Methods of treating schizophrenia and other neuropsychiatric disorders

Abstract

The present disclosure relates to restoring the K of glial cells in a subject. + These methods involve in vitro administration of K-1 inhibitors effective to restore the K uptake of the glial cells. + The present invention relates to a method for treating or suppressing the onset of a neuropsychiatric disorder in a subject under the condition of being effective in treating or suppressing the onset of a neuropsychiatric disorder in a subject in need thereof, and a SMAD4 inhibitor is administered to the subject. The present invention also relates to a method for treating or suppressing the onset of a neuropsychiatric disorder in a subject in need thereof, and a SMAD4 inhibitor is administered to the subject.

Description

[0001] This application claims the benefit of U.S. Provisional Patent Application Serial No. 62 / 778,145, filed December 11, 2018, which is incorporated herein by reference in its entirety.

[0002] This invention was made with government support under Grant MH099578 from the National Institutes of Health. The U.S. Government has certain rights in this invention. Technical Field

[0003] The present disclosure relates to a method for treating a K + Restoration of glial potassium (K) channel function in glial cells + ) ingestion. These methods are useful for treating a subject suffering from a neuropsychiatric condition. Background Art

[0004] Schizophrenia is a psychiatric disorder characterized by delusions, auditory hallucinations, and cognitive impairment that affects approximately 1% of the world's population, but remains poorly understood (Allen et al., "Systematic Meta-Analyses and Field Synopsis of Genetic Association Studies in Schizophrenia: The SzGene Database," Nature Genetics 40: 827-834 (2008); Sawa and Snyder, "Schizophrenia: Diverse Approaches to a Complex Disease," Science 296: 692-695 (2002)). In the past decade, it has become clear that many schizophrenia-associated genes are involved in the development and physiology of glial cells (Yin et al., "Synaptic Dysfunction in Schizophrenia," Adv. Exp. Med. Biol. 970: 493-516 (2012)). Therefore, both astrocyte and oligodendrocyte dysfunction are implicated in the etiology of schizophrenia. Astrocytes play a crucial role in the structural development of neural networks and the coordination of neural circuit activity, the latter of which plays an important role by releasing glial transmitters, maintaining synaptic density, and regulating synaptic potassium and neurotransmitter levels (Christopherson et al., "Thrombospondinsare Astrocyte-Secreted Proteins That Promote CNS Synaptogenesis," Cell 120:421-433 (2005); Chung et al., "Astrocytes Mediate Synapse Elimination Through MEGF10 and MERTK Pathways," Nature 504:394-400 (2013); and Thrane et al., "Ammonia Triggers Neuronal Disinhibition and Seizures by Impairing Astrocyte Potassium Buffering," Nat. Med. 19:1643-1648 (2013)). However, the role of astrocyte dysfunction in the development of neuropsychiatric disorders such as schizophrenia is still unclear. The present disclosure is directed to overcoming this and other deficiencies in the art. Summary of the invention

[0005] The first aspect of the present disclosure relates to a method for restoring the K + The method of uptake wherein the glial cells have impaired K + channel function. This method involves the effective restoration of K + K channel function in glial cells + A SMAD4 inhibitor is administered to the glial cells under conditions of uptake.

[0006] Another aspect of the present disclosure relates to a method for restoring the K of glial cells in a subject. + This method involves selecting cells with damaged glial cells K + The subject ingests the drug and is effective in restoring the K + The SMAD4 inhibitor is administered to the selected subject under the conditions of ingestion.

[0007] Another aspect of the present disclosure relates to a method for treating or inhibiting the onset of a neuropsychiatric disorder in a subject. This method involves selecting a subject suffering from a neuropsychiatric disorder or at risk of suffering from a neuropsychiatric disorder, and administering a SMAD4 inhibitor to the selected subject under conditions effective for treating or inhibiting the onset of the neuropsychiatric disorder in the subject.

[0008] To study the role of glial pathology in neurological and neuropsychiatric disorders such as schizophrenia, a protocol for generating glial progenitor cells (GPCs) from induced pluripotent cells (iPSCs) was established (Wang et al., "Human iPSC-Derived Oligodendrocyte Progenitor Cells Can Myelinate and Rescue a Mouse Model of Congenital Hypomyelination," Cell Stem Cell 12:252-264 (2013), which is incorporated herein by reference in its entirety). This model allows the generation of GPCs and their derived astrocytes and oligodendrocytes from patients with schizophrenia in a manner that retains their genetic integrity and functional repertoire. This protocol provides a means by which the differentiation, gene expression, and physiological function of astrocytes derived from patients with schizophrenia are assessed in vitro and in vivo after implantation into immunodeficient mice (Windrem et al., "HumaniPSC Glial MouseChimeras Reveal Glial Contributions to Schizophrenia," Cell Stem Cell 21: 195-208.e6 (2017), which is incorporated herein by reference in its entirety). It is noted that such human glial chimeric mice colonized with iPSC-derived GPCs generated from schizophrenia patients exhibit significant abnormalities in both astrocyte differentiation and mature structure associated with significant physiological and behavioral abnormalities. Importantly, RNA sequence analysis revealed that developmental defects in these schizophrenia GPCs were associated with downregulation of a core set of differentiation-related genes, whose transcriptional targets include many transporters, channels, and synaptic regulators in which similar defects are found in schizophrenia glial cells.

[0009] As described herein, targetable signaling nodes that can alleviate the glial pathology associated with this schizophrenia have been identified. For this reason, iPS CPGPCs are produced from patients with childhood-onset schizophrenia or their normal controls (CTR), and astrocytes are produced from these cells. The gene expression patterns and astrocyte functional differentiation of GPCs derived from schizophrenia and controls have been compared. Excessive TGFβ signaling has been found to play a key role in the functional differentiation of GPCs derived from schizophrenia, and the effect of TGFβ in this cell background is signaled by SMAD4, and the normal aspects of the phenotype can be restored to SCZ glial cells by SMAD4 inhibition. BRIEF DESCRIPTION OF THE DRAWINGS

[0010] Figure 1A-1F shows efficient generation of hGPCs from SCZ iPSCs. Flow cytometry revealed that >90% of undifferentiated hiPSCs in SCZ (4 SCZ lines, n≥3 / each line) and CTR (4 CTR lines, n≥3 / each line)-derived hiPSCs expressed SSEA4 ( Figure 1 A). At the neural progenitor cell (NPC) stage, the expression of the NPC marker CD133 was not different between SCZ- and CTR-derived lines ( Figure 1 B) CD140a-restricted hGPCs were similarly generated from SCZ- and CTR-derived iPSCs, and CD140a + The relative proportions of cells did not differ between SCZ and CTR hGPC cultures ( Figure 1 C). At the astrocyte progenitor stage, CD44 expression did not differ between SCZ- and CTR-derived lines ( Figure 1 D) After incubation with BMP4, PDGFαR + The percentage of glial cells was significantly higher in SCZ lines (4 SCZ lines, n≥3 / each line) compared with that in CTR lines (4 CTR lines, n≥3 / each line) ( Figure 1 E) In addition to GFAP, S100β + Astrocytes were significantly higher in the CTR line relative to the SCZ line ( Figure 1 F). FSC, forward scatter. Scale bar: 50 μm. ***p<0.001 by two-tailed t-test; NS: not significant; mean ± SEM.

[0011] Figure 2 A-2J shows that astrocyte differentiation is impaired in SCZ GPCs. Figure 2 As shown in A-2D, at the neural progenitor cell (NPC) stage, both SCZ and CTR (4 different patients and their respective derived lines, n≥3 / each line) hNPCs highly expressed SOX1 and PAX6. Similarly, the efficiency of PDGFRα / CD140a-defined hGPC generation did not differ between SCZ and CTR lines (4 different patient-specific lines, n≥3 / each line) ( Figure 2 E-2G). On the contrary, Figure 2 H-2J shows that GFAP + The proportion of astrocytes was significantly higher in CTR lines (4 CTR lines, n≥3 / each line [70.1±2.4%]) vs. SCZ lines (4 SCZ lines, n≥3 / each line, [39.9±2.0]). Scale bar: 50 μm; ***p<0.001 by two-tailed t-test; NS: not significant; mean±SEM.

[0012] Figures 3A-3E showed that TGFβ signaling-dependent transcripts were upregulated in SCZ GPCs. Figure 3A Schematic diagram of Ingenuity Pathway Analysis of RNA-seq data, which reveals that TGFβ-dependent transcription is upregulated in SCZ hGPCs. Upregulated genes include LTBP1, LTBP2, IGFBP3, TGFB1, PDGFB, GDF3, GDF7, BMP1, and BMP5. Downregulated genes include AMH and BMP3. qPCR confirmed that TGFβ pathway-related and upregulated genes (including BMP1, BMPR2, RUNX2, SERPINE1, BAMBI, etc.) were significantly upregulated in SCZ hGPCs (4 SCZ lines, 3 replicates / each line) relative to CTR cells (4 CTR lines, 3 replicates / each line) ( Figure 3B ). In contrast, Figure 3C As shown in Figure 2, the expression of these genes was not the same between SCZ and CTR lines at the NPC stage. Principal component analysis (PCA) showed similar methylation status between CTR- and SCZ-derived iPSCs ( Figure 3D ). Figure 3E is a heat map showing that the variability in iPSC methylation status is mainly due to sex and individual strains (p<0.05), rather than disease state or age. By two-tailed t-test, *p<0.05, **p<0.01; NS: not significant; mean ± SEM.

[0013] Figure 4A-4B Validation of BAMBI overexpression and knockdown is shown. In CTR hGPCs transduced with lentivirus-BAMBI (4 CTR lines, 3 replicates / each line), qPCR confirmed significant overexpression of BAMBI ( Figure 4A SCZ hGPCs (4 SCZ lines, 3 replicates / each line) expressed high levels of BAMBI relative to CTR hGPCs, whereas lentiviral-BAMBI-shRNAi transduction of SCZ hGPCs suppressed BAMBI expression to the level of CTR hGPCs ( Figure 4B ). For A and B, ***P<0.001 by one-way ANOVA; mean±SEM.

[0014] Figures 5A-5C showed that the BAMBI expression phenotype in normal hGPCs mimics the glial differentiation defect of SCZ. Figure 5A-5BOverexpression of the membrane-bound BMP antagonist BAMBI in CTR hGPCs (4 CTR lines, 3 replicates / each line) significantly reduced the efficiency of their astrocyte conversion. However, knockdown of BAMBI in SCZ hGPCs (4 SCZ lines, 3 replicates / each line) was insufficient to restore astrocyte differentiation ( Figure 5B In addition to BAMBI, the BMP antagonists follistatin (FST) and gremlin1 (GREM1) were also upregulated in SCZ hGPCs relative to controls ( Figure 5C ). Scale bar: 50 μm; ***p<0.001, one-way ANOVA for B; **p<0.001, two-tailed t-test for C; NS: not significant; mean±SEM.

[0015] Figures 6A-6D showed that SMAD4 regulates astrocyte differentiation of SCZ GPCs. Fig. 6A Schematic diagram of SMAD4 regulating expression of TGFβ and BMP pathways through: 1) phosphorylation of both SMAD2 / 3 and SMAD1 / 5 / 8; 2) SMAD nuclear translocation and target promoter activation, including early induction of the endogenous BMP inhibitors BAMBI, follistatin (FST), and gremlin1 (GREM1); and 3) subsequent feedback inhibition of BMP signaling. Figure 6B The graph shows that BAMBI, FST and GREM1 are all significantly overexpressed in SCZCD140a sorted hGPCs relative to control-derived hGPCs. SMAD4 knockdown in SCZ hGPCs (4 SCZ lines, 3 replicates / line) then inhibits the expression of BAMBI, FST and GREM1 to control levels. Figure 6C is a set of immunochemical images showing that SMAD4 knockdown in SCZ hGPCs restored astrocyte differentiation to CTR hGPCs (4 SCZ lines, 3 replicates / each line). DOX(-) / (+) means short-term / long-term culture with DOX. SMAD4 knockdown after astrocyte induction caused a loss of GFAP-defined astrocytes in both SCZ and CTR groups, as mediated by continuous doxycycline exposure. Fig.6D DOX(-) / (+) means short-term / long-term culture with DOX. Scale bar: 50 μm; *p<0.05, **p<0.01, ***p<0.001; One-way ANOVA; NS: not significant; Mean ± SEM.

[0016] Figures 7A-7C Validation of SMAD4 knockdown is shown. Fig. 7Aare graphs showing differences in SMAD4 mRNA levels between SCZ and control hGPCs and astrocytes, as reflected in CD140a-sorted hGPCs (left panel) and CD44-sorted astrocytes (right panel). Figure 7B is a schematic diagram of the experimental plan used to assess the effect of transient doxycycline-regulated SMAD4 knockdown on astrocyte differentiation of SCZ and CTR patient-derived hGPCs. Figure 7C It is a figure showing SMAD4 expression. The hGPCs (4 SCZ strains, 3 repetitions / each strain) of SCZ CD140a sorting were transduced with lentivirus-SMAD4-shRNAi inducible by doxycycline (DOX), and then induced by DOX to drive SMAD4-shRNAi expression. The culture was then switched to astrocyte differentiation conditions, and DOX was withdrawn, so as to allow SMAD4 expression and astrocyte maturation (DOX is only in the GPC stage), or continued, so as to continue to suppress SMAD4 expression during astrocyte maturation (keeping DOX in the AST stage). Slow virus SMAD4-shRNAi strongly suppresses SMAD4 expression under DOX, and SMAD4 expression is not affected in the absence of DOX induction. DOX (-) / (+) means short-term / long-term cultivation with DOX. By one-way ANOVA, **P < 0.01; NS: not significant; mean ± SEM.

[0017] Figures 8A-8B Shown is the expression of potassium channel (KCN) related genes in SCZ hGPCs. Fig. 8A is a heat map showing differentially expressed potassium channel genes in SCZ-derived hGPC lines. Each SCZ-derived hGPC line was compared to the three pooled CTR-derived hGPC lines (FDR 5%, FC>2.00 [if applicable]). The genes shown were found to be differentially expressed in at least three of the four assessed SCZ-derived hGPC lines. qPCR confirmed that potassium channel-related genes (including ATP1A2, SLC12A6, and KCNJ9) were all expressed in SCZ hGPCs (4 SCZ lines, 3 replicates / each line) relative to CTR cells (4 CTR lines, 3 replicates / each ( Figure 8B ) strain). **p<0.01 by two-tailed t-test; mean ± SEM.

[0018] Figures 9A-9E showed that potassium uptake was decreased in SCZ astrocytes. Fig. 9A It is the Na+ / K+-ATPase pump, NKCC1 Na + / K + / 2Cl -Schematic representation of the involvement of cotransporters and inwardly rectifying K+ channels in regulating potassium uptake in astrocytes. qPCR confirmed that several K+ channel-related genes were downregulated in SCZ CD44+ astrocyte-biased GPCs relative to CTR cells, such as Fig. 9B SCZ and CTR CD44+ GPCs were cultured in FBS with BMP4 to generate mature GFAP+ astrocytes, and their K + Uptake; results were normalized to total protein and cell number. Fig. 9C K of astrocytes was shown to be related to CTR + Compared with uptake (4 CTR lines, 5 replicates / each line), K of SCZ astrocytes + Uptake was significantly reduced in CTR astrocytes (4 SCZ lines, 5 replicates / line). Astrocytes were treated with ouabain, bumetanide, and topoisomerase to assess which potassium transporter classes were functionally impaired in SCZ astrocytes relative to controls (4 lines per control, 4 replicates / line). Both ouabain and bumetanide were effective in reducing K uptake in CTR astrocytes. + Intake ( Fig.9D , gray bars), while neither of them affected the K+ uptake of SCZ astrocytes ( Fig.9E , purple bars). For B and C, *P<0.05, **P<0.01, ***P<0.001 by two-tailed t-test; for D, ***P<0.001 by one-way ANOVA; NS: not significant; mean ± SEM.

[0019] Figures 10A-10C The results show that astrocytes are generated from SCZ CD44+ astrocyte-biased progenitors. SCZ-derived and CTR-derived CD44+ astrocyte precursors were induced to differentiate into astrocytes. Immunostaining for GFAP showed that the efficiency of astrocyte generation was significantly higher in the SCZ-derived strain ( Fig. 10A , right panel; 4 SCZ lines, 5 replicates / each line) and CTR-derived lines ( Fig. 10A , left panel; 4 CTR lines, 5 replicates / each line) were not significantly different (see also Fig. 10B qPCR revealed that GFAP mRNA expression was not different between SCZ- and CTR-derived CD44+ astrocyte precursors, as shown in Fig. 10C Scale bar: 50 μm. For B and C, two-tailed t test; NS: not significant; mean ± SEM. DETAILED DESCRIPTION

[0020] A first aspect of the present disclosure relates to a method for restoring K+ uptake in glial cells, wherein the glial cells have impaired K+ uptake.+ channel function. This method involves the effective restoration of K + K channel function in glial cells + A SMAD4 inhibitor is administered to the glial cells under conditions of uptake.

[0021] Another aspect of the present disclosure relates to a method for restoring the K of glial cells in a subject. + This method involves selecting cells with damaged glial cells K + The subject ingests the drug and is effective in restoring the K + The SMAD4 inhibitor is administered to the selected subject under the conditions of ingestion.

[0022] As described herein, "glial cells" include glial progenitor cells, oligodendrocyte-biased progenitor cells, astrocyte-biased progenitor cells, oligodendrocytes and astrocytes. Glial progenitor cells are bipotent progenitor cells that can differentiate into oligodendrocytes and astrocytes in the brain. Glial progenitor cells can be identified by their expression of certain stage-specific surface antigens (gangliosides and PDGFRα (CD140a) recognized by the A2B5 antibody) and stage-specific transcription factors (such as OLIG2, NKX2.2 and SOX10). Oligodendrocyte-biased progenitor cells and astrocyte-biased progenitor cells are identified by their acquired expression of stage-selective surface antigens, including, for example, CD9 and lipid sulfatides recognized by the O4 antibody for oligodendrocyte-biased progenitor cells and CD44 for astrocyte-biased progenitor cells. Mature oligodendrocytes are identified by their expression of myelin basic protein, and mature astrocytes are most commonly identified by their expression of glial fibrillary acid protein (GFAP). In one embodiment of the methods described herein, K+ uptake is restored in glial progenitor cells. In another embodiment, K+ uptake is restored in astrocyte-biased progenitor cells. + In another embodiment, K is restored in astrocytes. + Intake.

[0023] According to these aspects of the present disclosure, having impaired K + The cells that take up the protein have a reduced K compared to normal healthy glial cells. + In one embodiment, the invention relates to a glial cell that has a reduced K +The ingested glial cells are glial cells in which one or more potassium channel encoding genes are downregulated, thereby resulting in reduced expression of the corresponding potassium channel protein. In particular, downregulation of expression of one or more potassium channel encoding genes selected from the following can result in decreased expression of glial cell K + Decreased uptake: KCNJ9, KCNH8, KCNA3, KCNK9, KCNC1, KCNC3, KCNB1, KCNF1, KCNA6, SCN3A, SCN2A, SCNN1D, SCN8A, SCN3B, SLC12A6, SLC6A1, SLC8A3, ATP1A2, ATP1A3, ATP2B2.

[0024] Therefore, in one embodiment, cells with damaged glial cells are selected. + The method involves assessing potassium uptake in the glial cells of the subject, comparing the potassium uptake level of the glial cells with the potassium uptake level of a control healthy glial cell population, and selecting glial cell potassium uptake. + In another embodiment, subjects with impaired glial cell uptake are selected. + The subject of the uptake involves assessing the glial cell expression level of one or more potassium channel encoding genes selected from the group consisting of KCNJ9, KCNH8, KCNA3, KCNK9, KCNC1, KCNC3, KCNB1, KCNF1, KCNA6, SCN3A, SCN2A, SCNN1D, SCN8A, SCN3B, SLC12A6, SLC6A1, SLC8A3, ATP1A2, ATP1A3, ATP2B2, and selecting the subject if the expression of one or more potassium channel encoding genes is downregulated. In another embodiment, the subject is selected to have impaired glial cell K +The subjects of the ingestion were involved in assessing the glial cell protein expression of one or more potassium channels, including GIRK-3 (encoded by KCNJ9), potassium voltage-gated channel subfamily H member 8 (encoded by KCNH8), potassium voltage-gated channel subfamily A member 3 (encoded by KCNA3), potassium channel subfamily K member 9 (encoded by KCNK9), potassium voltage-gated channel subfamily C member 1 (encoded by KCNC1), potassium voltage-gated channel subfamily C member 3 (encoded by KCNC3), potassium voltage-gated channel subfamily B member 1 (encoded by KCNB1), potassium voltage-gated channel subfamily F member 1 (encoded by KCNF1), potassium voltage-gated channel subfamily A member 6 (encoded by KCNA6), type 3 sodium channel protein subunit alpha (encoded by SCN3A), type 2 sodium channel protein subunit alpha (encoded by SCN2A), amiloride-sensitive sodium channel subunit delta (encoded by SCNN1D), type 8 sodium channel protein subunit alpha (encoded by SCN8A), sodium channel subunit beta-3 (encoded by SCN3B), solute carrier family 12 member 6 (i.e., K + / Cl - cotransporter 3) (encoded by SLC12A6), sodium and chloride-dependent GABA transporter 1 (i.e., GAT-1) (encoded by SLC6A1), Na + / Ca +2 Exchange protein 3 (encoded by SLC8A3), Na + / K + Transporter ATPase subunit α-2 (encoded by ATP1A2), Na + / K + Transporting ATPase subunit alpha-2 (encoded by ATP1A3), plasma membrane calcium transporting ATPase 2 (ie, PMCA2) (encoded by ATP2B2). If the level of one or more potassium channel proteins is decreased, the subject is selected for treatment using the methods described herein.

[0025] Potassium uptake, potassium channel gene expression, potassium channel protein expression and SMAD4 gene expression can all be assessed using methods described herein and methods well known to those skilled in the art. These parameters can be assessed in the glial cell sample taken from the subject. Alternatively, one or more of these parameters can be assessed in the glial cell sample derived from the induced pluripotent stem cell (iPSC) derived from the subject. iPSC can be obtained from almost any somatic cell of the subject, and the somatic cell includes, for example, but is not limited to, fibroblasts, such as dermal fibroblasts obtained by skin samples or biopsy, synoviocytes from synovial tissue, keratinocytes, mature B cells, mature T cells, pancreatic beta cells, melanocytes, hepatocytes, foreskin cells, cheek cells, lung fibroblasts, peripheral blood cells, bone marrow cells, etc. iPSCs can be obtained by methods known in the art, including the use of integrating viral vectors (e.g., lentiviral vectors, inducible lentiviral vectors, and retroviral vectors), excisable vectors (e.g., transposons and lentiviral vectors marked with loxP sites (floxed)), and non-integrating vectors (e.g., adenovirus and plasmid vectors) to deliver the above-mentioned genes that promote cell reprogramming (see, e.g., Takahashi and Yamanaka, Cell 126:663-676 (2006); Okita. et al., Nature 448:313-317 (2007); Nakagawa et al., Nat. Biotechnol. 26:101-106 (2007); Takahashi et al., Cell 131:1-12 (2007); Meissner et al. Nat. Biotech. 25:1177-1181 (2007); Yu et al. Science 318:1917-1920 (2007); Park et al. Nature 451:141-146 (2008); and U.S. Patent Application Publication No. 2008 / 0233610, which are incorporated herein by reference in their entireties).Other methods for generating IPS cells include those disclosed in WO2007 / 069666, WO2009 / 006930, WO2009 / 006997, WO2009 / 007852, WO2008 / 118820, U.S. Patent Application Publication No. 2011 / 0200568 to Ikeda et al., U.S. Patent Application Publication No. 2010 / 0156778 to Egusa et al., U.S. Patent Application Publication No. 2012 / 0276070 to Musick, and U.S. Patent Application Publication No. 2012 / 0276636 to Nakagawa; Shi et al., Cell Stem Cell 3(5):568-574 (2008); Kim et al., Nature 454:646-650 (2008); Kim et al., Cell Stem Cell 3(5):568-574 (2008); 136(3):411-419 (2009); Huangfu et al., Nature Biotechnology 26:1269-1275 (2008); Zhao et al., Cell Stem Cell 3:475-479 (2008); Feng et al., Nature Cell Biology 11:197-203 (2009); and Hanna et al., Cell 133(2):250-264 (2008), which are incorporated herein by reference in their entirety. Methods for driving iPSCs toward glial progenitor cell (GPC) fate and astrocyte fate are described herein and are known in the art, see, e.g., Wang et al., “Human iPSC-Derived Oligodendrocyte Progenitor Cells can Myelinate and Rescue a Mouse Model of Congenital Hypomyelination,” Cell Stem Cell 12:252-264 (2013), which is incorporated herein by reference in its entirety.

[0026] In one embodiment, the K + The ingested glial cells are glial cells of a subject suffering from a neuropsychiatric disorder. As referred to herein, "neuropsychiatric disorder" includes any brain disease with psychiatric symptoms, including but not limited to dementia, amnesia syndrome, and personality and behavioral changes. It is known that impaired K in glial cells + Neuropsychiatric disorders that are channel-functional and suitable for treatment using the methods described herein include, but are not limited to, schizophrenia, autism spectrum disorders, and bipolar disorder.

[0027] Therefore, another aspect of the present disclosure relates to a method for treating or inhibiting the onset of a neuropsychiatric disorder in a subject. This method involves selecting a subject suffering from a neuropsychiatric disorder or at risk of suffering from a neuropsychiatric disorder, and administering a SMAD4 inhibitor to the selected subject under conditions effective for treating or inhibiting the onset of the neuropsychiatric disorder in the subject.

[0028] In one embodiment, the subject treated according to the present disclosure is a subject suffering from schizophrenia or at risk of suffering from schizophrenia. Schizophrenia is a chronic and severe mental disorder that affects how individuals think, feel and behave. To date, several staging models of illness have been proposed (Agius et al., "The Staging Model in Schizophrenia, and its Clinical Implications," Psychiatr. Danub. 22 (2): 211-220 (2010); McGorry et al., "Clinical Staging: a Heuristic Model and Practical Stage for New Research and Better Health and Social Outcomes for Psychotic and Related Disorders," Can. J. Psychiatry 55 (8): 486-497 (2010); Fava and Kellner, "Staging: a Neglected Dimension in Psychiatric Classification," Acta Psychiatr. Scand. 87: 225-230 (1993), which are incorporated herein by reference in their entirety). However, in general, schizophrenia develops in at least three stages: prodromal, first onset, and chronic. There is also heterogeneity among individuals at all stages of the illness, with some individuals considered to be at very high risk, clinically high risk, or at risk for psychotic episodes (Fusar-Poli et al., "The Psychosis High-Risk State: a Comprehensive State-of-the-Art Review," JAMA Psychiatry 70: 107-120 (2013), which is incorporated herein by reference in its entirety).

[0029] The methods described herein are applicable to treating subjects at any stage of schizophrenia and at any risk level for psychosis, as all stages will involve damaged glial cells. +Uptake. For example, in one embodiment, the subject treated according to the methods described herein is a subject at risk of developing schizophrenia. Such a subject may have one or more genetic mutations in one or more genes selected from the following genes associated with the development of schizophrenia and may or may not show any symptoms of the disease: ABCA13, ATK1, C4A, COMT, DGCR2, DGCR8, DRD2, MIR137, NOS1AP, NRXN1, OLIG2, RTN4R, SYN2, TOP3B YWHAE, ZDHHC8 or chromosome 22 (22q11). In another embodiment, the subject may be in the prodromal stage of the disease and show one or more early symptoms of schizophrenia, such as anxiety, depression, sleep disorders and / or transient intermittent psychotic syndrome. In another embodiment, the subject treated according to the methods described herein is experiencing psychotic symptoms of schizophrenia, such as hallucinations and delusions.

[0030] In another embodiment, the methods described herein are used to treat subjects with autism or related conditions.Related conditions include, but are not limited to, Asperger's disorder, pervasive developmental disorders not otherwise specified, disintegrative disorders in children, and Rett's Disorder, with different severity of symptoms, including difficulties in social interaction, communication, and abnormal behavior (McPartland et al., "Autism and Related Disorders," HandbClin Neurol 106: 407-418 (2012), which are incorporated herein by reference in their entirety). The methods described herein are applicable to treating each of these conditions and any stage of the conditions. In one embodiment, the subject treated according to the methods described herein does not show any symptoms of autism or related conditions. In another embodiment, the subject treated shows one or more early symptoms of autism or related conditions. In yet another embodiment, the subject treated according to the methods described herein shows a variety of symptoms of autism or related conditions.

[0031] In another embodiment, the methods described herein are used to treat a subject suffering from bipolar disorder. Bipolar disorder is a group of symptoms characterized by chronic instability of mood, circadian rhythm disturbances, and fluctuations in energy levels, mood, sleep, and perspectives of self and others. Bipolar disorder includes, but is not limited to, bipolar I disorder, bipolar II disorder, cyclothymic disorder, and bipolar disorder not otherwise specified.

[0032] Typically, bipolar disorder is a progressive condition that develops into at least three stages: a prodromal stage, a symptomatic stage, and a residual stage (Kapczinski et al., "Clinical Implications of a Staging Model for Bipolar Disorders," Expert Rev Neurother 9:957-966 (2009), and McNamara et al., "Preventative Strategies for Early-Onset Bipolar Disorder: Towards a Clinical Staging Model," CNS Drugs 24:983-996 (2010); which are incorporated herein by reference in their entirety). The methods described herein are applicable to treating subjects with any of the above-mentioned bipolar disorders and subjects at any stage of a specific bipolar disorder. For example, in one embodiment, the subject treated according to the methods described herein is a subject in the early prodromal stage, who exhibits symptoms of mood instability / swings, depression, rapid thinking, anger, irritability, physical agitation, and anxiety. In another embodiment, the subject treated according to the methods described herein is a subject in the symptomatic stage or the residual stage.

[0033] As used herein, the terms "subject" and "patient" specifically include human and non-human mammalian subjects. As used herein, the term "non-human mammal" extends to, but is not limited to, household pets and domestic animals. Non-limiting examples of such animals include primates, cattle, sheep, ferrets, mice, rats, pigs, camels, horses, rabbits, goats, dogs, and cats.

[0034] According to the present disclosure, + In another embodiment, a SMAD4 inhibitor is administered to glial cells with impaired glial cell K + In another embodiment, a SMAD4 inhibitor is administered to a subject who has a neurodegenerative disease that may or may not involve damaged glial cells. +The neuropsychiatric disorder of ingestion or the subject at risk of suffering from the neuropsychiatric disorder applies SMAD4 inhibitor.Smad4 (also known as Mothers Against Decapentaplegic Homolog 4, MADH4) and DPC4) represent the most unique members in the Smad family.This protein acts as a shared hetero-oligomerization partner (Lagna et al., "Partnership between DPC4 and SMAD Proteins in TGF-beta SignallingPathways," Nature 383: 832-836 (1996) in a complex with pathway-restricted Smad; Zhang et al., "The Tumor Suppressor Smad4 / DPC4as a Central Mediator of Smad Function," Curr.Biol.7: 270-276 (1997), which is incorporated herein by reference in its entirety). It has been confirmed that although Smad4 does not interact with TGF-β receptors, it exhibits two different functions in the Smad signaling cascade. Through its N-terminus, Smad4 facilitates the binding of the Smad complex to DNA, and through its C-terminus, it provides the activation signal required for the Smad complex to stimulate transcription (Liu et al., “Dual Role of the Smad4 / DPC4 Tumor Suppressor in TGFbeta-inducible Transcriptional Complexes,” Genes Dev. 11:3157-3167 (1997), which is incorporated herein by reference in its entirety).

[0035] The SMAD4 amino acid sequence is provided as SEQ ID NO:1 below.

[0036]

[0037] The nucleic acid sequence encoding SMAD4 is provided as SEQ ID NO: 2

[0038]

[0039]

[0040]

[0041] According to the present disclosure, suitable SMAD4 inhibitors are any agents or compounds that can reduce SMAD4 expression levels and / or SMAD4 signaling activity in the glial cells of the subject relative to SMAD4 expression levels and / or signaling activity occurring when the agent is not present. Suitable inhibitors can inhibit SMAD mRNA expression or protein expression, can block SMAD4 post-translational processing, can inhibit the interaction of SMAD4 with other signaling proteins, or can block SMAD4 nuclear translocation.

[0042] In one embodiment, SMAD4 inhibitor is a small molecule inhibitor. An exemplary SMAD4 inhibitor suitable for methods disclosed herein is a deubiquitinase inhibitor PR-619 (i.e., 2,6-diamino-3,5-pyridine dithiocyanate) that reduces SMAD4 expression levels; CAS No. 2645-32-1), such as Soji et al., " Deubiquitinase Inhibitor PR-619 Reduces Smad4 Expression and Suppresses Renal Fibrosis in Mice with Unilateral Ureteral Obstruction," PLoS 13 (8): e0202409 (2008), the document is incorporated herein by reference in its entirety. Another exemplary small molecule inhibitor of SMAD4 that also acts by reducing SMAD4 expression and is suitable for use in the methods described herein is valproic acid (see, e.g., Mao et al., “Valproic acid inhibits epithelial mesenchymal transition in renal cell carcinoma by decreasing SMAD4 expression,” Mol. Med. Rep. 16(5):6190-6199 (2017) and Lan et al., “Valproic acid (VPA) inhibits the epithelial-mesenchymal transition in prostate carcinoma via the dual suppression of SMAD4,” J Cancer Res Clin Oncol. 142(1):177-85 (2016), which are incorporated herein by reference in their entireties). Another exemplary small molecule inhibitor of SMAD4 suitable for use in the methods described herein is 5-fluorouracil (5-FU), which reduces SMAD4 protein levels, as taught by Okada et al., “Regulation of transforming growth factor is involved in the efficacy of combined 5-fluorouracil and interferon alpha-2b therapy of advanced hepatocellular carcinoma,” Cell Death Discov. 4:42 (2018), which is incorporated herein by reference in its entirety.Another exemplary SMAD4 inhibitor suitable for use in the methods described herein is the HDAC inhibitor vorinostat that inhibits SMAD4 nuclear translocation, as described in Sakamoto et al., "A Histone Deacetylase Inhibitor Suppresses Epithelial-Mesenchymal Transition and Attenuates Chemoresistance in Biliary Tract Cancer," PLoS One 11(1): e0145985 (2016), which is incorporated herein by reference in its entirety. Specific inhibitors of mitogen-activated protein kinase (MAPK) also block SMAD4 nuclear translocation, as disclosed in Jiang et al., "MAPK inhibitors modulate Smad2 / 3 / 4 complex cyto-nuclear translocation in myofibroblasts via Imp7 / 8 mediation," Mol Cell Biochem. 406(1-2): 255-62 (2015), which is incorporated herein by reference in its entirety). Thus, MAPK-specific inhibitors (particularly ERK, JNK, and p38-specific inhibitors) serve as another class of small molecule inhibitors useful in the methods disclosed herein.Suitable inhibitors in this class are known in the art and include, for example, but are not limited to, Ulixertinib (ERK inhibitor) (BVD523) (Sullivan et al., “First-in-Class ERK1 / 2 Inhibitor Ulixertinib (BVD-523) in Patient with MAPK Mutant Advanced Solid Tumors: Results of a Phase I Dose-Escalation and Expansion Study,” Cancer Discov. 8(2): 1-12 (2017), which is incorporated herein by reference in its entirety); CC-401, SP600125, AS601245, AS602801, D-JNKI-1 and BI-78D (JNK inhibitors) (Cicenas et al., “JNK, p38, ERK, and SGK1 Inhibitors in Cancer,” Cancers 10:1 (2018), which is incorporated herein by reference in its entirety); SCIO-469 (Talmapimod), BIRB-796 (Doramapimod), LY2228820 (Ralimetinib), VX-745, and PH-797804 (selective p38 inhibitors) (Cicenas et al., “JNK, p38, ERK, and SGK1 Inhibitors in Cancer,” Cancers 10:1 (2018), which is incorporated herein by reference in its entirety).

[0043] Another class of SMAD4 inhibitors suitable for use in the methods disclosed herein include inhibitory peptides. A suitable peptide inhibitor of SMAD4 is an SBD peptide (Urata et al., "A peptide thatblocks the interaction of NF-κB p65 subunit with Smad4 enhances BMP2-inducedosteogenesis," J Cell Physiol. 233 (9): 7356-7366 (2018), which is incorporated herein by reference in its entirety) that can block SMAD4 protein interactions. The SBD peptide corresponds to the amino-terminal region within the transactivation domain of p65 that interacts with the MH1 domain of SMAD4, called the Smad4 binding domain (SBD) (see Urata et al., “A peptide that blocks the interaction of NF-κB p65 subunit with Smad4 enhances BMP2-induced osteogenesis,” J Cell Physiol. 233(9):7356-7366 (2018) and Hirata-Tsuchiya et al., Inhibition of BMP2-Induced Bone Formation by the p65 Subunit of NK-kB via an Interaction with SMAD 4,” Mol. Endocrinology 28(9):1460-1470 (2014), which are incorporated herein by reference in their entireties). The binding of the SBD peptide to SMAD4 blocks the interaction of SMAD4 with other proteins such as p65. An exemplary SBD peptide has the amino acid sequence APGLPNGLLSGDEDFSSIADMDFSALLSQISS (SEQ ID NO:35).

[0044] Another suitable peptide inhibitor of SMAD4 is a hairy protein (CLP or Cotl1; UniProtKB accession number Q14019), which is an F-actin binding protein. This protein inhibits SMAD4 by causing post-translational downregulation of SMAD4 (Xia et al., "Coactosin-like protein CLP / Cotl1 suppresses breast cancer growththrough activation of IL-24 / PERP and inhibition of non-canonical TGFβsignaling," Oncogene 37(3):323-331(2018), which is incorporated herein by reference in its entirety). Therefore, a recombinant form of CLP / Cotl1 having an amino acid sequence of SEQ ID NO:8 (shown below) or an active fragment thereof is suitable for use in the methods disclosed herein.

[0045]

[0046] In another embodiment, the SMAD4 inhibitor is an inhibitory nucleic acid molecule selected from the group consisting of SMAD4 antisense oligonucleotides, SMAD4 shRNA, SMAD4 siRNA, and SMAD4 RNA aptamers.

[0047] The use of antisense methods to inhibit the in vivo translation of genes and subsequent protein expression is well known in the art (e.g., U.S. Pat. No. 7,425,544 of Dobie et al.; U.S. Pat. No. 7,307,069 of Karras et al.; U.S. Pat. No. 7,288,530 of Bennett et al.; U.S. Pat. No. 7,179,796 of Cowsert et al., which are incorporated herein by reference in their entirety). According to the present disclosure, suitable antisense nucleic acids are nucleic acid molecules complementary to or hybridizing with at least a portion of a specific nucleic acid molecule encoding SMAD4 (e.g., molecules containing DNA nucleotides, RNA nucleotides or modifications (e.g., modifications that increase molecular stability, such as 2'-O-alkyl (e.g., methyl) substituted nucleotides) or combinations thereof) (see, e.g., Weintraub, HM, "Antisense DNA and RNA," Scientific Am. 262: 40-46 (1990), which are incorporated herein by reference in their entirety). SEQ ID NO: 2 above is an exemplary nucleic acid molecule encoding SMAD4. The length of the antisense oligonucleotide suitable for methods described herein is or up to 12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29 or 30 core bases, and comprises no more than 6, no more than 5, no more than 4, no more than 3, no more than 2 or no more than 1 non-complementary core base relative to target SMAD4 nucleic acid or its specific part.Antisense nucleic acid molecule and its corresponding target SMAD4 nucleic acid molecule hybridize, to form a double-stranded molecule, the double-stranded molecule interferes with the translation of mRNA, because the cell will not translate double-stranded mRNA.

[0048] SMAD4 antisense nucleic acids can be introduced into cells as antisense oligonucleotides, or can be produced in cells having introduced nucleic acids encoding antisense nucleic acids, for example, using gene therapy methods. Anti-SMAD4 antisense oligonucleotides suitable for use according to the methods described herein are disclosed in U.S. Patent No. 6,013,787 and Kretschmer et al., " Differential Regulation of TGF-βSignaling Through Smad2, Smad3, and Smad4," Oncogene 22: 6748-6763 (2003), which are incorporated herein by reference in their entirety.

[0049] SMAD4 siRNA is a double-stranded synthetic RNA molecule with a length of about 20-25 nucleotides, with short 3' overhangs of 2-3 nucleotides at both ends. Double-stranded siRNA molecules represent the sense strand and antisense strand of a part of target mRNA molecules, in this case a part of SMAD4 nucleotide sequence, i.e. the SEQ ID NO:2 encoding SMAD4. siRNA molecules are generally designed to target the region of about 50-100 nucleotides from the start codon of SMAD4 mRNA targets. After being introduced into cells, siRNA complexes trigger endogenous RNA interference (RNAi) pathways, thereby causing target SMAD4 mRNA molecule cracking and degradation. siRNA molecules targeting SMAD4 and other members of the SMAD4 transcriptional complex that can be used in the methods disclosed herein are disclosed in U.S. Pat. No. 9,035,039 to Dhillon et al. and Puplampu-Dove et al., “Potentiating Tumor Immunity Using Aptamer-Targeted RNAi to Render CD8+T Cells Resistant to TGFβ Inhibition,” J. OncoImmunology 7(4) (2018), which are incorporated herein by reference in their entirety. Various improvements in siRNA compositions, such as incorporation of modified nucleosides or motifs into one or both strands of the siRNA molecule to enhance stability, specificity, and efficacy, have been described and are suitable for use in accordance with this aspect of the disclosure (see, e.g., WO2004 / 015107 to Giese et al.; WO2003 / 070918 to McSwiggen et al.; WO1998 / 39352 to Imanishi et al.; U.S. Patent Application Publication No. 2002 / 0068708 to Jesper et al.; U.S. Patent Application Publication No. 2002 / 0147332 to Kaneko et al.; U.S. Patent Application Publication No. 2008 / 0119427 to Bhat et al., which are incorporated herein by reference in their entireties).

[0050] Short or small hairpin RNA molecules are functionally similar to siRNA molecules, but include longer RNA sequences that produce tight hairpin turns. shRNA is cleaved into siRNA by cellular mechanisms, and gene expression is silenced by cell RNA interference pathways. The shRNA molecules that effectively interfere with SMAD4 expression are described herein, and they include the following nucleic acid sequences: 5'GUAAGUAGCUGGCUGACCA-3' (SEQ ID NO:3) targeting SMAD4 nucleotide sequence 5'-TGGTCAGCCAGCTACTTAC-3' (SEQ ID NO:4) and 5'-AGAAGUGAGUCAUAUUCAU-3' (SEQ ID NO:6) targeting SMAD4 nucleotide sequence 5'-ATGAATATGACTCACTTCT-3' (SEQ ID NO:7). Other shRNA molecules that suppress SMAD4 expression and are suitable for use according to the methods described herein are suppressed in this area, see, for example, Doiron's WO2016115558, which is incorporated herein by reference in its entirety.

[0051] The nucleic acid aptamer that specifically binds to SMAD4 is also applicable to methods as described herein.Nucleic acid aptamer is a single-stranded, partially single-stranded, partially double-stranded or double-stranded nucleotide sequence, which can specifically identify the target molecule selected by the mechanism other than Watson-Crick base pairing or triplex formation, i.e., the SMAD4 protein with amino acid sequence SEQ ID NO:1 or the SMAD4 nucleic acid molecule with nucleotide sequence SEQ ID NO:2.Appendix includes but is not limited to the sequence segment determined and the sequence of the nucleotides comprising nucleotides, ribonucleotides, deoxyribonucleotides, nucleotide analogs, modified nucleotides and the nucleotides comprising main chain modifications, branch points and non-nucleotide residues, groups or bridges.

[0052] Modification to inhibitory nucleic acid molecules as described herein (i.e., SMAD4 antisense oligonucleotides, siRNA, shRNA, PNA, aptamers) includes substitution or change of internucleoside bonds, sugar moieties or core bases. The inhibitory nucleic acid molecules modified are generally superior to native forms because they have desired characteristics, such as enhanced cellular uptake, enhanced affinity to nucleic acid targets, stability increased in the presence of nucleases or increased inhibitory activity. For example, chemically modified nucleosides can be used to increase the binding affinity of shortened or truncated antisense oligonucleotides to their target nucleic acids. Therefore, it is often possible to obtain suitable results with the shorter antisense compounds of such chemically modified nucleosides.

[0053] The inhibitory nucleic acid molecules targeting SMAD4 may optionally contain one or more nucleosides in which the sugar group has been modified. Such sugar-modified nucleosides can confer enhanced nuclease stability, increased binding affinity or some other beneficial biological properties to nucleic acid molecules. In certain embodiments, the nucleoside comprises a chemically modified furanose ring moiety. Examples of chemically modified furanose rings include, but are not limited to, adding substituents including 5' and 2' substituents, bridging non-geminal ring atoms to form bicyclic nucleic acids (BNAs), replacing ribose ring oxygen atoms with S, N (R) or C (R1) (R) 2 (wherein R = H, C1-C12 alkyl or protecting group), and combinations thereof. Examples of chemically modified sugars include 2'-F-5'-methyl substituted nucleosides, replacing ribose ring oxygen atoms with S and further replacing at the 2'-position.

[0054] In certain embodiments, nucleosides are modified by replacing the ribosyl ring with a sugar surrogate (sometimes referred to as a DNA analog), such as a morpholino ring, a cyclohexenyl ring, a cyclohexyl ring, or a tetrahydropyranyl ring.

[0055] Nucleobase (or base) modification or substitution can be distinguished structurally from naturally occurring or synthesized unmodified nucleobase, but can be interchanged with naturally occurring or synthesized unmodified nucleobase functionally.Both natural nucleobase and modified nucleobase can participate in hydrogen bonding.Such nucleobase modification can give SMAD4 inhibitor nucleic acid molecule nuclease stability, binding affinity or some other beneficial biological properties.Modified nucleobase includes synthetic and natural nucleobase, such as, for example, 5-methylcytosine (5-me-C).Some nucleobase substitutions (including 5-methylcytosine substitutions) are particularly useful for increasing the binding affinity of nucleic acid molecules and their target nucleic acids. Other modified nucleobases include 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl (-C≡C-CH3) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azouracil, cytosine and thymine. pyrimidine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxy and other 8-substituted adenines and guanines, 5-halo (specifically 5-bromo), 5-trifluoromethyl, 7-methylguanine and 7-methyladenine, 2-F-adenine, 2-aminoadenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine and 3-deazaadenine.

[0056] The naturally occurring internucleoside bond of RNA and DNA is a 3' to 5' phosphodiester bond. The inhibitory nucleic acid molecule with a modified internucleoside bond includes an internucleoside bond retaining a phosphorus atom and an internucleoside bond without a phosphorus atom. Representative phosphorus-containing internucleoside linkages include but are not limited to phosphodiester, phosphotriester, methyl phosphate, phosphoramidate and thiophosphate. The method for preparing phosphorus-containing bonds and non-phosphorus-containing bonds is well known. In certain embodiments, the inhibitory nucleic acid molecule of targeting SMAD4 nucleic acid includes one or more modified internucleoside bonds.

[0057] Inhibitory nucleic acid molecules described herein can be covalently linked to one or more parts or conjugates, and said parts or conjugates enhance the activity, cellular distribution or cellular uptake of the inhibitory nucleic acid molecules obtained. Typical conjugate groups include cholesterol moieties and lipid moieties. Other conjugate groups include carbohydrates, polymers, peptides, inorganic nanostructured materials, phospholipids, biotin, phenazine, folic acid, phenanthridine, anthraquinone, acridine, fluorescein, rhodamine, coumarin and dyestuff.

[0058] Inhibitory nucleic acid molecules as described herein can also be modified to have one or more stabilizing groups, such as cap structures, that are usually connected to one or both ends of inhibitory nucleic acid molecules to enhance properties (e.g., nuclease stability). These end modifications protect inhibitory nucleic acid molecules from exonuclease degradation, and contribute to intracellular delivery and / or positioning. Cap structures can be present at 5' ends (5'-caps) or 3' ends (3'-caps), or can be present at both ends. Cap structures are well known in the art and include, for example, reverse deoxy-basic caps. Other 3' and 5'-stabilizing groups that can be used to end-cap inhibitory nucleic acid molecules to impart nuclease stability include those disclosed in WO 03 / 004602 of Manoharan, which is incorporated herein by reference in its entirety.

[0059] In another embodiment, a suitable SMAD4 inhibitor is any agent or small molecule that is capable of reducing, blocking or preventing the level of SMAD4 interaction with SMAD 2 and 3 and / or SMAD4 interaction with SMAD 1, 5 and 8 in glial cells relative to the level of such interaction that occurs in the absence of the agent.

[0060] In another embodiment, a suitable SMAD4 inhibitor is any agent or small molecule capable of antagonizing or reducing SMAD4 activity in glial cells relative to the level of SMAD4 activity that occurs in the absence of the agent.

[0061] In one embodiment, the SMAD4 inhibitor used according to the method described herein is packaged into a nanoparticle delivery vehicle to realize the delivery of the inhibitor to the glial cells of the subject. Suitable nanoparticle delivery vehicles for passing through the blood-brain barrier and / or delivering SMAD4 inhibitors to glial cells include but are not limited to liposomes, protein nanoparticles, polymer nanoparticles, metal nanoparticles and dendrimers.

[0062] Liposome is a spherical vesicle composed of phospholipids and steroid (e.g., cholesterol) bilayers of about 80-300nm in size. Liposome is biodegradable and has low immunogenicity. Encapsulation method can be used to incorporate SMAD4 inhibitors as described herein into liposome. Liposome is absorbed by target cells by adsorption, fusion, endocytosis or lipid transfer. The release of SMAD4 inhibitor from liposome depends on liposome composition, pH, osmotic gradient and surrounding environment. Liposome can be designed to release SMAD4 inhibitor in an organelle-specific manner, to achieve nuclear delivery of SMAD4 inhibitor, for example.

[0063] Methods and types of liposomes that can be used to deliver the SMAD4 inhibitors described herein to glial cells are known in the art, see, for example, Liu et al., “Paclitaxel loaded liposomes decorated with amultifunctional tandem peptide for glioma targeting,” Biomaterials 35:4835–4847 (2014); Gao et al., “Glioma targeting and blood-brain barrier penetration by dual-targeting doxorubicin liposomes,” Biomaterials 34:5628–5639 (2013); Zong et al., “Synergistic dual-ligand doxorubicin liposomes improve targeting and therapeutic efficacy of brain glioma in animals,” Mol Pharm. 11:2346–2357 (2014); Yemisci et al., “Systemically administered brain-targeted nanoparticles transport peptides across the blood-brain barrier and provide neuroprotection,” J Cerebr Blood F Met. 35:469–475 (2015), which is incorporated herein by reference in its entirety.

[0064] In another embodiment, SMAD4 inhibitors as described herein are packaged in polymer delivery vehicles. Polymer delivery vehicles are structures with a diameter of generally about 10 to 100 nm. Suitable polymer nanoparticles for encapsulating SMAD4 inhibitors as described herein can be made of synthetic polymers (e.g., poly-ε-caprolactone, polyacrylamide, and polyacrylate) or natural polymers (e.g., albumin, gelatin, or chitosan). Polymer nanoparticles used herein can be biodegradable, such as poly (L-lactide) (PLA), polyglycolide (PGA), poly (lactic acid-co-glycolic acid) (PLGA), or non-biodegradable, such as polyurethane. Polymer nanoparticles used herein can also contain one or more enhanced surface modifications for delivery. For example, in one embodiment, polymer nanoparticles are coated with nonionic surfactants to reduce immunological interactions and intermolecular interactions. The surface of the polymeric nanoparticles can also be functionalized to attach or immobilize one or more targeting moieties as described below, such as antibodies or other binding polypeptides or ligands that direct the nanoparticles across the blood-brain barrier and / or to glial cells for glial uptake (i.e., uptake by glial progenitor cells or astrocytes).

[0065] Methods and types of polymer nanoparticles that can be used to deliver SMAD4 inhibitors as described herein to glial cells are known in the art, see, for example, Koffie et al. "Nanoparticles enhance brain delivery of blood-brain barrier-impermeable probes for in vivo optical and magnetic resonance imaging," Proc Natl Acad Sci US A. 108: 18837-18842 (2011); Zhao et al., "The permeability of puerarin loaded poly(butylcyanoacrylate) nanoparticles coated with polysorbate 80 on the blood-brain barrier and its protective effect against cerebral ischemia / reperfusion injury," Biol Pharm Bull. 36: 1263-1270 (2013); Yemisci et al., "Systemically administered brain-targeted nanoparticles transport peptides across the blood-brain barrier and provide neuroprotection," J Cerebr Blood F Met. 35:469–475 (2015), which is incorporated herein by reference in its entirety.

[0066] In another embodiment, the composition of the present disclosure is packaged in a dendrimer nanocarrier delivery vehicle. Dendrimers are unique polymers with clearly defined sizes and structures. Exemplary nanomolecules with dendritic structures suitable for use as delivery vehicles for SMAD4 inhibitors as described herein include, but are not limited to, glycogen, amylopectin, and proteoglycans. Methods for encapsulating therapeutic compositions (e.g., compositions described herein) in the internal structure of dendrimers are known in the art, see, e.g., D'Emanuele et al., "Dendrimer-drug interactions," Adv Drug Deliv Rev 57: 2147–2162 (2005), which are incorporated herein by reference in their entirety. The surface of the dendrimer is suitable for connecting one or more targeting moieties, such as antibodies or other binding proteins and / or ligands capable of targeting dendrimers across the blood-brain barrier and / or reaching glial cells as described herein.

[0067] An exemplary dendrimer for encapsulating SMAD4 inhibitors for administration and delivery to a subject in need thereof is poly(amidoamide) (PAMAM). PAMAM has been used to deliver protein and nucleic acid therapeutics to target cells of interest. Methods for encapsulating therapeutic agents in PAMAM and methods for delivering therapeutic agents to the central nervous system using PAMAM are also known in the art and can be used herein, see, for example, Cerqueira et al., “Multifunctionalized CMChot / PAMAM dendrimer nanoparticles modulate the cellular uptake by astrocytes and oligodendrocytes in primary cultures of glial cells,” Macromol Biosci. 12:591–597 (2012); Nance et al., “Systemic dendrimer-drug treatment of ischemia-induced neonatal white matter injury,” J Control Release 214:112–120 (2015); Natali et al., “Dendrimers as drug carriers: dynamics of PEGylated and methotrexate-loaded dendrimers in aqueous solution,” Macromolecules 43:3011–3017 (2010); Han et al., “Peptide conjugated PAMAM for targeted "doxorubicindelivery to transferrin receptor overexpressed tumors," Mol Pharm 7:2156–2165 (2010); Kannan et al., "Dendrimer-based Postnatal Therapy for Neuroinflammation and Cerebral Palsy in a Rabbit Model," Sci.Transl.Med.4:130 (2012); and Singh et al., “Folate and Folate-PEG-PAMAM dendrimers: synthesis, characterization, and targeted anticancer drug delivery potential in tumor bearing mice,” Bioconjugate Chem 19:2239–2252 (2008), which are incorporated herein by reference in their entirety.

[0068] In another embodiment, the SMAD4 inhibitor as disclosed herein is packaged in silver nanoparticles or iron oxide nanoparticles. The method for delivering the SMAD4 inhibitor as described herein to glial cells and the preparation of silver and iron oxide nanoparticles are known in the art, see, for example, Hohnholt et al., "Handling of iron oxide and silver nanoparticles by astrocytes," Neurochem Res. 38: 227–239 (2013), which is incorporated herein by reference in its entirety.

[0069] In another embodiment, SMAD4 inhibitors as described herein are packaged in gold nanoparticles. Gold nanoparticles are small particles (<50nm) that enter cells through endocytosis pathways. In one embodiment, gold nanoparticles are coated with glucose to promote nanoparticles to cross the blood-brain barrier and transfer and astrocytes to nanoparticles through GLUT-1 receptors, such as Gromnicova et al., " Glucose-coated Gold Nanoparticles Transferacross HumanBrain Endothelium and Enter Astrocytes In vitro," PLoSONE 8 (12): e81043 (2013), the document is incorporated herein by reference in its entirety.

[0070] In another embodiment, the composition of the present disclosure is packaged in silica nanoparticles. Silica nanoparticles are biocompatible, highly porous and easy to functionalize. Silica nanoparticles are amorphous in shape and range in size from 10-300 nm. Silica nanoparticles suitable for delivering therapeutic compositions, such as SMAD4 inhibitors, to the CNS for glial uptake are known in the art, see, for example, Song et al., “In vitro Study of Receptor-mediated Silica Nanoparticles Delivery Across Blood Brain Barrier,” ACS Appl. Mater. Interfaces 9(24):20410-20416 (2017); Tamba et al., “Tailored Surface Silica Nanoparticles for Blood-Brain Barrier Penetration: Preparation and Invivo Investigation,” Arabian J. Chem. doi.org / 10.1016 / j.arabjc.2018.03.019 (2018), which are incorporated herein by reference in their entirety.

[0071] In another embodiment, the SMAD4 inhibitor is packaged into a protein nanoparticle delivery vehicle. Protein nanoparticles are biodegradable, metabolizable, and easily modified to allow for the capture of therapeutic molecules or compositions and the attachment of targeting molecules as desired. Suitable protein nanoparticle delivery vehicles known in the art and used to deliver therapeutic compositions to the central nervous system include, but are not limited to, albumin particles (see, e.g., Lin et al., “Blood-brain Barrier Penetrating Albumin Nanoparticles for Biomimetic Drug Delivery via Albumin-Binding Protein Pathway for Antiglioma Therapy,” ACS Nano 10(11):9999-10012 (2016), and Ruan et al., “Substance P-modified Human Serum Albumin Nanoparticles Loaded with Paclitaxel for Targeted Therapy of Glioma,” Acta Pharmaceutica Sinica B 8(1):85-96 (2018), which are incorporated herein by reference in their entirety), gelatin nanoparticles (see, e.g., Zhao et al., “Using Gelatin Nanoparticle Mediated Intranasal Delivery of Neuropeptide Substance P to Enhance Neuro-Recovery in Hemiparkinsoninan Rats,” PLoS One 11(2):e0148848 (2016), which is incorporated herein by reference in its entirety) and lactoferrin nanoparticles (see, e.g., Kumari et al., “Overcoming Blood Brain Barrier with Dual Purpose Temozolomide Loaded Lactoferrin Nanoparticles for Combating Glioma (SERP-17-12433),” Scientific Reports 7:6602 (2017), which is incorporated herein by reference in its entirety).

[0072] The delivery of nanoparticle-mediated therapeutic compositions can be achieved passively (i.e., based on the normal distribution pattern of liposomes or nanoparticles in vivo) or by active targeted delivery. Active targeted delivery involves changing the natural distribution pattern of the delivery vehicle by connecting the targeting moiety to the outer surface of the liposome. In one embodiment, the delivery vehicle as described herein is modified to include one or more targeting moieties, i.e., the targeting moieties that promote liposomes or nanoparticles to pass through the blood-brain barrier and / or the targeting moieties that promote glial cell uptake (i.e., glial progenitor cell uptake and / or astrocyte uptake). In one embodiment, the delivery vehicle as described herein is surface-modified to express a targeting moiety that is suitable for achieving blood-brain barrier penetration. In another embodiment, the delivery vehicle as described herein is surface-modified to express a targeting moiety that is suitable for glial cell uptake. In another embodiment, the delivery vehicle as described herein is surface-modified to express a dual targeting moiety.

[0073] Targeting moieties that facilitate liposome or nanoparticle delivery across the blood-brain barrier utilize receptor-mediated, transporter-mediated, or adsorption-mediated transport across the barrier. Suitable targeting moieties for achieving blood-brain barrier crossing include antibodies and ligands that bind to endothelial cell surface proteins and receptors. Exemplary targeting moieties include, but are not limited to, cyclic RGD peptides (Liu et al., “Paclitaxel loaded liposomes decorated with a multifunctional tandempeptide for glioma targeting,” Biomaterials 35:4835–4847 (2014), which is incorporated herein by reference in its entirety); cyclic A7R peptides that bind to VEGFR2 and neuropilin-1 (Ying et al., “AStabilized Peptide Ligand for Multifunctional Glioma Targeted Drug Delivery,” J. Contr. Rel. 243:86-98 (2016), which is incorporated herein by reference in its entirety); transferrin, peptides or antibodies capable of binding to transferrin receptor (Zong et al., “Synergistic dual-ligand doxorubicin liposomes simulate targeting and therapeutic efficacy of brain glioma in a animals,” MolPharm. 11:2346–235773 (2014); Yemisci et al., “Systemically administered brain-targeted nanoparticles transport peptides a cross the blood-brain barrier and provide neuroprotection,” J Cerebr Blood F Met. 35:469–475 (2015); and Wei et al., “Brain Tumor-targeted Therapy by Systemic Delivery of siRNA with TransferrinReceptor-Mediated Core-Shell Nanoparticles,” Inter.J.Pharm 510(1):394-405), Niewoehner et al., “Increased Brain Penetration and Potency of a TherapeuticAntibody Using a Monovalent Molecular Shuttle,” Neuron 81:49-60 (2014), which is incorporated herein by reference in its entirety); folate protein or peptide that binds to folate receptor (Gao et al. “Glioma targeting and blood-brain barrier penetration by dual-targeting doxorubincin liposomes,” Biomaterials 34:5628–5639 (2013), which is incorporated herein by reference in its entirety); lactoferrin protein or peptide that binds to lactoferrin receptor (Song et al., “In vitro Study of Receptor-mediated SilicaNanoparticles Delivery Across Blood Brain Barrier,” ACS Appl. Mater.Interfaces 9(24):20410-20416 (2017), which is incorporated herein by reference in its entirety); low-density lipoprotein receptor ligands, such as ApoB and ApoE (Wagner et al., “Uptake Mechanisms of ApoE-modified Nanoparticles on Brain Capillary Endothelial Cells as a Blood-brain Barrier Model,” PLoS One 7:e32568 (2012), which is incorporated herein by reference in its entirety); substance P peptide (Ruan et al., “Substance P-modified Human Serum Albumin Nanoparticles Loaded with Paclitaxel for Targeted Therapy of Glioma,” Acta Pharmaceutica Sinica B 8(1):85-96 (2018), which is incorporated herein by reference in its entirety); and angiopep-2 (An2) peptide (Demeule et al., “Conjugation of abrain-penetrant peptide with neurotensin provides antinociceptive properties," J. Clin. Invest. 124: 1199–1213 (2014), which is incorporated herein by reference in its entirety). Other suitable targeting moieties include ligands for amino acid transporters, such as glutathione for transport via glutathione transporters (Rip et al., "Glutathione PEGylated Liposomes: Pharmacokinetics and Delivery of Cargo Across the Blood-Brain Barrier in Rats," J. Drug Target 22: 460-67 (2014), which is incorporated herein by reference in its entirety), and choline derivatives for delivery via choline transporters (Li et al., "Choline-derivative-modified Nanoparticles for Brain-targeting Gene Delivery," Adv. Mater. 23: 4516-20 (2011), which is incorporated herein by reference in its entirety).

[0074] The second targeting moiety is a moiety that promotes delivery and uptake by glial cells. Suitable targeting moieties for achieving astrocyte uptake include, but are not limited to, low-density lipoprotein (LDL) receptor ligands or peptides thereof that are capable of binding to LDL receptors and oxidized LDL receptors on astrocytes (Lucarelli et al., “The Expression of Native and Oxidized LDL Receptors in Brain Microvessels is Specifically Enhanced by Astrocyte-derived Soluble Factor(s),” FEBS Letters 522(1-3):19-23 (2002), which is incorporated herein by reference in its entirety), glucose or other glycans that are capable of binding to GLUT-1 receptors on astrocytes (Gromnicova et al., “Glucose-coated Gold Nanoparticles Transfer across Human Brain Endothelium and Enter Astrocytes In vitro,” PLoS ONE 8(12):e81043 (2013), which is incorporated herein by reference in its entirety), and platelet-derived growth factor or peptides thereof that are capable of binding to PDGFRα of glial progenitor cells.

[0075] Glial cell delivery of the inhibitory nucleic acid molecules described herein (eg, SMAD4 antisense oligonucleotides, SMAD4 siRNA, SMAD4 shRNA) can also be achieved by packaging such nucleic acid molecules in viral vectors. Several viral vectors are known to intrinsically target astrocytes in vivo, such as lentiviral vectors (Colin et al., "Engineered Lentiviral Vector Targeting Astrocytes In vivo," Glia 57:667-679 (2009), and Cannon et al., "Pseudotype-dependent Lentiviral Transduction of Astrocytes or Neurons in the Rat Substantia Nigra," Exp. Neurol. 228:41-52 (2011), which are incorporated herein by reference in their entireties) and adeno-associated viral vectors (Furman et al., "Targeting Astrocytes Ameliorates Neurologic Changes in a Mouse Model of Alzheimer's Disease," J. Neurosci. 32:16129-40 (2012), which are incorporated herein by reference in their entireties), and are therefore suitable for use in achieving delivery of nucleic acid SMAD4 inhibitory molecules according to the methods described herein.

[0076] In one embodiment, the carrier is an adenovirus-associated virus (AAV) carrier. It is known in the art that many therapeutic AAV carriers suitable for delivering nucleic acid SMAD4 inhibitors or polynucleotides encoding SMAD4 protein inhibitors described herein to the central nervous system. See, for example, Deverman et al., "Gene Therapy for Neurological Disorders: Progress and Prospects," Nature Rev. 17: 641-659 (2018), which is incorporated herein by reference in its entirety. Suitable AAV carriers include serotypes AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10 or AAV11 that are engineered in natural form or for enhanced tropism. It is known that CNS has tropism and is particularly suitable for therapeutic expression of SMAD4 nucleic acid molecules described herein AAV carriers include AAV1, AAV2, AAV4, AAV5, AAV8 and AAV9 that are engineered in natural form or for enhanced tropism. In one embodiment, the AAV vector is an AAV2 vector. In another embodiment, the AAV vector is an AAV5 vector as described in Vitale et al., "Anti-tau Conformational scFvMC1 Antibody Efficiently Reduces Pathological Tau Species in Adult JNPL3Mice," Acta Neuropathol. Commun. 6: 82 (2018), optionally containing GFAP or CAG promoters and woodchuck hepatitis virus (WPRE) post-translational regulatory elements. In another embodiment, the AAV vector is an AAV9 vector as described in Haiyan et al., "Targeting Root Cause by SystemicscAAV9-hIDS Gene Delivery: Functional Correction and Reversal of Severe MPSII in Mice," Mol. Ther. Methods Clin. Dev. 10: 327-340 (2018), which is incorporated herein by reference in its entirety.In another embodiment, the AAV vector is an AAVrh10 vector as described in Liu et al., “Vectored Intracerebral Immunizations with the Anti-Tau Monoclonal Antibody PHF1 Markedly Reduces Tau Pathology in Mutant Transgenic Mice,” J. Neurosci. 36(49): 12425-35 (2016), which is incorporated herein by reference in its entirety.

[0077] In another embodiment, the AAV vector is a hybrid vector comprising a genome of one serotype (e.g., AAV2) and a capsid protein of another serotype (e.g., AAV1 or AAV3-9) that controls tropism. See, e.g., Broekman et al., "Adeno-associated Virus Vectors Serotyped with AAV8 Capsid are More Efficientthan AAV-1 or -2 Serotypes for Widespread Gene Delivery to the Neonatal Mouse Brain," Neuroscience 138:501-510 (2006), which is incorporated herein by reference in its entirety. In one embodiment, the AAV vector is an AAV2 / 8 hybrid vector as described in Ising et al., "AAV-mediated Expression of Anti-Tau ScFvDecreases Tau Accumulation in a Mouse Model of Tauopathy," J. Exp. Med. 214 (5): 1227 (2017), which is incorporated herein by reference in its entirety. In another embodiment, the AAV vector is an AAV2 / 9 hybrid vector as described in Simon et al., “A Rapid Gene Delivery-Based Mouse Model for Early-Stage Alzheimer Disease-Type Tauopathy,” J. Neuropath. Exp. Neurol. 72(11):1062-71 (2013), which is incorporated herein by reference in its entirety.

[0078] In another embodiment, the AAV vector is a vector that has been engineered or selected for enhanced CNS transduction following intraparenchymal administration, such as AAV-DJ (Grimm et al., J. Viol. 82:5887-5911 (2008), which is incorporated herein by reference in its entirety); increased transduction of stem or progenitor cells, such as SCH9 and AAV4.18 (Murlidharan et al., J. Virol. 89:3976-3987 (2015) and Ojala et al., Mol. Ther. 26:304-319 (2018), which is incorporated herein by reference in its entirety); retrograde transduction enhancement, such as rAAV2-retro (Muller et al., Nat. Biotechnol. 21:1040-1046 (2003), which is incorporated herein by reference in its entirety); or transduction enhancement of the adult CNS after IV administration, such as AAV-PHP.B and AAVPHP.eB (Deverman et al., Nat. Biotechnol. 34:204-209 (2016) and Chan et al., Nat. Neurosci. 20:1172-1179 (2017), which are incorporated herein by reference in their entirety.

[0079] As used herein, "treatment" or "treatment" includes the use of SMAD4 inhibitors to partially or completely restore or de-block potassium channel gene expression in neuroglial cells, partially or completely restore potassium channel uptake activity in neuroglial cells, and partially or completely restore potassium homeostasis in neuroglial cells and surrounding tissues. Regarding the treatment of a subject suffering from a neuropsychiatric condition, "treatment" includes any indication of successfully improving the condition, including any objective or subjective parameter, such as mitigation, relief, reduction (e.g., reducing neuronal excitability) of symptoms or making the patient more tolerant to the condition (e.g., reducing epileptic events); slowing down the progress of the condition; preventing the condition from worsening; or improving the physical and mental health of the subject. The treatment or improvement of symptoms can be based on objective or subjective parameters; including the results of physical examination, neurological examination and / or psychiatric assessment.

[0080] As referred to herein, "under effective conditions" refers to the effective dose, route of administration, frequency of administration, preparation of SMAD4 inhibitors, etc., which play a role in achieving the desired therapeutic benefit of the subject. The effective amount of the SMAD4 inhibitor for treating the subject according to the method described herein is to partially or completely de-repress potassium channel gene expression, thereby restoring potassium channel uptake function (partially or completely) to allow the dose of the SMAD4 inhibitor for restoring brain potassium homeostasis. In the case of applying SMAD4 inhibitors to subjects suffering from neuropsychiatric disorders such as schizophrenia, the effective dose is the dose that induces glial progenitor cells to differentiate into astrocytes. In another embodiment, the effective dose is to restore brain potassium homeostasis to the dose required for the extracellular level of potassium, reduce neuronal excitability and reduce the level of epileptic events. In another embodiment, the effective dose for treating a subject suffering from neuropsychiatric disorders is a dose that is effective in improving the cognitive disorder of the subject. The effective dose and administration conditions for a specific subject are, for example, according to the health and physical condition of the individual to be treated, the mental and emotional abilities of the individual, the stage of the disease, the type of SMAD4 inhibitor, route of administration, preparation, the assessment of the medical condition by the attending physician and other relevant factors.

[0081] In one embodiment, the K + The glial cells that function in the channel are glial progenitor cells. As shown in the examples herein, upregulation of SMAD4 in glial progenitor cells inhibits K + channel gene expression and subsequently inhibited K + Intake. K + The reduction in uptake inhibits terminal glial progenitor differentiation. Therefore, in one embodiment, an effective dose of a SMAD4 inhibitor is a dose that enhances astrocyte maturation of glial progenitor cells, thereby reducing, eliminating or inhibiting the onset of neuropsychiatric disease, symptoms of neuropsychiatric disease or the onset of side effects of the disease.

[0082] In another embodiment, the K + The glial cells that function the channel are astrocytes. SMAD4 inhibition in astrocytes restored K + Uptake and subsequent K +Steady state.SMAD4 inhibition in astrocytes (wherein potassium channel expression and function change) of a subject suffering from neuropsychiatric disease reduces neuronal excitability, reduces epilepsy incidence (seizure incidence) and improves cognitive disorder.Therefore, the treatment carried out with the SMAD4 inhibitor of effective dose reduces, alleviates, prevents or suppresses the development of symptoms or symptom related to schizophrenia, autism spectrum disorder, bipolar disorder or any other neuropsychiatric disorder.Treatment can be preventive, to prevent or delay the onset or deterioration of disease, symptom or illness, or to prevent the performance of its clinical or subclinical symptoms.Or, treatment can be therapeutic, to suppress and / or alleviate symptoms after disease, symptom or illness performance.

[0083] Can be used to restore glial cells in a subject (e.g., a subject suffering from a neuropsychiatric condition) + The ingested SMAD4 inhibitor can be administered parenterally, topically, orally or intranasally for therapeutic treatment. Intramuscular injection (e.g., injection into arm or leg muscles) and intravenous infusion are suitable methods for administering the SMAD4 inhibitors disclosed herein. In some methods, such molecules are administered as sustained release compositions or devices such as Medipad TM Device (Elan Pharm. Technologies, Dublin, Ireland). Alternatively, the SMAD4 inhibitors disclosed herein are administered parenterally by intracerebral delivery, intrathecal delivery, intranasal delivery, or by direct infusion into the cerebral ventricle.

[0084] In one embodiment, parenteral administration is carried out by infusion.The SMAD4 inhibitor of infusion can be delivered with a pump.In certain embodiments, the extensive distribution of the SMAD4 inhibitor of infusion is achieved by intracranial administration, intrathecal administration or intraventricular administration delivery to cerebrospinal fluid.

[0085] In certain embodiments, the SMAD4 inhibitor of infusion is delivered directly to tissue. The example of such tissue includes striatal tissue, intraventricular tissue and caudate nucleus tissue. The specific positioning of SMAD4 inhibitor can be achieved by directly infusing into target tissue.

[0086] In certain embodiments, parenteral administration is performed by injection. Injection can be delivered with a syringe or pump. In certain embodiments, injection is a bolus administered directly to a tissue. Examples of such tissues include striatal tissue, intraventricular tissue, and caudate nucleus tissue. Specific localization of an agent including an antisense oligonucleotide can be achieved by injection into a target tissue.

[0087] In certain embodiments, compared with the extensive diffusion of SMAD4 inhibitors, SMAD4 inhibitors such as SMAD4 antisense oligonucleotides improve the pharmacokinetic properties of the inhibitor to the specific localization of target tissues. Compared with the extensive diffusion of inhibitors, the specific localization of SMAD4 inhibitors improves effectiveness, and therefore the inhibitors required to be applied to achieve similar pharmacology are less." Similar pharmacology" refers to the amount of time (such as the duration of action) that target SMAD4 mRNA and / or target SMAD4 protein are downregulated / inhibited. In certain embodiments, the method for specifically localizing SMAD4 inhibitors (such as by bolus injection) reduces the median effective concentration (EC50) of inhibitors by about 20 times.

[0088] In another embodiment, SMAD4 inhibitor as described herein is co-administered with one or more other agents. According to this embodiment of the present disclosure, such one or more other agents are designed to treat the same disease, illness or condition as SMAD4 inhibitor as described herein or one or more symptoms associated therewith. In one embodiment, one or more other agents are designed to treat the undesirable side effects of one or more pharmaceutical compositions of the present disclosure. In one embodiment, SMAD4 inhibitor as described herein is co-administered with another agent to treat undesirable effects. In another embodiment, SMAD4 inhibitor as described herein is co-administered with another agent to produce a combined effect. In another embodiment, SMAD4 inhibitor as described herein is co-administered with another agent to produce a synergistic effect.

[0089] In one embodiment, SMAD4 inhibitor as described herein and another medicament are applied simultaneously. In another embodiment, SMAD4 inhibitor as described herein and another medicament are applied at different times. In another embodiment, SMAD4 inhibitor as described herein and another medicament are prepared into a single formulation together. In another embodiment, SMAD4 inhibitor as described herein and another medicament are prepared separately.

[0090] In certain embodiments, agents that can be co-administered with a SMAD4 inhibitor as described herein include antipsychotics such as haloperidol, chlorpromazine, clozapine, quetiapine, and olanzapine; antidepressants such as fluoxetine, sertraline hydrochloride, venlafaxine, and nortriptyline; tranquilizers such as benzodiazepines. , clonazepam, paroxetine, venlafaxine, and beta-blockers; and mood stabilizers such as lithium, valproate, lamotrigine, and carbamazepine.

[0091] Example

[0092] Materials and methods

[0093] Patient Identification, Protection, and Sampling. The patients from whom these lines were derived were diagnosed with disabling degrees of schizophrenia with early adolescent onset; all patients and their guardians were blinded to subsequent line designation under the supervision of one of us (RLF) with consent / assentation from a child and adolescent psychiatrist and in accordance with approved protocols of the University Hospitals Case Medical Center Institutional Review Board. No study investigator had access to patient identifiers.

[0094] Cell sources and strains. Schizophrenia-derived iPSC strains were generated from patients with childhood-onset schizophrenia, and control strains were generated from age- and sex-appropriate control subjects; all iPSC strains were obtained as previously reported (Windrem et al., "Human iPSC Glial Mouse Chimeras Reveal Glial Contributions to Schizophrenia," Cell Stem Cell 21: 195-208.e6 (2017), which is incorporated herein by reference in its entirety). Another control strain (C27; Wang et al., "Human iPSC-derived Oligodendrocyte Progenitor Cells Can Myelinate and Rescue a Mouse Model of Congenital Hypomyelination," Cell Stem Cell 12: 252-264 (2013), which is incorporated herein by reference in its entirety) was enthusiastically provided by Dr. Lorenz Studer (Memorial Sloan-Kettering). Control-derived lines include: CWRU-22 (26-year-old male), CWRU-37 (32-year-old female), CWRU-208 (25-year-old male) and C27; SCZ-derived lines include CWRU-8 (10-year-old female), CWRU-51 (16-year-old male), CWRU-52 (16-year-old male), CWRU-193 (15-year-old female), CWRU-164 (14-year-old female), CWRU-29 (12-year-old male), CWRU-30 (12-year-old male) and CWRU-31 (12-year-old male) (Windrem et al., “Human iPSC Glial Mouse Chimeras Reveal Glial Contributions to Schizophrenia,” Cell Stem Cell 21:195-208.e6 (2017), which is incorporated herein by reference in its entirety; see Table 1). CWRU-51 / 52 and CWRU-29 / 30 / 31 included different strains from the same patient and were assessed to estimate inter-strain variability from a single patient.All iPSCs were generated from fibroblasts by retroviral expression of Cre-cleavable Yamanaka factors (Oct4, Sox2, Klf4, c-Myc) (Takahashi et al., “Induction of Pluripotent Stem Cells from Adult Human Fibroblasts by Defined Factors,” Cell 131:861-872 (2007), which is incorporated herein by reference in its entirety), and pluripotency and karyotype stability were verified as described (Windrem et al., “Human iPSC Glial Mouse Chimeras Reveal Glial Contributions to Schizophrenia,” Cell Stem Cell 21:195-208.e6 (2017), which is incorporated herein by reference in its entirety).

[0095] Table 1. Patient-derived iPSC lines used in this study

[0096]

[0097] The strains used in this study have been previously described and published in Windrem et al., "Human iPSC Glial Mouse Chimeras Reveal Glial Contributions to Schizophrenia," Cell Stem Cell 21: 195-208.e6 (2017), which is incorporated herein by reference in its entirety. Other manipulations added in this study (astroglial differentiation and the resulting differentiated astrocytes for K + The lines with normal karyotype and available CGH array data are indicated in the two rightmost columns. All of these lines have normal karyotypes. The CGH array showed that several lines have sporadic indels, but none have been previously associated with schizophrenia or autism spectrum disorders.

[0098] hiPSC culture and passage. hiPSC is cultured on irradiated mouse embryonic fibroblasts (MEF) in 6-well plates coated with 0.1% gelatin (Sigma G1890-100G) supplemented with 10 ng / ml bFGF (Invitrogen, 13256-029) in hESC culture medium (see below) with 100-1.2 million cells / well. Culture medium is replaced every day, and after 4-7 days of culture, cells are passaged at 80% confluence. For hiPSC passage, cells are first incubated with 1 ml collagenase (Invitrogen, 17104-019) at 37 ° C for 3-5 minutes, and then the cells are transferred to a 15 ml test tube and centrifuged for 3 minutes. The precipitate is resuspended with ES culture medium containing bFGF, and plated onto new irradiated MEFs at 1:3-1:4.

[0099] Generation of GPCs and astrocytes from hiPSCs When hiPSCs reached 80% confluence, they were incubated with 1 ml of dispase (Invitrogen, 17105-041) to generate embryoid bodies (Eb); they were cultured in ES medium without bFGF for 5 days. At DIV6, EBs were plated onto poly-ornithine (Sigma, P4957) and laminin (VWR, 47743) coated dishes and cultured for 10 days in neural induction medium (NIM; see below) supplemented with 20 ng / ml bFGF, 2 μg / ml heparin, and 10 μg / ml laminin (Wang et al., “Human iPSC-derived Oligodendrocyte Progenitor Cells Can Myleinate and Rescue a Mouse Model of Congenital Hypomyelination,” Cell Stem Cell 12:252-264 (2013), which is incorporated herein by reference in its entirety).

[0100] At DIV 25, Eb were gently scraped with a 2 ml glass pipette and then cultured in NIM plus 1 μM purple morphamine (Calbiochem, 80603-730) and 0.1 μM RA (Sigma, R2625). At DIV33, NPCs appeared and were continuously switched to NIM with 1 μM purple morphamine and 10 ng / ml bFGF for 7 days, and then switched to glial induction medium (GIM) with 1 μM purple morphamine (Wang et al., "Human iPSC-Derived OligodendrocyteProgenitor Cells Can Myelinate and Rescue a Mouse Model of Congenital Hypomyelination," Cell Stem Cell 12: 252-264 (2013), which is incorporated herein by reference in its entirety) for 15 days. At DIV 56, the resulting glial spheres were mechanically dissected with a microsurgery blade under a dissecting microscope and switched to GIM with 10 ng / ml PDGF, 10 ng / ml IGF, and 10 ng / ml NT3, with the medium changed every 2 days. At DIV 80-100, CTR GPCs were cultured with 10 ng / ml BMP4 (PeproTech, AF-120-05ET) and 0.5 μM DMH1 (Sigma, D8946-5MG) for 2 weeks, and SCZ GPCs were transduced with lentiviral-SMAD4-shRNAi for 2 weeks, both of which were used to verify K + At DIV 150-180, GPCs were incubated with mouse anti-CD44 microbeads (1:50) and then with rabbit anti-mouse IgG2a+b microbeads (1:100) and further sorted by magnetic cell sorting (MACS) using magnetic columns. + Cells were matured into astrocytes for 4 weeks in M41 supplemented with 10% FBS (VWR, 16777-014) and 20 ng / mL BMP4.

[0101] The medium recipes are listed in Table 2 (hESC medium and neural medium) and Table 3 (glial cell medium and astrocyte induction medium).

[0102] Table 2. Culture medium formula: basal medium, hESC medium and neural medium

[0103]

[0104] Table 3. Culture medium formulations: glial cell culture medium and astrocyte induction medium

[0105]

[0106] FACS / MACS sorting. The cells were incubated with Accutase (Fisher Scientific, SCR005) at 37 ° C for 5 minutes to obtain a single cell suspension, and then centrifuged at 200 RCF for 10 minutes. The GPCs were resuspended in cold Miltenyi wash buffer with primary antibodies (1:50 for FACS, phycoerythrin (PE)-conjugated mouse anti-CD140a; 1:100 for MACS) and incubated on ice for 30 minutes, gently rotating every 10 minutes. After the primary antibody incubation, the cells were then washed and incubated with secondary antibodies (rabbit anti-mouse IgG2a+b microbeads, 1:100), and then sorted by MACS on a magnetic column, or sorted directly by FACS on a FACSAria IIIu (Becton-Dickinson). The sorted cells were counted and plated on 24-well plates coated with poly-ornithine and laminin for further experiments. Antibodies and dilutions are listed in Table 4.

[0107] Table 4. Antibodies used for FACS / MACS sorting

[0108]

[0109]

[0110]

[0111]

[0112]

[0113] RT-PCR. Total RNA was extracted from the cell line using the miRNeasy micro kit (Qiagen, 217004) and then reverse transcribed into cDNA using the Taqman reverse transcription kit (Fisher Scientific, N8080234). The relative expression of mRNA was measured by Bio-RADS6048 and further normalized to the expression of 18S mRNA.

[0114] The primer sequences are listed in Table 5.

[0115] Table 5. RT-PCR primers

[0116]

[0117]

[0118] In vitro immunocytochemistry. First, the cells were fixed with 4% paraformaldehyde for 5 minutes at room temperature. After washing 3 times with D-PBS (Invitrogen, 14190-250) containing thimerosal (Sigma, T5125), the cells were permeabilized with 0.1% saponin (Fluka Analytical, 47036) plus 1% goat or donkey serum for 15 minutes at room temperature. The cells were further blocked with 5% goat or donkey serum plus 0.05% saponin for 15 minutes at room temperature. After incubation with the primary antibody overnight at 4°C, the cells were incubated with the secondary antibody for 30 minutes at room temperature. The counts of immunofluorescent cells were obtained from 10 random fields per replicate, and each sample had three replicates. See Table 4 for the antibodies and dilutions used.

[0119] Methylation. DNA was extracted from iPSC lines using QIAamp DNA micro kit (Qiagen, 56304), and then whole genome methylation analysis was performed using Illumina Methylation Epic arrays; This analysis was performed at UCLA Neuroscience Genomics Core. The raw data (IDAT) file from the intensity data was input into R and normalized using the preprocessQuantile function from the minfi package (Aryee et al., "Minfi: a Flexible and Comprehensive Bioconductor Package for the Analysis of Infinium DNA Methylation Microarrays," Bioinformatics 30: 136301369 (2014), which is incorporated herein by reference in its entirety). Probes with poor quality signals were excluded based on the detection p value threshold (> 0.01) set. If the probe is mapped to multiple genomic locations of sex chromosomes or if the probe contains a single nucleotide polymorphism at a CpG site, the probe is also excluded. After pretreatment, samples were evaluated based on the features (M values) of methylation intensity by principal component analysis. To determine whether covariates (gender, age, cell line, etc.) can explain the variation in methylation profiles of samples, linear regression models were fitted to the covariates and each principal component. Covariates with significant p-values ​​(<0.05) were highlighted, indicating a meaningful relationship between changes in the covariate (predictor variable) and changes in the principal component values ​​(response variable).

[0120] Molecular cloning and virus construction. Human cDNA encoding SMAD4 was cloned downstream of the EF1α promoter in pTANK-EF1a-IRES-mCherry-WPRE (GE Healthcare, MHS6278) (Benraiss et al., "Human Glia Can Both Induce and Rescue Aspects of Disease Phenotype in Huntington Disease," Nature Communications 7: 11758 (2016), which is incorporated herein by reference in its entirety). Lentiviral vectors allow SMAD4 to be expressed in tandem with the reporter gene mCherry. Doxycycline-inducible shRNA (gene target sequence: TGGTCAGCCAGCTACTTAC (SEQ ID NO: 4) or ATGAATATGACTCACTTCT (SEQ ID NO: 7)) of human SMAD4 in SMAD4 pSMART-TRE3G-EGFP-Puro-WPRE was ordered from GE Healthcare (V3SH11252). BAMBI previously produced human shRNA and cDNA for BAMBI (Sim et al., "Complementary Patterns of Gene Expression by Human Oligodendrocyte Progenitors and Their Environment Predict Determinants of Progenitor Maintenance and Differentiation," Ann. Neurol. 59: 763-779 (2006), which is incorporated herein by reference in its entirety). Correct insertion in the final construct was verified by sequencing. The plasmid was then co-transfected into 293FT cells (Fisher Scientific, R70007) by X-tremeGENE (Roche, 06366236001) with pLP-VSV (Invitrogen, K497500) and psPAX2 (a gift from Didier Trono, Addgene 12260) for lentivirus generation. The supernatant of 293T cells was then collected and centrifuged at 76000RCF for 3 hours to concentrate the virus (Beckman, L8-70, Ultracentrifuge). Ten-fold serial dilutions of the virus were then prepared and transduced into 293T cells, and fluorescent colonies were counted to estimate the viral titer.

[0121] Cell transduction. Isolation of CD140a by MACS+ hGPCs were then transduced with lentivirus-TRE3G-SMAD4-shRNAi or lentivirus-EF1α-BAMBI-shRNAi or their corresponding scrambled control viruses. Lentivirus-EF1a-BAMBI-shRNAi effectively inhibited the expression of the target gene ( Figure 4B ). Cells infected with lentivirus-TRE3G-SMAD4-shRNAi were treated with 0.5 μg / ml doxycycline (Fisher, CN19895510) doxycycline starting 4 days after viral infection; this treatment was maintained for 1 week before the experiment was started; during this period, cells were maintained in glial cell induction medium. Under doxycycline, SMAD4 mRNA expression decreased to <30% of control; no inhibition was indicated in the absence of doxycycline ( Figures 7A-7C ).

[0122] Potassium uptake. Astrocytes were plated at 30,000 cells / well on 24-well plates coated with poly-ornithine and laminin. For the potassium uptake assay, astrocytes were incubated with 86 Rb (1.0-3.3 μCi / well) was incubated together for 15 minutes, and then washed three times with ice-cold artificial cerebrospinal fluid (aCSF, 500 μL / well). 0.5N NaOH (200 μL / well) was loaded into each well for cell lysis, and the well was loaded into 5 ml mixed solution (Ultima Gold, Fisher Scientific, 509050575), and measured by scintillation counter (Beckman Coulter, LS6500), and the results were normalized to total protein (BCA protein assay kit, Fisher Scientific, 23227) and cell number (hemocytometer, Fisher Scientific, 02-671-54). aCSF solution contains (in mM): 124NaCl, 2.5KCl, 1.75NaH2PO4, 2MgCl2, 2CaCl2, 0.04 vitamin C, 10 glucose and 26NaHCO3, pH 7.4.

[0123] Quantitative and statistical analysis. Statistical parameters, including exact n, center, dispersion, exact measure (mean ± SEM), and statistical significance are reported in the accompanying drawings and legends. All analyses were performed using GraphPad PRISM 6 using one-way ANOVA and two-tailed t-tests. Statistical significance was considered to be less than a P-value of 0.05. Significance was expressed as *p<0.05, **p<0.01, and ***p<0.001. Graphs and accompanying drawings were drawn and assembled using Prism 6.

[0124] Example 1 - Impaired astrocyte differentiation in SCZ GPCs

[0125] iPSCs were generated from skin samples obtained from patients with childhood-onset schizophrenia and healthy young adult controls without known psychiatric illness, as previously described (Windrem et al., "Human iPSC Glial Mouse Chimeras Reveal Glial Contributions to Schizophrenia," Cell Stem Cell 21: 195-208.e6 (2017), which is incorporated herein by reference in its entirety). Although age, sex, race, diagnosis, and medication history were accompanied by cell line identifiers, the researchers had no access to patient identifiers except to the attending psychiatrist. Briefly, fibroblasts were isolated from each sample; from these cells, 8 hiPSC lines were derived from patient samples and normal controls (5 adolescent-onset schizophrenia patients and 3 healthy sex-matched and age-similar controls) (Table 1).The excisable polycistronic hSTEMCCA lentivirus (Somers et al., "Generation of Transgene-free Lung Disease-specific Human Induced Pluripotent Stem Cells Using a Single Excisable Lentiviral Stem Cell Cassette," Stem Cells 28:1728-1740 (2010); Zou et al., "Establishment of iPS Cells from MEFS," J. Vis. Exp. 14:734 (2008), which are incorporated herein by reference in their entireties) encoding Oct4, Sox2, Klf4, and c-Myc (Takahashi et al., "Induction of Pluripotent Stem Cells from Adult Human Fibroblasts by Defined Factors," Cell 131:861-872 (2007); Welstead et al., "Generating iPS Cells from MEFS Through Forced Expression of Sox-2, Oct-4, c-Myc, and Klf4," J. Vis. Exp. 14:734 (2008), which are incorporated herein by reference in their entireties) was used. of Transgene-free Induced Pluripotent StemCells Reprogrammed from Human Stem Cells of Apical Papilla for NeuralDifferentiation," Stem Cell Res Ther 3:43 (2012), which is incorporated herein by reference in its entirety) to generate iPSCs.A fourth hiPSC control line, C27 (Chambers et al., "Highly Efficient Neural Conversion of Human ES and iPS Cells by Dual Inhibition of SMAD Signaling," Nature Biotechnol. 27:275-280 (2009), which is incorporated herein by reference in its entirety), was also used to ensure that all genomic and phenotypic data were consistent with previous work (Wang et al., "Human iPSC-derived Oligodendrocyte Progenitor Cells Can Myleinate and Rescue a Mouse Model of Congenital Hypomyelination," Cell Stem Cell 12:252-264 (2013), which is incorporated herein by reference in its entirety). All lines were confirmed to be pluripotent using RNA sequencing and immunolabeling to assess pluripotent gene expression. Using short tandem repeat (STR)-based DNA fingerprinting, the identity of each iPSC line was confirmed to match the parental donor fibroblasts, and each line was karyotyped and assayed for comparative genomic hybridization to confirm genomic integrity. In addition, the whole genome methylation of these iPSC lines was arrayed to compare their methylation status.

[0126] The glial differentiation efficiency of cells obtained from SCZ patients and control subjects (n=4 lines, from 4 different patients, each with ≥3 replicates / patient, each line versus paired controls) was first compared by directing these iPSC cells toward a GPC fate as previously described (Wang et al., "Human iPSC-derived Oligodendrocyte Progenitor Cells Can Myleinate and Rescue a Mouse Model of Congenital Hypomyelination," Cell Stem Cell 12:252-264 (2013), which is incorporated herein by reference in its entirety) and assessing the expression of stage-specific markers of maturity over time. By flow cytometry, all iPSCs tested showed typical colonies and expressed pluripotency markers, including SSEA4 ( Figure 1A). At the neural progenitor cell (NPC) stage, both ICC and flow cytometry revealed that the expression levels of the stage-selective markers, paired box protein pax-6 (PAX6), sex-determining region Y-box1 (SOX1), and cell surface marker prominin-1 / CD133, were not different between CTR- and SCZ-derived lines ( Figure 2 A-2D; Figure 1 B). At the GPC stage, the expression of GPC-selective platelet-derived growth factor receptor α (PDGFRα / CD140a) was then assessed (Sim et al., "CD140a Identifies a Population of Highly Myelinogenic, Migration-Competent and Efficiently Engrafting Human Oligodendrocyte Progenitor Cells," Nature Biotechnol. 29:934-941 (2011), which is incorporated herein by reference in its entirety), which revealed that there was no significant difference in the efficiency of GPC generation between SCZ- and CTR-derived NPCs ( Figure 2 E-2G; Figure 1 C). At the astrocyte progenitor stage, flow cytometry confirmed that the expression level of the cell surface marker CD44 did not differ between CTR- and SCZ-derived lines ( Figure 1 D) Thus, no differences in SCZ and CTR iPSC differentiation were found throughout the GPC and astrocyte progenitor stages.

[0127] At this time, SCZ- and CTR-derived GPCs were further differentiated into astrocytes by incubation in M41 medium supplemented with 20 ng / ml BMP4 for 4 weeks. Immunolabeling revealed that GFAP expression in control lines (4 CTR lines, n≥3 / line, mean of 4 CTR lines = 70.1±2.4%) was significantly higher than that in control lines (n≥3 / line, mean of 4 CTR lines = 70.1±2.4%). + The proportion of astrocytes was significantly higher than that of SCZ strains (4 SCZ strains, n≥3 / strain, average of 4 SCZ strains = 39.9±2.0%; by two-tailed t test, P<0.001) ( Figure 2 H-2J). In addition to GFAP, S100β + The percentage of astrocytes was significantly higher in the CTR strain relative to the SCZ strain ( Figure 1 F). In contrast, PDGFαR +The proportion of GPCs was significantly higher in BMP4-treated SCZ glial cells (4 SCZ lines, n ≥ 3 / line) relative to BMP4-treated CTR glial cells (4 CTR lines, n ≥ 3 / line) ( Figure 1 E). This defect in astroglial differentiation was consistently observed in all SCZ GPCs relative to CTR cells and correlated in vitro with previously described in vivo astroglial differentiation defects (Windrem et al., “Human iPSC GlialMouse Chimeras Reveal Glial Contributions to Schizophrenia,” Cell Stem Cell 21: 195-208.e6 (2017), which is incorporated herein by reference in its entirety).

[0128] Example 2 - SCZ GPC upregulates the expression of BMP signaling inhibitor BAMBI

[0129] To identify molecular accompaniments of defective astroglial differentiation of SCZ GPCs, FACS-sorted CD140a from three different CTR-derived lines and four SCZ-derived lines were expressed at early time points of 154 to 242 days in vitro. +GPCs were subjected to RNA-seq (Windrem et al., "Human iPSC Glial Mouse Chimeras Reveal Glial Contributions to Schizophrenia," Cell Stem Cell 21: 195-208.e6 (2017), which is incorporated herein by reference in its entirety). mRNA was isolated from these cells using polyA-selection for RNA sequencing on an Illumina HiSeq2500 platform, with approximately 45 million 1x100 bp reads per sample. Raw counts were analyzed to determine disease-disregulated genes at 5% FDR and log2 fold change>1. By this approach, 118 mRNAs have been identified that are consistently and significantly differentially expressed by CD140a-sorted SCZ hGPCs relative to their control iPSC hGPCs (Windrem et al., "Human iPSC Glial Mouse Chimeras Reveal Glial Contributions to Schizophrenia," Cell Stem Cell 21: 195-208.e6 (2017), which is incorporated herein by reference in its entirety). Among these, many genes involved in glial lineage progression were downregulated in SCZ hGPCs relative to their normal controls, suggesting that astrocyte differentiation in SCZ is impaired in a cell-autonomous manner due to intrinsic defects in SCZ-derived glial progenitor cells.

[0130] Leveraging these early data, in this study, we first used Ingenuity Pathway Analysis (IPA) to identify pathways that were significantly differently regulated in SCZ hGPCs. Among these, BMP signaling-related transcripts were found to be upregulated in SCZ hGPCs compared to CTR hGPCs ( Figure 3A ). Then, qPCR verified that the expression of many TGFβ pathway regulators (including BAMBI) was indeed significantly increased in SCZ GPCs ( Figure 3B In contrast, these BMP signaling-related transcripts differed between SCZ and CTR lines at the NPC stage ( Figure 3C ). The methylation status of CTR-derived and SCZ-derived iPSCs was similar ( Figure 3D ); the less variability noted between lines in iPSC methylation status appears to be due to sex and line rather than disease state or subject age ( Figure 3E). Therefore, the upregulation of BAMBI and other TGFβ and BMP pathway regulators marked in SCZ hGPCs is not due to any systemic disease-dependent differences in methylation patterns between CTR and SCZ cells at the pluripotent stem cell stage.

[0131] BMP4 is a strong stimulator of astrocyte differentiation by human GPCs, and BAMBI is a strong antagonist of BMP4-induced astrocyte induction, thereby acting as a pseudoreceptor and thus as a dominant inhibitor of BMP signaling (Sim et al., "Complementary Patterns of Gene Expression by Human Oligodendrocyte Progenitors and Their Environment Predict Determinants of Progenitor Maintenance and Differentiation," Ann Neurol 59:763-779 (2006), which is incorporated herein by reference in its entirety). BAMBI expression is also activated by TGFβ and BMP receptor-dependent signaling as a compensatory negative feedback response (Onichtchouk et al., "Silencing of TGF-beta Signaling by the Pseudoreceptor BAMBI," Nature 40:480-485 (1999), which is incorporated herein by reference in its entirety). Thus, RNA-seq qPCR data revealed that both BMP signaling-dependent transcripts and BAMBI were upregulated in SCZ hGPCs but not in SCZ hNPCs ( Figure 3B-3C These data suggest that upregulation of BMP signaling is specific to SCZ glial cells and first appears at the glial progenitor cell stage, and this process is associated with upregulation of BAMBI expression, which in turn inhibits astroglial differentiation of SCZ hGPCs.

[0132] Based on this, it was determined that overexpression of BAMBI in hGPCs derived from normal control subjects could mimic or regenerate the SCZ GPC phenotype by inhibiting the differentiation of these hGPCs. To this end, the expression of BAMBI was genetically modulated in both hGPCs, i.e., SCZ and CTR-derived GPCs ( Figure 4A-4BOverexpression of BAMBI in CTR GPCs was found to significantly reduce the efficiency of astrocyte conversion (4 CTR lines, 3 replicates / each, mean of 4 CTR lines / 36.4%±4.3%), resulting in cells that resemble SCZ hGPCs in their refractoryness to final astrocyte maturation (4 SCZ lines, 3 replicates / each, mean of 4 SCZ lines / 45.5%±3.6%; p=0.12 by two-tailed t-test) ( Figure 5A-5B However, BAMBI knockdown in SCZ GPCs did not rescue astrocyte differentiation in these cells, suggesting that BAMBI overexpression is responsible for the resistance of SCZ hGPCs to maturation, but is not sufficient in this regard ( Figure 5A-5B Thus, when the expression of alternative inhibitors of BMP signaling was assessed using qPCR, mRNAs encoding follistatin (FST) and gremlin1 (GREM1), two potent antagonists of BMP and BMP-dependent signaling, were found to be significantly upregulated by SCZ GPCs (SCZ vs. CTR; 4 SCZ and 4 CTR lines, 3 replicates / each line; ddCt = 2.45 ± 0.39, p < 0.05 for FST; 3.38 ± 0.53, p < 0.01 for GREM1; two-tailed t-test) ( Figure 5C ).

[0133] Example 3 - Astrocyte differentiation by SCZ GPCs can be rescued by SMAD4 knockdown.

[0134] SMAD4 is essential for canonical BMP signaling because it serves as a common effector of multiple upstream signals, in response to which it translocates to the nucleus where it activates BMP and TGFβ-regulated genes (Herhaus and Sapkota, "The Emerging Roles of Deubiquitylating Enzymes (DUBs) in the TGFβ and BMP Pathways," Cell Signal 26:2186-2192 (2014), which is incorporated herein by reference in its entirety). These include BAMBI as well as FST and GREM1, all of which function consistently as negative feedback regulators of pro-glial BMP signaling (Brazil et al., "BMP Signaling: Agony and Antagony in the Family," Trends Cell Biol 25:249-264 (2015); Onichtchouk et al., "Silencing of TGF-beta Signaling by the Pseudoreceptor BAMBI," Nature 40:480-485 (1999), which are incorporated herein by reference in their entireties) ( Fig. 6A ). Based on this, it was assumed that SMAD4 knockdown in hGPCs by inhibiting early expression of BAMBI, FST, and GREM1 could enhance astrocyte differentiation from hGPCs. In addition, to the extent that differentiation blockade in SCZ hGPCs is due to SMAD4-mediated overexpression of endogenous BMP inhibitors, it was assumed that SMAD4 knockdown thus differently enhances astrocyte differentiation by SCZ hGPCs. To test this possibility, SMAD4 expression in SCZ and CTR hGPCs was conditionally knocked down using doxycycline (DOX) induction of SMAD4 shRNAi, and the expression of its BMP-regulated genes was then assessed by qPCR ( Figures 7A-7C ). It was found that SMAD4 knockdown indeed inhibited the expression of BMP signaling-dependent genes, including BAMBI, FST, and GREM1 (SCZ-LV-scrambled vs. SCZ-LV-SMAD4-shRNA; 4 different patient iPSC lines / group, 3 replicates / line; ddCt of BAMBI: 2.56±0.35, p<0.05; FST: 2.38±0.24, p<0.01; GREM1: 3.04±0.45, p<0.05; all comparisons were performed by ANOVA and post hoc t-tests) ( Figure 6BImportantly, transient DOX-induced knockdown of SMAD4 (with shRNAi expression restricted to the progenitor state) strongly promoted astrocyte differentiation of SCZ GPCs, thereby overcoming its relative block in astrocyte differentiation to effectively rescue the astrocyte phenotype ( Figure 6C-6D Specifically, SMAD4 knockdown (KD) in SCZ GPCs restored the efficiency of GFAP-restricted astrocyte differentiation to the level of CTR GPCs (SCZ-SMAD4-shRNA at the GPC stage: 56.8% ± 3.8%; CTR lines: 62.2% ± 4.0%; p > 0.05, one-way ANOVA; mean ± SE of 4 different patient lines / group, n ≥ 3 replicates / line) ( Figure 6C-6D In contrast, continuous DOX exposure (e.g. Figure 7B Continuous SMAD4 knockdown after astrocyte induction resulted in a decrease in GFAP-restricted astrocytes in both SCZ and CTR groups ( Figure 6C-6D ). Thus, maintenance of the mature astrocyte phenotype appears to require ongoing SMAD4 signaling identically in SCZ and CTR astrocytes.

[0135] In summary, these data show that the abnormal BMP signaling produced by driving the overexpression of BMP signaling inhibitors in SCZ GPCs inhibits astrocyte differentiation, and this differentiation defect can be rescued by knocking down SMAD4. Nevertheless, once SCZ GPCs proceed to astrocyte differentiation, SMAD4 expression is then required to maintain the astrocyte phenotype identically in CTR and SCZ astrocytes, which is consistent with its previously described function as the effector of BMP-mediated astrocyte maturation (Kohyama et al., "BMP-induced REST Regulates the Establishment and Maintenance of Astrocytic Identity," J. Cell Biol. 189: 159-170 (2010), which is incorporated herein by reference in its entirety). These data demonstrate that pathological BMP-dependent signaling in SCZ GPs may define their astrocyte maturation and suggest that this cellular pathology may result in part from SMAD4-dependent overexpression of endogenous inhibitors of pro-glial BMP signaling by GPCs.

[0136] Example 4 - SCZ astrocytes exhibit reduced potassium uptake

[0137] Together with the impaired astrocyte differentiation of SCZ GPCs, RNA-seq data suggest that those astrocytes that successfully differentiated may still be functionally impaired. In particular, RNA-seq revealed transcriptional downregulation of a large number of potassium channel (KCN) encoding genes in SCZ GPCs, including Na + -K + ATPase, Na + -K + / 2Cl - cotransporter (NKCC) and Kir family inward rectifier potassium channels ( Fig. 8A )(Windrem et al., “Human iPSC Glial Mouse Chimeras Reveal Glial Contributions to Schizophrenia,” Cell Stem Cell 21:195-208.e6 (2017), which is incorporated herein by reference in its entirety), all of which play an important role in potassium uptake by astrocytes (Larsen et al., “Contributions of the Na(+) / K(+)-ATPase, NKCC1, and Kir4.1 to Hippocampal K(+)Clearance and Volume Responses,” Glia 62:608-622 (2014); Macaulay and Zeuthen, “Glial K(+)Clearance and Cell Swelling:Key Roles for Cotransporters and Pumps,” Neurochem. Res. 37:2299-2309 (2012), which is incorporated herein by reference in its entirety)) Fig. 9A Among these dysregulated KCN genes, the genes encoding Na+, KCN+, and KCN+ were upregulated in all four SCZ lines evaluated compared to the four control lines. + / K + -ATPase pump, NKCC1 Na + / K + / 2Cl - Cotransporter and Kir3.3 voltage-gated K +ATP1A2, SLC12A6, and KCNJ9 of the channels (Bottger et al., “Glutamate-System Defects Behind Psychiatric Manifestations in a Familial Hemiplegic Migraine Type 2 Disease-Mutation Mouse Model,” Sci. Rep. 6:22047 (2016); Gamba and Friedman, “Thick Ascending Limb:The Na(+):K(+):2Cl(-) Cotransporter, NKCC2, and the Calcium-Sensing Receptor, CaSR,” Pflugers Arch. 458:61-76 (2009); Lesage et al., “Molecular Properties of Neuronal G-Protein-Activated Inwardly Rectifying K+ Channels,” J. Biol. Chem. 270:28660-28667 (1995), which are incorporated herein by reference in their entireties) were consistently and substantially downregulated. These findings suggest that K + uptake by glial cells is extensively impaired in SCZ.

[0138] Based on these genomic data, we evaluated the expression of K in SCZ astrocytes. + To address this hypothesis, we used qPCR to confirm whether these K+ channel-related genes were dysregulated in SCZ glial cells. They were indeed significantly downregulated, thus validating the RNA-seq analysis ( Figure 8B and Fig. 9B Next, functional K was directly assessed in cultured SCZ- and CTR-derived astrocytes. + To obtain mature SCZ and CTR astrocyte cultures, CD44-sorted glial progenitor cells were cultured for 4 weeks in basal medium supplemented with 10% fetal bovine serum (FBS) and 20 ng / ml BMP4 to enhance the differentiation of mature glial fibrillary acidic protein (GFAP)-expressing fibrillar astrocytes ( Figures 10A-10C Under these highly astrogliogenic conditions and using cells that had been sorted for the early astrocyte marker CD44, astrocyte maturation was achieved with SCZ-derived as well as CTR-derived progenitor cells ( Figures 10A-10C ). Astrocytes from four different SCZ and four different CTR lines were then mixed with+ The cells were incubated with the alternative monovalent cation 86Rb (Larsen et al., "Contributions of the Na(+) / K(+)-ATPase, NKCC1, and Kir4.1 to Hippocampal K(+) Clearance and Volume Responses," Glia 62:608-622 (2014), which is incorporated herein by reference in its entirety), and rubidium uptake was measured as a function of cell number and total protein. K+ uptake in SCZ glial cells (4 SCZ cell lines, 5 replicates / each cell line) was dramatically reduced relative to CTR glial cells (4 CTR cell lines, 5 replicates / each cell line), normalized by cell number and total protein ( Fig. 9C ; P < 0.001 by two-tailed t test).

[0139] Due to the different potassium and Na + / K + The researchers used the drugs ouabain, bumetanide, and tolbutamide to block these three potassium uptake mechanisms, respectively. The effects of these drugs on astrocytes had not been previously evaluated, so they first tested different concentrations of each drug to determine the best target for regulating K in human astrocytes. + The optimal dosage range for ingestion. + / K + -ATPase pump and NKCC1-encoded Na + / K + / 2Cl - Ouabain and bumetanide significantly inhibited K cotransporter in CTR glial cells + Uptake, while the Kir channel-targeting peptide did not ( Figures 9D-9E , left). In sharp contrast, neither ouabain nor bumetanide affected the response of SCZ astrocytes to K + Intake ( Figures 9D-9E , right). This suggests that the K + The functional decline in uptake may be mainly attributed to Na + / K + -ATPase and Na + / K + / 2Cl - Downregulation of cotransporter function renders these cells refractory to ouabain and bumetanide treatment.

[0140] Discussion of Examples 1-4

[0141] These data suggest that astrocyte differentiation is impaired in GPCs derived from childhood-onset schizophrenia and that this maturation defect can be rescued by inhibiting BMP signaling via SMAD4 knockdown. Importantly, astrocyte depletion has recently been noted in both cortical and subcortical regions of patients with schizophrenia, and this may be particularly prominent in the white matter (Rajkowska et al., “Layer-specific Reductions in GFAP-reactive Astroglia in the Dorsolateral Prefrontal Cortex in Schizophrenia,” Schizophr Res 57:127-138 (2002); Steffek et al., “Cortical Expression of Glial Fibrillary Acidic Protein and Glutamine Synthetase is Decreased in Schizophrenia,” Schizophr Res 103:71-82 (2008); Williams et al., “Astrocyte Decrease in the Subgenual Cingulate and Callosal Genu in Schizophrenia,” Eur Arch Psychiatry Clin Neurosci 263:41-52 (2013), which are incorporated herein by reference in their entireties). Astrocytes play a key role in neural circuit formation and stability (Christopherson et al., “Thrombospondins are Astrocyte-secreted Proteins that Promote CNS Synaptogenesis,” Cell 120:421-433 (2005); Clarke and Barres, “Emerging Roles of Astrocytes in Neural Circuit Development,” Nature Reviews Neuroscience 14:311-321 (2013), which are herein incorporated by reference in their entireties).Therefore, any such developmental defects in astrocyte differentiation in SCZ GPCs may result in severe defects in the initial formation or stability of neural circuits, which is one of the hallmarks of schizophrenia (Penzes et al., "Dendritic Spinepathology in Neuropsychiatric Disorders," Nat Neurosci 14:285-293 (2011), which is incorporated herein by reference in its entirety). In this regard, RNA-seq data indicate that TGFBR and BMP signaling are upregulated in SCZ GPCs, which is associated with the activation of downstream BMP-regulated genes including the competitive inhibitor of pro-glial BMP signaling, BAMBI (Onichtchouk et al., "Silencing of TGF-beta Signaling by the Pseudoreceptor BAMBI," Nature 40:480-485 (1999), which is incorporated herein by reference in its entirety). It has been previously noted that high expression of BAMBI in adult GPCs significantly inhibits their astrocyte differentiation, as induced by BMP4 (Sim et al., "Complementary Patterns of Gene Expression by Human Oligodendrocyte Progenitors and Their Environment Predict Determinants of Progenitor Maintenance and Differentiation," Ann Neurol 59:763-779 (2006), which is incorporated herein by reference in its entirety), suggesting that the pathological increase in BAMBI expression induced by BMP signaling in SCZ hGPCs relative to normal control hGPCs may be sufficient to inhibit their differentiation into mature astrocytes. In addition to BAMBI, several other inhibitors of TGFβ / BMP signaling, including FST and GREM1 (Brazil et al., “BMP Signalling: Agony and Antagony in the Family,” Trends Cell Biol 25:249-264 (2015), which is incorporated herein by reference in its entirety), are also upregulated by SCZ GPCs; these may allow SCZ hGPCs to avoid an astrocyte fate, even after BAMBI knockdown.

[0142] It is noteworthy that the activation of canonical TGFβ signaling depends on SMAD2 / 3 activation through the TGFβ pathway or SMAD1 / 5 / 8 through BMP receptor-dependent signaling; each of these effectors requires nuclear translocation in combination with SMAD4 before activating its downstream gene targets (Hata and Chen, "TGF-beta Signaling from Receptors to Smads," Cold Spring Harb Perspect Biol 8 (2016); Herhaus and Sapkota, "The Emerging Roles of Deubiquitylating Enzymes (DUBs) in the TGFbeta and BMP Pathways," Cell Signal 26: 2186-2192 (2014), which is incorporated herein by reference in its entirety). Therefore, it was found that SMAD4 knockdown effectively inhibited the BMP signaling-induced expression of endogenous BMP inhibitors, and thus significantly promoted the astrocyte differentiation of otherwise differentiation-resistant SCZGPCs. Importantly, this differentiation response of hGPCs to SMAD4 inhibition was only marked at the hGPC stage and only in SCZ hGPCs; control patient-derived hGPCs did not show this enhanced differentiation in response to SMAD4 inhibition. Thus, modulation of SMAD4 may represent a strategy suitable for ameliorating glial differentiation defects in schizophrenia.

[0143] Glial cell maturation is precisely regulated in human brain development (Goldman and Kuypers, “How to Make an Oligodendrocyte,” Development 142:3983-3995 (2015); Molofsky et al., “Astrocytes and Disease: a Neurodevelopmental Perspective,” Genes and Development 26:891-907 (2012), which are incorporated herein by reference in their entireties). Astrocytes have multiple roles in the CNS, including energy support for neurons and oligodendrocytes, potassium buffering, neurotransmitter recycling, and synapse formation and maturation; as such, astrocytes play a key role in the formation and maintenance of neural circuits (Blanco-Suarez et al., "Role of Astrocyte-synapse Interactions in CNS Disorders," J. Physiol. 595: 1903-1916 (2017); Clarke and Barres, "Emerging Roles of Astrocytes in Neural Circuit Development," Nature Reviews Neuroscience 14: 311-321 (2013); Verkhratsky et al., "Why are Astrocytes Important? Neurochemical Research 40: 389-401 (2015), which are incorporated herein by reference in their entireties). Astrocytes also contribute to the lymphatic system by regulating the flow of cerebrospinal fluid through the brain interstitium (Xie et al., "Sleep Drives Metabolic Clearance from the Adult Brain,” Science 342:373-377 (2013), which is incorporated herein by reference in its entirety). Therefore, the delayed differentiation of SCZ astrocytes may have important effects on the formation, organization and mature function of neural networks.

[0144] It has been found that many potassium transporters are downregulated in SCZ glial cells. Interestingly, previous genome-wide association studies (GWAS) have identified the relevance of potassium pumps, transport and channel genes to schizophrenia. For example, the chromosome 1q21-q22 locus containing KCNN3 has a significant connection with familial schizophrenia (Brzustowicz et al., " Location of a Major Susceptibility Locus for Familial Schizophrenia on Chromosome 1q21-q22, " Science 288: 678-682 (2000), which is incorporated herein by reference in its entirety). KCNN3 is widely expressed in the human brain, and selectively regulates neurotransmitter release in neuronal excitability and monoamine neurons (O'Donovan and Owen, " Candidate-gene Association Studies of Schizophrenia, " Am. J. Hum. Genet. 65: 587-592 (1999), which is incorporated herein by reference in its entirety). In addition to KCNN3, many other potassium channel genes are also associated with schizophrenia, including KCNQ2 and KCNAB1 (Lee et al., "Pathway Analysis of Genome-wide Association Study in Schizophrenia," Gene 525: 107-115 (2013), which is incorporated herein by reference in its entirety). Recently, new de novo mutations in ATP1A3 (a subunit of the sodium-potassium pump) are particularly associated with childhood-onset schizophrenia (Smedemark-Margulies et al., "A Novel De Novo Mutation in ATP1A3 and Childhood-Onset Schizophrenia," Cold Spring Harb Mol Case Stud 2, a001008 (2016), which is incorporated herein by reference in its entirety).

[0145] Downregulation or dysfunction of these potassium transporters in GPCs and their derived astrocytes may significantly contribute to the disease phenotype of schizophrenia. Potassium channels, pumps, and transporter genes are expressed in GPCs (Coppi et al., "UDP-glucose Enhances Outward K(+) Currents Necessary for Cell Differentiation and Stimulates Cell Migration by Activating the GPR17 Receptor in Oligodendrocyte Precursors," Glia 61:1155-1171 (2013); Maldonado et al., "Oligodendrocyte Precursor Cells are Accurate Sensors of Local K +in Mature Gray Matter," J. Neurosci. 33:2432-2442 (2013), which is incorporated herein by reference in its entirety) and astrocytes (Larsen et al., "Contributions of the Na(+) / K(+)-ATPase, NKCC1, and Kir4.1 to Hippocampal K(+)Clearance and Volume Responses," Glia 62:608-622 (2014); Zhang and Barres, "Astrocyte Heterogeneity: an Underappreciated Topic in Neurobiology," Current Opinion in Neurobiology 20:588-594 (2010), which is incorporated herein by reference in its entirety), where they regulate not only proliferation, migration and differentiation, but also the relationship between glial cells and neurons (Coppi et al., "UDP-glucose Enhances Outward K(+) Currents Necessary for Cell Differentiation and Stimulates Cell Migration by Activating the GPR17Receptor in Oligodendrocyte Precursors,” Glia 61:1155-1171 (2013); Maldonado et al., “Oligodendrocyte Precursor Cells are Accurate Sensors of Local K + in Mature Gray Matter," J. Neurosci. 33:2432-2442 (2013), which is incorporated herein by reference in its entirety). Regarding the latter, astrocytes also express all three major K + Transport mechanisms (including Na+ / K+-ATPase, NKCC1 cotransporter, and inwardly rectifying Kir channels) regulate synaptic K +Uptake (Larsen et al., “Contributions of the Na(+) / K(+)-ATPase, NKCC1, and Kir4.1 to Hippocampal K(+) Clearance and Volume Responses,” Glia 62:608-622 (2014); Zhang and Barres, “Astrocyte Heterogeneity: an Underappreciated Topic in Neurobiology,” Current Opinion in Neurobiology 20:588-594 (2010), which are incorporated herein by reference in their entireties), thereby establishing neuronal firing thresholds over a wide range of regions.

[0146] Therefore, dysregulated K+ transport and potassium channel gene expression have been associated with a variety of neurological and psychiatric diseases. Several Kir genes (including Kir4.1) are involved in astrocyte potassium buffering and glutamate uptake, and deletions of these genes have been noted in Huntington's disease and multiple sclerosis (Seifert et al., "Astrocyte Dysfunction in NeurologicalDisorders: a Molecular Perspective," Nat Rev Neurosci 7: 194-206 (2006); Tong et al., "Astrocyte Kir4.1 Ion Channel Deficits Contribute to Neuronal Dysfunction in Huntington's Disease Model Mice," Nature Neuroscience 17: 694-703 (2014), which are incorporated herein by reference in their entirety). In addition, mutations in astrocyte ATP1A2 (the α2 isoform of the sodium-potassium pump) may be causally associated with familial hemiplegic migraine (Bottger et al., "Glutamate-system Defects Behind Psychiatric Manifestations in a Familial Hemiplegic Migraine Type 2 Disease-mutation Mouse Model," Sci Rep 6:22047 (2016); Swarts et al., "Familial Hemiplegic Migraine Mutations Affect Na,K-ATPase Domain Interactions," Biochim Biophys Acta 1832:2173-2179 (2013), which are incorporated herein by reference in their entirety). In all of these embodiments, glial K + Uptake is impaired in all glial cells, as in SCZ, and all of these impairments are associated with a hyperexcitatory phenotype. Indeed, in mouse models of schizophrenia, extracellular K +Increased K has been shown to alter neuronal excitability and neural circuit stability (Crabtree et al., "Alteration of Neuronal Excitability and Short-term Synaptic Plasticity in the Prefrontal Cortex of a Mouse Model of Mental Illness," J. Neurosci. (2017), which is incorporated herein by reference in its entirety). + Reduced uptake may be an important contributor to the pathogenesis of schizophrenia, particularly with respect to those schizophrenia phenotypes associated with hyperarousal and epilepsy, which are potentiated in the context of disrupted potassium homeostasis.

[0147] These data therefore reveal defective astrocyte differentiation from SCZ GPCs, potential reversibility of this defect by SMAD4 knockdown, and potential reversibility of SCZ glial cells to K + Defective uptake of potassium. The resulting defects in synaptic potassium homeostasis may be expected to significantly reduce neuronal firing thresholds while enhancing network desynchronization (Benraiss et al., "Human Glia Can Both Induce and Rescue Aspects of Disease Phenotype in Huntington Disease," Nature Communications 7: 11758 (2016), which is incorporated herein by reference in its entirety). Similarly, it is expected that glial K +Positive modulators of uptake may have practical value in treating schizophrenia (Calcaterra et al., “Schizophrenia-associated hERG Channel Kv11.1-3.1 Exhibits a Unique Trafficking Deficit that is Rescued Through Proteasome Inhibition for High Throughput Screening,” Sci Rep 6:19976 (2016); He et al., “Current Pharmacogenomic Studies on hERG Potassium Channels,” Trends Mol Med 19:227-238 (2013); Rahmanzadeh et al., “Lack of the Effect of Bumetanide, a Selective NKCC1 Inhibitor, in Patients with Schizophrenia: A Double-blind Randomized Trial,” Psychiatry Clin Neurosci 71:72-73 (2017), which are incorporated herein by reference in their entireties). Taken together, these findings identify a causal role for astrocyte pathology on the neuronal dysfunction in SCZ and in doing so suggest a tractable set of molecular targets for its treatment.

[0148] Although preferred embodiments have been shown and described in detail herein, it will be apparent to those skilled in the relevant art that various modifications, additions, substitutions, etc. may be made without departing from the spirit of the invention and, therefore, such modifications, additions, substitutions, etc. are considered to be within the scope of the invention as defined in the following claims. Sequence Listing <110> University of Rochester <120> Methods of treating schizophrenia and other neuropsychiatric disorders <130> 147400.03771 (6-18129) <150> 62 / 778,145 <151> 2018-12-11 <160> 35 <170> PatentIn version 3.5 <210> 1 <211> 552 <212> PRT <213> Homo sapiens <400> 1 Met Asp Asn Met Ser Ile Thr Asn Thr Pro Thr Ser Asn Asp Ala Cys 1 5 10 15 Leu Ser Ile Val His Ser Leu Met Cys His Arg Gln Gly Gly Glu Ser 20 25 30 Glu Thr Phe Ala Lys Arg Ala Ile Glu Ser Leu Val Lys Lys Leu Lys 35 40 45 Glu Lys Lys Asp Glu Leu Asp Ser Leu Ile Thr Ala Ile Thr Thr Asn 50 55 60 Gly Ala His Pro Ser Lys Cys Val Thr Ile Gln Arg Thr Leu Asp Gly 65 70 75 80 Arg Leu Gln Val Ala Gly Arg Lys Gly Phe Pro His Val Ile Tyr Ala 85 90 95 Arg Leu Trp Arg Trp Pro Asp Leu His Lys Asn Glu Leu Lys His Val 100 105 110 Lys Tyr Cys Gln Tyr Ala Phe Asp Leu Lys Cys Asp Ser Val Cys Val 115 120 125 Asn Pro Tyr His Tyr Glu Arg Val Val Ser Pro Gly Ile Asp Leu Ser 130 135 140 Gly Leu Thr Leu Gln Ser Asn Ala Pro Ser Ser Met Met Val Lys Asp 145 150 155 160 Glu Tyr Val His Asp Phe Glu Gly Gln Pro Ser Leu Ser Thr Glu Gly 165 170 175 His Ser Ile Gln Thr Ile Gln His Pro Pro Ser Asn Arg Ala Ser Thr 180 185 190 Glu Thr Tyr Ser Thr Pro Ala Leu Leu Ala Pro Ser Glu Ser Asn Ala 195 200 205 Thr Ser Thr Ala Asn Phe Pro Asn Ile Pro Val Ala Ser Thr Ser Gln 210 215 220 Pro Ala Ser Ile Leu Gly Gly Ser His Ser Glu Gly Leu Leu Gln Ile 225 230 235 240 Ala Ser Gly Pro Gln Pro Gly Gln Gln Gln Asn Gly Phe Thr Gly Gln 245 250 255 Pro Ala Thr Tyr His His Asn Ser Thr Thr Thr Trp Thr Gly Ser Arg 260 265 270 Thr Ala Pro Tyr Thr Pro Asn Leu Pro His His Gln Asn Gly His Leu 275 280 285 Gln His His Pro Pro Met Pro Pro His Pro Gly His Tyr Trp Pro Val 290 295 300 His Asn Glu Leu Ala Phe Gln Pro Pro Ile Ser Asn His Pro Ala Pro 305 310 315 320 Glu Tyr Trp Cys Ser Ile Ala Tyr Phe Glu Met Asp Val Gln Val Gly 325 330 335 Glu Thr Phe Lys Val Pro Ser Ser Cys Pro Ile Val Thr Val Asp Gly 340 345 350 Tyr Val Asp Pro Ser Gly Gly Asp Arg Phe Cys Leu Gly Gln Leu Ser 355 360 365 Asn Val His Arg Thr Glu Ala Ile Glu Arg Ala Arg Leu His Ile Gly 370 375 380 Lys Gly Val Gln Leu Glu Cys Lys Gly Glu Gly Asp Val Trp Val Arg 385 390 395 400 Cys Leu Ser Asp His Ala Val Phe Val Gln Ser Tyr Tyr Leu Asp Arg 405 410 415 Glu Ala Gly Arg Ala Pro Gly Asp Ala Val His Lys Ile Tyr Pro Ser 420 425 430 Ala Tyr Ile Lys Val Phe Asp Leu Arg Gln Cys His Arg Gln Met Gln 435 440 445 Gln Gln Ala Ala Thr Ala Gln Ala Ala Ala Ala Ala Gln Ala Ala Ala 450 455 460 Val Ala Gly Asn Ile Pro Gly Pro Gly Ser Val Gly Gly Ile Ala Pro 465 470 475 480 Ala Ile Ser Leu Ser Ala Ala Ala Gly Ile Gly Val Asp Asp Leu Arg 485 490 495 Arg Leu Cys Ile Leu Arg Met Ser Phe Val Lys Gly Trp Gly Pro Asp 500 505 510 Tyr Pro Arg Gln Ser Ile Lys Glu Thr Pro Cys Trp Ile Glu Ile His 515 520 525 Leu His Arg Ala Leu Gln Leu Leu Asp Glu Val Leu His Thr Met Pro 530 535 540 Ile Ala Asp Pro Gln Pro Leu Asp 545 550 <210> 2 <211> 8789 <212> DNA <213> Homo sapiens <400> 2 atgctcagtg gcttctcgac aagttggcag caacaacacg gccctggtcg tcgtcgccgc 60 tgcggtaacg gagcggtttg ggtggcggag cctgcgttcg cgccttcccg ctctcctcgg 120 gaggcccttc ctgctctccc ctaggctccg cggccgccca gggggtggga gcgggtgagg 180 ggagccaggc gcccagcgag agaggcccccc cgccgcagg cggcccggga gctcgaggcg 240 gtccggcccg cgcgggcagc ggcgcggcgc tgaggagggg cggcctggcc gggacgcctc 300 ggggcgggg ccgaggagct ctccgggccg ccggggaaag ctacgggccc ggtgcgtccg 360 cggaccagca gcgcgggaga gcggactccc ctcgccaccg cccgagccca ggttatcctg 420 aatacatgtc taacaatttt ccttgcaacg ttagctgttg tttttcactg tttccaaagg 480 atcaaaattg cttcagaaat tggagacata tttgatttaa aggaaaaac ttgaacaaat 540 ggacaatatg tctattacga ataccaac aagtaatgat gcctgtctga gcattgtgca 600 tagtttgatg tgccatagac aaggtggaga gagtgaaaca tttgcaaaaa gagcaattga 660 aagtttggta aagaagctga aggagaaaaa agatgaattg gattctttaa taacagctat 720 aactacaaat ggagctcatc ctagtaaatg tgttaccata cagagaacat tggatgggag 780 gcttcaggtg gctggtcgga aggattttcc tcatgtgatc tatgcccgtc tctggaggtg 840 gcctgatctt cacaaaaaatg aactaaaaca tgttaaatat tgtcagtatg cgtttgactt 900 aaaatgtgat agtgtctgtg tgaatccata tcactacgaa cgagttgtat cacctggaat 960 tgatctctca ggattaacac tgcagagtaa tgctccatca agtatgatgg tgaaggatga 1020 atatgtgcat gactttgagg gacagccatc gttgtccact gaaggacatt caattcaaac 1080 catccagcat ccaccaagta atcgtgcatc gacagagaca tacagcaccc cagctctgtt 1140 agccccatct gagtctaatg ctaccagcac tgccaacttt cccaacattc ctgtggcttc 1200 cacaagtcag cctgccagta tactgggggg cagccatagt gaaggactgt tgcagatagc 1260 atcagggcct cagccaggac agcagcagaa tggatttact ggtcagccag ctacttacca 1320 tcataacagc actaccacct ggactggaag taggactgca ccatacacac ctaatttgcc 1380 tcaccaccaa aacggccatc ttcagcacca cccgcctatg ccgccccatc ccggacatta 1440 ctggcctgtt cacaatgagc ttgcattcca gcctcccatt tccaatcatc ctgctcctga 1500 gtattggtgt tccattgctt actttgaaat ggatgttcag gtaggagaga catttaaggt 1560 tccttcaagc tgccctattg ttactgttga tggatacgtg gacccttctg gaggagatcg 1620 cttttgtttg ggtcaactct ccaatgtcca caggacagaa gccattgaga gagcaaggtt 1680 gcacataggc aaaggtgtgc agttggaatg taaaggtgaa ggtgatgttt gggtcaggtg 1740 ccttagtgac cacgcggtct ttgtacagag ttactactta gacagagaag ctgggcgtgc 1800 acctggagat gctgttcata agatctaccc aagtgcatat ataaaggtct ttgatttgcg 1860 tcagtgtcat cgacagatgc agcagcaggc ggctactgca caagctgcag cagctgccca 1920 ggcagcagcc gtggcaggaa acatccctgg cccaggatca gtaggtggaa tagctccagc 1980 tatcagtctg tcagctgctg ctggaattgg tgttgatgac cttcgtcgct tatgcatact 2040 caggatgagt tttgtgaaag gctggggacc ggattaccca agacagagca tcaaagaaac 2100 accttgctgg attgaaattc acttacaccg ggccctccag ctcctagacg aagtacttca 2160 taccatgccg attgcagacc cacaaccttt agactgaggt cttttaccgt tggggccctt 2220 aaccttatca ggatggtgga ctacaaaata caatcctgtt tataatctga agatatattt 2280 cacttttgtt ctgctttatc ttttcataaa gggttgaaaa tgtgtttgct gccttgctcc 2340 tagcagacag aaactggatt aaaacaattt tttttttcct cttcagaact tgtcaggcat ggctcagagc ttgaagatta ggagaaacac attcttatta attcttcacc tgttatgtat gaggle ttccagtgct agaaattta gccctttaa acgtcttag gccttttatc tgcagaacat cgatatgtat atcattctac agaatatcc agtattgctg attttaaagg cagagaagtt ctcaaagtta attcacctat gttattttgt gtacaagttg ttattgttga acatacttca aaataatgt gccatgtggg tgagttaatt ttaccaagag taactttact ctgtgtttaa aaagtaagtt aataatgtat tgtaatcttt catccaaaat attttttgca agttatta gtgaagatgg tttcaattca gattgtcttg caacttcagt tttatttttg ccaaggcaaa aaactcttaa tctgtgtgta tattgagaat cccttaaaat taccagacaa aaaaatttaa aattacgttt gttattccta gtggatgact gttgatgaag tatacttttc ccctgttaaa cagtagttgt attcttctgt atttctaggc acaaggttgg ttgctaagaa gcctataaga ggaatttctt ttccttcatt catagggaa ggttttgtat tttttaaaac actaaaagca gcgtcactct acctaatgtc tcactgttct gcaaaggtgg caatgcttaa 3120 actaaataat gaataaactg aatattttgg aaactgctaa attctatgtt aaatactgtg 3180 cagaataatg gaaacattac agttcataat aggtagtttg gatatttttg tacttgattt 3240 gatgtgactt tttttggtat aatgtttaaa tcatgtatgt tatgatattg tttaaaattc 3300 agttttgta tcttggggca agactgcaaa cttttttata tctttttggtt attctaagcc 3360 ctttgccatc aatgatcata tcaattggca gtgactttgt atagagaatt tagtagaaa 3420 agttgcagat gtattgactg taccacagac acaatatgta tgctttttac ctagctggta 3480 gcataaataa aactgaatct caacatacaa agttgaattc taggtttgat ttttaagatt 3540 ttttttttct tttgcacttt tgagtccaat ctcagtgatg aggtaccttc tactaaatga 3600 caggcaacag ccagttctat tgggcagctt tgtttttttc cctcacactc taccgggact 3660 tccccatgga cattgtgtat catgtgtaga gttggtttt tttttttta atttttatttt 3720 tactatagca gaatagacc tgattatcta caagatgata aatagattgt ctacaggata 3780 atagtatga aaaaatca aggatctct ttcagatgtg tttactttg cctggagaac 3840 tttagctat agaacactt gtgtgatgat agtcctcctt atatcacctg gatgaacac 3900 agctctact gccttgctca gaaggtcttt taaatagacc atcctagaaa ccactgagtt 3960 tgcttatttc tgtgatttaa acatagatct tgatccaagc tacatgactt ttgtctttaa 4020 ataacttatc taccacctca ttgtactct tgattactta caatttctt cagtaacac 4080 ctaattttct tctgtaaag ttggtgatt taagttttat tggcagtttt AAAAAAAGc 4140 atcttctcta gaaattgcta actttaggtc cattttactg tgaatgagga aggagtga 4200 gttttagaat aacagatttt taaaaatcca gatgatttga ttaaaacctt atcatacat 4260 tgacataatt cattgcttct tttttga atatggagtc tgctgtgtt gcccaggcag 4320 gagtgcagtg gtatgatctc agctcactgc aacctctgcc tcccggttc aactgattct 4380 cctgcctcag cctccctggt agctaggatt acaggtgccc gccaccatgc ctgctact 4440 tttgtagttt tagtagac ggggttttgc ctgttggcca ggctggtctt gaactcctga 4500 cctcaagtga tccatccacc ttggcctccc aaagtgctgg gattacgggc gtgagccact 4560 gtccctggcc tcattgttcc cttttctact ttaaggaaag ttttcatgtt taatcatctg 4620 gggaaagtat gtgaaaata tttgttaaga agtatctctt tggagccaag ccacctgtct 4680 tggttcttt ctactaagag ccataaagta tagaaatact tctagttgtt aagtgcttat 4740 atttgtacct agatttagtc acacgcttt gagaaaacat ctagtatgtt atgatcagct 4800 attcctgaga gcttggttgt taatctatat ttctatttct tagtggtagt catctttgat 4860 gaataagact aaagattctc acaggtttaa aattttatgt ctactttaag ggtaaaatta 4920 tgaggttatg gttctgggtg ggttttctct agctaattca tatctcaaag agtctcaaaa 4980 tgttgaattt cagtgcaagc tgaatgagag atgagccatg tacacccacc gtaagacctc 5040 attccatgtt tgtccagtgc ctttcagtgc attatcaaag ggaatccttc atggtgttgc 5100 cggggagtag atcgtgggat atagtctatc tcatttttaa tagttaccg 5160 cccctggtat acaaagataa tgacaataaa tcactgccat ataaccttgc tttttccaga 5220 5280. aacatggctg ttttgtattg ctgtaaccac taaataggtt gcctatacca ttcctcctgt gacagtgca gatttacagg ttgcatggtc tggcttaagg agagccatac ttgagacatg tgagtaaact gaactcatat tagctgtgct gcatttcaga cttaaaatcc atttttgtgg ggcagggtgt ggtgtgtaaa ggggggtgtt tgtaatacaa gttgaaggca aaataaaatg tcctgtctcc cagatgatat acatcttatt atttttaag tttattgcta attgtaggaa ggtgagttgc aggtatcttt gactatggtc atctgggga ggaaaattt acattttact 5580 attachment cttaagtgtc tatggaggtt aaagaataaa atggtaaatg tttctgtgcc tggtttgatg gtaactggtt aatagttact caccatttta tgcagagtca cattagttca caccctttct gagagccttt tgggagaagc agttttattc tctgagtgga acagagttct 5760. ttttgttgat aatttctagt ttgctccctt cgttattgcc aactttactg gcattttatt 5820 taatgatagc agttggga aatggcaaat ttaggttacg gaggtaaatg agtatatgaa agcaattacc tctaaagcca gttaacaatt attttgtagg tggggtacac tcagcttaaa gtaatgcatt ttttttccc gtaaaggcag aatccatctt gttgcagata gctatctaaa 6000 taatctcata tcctctttg caaagactac agagaatagg ctatgacaat cttgttcaag 6060 cctttccatt ttttccctg ataactaagt aatttctttg aacataccaa gaagtatgta 6120 aaaagtccat ggccttattc atccacaaag tggcatccta ggcccagcct tatccctagc 6180 agttgtccca gtgctgctag gttgcttatc ttgtttatct ggaatcactg tggagtgaaa 6240 ttttccacat catccagaat tgccttattt aagaagtaaa acgttttaat ttttagcctt 6300 ttttggtgg agttatttaa tatgtatatc agaggatata ctagatggta acatttcttt 6360 ctgtgcttgg ctatctttgt ggacttcagg ggcttctaaa acagacagga ctgtgttgcc 6420 tttactaaat ggtctgagac agctatggtt ttgaattttt agtttttttt ttttaaccca 6480 cttcccctcc tggtctcttc cctctctgat aattaccatt catatgtgag tgttagtgtg 6540 cctcctttta gcattttctt cttctctttc tgattcttca tttctgactg cctagcaag 6600 gaaaccagat aaccaaactt actagaacgt tctttaaaac acaagtacaa actctgggac 6660 aggacccaag acactttcct gtgaagtgct gaaaaagacc tcattgtatt ggcatttgat 6720 atcagtttga tgtagcttag agtgcttcct gattcttgct gagtttcagg tagttgagat 6780 aagagaagat gagtcatatt catattttcc cccttagaat aatattttga aaggtttcat 6840 tgcttccact tgaatgctgc tcttacaaaa actggggtta caagggttac taaattagca 6900 tcagtagcca gaggcaatac cgttgtctgg aggacaccag caaacaacac acaacaaagc 6960 aaaacaaacc ttgggaaact aaggccattt gttttgtttt ggtgtcccct ttgaagccct 7020 gccttctggc cttactcctg tacagatatt tttgacctat aggtgccttt atgagaattg 7080 agggtctgac atcctgcccc aaggatgac taagtaatt gctagtgttt tcagggattt 7140 7200 7260 tgtggatact tttcacaccg tttatttaaa tgctttctca ataggtccag agccagtgtt 7320 7380 ccctctgcca caaatttgat gtgtgacctt tgggcaagtc atttatcttc tctgggcctt 7440 agttgcctca tctgtaaaat gagggagttg gagtagatta attattccag ctctgaaatt 7500 ctaagtgacc ttggctacct tgcagcagtt ttggatttct tccttatctt tgttctgctg 7560 tttgagggg ctttttactt atttccatgt tattcaaagg agactaggct tgatattta 7620 ttactgttct tttatggaca aaaggttaca tagtatgccc ttaagactta attttaacca 7680 aaggcctagc accaccttag gggctgcaat aaacacttaa cgcgcgtgcg cacgcgcgcg 7740 cgcacacaca cacacaca cacacaca cacaggtcag agtttaaggc tttcgagtca 7800 tgacattcta gcttttgaat tgcgtgcaca cacacacgca cgcacacact ctggtcagag 7860 tttattaagg ctttcgagtc atgacattat agcttttgag ttggtgtgtg tgacaccacc 7920 ctcctaagtg gtgtgtgctt gtaatttttt ttttcagtga aaatggattg aaaacctgtt 7980 gttaatgctt agtgatatta tgctcaaaac aaggaaaattc ccttgaaccg tgtcaattaa 8040 actggtttat atgactcaag aaaacaatac footgatga ttattaactt tattcttggc 8100 tctttttagg tccattttga ttaagtgact ttggctgga tcattcagag ctctcttcta 8160 gcctaccctt ggatgagtac attaatgaa attcatattt tcaaggacct gggagccttc 8220 cttggggctg ggttgagggt ggggggttgg ggagtcctgg tagaggccag cttgtggta 8280 gctggagagg aagggatgaa accagctgct gttgcaaagg ctgcttgtca ttgatagaag 8340 gactcacggg cttggattga ttaagactaa acatggagtt ggcaaacttt cttcaagtat 8400 tgagttctgt tcaatgcatt ggacatgtga tttaagggaa aagtgtgaat gcttatagat 8460 gatgaaaacc tggtgggctg cagagcccag tttagaagaa gtgagttggg ggttggggac 8520 agatttggtg gtggtatttc ccaactgttt cctcccctaa attcagagga atgcagctat 8580 gccagaagcc agagaagagc cactcgtagc ttctgctttg gggacaactg gtcagttgaa 8640 agtcccagga gttcctttgt ggctttctgt atacttttgc ctggttaaag tctgtggcta 8700 aaaaatagtc gaacctttct tgagaactct gtaacaaagt atgtttttga ttaaaagaga 8760 aagccaacta aaaaaaaaaa aaaaaaaa 8789 <210> 3 <211> 19 <212> RNA <213> Artificial <220> <223> SMAD4 shRNA <400> 3 guaaguagcu ggcugacca 19 <210> 4 <211> 19 <212> DNA <213> Homo sapiens <400> 4 tggtcagcca gctacttac 19 <210> 5 <211> twenty one <212> DNA <213> Artificial <220> <223> Scrambled shRNA <400> 5 aagttgcaaa tcgcgtctct a 21 <210> 6 <211> 19 <212> RNA <213> Artificial <220> <223> SMAD4 shRNA <400> 6 agaagugagu cauauucau 19 <210> 7 <211> 19 <212> DNA <213> Homo sapiens <400> 7 atgaatatga ctcacttct 19 <210> 8 <211> 142 <212> PRT <213> Artificial <220> <223> Recombinant CLP / cotl 1 <400> 8 Met Ala Thr Lys Ile Asp Lys Glu Ala Cys Arg Ala Ala Tyr Asn Leu 1 5 10 15 Val Arg Asp Asp Gly Ser Ala Val Ile Trp Val Thr Phe Lys Tyr Asp 20 25 30 Gly Ser Thr Ile Val Pro Gly Glu Gln Gly Ala Glu Tyr Gln His Phe 35 40 45 Ile Gln Gln Cys Thr Asp Asp Val Arg Leu Phe Ala Phe Val Arg Phe 50 55 60 Thr Thr Gly Asp Ala Met Ser Lys Arg Ser Lys Phe Ala Leu Ile Thr 65 70 75 80 Trp Ile Gly Glu Asn Val Ser Gly Leu Gln Arg Ala Lys Thr Gly Thr 85 90 95 Asp Lys Thr Leu Val Lys Glu Val Val Gln Asn Phe Ala Lys Glu Phe 100 105 110 Val Ile Ser Asp Arg Lys Glu Leu Glu Glu Asp Phe Ile Lys Ser Glu 115 120 125 Leu Lys Lys Ala Gly Gly Ala Asn Tyr Asp Ala Gln Thr Glu 130 135 140 <210> 9 <211> 20 <212> DNA <213> Artificial <220> <223> Primers <400> 9 ctggataccg cagctaggaa 20 <210> 10 <211> 20 <212> DNA <213> Artificial <220> <223> Primers <400> 10 ccctcttaat catggcctca 20 <210> 11 <211> 17 <212> DNA <213> Artificial <220> <223> Primers <400> 11 tgcggccgat tgtgaac 17 <210> 12 <211> twenty one <212> DNA <213> Artificial <220> <223> Primers <400> 12 cctcttttct ctgcggaacg t 21 <210> 13 <211> 20 <212> DNA <213> Artificial <220> <223> Primers <400> 13 ctaccatgga ccatcctgct 20 <210> 14 <211> 20 <212> DNA <213> Artificial <220> <223> Primers <400> 14 cctatcccaa ggtcttgctg 20 <210> 15 <211> 20 <212> DNA <213> Artificial <220> <223> Primers <400> 15 gtggacgaggcaagagtttc 20 <210> 16 <211> 20 <212> DNA <213> Artificial <220> <223> Primers <400> 16 ttcccgaggt ccatctactg 20 <210> 17 <211> 20 <212> DNA <213> Artificial <220> <223> Primers <400> 17 tcaggaacct caccttggac 20 <210> 18 <211> 20 <212> DNA <213> Artificial <220> <223> Primers <400> 18 gcacagtggg gagaagagag 20 <210> 19 <211> 20 <212> DNA <213> Artificial <220> <223> Primers <400> 19 gattgatgac aagggcatgg 20 <210> 20 <211> 20 <212> DNA <213> Artificial <220> <223> Primers <400> 20 cccatagggt gagaaaacca 20 <210> twenty one <211> 20 <212> DNA <213> Artificial <220> <223> Primers <400> twenty one atcgccactc cagctacatc 20 <210> twenty two <211> 20 <212> DNA <213> Artificial <220> <223> Primers <400> twenty two ggcagcatca cagtagcatc 20 <210> twenty three <211> 20 <212> DNA <213> Artificial <220> <223> Primers <400> twenty three ccatttccaa tcatcctgct 20 <210> twenty four <211> 20 <212> DNA <213> Artificial <220> <223> Primers <400> twenty four acctttgcct atgtgcaacc 20 <210> 25 <211> 20 <212> DNA <213> Artificial <220> <223> Primers <400> 25 ggaggacgtg aatgacaaca 20 <210> 26 <211> twenty three <212> DNA <213> Artificial <220> <223> Primers <400> 26 cacgttctca cacgtttctt tac 23 <210> 27 <211> 20 <212> DNA <213> Artificial <220> <223> Primers <400> 27 ggccagtgca actctttcta 20 <210> 28 <211> twenty one <212> DNA <213> Artificial <220> <223> Primers <400> 28 ctgtagttca gggcagttga g 21 <210> 29 <211> 20 <212> DNA <213> Artificial <220> <223> Primers <400> 29 gttatcctcg agggcatggt 20 <210> 30 <211> 20 <212> DNA <213> Artificial <220> <223> Primers <400> 30 cgtcctccag agtcagcact 20 <210> 31 <211> twenty two <212> DNA <213> Artificial <220> <223> Primers <400> 31 aactgttaga cgacggacat ag 22 <210> 32 <211> 20 <212> DNA <213> Artificial <220> <223> Primers <400> 32 cttcggtctg gtgtccattt 20 <210> 33 <211> twenty two <212> DNA <213> Artificial <220> <223> Primers <400> 33 tgaaccatcc aacgacaatc ta 22 <210> 34 <211> twenty one <212> DNA <213> Artificial <220> <223> Primers <400> 34 cttgctgagg taccatgttc t 21 <210> 35 <211> 32 <212> PRT <213> artificial <220> <223> SBD peptide <400> 35 Ala Pro Gly Leu Pro Asn Gly Leu Leu Ser Gly Asp Glu Asp Phe Ser 1 5 10 15 Ser Ile Ala Asp Met Asp Phe Ser Ala Leu Leu Ser Gln Ile Ser Ser 20 25 30

Claims

1. Use of a composition for the preparation of a medicament for treating or inhibiting the onset of schizophrenia in a subject suffering from schizophrenia or at risk of suffering from schizophrenia, the composition comprising a SMAD4 inhibitor, wherein the SMAD4 inhibitor is an inhibitory nucleic acid molecule selected from the group consisting of SMAD4 antisense oligonucleotides, SMAD4 shRNA and SMAD4 siRNA, and wherein the composition restores K of glial cells in the subject + Intake.

2. The use according to claim 1, wherein the glial cells are glial progenitor cells.

3. The use of claim 2, wherein the composition is administered under conditions effective to restore astrocyte differentiation of glial progenitor cells. The use according to claim 1 , wherein the glial cells are astrocytes.

5. The use of claim 1, wherein the composition is formulated for glial cell delivery.

6. The use of claim 1, wherein the SMAD4 inhibitor is packaged in a nanoparticle delivery vehicle.

7. The use of claim 6, wherein the delivery vehicle comprises a neuroglia cell targeting moiety.

8. The use of claim 1, wherein the composition is administered under conditions effective to reduce neuronal excitability in the subject.

9. The use of claim 1, wherein the composition is administered under conditions effective to reduce the incidence of epilepsy in the subject.

10. The use of claim 1, wherein the composition is administered under conditions effective to improve cognitive impairment in the subject.

11. The use of claim 1, wherein the composition is administered by intracerebral delivery, intrathecal delivery, intranasal delivery or by direct infusion into the cerebral ventricle.

12. The use of claim 1, wherein the subject is a human.

Images