Sequencing adapters, construction methods, nanopore library construction kits and applications

Abstract

The present application discloses a sequencing adapter, a construction method, a nanopore library construction kit and an application. The sequencing adapter includes an adapter top chain and a target adapter. The adapter top chain includes a nanopore guide chain and a first connecting group arranged along a preset sequencing direction. The nanopore guide chain is used to guide the sequence to be tested through the nanopore sequencing channel; the target adapter includes a second connecting group that undergoes a click chemistry reaction with the first connecting group, and the second connecting group is used to connect to the sequence to be tested. The sequencing adapter provided in the present application can avoid the use of ligase, thereby eliminating the purification treatment step before sequencing on the machine, improving sequencing efficiency, and can also avoid the template self-ligation caused by the use of ligase, artificially introducing chimeric sequences, and affecting structural variation analysis.

Description

Technical Field

[0001] The present application belongs to the field of gene sequencing technology, and in particular relates to a sequencing adapter, a construction method, a nanopore library construction kit and applications. Background Art

[0002] In the prior art, whether it is second-generation high-throughput sequencing or nanopore sequencing, it is necessary to connect the sequencing adapter and the sequence to be tested by DNA ligase during the library construction process, and then perform sequencing on the machine. Compared with the second-generation sequencing platform in the prior art, the read length of the nanopore sequencing platform is longer. The added DNA ligase will not only connect the sequencing adapter and the sequence to be tested, but also cause part of the sequence to be tested to self-connect, which seriously interferes with the analysis of subsequent sequencing sequences. After connecting the sequencing adapter and the sequence to be tested by DNA ligase, purification treatment must be performed to remove the components in the connection reaction to avoid affecting the subsequent sequencing on the machine. The purification treatment step will prolong the library construction time and reduce the sequencing efficiency. Summary of the invention

[0003] The embodiments of the present application provide a sequencing adapter, a construction method, a nanopore library construction kit and an application, which can avoid the use of DNA ligase, thereby eliminating purification processing and improving sequencing efficiency. It can also avoid template self-ligation caused by the use of ligase, artificially introduce chimeric sequences, and affect structural variation analysis.

[0004] In one aspect, the present invention provides a sequencing adapter, the sequencing adapter comprising:

[0005] The adapter top strand comprises a nanopore guide strand and a first linking group arranged along a preset sequencing direction, wherein the nanopore guide strand is used to guide the sequence to be tested to pass through the nanopore sequencing channel;

[0006] The target linker includes a second linking group that undergoes a click chemistry reaction with the first linking group, and the second linking group is used to connect to the sequence to be detected.

[0007] Optionally, the target linker further comprises a transposase recognition sequence connected to the second linker group.

[0008] Optionally, the target connector further comprises a connection sequence connected to the second connection group, and along a preset sequencing direction, the end of the connection sequence away from the second connection group is provided with a protruding sticky end.

[0009] Optionally, the target connector further includes a primer corresponding to the upstream or downstream of the sequence to be detected, and the second connecting group is connected to the primer.

[0010] Optionally, when the target linker includes a linker sequence connected to the second linker group, the target linker also includes an impedance polymerase modification located between the second linker group and the primer; preferably, the impedance polymerase modification is a dspacer modification.

[0011] Optionally, one of the first linking group and the second linking group is cyclooctene and the other is tetrazine; Optionally, the first linking group is cyclooctene and the second linking group is tetrazine;

[0012] Alternatively, one of the first linking group and the second linking group is diphenylcyclooctyne, and the other is an azide group.

[0013] Optionally, the molar amount of the linker top strand is less than the molar amount of the target linker.

[0014] Optionally, the sequencing adapter further comprises:

[0015] The adapter bottom strand comprises an adapter complementary strand that is partially complementary to the nanopore guide strand.

[0016] Optionally, the connector bottom chain also includes a first sticky end sequence, and the first sticky end sequence and the connector complementary chain are connected along the sequencing direction; the target connector also includes a second sticky end sequence complementary to the first sticky end sequence, and the second connecting group and the second sticky end sequence are arranged along the sequencing direction.

[0017] Optionally, the molar amount ratio of the linker top chain to the linker bottom chain is 1:1, and the molar amount of the linker top chain is less than the molar amount of the target linker.

[0018] On the other hand, an embodiment of the present application provides a method for constructing a library, such as the above-mentioned sequencing adapter is applied to the construction method, and the construction method comprises:

[0019] Provide sequencing adapters as above:

[0020] Connecting the target connector to the sequence to be tested;

[0021] The first linking group and the second linking group undergo a click chemistry reaction to obtain a sample library.

[0022] On the other hand, an embodiment of the present application provides a nanopore library construction kit, which includes the sequencing adapter and polynucleotide binding protein as described above.

[0023] In yet another aspect, embodiments of the present application provide a use of the above-mentioned sequencing adapter, method, or nanopore library construction kit in characterizing a biopolymer or preparing a product for characterizing a biopolymer.

[0024] The sequencing adapter, construction method, nanopore library construction kit and application of the embodiments of the present application provide a first linking group on the top chain of the adapter and a second linking group for connecting to the sequence to be tested, so that the top chain of the adapter and the sequence to be tested are connected by a click chemistry reaction through the first linking group and the second linking group, thereby eliminating the need for T4 DNA ligase and purification treatment before sequencing on a machine, thereby improving sequencing efficiency; by providing a nanopore guide chain, the sequencing adapter connected to the sequence to be tested can accurately identify the nanopore and guide the connected sequence to be tested through the nanopore sequencing channel of the sequencer. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the technical solution of the embodiments of the present application, the following is a brief introduction to the drawings required for use in the embodiments of the present application. For ordinary technicians in this field, other drawings can be obtained based on these drawings without any creative work.

[0026] Figure 1 This is a schematic diagram of a partial chemical formula of the top chain of the linker in one embodiment of the present application;

[0027] Figure 2 This is a schematic diagram of a partial chemical formula of a target linker in one embodiment of the present application;

[0028] Figure 3 yes Figure 1 The connector top chain shown and Figure 2 Schematic diagram of a partial chemical formula of the annealing product of the target linker shown;

[0029] Figure 4 This is a schematic diagram of the structure of a sequencing adapter in one embodiment of the present application;

[0030] Figure 5 is a schematic diagram of the structure of a sequencing adapter in another embodiment of the present application;

[0031] Figure 6 is a schematic diagram of the structure of a sequencing adapter in another embodiment of the present application;

[0032] Figure 7 This is a polyacrylamide gel electrophoresis diagram of an embodiment of the present application;

[0033] Figure 8 This is a nanopore sequencing through-hole signal diagram of an embodiment of the present application;

[0034] Fig. 9 is a polyacrylamide gel electrophoresis diagram of another embodiment of the present application;

[0035] Fig.10 This is a polyacrylamide gel electrophoresis diagram of another embodiment of the present application;

[0036] Fig.11 This is a polyacrylamide gel electrophoresis diagram of another embodiment of the present application. DETAILED DESCRIPTION

[0037] The features and exemplary embodiments of various aspects of the present application will be described in detail below. In order to make the purpose, technical solutions and advantages of the present application clearer, the present application will be further described in detail below in conjunction with the accompanying drawings and specific embodiments. It should be understood that the specific embodiments described herein are only intended to explain the present application, rather than to limit the present application. For those skilled in the art, the present application can be implemented without the need for some of these specific details. The following description of the embodiments is only to provide a better understanding of the present application by illustrating the examples of the present application.

[0038] It should be noted that, in this article, relational terms such as first and second, etc. are only used to distinguish one entity or operation from another entity or operation, and do not necessarily require or imply any such actual relationship or order between these entities or operations. Moreover, the terms "include", "comprise" or any other variants thereof are intended to cover non-exclusive inclusion, so that a process, method, article or device including a series of elements includes not only those elements, but also other elements not explicitly listed, or also includes elements inherent to such process, method, article or device. In the absence of further restrictions, the elements defined by the statement "include..." do not exclude the presence of other identical elements in the process, method, article or device including the elements.

[0039] In order to solve the problems of the prior art, the present application provides a sequencing adapter, a construction method, a nanopore library construction kit and an application. The sequencing adapter provided in the present application is first introduced below.

[0040] The sequencing connector includes a connector top chain and a target connector. The connector top chain includes a nanopore guide chain and a first connecting group arranged along a preset sequencing direction. The nanopore guide chain is used to guide the sequence to be tested through the nanopore sequencing channel; the target connector includes a second connecting group that undergoes a click chemistry reaction with the first connecting group, and the second connecting group is used to connect to the sequence to be tested.

[0041] The sequencing adapter provided in the present application is applied to a nanopore sequencing platform. Specifically, polynucleotides can be sequenced, and the polynucleotides include DNA and / or RNA. The nanopore sequencing includes a nanopore sequencing channel through which the template strand and / or complementary strand of the sequence to be tested passes, and the changes in electrical signals such as current caused when the template strand and / or complementary strand of the sequence to be tested passes through the nanopore sequencing channel are detected to characterize the sequence to be tested. For example, size information, sequence information, identity information, modification information, etc. of the analyte to be analyzed are obtained based on the current change information.

[0042] The preset sequencing direction is a direction set by a person skilled in the art according to the requirements of the sequence to be tested or the nanopore sequencing platform. The preset sequencing direction may specifically include proceeding from the 5' end to the 3' end of the sequence to be tested, or proceeding from the 3' end to the 5' end of the sequence to be tested. When the preset sequencing direction is from the 3' end to the 5' end, the first linking group is connected to the 5' end of the nanopore guide chain; when the preset sequencing direction is from the 5' end to the 3' end, the first linking group is connected to the 3' end of the nanopore guide chain. The sequencing adapter may also include a adapter bottom chain that is partially or completely complementary to the adapter top chain, and the adapter bottom chain may also include a sequence recognized by the nanopore sequencing channel to guide the sequence to be tested to the vicinity of the nanopore sequencing channel; the adapter bottom chain may also be provided with a polynucleotide binding protein, such as a helicase binding site, etc., as required, so as to facilitate the small molecules of the sequence to be tested to pass through the nanopore sequencing channel in sequence. In one embodiment, the adapter top chain and the adapter bottom chain may be composed of two partially complementary oligomers, which form a y-shaped structure after annealing; the adapter top chain and the adapter bottom chain may also be internally complementary single oligomers to form a hairpin structure. Those skilled in the art can design the adapter top strand and adapter bottom strand according to the nanopore sequencing platform, the type of nanopore sequencing channel, the annealing temperature requirement, the design of the identification tag, etc. The adapter top strand and adapter bottom strand may also include a variety of marker sequences, such as a detection date marker sequence, a sample number marker sequence, etc., to distinguish different sequencing adapters by different base sequences; of course, the adapter top strand and adapter bottom strand may also include other sequences and modifications with biological functions.

[0043] Click chemistry is to quickly complete the chemical synthesis of different molecules by splicing small units. In the present application, the first linking group and the second linking group can be connected together based on the click chemical reaction, that is, by connecting the first linking group and the second linking group, the nanopore guide chain and the sequence to be tested are connected, so that the nanopore guide chain can be further connected to pull the sequence to be tested through the nanopore sequencing channel. The first linking group and the second linking group can be connected by a carbon-carbon multi-bond addition reaction, connected by a nucleophilic ring-opening reaction, and click chemical reactions such as cycloaddition reactions. For example: the first linking group can be any one of cyclooctene (TCO), dibenzocyclooctyne (DBCO), difluorinated cyclooctyne (DIFO), dicyclononyne (BCN) or dibenzocyclooctyne (DICO). The second linking group can be an azido group (N3), a tetrazine group (TZ), etc. It can be understood by those skilled in the art that the present embodiment does not limit which group the first linking group and the second linking group are specifically which group can undergo a click chemical reaction.

[0044] The second linking group in the present application can be connected to the sequence to be tested in a variety of ways. For example, the second linking group is coupled to a primer, the sequence to be tested is used as a template, and a plurality of sequences to be tested connected with the second linking group are obtained by PCR (polymerase chain reaction) amplification; the second linking group can also be coupled to a sequence with a transposon, and the sequence connected with the second linking group is connected to the sequence to be tested by transposase, thereby obtaining a sequence to be tested connected with the second linking group; the second linking group can also be connected to the sequence to be tested by TA connection, the 5' end of the sequence to be tested is phosphorylated and the 3' end is treated with adenine (A), and the second linking group is connected to the 5' end of the preset sequence, and the 3' end of the preset sequence is treated with thymine (T), and the second linking group and the sequence to be tested are connected by complementation of adenine (A) and thymine (T). This embodiment does not limit the connection method of the second linking group and the sequence to be tested.

[0045] In the present application, by setting a first linking group on the top chain of the linker and setting a second linking group for connecting the sequence to be tested, the top chain of the linker and the sequence to be tested are connected by a click chemistry reaction through the first linking group and the second linking group, thereby eliminating the need for DNA ligase and the need for purification treatment before sequencing on a sequencing machine, thereby improving sequencing efficiency; by setting the top chain of the linker and the bottom chain of the linker, the sequencing linker connected with the sequence to be tested can accurately identify the nanopore and guide the connected sequence to be tested to pass through the nanopore sequencing channel of the sequencer; at the same time, the template self-ligation caused by the use of ligase is avoided, and the chimeric sequence is artificially introduced, which affects the structural variation analysis.

[0046] When the second linking group is connected to the sequence to be tested through a primer, the target connector also includes a primer corresponding to the upstream or downstream of the sequence to be tested, and the second linking group is connected to the primer. The bottom chain of the joint also includes a first sticky end sequence, and the first sticky end sequence and the joint complementary chain are connected along the sequencing direction; the target connector also includes a second sticky end sequence complementary to the first sticky end sequence, and the second linking group and the second sticky end sequence are arranged along the sequencing direction. In the present application, the primer can be an upstream primer or a downstream primer, and the second sticky end sequence and the second linking group are arranged together in the same primer. For the convenience of description, the following is all connected with the second linking group, the second sticky end and the upstream primer, and the sequencing direction is 5' to 3' end as an example for explanation. Through the target connector and the corresponding downstream primer, PCR amplification can be performed with the sequence to be tested as a template, and the generated amplification product is a sequence to be tested carrying the target connector; then through annealing treatment, the first sticky end and the second sticky end are complementary, and the joint top chain and the target connector are close in space, so as to improve the efficiency of the click chemistry reaction between the first chemical group and the second chemical group. Further increase the stability of the connection between the target connector, the connector bottom chain and the connector top chain.

[0047] Furthermore, the target connector also includes an impedance polymerase modification located between the second linker group and the sequence to be tested. The impedance polymerase modification is a chemical modification that prevents the polymerase from continuing to extend, such as: 3' phosphorylation modification, dideoxycytidine (3'ddC Dideoxy-C), etc. The impedance polymerase modification can also be a dspacer modification, where dspacer is a nucleotide with only a phosphate backbone and no base, so its spatial structure is smaller than that of a normal nucleotide, so that when the DNA polymerase extends to the position of the dspacer modification, it cannot be recognized and slips off the amplified sequence to be tested, thereby stopping polymerization.

[0048] In one embodiment, one of the first linking group and the second linking group is cyclooctene (TCO), and the other is tetrazine (Tz). In another embodiment, one of the first linking group and the second linking group is diphenylcyclooctyne (DBCO), and the other is azido (N3). The chemical formula of TCO can be as follows: Figure 1 As shown, the chemical formula of Tz can be Figure 2 As shown, Tco and Tz interact to form the following Figure 3 The chemical formula shown, wherein R1 and R2 are the nanopore guide strand and the sequence to be detected, respectively. It can be understood by those skilled in the art that R1 and R2 may also include other sequences or modifications, so that TCO or Tz connects to R1 to form the linker top strand in each embodiment of the present application, and TCO or Tz connects to R2 to form the target linker in each embodiment of the present application. Figure 2It is 1,2,4,5-tetrazine. It can be understood by those skilled in the art that the tetrazine group (Tz) in the present application can also be 1,2,3,4-tetrazine, 1,2,3,5-tetrazine or its derivatives to achieve connection through click chemistry reaction. Similarly, the cyclooctene (TCO) in the present application is not limited to Figure 1 The groups shown can also be Figure 1 Derivatives of the groups shown.

[0049] Furthermore, the molar ratio of the top linker chain and the bottom linker chain is 1:1, so as to ensure that the top linker chain and the bottom linker chain can all complement each other one by one, avoid the formation of free single chains, and affect the subsequent on-machine detection. Since not all top linker chains can be connected to the target connector one by one, the molar number of the top linker chain is set to be less than the molar number of the target connector to ensure that the added top linker chains can be connected to the target connector, avoid free top linker chains, and improve the accuracy and rate of subsequent on-machine detection. The molar ratio of the top linker chain to the target connector can be 1:1 to 2.

[0050] Those skilled in the art can design the primers in the target linker according to the structure of the sequence to be tested, and determine the amplification system according to the length and CG content of the sequence to be tested, so that the amplification product is the sequence to be tested with the second linker group. Figure 4 In one embodiment, the sequencing direction is from 5' to 3', and the top strand 11 of the adapter is: 5'- AATGT ACTTC GTTC AGTTA CGTAT TGC - TCO -3';

[0051] The bottom chain 12 of the joint is: 5'- GCCG - GCAAT ACGT AACTG AACGA AGTAC ATT -GAGGC GAGCGGTCAA T-3';

[0052] The upstream primer is 228-F: 5'- Tz - CGGC - dspacer -ATCGGCATCAGAGCAGATTGTA-3';

[0053] The downstream primer was 228-R: 5′-AACGTCGTGACTGGGAAAAC-3′.

[0054] Among them, the "CGGC" in the upstream primer 228-F is the second sticky end, and the " GCCG " is the first sticky end, "CGGC" sequence and " GCCG "Sequences are connected by complementary base pairing; in the top strand 11 of the linker, " AATGTACTTCGTTCAGTTACGTATTGC " is a polynucleotide that simulates the structure of the nanopore guide strand, and the bottom strand 12 of the adapter is " GCAATACGTAACTGAACGAAGTA CATT" is a complementary sequence to the simulated nanopore guide chain, and a sequence that is not complementary to the top chain of the adapter is left at the 3' end of the bottom chain 12 of the adapter, so that when the top chain 11 of the adapter and the bottom chain 12 of the adapter are complementary, the top chain 11 of the adapter and the bottom chain 12 of the adapter form a Y-shaped structure. Tz in the upstream primer 228-F is the second connecting group, and TCO in the top chain of the adapter is the first connecting group. The upstream primer 228-F and the downstream primer 228-R use the sequence to be tested as a template, and the obtained amplification product is 228-F-the sequence to be tested. The Tz group in the 228-F-sequence to be tested and the TCO group in the top chain of the adapter are click-chemically connected, thereby realizing the connection between the nanopore guide chain and the sequence to be tested. It can be understood by those skilled in the art that the length, base type, etc. of the first sticky end and the second sticky end can be designed according to the spatial structure, sequence length, CG content, etc. of the upstream primer and the top chain of the adapter, and it is only necessary to ensure that the first sticky end and the second sticky end can be complementary to each other through base pairing.

[0055] See also Figure 5 , when the second linking group is connected to the sequence to be tested through a transposase, the target connector also includes a transposase recognition sequence connected to the second linking group. The transposase recognition sequence is a sequence that can be recognized by a transposase, and the transposase and the transposase recognition sequence can combine to form a transposase complex. Under the action of the transposase, the second linking group is introduced to the end of the sequence to be tested. It can be understood by those skilled in the art that the target connector not only includes the second linking group connected to the transposase recognition sequence, but also includes the first sticky end or other sequences or bound proteins that need to be introduced. In one embodiment, the sequencing direction is from the 5' end to the 3' end, and the top chain 11 of the adapter is: 5'- AATGT ACTTC GTTC AGTTA CGTAT TGC - TCO -3';

[0056] The bottom chain 12 of the joint is: 5'- GCCG - GCAAT ACGT AACTG AACGA AGTAC ATT -GAGGC GAGCGGTCAA T-3';

[0057] Transposase recognition sequences include complementary:

[0058] Tn5-Top: TZ-CGGC AGATGTGTATAAGAGACAG ;

[0059] Tn5-bottom: CTGTCTCTTATACACATCT.

[0060] Among them, the "CGGC" in the transposase recognition sequence Tn5-Top is the second sticky end, and the " GCCG " is the first sticky end, "CGGC" sequence and " GCCG "Sequences are connected by complementary base pairing; the top strand of the adapter is " AATGTACTTCGTTCAGTTACGTATTGC " is a polynucleotide that simulates the structure of the nanopore guide chain, and the " GCAATACGTAACTGAACGAAGTA CATT ” is a complementary sequence to the nanopore guide strand. Tz in the transposase recognition sequence Tn5-Top is the second linking group, and TCO in the top chain of the adapter is the first linking group. After the transposase recognition sequences Tn5-Top and Tn5-bottom are annealed and incubated with Tn5 transposase, a transposase complex can be obtained. After the transposase complex is incubated with the sequence to be tested, “TZ-CGGC” is connected to the sequence to be tested, thereby realizing the connection between the nanopore guide strand and the sequence to be tested. In another embodiment, the top chain of the adapter is “5'-(iSpC3) 30 -GCGTG ACTAT CGGAC TCGTG GTC TTTTT TTTTT-(iSp18) 4 - GTCAG TTCGC TTCTT ACGCA -TCO-3'", the bottom chain of the linker is "5'-GCCG TGCGT AAGAA GCGAA CTGAC AGTCCAGCAC CGACC T-3'", in this embodiment, the top chain of the linker also includes (iSpC3) 30 Modification, (iSp18) 4 modification, and "TTTTT TTTTT" flexible sequence, etc.

[0061] See also Figure 6 , when the second linking group is connected to the sequence to be tested by TA connection, the target connector also includes a connection sequence connected to the second linking group, and the target connector also includes a connection sequence connected to the second linking group. Along the preset sequencing direction, the end of the connection sequence away from the second linking group is provided with a protruding sticky end, and the connection sequence is connected to the sequence to be tested in a TA connection manner through the protruding sticky end. For example, a protruding thymine nucleotide end can be provided at the 3' end of the connection sequence. It can be understood by those skilled in the art that the end of the connection sequence away from the second linking group is not a flat end, and the protruding thymine nucleotide end can be connected to the sequence to be tested by adding A through base complementary pairing, or the protruding adenine nucleotide end can be connected to the sequence to be tested by adding T through base complementary pairing. Similarly, it can be understood by those skilled in the art that the target connector includes not only the second connection gene, but also the first sticky end or other sequences to be introduced. The design of the connection sequence is based on the principle of not being complementary to the sequence to be tested, the top chain of the joint, etc., and the appropriate CG content. In one embodiment, the sequencing direction is from 5' to 3', and the top strand 11 of the adapter is: 5'-(iSpC3) 30 -GCGTG ACTAT CGGAC TCGTG GTCTTTTT TTTTT-(iSp18)4 - GTCAG TTCGC TTCTT ACGCA -TCO-3';

[0062] The bottom strand 12 of the adapter is: 5'-GCCG TGCGT AAGAA GCGAA CTGAC AGTCC AGCAC CGACC T-3';

[0063] The linker sequence includes complementary:

[0064] TA-Top:TZ-CGGC AGATGTGTATAAGAGACAG T;

[0065] TA-bottom:5p- CTGTCTCTTATACACATCT .

[0066] The "CGGC" in the linker sequence TA-Top is the second sticky end, and the " GCCG " is the first sticky end, "CGGC" sequence and " GCCG "Sequences are connected by complementary base pairing; Tz in the connecting sequence TA-Top is the second connecting group, and TCO in the top chain of the linker is the first connecting group. After annealing, the connecting sequences TA-Top and TA-bottom are mixed with the sequence to be tested that has been treated with adenine nucleotides (A). The connecting sequence is connected to the sequence to be tested, and "TZ-CGGC" is connected to the top chain of the linker, thereby realizing the connection between the nanopore guide chain and the sequence to be tested.

[0067] In addition, in combination with the sequencing adapter in the above embodiment, the present application embodiment also provides a method for constructing a library, such as the above sequencing adapter is applied to the construction method, the construction method comprises:

[0068] Step S1, providing the sequencing adapter as described above;

[0069] Step S2, connecting the target connector to the sequence to be tested;

[0070] Step S3: causing the first linking group and the second linking group to undergo a click chemistry reaction to obtain a sample library.

[0071] In step S1, the sequencing adapter can be prepared in a variety of ways. Similarly, in step S2, the second linking group can be connected to the sequence to be tested in a variety of ways. For details, please refer to the methods listed in the above embodiments, which will not be described in detail here.

[0072] In the present application, step S3 specifically includes: annealing the top chain of the linker and the bottom chain of the linker to obtain an annealing product; contacting the annealing product with the sequence to be tested connected with the second linking group, so that the first linking group and the second linking group undergo a click chemistry reaction to obtain a sample library. It is only necessary to mix the annealing product prepared in step S2 with the sequence to be tested connected with the second linking group prepared in step S1, so that the first linking group and the second linking group can undergo a click chemistry reaction to achieve connection between the sequence to be tested and the top chain of the linker, and prepare a sample library. There is no need to add DNA ligase in step S3, so that there is no need to purify in step S3, and a sample library that can be used for further characterization of biomolecules can be prepared.

[0073] The sequencing adapter provided in the embodiment of the present application has the same technical effect as the sequencing adapter provided in any of the above embodiments, and will not be described in detail here.

[0074] In addition, in combination with the sequencing adapter in the above embodiment, the embodiment of the present application also provides a nanopore library construction kit. The nanopore library construction kit includes a sequencing adapter and a polynucleotide binding protein as described above. The adapter top chain, target connector, etc. in the sequencing adapter can be stored in a freeze-dried manner, or can be placed in a buffer storage method. Those skilled in the art can select a suitable method to store the sequencing adapter based on reasons such as ease of operation, convenience of transportation, or storage stability. The polynucleic acid binding protein may include: one or more of a helicase, an exonuclease, a telomerase, a topoisomerase, a reverse transcriptase, a translocase, and / or a polymerase, for making the translocation speed of the sequence to be tested through the nanopore sequencing channel less than the translocation speed when the nucleic acid binding protein, helicase, exonuclease, telomerase, topoisomerase, reverse transcriptase, translocase, and / or polymerase are not present.

[0075] In one embodiment, the nanopore library construction kit includes a first solution and a second solution, the first solution includes a first buffer, and a top linker chain and a bottom linker chain placed in the first buffer; the second solution includes a second buffer and a target connector placed in the second buffer. The nanopore library construction kit provided in the embodiment of the present application has the same technical effect as the sequencing connector provided in any of the above embodiments, and will not be described in detail here.

[0076] The first buffer solution can be a phosphate buffer solution, a TE buffer solution (Tris-EDTA buffer solution), or the like, which can stably preserve the structure of the top chain and the bottom chain of the adapter. The first buffer solution can be a DNA oligonucleotide annealing buffer solution, thereby stabilizing the structure of the top chain and the bottom chain of the adapter, while ensuring that the structure of the top chain and the bottom chain of the adapter can be effectively hybridized. For example, the first buffer solution includes 10mM Tris, 50mM NaCl, and 1mM EDTA, with a pH of 7.5-8.0. By storing the top chain and the bottom chain of the adapter in the first buffer solution, the stability of the structure of the top chain and the bottom chain of the adapter can be improved.

[0077] Similarly, the second buffer is a buffer for stabilizing the target connector. Those skilled in the art can select a suitable buffer according to the structure of the target connector. When the target connector includes an upstream sequencing primer or a downstream sequencing primer corresponding to the sequence to be tested, the second buffer is a buffer that is conducive to stabilizing the DNA structure, for example: TE buffer; when the target connector includes a transposon sequence, the second buffer is a buffer that is conducive to stabilizing the DNA structure and transposase reaction.

[0078] Those skilled in the art will appreciate that the nanopore library construction kit provided in the present application may also include one or more of independently packaged Primer-index complex F (forward primer), Primer-index complex R (reverse primer), Amplify enzyme and Amplify buffer, PCR tube, EP tube, etc., and is not limited thereto, to facilitate users to prepare samples that can be directly loaded onto the machine.

[0079] In addition, in combination with the nanopore library construction kit in the above embodiment, the present application embodiment also provides an application of a nanopore library construction kit in nucleotide sequencing. The application of the nanopore library construction kit provided in the present application embodiment in nucleotide sequencing has the same technical effect as the nanopore library construction kit provided in any of the above embodiments, and will not be repeated here.

[0080] When the target linker further includes an upstream primer or a downstream primer corresponding to the sequence to be detected, the second linking group is located at the 5' end of the primer; the sequencing method includes:

[0081] Step S21, taking a second solution to amplify the sequence to be detected to obtain an amplified product;

[0082] Specifically, the second solution, PCR amplification buffer, dNTP, the sequence to be tested, polymerase, primers corresponding to the primers of the target connector, etc. are mixed, and a suitable amplification system and amplification parameters are set according to the sequence to be tested and subsequent sequencing requirements for PCR amplification.

[0083] Step S22, mixing the amplified product with the first solution to cause a click chemical reaction between the first linking group and the second linking group, and connecting the amplified product with the top strand of the adapter to generate an annealing product;

[0084] According to the copy number of the amplified product, an appropriate amount of the first solution can be added so that the molar amount of the first linking group is less than that of the second linking group. The mixture is allowed to stand at room temperature for a period of time so that the first linking group and the second linking group have sufficient time to undergo a click chemistry reaction.

[0085] Step S23, sequencing the annealing product by a nanopore sequencer to obtain nucleotide sequence information corresponding to the sequence to be tested.

[0086] This application does not limit the nanopore sequencer of the nanopore sequencing platform, it is only necessary to ensure that the nanopore sequencer used is compatible with the top chain of the adapter and the bottom chain of the adapter in the first solution. When it is necessary to detect and sequence the sequence to be tested that may exist in multiple samples, an amplification primer with a second linking group can be designed and synthesized in advance according to the sequence to be tested, and after mixing with the second buffer, a second solution is prepared. The tester extracts nucleotides from each sample in advance, and then uses the extracted nucleotides as a template for amplification, and refers to the above steps S21-S23 to complete the detection and sequencing of each sample.

[0087] Compared with the existing sequencing methods, this embodiment does not require end filling, 5' end phosphorylation and 3' end A addition treatment for the sequence to be tested, and also does not require the use of DNA ligase, thereby eliminating the purification step before sequencing on the machine and improving the sequencing efficiency; since DNA ligase is not used, self-ligation of the sequence to be tested is avoided, thereby improving the accuracy of the sequencing results, which is conducive to the subsequent sequence analysis.

[0088] The present application also provides the following validation experiments to illustrate the effects of the sequencing adapters, construction methods, nanopore library construction kits and applications provided in the present application.

[0089] Embodiment 1:

[0090] (1) Designing and synthesizing a simulated linker top chain simulating a linker top chain structure and a simulated linker bottom chain simulating a linker bottom chain, wherein:

[0091] The top chain of the simulated adapter is adapter-top:

[0092] 5'- AATGTACTTCGTTCAGTTACGTATTGC -TCO-3';

[0093] The bottom chain of the simulated adapter is adapter-bottom:

[0094] 5'-GCCG GCAATACGTAACTGAACGAAGTACATT GAGGCGAGCGGTCAAT-3'.

[0095] Take annealing buffer to dissolve the synthesized simulated linker top chain and simulated linker bottom chain respectively, prepare 20uM stock solution A and stock solution B, mix stock solution A and stock solution B in equal proportions and then perform annealing treatment to obtain annealing products.

[0096] (2) Based on the known sequence of the pUC19 plasmid, a pair of primers with a product of 228 bp were designed, wherein the 5' end of the upstream primer was appropriately modified as follows:

[0097] 228-F: 5'-Tz-CGGC-dspacer-ATCGGCATCAGAGCAGATTGTA-3';

[0098] The downstream primer 228-R is: 5'-AACGTCGTGACTGGGAAAAC-3'.

[0099] (3) HiFi DNA polymerase prepared by KAPA Biosystems and the above-mentioned 228-F and 228-R primers were used for amplification according to the following amplification system and reaction parameters. After amplification, the DNA was purified with 1x Ampure xp beads and quantified by qubit4.0 to calculate the copy number based on the length.

[0100]

[0101] The enzyme was hot-started at 95°C for 2-5 min; denaturation at 98°C for 120 s, annealing at 55°C for 15 s, and extension at 72°C for 9 s, for 30 cycles; and extension at 72°C for 5 min.

[0102] (4) Based on the calculated copy number, 150 fmol of amplified product was taken into a new centrifuge tube, and 300 fmol of annealing products of the top chain of the simulated adapter and the bottom chain of the simulated adapter were taken into the centrifuge tube. The total volume was supplemented to 10 μl with annealing buffer. After standing at room temperature for 10 min, the annealing product was obtained.

[0103] The annealing products, amplification products and annealing products were detected by polyacrylamide gel electrophoresis. Figure 7 As shown, it is an electrophoresis diagram of the simulated sequencing adapter provided by the present application connected to the sequence to be tested, wherein the gel wells corresponding to the samples are, from left to right, maker; well 1: top strand of the adapter; well 2: amplified product; wells 3 and 4 are the sequence to be tested connected with the simulated sequencing adapter. Figure 7It can be seen that there is a band of about 200 bp corresponding to wells 2, 3 and 4, which is consistent with the size of the target product corresponding to the 228-F primer and the 228-R primer; there is also a band of about 300 bp in wells 3 and 4, and the size of this band is consistent with the size of the sequence to be tested connected with the simulated sequencing adapter, proving that the amplified product is successfully connected to the top chain of the simulated adapter; the brightness of wells 2, 3 and 4 shows that at least half of the amplified products are connected to the simulated sequencing adapter.

[0104] Embodiment 2:

[0105] (1) Design and synthesize the top linker chain and the bottom linker chain, wherein:

[0106] The top chain of the connector is adapter-top:

[0107] 5'-(iSpC3) 30 -GCGTG ACTAT CGGAC TCGTG GTC TTTTT TTTTT-(iSp18) 4 - GTCAG TTCGC TTCTT ACGCA -TCO-3';

[0108] The bottom link of the adapter is adapter-bottom:

[0109] 5'-GCCG TGCGT AAGAA GCGAA CTGAC AGTCC AGCAC CGACC T-3';

[0110] Take annealing buffer to dissolve the synthesized linker top chain and linker bottom chain respectively to prepare 20 μM stock solution A and stock solution B, mix stock solution A and stock solution B in equal proportions and then perform annealing treatment.

[0111] The T4 Dda helicase is loaded onto the Y adaptor to obtain a complex of the enzyme and the adaptor. The sequence of the T4 Dda helicase is shown in SEQ ID NO.1.

[0112] (2) Based on the known sequence of phage, a pair of PCR amplification primers with a product of 502 bp were designed. The upstream primer was modified to:

[0113] phage-502-F: 5'-Tz-CGGC-dspacer-AATAACGTCGGCAACTTTGG-3';

[0114] The downstream primer is: phage-502-R: 5′-GTTACGCCACCAGTCATCCT-3′.

[0115] (3) Perform PCR amplification, purification, and copy number calculation with reference to the amplification system and amplification parameters of Example 1.

[0116] (4) According to the calculated copy number, 100 fmol of the amplified product is placed in a new centrifuge tube, 100 fmol of the enzyme and adapter complex is placed in the centrifuge tube, and the total volume is supplemented to 10 ul with annealing buffer to obtain the sequence to be tested connected with the sequencing adapter;

[0117] (5) The sequence to be tested is sequenced using the gene sequencer QNome-9604, sequencing chip Qcell-3841 and sequencing kit Qeagen-8 of Qi Carbon Technology Co., Ltd. The reaction product of the sequencing kit Qeagen-8 is mixed with the sequence to be tested connected with the sequencing adapter, and the mixture is dripped onto the sequencing chip to obtain a through-hole signal map.

[0118] See also Figure 8 , which is a through-hole signal diagram of the sequence to be tested connected with the sequencing adapter being sequenced on the machine. Figure 8 The circled portion is the via signal of Tco-Tz-CGGC-dspacer, and the right side of the via signal is the via signals of different bases, which proves that the sequencing adapter provided in this embodiment can be applied to nanopore sequencing.

[0119] Embodiment 3:

[0120] The test sequence connected to the sequencing adapter was prepared according to the scheme of Example 2, except that the Tco group in the top chain of the adapter was replaced by the DBCO group, and the Tz group in the upstream primer was replaced by the N3 group; and three control groups were set up, in which the mixture of the annealing product and the amplification product was allowed to stand for 25 min, 2 hours and 6 hours, respectively, to verify the effect of different standing times on the connection rate of the annealing product and the amplification product.

[0121] The above products were detected by polyacrylamide gel electrophoresis. Figures 9 to 11 , Fig. 9 This is the electrophoresis diagram of the product after standing for 25 minutes. The samples corresponding to the gel wells from left to right are: maker; wells 1-3: mixture of annealing products and amplification products after standing for 25 minutes; well 4: amplification products; well 5: top strand of the adapter. Fig.10 This is the electrophoresis diagram of the product after standing for 2 hours. The samples corresponding to the wells from left to right are: maker; wells 1-3: mixture of annealing products and amplification products after standing for 2 hours; well 4: amplification products; well 5: top strand of the adapter. Fig.11This is the electrophoresis diagram of the product after standing for 6 hours, where the samples corresponding to the gel wells from left to right are: maker; wells 1 to 3: a mixture of annealing products and amplification products after standing for 6 hours; well 4: amplification products; well 5: top chain of the adapter.

[0122] from Fig. 9 , Fig.10 and Fig.11 It can be seen that the mixture has two obvious bands, proving that the sequence to be tested is successfully connected to the sequencing adapter; and Fig. 9 , Fig.10 and Fig.11 By comparison, it can be seen that when standing for 25 minutes, 2 hours, and 6 hours, the number of sequences to be tested connected with sequencing adapters gradually increases with time.

[0123] Nanopore sequencing: The method is the same as step (5) of Example 2. Results: The via signal of DBCO-N3-CGGC-dspacer is similar to the via signal of Tco-Tz-CGGC-dspacer in step (5) of Example 2, that is, the via signal is significantly different from the base to be tested, which proves that the sequencing adapter provided in this example can be applied to nanopore sequencing.

[0124] Embodiment 4:

[0125] (1) Prepare a complex of an enzyme and a linker by referring to step (1) of Example 2;

[0126] (2) designing and synthesizing a connecting sequence, wherein the connecting sequence includes two partially complementary sequences,

[0127] Tn5-Top: 5'-TZ-CGGC AGATGTGTATAAGAGACAG -3',

[0128] Tn5-bottom: 5'- CTGTCTCTTATACACATCT- 3';

[0129] (3) Dilute Tn5-Top and Tn5-bottom with anneal buffer to a concentration of 40 uM, then mix them in equal proportions to anneal the two sequences to obtain annealing products;

[0130] (4) taking a certain amount of the annealing product prepared in step (3) and incubating it with an appropriate concentration of Tn5 transposase to prepare a transposase complex;

[0131] (5) taking a certain amount of long DNA fragments of known sequence and fragmenting them using the above transposase complex so that "Tz-CGGC" is introduced to the ends of the fragmented DNA;

[0132] (6) Referring to steps (4) and (5) of Example 2, the sequence to be tested connected with the sequencing adapter is sequenced to obtain a via signal, and the sequence obtained by the via signal analysis is consistent with the known sequence.

[0133] Embodiment 5:

[0134] (1) Prepare a complex of an enzyme and a linker by referring to step (1) of Example 2;

[0135] (2) designing and synthesizing a connecting sequence, wherein the connecting sequence includes two partially complementary sequences,

[0136] TA-Top: 5'-TZ-CGGC AGATGTGTATAAGAGACAG T-3',

[0137] TA-bottom: 5'-5p- CTGTCTCTTATACACATCT -3';

[0138] (3) Dilute TA-Top and TA-bottom with anneal buffer to a concentration of 40uM, then mix them in equal proportions to anneal the two sequences to obtain annealing products;

[0139] (4) The known sequence of the test sequence is repaired at the end and treated with adenine nucleotide (A) to phosphorylate the 5' end and protrude an A base at the 3' end;

[0140] (5) using T4 DNA ligase to connect the annealing product in step (3) and the sequence to be tested after treatment in step (4), after which Tz-CGGC will be introduced to the end of the sequence to be tested, and the annealing product is purified;

[0141] (6) Referring to steps (4) and (5) of Example 2, the sequence to be tested connected with the sequencing adapter is sequenced to obtain a via signal, and the sequence obtained by the via signal analysis is consistent with the known sequence.

[0142] In addition, the term "and / or" in this article is only a description of the association relationship of associated objects, indicating that there may be three relationships. For example, A and / or B can represent: A exists alone, A and B exist at the same time, and B exists alone. In addition, the character " / " in this article generally indicates that the objects associated before and after are in an "or" relationship. It should be understood that in the embodiments of the present application, "B corresponding to A" means that B is associated with A, and B can be determined based on A. However, it should also be understood that determining B based on A does not mean determining B only based on A, but B can also be determined based on A and / or other information.

[0143] The above are only specific implementations of the present application, but the protection scope of the present application is not limited thereto. Any technician familiar with the technical field can easily think of various equivalent modifications or replacements within the technical scope disclosed in the present application, and these modifications or replacements should be included in the protection scope of the present application. Therefore, the protection scope of the present application shall be based on the protection scope of the claims. Sequence Listing <110> Chengdu Qitan Technology Co., Ltd. <120> Sequencing adapters, construction methods, nanopore library construction kits and applications <160> 1 <170> SIPOSequenceListing 1.0 <210> 1 <211> 439 <212> PRT <213> Enterobacteria phage T4 <400> 1 Gly Thr Pro Ala Ala Leu Thr Gly Gly Gly Leu Ala Ala Pro Ala Ile 1 5 10 15 Val Met Leu Ala Ile Leu Gly Leu Leu His His Val Thr Ile Ala Gly 20 25 30 Pro Ala Gly Thr Gly Leu Thr Thr Leu Thr Leu Pro Ile Ile Gly Ala 35 40 45 Leu Ile Ser Thr Gly Gly Thr Gly Ile Ile Leu Ala Ala Pro Thr His 50 55 60 Ala Ala Leu Leu Ile Leu Ser Leu Leu Ser Gly Leu Gly Ala Ser Thr 65 70 75 80 Ile His Ser Ile Leu Leu Ile Ala Pro Val Thr Thr Gly Cys Ala Val 85 90 95 Leu Pro Gly Gly Leu Gly Val Pro Ala Leu Ala Leu Ala Ala Val Leu 100 105 110 Ile Cys Ala Gly Val Ser Met Thr Ala Ala Leu Leu Pro Leu Ile Leu 115 120 125 Leu Ser Thr Ile Pro Pro Thr Ala Thr Ile Ile Gly Ile Gly Ala Ala 130 135 140 Leu Gly Ile Ala Pro Val Ala Pro Gly Gly Ala Thr Ala Thr Ile Ser 145 150 155 160 Pro Pro Pro Thr His Leu Ala Pro Thr Gly Cys Gly Leu Thr Gly Val 165 170 175 Leu Ala Ser Ala Ala Pro Ile Ile Ala Val Ala Thr Ala Val Ala Ala 180 185 190 Gly Leu Thr Ile Thr Ala Leu Val Val Ala Gly His Gly Val Ala Gly 195 200 205 Pro Thr Gly Ala Thr Ala Leu Ala Ala Pro Met Val Ala Thr Pro Ser 210 215 220 Ile Val Leu Ser Leu Ala Ala Leu Pro Gly Ala Ala Val Met Ala Pro 225 230 235 240 Thr Ala Leu Ser Val Ala Leu Leu Ala Ser Ile Ile Ala Leu Leu Ile 245 250 255 Pro Gly Thr Ala Leu Ala Pro Ile Val Gly Gly Ile Ile Val Met Gly 260 265 270 Gly Pro Leu Pro Leu Thr Thr Leu Ile Ala Gly Leu Pro Val Ser Gly 275 280 285 Ile Ile Pro Ala Ala Gly Gly Leu Val Ala Ile Ile Gly Ala Gly Thr 290 295 300 Thr Ser Thr Pro Val Leu Ala Ala Gly Val Pro Gly Gly Thr Leu Ile 305 310 315 320 Ala His Thr Ala Leu Thr Val Gly Thr Thr Gly Ala Ala Gly Thr Thr 325 330 335 Ala Gly Leu Ile Leu Ile Ile Ser Ser Ala Gly Gly Leu Thr Leu Pro 340 345 350 Ala Leu Pro Leu Gly Leu Thr Cys Gly Thr Thr Leu Ala Thr Ala Leu 355 360 365 Gly Gly Leu Ala Pro Thr Ser Ala Pro Thr Ala Ala Leu Ser Gly Pro 370 375 380 Ser Leu Val Leu Ala Leu Pro Ala Ser Thr Pro His Leu Ala Gly Gly 385 390 395 400 Met Ser Val Ala Ala Ala Pro Ile Thr Thr Pro Cys Ile His Thr Ala 405 410 415 Ala Val Gly Leu Ala Gly Gly Leu Leu Thr Val Gly Val Thr Ala Gly 420 425 430 Ala Thr Ala Val Pro Thr Val 435

Claims

1. A sequencing adapter for nanopore sequencing, characterized in that: The sequencing adapter comprises: The adapter top strand comprises a nanopore guide strand and a first linking group arranged along a preset sequencing direction, wherein the nanopore guide strand is used to guide the sequence to be tested to pass through the nanopore sequencing channel; An adapter bottom strand, comprising an adapter complementary strand partially complementary to the nanopore guide strand, the adapter bottom strand further comprising a first sticky end sequence, the first sticky end sequence and the adapter complementary strand being arranged along the sequencing direction; The target connector includes a second connector group that undergoes a click chemistry reaction with the first connector group and a second sticky end sequence that is complementary to the first sticky end sequence, the second connector group and the second sticky end sequence are arranged along the sequencing direction, and the second connector group is used to connect to the sequence to be tested.

2. The sequencing adapter according to claim 1, characterized in that The target linker also includes a transposase recognition sequence linked to the second linking group.

3. The sequencing adapter according to claim 1, characterized in that The target connector further comprises a connection sequence connected to the second connection group, and along a preset sequencing direction, the end of the connection sequence away from the second connection group is provided with a protruding sticky end.

4. The sequencing adapter according to claim 1, characterized in that The target connector also includes a primer corresponding to the upstream or downstream of the sequence to be detected, and the second connecting group is connected to the primer.

5. The sequencing adapter according to claim 4, characterized in that When the target linker includes a primer corresponding to the upstream or downstream of the sequence to be detected, the target linker also includes an impedance polymerase modification located between the second linking group and the primer.

6. The sequencing adapter according to claim 5, characterized in that The impedance polymerase modification is a dspacer modification.

7. The sequencing adapter according to any one of claims 1 to 4, characterized in that One of the first linking group and the second linking group is cyclooctene, and the other is tetrazine.

8. The sequencing adapter according to claim 7, characterized in that The first connecting group is cyclooctene, and the second connecting group is tetrazine.

9. The sequencing adapter according to any one of claims 1 to 4, characterized in that One of the first linking group and the second linking group is diphenylcyclooctyne, and the other is an azide group.

10. The sequencing adapter according to any one of claims 1 to 4, characterized in that The molar amount of the linker top chain is less than the molar amount of the target linker.

11. A method for constructing a library, characterized in that: include: Providing a sequencing adapter according to any one of claims 1 to 10: Connecting the target connector to the sequence to be tested; The first linking group and the second linking group undergo a click chemistry reaction to obtain a sample library.

12. A nanopore library construction kit, characterized in that: The method comprises a sequencing adapter as claimed in any one of claims 1 to 10 and a polynucleotide binding protein.

13. Use of the sequencing adapter according to any one of claims 1 to 10, the method according to claim 11, or the nanopore library construction kit according to claim 12 in characterizing a biopolymer or preparing a product for characterizing a biopolymer.

Images