2760 cgcctttctc ccttcgggaa gcgtggcgct ttctcatagc tcacgctgta ggtatctcag 2820 ttcggtgtag gtcgttcgct ccaagctggg ctgtgtgcac gaaccccccg ttcagcccga 2880 ccgctgcgcc ttatccggta actatcgtct tgagtccaac ccggtaagac acgacttatc 2940 gccactggca gcagccactg gtaacaggat tagcagagcg aggtatgtag gcggtgctac 3000 agagttcttg aagtggtggg ctaactacgg ctacactaga agaacagtat ttggtatctg 3060 cgctctgctg aagccagtta ccttcggaaa aagagttggt agctcttgat ccggcaaaca 3120 aaccaccgct ggtagcggtg gtttttttgt ttgcaagcag cagattacgc gcagaaaaaa 3180 aggatctcaa gaagatcctt tgatcttttc tacggggtct gacgctcagt ggaacgacgc 3240 gcgcgtaact cacgttaagg gattttggtc atgagttaga aaaactcatc gagcatcaaa 3300 tgaaactgca atttattcat atcaggatta tcaataccat atttttgaaa aagccgtttc 3360 tgtaatgaag gagaaaactc accgaggcag ttccatagga tggcaagatc ctggtatcgg 3420 tctgcgattc cgactcgtcc aacatcaata caacctatta atttcccctc gtcaaaaata 3480 aggttatcaa gtgagaaatc accatgagtg acgactgaat ccggtgagaa tggcaaaagt 3540 ttatgcattt ctttccagac ttgttcaaca ggccagccat tacgctcgtc atcaaaatca 3600 ctcgcatcaa ccaaaccgtt attcattcgt gattgcgcct gagcgaggcg aaatacgcga 3660 tcgctgttaa aaggacaatt acaaacagga atcgagtgca accggcgcag gaacactgcc 3720 agcgcatcaa caatattttc acctgaatca ggatattctt ctaatacctg gaacgctgtt 3780 tttccgggga tcgcagtggt gagtaaccat gcatcatcag gagtacggat aaaatgcttg 3840 atggtcggaa gtggcataaa ttccgtcagc cagtttagtc tgaccatctc atctgtaaca 3900 tcattggcaa cgctaccttt gccatgtttc agaaacaact ctggcgcatc gggcttccca 3960 tacaagcgat agattgtcgc acctgattgc ccgacattat cgcgagccca tttataccca 4020 tataaatcag catccatgtt ggaatttaat cgcggcctcg acgtttcccg ttggatatgg 4080 ctcatttttt acttcctcac cttgtcgtat tatactatgc cgatatacta tgccgatgat 4140 taattgtcga cactgcgggg gctctgtgtg gtaagcaggt cttaaccttt ttactgccaa 4200 tgacgcatgg gatacgtcgt ggcagtaaaa gggcttaaat gccaacgacg cgtcccatac 4260 gttgttggca ttttaattct tctctctgca gcggcagcat gtgccgccgc tgcagagagt 4320 ttctagcgat gacagcccct ctgggcaacg agccgggggg gctgtctttc tttatgtttt 4380 aaatgcactg acctcccaca ttcccttttt agtaaaatat tcagaaataa tttaaataca 4440 tcattgcaat gaaaataaat gttttttatt aggcagaatc cagatgctca aggcccttca 4500 taatatcccc cagtttagta gttggactta gggaacaaag gaacctttaa tagaaattgg 4560 acagcaagaa agcgagtcag gcaccgggct tgcgggtcat gcaccaggtg cgcggtcctt 4620 cgggcacctc gacgtcggcg gtgacggtga agccgagccg ctcgtagaag gggaggttgc 4680 ggggcgcgga tgtctccagg aaggcgggca ccccggcgcg ctcggccgcc tccactccgg 4740 ggagcacgac ggcgctgccc agacccttgc cctggtggtc gggcgacacg ccgacggtgg 4800 ccaggaacca cgcgggctcc ttgggccggt gcggcgccag gaggccttcc atctgttgct 4860 gcgcggccag ccgggaaccg ctcaactcgg ccatgcgcgg gccgatctcg gcgaacaccg 4920 cccccgcttc gacgctctcc ggcgtggtcc agaccgccac cgcggcgccg tcgtccgcga 4980 cccacacctt gccgatgtcg agcccgacgc gcgtgaggaa gagttcttgc agctcggtga 5040 cccgctcgat gtggcggtcc ggatcgacgg tgtggcgcgt ggcggggtag tcggcgaacg 5100 cggcggcgag ggtgcgtacg gccctgggga cgtcgtcgcg ggtggcgagg cgcaccgtgg 5160 gcttgtactc ggtcatggtg gcggacgaaa ggcccggaga tgaggaagag gagaacagcg 5220 cggcagacgt gcgcttttga agcgtgcaga atgccgggcc tccggagc cttcgggcgc 5280 ccgccccgcc cctgagcccg cccctgagcc cgccccgga cccacccctt cccagcctct 5340 gagcccagaa agcgaaggag caaagctgct attggccgct gccccaaagg cctacccgct 5400 tccattgctc agcggtgctg tccatctgca cgagactagt gagtcgtgct acttccattt 5460 gtcacgtcct gcacgacgcg agctgcgggg cggggggaa cttcctgact agggaggag 5520 tagaaggtgg cgcgaagggg ccaccaaaga acggagccgg ttggcgccta ccggtggatg 5580 tggaatgtgt gcgaggccag aggccacttg tgtagcgcca agtgcccagc ggggctgcta 5640 aagcgcatgc tccagactgc cttgggaaaa gcgcctcccc tacccggtag agaaacttga 5700 tctgtcgccg caattcaaac ttcgtgaggc tccggtgccc gtcagtgacc tgctatactc 5760 tggagacgac ttacggtaaa tggcccgcct ggctgaccgc ccaacgaccc ccgcccattg 5820 acgtcaataa tgacgtatgt tcccatagta acgccaatag ggactttcca ttgacgtcaa 5880 tgggtggagt atttacggta aactgcccac ttggcagtac atcaagtgta tcatatgcca 5940 agtccgcccc ctattgacgt caatgacggt aaatggcccg cctggcatta tgcccagtac 6000 atgaccttac gggactttcc tacttggcag tacatctacg tattagtcat cgctattacc 6060 atgctgatgc ggttttggca gtacaccaat gggcgtggat agcggtttga ctcacgggga 6120 tttccaagtc tccaccccat tgacgtcaat gggagtttgt tttggcacca aaatcaacgg 6180 gactttccaa aatgtcgtaa taaccccgcc ccgttgacgc aaatgggcgg taggcgtgta 6240 cggtgggagg tctatataag cagagctcgt ttagtgaacc gtcagatcgc ctggagaggc 6300 catccacgct gttttgacct ccatagtgga caccgggacc gatccagcct ccgcgtctca 6360 gg 6362 <210> 53 <211> 160 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide, His-avitag-Natural NKG2D extracellular domain <400> 53 Glu Pro His His His His His His Gly Leu Asn Asp Ile Phe Glu Ala 1 5 10 15 Gln Lys Ile Glu Trp His Glu Asn Ser Leu Phe Asn Gln Glu Val Gln 20 25 30 Ile Pro Leu Thr Glu Ser Tyr Cys Gly Pro Cys Pro Lys Asn Trp Ile 35 40 45 Cys Tyr Lys Asn Asn Cys Tyr Gln Phe Phe Asp Glu Ser Lys Asn Trp 50 55 60 Tyr Glu Ser Gln Ala Ser Cys Met Ser Gln Asn Ala Ser Leu Leu Lys 65 70 75 80 Val Tyr Ser Lys Glu Asp Gln Asp Leu Leu Lys Leu Val Lys Ser Tyr 85 90 95 His Trp Met Gly Leu Val His Ile Pro Thr Asn Gly Ser Trp Gln Trp 100 105 110 Glu Asp Gly Ser Ile Leu Ser Pro Asn Leu Leu Thr Ile Ile Glu Met 115 120 125 Gln Lys Gly Asp Cys Ala Leu Tyr Ala Ser Ser Phe Lys Gly Tyr Ile 130 135 140 Glu Asn Cys Ser Thr Pro Asn Thr Tyr Ile Cys Met Gln Arg Thr Val 145 150 155 160 <210> 54 <211> 160 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide, His-avitag-non-natural NKG2D Y152A extracellular domain <400> 54 Glu Pro His His His His His His Gly Leu Asn Asp Ile Phe Glu Ala 1 5 10 15 Gln Lys Ile Glu Trp His Glu Asn Ser Leu Phe Asn Gln Glu Val Gln 20 25 30 Ile Pro Leu Thr Glu Ser Tyr Cys Gly Pro Cys Pro Lys Asn Trp Ile 35 40 45 Cys Tyr Lys Asn Asn Cys Tyr Gln Phe Phe Asp Glu Ser Lys Asn Trp 50 55 60 Tyr Glu Ser Gln Ala Ser Cys Met Ser Gln Asn Ala Ser Leu Leu Lys 65 70 75 80 Val Tyr Ser Lys Glu Asp Gln Asp Leu Leu Lys Leu Val Lys Ser Ala 85 90 95 His Trp Met Gly Leu Val His Ile Pro Thr Asn Gly Ser Trp Gln Trp 100 105 110 Glu Asp Gly Ser Ile Leu Ser Pro Asn Leu Leu Thr Ile Ile Glu Met 115 120 125 Gln Lys Gly Asp Cys Ala Leu Tyr Ala Ser Ser Phe Lys Gly Tyr Ile 130 135 140 Glu Asn Cys Ser Thr Pro Asn Thr Tyr Ile Cys Met Gln Arg Thr Val 145 150 155 160 <210> 55 <211> 160 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide, His-avitag-non-natural NKG2D Y199A extracellular domain <400> 55 Glu Pro His His His His His His Gly Leu Asn Asp Ile Phe Glu Ala 1 5 10 15 Gln Lys Ile Glu Trp His Glu Asn Ser Leu Phe Asn Gln Glu Val Gln 20 25 30 Ile Pro Leu Thr Glu Ser Tyr Cys Gly Pro Cys Pro Lys Asn Trp Ile 35 40 45 Cys Tyr Lys Asn Asn Cys Tyr Gln Phe Phe Asp Glu Ser Lys Asn Trp 50 55 60 Tyr Glu Ser Gln Ala Ser Cys Met Ser Gln Asn Ala Ser Leu Leu Lys 65 70 75 80 Val Tyr Ser Lys Glu Asp Gln Asp Leu Leu Lys Leu Val Lys Ser Tyr 85 90 95 His Trp Met Gly Leu Val His Ile Pro Thr Asn Gly Ser Trp Gln Trp 100 105 110 Glu Asp Gly Ser Ile Leu Ser Pro Asn Leu Leu Thr Ile Ile Glu Met 115 120 125 Gln Lys Gly Asp Cys Ala Leu Tyr Ala Ser Ser Phe Lys Gly Ala Ile 130 135 140 Glu Asn Cys Ser Thr Pro Asn Thr Tyr Ile Cys Met Gln Arg Thr Val 145 150 155 160 <210> 56 <211> 160 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide, His-avitag-non-natural NKG2D Y152A +Y199A Extracellular domain <400> 56 Glu Pro His His His His His His Gly Leu Asn Asp Ile Phe Glu Ala[[ID=​​​​20 25 30 Ile Pro Leu Thr Glu Ser Tyr Cys Gly Pro Cys Pro Lys Asn Trp Ile 35 40 45 Cys Tyr Lys Asn Asn Cys Tyr Gln Phe Phe Asp Glu Ser Lys Asn Trp 50 55 60 Tyr Glu Ser Gln Ala Ser Cys Met Ser Gln Asn Ala Ser Leu Leu Lys 65 70 75 80 Val Tyr Ser Lys Glu Asp Gln Asp Leu Leu Lys Leu Val Lys Ser Ala 85 90 95 His Trp Met Gly Leu Val His Ile Pro Thr Asn Gly Ser Trp Gln Trp 100 105 110 Glu Asp Gly Ser Ile Leu Ser Pro Asn Leu Leu Thr Ile Ile Glu Met 115 120 125 Gln Lys Gly Asp Cys Ala Leu Tyr Ala Ser Ser Phe Lys Gly Ala Ile 130 135 140 Glu Asn Cys Ser Thr Pro Asn Thr Tyr Ile Cys Met Gln Arg Thr Val 145 150 155 160 <210> 57 <211> 7640 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide, wt MIC-Fc expression vector <400> 57 ggagagacca cacccaagct gtctagagcc gccaacatgg ggctgggccc ggtcttcctg 60 cttctggctg gcatcttccc ttttgcacct ccgggagctg ctgctgagcc ccacagtctt 120 cgttataacc tcacggtgct gtcctgggat ggatctgtgc agtcagggtt tctcactgag 180 gtacatctgg atggtcagcc cttcctgcgc tgtgacaggc agaaatgcag ggcaaagccc 240 cagggacagt gggcagaaga tgtcctggga aataagacat gggacagaga gaccagagac 300 ttgacagggt ggggaaagga cctcaggatg accctggctc atatcaagga ccagaaagaa 360 ggcttgcatt ccctccagga gattagggtc tgtgagatcc atgaagacaa cagcaccagg 420 agctcccagc atttctacta cgatggggag ctctttctct cccaaaacct ggagactaag 480 gaatggacaa tgccccagtc ctccagagct cagaccttgg ccatgaacgt caggaatttc 540 ttgaaggaag atgcaatgga gaccgataca cactatcacg ctatgcatgc agactgcctg 600 caggaactac ggcgatatct aaaatccggc gtagtcctga ggagaacagt gccccccatg 660 gtgaatgtca cccgcagcga ggcctcagag ggcaacatta ccgtgacatg cagggcttct 720 ggcttctatc cctggaatat cacactgagc tggcgtcagg atggggtatc tttgagccac 780 gacacccagc agtgggggga tgtcctgcct gatgggaatg gaacctacca gacctgggtg 840 gccaccagga tttgccaagg agaggagcag aggttcacct gctacatgga acacagcggg 900 aatcacagca ctcaccctgt gccctctggg aaaatcgaag gacgcatgga cccaaagagt 960 tgcgacaaaa ctcacacatg cccaccgtgc ccaggtaagc cagcccaggc ctcgccctcc 1020 agctcaaggc gggacaggtg ccctagagta gcctgcatcc agggacaggc cccagccggg 1080 tgctgacacg tccacctcca tctcttcctc agcacctgaa ctcctggggg gaccgtcagt 1140 cttcctcttc cccccaaaac ccaaggacac cctcatgatc tcccggaccc ctgaggtcac 1200 atgcgtggtg gtggacgtga gccacgaaga ccctgaggtc aagttcaact ggtacgtgga 1260 cggcgtggag gtgcataatg ccaagacaaa gccgcgggag gagcagtaca acagcacgta 1320 ccgtgtggtc agcgtcctca ccgtcctgca ccaggactgg ctgaatggca aggagtacaa 1380 gtgcaaggtc tccaacaaag ccctcccagc ccccatcgag aaaaccatct ccaaagccaa 1440 aggtgggacc cgtggggtgc gagggccaca tggacagagg ccggctcggc ccaccctctg 1500 ccctgagagt gactgctgta ccaacctctg tccctacagg gcagccccga gaaccacagg 1560 tgtacaccct gcccccatcc cgggatgagc tgaccaagaa ccaggtcagc ctgacctgcc 1620 tggtcaaagg cttctatccc agcgacatcg ccgtggagtg ggagagcaat gggcagccgg 1680 agaacaacta caagaccacg cctcccgtgc tggactccga cggctccttc ttcctctaca 1740 gcaagctcac cgtggacaag agcaggtggc agcaggggaa cgtcttctca tgctccgtga 1800 tgcatgaggc tctgcacaac cactacacgc agaagagcct ctccctgtct ccgggtaaat 1860 gataggatcc ggttgaggtc tctaaaagcg tcttcctgtt ctcatcacat catatcaagg 1920 ttatatacca tcaatattgc cacagatgtt acttagcctt ttaatattc tctaatttag 1980 tgtatatgca atgatagttc tctgatttct gagattgagt ttctcatgtg taatgattat 2040 ttagagtttc tctttcatct gttcaaattt ttgtctagtt ttatttttta ctgatttgta 2100 agacttcttt ttataatctg catattacaa ttctctttac tggggtgttg caaatatttt 2160 ctgtcattct atggcctgac ttttcttaat ggttttttaa ttttaaaaat aagtctttaat 2220 attcatgcaa tctaattaac aatcttttct ttgtggttag gactttgagt cataagaaat 2280 ttttctctac actgaagtca tgatggcatg cttctatatt attttctaaa agatttaaag 2340 ttttgccttc tccatttaga cttataattc actggaattt ttttgtgtgt atggtatgac 2400 atatgggttc ccttttattt tttacatata aatatatttc cctgtttttc taaaaaagaa 2460 aaagatcatc attttcccat tgtaaaatgc catatttttt tcataggtca cttadata 2520 tcaatgggtc tgtttctgag ctctactcta ttttatcagc ctcactgtct atccccacac 2580 atctcatgct ttgctctaaa tcttgatatt tagtggaaca ttctttccca ttttgttcta 2640 caagaatatt tttgttattg tctttgggct ttctatatac attttgaaat gaggttgaca 2700 agttaataat caacctctgg attacaaaat ttgtgaaaga ttgactggta ttcttaacta 2760 tgttgctcct tttacgctat gtggatacgc tgctttaatg cctttgtatc atgctattgc 2820 ttcccgtatg gctttcattt tctcctcctt gtataaatcc tggttgctgt ctctttatga 2880 ggagttgtgg cccgttgtca ggcaacgtgg cgtggtgtgc actgtgtttg ctgacgcaac 2940 ccccactggt tggggcattg ccaccacctg tcagctcctt tccgggactt tcgctttccc 3000 cctccctatt gccacggcgg aactcatcgc cgcctgcctt gcccgctgct ggacaggggc 3060 tcggctgttg ggcactgaca attccgtggt gttgtcgggg aaatcatcgt cctttccttg 3120 gctgctcgcc tgtgttgcca cctggattct gcgcgggacg tccttctgct acgtcccttc 3180 ggccctcaat ccagcggacc ttccttcccg cggcctgctg ccggctctgc ggcctcttcc 3240 gcctcttcgc cttcgccctc agacgagtcg gatctccctt tgggccgcct ccccgcatct 3300 gtgccttcta gttgccagcc atctgttgtt tgcccctccc ccgtgccttc cttgaccctg 3360 gaaggtgcca ctcccactgt cctttcctaa taaaatgagg aaattgcatc gcattgtctg 3420 agtaggtgtc attctattct ggggggtggg gtggggcagg acagcaaggg ggaggattgg 3480 caagacaata gcaggctttg catttttaga catttagaag cctatatctt gttacagaat 3540 tggaattaca caaaaattct accatatttt gaaagcttag gttgttctga aaaaaacaat 3600 atattgtttt cctgggtaaa ctaaaagtcc cctcgaggaa aggcccctaa agtgaaacag 3660 tgcaaaacgt tcaaaaactg tctggcaata caagttccac tttgaccaaa acggctggca 3720 gtaaaagggt taagaagact gtcagccttg agcggtatca gctcactcaa aggcggtaat 3780 acggttatcc acagaatcag gggataacgc aggaaagaac atgtgagcaa aaggccagca 3840 aaaggccagg aaccgtaaaa aggccgcgtt gctggcgttt ttccataggc tccgcccccc 3900 tgacgagcat cacaaaaaatc gacgctcaag tcagaggtgg cgaaacccga caggactata 3960 aagataccag gcgtttcccc ctggaagctc cctcgtgcgc tctcctgttc cgaccctgcc 4020 gcttaccgga tacctgtccg cctttctccc ttcgggaagc gtggcgcttt ctcatagctc 4080 acgctgtagg tatctcagtt cggtgtaggt cgttcgctcc aagctggggct gtgtgcacga 4140 accccccgtt cagcccgacc gctgcgccctt atccggtaac tatcgtcttg agtccaaccc 4200 ggtaagacac gacttatcgc cactggcagc agccactggt aacaggatta gcagagcgag 4260 gtatgtaggc ggtgctacag agttcttgaa gtggtgggct aactacggct acactagaag 4320 aacagtattt ggtatctgcg ctctgctgaa gccagttacc ttcggaaaaa gagttggtag 4380 ctcttgatcc ggcaaacaaa ccaccgctgg tagcggtggt ttttttgttt gcaagcagca 4440 gattacgcgc agaaaaaaag gatctcaaga agatcctttg atcttttcta cggggtctga 4500 cgctcagtgg aacgacgcgc gcgtaactca cgttaaggga ttttggtcat gagttagaaa 4560 aactcatcga gcatcaaatg aaactgcaat ttattcatat caggattatc aataccatat 4620 ttttgaaaaa gccgtttctg taatgaagga gaaaactcac cgaggcagtt ccataggatg 4680 gcaagatcct ggtatcggtc tgcgattccg actcgtccaa catcaataca acctattaat 4740 ttcccctcgt caaaaataag gttatcaagt gagaaatcac catgagtgac gactgaatcc 4800 ggtgagaatg gcaaaagttt atgcatttct ttccagactt gttcaacagg ccagccatta 4860 cgctcgtcat caaaatcact cgcatcaacc aaaccgttat tcattcgtga ttgcgcctga 4920 gcgaggcgaa atacgcgatc gctgttaaaa ggacaattac aaacaggaat cgagtgcaac 4980 cggcgcagga acactgccag cgcatcaaca atattttcac ctgaatcagg atattcttct 5040 aatacctgga acgctgtttt tccggggatc gcagtggtga gtaaccatgc atcatcagga 5100 gtacggataa aatgcttgat ggtcggaagt ggcataaatt ccgtcagcca gtttagtctg 5160 accatctcat ctgtaacatc attggcaacg ctacctttgc catgtttcag aaaaactct 5220 ggcgcatcgg gcttcccata caagcgatag attgtcgcac ctgattgccc gacattatcg 5280 cgagcccatt tatacccata taaatcagca tccatgttgg aatttaatcg cggcctcgac 5340 gtttcccgtt ggatatggct cattttttac ttcctcacct tgtcgtatta tactatgccg 5400 atatactatg ccgatgatta attgtcgaca ctgcgggggc tctgtgtggt aagcaggtct 5460 taacctttt actgccaatg acgcatggga tacgtcgtgg cagtaaaagg gcttaaatgc 5520 caacgacgcg tcccatacgt tgttggcatt ttaattcttc tctctgcagc ggcagcatgt 5580 gccgccgctg cagagagttt ctagcgatga cagcccctct gggcaacgag ccggggggc 5640 tgtctttct tatgttttaa atgcactgac ctcccacatt ccctttttag taaaatattc 5700 agaataatt taaatacatc attgcaatga aaataaatgt tttttattag gcagaatcca 5760 gatgctcaag gcccttcata atatccccca gtttagtagt tggacttagg gaacaaagga 5820 acctttaata gaaattggac agcaagaaag cgagtcaggc accgggcttg cgggtcatgc 5880 accaggtgcg cggtccttcg ggcacctcga cgtcggcggt gacggtgaag ccgagccgct 5940 cgtagaaggg gaggttgcgg ggcgcggatg tctccaggaa ggcgggcacc ccggcgcgct 6000 cggccgcctc cactccgggg agcacgacgg cgctgcccag acccttgccc tggtggtcgg 6060 gcgacacgcc gacggtggcc aggaaccacg cgggctcctt gggccggtgc ggcgccagga 6120 ggccttccat ctgttgctgc gcggccagcc gggaaccgct caactcggcc atgcgcgggc 6180 cgatctcggc gaacaccgcc cccgcttcga cgctctccgg cgtggtccag accgccaccg 6240 cggcgccgtc gtccgcgacc cacaccttgc cgatgtcgag cccgacgcgc gtgaggaaga 6300 gttcttgcag ctcggtgacc cgctcgatgt ggcggtccgg atcgacggtg tggcgcgtgg 6360 cggggtagtc ggcgaacgcg gcggcgaggg tgcgtacggc cctggggacg tcgtcgcggg 6420 tggcgaggcg caccgtgggc ttgtactcgg tcatggtggc ggacgaaagg cccggagatg 6480 aggaagagga gaacagcgcg gcagacgtgc gcttttgaag cgtgcagaat gccgggcctc 6540 cggaggacct tcgggcgccc gccccgcccc tgagcccgcc cctgagcccg cccccggacc 6600 caccccttcc cagcctctga gcccagaaag cgaaggagca aagctgctat tggccgctgc 6660 cccaaaggcc tacccgcttc cattgctcag cggtgctgtc catctgcacg agactagtga 6720 gtcgtgctac ttccatttgt cacgtcctgc acgacgcgag ctgcggggcg ggggggaact 6780 tcctgactag gggaggagta gaaggtggcg cgaaggggcc accaaagaac ggagccggtt 6840 ggcgcctacc ggtggatgtg gaatgtgtgc gaggccagag gccacttgtg tagcgccaag 6900 tgcccagcgg ggctgctaaa gcgcatgctc cagactgcct tgggaaaagc gcctccccta 6960 cccggtagag aaacttgatc tgtcgccgca attcaaactt cgtgaggctc cggtgcccgt 7020 cagtgacctg ctatactctg gagacgactt acggtaaatg gcccgcctgg ctgaccgccc 7080 aacgaccccc gcccattgac gtcaataatg acgtatgttc ccatagtaac gccaataggg 7140 actttccatt gacgtcaatg ggtggagtat ttacggtaaa ctgcccactt ggcagtacat 7200 caagtgtatc atatgccaag tccgccccct attgacgtca atgacggtaa atggcccgcc 7260 tggcattatg cccagtacat gaccttacgg gactttccta cttggcagta catctacgta 7320 ttagtcatcg ctattaccat gctgatgcgg ttttggcagt acaccaatgg gcgtggatag 7380 cggtttgact cacggggatt tccaagtctc caccccattg acgtcaatgg gagtttgttt 7440 tggcaccaaa atcaacggga ctttccaaaa tgtcgtaata accccgcccc gttgacgcaa 7�00 atgggcggta ggcgtgtacg gtgggaggtc tatataagca gagctcgttt agtgaaccgt 7560 cagatcgcct ggagaggcca tccacgctgt tttgacctcc atagtggaca ccgggaccga 7620 tccagcctcc gcgtctcagg 7640 <210> 58 <211> 438 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide, MICA-Fc <400> 58 Glu Pro His Ser Leu Arg Tyr Asn Leu Thr Val Leu Ser Trp Asp Gly 1 5 10 15 Ser Val Gln Ser Gly Phe Leu Thr Glu Val His Leu Asp Gly Gln Pro 20 25 30 Phe Leu Arg Cys Asp Arg Gln Lys Cys Arg Ala Lys Pro Gln Gly Gln 35 40 45 Trp Ala Glu Asp Val Leu Gly Asn Lys Thr Trp Asp Arg Glu Thr Arg 50 55 60 Asp Leu Thr Gly Asn Gly Lys Asp Leu Arg Met Thr Leu Ala His Ile 65 70 75 80 Lys Asp Gln Lys Glu Gly Leu His Ser Leu Gln Glu Ile Arg Val Cys 85 90 95 Glu Ile His Glu Asp Asn Ser Thr Arg Ser Ser Gln His Phe Tyr Tyr 100 105 110 Asp Gly Glu Leu Phe Leu Ser Gln Asn Leu Glu Thr Lys Glu Trp Thr 115 120 125 Met Pro Gln Ser Ser Arg Ala Gln Thr Leu Ala Met Asn Val Arg Asn 130 135 140 Phe Leu Lys Glu Asp Ala Met Lys Thr Lys Thr His Tyr His Ala Met 145 150 155 160 His Ala Asp Cys Leu Gln Glu Leu Arg Arg Tyr Leu Lys Ser Gly Val 165 170 175 Val Leu Arg Arg Thr Val Pro Pro Met Val Asn Val Thr Arg Ser Glu 180 185 190 Ala Ser Glu Gly Asn Ile Thr Val Thr Cys Arg Ala Ser Gly Phe Tyr 195 200 205 Pro Trp Asn Ile Thr Leu Ser Trp Arg Gln Asp Gly Val Ser Leu Ser 210 215 220 His Asp Thr Gln Gln Trp Gly Asp Val Leu Pro Asp Gly Asn Gly Thr 225 230 235 240 Tyr Gln Thr Trp Val Ala Thr Arg Ile Ser Gln Gly Glu Glu Gln Arg 245 250 255 Phe Thr Cys Tyr Met Glu His Ser Gly Asn His Ser Thr His Pro Val 260 265 270 Pro Ser Gly Lys Ile Glu Gly Arg Met Asp Pro Lys Ser Cys Asp Lys 275 280 285 Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro 290 295 300 Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser 305 310 315 320 Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu Asp 325 330 335 Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn 340 345 350 Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val 355 360 365 Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu 370 375 380 Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys 385 390 395 400 Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr 405 410 415 Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Thr 420 425 430 Cys Leu Val Lys Gly Phe 435 <210> 59 <211> 513 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide, MICwed-Fc <400> 59 Glu Pro His Ser Leu Arg Tyr Asn Leu Thr Val Leu Ser Trp Asp Gly 1 5 10 15 Ser Val Gln Ser Gly Phe Leu Thr Glu Val His Leu Asp Gly Gln Pro 20 25 30 Phe Leu Arg Cys Asp Arg Gln Lys Cys Arg Ala Lys Pro Gln Gly Gln 35 40 45 Trp Ala Glu Asp Val Leu Gly Asn Lys Thr Trp Asp Arg Glu Thr Arg 50 55 60 Asp Leu Thr Gly Trp Gly Lys Asp Leu Arg Met Thr Leu Ala His Ile 65 70 75 80 Lys Asp Gln Lys Glu Gly Leu His Ser Leu Gln Glu Ile Arg Val Cys 85 90 95 Glu Ile His Glu Asp Asn Ser Thr Arg Ser Ser Gln His Phe Tyr Tyr 100 105 110 Asp Gly Glu Leu Phe Leu Ser Gln Asn Leu Glu Thr Lys Glu Trp Thr 115 120 125 Met Pro Gln Ser Ser Arg Ala Gln Thr Leu Ala Met Asn Val Arg Asn 130 135 140 Phe Leu Lys Glu Asp Ala Met Glu Thr Asp Thr His Tyr His Ala Met 145 150 155 160 His Ala Asp Cys Leu Gln Glu Leu Arg Arg Tyr Leu Lys Ser Gly Val 165 170 175 Val Leu Arg Arg Thr Val Pro Pro Met Val Asn Val Thr Arg Ser Glu 180 185 190 Ala Ser Glu Gly Asn Ile Thr Val Thr Cys Arg Ala Ser Gly Phe Tyr 195 200 205 Pro Trp Asn Ile Thr Leu Ser Trp Arg Gln Asp Gly Val Ser Leu Ser 210 215 220 His Asp Thr Gln Gln Trp Gly Asp Val Leu Pro Asp Gly Asn Gly Thr 225 230 235 240 Tyr Gln Thr Trp Val Ala Thr Arg Ile Ser Gln Gly Glu Glu Gln Arg 245 250 255 Phe Thr Cys Tyr Met Glu His Ser Gly Asn His Ser Thr His Pro Val 260 265 270 Pro Ser Gly Lys Ile Glu Gly Arg Met Asp Pro Lys Ser Cys Asp Lys 275 280 285 Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro 290 295 300 Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser 305 310 315 320 Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu Asp 325 330 335 Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn 340 345 350 Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val 355 360 365 Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu 370 375 380 Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys 385 390 395 400 Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr 405 410 415 Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Thr 420 425 430 Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu 435 440 445 Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu 450 455 460 Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys 465 470 475 480 Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu 485 490 495 Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly 500 505 510 Lys <210> 60 <211> 513 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide, MICv25-Fc <400> 60 Glu Pro His Ser Leu Arg Tyr Asn Leu Thr Val Leu Ser Trp Asp Gly 1 5 10 15 Ser Val Gln Ser Gly Phe Leu Thr Glu Val His Leu Asp Gly Gln Pro 20 25 30 Phe Leu Arg Cys Asp Arg Gln Lys Cys Arg Ala Lys Pro Gln Gly Gln 35 40 45 Trp Ala Glu Asp Val Leu Gly Asn Lys Thr Trp Asp Arg Glu Thr Arg 50 55 60 Asp Leu Thr Gly Trp Gly Lys Asp Leu Arg Met Thr Leu Ala His Ile 65 70 75 80 Lys Asp Gln Lys Glu Gly Leu His Ser Leu Gln Glu Ile Arg Val Cys 85 90 95 Glu Ile His Glu Asp Asn Ser Thr Arg Ser Ser Gln His Phe Tyr Tyr 100 105 110 Asp Gly Glu Leu Phe Leu Ser Gln Asn Leu Glu Thr Leu Glu Trp Thr 115 120 125 Met Pro Gln Ser Ser Arg Ala Gln Thr Leu Ala Met Asn Val Arg Asn 130 135 140 Phe Leu Lys Glu Asp Ala Met Glu Thr Asp Thr His Tyr His Ala Met 145 150 155 160 Arg Ala Asp Cys Leu Ser Glu Leu Arg Arg Tyr Leu Lys Ser Gly Val 165 170 175 Val Leu Arg Arg Thr Val Pro Pro Met Val Asn Val Thr Arg Ser Glu 180 185 190 Ala Ser Glu Gly Asn Ile Thr Val Thr Cys Arg Ala Ser Gly Phe Tyr 195 200 205 Pro Trp Asn Ile Thr Leu Ser Trp Arg Gln Asp Gly Val Ser Leu Ser 210 215 220 His Asp Thr Gln Gln Trp Gly Asp Val Leu Pro Asp Gly Asn Gly Thr 225 230 235 240 Tyr Gln Thr Trp Val Ala Thr Arg Ile Ser Gln Gly Glu Glu Gln Arg 245 250 255 Phe Thr Cys Tyr Met Glu His Ser Gly Asn His Ser Thr His Pro Val 260 265 270 Pro Ser Gly Lys Ile Glu Gly Arg Met Asp Pro Lys Ser Cys Asp Lys 275 280 285 Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro 290 295 300 Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser 305 310 315 320 Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu Asp 325 330 335 Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn 340 345 350 Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val 355 360 365 Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu 370 375 380 Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys 385 390 395 400 Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr 405 410 415 Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Thr 420 425 430 Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu 435 440 445 Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu 450 455 460 Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys 465 470 475 480 Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu 485 490 495 Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly 500 505 510 Lys <210> 61 <211> 189 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide ULBP2 α1-α2 <400> 61 Ala Ala Glu Pro His Ser Leu Ser Tyr Asp Ile Thr Val Ile Pro Lys 1 5 10 15 Phe Arg Pro Gly Pro Arg Trp Cys Ala Val Gln Gly Gln Val Asp Glu 20 25 30 Lys Thr Phe Leu His Tyr Asp Cys Gly Asn Lys Thr Val Thr Pro Val 35 40 45 Ser Pro Leu Gly Lys Lys Leu Asn Val Thr Thr Ala Trp Lys Ala Gln 50 55 60 Asn Pro Val Leu Arg Glu Val Val Asp Ile Leu Thr Glu Gln Leu Arg 65 70 75 80 Asp Ile Gln Leu Glu Asn Tyr Thr Pro Lys Glu Pro Leu Thr Leu Gln 85 90 95 Ala Arg Met Ser Cys Glu Gln Lys Ala Glu Gly His Ser Ser Gly Ser 100 105 110 Trp Gln Phe Ser Phe Asp Gly Gln Ile Phe Leu Leu Phe Asp Ser Glu 115 120 125 Lys Arg Met Trp Thr Thr Val His Pro Gly Ala Arg Lys Met Lys Glu 130 135 140 Lys Trp Glu Asn Asp Lys Val Val Ala Met Ser Phe His Tyr Phe Ser 145 150 155 160 Met Gly Asp Cys Ile Gly Trp Leu Glu Asp Phe Leu Met Gly Met Asp 165 170 175 Ser Thr Leu Glu Pro Ser Ala Gly Ala Pro Pro Met Val 180 185 <210> 62 <211> 187 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide ULBP3 α1-α2 <400> 62 Ala Ala Glu Pro His Ser Leu Trp Tyr Asn Phe Thr Ile Ile His Leu 1 5 10 15 Pro Arg His Gly Gln Gln Trp Cys Glu Val Gln Ser Gln Val Asp Gln 20 25 30 Lys Asn Phe Leu Ser Tyr Asp Cys Gly Ser Asp Lys Val Leu Ser Met 35 40 45 Gly His Leu Glu Glu Gln Leu Tyr Ala Thr Asp Ala Trp Gly Lys Gln 50 55 60 Leu Glu Met Leu Arg Glu Val Gly Gln Arg Leu Arg Leu Glu Leu Ala 65 70 75 80 Asp Thr Glu Leu Glu Asp Phe Thr Pro Ser Gly Pro Leu Thr Leu Gln 85 90 95 Val Arg Met Ser Cys Glu Ser Glu Ala Asp Gly Tyr Ile Arg Gly Ser 100 105 110 Trp Gln Phe Ser Phe Asp Gly Arg Lys Phe Leu Leu Phe Asp Ser Asn 115 120 125 Asn Arg Lys Trp Thr Val Val His Ala Gly Ala Arg Arg Met Lys Glu 130 135 140 Lys Trp Glu Lys Asp Ser Gly Leu Thr Thr Phe Phe Lys Met Val Ser 145 150 155 160 Met Arg Asp Cys Lys Ser Trp Leu Arg Asp Phe Leu Met His Arg Lys 165 170 175 Lys Arg Leu Glu Pro Thr Ala Pro Pro Met Val 180 185 <210> 63 <211> 186 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide, ULBP2 R80W <400> 63 Ala Ala Glu Pro His Ser Leu Ser Tyr Asp Ile Thr Val Ile Pro Lys 1 5 10 15 Phe Arg Pro Gly Pro Arg Trp Cys Ala Val Gln Gly Gln Val Asp Glu 20 25 30 Lys Thr Phe Leu His Tyr Asp Cys Gly Asn Lys Thr Val Thr Pro Val 35 40 45 Ser Pro Leu Gly Lys Lys Leu Asn Val Thr Thr Ala Trp Lys Ala Gln 50 55 60 Asn Pro Val Leu Arg Glu Val Val Asp Ile Leu Thr Glu Gln Leu Trp 65 70 75 80 Asp Ile Gln Leu Glu Asn Tyr Thr Pro Lys Glu Pro Leu Thr Leu Gln 85 90 95 Ala Arg Met Ser Cys Glu Gln Lys Ala Glu Gly His Ser Ser Gly Ser 100 105 110 Trp Gln Phe Ser Phe Asp Gly Gln Ile Phe Leu Leu Phe Asp Ser Glu 115 120 125 Lys Arg Met Trp Thr Thr Val His Pro Gly Ala Arg Lys Met Lys Glu 130 135 140 Lys Trp Glu Asn Asp Lys Val Val Ala Met Ser Phe His Tyr Phe Ser 145 150 155 160 Met Gly Asp Cys Ile Gly Trp Leu Glu Asp Phe Leu Met Gly Met Asp 165 170 175 Ser Thr Leu Glu Pro Ser Ala Gly Ala Pro 180 185 <210> 64 <211> 186 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide, ULBP2 V151D <400> 64 Ala Ala Glu Pro His Ser Leu Ser Tyr Asp Ile Thr Val Ile Pro Lys 1 5 10 15 Phe Arg Pro Gly Pro Arg Trp Cys Ala Val Gln Gly Gln Val Asp Glu 20 25 30 Lys Thr Phe Leu His Tyr Asp Cys Gly Asn Lys Thr Val Thr Pro Val 35 40 45 Ser Pro Leu Gly Lys Lys Leu Asn Val Thr Thr Ala Trp Lys Ala Gln 50 55 60 Asn Pro Val Leu Arg Glu Val Val Asp Ile Leu Thr Glu Gln Leu Arg 65 70 75 80 Asp Ile Gln Leu Glu Asn Tyr Thr Pro Lys Glu Pro Leu Thr Leu Gln 85 90 95 Ala Arg Met Ser Cys Glu Gln Lys Ala Glu Gly His Ser Ser Gly Ser 100 105 110 Trp Gln Phe Ser Phe Asp Gly Gln Ile Phe Leu Leu Phe Asp Ser Glu 115 120 125 Lys Arg Met Trp Thr Thr Val His Pro Gly Ala Arg Lys Met Lys Glu 130 135 140 Lys Trp Glu Asn Asp Lys Asp Val Ala Met Ser Phe His Tyr Phe Ser 145 150 155 160 Met Gly Asp Cys Ile Gly Trp Leu Glu Asp Phe Leu Met Gly Met Asp 165 170 175 Ser Thr Leu Glu Pro Ser Ala Gly Ala Pro 180 185 <210> 65 <211> 184 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide, ULBP3 R162G <400> 65 Ala Ala Glu Pro His Ser Leu Trp Tyr Asn Phe Thr Ile Ile His Leu 1 5 10 15 Pro Arg His Gly Gln Gln Trp Cys Glu Val Gln Ser Gln Val Asp Gln 20 25 30 Lys Asn Phe Leu Ser Tyr Asp Cys Gly Ser Asp Lys Val Leu Ser Met 35 40 45 Gly His Leu Glu Glu Gln Leu Tyr Ala Thr Asp Ala Trp Gly Lys Gln 50 55 60 Leu Glu Met Leu Arg Glu Val Gly Gln Arg Leu Arg Leu Glu Leu Ala 65 70 75 80 Asp Thr Glu Leu Glu Asp Phe Thr Pro Ser Gly Pro Leu Thr Leu Gln 85 90 95 Val Arg Met Ser Cys Glu Ser Glu Ala Asp Gly Tyr Ile Arg Gly Ser 100 105 110 Trp Gln Phe Ser Phe Asp Gly Arg Lys Phe Leu Leu Phe Asp Ser Asn 115 120 125 Asn Arg Lys Trp Thr Val Val His Ala Gly Ala Arg Arg Met Lys Glu 130 135 140 Lys Trp Glu Lys Asp Ser Gly Leu Thr Thr Phe Phe Lys Met Val Ser 145 150 155 160 Met Gly Asp Cys Lys Ser Trp Leu Arg Asp Phe Leu Met His Arg Lys 165 170 175 Lys Arg Leu Glu Pro Thr Ala Pro 180 <210> 66 <211> 182 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide, MICA25.17 <400> 66 Glu Pro His Ser Leu Arg Tyr Asn Leu Thr Val Leu Ser Trp Asp Gly 1 5 10 15 Ser Val Gln Ser Gly Phe Leu Thr Glu Val His Leu Asp Gly Gln Pro [[ID=3�]]20 25 30 Phe Leu Arg Cys Asp Arg Gln Lys Cys Arg Ala Lys Pro Gln Gly Gln 35 40 45 Trp Ala Glu Asp Val Leu Gly Asn Lys Thr Trp Asp Arg Glu Thr Arg 50 55 60 Asp Leu Thr Gly Trp Gly Thr Thr Leu Leu Met Thr Leu Ala His Ile 65 70 75 80 Lys Asp Gln Lys Glu Gly Leu His Ser Leu Gln Glu Ile Arg Val Cys 85 90 95 Glu Ile His Glu Asp Asn Ser Thr Arg Ser Ser Gln His Phe Tyr Tyr 100 105 110 Asp Gly Glu Leu Phe Leu Ser Gln Asn Leu Glu Thr Leu Glu Trp Thr 115 120 125 Met Pro Gln Ser Ser Arg Ala Gln Thr Leu Ala Met Asn Val Arg Asn 130 135 140 Phe Leu Lys Glu Asp Ala Met Glu Thr Asp Ile Gly Tyr Arg Leu Met 145 150 155 160 Arg Ala Asp Cys Leu Ser Glu Leu Arg Arg Tyr Leu Lys Ser Gly Val 165 170 175 Val Leu Arg Arg Thr Val 180 <210> 67 <211> 182 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide, MICA25.18 <400> 67 Glu Pro His Ser Leu Arg Tyr Asn Leu Thr Val Leu Ser Trp Asp Gly 1 5 10 15 Ser Val Gln Ser Gly Phe Leu Thr Glu Val His Leu Asp Gly Gln Pro 20 25 30 Phe Leu Arg Cys Asp Arg Gln Lys Cys Arg Ala Lys Pro Gln Gly Gln 35 40 45 Trp Ala Glu Asp Val Leu Gly Asn Lys Thr Trp Asp Arg Glu Thr Arg 50 55 60 Asp Leu Thr Gly Trp Gly Thr Phe Leu Arg Met Thr Leu Ala His Ile 65 70 75 80 Lys Asp Gln Lys Glu Gly Leu His Ser Leu Gln Glu Ile Arg Val Cys 85 90 95 Glu Ile His Glu Asp Asn Ser Thr Arg Ser Ser Gln His Phe Tyr Tyr 100 105 110 Asp Gly Glu Leu Phe Leu Ser Gln Asn Leu Glu Thr Leu Glu Trp Thr 115 120 125 Met Pro Gln Ser Ser Arg Ala Gln Thr Leu Ala Met Asn Val Arg Asn 130 135 140 Phe Leu Lys Glu Asp Ala Met Glu Thr Asp Arg Ser Gly Leu Leu Met 145 150 155 160 Arg Ala Asp Cys Leu Ser Glu Leu Arg Arg Tyr Leu Lys Ser Gly Val 165 170 175 Val Leu Arg Arg Thr Val 180 <210> 68 <211> 186 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide, ULBP2.S1 <400> 68 Ala Ala Glu Pro His Ser Leu Ser Tyr Asp Ile Thr Val Ile Pro Lys 1 5 10 15 Phe Arg Pro Gly Pro Arg Trp Cys Ala Val Gln Gly Gln Val Asp Glu 20 25 30 Lys Thr Phe Leu His Tyr Asp Cys Gly Asn Lys Thr Val Thr Pro Val 35 40 45 Ser Pro Leu Gly Lys Lys Leu Asn Val Thr Thr Ala Trp Lys Ala Gln 50 55 60 Asn Pro Val Leu Arg Glu Val Val Asp Ile Leu Thr Glu Gln Leu Trp 65 70 75 80 Asp Ile Gln Leu Glu Asn Tyr Thr Pro Lys Glu Pro Leu Thr Leu Gln 85 90 95 Ala Arg Met Ser Cys Glu Gln Lys Ala Glu Gly His Ser Ser Gly Ser 100 105 110 Trp Gln Phe Ser Phe Asp Gly Gln Ile Phe Leu Leu Phe Asp Ser Glu 115 120 125 Lys Arg Met Trp Thr Thr Val His Pro Gly Ala Arg Lys Met Lys Glu 130 135 140 Lys Trp Glu Asn Asp Lys Val Val Ala Thr Thr Leu Tyr Thr Trp Ser 145 150 155 160 Met Gly Asp Cys Ile Gly Trp Leu Glu Asp Phe Leu Met Gly Met Asp 165 170 175 Ser Thr Leu Glu Pro Ser Ala Gly Ala Pro 180 185 <210> 69 <211> 186 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide, ULBP2.S2 <400> 69 Ala Ala Glu Pro His Ser Leu Ser Tyr Asp Ile Thr Val Ile Pro Lys 1 5 10 15 Phe Arg Pro Gly Pro Arg Trp Cys Ala Val Gln Gly Gln Val Asp Glu 20 25 30 Lys Thr Phe Leu His Tyr Asp Cys Gly Asn Lys Thr Val Thr Pro Val 35 40 45<[ Ser Pro Leu Gly Lys Lys Leu Asn Val Thr Thr Ala Trp Lys Ala Gln 50 55 60 Asn Pro Val Leu Arg Glu Val Val Asp Ile Leu Thr Glu Gln Leu Trp 65 70 75 80 Asp Ile Gln Leu Glu Asn Tyr Thr Pro Lys Glu Pro Leu Thr Leu Gln 85 90 95 Ala Arg Met Ser Cys Glu Gln Lys Ala Glu Gly His Ser Ser Gly Ser 100 105 110 Trp Gln Phe Ser Phe Asp Gly Gln Ile Phe Leu Leu Phe Asp Ser Glu 115 120 125 Lys Arg Met Trp Thr Thr Val His Pro Gly Ala Arg Lys Met Lys Glu 130 135 140 Lys Trp Glu Asn Asp Lys Val Val Ala Thr Leu Met Arg Ile Trp Ser 145 150 155 160 Met Gly Asp Cys Ile Gly Trp Leu Glu Asp Phe Leu Met Gly Met Asp 165 170 175 Ser Thr Leu Glu Pro Ser Ala Gly Ala Pro 180 185 <210> 70 <211> 186 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide, ULBP2.S3 <400> 70 Ala Ala Glu Pro His Ser Leu Ser Tyr Asp Ile Thr Val Ile Pro Lys 1 5 10 15 Phe Arg Pro Gly Pro Arg Trp Cys Ala Val Gln Gly Gln Val Asp Glu 20 25 30 Lys Thr Phe Leu His Tyr Asp Cys Gly Asn Lys Thr Val Thr Pro Val 35 40 45 Ser Pro Leu Gly Lys Lys Leu Asn Val Thr Thr Ala Trp Lys Ala Gln 50 55 60 Asn Pro Val Leu Arg Glu Val Val Asp Ile Leu Thr Glu Gln Leu Trp 65 70 75 80 Asp Ile Gln Leu Glu Asn Tyr Thr Pro Lys Glu Pro Leu Thr Leu Gln 85 90 95 Ala Arg Met Ser Cys Glu Gln Lys Ala Glu Gly His Ser Ser Gly Ser 100 105 110 Trp Gln Phe Ser Phe Asp Gly Gln Ile Phe Leu Leu Phe Asp Ser Glu 115 120 125 Lys Arg Met Trp Thr Thr Val His Pro Gly Ala Arg Lys Met Lys Glu 130 135 140 Lys Trp Glu Asn Asp Lys Val Val Ala Thr Lys Leu Tyr Leu Trp Ser 145 150 155 160 Met Gly Asp Cys Ile Gly Trp Leu Glu Asp Phe Leu Met Gly Met Asp 165 170 175 Ser Thr Leu Glu Pro Ser Ala Gly Ala Pro 180 185 <210> 71 <211> 184 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide, ULBP3.S1 <400> 71 Ala Ala Glu Pro His Ser Leu Trp Tyr Asn Phe Thr Ile Ile His Leu 1 5 10 15 Pro Arg His Gly Gln Gln Trp Cys Glu Val Gln Ser Gln Val Asp Gln 20 25 30 Lys Asn Phe Leu Ser Tyr Asp Cys Gly Ser Asp Lys Val Leu Ser Met 35 40 45 Gly His Leu Glu Glu Gln Leu Tyr Ala Thr Asp Ala Trp Gly Lys Gln 50 55 60 Leu Glu Met Leu Arg Glu Val Gly Gln Arg Leu Arg Leu Glu Leu Ala 65 70 75 80 Asp Thr Glu Leu Glu Asp Phe Thr Pro Ser Gly Pro Leu Thr Leu Gln 85 90 95 Val Arg Met Ser Cys Glu Ser Glu Ala Asp Gly Tyr Ile Arg Gly Ser 100 105 110 Trp Gln Phe Ser Phe Asp Gly Arg Lys Phe Leu Leu Phe Asp Ser Asn 115 120 125 Asn Arg Lys Trp Thr Val Val His Ala Gly Ala Arg Arg Met Lys Glu 130 135 140 Lys Trp Glu Lys Asp Ser Gly Leu Thr Thr Asp Leu Ile Arg Arg Ser 145 150 155 160 Met Gly Asp Cys Lys Ser Trp Leu Arg Asp Phe Leu Met His Arg Lys 165 170 175 Lys Arg Leu Glu Pro Thr Ala Pro 180 <210> 72 <211> 184 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide ULBP3.S2 <400> 72 Ala Ala Glu Pro His Ser Leu Trp Tyr Asn Phe Thr Ile Ile His Leu 1 5 10 15 Pro Arg His Gly Gln Gln Trp Cys Glu Val Gln Ser Gln Val Asp Gln 20 25 30 Lys Asn Phe Leu Ser Tyr Asp Cys Gly Ser Asp Lys Val Leu Ser Met 35 40 45 Gly His Leu Glu Glu Gln Leu Tyr Ala Thr Asp Ala Trp Gly Lys Gln 50 55 60 Leu Glu Met Leu Arg Glu Val Gly Gln Arg Leu Arg Leu Glu Leu Ala 65 70 75 80 Asp Thr Glu Leu Glu Asp Phe Thr Pro Ser Gly Pro Leu Thr Leu Gln 85 90 95 Val Arg Met Ser Cys Glu Ser Glu Ala Asp Gly Tyr Ile Arg Gly Ser 100 105 110 Trp Gln Phe Ser Phe Asp Gly Arg Lys Phe Leu Leu Phe Asp Ser Asn 115 120 125 Asn Arg Lys Trp Thr Val Val His Ala Gly Ala Arg Arg Met Lys Glu 130 135 140 Lys Trp Glu Lys Asp Ser Gly Leu Thr Thr Tyr Phe Tyr Leu Arg Ser 145 150 155 160 Met Gly Asp Cys Lys Ser Trp Leu Arg Asp Phe Leu Met His Arg Lys 165 170 175 Lys Arg Leu Glu Pro Thr Ala Pro 180 <210> 73 <211> 657 <212> PRT <213> Artificial Sequence <220> <223> synthetic peptide, R3 HC25.17 <400> 73 Met Arg Pro Ile Val Leu Val Leu Leu Phe Ala Thr Ser Ala Leu Ala 1 5 10 15 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 20 25 30 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Thr Ser Thr 35 40 45 Gly Ile Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 50 55 60 Gly Arg Ile Tyr Pro Thr Asn Gly Ser Thr Asn Tyr Ala Asp Ser Val 65 70 75 80 Lys Gly Arg Phe Thr Ile Ser Ala Asp Thr Ser Lys Asn Thr Ala Tyr 85 90 95 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 100 105 110 Ala Arg Thr Tyr Gly Ile Tyr Asp Leu Tyr Val Asp Tyr Thr Glu Tyr 115 120 125 Val Met Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Ala 130 135 140 Ser Thr Lys Gly Pro Ser Val Phe Pro Leu Ala Pro Ser Ser Lys Ser 145 150 155 160 Thr Ser Gly Gly Thr Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr Phe 165 170 175 Pro Glu Pro Val Thr Val Ser Trp Asn Ser Gly Ala Leu Thr Ser Gly 180 185 190 Val His Thr Phe Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser Leu 195 200 205 Ser Ser Val Val Thr Val Pro Ser Ser Ser Leu Gly Thr Gln Thr Tyr 210 215 220 Ile Cys Asn Val Asn His Lys Pro Ser Asn Thr Lys Val Asp Lys Lys 225 230 235 240 Val Glu Pro Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro 245 250 255 Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys 260 265 270 Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val 275 280 285 Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr 290 295 300 Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu 305 310 315 320 Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His 325 330 335 Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys 340 345 350 Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln 355 360 365 Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu 370 375 380 Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro 385 390 395 400 Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn 405 410 415 Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu 420 425 430 Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val 435 440 445 Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln 450 455 460 Lys Ser Leu Ser Leu Ser Pro Gly Gly Gly Gly Ser Glu Pro His Ser 465 470 475 480 Leu Arg Tyr Asn Leu Thr Val Leu Ser Trp Asp Gly Ser Val Gln Ser 485 490 495 Gly Phe Leu Thr Glu Val His Leu Asp Gly Gln Pro Phe Leu Arg Cys 500 505 510 Asp Arg Gln Lys Cys Arg Ala Lys Pro Gln Gly Gln Trp Ala Glu Asp 515 520 525 Val Leu Gly Asn Lys Thr Trp Asp Arg Glu Thr Arg Asp Leu Thr Gly 530 535 540 Trp Gly Thr Thr Leu Leu Met Thr Leu Ala His Ile Lys Asp Gln Lys 545 550 555 560 Glu Gly Leu His Ser Leu Gln Glu Ile Arg Val Cys Glu Ile His Glu 565 570 575 Asp Asn Ser Thr Arg Ser Ser Gln His Phe Tyr Tyr Asp Gly Glu Leu 580 585 590 Phe Leu Ser Gln Asn Leu Glu Thr Leu Glu Trp Thr Met Pro Gln Ser 595 600 605 Ser Arg Ala Gln Thr Leu Ala Met Asn Val Arg Asn Phe Leu Lys Glu 610 615 620 Asp Ala Met Glu Thr Asp Ile Gly Tyr Arg Leu Met Arg Ala Asp Cys 625 630 635 640 Leu Ser Glu Leu Arg Arg Tyr Leu Lys Ser Gly Val Val Leu Arg Arg 645 650 655 Thr <210> 74 <211> 656 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide, R3 HC.U2S3 <400> 74 Met Arg Pro Ile Val Leu Val Leu Leu Phe Ala Thr Ser Ala Leu Ala 1 5 10 15 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 20 25 30 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Thr Ser Thr 35 40 45 Gly Ile Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 50 55 60 Gly Arg Ile Tyr Pro Thr Asn Gly Ser Thr Asn Tyr Ala Asp Ser Val 65 70 75 80 Lys Gly Arg Phe Thr Ile Ser Ala Asp Thr Ser Lys Asn Thr Ala Tyr 85 90 95 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 100 105 110 Ala Arg Thr Tyr Gly Ile Tyr Asp Leu Tyr Val Asp Tyr Thr Glu Tyr 115 120 125 Val Met Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Ala 130 135 140 Ser Thr Lys Gly Pro Ser Val Phe Pro Leu Ala Pro Ser Ser Lys Ser 145 150 155 160 Thr Ser Gly Gly Thr Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr Phe 165 170 175 Pro Glu Pro Val Thr Val Ser Trp Asn Ser Gly Ala Leu Thr Ser Gly 180 185 190 Val His Thr Phe Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser Leu 195 200 205 Ser Ser Val Val Thr Val Pro Ser Ser Ser Leu Gly Thr Gln Thr Tyr 210 215 220 Ile Cys Asn Val Asn His Lys Pro Ser Asn Thr Lys Val Asp Lys Lys 225 230 235 240 Val Glu Pro Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro 245 250 255 Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys 260 265 270 Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val 275 280 285 Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr 290 295 300 Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu 305 310 315 320 Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His 325 330 335 Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys 340 345 350 Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln 355 360 365 Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu 370 375 380 Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro 385 390 395 400 Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn 405 410 415 Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu 420 425 430 Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val 435 440 445 Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln 450 455 460 Lys Ser Leu Ser Leu Ser Pro Gly Gly Gly Gly Ser Glu Pro His Ser 465 470 475 480 Leu Ser Tyr Asp Ile Thr Val Ile Pro Lys Phe Arg Pro Gly Pro Arg 485 490 495 Trp Cys Ala Val Gln Gly Gln Val Asp Glu Lys Thr Phe Leu His Tyr 500 505 510 Asp Cys Gly Asn Lys Thr Val Thr Pro Val Ser Pro Leu Gly Lys Lys 515 520 525 Leu Asn Val Thr Thr Ala Trp Lys Ala Gln Asn Pro Val Leu Arg Glu 530 535 540 Val Val Asp Ile Leu Thr Glu Gln Leu Trp Asp Ile Gln Leu Glu Asn 545 550 555 560 Tyr Thr Pro Lys Glu Pro Leu Thr Leu Gln Ala Arg Met Ser Cys Glu 565 570 575 Gln Lys Ala Glu Gly His Ser Ser Gly Ser Trp Gln Phe Ser Phe Asp 580 585 590 Gly Gln Ile Phe Leu Leu Phe Asp Ser Glu Lys Arg Met Trp Thr Thr 595 600 605 Val His Pro Gly Ala Arg Lys Met Lys Glu Lys Trp Glu Asn Asp Lys[[ID=I4]] 610 615 620 Val Val Ala Thr Lys Leu Tyr Leu Trp Ser Met Gly Asp Cys Ile Gly 625 630 635 640 Trp Leu Glu Asp Phe Leu Met Gly Met Asp Ser Thr Leu Glu Pro Ser 645 650 655 <210> 75 <211> 139 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide, non - native NKG2D Y152A extracellular domain <400> 75 Phe Leu Asn Ser Leu Phe Asn Gln Glu Val Gln Ile Pro Leu Thr Glu 1 5 10 15 Ser Tyr Cys Gly Pro Cys Pro Lys Asn Trp Ile Cys Tyr Lys Asn Asn 20 25 30 Cys Tyr Gln Phe Phe Asp Glu Ser Lys Asn Trp Tyr Glu Ser Gln Ala 35 40 45 Ser Cys Met Ser Gln Asn Ala Ser Leu Leu Lys Val Tyr Ser Lys Glu 50 55 60 Asp Gln Asp Leu Leu Lys Leu Val Lys Ser Ala His Trp Met Gly Leu 65 70 75 80 Val His Ile Pro Thr Asn Gly Ser Trp Gln Trp Glu Asp Gly Ser Ile 85 90 95 Leu Ser Pro Asn Leu Leu Thr Ile Ile Glu Met Gln Lys Gly Asp Cys 100 105 110 Ala Leu Tyr Ala Ser Ser Phe Lys Gly Tyr Ile Glu Asn Cys Ser Thr 115 120 125 Pro Asn Thr Tyr Ile Cys Met Gln Arg Thr Val 130 135 <210> 76 <211> 139 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide, non - native NKG2D Y199A extracellular domain <400> 76 Phe Leu Asn Ser Leu Phe Asn Gln Glu Val Gln Ile Pro Leu Thr Glu 1 5 10 15 Ser Tyr Cys Gly Pro Cys Pro Lys Asn Trp Ile Cys Tyr Lys Asn Asn 20 25 30 Cys Tyr Gln Phe Phe Asp Glu Ser Lys Asn Trp Tyr Glu Ser Gln Ala 35 40 45 Ser Cys Met Ser Gln Asn Ala Ser Leu Leu Lys Val Tyr Ser Lys Glu 50 55 60 Asp Gln Asp Leu Leu Lys Leu Val Lys Ser Tyr His Trp Met Gly Leu 65 70 75 80 Val His Ile Pro Thr Asn Gly Ser Trp Gln Trp Glu Asp Gly Ser Ile 85 90 95 Leu Ser Pro Asn Leu Leu Thr Ile Ile Glu Met Gln Lys Gly Asp Cys 100 105 110 Ala Leu Tyr Ala Ser Ser Phe Lys Gly Ala Ile Glu Asn Cys Ser Thr 115 120 125 Pro Asn Thr Tyr Ile Cys Met Gln Arg Thr Val 130 135 <210> 77 <211> 139 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide, non - native NKG2D Y152A / Y199A extracellular domain <400> 77 Phe Leu Asn Ser Leu Phe Asn Gln Glu Val Gln Ile Pro Leu Thr Glu 1 5 10 15 Ser Tyr Cys Gly Pro Cys Pro Lys Asn Trp Ile Cys Tyr Lys Asn Asn 20 25 30 Cys Tyr Gln Phe Phe Asp Glu Ser Lys Asn Trp Tyr Glu Ser Gln Ala 35 40 45 Ser Cys Met Ser Gln Asn Ala Ser Leu Leu Lys Val Tyr Ser Lys Glu 50 55 60 Asp Gln Asp Leu Leu Lys Leu Val Lys Ser Ala His Trp Met Gly Leu 65 70 75 80 Val His Ile Pro Thr Asn Gly Ser Trp Gln Trp Glu Asp Gly Ser Ile 85 90 95 Leu Ser Pro Asn Leu Leu Thr Ile Ile Glu Met Gln Lys Gly Asp Cys 100 105 110 Ala Leu Tyr Ala Ser Ser Phe Lys Gly Ala Ile Glu Asn Cys Ser Thr 115 120 125 Pro Asn Thr Tyr Ile Cys Met Gln Arg Thr Val 130 135 <210> 78 <211> 139 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide, non-natural NKG2D Y199F eNKG2D1 extracellular domain <400> 78 Phe Leu Asn Ser Leu Phe Asn Gln Glu Val Gln Ile Pro Leu Thr Glu 1 5 10 15 Ser Tyr Cys Gly Pro Cys Pro Lys Asn Trp Ile Cys Tyr Lys Asn Asn 20 25 30 Cys Tyr Gln Phe Phe Asp Glu Ser Lys Asn Trp Tyr Glu Ser Gln Ala 35 40 45 Ser Cys Met Ser Gln Asn Ala Ser Leu Leu Lys Val Tyr Ser Lys Glu 50 55 60 Asp Gln Asp Leu Leu Lys Leu Val Lys Ser Tyr His Trp Met Gly Leu 65 70 75 80 Val His Ile Pro Thr Asn Gly Ser Trp Gln Trp Glu Asp Gly Ser Ile 85 90 95 Leu Ser Pro Asn Leu Leu Thr Ile Ile Glu Met Gln Lys Gly Asp Cys 100 105 110 Ala Leu Tyr Ala Ser Ser Phe Lys Gly Phe Ile Glu Asn Cys Ser Thr 115 120 125​​​​​​​​​​​<213> Artificial Sequence <220> <223> Synthetic peptide, non-natural NKG2D Y152S eNKG2D2 extracellular domain <400> 79 Phe Leu Asn Ser Leu Phe Asn Gln Glu Val Gln Ile Pro Leu Thr Glu 1 5 10 15 Ser Tyr Cys Gly Pro Cys Pro Lys Asn Trp Ile Cys Tyr Lys Asn Asn 20 25 30 Cys Tyr Gln Phe Phe Asp Glu Ser Lys Asn Trp Tyr Glu Ser Gln Ala 35 40 45 Ser Cys Met Ser Gln Asn Ala Ser Leu Leu Lys Val Tyr Ser Lys Glu 50 55 60 Asp Gln Asp Leu Leu Lys Leu Val Lys Ser Ser His Trp Met Gly Leu 65 70 75 80 Val His Ile Pro Thr Asn Gly Ser Trp Gln Trp Glu Asp Gly Ser Ile 85 90 95 Leu Ser Pro Asn Leu Leu Thr Ile Ile Glu Met Gln Lys Gly Asp Cys 100 105 110 Ala Leu Tyr Ala Ser Ser Phe Lys Gly Tyr Ile Glu Asn Cys Ser Thr 115 120 125 Pro Asn Thr Tyr Ile Cys Met Gln Arg Thr Val 130 135 <210> 80 <211> 139 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide, non-natural NKG2D Y152T eNKG2D3 extracellular domain <400> 80 Phe Leu Asn Ser Leu Phe Asn Gln Glu Val Gln Ile Pro Leu Thr Glu 1 5 10 15 Ser Tyr Cys Gly Pro Cys Pro Lys Asn Trp Ile Cys Tyr Lys Asn Asn 20 25 30 Cys Tyr Gln Phe Phe Asp Glu Ser Lys Asn Trp Tyr Glu Ser Gln Ala 35 40 45 Ser Cys Met Ser Gln Asn Ala Ser Leu Leu Lys Val Tyr Ser Lys Glu 50 55 60 Asp Gln Asp Leu Leu Lys Leu Val Lys Ser Thr His Trp Met Gly Leu 65 70 75 80 Val His Ile Pro Thr Asn Gly Ser Trp Gln Trp Glu Asp Gly Ser Ile 85 90 95 Leu Ser Pro Asn Leu Leu Thr Ile Ile Glu Met Gln Lys Gly Asp Cys 100 105 110 Ala Leu Tyr Ala Ser Ser Phe Lys Gly Tyr Ile Glu Asn Cys Ser Thr 115 120 125 Pro Asn Thr Tyr Ile Cys Met Gln Arg Thr Val 130 135 <210> 81 <211> 139 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide, non-natural NKG2D Y152V eNKG2D4 extracellular domain <400> 81 Phe Leu Asn Ser Leu Phe Asn Gln Glu Val Gln Ile Pro Leu Thr Glu 1 5 10 15 Ser Tyr Cys Gly Pro Cys Pro Lys Asn Trp Ile Cys Tyr Lys Asn Asn 20 25 30 Cys Tyr Gln Phe Phe Asp Glu Ser Lys Asn Trp Tyr Glu Ser Gln Ala 35 40 45 Ser Cys Met Ser Gln Asn Ala Ser Leu Leu Lys Val Tyr Ser Lys Glu 50 55 60 Asp Gln Asp Leu Leu Lys Leu Val Lys Ser Val His Trp Met Gly Leu 65 70 75 80 Val His Ile Pro Thr Asn Gly Ser Trp Gln Trp Glu Asp Gly Ser Ile 85 90 95 Leu Ser Pro Asn Leu Leu Thr Ile Ile Glu Met Gln Lys Gly Asp Cys 100 105 110 Ala Leu Tyr Ala Ser Ser Phe Lys Gly Tyr Ile Glu Asn Cys Ser Thr 115 120 125 Pro Asn Thr Tyr Ile Cys Met Gln Arg Thr Val 130 135 <210> 82 <211> 139 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide, non - native NKG2D Y152A / Y199F eNKG2D5 Extracellular domain <400> 82 Phe Leu Asn Ser Leu Phe Asn Gln Glu Val Gln Ile Pro Leu Thr Glu<e 1 5 10 15 Ser Tyr Cys Gly Pro Cys Pro Lys Asn Trp Ile Cys Tyr Lys Asn Asn 20 25 30 Cys Tyr Gln Phe Phe Asp Glu Ser Lys Asn Trp Tyr Glu Ser Gln Ala 35 40 45 Ser Cys Met Ser Gln Asn Ala Ser Leu Leu Lys Val Tyr Ser Lys Glu 50 55 60 Asp Gln Asp Leu Leu Lys Leu Val Lys Ser Ala His Trp Met Gly Leu 65 70 75 80 Val His Ile Pro Thr Asn Gly Ser Trp Gln Trp Glu Asp Gly Ser Ile 85 90 95 Leu Ser Pro Asn Leu Leu Thr Ile Ile Glu Met Gln Lys Gly Asp Cys 100 105 110 Ala Leu Tyr Ala Ser Ser Phe Lys Gly Phe Ile Glu Asn Cys Ser Thr 115 120 125 Pro Asn Thr Tyr Ile Cys Met Gln Arg Thr Val 130 135 <210> 83 <211> 139 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide, non - native NKG2D Y152L / Y199F eNKG2D6 Extracellular domain <400> 83 Phe Leu Asn Ser Leu Phe Asn Gln Glu Val Gln Ile Pro Leu Thr Glu 1 5 10 15 Ser Tyr Cys Gly Pro Cys Pro Lys Asn Trp Ile Cys Tyr Lys Asn Asn 20 25 30 Cys Tyr Gln Phe Phe Asp Glu Ser Lys Asn Trp Tyr Glu Ser Gln Ala 35 40 45 Ser Cys Met Ser Gln Asn Ala Ser Leu Leu Lys Val Tyr Ser Lys Glu 50 55 60 Asp Gln Asp Leu Leu Lys Leu Val Lys Ser Leu His Trp Met Gly Leu 65 70 75 80 Val His Ile Pro Thr Asn Gly Ser Trp Gln Trp Glu Asp Gly Ser Ile 85 90 95 Leu Ser Pro Asn Leu Leu Thr Ile Ile Glu Met Gln Lys Gly Asp Cys 100 105 110 Ala Leu Tyr Ala Ser Ser Phe Lys Gly Phe Ile Glu Asn Cys Ser Thr 115 120 125 Pro Asn Thr Tyr Ile Cys Met Gln Arg Thr Val 130 135 <210> 84 <211> 139 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide, non - native NKG2D Y152S / Y199F eNKG2D7 Extracellular domain <400> 84 Phe Leu Asn Ser Leu Phe Asn Gln Glu Val Gln Ile Pro Leu Thr Glu 1 5 10 15 Ser Tyr Cys Gly Pro Cys Pro Lys Asn Trp Ile Cys Tyr Lys Asn Asn 20 25 30 Cys Tyr Gln Phe Phe Asp Glu Ser Lys Asn Trp Tyr Glu Ser Gln Ala 35 40 45 Ser Cys Met Ser Gln Asn Ala Ser Leu Leu Lys Val Tyr Ser Lys Glu 50 55 60 Asp Gln Asp Leu Leu Lys Leu Val Lys Ser Ser His Trp Met Gly Leu 65 70 75 80 Val His Ile Pro Thr Asn Gly Ser Trp Gln Trp Glu Asp Gly Ser Ile 85 90 95 Leu Ser Pro Asn Leu Leu Thr Ile Ile Glu Met Gln Lys Gly Asp Cys 100 105 110 Ala Leu Tyr Ala Ser Ser Phe Lys Gly Phe Ile Glu Asn Cys Ser Thr 115 120 125 Pro Asn Thr Tyr Ile Cys Met Gln Arg Thr Val 130 135 <210> 85 <211> 139 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide, non - native NKG2D Y152T / Y199F eNKG2D8 Extracellular domain <400> 85 Phe Leu Asn Ser Leu Phe Asn Gln Glu Val Gln Ile Pro Leu Thr Glu 1 5 10 15 Ser Tyr Cys Gly Pro Cys Pro Lys Asn Trp Ile Cys Tyr Lys Asn Asn 20 25 30 Cys Tyr Gln Phe Phe Asp Glu Ser Lys Asn Trp Tyr Glu Ser Gln Ala 35 40 45 Ser Cys Met Ser Gln Asn Ala Ser Leu Leu Lys Val Tyr Ser Lys Glu 50 55 60 Asp Gln Asp Leu Leu Lys Leu Val Lys Ser Thr His Trp Met Gly Leu 65 70 75 80 Val His Ile Pro Thr Asn Gly Ser Trp Gln Trp Glu Asp Gly Ser Ile 85 90 95 Leu Ser Pro Asn Leu Leu Thr Ile Ile Glu Met Gln Lys Gly Asp Cys 100 105 110 Ala Leu Tyr Ala Ser Ser Phe Lys Gly Phe Ile Glu Asn Cys Ser Thr 115 120 125 Pro Asn Thr Tyr Ile Cys Met Gln Arg Thr Val 130 135 <210> 86 <211> 139 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide, non-natural NKG2D Y152V / Y199F eNKG2D9 Extracellular domain <400> 86 Phe Leu Asn Ser Leu Phe Asn Gln Glu Val Gln Ile Pro Leu Thr Glu<00​​​​​​Cys Tyr Gln Phe Phe Asp Glu Ser Lys Asn Trp Tyr Glu Ser Gln Ala 35 40 45 Ser Cys Met Ser Gln Asn Ala Ser Leu Leu Lys Val Tyr Ser Lys Glu 50 55 60 Asp Gln Asp Leu Leu Lys Leu Val Lys Ser Val His Trp Met Gly Leu 65 70 75 80 Val His Ile Pro Thr Asn Gly Ser Trp Gln Trp Glu Asp Gly Ser Ile 85 90 95 Leu Ser Pro Asn Leu Leu Thr Ile Ile Glu Met Gln Lys Gly Asp Cys 100 105 110 Ala Leu Tyr Ala Ser Ser Phe Lys Gly Phe Ile Glu Asn Cys Ser Thr 115 120 125 Pro Asn Thr Tyr Ile Cys Met Gln Arg Thr Val 130 135 <210> 87 <211> 139 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide, non-natural NKG2D Y199D eNKG2D10 extracellular domain <400> 87 Phe Leu Asn Ser Leu Phe Asn Gln Glu Val Gln Ile Pro Leu Thr Glu 1 5 10 15 Ser Tyr Cys Gly Pro Cys Pro Lys Asn Trp Ile Cys Tyr Lys Asn Asn 20 25 30 Cys Tyr Gln Phe Phe Asp Glu Ser Lys Asn Trp Tyr Glu Ser Gln Ala 35 40 45 Ser Cys Met Ser Gln Asn Ala Ser Leu Leu Lys Val Tyr Ser Lys Glu 50 55 60 Asp Gln Asp Leu Leu Lys Leu Val Lys Ser Tyr His Trp Met Gly Leu 65 70 75 80 Val His Ile Pro Thr Asn Gly Ser Trp Gln Trp Glu Asp Gly Ser Ile 85 90 95 Leu Ser Pro Asn Leu Leu Thr Ile Ile Glu Met Gln Lys Gly Asp Cys 100 105 110 Ala Leu Tyr Ala Ser Ser Phe Lys Gly Asp Ile Glu Asn Cys Ser Thr 115 120 125 Pro Asn Thr Tyr Ile Cys Met Gln Arg Thr Val 130 135 <210> 88 <211> 139 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide, non - native NKG2D Y199E eNKG2D11 extracellular domain <400> 88 Phe Leu Asn Ser Leu Phe Asn Gln Glu Val Gln Ile Pro Leu Thr Glu 1 5 10 15 Ser Tyr Cys Gly Pro Cys Pro Lys Asn Trp Ile Cys Tyr Lys Asn Asn 20 25 30 Cys Tyr Gln Phe Phe Asp Glu Ser Lys Asn Trp Tyr Glu Ser Gln Ala 35 40 45 Ser Cys Met Ser Gln Asn Ala Ser Leu Leu Lys Val Tyr Ser Lys Glu 50 55 60 Asp Gln Asp Leu Leu Lys Leu Val Lys Ser Tyr His Trp Met Gly Leu 65 70 75 80<​​​​​​​​​​​​​​​​​​​​​​​​​​<223> Synthetic peptide, non-natural NKG2D Y152D / Y199D eNKG2D12 Extracellular domain <400> 89 Phe Leu Asn Ser Leu Phe Asn Gln Glu Val Gln Ile Pro Leu Thr Glu 1 5 10 15 Ser Tyr Cys Gly Pro Cys Pro Lys Asn Trp Ile Cys Tyr Lys Asn Asn 20 25 30 Cys Tyr Gln Phe Phe Asp Glu Ser Lys Asn Trp Tyr Glu Ser Gln Ala 35 40 45 Ser Cys Met Ser Gln Asn Ala Ser Leu Leu Lys Val Tyr Ser Lys Glu 50 55 60 Asp Gln Asp Leu Leu Lys Leu Val Lys Ser Asp His Trp Met Gly Leu 65 70 75 80 Val His Ile Pro Thr Asn Gly Ser Trp Gln Trp Glu Asp Gly Ser Ile 85 90 95 Leu Ser Pro Asn Leu Leu Thr Ile Ile Glu Met Gln Lys Gly Asp Cys 100 105 110 Ala Leu Tyr Ala Ser Ser Phe Lys Gly Asp Ile Glu Asn Cys Ser Thr 115 120 125 Pro Asn Thr Tyr Ile Cys Met Gln Arg Thr Val 130 135 <210> 90 <211> 139 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide, non-natural NKG2D Y152E / Y199E eNKG2D13 Extracellular domain <400> 90 Phe Leu Asn Ser Leu Phe Asn Gln Glu Val Gln Ile Pro Leu Thr Glu 1 5 10 15 Ser Tyr Cys Gly Pro Cys Pro Lys Asn Trp Ile Cys Tyr Lys Asn Asn 20 25 30 Cys Tyr Gln Phe Phe Asp Glu Ser Lys Asn Trp Tyr Glu Ser Gln Ala 35 40 45 Ser Cys Met Ser Gln Asn Ala Ser Leu Leu Lys Val Tyr Ser Lys Glu 50 55 60 Asp Gln Asp Leu Leu Lys Leu Val Lys Ser Glu His Trp Met Gly Leu 65 70 75 80[[ID=3′1]] Val His Ile Pro Thr Asn Gly Ser Trp Gln Trp Glu Asp Gly Ser Ile 85 90 95 Leu Ser Pro Asn Leu Leu Thr Ile Ile Glu Met Gln Lys Gly Asp Cys 100 105 110 Ala Leu Tyr Ala Ser Ser Phe Lys Gly Glu Ile Glu Asn Cys Ser Thr 115 120 125 Pro Asn Thr Tyr Ile Cys Met Gln Arg Thr Val 130 135 <210> 91 <211> 139 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide, non-natural NKG2D Y152L eNKG2D14 extracellular domain <400> 91 Phe Leu Asn Ser Leu Phe Asn Gln Glu Val Gln Ile Pro Leu Thr Glu 1 5 10 15 Ser Tyr Cys Gly Pro Cys Pro Lys Asn Trp Ile Cys Tyr Lys Asn Asn 20 25 30 Cys Tyr Gln Phe Phe Asp Glu Ser Lys Asn Trp Tyr Glu Ser Gln Ala 35 40 45 Ser Cys Met Ser Gln Asn Ala Ser Leu Leu Lys Val Tyr Ser Lys Glu 50 55 60 Asp Gln Asp Leu Leu Lys Leu Val Lys Ser Leu His Trp Met Gly Leu 65 70 75 80 Val His Ile Pro Thr Asn Gly Ser Trp Gln Trp Glu Asp Gly Ser Ile 85 90 95 Leu Ser Pro Asn Leu Leu Thr Ile Ile Glu Met Gln Lys Gly Asp Cys 100 105 110 Ala Leu Tyr Ala Ser Ser Phe Lys Gly Tyr Ile Glu Asn Cys Ser Thr 115 120 125 Pro Asn Thr Tyr Ile Cys Met Gln Arg Thr Val 130 135 <210> 92 <211> 139 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide, non - native NKG2D Y152F / Y199F eNKG2D15 Extracellular domain <400> 92 Phe Leu Asn Ser Leu Phe Asn Gln Glu Val Gln Ile Pro Leu Thr Glu 1 5 10 15 Ser Tyr Cys Gly Pro Cys Pro Lys Asn Trp Ile Cys Tyr Lys Asn Asn 20 25 30 Cys Tyr Gln Phe Phe Asp Glu Ser Lys Asn Trp Tyr Glu Ser Gln Ala 35 40 45 Ser Cys Met Ser Gln Asn Ala Ser Leu Leu Lys Val Tyr Ser Lys Glu 50 55 60 Asp Gln Asp Leu Leu Lys Leu Val Lys Ser Phe His Trp Met Gly Leu 65 70 75 80 Val His Ile Pro Thr Asn Gly Ser Trp Gln Trp Glu Asp Gly Ser Ile 85 90 95 Leu Ser Pro Asn Leu Leu Thr Ile Ile Glu Met Gln Lys Gly Asp Cys 100 105 110 Ala Leu Tyr Ala Ser Ser Phe Lys Gly Phe Ile Glu Asn Cys Ser Thr 115 120 125 Pro Asn Thr Tyr Ile Cys Met Gln Arg Thr Val 130 135 <210> 93 <211> 237 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide human IgG1 Fc with IEGR linker <400> 93 Met Asp Pro Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro 1 5 10 15 Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys 20 25 30 Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val 35 40 45 Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr 50 55 60 Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu 65 70 75 80 Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His 85 90 95 Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys 100 105 110 Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln 115 120 125 Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu 130 135 140 Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro 145 150 155 160 Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn 165 170 175 Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu 180 185 190 Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val 195 200 205 Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln 210 215 220 Lys Ser Leu Ser Leu Ser Pro Gly Lys Ile Glu Gly Arg 225 230 235 <210> 94 <211> 376 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide human IgG1 Fc-NKG2D fusion <400> 94 Met Asp Pro Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro 1 5 10 15 Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys 20 25 30 Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val 35 40 45 Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr 50 55 60 Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu 65 70 75 80 Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His 85 90 95 Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys 100 105 110 Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln 115 120 125 Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu 130 135 140 Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro 145 150 155 160 Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn 165 170 175 Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu 180 185 190 Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val 195 200 205 Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln 210 215 220 Lys Ser Leu Ser Leu Ser Pro Gly Lys Ile Glu Gly Arg Phe Leu Asn 225 230 235 240 Ser Leu Phe Asn Gln Glu Val Gln Ile Pro Leu Thr Glu Ser Tyr Cys 245 250 255 Gly Pro Cys Pro Lys Asn Trp Ile Cys Tyr Lys Asn Asn Cys Tyr Gln 260 265 270 Phe Phe Asp Glu Ser Lys Asn Trp Tyr Glu Ser Gln Ala Ser Cys Met 275 280 285 Ser Gln Asn Ala Ser Leu Leu Lys Val Tyr Ser Lys Glu Asp Gln Asp 290 295 300 Leu Leu Lys Leu Val Lys Ser Tyr His Trp Met Gly Leu Val His Ile 305 310 315 320 Pro Thr Asn Gly Ser Trp Gln Trp Glu Asp Gly Ser Ile Leu Ser Pro 325 330 335 Asn Leu Leu Thr Ile Ile Glu Met Gln Lys Gly Asp Cys Ala Leu Tyr 340 345 350 Ala Ser Ser Phe Lys Gly Tyr Ile Glu Asn Cys Ser Thr Pro Asn Thr 355 360 365 Tyr Ile Cys Met Gln Arg Thr Val 370 375 <210> 95 <211> 376 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide, human IgG1 Fc-NKG2D Y152A fusion <400> 95 Met Asp Pro Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro 1 5 10 15 Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys 20 25 30 Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val 35 40 45 Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr 50 55 60 Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu 65 70 75 80 Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His 85 90 95 Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys 100 105 110 Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln 115 120 125 Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu 130 135 140 Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro 145 150 155 160 Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn 165 170 175 Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu 180 185 190 Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val 195 200 205 Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln 210 215 220 Lys Ser Leu Ser Leu Ser Pro Gly Lys Ile Glu Gly Arg Phe Leu Asn 225 230 235 240 Ser Leu Phe Asn Gln Glu Val Gln Ile Pro Leu Thr Glu Ser Tyr Cys 245 250 255 Gly Pro Cys Pro Lys Asn Trp Ile Cys Tyr Lys Asn Asn Cys Tyr Gln 260 265 270 Phe Phe Asp Glu Ser Lys Asn Trp Tyr Glu Ser Gln Ala Ser Cys Met 275 280 285 Ser Gln Asn Ala Ser Leu Leu Lys Val Tyr Ser Lys Glu Asp Gln Asp 290 295 300 Leu Leu Lys Leu Val Lys Ser Ala His Trp Met Gly Leu Val His Ile 305 310 315 320 Pro Thr Asn Gly Ser Trp Gln Trp Glu Asp Gly Ser Ile Leu Ser Pro 325 330 335 Asn Leu Leu Thr Ile Ile Glu Met Gln Lys Gly Asp Cys Ala Leu Tyr 340 345 350 Ala Ser Ser Phe Lys Gly Tyr Ile Glu Asn Cys Ser Thr Pro Asn Thr 355 360 365 Tyr Ile Cys Met Gln Arg Thr Val 370 375 <210> 96 <211> 376 <212> PRT <213> Artificial Sequence 7]<220> <223> Synthetic peptide, human IgG1 Fc - NKG2D Y199A extracellular domain <400> 96 Met Asp Pro Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro 1 5 10 15 Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys 20 25 30 Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val 35 40 454] Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr 50 55 60 Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu 65 70 75 80 Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His 85 90 95 Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys 100 105 110 Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln 115 120 125 Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu 130 135 140 Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro 145 150 155 160 Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn 165 170 175 Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu 180 185 190 Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val 195 200 205 Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln 210 215 220 Lys Ser Leu Ser Leu Ser Pro Gly Lys Ile Glu Gly Arg Phe Leu Asn 225 230 235 240 Ser Leu Phe Asn Gln Glu Val Gln Ile Pro Leu Thr Glu Ser Tyr Cys 245 250 255 Gly Pro Cys Pro Lys Asn Trp Ile Cys Tyr Lys Asn Asn Cys Tyr Gln 260 265 270 Phe Phe Asp Glu Ser Lys Asn Trp Tyr Glu Ser Gln Ala Ser Cys Met 275 280 285 Ser Gln Asn Ala Ser Leu Leu Lys Val Tyr Ser Lys Glu Asp Gln Asp 290 295 300 Leu Leu Lys Leu Val Lys Ser Tyr His Trp Met Gly Leu Val His Ile 305 310 315 320 Pro Thr Asn Gly Ser Trp Gln Trp Glu Asp Gly Ser Ile Leu Ser Pro 325 330 335 Asn Leu Leu Thr Ile Ile Glu Met Gln Lys Gly Asp Cys Ala Leu Tyr 340 345 350 Ala Ser Ser Phe Lys Gly Ala Ile Glu Asn Cys Ser Thr Pro Asn Thr 355 360 365 Tyr Ile Cys Met Gln Arg Thr Val 370 375 <210> 97 <211> 376 <212> PRT <213> Artificial Sequence <220> [[ID=​​​Met Asp Pro Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro 1 5 10 15 Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys 20 25 30 Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val 35 40 45 Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr 50 55 60 Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu 65 70 75 80 Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His 85 90 95 Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys 100 105 110 Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln 115 120 125 Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu 130 135 140 Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro 145 150 155 160 Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn 165 170 175 Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu 180 185 190 Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val 195 200 205 Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln 210 215 220 Lys Ser Leu Ser Leu Ser Pro Gly Lys Ile Glu Gly Arg Phe Leu Asn 225 230 235 240 Ser Leu Phe Asn Gln Glu Val Gln Ile Pro Leu Thr Glu Ser Tyr Cys 245 250 255 Gly Pro Cys Pro Lys Asn Trp Ile Cys Tyr Lys Asn Asn Cys Tyr Gln 260 265 270 Phe Phe Asp Glu Ser Lys Asn Trp Tyr Glu Ser Gln Ala Ser Cys Met 275 280 285 Ser Gln Asn Ala Ser Leu Leu Lys Val Tyr Ser Lys Glu Asp Gln Asp 290 295 300 Leu Leu Lys Leu Val Lys Ser Ala His Trp Met Gly Leu Val His Ile 305 310 315 320 Pro Thr Asn Gly Ser Trp Gln Trp Glu Asp Gly Ser Ile Leu Ser Pro 325 330 335 Asn Leu Leu Thr Ile Ile Glu Met Gln Lys Gly Asp Cys Ala Leu Tyr 340 345 350 Ala Ser Ser Phe Lys Gly Ala Ile Glu Asn Cys Ser Thr Pro Asn Thr 355 360 365 Tyr Ile Cys Met Gln Arg Thr Val 370 375 <210> 98 <211> 376 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide, human IgG1 Fc-NKG2D Y199F eNKG2D1 fusion <400> 98 Met Asp Pro Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro 1 5 10 15 Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys 20 25 30 Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val 35 40 45 Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr 50 55 60 Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu 65 70 75 80 Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His 85 90 95 Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys 100 105 110 Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln 115 120 125 Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu 130 135 140 Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro 145 150 155 160 Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn 165 170 175 Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu 180 185 190 Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val 195 200 205 Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln 210 215 220 Lys Ser Leu Ser Leu Ser Pro Gly Lys Ile Glu Gly Arg Phe Leu Asn 225 230 235 240 Ser Leu Phe Asn Gln Glu Val Gln Ile Pro Leu Thr Glu Ser Tyr Cys 245 250 255 Gly Pro Cys Pro Lys Asn Trp Ile Cys Tyr Lys Asn Asn Cys Tyr Gln 260 265 270 Phe Phe Asp Glu Ser Lys Asn Trp Tyr Glu Ser Gln Ala Ser Cys Met 275 280 285 Ser Gln Asn Ala Ser Leu Leu Lys Val Tyr Ser Lys Glu Asp Gln Asp 290 295 300 Leu Leu Lys Leu Val Lys Ser Tyr His Trp Met Gly Leu Val His Ile 305 310 315 320 Pro Thr Asn Gly Ser Trp Gln Trp Glu Asp Gly Ser Ile Leu Ser Pro 325 330 335 Asn Leu Leu Thr Ile Ile Glu Met Gln Lys Gly Asp Cys Ala Leu Tyr 340 345 350 Ala Ser Ser Phe Lys Gly Phe Ile Glu Asn Cys Ser Thr Pro Asn Thr 355 360 365 Tyr Ile Cys Met Gln Arg Thr Val 370 375 <210> 99 <211> 376 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide, human IgG1 Fc-NKG2D Y152S eNKG2D2 fusion <400> 99 Met Asp Pro Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro 1 5 10 15 Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys 20 25 30 Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val 35 40 45 Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr 50 55 60 Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu 65 70 75 80 Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His<00,050,50>85 90 95 Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys<000505,2>100 105 110 Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln 115 120 125 Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu 130 135 140 Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro 145 150 155 160 Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn 165 170 175 Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu 180 185 190 Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val 195 200 205 Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln 210 215 220 Lys Ser Leu Ser Leu Ser Pro Gly Lys Ile Glu Gly Arg Phe Leu Asn 225 230 235 240 Ser Leu Phe Asn Gln Glu Val Gln Ile Pro Leu Thr Glu Ser Tyr Cys 245 250 255 Gly Pro Cys Pro Lys Asn Trp Ile Cys Tyr Lys Asn Asn Cys Tyr Gln 260 265 270 Phe Phe Asp Glu Ser Lys Asn Trp Tyr Glu Ser Gln Ala Ser Cys Met 275 280 285 Ser Gln Asn Ala Ser Leu Leu Lys Val Tyr Ser Lys Glu Asp Gln Asp 290 295 300 Leu Leu Lys Leu Val Lys Ser Tyr His Trp Met Gly Leu Val His Ile 305 310 315 320 Pro Thr Asn Gly Ser Trp Gln Trp Glu Asp Gly Ser Ile Leu Ser Pro 325 330 335 Asn Leu Leu Thr Ile Ile Glu Met Gln Lys Gly Asp Cys Ala Leu Tyr 340 345 350 Ala Ser Ser Phe Lys Gly Phe Ile Glu Asn Cys Ser Thr Pro Asn Thr 355 360 365 Tyr Ile Cys Met Gln Arg Thr Val 370 375 <210> 100 <211> 376 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide, human IgG1 Fc-NKG2D Y152T eNKG2D3 fusion <400> 100 Met Asp Pro Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro 1 5 10 15 Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys 20 25 30 Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val 35 40 45 Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr 50 55 60 Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu 65 70 75 80 Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His 85 90 95 Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys 100 105 110 Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln 115 120 125 Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu 130 135 140 Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro 145 150 155 160 Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn 165 170 175 Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu 180 185 190 Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val 195 200 205 Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln 210 215 220 Lys Ser Leu Ser Leu Ser Pro Gly Lys Ile Glu Gly Arg Phe Leu Asn 225 230 235 240 Ser Leu Phe Asn Gln Glu Val Gln Ile Pro Leu Thr Glu Ser Tyr Cys 245 250 255 Gly Pro Cys Pro Lys Asn Trp Ile Cys Tyr Lys Asn Asn Cys Tyr Gln 260 265 270 Phe Phe Asp Glu Ser Lys Asn Trp Tyr Glu Ser Gln Ala Ser Cys Met 275 280 285 Ser Gln Asn Ala Ser Leu Leu Lys Val Tyr Ser Lys Glu Asp Gln Asp 290 295 300 Leu Leu Lys Leu Val Lys Ser Thr His Trp Met Gly Leu Val His Ile 305 310 315 320 Pro Thr Asn Gly Ser Trp Gln Trp Glu Asp Gly Ser Ile Leu Ser Pro 325 330 335 Asn Leu Leu Thr Ile Ile Glu Met Gln Lys Gly Asp Cys Ala Leu Tyr 340 345 350 Ala Ser Ser Phe Lys Gly Tyr Ile Glu Asn Cys Ser Thr Pro Asn Thr 355 360 365 Tyr Ile Cys Met Gln Arg Thr Val 370 375 <210> 101 <211> 376 <212> PRT <213> Artificial Sequence <220> <223> Synthetic peptide human IgG1 Fc-NKG2D Y152V eNKG2D4 fusion <400> 101 Met Asp Pro Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro 1 5 10 15 Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys 20 25 30 Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val 35 40 45 Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr 50 55 60 Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu 65 70 75 80 Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His 85 90 95 Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys 100 105 110 Ala Leu Pro...

Claims

1. A modified, non-natural ligand of a modified non-natural NKG2D receptor, wherein the modified, non-natural ligand (a) consists of an amino acid sequence selected from the group consisting of SEQ ID NOs: 66-72; and (b) a heterologous molecule is attached thereto, wherein the heterologous molecule is an antibody whose heavy chain and light chain are selected from the group consisting of SEQ ID NOs: 139 and 151, SEQ ID NOs: 139 and 152, SEQ ID NOs: 153 and 140, SEQ ID NOs: 139 and 141, SEQ ID NOs: 95 and 133, SEQ ID NOs: 161 and 162, SEQ ID NOs: 163 and 164, SEQ ID NOs: 165 and 166, and SEQ ID NOs: 167 and 168.

2. The modified, non-natural ligand of claim 1, wherein the modified, non-natural ligand consists of an amino acid sequence selected from the group consisting of SEQ ID NOs: 68-72.

3. The modified, non-natural ligand of claim 1, wherein the modified, non-natural ligand binds to a non-natural NKG2D receptor comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 54 and SEQ ID NO:

154.

4. A CAR cell that binds to a modified, non-natural ligand as described in claim 1, wherein the CAR cell binds to multiple modified, non-natural ligands, the ligands having different, unique heterologous molecules that bind to different epitopes, proteins or other molecules on the surface of HIV-infected cells.

5. The CAR cell of claim 4, wherein the CAR cell comprises a modified, non-natural NKG2D receptor comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 54 and SEQ ID NO: 154, and Wherein the CAR cell also binds to a modified, non-natural ligand, which consists of an amino acid sequence selected from the group consisting of SEQ ID NOs: 68-72, to which is attached a heterologous molecule or atom that does not bind to HIV protein.

6. The CAR cell of claim 4 or 5, wherein the heterologous molecule or atom does not bind to an HIV protein that regulates the function of the CAR cell.

7. The CAR cell of claim 6, wherein the function is selected from the group consisting of proliferation, differentiation, ablation, imaging, antagonism of immunosuppression, homing and cell lysis of cells not infected by HIV.

Images