Aptamers and their uses

Abstract

The present application provides an anti-Ang2 aptamer, a bispecific molecule or composition comprising the anti-Ang2 aptamer, and uses thereof.

Description

Background Art

[0001] Neovascularization (NV) and vascular leakage are hallmarks of multiple neovascular retinal diseases such as diabetic macular edema (DME), wet age-related macular degeneration (AMD), and diabetic retinopathy (DR).

[0002] VEGF plays a key role in regulating angiogenesis, which is the main mechanism of ocular NV, and vascular permeability, which determines the extent of leakage, and is therefore an effective target for various diseases.

[0003] A large number of studies have shown that the Ang2 / Tie2 pathway is an important supplementary factor for VEGF and has great potential as a new target for the treatment of various diseases (such as retinal diseases). It is reported that Tie2 is a tyrosine kinase receptor for both angiopoietin-1 (Ang1) and angiopoietin-2 (Ang2) and is located on the surface of vascular endothelial cells. Ang2 is only expressed under pathological conditions. It complements the function of VEGF by promoting vascular permeability and stimulating the secretion of pro-angiogenic cytokines, which are necessary for VEGF-induced ocular NV and vascular leakage.

[0004] Current anti-VEGF drugs, despite their success, are still limited by their efficacy and duration. Increasing the dose of anti-VEGF agents can improve drug efficacy and duration. Aptamers have high solubility and small molecular weight (~15 kDa), so much higher molar doses can be achieved.

[0005] However, previous anti-VEGF aptamers, such as This potential cannot be realized. Failure to recognize all VEGFA isoforms leads to low efficacy. Therefore, there is an urgent need to develop more effective aptamers than existing technologies.

[0006] There is a need to develop aptamers targeting VEGF and / or Ang2 that have higher specificity, higher affinity and / or are more effective. Summary of the invention

[0007] The present application provides an anti-VEGF aptamer, an anti-Ang2 aptamer, a bispecific aptamer, and a composition comprising an anti-VEGF aptamer and / or an anti-Ang2 aptamer and uses thereof.

[0008] The anti-VEGF aptamers provided in the present application can have at least one of the following properties: 1) bind to all VEGFA isoforms (e.g., VEGF-121, VEGF-165, and VEGF 189) with a K of about 20 nanomolar (nM) or less; Dvalue; 2) forming a specific secondary structure, which comprises, from 5' to 3' direction, a first stem, a first protrusion, a second stem, a second protrusion, a third stem, a third protrusion, a fourth stem and a first loop; 3) formulated at a concentration of up to 200 mg / ml or higher; 4) having nuclease resistance; 5) binding to VEGFA isoforms of different species, such as human VEGFs, mouse VEGFs, rat VEGFs, rabbit VEGFs and monkey VEGFs; 6) inhibiting the interaction between VEGF and VEGF receptor; and 7) preventing, treating and / or ameliorating neovascular diseases, disorders or conditions.

[0009] The anti-Ang2 aptamers provided in the present application can have at least one of the following properties: 1) a K of about 500 picomolar (pM) or less; D 1) binds to Ang2; 2) does not substantially bind to human Ang1; 3) forms a specific secondary structure, which comprises a first stem, a first protrusion, a second stem, a second protrusion, a third stem, a third protrusion, a fourth stem and a first loop from 5' to 3' direction; 4) binds to human Ang2 and mouse Ang2; 5) has nuclease resistance; 6) inhibits the interaction between Ang2 and Tie2; and 7) prevents, treats and / or ameliorates neovascular diseases, disorders or conditions.

[0010] The bispecific aptamers and / or compositions provided herein can have at least one of the following properties: 1) bind to all VEGFA isoforms (e.g., VEGF-121, VEGF-165, and VEGF 189) with a K of about 20 nanomolar (nM) or less; D 2) with a K of about 500 picomolar (pM) or less D value and Ang2; 3) having nuclease resistance; 4) inhibiting the interaction between Ang2 and Tie2; 5) inhibiting the interaction between VEGF and VEGF receptor; and 6) preventing, treating and / or ameliorating neovascular diseases, disorders or conditions.

[0011] Anti-VEGF Aptamer

[0012] In one aspect, the present application provides an anti-VEGF aptamer with a K of about 20 nanomolar (nM) or less. D The values ​​bind to VEGF-121 with a K of approximately 20 nanomolar (nM) or less. D Values ​​for binding to VEGF-165.

[0013] In certain embodiments, the anti-VEGF aptamer has a K of about 2 nanomolar (nM) or less. D In certain embodiments, the anti-VEGF aptamer binds to VEGF-121 with a K of about 2 nanomolar (nM) or less.D Values ​​for binding to VEGF-165.

[0014] In certain embodiments, VEGF-121 is human VEGF-121, mouse VEGF-120, monkey VEGF-121, rabbit VEGF-121 and / or rat VEGF-120. In certain embodiments, VEGF-165 is human VEGF-165, mouse VEGF-164, monkey VEGF-165, rabbit VEGF-165 and / or rat VEGF-164. In certain embodiments, the anti-VEGF aptamer binds to VEGF-189, such as rabbit VEGF-189.

[0015] In certain embodiments, the anti-VEGF aptamer specifically binds to the VEGF receptor binding domain of VEGF-121 or a fragment thereof and the VEGF receptor binding domain of VEGF-165 or a fragment thereof.

[0016] In certain embodiments, the VEGF receptor binding domain of VEGF-121 comprises the amino acid sequence of any one of SEQ ID NOs: 118-122, 128, 129 and 133. In certain embodiments, the VEGF receptor binding domain of VEGF-165 comprises the amino acid sequence of any one of SEQ ID NOs: 118-122, 128 and 129.

[0017] In certain embodiments, the anti-VEGF aptamer inhibits the interaction between VEGF-121 and VEGF-R1. In certain embodiments, the anti-VEGF aptamer inhibits the interaction between VEGF-121 and VEGF-R2.

[0018] In certain embodiments, the anti-VEGF aptamer inhibits the interaction between VEGF-165 and VEGF-R1. In certain embodiments, the anti-VEGF aptamer inhibits the interaction between VEGF-165 and VEGF-R2.

[0019] In certain embodiments, the anti-VEGF aptamers are capable of reducing and / or ameliorating lesions and / or leakage in a laser-induced choroidal neovascularization (CNV) rat model.

[0020] In certain embodiments, the anti-VEGF aptamer is highly soluble.

[0021] In certain embodiments, the anti-VEGF aptamer is an RNA aptamer, a DNA aptamer, or a combination thereof. In certain embodiments, the anti-VEGF aptamer antibody comprises one or more modified nucleotides. In certain embodiments, the anti-VEGF aptamer is nuclease resistant. In certain embodiments, all nucleotides of the anti-VEGF aptamer are modified nucleotides. In certain embodiments, such modified nucleotides include chemical substitutions or modifications at one or more positions independently selected from a ribose position, a deoxyribose position, a phosphate position, and a base position. In certain embodiments, the modified nucleotide includes one or more modifications independently selected from the following: 2'-position sugar modification, 2'-amino (2'-NH2) modification, 2'-fluoro (2'-F) modification, 2'-O-methyl (2'-OMe) modification, 2'-O-(2-methoxyethyl) (2'-O-MOE) modification, 5-position modified pyrimidine, modification at the cytosine exocyclic amine, substitution with 5'-bromouracil, substitution with 5'-bromodeoxyuridine, substitution with 5'-bromodeoxycytidine, backbone modification, locked nucleic acid (LNA), methylation, 3' cap and 5' cap. In certain embodiments, the 5-position modified pyrimidine is selected from 5-carboxy-2'-deoxyuridine, 5-aminoallyl-2'-deoxyuridine, 5-[(3-indolyl)propionamide-N-allyl]-2'-deoxyuridine, 5-carboxy-2'-deoxycytidine, 5-aminoallyl-2'-deoxycytidine, biotin-16-aminoallyl-2'-deoxycytidine, 5-(N-benzylcarboxamide)-2'-deoxyuridine, 5-(N-isobutylcarboxamide)-2'-deoxyuridine, 5-(N-naphthylmethylcarboxamide)-2'-deoxyuridine and 5-(N-tryptophanaminocarboxamide)-2'-deoxyuridine.

[0022] In certain embodiments, the anti-VEGF aptamer comprises at least one 2'-modified nucleotide. In certain embodiments, all nucleotides of the anti-VEGF aptamer are 2'-modified nucleotides. In certain embodiments, the 2'-modified nucleotides are selected from 2'-amino modified nucleotides, 2'-fluoro modified nucleotides, and 2'-O-methyl modified nucleotides and 2'-O-(2-methoxyethyl) modified nucleotides. In certain embodiments, the aptamer comprises at least one 2'-fluoro modified nucleotide, at least one 2'-O-methyl modified nucleotide and / or at least one LNA.

[0023] In certain embodiments, all cytidines of an anti-VEGF aptamer are 2'-modified cytidines. In certain embodiments, all cytidines of an anti-VEGF aptamer are 2'-fluorine-modified cytidines and / or 2'-O-methyl-modified cytidines. In certain embodiments, all cytidines of an anti-VEGF aptamer are 2'-deoxy-2'-fluoro cytidines. In certain embodiments, all uridines of an anti-VEGF aptamer are 2'-modified uridines. In certain embodiments, all uridines of an anti-VEGF aptamer are 2'-fluorine-modified uridines and / or 2'-O-methyl-modified uridines. In certain embodiments, all uridines of an anti-VEGF aptamer are 2'-deoxy-2'-fluoro uridines. In certain embodiments, all adenosines of an anti-VEGF aptamer are 2'-modified adenosines. In certain embodiments, all adenosines of an anti-VEGF aptamer are 2'-fluorine-modified adenosines and / or 2'-O-methyl-modified adenosines. In certain embodiments, all adenosines of an anti-VEGF aptamer are 2'-deoxy-2'-fluoro adenosines. In certain embodiments, all guanosines of the anti-VEGF aptamer are 2'-modified guanosines. In certain embodiments, all guanosines of the anti-VEGF aptamer are 2'-fluoro-modified guanosines and / or 2'-O-methyl-modified guanosines. In certain embodiments, all guanosines of the anti-VEGF aptamer are 2'-deoxy-2'-fluoroguanosines.

[0024] In certain embodiments, all nucleotides of an anti-VEGF aptamer are 2'-fluoro modified nucleotides and / or 2'-O-methyl modified nucleotides.

[0025] In certain embodiments, all nucleotides of an anti-VEGF aptamer are 2'-fluoro modified nucleotides.

[0026] In certain embodiments, the anti-VEGF aptamer does not comprise any naturally occurring nucleotides.

[0027] In certain embodiments, an anti-VEGF aptamer comprises about 10 to about 150 nucleotides.

[0028] In certain embodiments, the anti-VEGF aptamer competes with an anti-VEGF reference nucleic acid aptamer for binding to VEGF-165 and / or VEGF-121, wherein the anti-VEGF reference aptamer comprises a secondary structure comprising, from the 5' to the 3' direction, a first stem, a first protrusion, a second stem, a second protrusion, a third stem, a third protrusion, a fourth stem, and a first loop.

[0029] In certain embodiments, the anti-VEGF reference aptamer comprises a secondary structure consisting of, from 5' to 3' direction, a first stem, a first bulge, a second stem, a second bulge, a third stem, a third bulge, a fourth stem, and a first loop.

[0030] In certain embodiments, the anti-VEGF reference aptamer comprises a first consensus sequence comprising the nucleotide sequence set forth in any one of SEQ ID NOs: 79-90. In certain embodiments, the anti-VEGF reference aptamer comprises a second consensus sequence comprising the nucleotide sequence set forth in any one of SEQ ID NOs: 91-100.

[0031] In certain embodiments, the first consensus sequence is comprised in the nucleotide sequence that forms the first stem, first lug, second stem, second lug, third stem, third lug and / or fourth stem of an anti-VEGF reference aptamer. In certain embodiments, the first consensus sequence is not comprised in the nucleotide sequence that forms the first loop of an anti-VEGF reference aptamer. In certain embodiments, the second consensus sequence is comprised in the nucleotide sequence that forms the first stem, first lug, second stem, second lug, third stem, third lug and / or fourth stem of an anti-VEGF reference aptamer. In certain embodiments, the second consensus sequence is not comprised in the nucleotide sequence that forms the first loop of an anti-VEGF reference aptamer.

[0032] In certain embodiments, the anti-VEGF reference aptamer comprises any one of SEQ ID NOs: 1-62 or a variant or truncated form thereof. In certain embodiments, the variant comprises a nucleotide sequence having at least 50% identity to the nucleotide sequence of any one of SEQ ID NOs: 1-62. In certain embodiments, the variant comprises a nucleotide sequence of any one of SEQ ID NOs: 1-62 having one or more nucleotide additions, deletions and / or substitutions. In certain embodiments, the anti-VEGF reference aptamer comprises about 10 to about 150 nucleotides.

[0033] In certain embodiments, the anti-VEGF reference aptamer comprises a first consensus sequence and a second consensus sequence, and the first consensus sequence is located 5' to the second consensus sequence.

[0034] In certain embodiments, the anti-VEGF reference aptamer comprises a first consensus sequence and a second consensus sequence, and the second consensus sequence is located 5' to the first consensus sequence.

[0035] In certain embodiments, the anti-VEGF aptamer comprises a secondary structure comprising, from the 5' to the 3' direction, a first stem, a first bulge, a second stem, a second bulge, a third stem, a third bulge, a fourth stem, and a first loop. In certain embodiments, the anti-VEGF aptamer comprises a secondary structure consisting, from the 5' to the 3' direction, of a first stem, a first bulge, a second stem, a second bulge, a third stem, a third bulge, a fourth stem, and a first loop.

[0036] In certain embodiments, the anti-VEGF aptamer comprises a first consensus sequence comprising the nucleotide sequence set forth in any one of SEQ ID NOs: 79-90. In certain embodiments, the anti-VEGF aptamer comprises a second consensus sequence comprising the nucleotide sequence set forth in any one of SEQ ID NOs: 91-100.

[0037] In certain embodiments, the first consensus sequence is contained in the nucleotide sequence that forms the first stem, first bulge, second stem, second bulge, third stem, third bulge and / or fourth stem of an anti-VEGF aptamer. In certain embodiments, the first consensus sequence is not contained in the nucleotide sequence that forms the first loop of an anti-VEGF aptamer. In certain embodiments, the second consensus sequence is contained in the nucleotide sequence that forms the first stem, first bulge, second stem, second bulge, third stem, third bulge and / or fourth stem of an anti-VEGF aptamer. In certain embodiments, the second consensus sequence is not contained in the nucleotide sequence that forms the first loop of an anti-VEGF aptamer.

[0038] The first loop of the anti-VEGF reference aptamer or anti-VEGF aptamer described in the present application may contain 2-30 nucleotides.

[0039] In certain embodiments, the anti-VEGF aptamer comprises a nucleotide sequence as shown in any one of SEQ ID NOs: 1-62, or a variant or truncated form thereof. In certain embodiments, the variant comprises a nucleotide sequence having at least 50% identity to a nucleotide sequence as shown in any one of SEQ ID NOs: 1-62. In certain embodiments, the variant comprises a nucleotide sequence as shown in any one of SEQ ID NOs: 1-62, which has one or more nucleotide additions, deletions and / or substitutions.

[0040] In certain embodiments, the anti-VEGF binding protein comprises a first consensus sequence and a second consensus sequence, and the first consensus sequence is located 5' to the second consensus sequence. In certain embodiments, the anti-VEGF aptamer comprises a first consensus sequence and a second consensus sequence, and the second consensus sequence is located 5' to the first consensus sequence.

[0041] In certain embodiments, anti-VEGF aptamers are used to modulate the biological activity of VEGF or a VEGF receptor.

[0042] In certain embodiments, the anti-VEGF aptamer is used to prevent, treat and / or ameliorate a VEGF-related disease, disorder or condition. In certain embodiments, the VEGF-related disease, disorder or condition is a neovascular disease, disorder or condition. In certain embodiments, the VEGF-related disease, disorder or condition is an ocular neovascular disease, disorder or condition. In certain embodiments, the VEGF-related disease, disorder or condition is selected from age-related macular degeneration, choroidal neovascularization, diabetic macular edema, retinal vein occlusion and diabetic retinopathy. In certain embodiments, the VEGF-related disease, disorder or condition is selected from wet age-related macular degeneration, myopic choroidal neovascularization and proliferative diabetic retinopathy.

[0043] In one aspect, the present application provides an anti-VEGF agent comprising an anti-VEGF aptamer as described herein. In certain embodiments, the anti-VEGF agent further comprises a polyethylene glycol (PEG) moiety. In certain embodiments, the PEG moiety is conjugated to the 5' end of the aptamer.

[0044] In one aspect, the present application provides a composition comprising the anti-VEGF aptamer or anti-VEGF agent described herein.

[0045] In certain embodiments, the composition is a pharmaceutical composition. In certain embodiments, the composition comprises a pharmaceutically acceptable excipient or carrier. In certain embodiments, the composition comprises a therapeutically effective amount of an anti-VEGF aptamer or anti-VEGF agent.

[0046] In one aspect, the present application provides a method for modulating the biological activity of VEGF and / or VEGF receptor, comprising administering an effective amount of the anti-VEGF aptamer or anti-VEGF agent described herein to a subject in need thereof.

[0047] On the one hand, the present application provides a method for preventing, treating and / or ameliorating VEGF-related diseases, disorders or conditions, comprising administering an effective amount of an anti-VEGF aptamer or anti-VEGF agent described herein to a subject in need thereof. In certain embodiments, the VEGF-related disease, disorder or condition is a neovascular disease, disorder or condition. In certain embodiments, the VEGF-related disease, disorder or condition is an ocular neovascular disease, disorder or condition. In certain embodiments, the VEGF-related disease, disorder or condition is selected from age-related macular degeneration, choroidal neovascularization, diabetic macular edema, retinal vein occlusion and diabetic retinopathy. In certain embodiments, the VEGF-related disease, disorder or condition is selected from wet age-related macular degeneration, myopic choroidal neovascularization and proliferative diabetic retinopathy.

[0048] In one aspect, the present application provides use of the anti-VEGF antibody or anti-VEGF agent described herein in the preparation of an agent for regulating the biological activity of VEGF or VEGF receptor.

[0049] On the one hand, the present application provides the use of the anti-VEGF aptamer or anti-VEGF agent described in the present application in the preparation of a medicament for preventing, treating and / or ameliorating VEGF-related diseases, disorders or conditions. In certain embodiments, the VEGF-related disease, disorder or condition is a neovascular disease, disorder or condition. In certain embodiments, the VEGF-related disease, disorder or condition is an ocular neovascular disease, disorder or condition. In certain embodiments, the VEGF-related disease, disorder or condition is selected from age-related macular degeneration, choroidal neovascularization, diabetic macular edema, retinal vein occlusion and diabetic retinopathy. In certain embodiments, the VEGF-related disease, disorder or condition is selected from wet age-related macular degeneration, myopic choroidal neovascularization and proliferative diabetic retinopathy.

[0050] Anti-Ang2 Aptamer

[0051] In one aspect, the present application provides an anti-Ang2 aptamer having a K of about 500 picomolar (pM) or less. D Value for binding to Ang2.

[0052] In certain embodiments, the anti-Ang2 aptamer has a K of about 100 picomolar (pM) or less. D Value for binding to Ang2.

[0053] In certain embodiments, Ang2 is human Ang2, mouse Ang2, monkey Ang2, rabbit Ang2 and / or rat Ang2.

[0054] In certain embodiments, the anti-Ang2 aptamer does not substantially bind to human Ang1.

[0055] In certain embodiments, the anti-Ang2 aptamer inhibits the interaction between Ang2 and Tie2.

[0056] In certain embodiments, the anti-Ang2 aptamer is capable of reducing neovascularization and / or decreasing vascular permeability in a mouse oxygen-induced ischemic retinopathy (OIR) model.

[0057] In certain embodiments, the anti-Ang2 aptamer is highly soluble.

[0058] In certain embodiments, the anti-Ang2 aptamer is an RNA aptamer, a DNA aptamer or a combination thereof. In certain embodiments, the anti-Ang2 aptamer comprises one or more modified nucleotides. In certain embodiments, the anti-Ang2 aptamer is nuclease resistant. In certain embodiments, all nucleotides of the anti-Ang2 aptamer are modified nucleotides. In certain embodiments, the modified nucleotide comprises a chemical substitution or modification at one or more positions independently selected from a ribose position, a deoxyribose position, a phosphate position and a base position. In certain embodiments, the modified nucleotide includes one or more independently selected from 2'-position sugar modification, 2'-amino (2'-NH2) modification, 2'-fluoro (2'-F) modification, 2'-O-methyl (2'-OMe) modification, 2'-O-(2-methoxyethyl) (2'-O-MOE) modification, 5-position modified pyrimidine, modification at the cytosine exocyclic amine, substitution with 5'-bromouracil, substitution with 5'-bromodeoxyuridine, substitution with 5'-bromodeoxycytidine, backbone modification, locked nucleic acid (LNA), methylation, 3' cap and 5' cap. In some embodiments, the 5-position modified pyrimidine is selected from 5-carboxy-2'-deoxyuridine, 5-aminoallyl-2'-deoxyuridine, 5-[(3-indolyl)propionamide-N-allyl]-2'-deoxyuridine, 5-carboxy-2'-deoxycytidine, 5-aminoallyl-2'-deoxycytidine, biotin-16-aminoallyl-2'-deoxycytidine, 5-(N-benzylcarboxamide)-2'-deoxyuridine, 5-(N-isobutylcarboxamide)-2'-deoxyuridine, 5-(N-naphthylmethylcarboxamide)-2'-deoxyuridine and 5-(N-tryptophanaminocarboxamide)-2'-deoxyuridine.

[0059] In certain embodiments, the anti-Ang2 aptamer comprises at least one 2'-modified nucleotide. In certain embodiments, all nucleotides of the anti-Ang2 aptamer are 2'-modified nucleotides. In certain embodiments, the 2'-modified nucleotides are selected from 2'-amino modified nucleotides, 2'-fluoro modified nucleotides, 2'-O-methyl modified nucleotides and 2'-O-methoxy modified nucleotides.

[0060] In certain embodiments, the anti-Ang2 aptamer comprises at least one 2'-fluoro modified nucleotide, at least one 2'-O-methyl modified nucleotide and / or at least one LNA. In certain embodiments, all cytidines of the anti-Ang2 aptamer are 2'-modified cytidines. In certain embodiments, all cytidines of the anti-Ang2 aptamer are 2'-fluoro modified cytidines and / or 2'-O-methyl modified cytidines. In certain embodiments, all cytidines of the anti-Ang2 aptamer are 2'-deoxy-2'-fluoro cytidines. In certain embodiments, all uridines of the anti-Ang2 aptamer are 2'-modified uridines. In certain embodiments, all uridines of the anti-Ang2 aptamer are 2'-fluoro modified uridines and / or 2'-O-methyl modified uridines. In certain embodiments, all uridines of the anti-Ang2 aptamer are 2'-deoxy-2'-fluoro uridines. In certain embodiments, all adenosines of the anti-Ang2 aptamer are 2'-modified adenosines. In certain embodiments, all adenosines of the anti-Ang2 aptamer are 2'-fluoro-modified adenosines and / or 2'-O-methyl-modified adenosines. In certain embodiments, all adenosines of the anti-Ang2 aptamer are 2'-deoxy-2'-fluoro adenosines. In certain embodiments, all guanosines of the anti-Ang2 aptamer are 2'-modified guanosines. In certain embodiments, all guanosines of the anti-Ang2 aptamer are 2'-fluoro-modified guanosines and / or 2'-O-methyl-modified guanosines. In certain embodiments, all guanosines of the anti-Ang2 aptamer are 2'-deoxy-2'-fluoro guanosines. In certain embodiments, all nucleotides of the anti-Ang2 aptamer are 2'-fluoro-modified nucleotides and / or 2'-O-methyl-modified nucleotides. In certain embodiments, all nucleotides of the anti-Ang2 aptamer are 2'-fluoro-modified nucleotides.

[0061] In certain embodiments, the anti-Ang2 aptamer does not comprise any natural nucleotides. In certain embodiments, the anti-Ang2 aptamer comprises about 10 to about 150 nucleotides.

[0062] In certain embodiments, the anti-Ang2 aptamer competes with an anti-Ang2 reference aptamer for binding to Ang2, wherein the anti-Ang2 reference aptamer comprises a secondary structure comprising, from 5' to 3' direction, a first stem, a first protrusion, a second stem, a second protrusion, a third stem, a third protrusion, a fourth stem, and a first loop.

[0063] In certain embodiments, the anti-Ang2 reference aptamer comprises a secondary structure consisting of, from 5' to 3' direction, a first stem, a first bulge, a second stem, a second bulge, a third stem, a third bulge, a fourth stem, and a first loop.

[0064] In some embodiments, the anti-Ang2 reference aptamer comprises a first consensus sequence, the first consensus sequence comprising the nucleotide sequence shown in any one of SEQ ID NOs: 101-108. In some embodiments, the anti-Ang2 reference aptamer comprises a second consensus sequence, the second consensus sequence comprising the nucleotide sequence shown in any one of SEQ ID NOs: 109-116.

[0065] In certain embodiments, the first consensus sequence is comprised in the nucleotide sequence forming the first protrusion, the second stem, the second protrusion, the third stem, the third protrusion and / or the fourth stem of the anti-Ang2 reference aptamer. In certain embodiments, the first consensus sequence is not comprised in the nucleotide sequence forming the first loop of the anti-Ang2 reference aptamer.

[0066] In certain embodiments, the second consensus sequence is comprised in the nucleotide sequence forming the first protrusion, the second stem, the second protrusion, the third stem, the third protrusion and / or the fourth stem of the anti-Ang2 reference aptamer. In certain embodiments, the second consensus sequence is not comprised in the nucleotide sequence forming the first loop of the anti-Ang2 reference aptamer.

[0067] In certain embodiments, the anti-Ang2 reference aptamer comprises a nucleotide sequence as shown in any one of SEQ ID NOs: 63-74, or a variant or truncated form thereof. In certain embodiments, the variant comprises a nucleotide sequence having at least 50% identity with the nucleotide sequence as shown in any one of SEQ ID NOs: 63-74. In certain embodiments, the variant comprises a nucleotide sequence as shown in any one of SEQ ID NOs: 63-74, which has one or more nucleotide additions, deletions and / or substitutions. In certain embodiments, the anti-Ang2 reference aptamer comprises about 10 to about 150 nucleotides.

[0068] In certain embodiments, the anti-Ang2 reference aptamer comprises a first consensus sequence and a second consensus sequence, and the first consensus sequence is located at the 5′ end of the second consensus sequence.

[0069] In certain embodiments, the anti-Ang2 aptamer comprises a secondary structure, which comprises, from 5' to 3' direction, a first stem, a first protrusion, a second stem, a second protrusion, a third stem, a third protrusion, a fourth stem, and a first loop. In certain embodiments, the anti-Ang2 aptamer comprises a secondary structure, which consists, from 5' to 3' direction, of a first stem, a first protrusion, a second stem, a second protrusion, a third stem, a third protrusion, a fourth stem, and a first loop.

[0070] In certain embodiments, the anti-Ang2 aptamer comprises a first consensus sequence comprising a nucleotide sequence as shown in any one of SEQ ID NOs: 101-108. In certain embodiments, the anti-Ang2 aptamer comprises a second consensus sequence comprising a nucleotide sequence as shown in any one of SEQ ID NOs: 109-116.

[0071] In certain embodiments, the first consensus sequence is included in the nucleotide sequence that forms the first protrusion, the second stem, the second protrusion, the third stem, the third protrusion and / or the fourth stem of the anti-Ang2 aptamer. In certain embodiments, the first consensus sequence is not included in the nucleotide sequence that forms the first loop of the anti-Ang2 aptamer. In certain embodiments, the second consensus sequence is included in the nucleotide sequence that forms the first protrusion, the second stem, the second protrusion, the third stem, the third protrusion and / or the fourth stem of the anti-Ang2 aptamer. In certain embodiments, the second consensus sequence is not included in the nucleotide sequence that forms the first loop of the anti-Ang2 aptamer.

[0072] The first loop of the anti-Ang2 reference aptamer or the anti-Ang2 aptamer described in the present application may contain 2-30 nucleotides.

[0073] In certain embodiments, the anti-Ang2 aptamer comprises a nucleotide sequence as shown in any one of SEQ ID NOs: 63-74, or a variant or truncated form thereof. In certain embodiments, the variant comprises a nucleotide sequence having at least 50% identity to the nucleotide sequence as shown in any one of SEQ ID NOs: 63-74. In certain embodiments, the variant comprises a nucleotide sequence as shown in any one of SEQ ID NOs: 63-74, which has one or more nucleotide additions, deletions and / or substitutions.

[0074] In certain embodiments, the anti-Ang2 aptamer comprises a first consensus sequence and a second consensus sequence, and the first consensus sequence is located 5' to the second consensus sequence.

[0075] In certain embodiments, the anti-Ang2 aptamer comprises a first consensus sequence and a second consensus sequence, and the second consensus sequence is located 5' to the first consensus sequence.

[0076] In certain embodiments, anti-Ang2 aptamers are used to modulate the biological activity of Ang2 or Tie2.

[0077] In certain embodiments, the anti-Ang2 aptamer is used to prevent, treat and / or ameliorate an Ang2-related disease, disorder or condition. In certain embodiments, the Ang2-related disease, disorder or condition is a neovascular disease, disorder or condition. In certain embodiments, the Ang2-related disease, disorder or condition is an ocular neovascular disease, disorder or condition. In certain embodiments, the Ang2-related disease, disorder or condition is selected from age-related macular degeneration, choroidal neovascularization, diabetic macular edema, retinal vein occlusion and diabetic retinopathy. In certain embodiments, the Ang2-related disease, disorder or condition is selected from age-related macular degeneration, choroidal neovascularization, diabetic macular edema, retinal vein occlusion and diabetic retinopathy.

[0078] In one aspect, the present application provides an anti-Ang2 agent comprising the anti-Ang2 aptamer described herein. In certain embodiments, the anti-Ang2 agent further comprises a polyethylene glycol (PEG) moiety. In certain embodiments, the PEG moiety is conjugated to the 3' end of the anti-Ang2 aptamer.

[0079] In one aspect, the present application provides a composition comprising the anti-Ang2 aptamer or anti-Ang2 agent described herein.

[0080] In certain embodiments, the composition is a pharmaceutical composition. In certain embodiments, the composition comprises a pharmaceutically acceptable excipient or carrier. In certain embodiments, the composition comprises an effective amount of an anti-Ang2 aptamer or anti-Ang2 agent.

[0081] In certain embodiments, the composition further comprises an anti-VEGF agent. In certain embodiments, the anti-VEGF agent comprises aflibercept.

[0082] In one aspect, the present application provides a method for modulating the biological activity of Ang2 or Tie2, comprising administering an effective amount of the anti-Ang2 aptamer or anti-Ang2 agent described herein to a subject in need thereof.

[0083] In one aspect, the present application provides a method for preventing, treating and / or ameliorating Ang2-related diseases, disorders or conditions, comprising administering an effective amount of the anti-Ang2 aptamer or anti-Ang2 agent described herein to a subject in need thereof.

[0084] In certain embodiments, the Ang2-related disease, disorder or condition is a neovascular disease, disorder or condition. In certain embodiments, the Ang2-related disease, disorder or condition is selected from age-related macular degeneration, choroidal neovascularization, diabetic macular edema, retinal vein occlusion and diabetic retinopathy. In certain embodiments, the Ang2-related disease, disorder or condition is selected from wet age-related macular degeneration, myopic choroidal neovascularization and proliferative diabetic retinopathy. In certain embodiments, the method further comprises administering an anti-VEGF agent to the subject. In certain embodiments, the anti-VEGF agent comprises aflibercept.

[0085] In one aspect, the present application provides use of the anti-Ang2 aptamer or anti-Ang2 agent described herein in the preparation of an agent for regulating the biological activity of Ang2 or Tie2.

[0086] In one aspect, the present application provides use of the anti-Ang2 aptamer or anti-Ang2 agent described herein in the preparation of a medicament for preventing, treating and / or ameliorating Ang2-related diseases, disorders or conditions.

[0087] In certain embodiments, the Ang2-related disease, disorder or condition is a neovascular disease, disorder or condition. In certain embodiments, the Ang2-related disease, disorder or condition is an ocular neovascular disease, disorder or condition. In certain embodiments, the Ang2-related disease, disorder or condition is selected from age-related macular degeneration, choroidal neovascularization, diabetic macular edema, retinal vein occlusion and diabetic retinopathy. In certain embodiments, the Ang2-related disease, disorder or condition is selected from wet age-related macular degeneration, myopic choroidal neovascularization and proliferative diabetic retinopathy.

[0088] In one aspect, the present application provides a combination of 1) an anti-Ang2 aptamer or anti-Ang2 agent described herein and 2) an anti-VEGF agent in the preparation of a medicament for preventing, treating and / or ameliorating a neovascular disease, disorder or condition. In certain embodiments, the anti-VEGF agent comprises aflibercept. In certain embodiments, the neovascular disease or disorder is an ocular neovascular disease, disorder or condition. In certain embodiments, the neovascular disease, disorder or condition is selected from age-related macular degeneration, choroidal neovascularization, diabetic macular edema, retinal vein occlusion and diabetic retinopathy. In certain embodiments, the neovascular disease, disorder or condition is selected from wet age-related macular degeneration, myopic choroidal neovascularization and proliferative diabetic retinopathy.

[0089] Bispecific Aptamers

[0090] In another aspect, the present application provides a bispecific aptamer, which comprises an anti-Ang2 aptamer and an anti-VEGF aptamer. The bispecific aptamer may be included in the composition described in the present application.

[0091] In certain embodiments, the anti-VEGF aptamer has a K of about 20 nanomolar (nM) or less. D values ​​bind to VEGF-121, and with a K of about 20 nanomolar (nM) or less D Values ​​for binding to VEGF-165.

[0092] In certain embodiments, the anti-Ang2 aptamer has a K of about 500 picomolar (pM) or less. D The value specifically binds to Ang2.

[0093] In certain embodiments, the anti-VEGF aptamer has a K of about 2 nanomolar (nM) or less. D In certain embodiments, the anti-VEGF aptamer binds to VEGF-121 with a K of about 2 nanomolar (nM) or less. D Values ​​for binding to VEGF-165.

[0094] In certain embodiments, VEGF-121 is human VEGF-121, mouse VEGF-120, monkey VEGF-121, rabbit VEGF-121 and / or rat VEGF-120. In certain embodiments, VEGF-165 is human VEGF-165, mouse VEGF-164, monkey VEGF-165, rabbit VEGF-165 or rat VEGF-164.

[0095] In certain embodiments, the anti-VEGF aptamer specifically binds to both the VEGF receptor binding domain of VEGF-121 and the VEGF receptor binding domain of VEGF-165.

[0096] In certain embodiments, the VEGF receptor binding domain of VEGF-121 comprises the amino acid sequence shown in any one of SEQ ID NOs: 118-122, 128, 129 and 133. In certain embodiments, the VEGF receptor binding domain of VEGF-165 comprises the amino acid sequence shown in any one of SEQ ID NOs: 118-122, 128 and 129.

[0097] In certain embodiments, the anti-VEGF aptamer inhibits the interaction between VEGF-121 and VEGF-R1. In certain embodiments, the anti-VEGF aptamer inhibits the interaction between VEGF-121 and VEGF-R2. In certain embodiments, the anti-VEGF aptamer inhibits the interaction between VEGF-165 and VEGF-R1. In certain embodiments, the anti-VEGF aptamer inhibits the interaction between VEGF-165 and VEGF-R2.

[0098] In certain embodiments, the anti-VEGF aptamer is capable of reducing and / or ameliorating lesions and / or leakage in a laser-induced choroidal neovascularization (CNV) rat model.

[0099] In certain embodiments, the anti-VEGF aptamer is highly soluble.

[0100] In certain embodiments, the anti-VEGF aptamer is an RNA aptamer, a DNA aptamer, or a combination thereof. In certain embodiments, the anti-VEGF aptamer is nuclease resistant. In certain embodiments, the anti-VEGF aptamer comprises one or more modified nucleotides. In certain embodiments, all nucleotides of the anti-VEGF aptamer are modified nucleotides. In certain embodiments, the modified nucleotide comprises a chemical substitution or modification at one or more positions independently selected from a ribose position, a deoxyribose position, a phosphate position, and a base position. In certain embodiments, the modified nucleotide includes one or more independently selected from 2'-position sugar modification, 2'-amino (2'-NH2) modification, 2'-fluoro (2'-F) modification, 2'-O-methyl (2'-OMe) modification, 2'-O-(2-methoxyethyl) (2'-O-MOE) modification, 5-position modified pyrimidine, modification at the cytosine exocyclic amine, substitution with 5'-bromouracil, substitution with 5'-bromodeoxyuridine, substitution with 5'-bromodeoxycytidine, backbone modification, locked nucleic acid (LNA), methylation, 3' cap and 5' cap. In some embodiments, the 5-position modified pyrimidine is selected from 5-carboxy-2'-deoxyuridine, 5-aminoallyl-2'-deoxyuridine, 5-[(3-indolyl)propionamide-N-allyl]-2'-deoxyuridine, 5-carboxy-2'-deoxycytidine, 5-aminoallyl-2'-deoxycytidine, biotin-16-aminoallyl-2'-deoxycytidine, 5-(N-benzylcarboxamide)-2'-deoxyuridine, 5-(N-isobutylcarboxamide)-2'-deoxyuridine, 5-(N-naphthylmethylcarboxamide)-2'-deoxyuridine and 5-(N-tryptaminecarboxamide)-2'-deoxyuridine.

[0101] In certain embodiments, the anti-VEGF aptamer comprises at least one 2'-modified nucleotide. In certain embodiments, all nucleotides of the anti-VEGF aptamer are 2'-modified nucleotides. In certain embodiments, the 2'-modified nucleotides are selected from 2'-amino modified nucleotides, 2'-fluoro modified nucleotides, 2'-O-methyl modified nucleotides and 2'-O-(2-methoxyethyl) modified nucleotides. In certain embodiments, the anti-VEGF aptamer comprises at least one 2'-fluoro modified nucleotide. In certain embodiments, the anti-VEGF aptamer comprises at least one 2'-fluoro modified nucleotide, at least one 2'-O-methyl modified nucleotide and / or at least one LNA.

[0102] In certain embodiments, all cytidines of an anti-VEGF aptamer are 2'-modified cytidines. In certain embodiments, all cytidines of an anti-VEGF aptamer are 2'-fluorine-modified cytidines and / or 2'-O-methyl-modified cytidines. In certain embodiments, all cytidines of an anti-VEGF aptamer are 2'-deoxy-2'-fluoro cytidines. In certain embodiments, all uridines of an anti-VEGF aptamer are 2'-modified uridines. In certain embodiments, all uridines of an anti-VEGF aptamer are 2'-fluorine-modified uridines and / or 2'-O-methyl-modified uridines. In certain embodiments, all uridines of an anti-VEGF aptamer are 2'-deoxy-2'-fluoro uridines. In certain embodiments, all adenosines of an anti-VEGF aptamer are 2'-modified adenosines. In certain embodiments, all adenosines of an anti-VEGF aptamer are 2'-fluorine-modified adenosines and / or 2'-O-methyl-modified adenosines. In certain embodiments, all adenosines of an anti-VEGF aptamer are 2'-deoxy-2'-fluoro adenosines. In certain embodiments, all guanosines are 2'-modified guanosines. In certain embodiments, all guanosines of the anti-VEGF aptamer are 2'-fluoro-modified guanosines and / or 2'-O-methyl-modified guanosines. In certain embodiments, all guanosines of the anti-VEGF aptamer are 2'-deoxy-2'-fluoroguanosines.

[0103] In certain embodiments, all nucleotides of an anti-VEGF aptamer are 2'-fluoro modified nucleotides and / or 2'-O-methyl modified nucleotides.

[0104] In certain embodiments, all nucleotides of an anti-VEGF aptamer are 2'-fluoro modified nucleotides.

[0105] In certain embodiments, the anti-VEGF aptamer does not comprise any naturally occurring nucleotides.

[0106] In certain embodiments, an anti-VEGF aptamer comprises about 10 to about 150 nucleotides.

[0107] In certain embodiments, the anti-VEGF aptamer competes with an anti-VEGF reference aptamer for binding to VEGF-165 and / or VEGF-121, and the anti-VEGF reference aptamer comprises a secondary structure comprising, from 5' to 3' direction, a first stem, a first bulge, a second stem, a second bulge, a third stem, a third bulge, a fourth stem, and a first loop.

[0108] In certain embodiments, the anti-VEGF reference aptamer comprises a secondary structure consisting of, from 5' to 3' direction, a first stem, a first bulge, a second stem, a second bulge, a third stem, a third bulge, a fourth stem, and a first loop.

[0109] In certain embodiments, the anti-VEGF reference aptamer comprises a first consensus sequence comprising a nucleotide sequence having at least 50% identity to the nucleotide sequence set forth in any one of SEQ ID NOs: 79-90. In certain embodiments, the anti-VEGF reference aptamer comprises a second consensus sequence comprising a nucleotide sequence having at least 50% identity to the nucleotide sequence set forth in any one of SEQ ID NOs: 91-100.

[0110] In certain embodiments, the first consensus sequence is comprised in the nucleotide sequence that forms the first stem, first lug, second stem, second lug, third stem, third lug and / or fourth stem of an anti-VEGF reference aptamer. In certain embodiments, the first consensus sequence is not comprised in the nucleotide sequence that forms the first loop of an anti-VEGF reference aptamer. In certain embodiments, the second consensus sequence is comprised in the nucleotide sequence that forms the first stem, first lug, second stem, second lug, third stem, third lug and / or fourth stem of an anti-VEGF reference aptamer. In certain embodiments, the second consensus sequence is not comprised in the nucleotide sequence that forms the first loop of an anti-VEGF reference aptamer.

[0111] In certain embodiments, the anti-VEGF reference aptamer comprises a nucleotide sequence as set forth in any one of SEQ ID NOs: 1-62, or a variant or truncated form thereof. In certain embodiments, the variant comprises a nucleotide sequence having at least 50% identity to a nucleotide sequence as set forth in any one of SEQ ID NOs: 1-62. In certain embodiments, the variant comprises a nucleotide sequence as set forth in any one of SEQ ID NOs: 1-62 having one or more nucleotide additions, deletions and / or substitutions. In certain embodiments, the anti-VEGF reference aptamer comprises about 10 to about 150 nucleotides.

[0112] In certain embodiments, the anti-VEGF reference aptamer comprises a first consensus sequence and a second consensus sequence, and the first consensus sequence is located 5' to the second consensus sequence.

[0113] In certain embodiments, the anti-VEGF reference aptamer comprises a first consensus sequence and a second consensus sequence, wherein the second consensus sequence is located 5' to the first consensus sequence.

[0114] In certain embodiments, the anti-VEGF aptamer comprises a secondary structure, which comprises, from 5' to 3' direction, a first stem, a first protrusion, a second stem, a second protrusion, a third stem, a third protrusion, a fourth stem, and a first loop. In certain embodiments, the anti-VEGF aptamer comprises a secondary structure, which consists, from 5' to 3' direction, of a first stem, a first protrusion, a second stem, a second protrusion, a third stem, a third protrusion, a fourth stem, and a first loop.

[0115] In certain embodiments, the anti-VEGF aptamer comprises a first consensus sequence comprising the nucleotide sequence set forth in any one of SEQ ID NOs: 79-90. In certain embodiments, the anti-VEGF aptamer comprises a second consensus sequence comprising the nucleotide sequence set forth in any one of SEQ ID NOs: 91-100.

[0116] In certain embodiments, the first consensus sequence is contained in the nucleotide sequence that forms the first stem, first bulge, second stem, second bulge, third stem, third bulge and / or fourth stem of an anti-VEGF aptamer. In certain embodiments, the first consensus sequence is not contained in the nucleotide sequence that forms the first loop of an anti-VEGF aptamer. In certain embodiments, the second consensus sequence is contained in the nucleotide sequence that forms the first stem, first bulge, second stem, second bulge, third stem, third bulge and / or fourth stem of an anti-VEGF aptamer. In certain embodiments, the second consensus sequence is not contained in the nucleotide sequence that forms the first loop of an anti-VEGF aptamer.

[0117] In certain embodiments, the anti-VEGF aptamer comprises a nucleotide sequence as shown in any one of SEQ ID NOs: 1-62, or a variant or truncated form thereof. In certain embodiments, the variant comprises a nucleotide sequence having at least 50% identity to a nucleotide sequence as shown in any one of SEQ ID NOs: 1-62. In certain embodiments, the variant comprises a nucleotide sequence as shown in any one of SEQ ID NOs: 1-62, which has one or more nucleotide additions, deletions and / or substitutions.

[0118] In certain embodiments, the anti-VEGF aptamer comprises a first consensus sequence and a second consensus sequence, and the first consensus sequence is located 5' to the second consensus sequence.

[0119] In certain embodiments, the anti-VEGF aptamer comprises a first consensus sequence and a second consensus sequence, and the second consensus sequence is located at the 5' end of the consensus sequence.

[0120] In certain embodiments, the anti-Ang2 aptamer has a K of about 100 picomolar (pM) or less. D Value for binding to Ang2.

[0121] In certain embodiments, Ang2 is human Ang2, mouse Ang2, monkey Ang2, rabbit Ang2 and / or rat Ang2.

[0122] In certain embodiments, the anti-Ang2 aptamer does not substantially bind to human Ang1.

[0123] In certain embodiments, the anti-Ang2 aptamer inhibits the interaction between Ang2 and Tie2.

[0124] In certain embodiments, the anti-Ang2 aptamer is capable of reducing neovascularization and / or decreasing vascular permeability in a mouse oxygen-induced ischemic retinopathy (OIR) model.

[0125] In certain embodiments, the anti-Ang2 aptamer is highly soluble.

[0126] In certain embodiments, the anti-Ang2 aptamer is an RNA aptamer, a DNA aptamer or a combination thereof. In certain embodiments, the anti-Ang2 aptamer comprises one or more modified nucleotides. In certain embodiments, the anti-Ang2 aptamer is nuclease resistant. In certain embodiments, all nucleotides of the anti-Ang2 aptamer are modified nucleotides. In certain embodiments, the modified nucleotide comprises a chemical substitution or modification at one or more positions independently selected from a ribose position, a deoxyribose position, a phosphate position and a base position. In certain embodiments, the modified nucleotides include one or more independently selected from 2'-sugar modification, 2'-amino (2'-NH2) modification, 2'-fluoro (2'-F) modification, 2'-O-methyl (2'-OMe) modification, 2'-O-(2-methoxyethyl) (2'-O-MOE) modification, 5-modified pyrimidine, modification at the amine outside the cytosine ring, substitution with 5'-bromouracil, substitution with 5'-bromodeoxyuridine, substitution with 5'-bromodeoxycytidine, backbone modification, locked nucleic acid (LNA), methylation, 3' cap and 5' cap. In certain embodiments, the 5-position modified pyrimidine is selected from 5-carboxy-2'-deoxyuridine, 5-aminoallyl-2'-deoxyuridine, 5-[(3-indolyl)propionamide-N-allyl]-2'-deoxyuridine, 5-carboxy-2'-deoxycytidine, 5-aminoallyl-2'-deoxycytidine, biotin-16-aminoallyl-2'-deoxycytidine, 5-(N-benzylcarboxamide)-2'-deoxyuridine, 5-(N-isobutylcarboxamide)-2'-deoxyuridine, 5-(N-naphthylmethylcarboxamide)-2'-deoxyuridine and 5-(N-tryptaminecarboxamide)-2'-deoxyuridine.

[0127] In certain embodiments, the anti-Ang2 aptamer comprises at least one 2'-modified nucleotide. In certain embodiments, all nucleotides of the anti-Ang2 aptamer are 2'-modified nucleotides. In certain embodiments, the 2'-modified nucleotides are selected from 2'-amino modified nucleotides, 2'-fluoro modified nucleotides, 2'-O-methyl modified nucleotides and 2'-O-(2-methoxyethyl) modified nucleotides. In certain embodiments, the anti-Ang2 aptamer comprises at least one 2'-fluoro modified nucleotide, at least one 2'-O-methyl modified nucleotide and / or at least one LNA.

[0128] In certain embodiments, the anti-Ang2 aptamer comprises at least one 2'-fluoro modified nucleotide. In certain embodiments, all cytidines of the anti-Ang2 aptamer are 2'-modified cytidines. In certain embodiments, all cytidines of the anti-Ang2 aptamer are 2'-fluoro modified cytidines and / or 2'-O-methyl modified cytidines. In certain embodiments, all cytidines of the anti-Ang2 aptamer are 2'-deoxy-2'-fluoro cytidines. In certain embodiments, all uridines of the anti-Ang2 aptamer are 2'-modified uridines. In certain embodiments, all uridines of the anti-Ang2 aptamer are 2'-fluoro modified uridines and / or 2'-O-methyl modified uridines. In certain embodiments, all uridines of the anti-Ang2 aptamer are 2'-deoxy-2'-fluoro uridines. In certain embodiments, all adenosines of the anti-Ang2 aptamer are 2'-modified adenosines. In certain embodiments, all adenosines of the anti-Ang2 aptamer are 2'-fluoro modified adenosines and / or 2'-O-methyl modified adenosines. In certain embodiments, all adenosines of the anti-Ang2 aptamer are 2'-deoxy-2'-fluoro adenosine. In certain embodiments, all guanosines of the anti-Ang2 aptamer are 2'-modified guanosines. In certain embodiments, all guanosines of the anti-Ang2 aptamer are 2'-fluoro modified guanosines and / or 2'-O-methyl modified guanosines. In certain embodiments, all guanosines of the anti-Ang2 aptamer are 2'-deoxy-2'-fluoro guanosines. In certain embodiments, all nucleotides of the anti-Ang2 aptamer are 2'-fluoro modified nucleotides. In certain embodiments, all nucleotides of the anti-Ang2 aptamer are 2'-fluoro modified nucleotides and / or 2'-O-methyl modified nucleotides.

[0129] In certain embodiments, the anti-Ang2 aptamer does not comprise any natural nucleotides. In certain embodiments, the anti-Ang2 aptamer comprises about 10 to about 150 nucleotides.

[0130] In certain embodiments, the anti-Ang2 aptamer competes with an anti-Ang2 reference aptamer for binding to Ang2, wherein the anti-Ang2 reference aptamer comprises a secondary structure comprising, from 5' to 3' direction, a first stem, a first protrusion, a second stem, a second protrusion, a third stem, a third protrusion, a fourth stem, and a first loop.

[0131] In certain embodiments, the anti-Ang2 reference aptamer comprises a secondary structure consisting of, from 5' to 3' direction, a first stem, a first bulge, a second stem, a second bulge, a third stem, a third bulge, a fourth stem, and a first loop.

[0132] In some embodiments, the anti-Ang2 reference aptamer comprises a first consensus sequence, the first consensus sequence comprising the nucleotide sequence shown in any one of SEQ ID NOs: 101-108. In some embodiments, the anti-Ang2 reference aptamer comprises a second consensus sequence, the second consensus sequence comprising the nucleotide sequence shown in any one of SEQ ID NOs: 109-116.

[0133] In certain embodiments, the first consensus sequence is comprised in the nucleotide sequence forming the first protrusion, the second stem, the second protrusion, the third stem, the third protrusion and / or the fourth stem of the anti-Ang2 reference aptamer. In certain embodiments, the first consensus sequence is not comprised in the nucleotide sequence forming the first loop of the anti-Ang2 reference aptamer.

[0134] In certain embodiments, the second consensus sequence is comprised in the nucleotide sequence forming the first protrusion, the second stem, the second protrusion, the third stem, the third protrusion and / or the fourth stem of the anti-Ang2 reference aptamer. In certain embodiments, the second consensus sequence is not comprised in the nucleotide sequence forming the first loop of the anti-Ang2 reference aptamer.

[0135] In certain embodiments, the anti-Ang2 reference aptamer comprises a nucleotide sequence as shown in any one of SEQ ID NOs: 63-74, or a variant or truncated form thereof. In certain embodiments, the variant comprises a nucleotide sequence having at least 50% identity with the nucleotide sequence as shown in any one of SEQ ID NOs: 63-74. In certain embodiments, the variant comprises a nucleotide sequence as shown in any one of SEQ ID NOs: 63-74, which has one or more nucleotide additions, deletions and / or substitutions. In certain embodiments, the anti-Ang2 reference aptamer comprises about 10 to about 150 nucleotides.

[0136] In certain embodiments, the anti-Ang2 reference aptamer comprises a first consensus sequence and a second consensus sequence, and the first consensus sequence is located at the 5′ end of the second consensus sequence.

[0137] In certain embodiments, the anti-Ang2 reference aptamer comprises a first consensus sequence and a second consensus sequence, and the second consensus sequence is located at the 5′ end of the first consensus sequence.

[0138] In certain embodiments, the anti-Ang2 aptamer comprises a secondary structure, which comprises, from 5' to 3', a first stem, a first protrusion, a second stem, a second protrusion, a third stem, a third protrusion, a fourth stem, and a first loop. In certain embodiments, the aptamer comprises a secondary structure, which consists, from 5' to 3', of a first stem c, a first protrusion, a second stem, a second protrusion, a third stem, a third protrusion, a fourth stem, and a first loop.

[0139] In certain embodiments, the anti-Ang2 aptamer comprises a first consensus sequence comprising a nucleotide sequence having at least 50% identity to the nucleotide sequence shown in any one of SEQ ID NOs: 101-108. In certain embodiments, the anti-Ang2 aptamer comprises a second consensus sequence comprising a nucleotide sequence shown in any one of SEQ ID NOs: 109-116.

[0140] In certain embodiments, the first consensus sequence is included in the nucleotide sequence that forms the first protrusion, the second stem, the second protrusion, the third stem, the third protrusion and / or the fourth stem of the anti-Ang2 aptamer. In certain embodiments, the first consensus sequence is not included in the nucleotide sequence that forms the first loop of the anti-Ang2 aptamer. In certain embodiments, the second consensus sequence is included in the nucleotide sequence that forms the first protrusion, the second stem, the second protrusion, the third stem, the third protrusion and / or the fourth stem of the anti-Ang2 aptamer. In certain embodiments, the second consensus sequence is not included in the nucleotide sequence that forms the first loop of the anti-Ang2 aptamer.

[0141] In certain embodiments, the anti-Ang2 aptamer comprises a nucleotide sequence as shown in any one of SEQ ID NOs: 63-74, or a variant or truncated form thereof. In certain embodiments, the variant comprises a nucleotide sequence having at least 50% identity to the nucleotide sequence as shown in any one of SEQ ID NOs: 63-74. In certain embodiments, the variant comprises a nucleotide sequence as shown in any one of SEQ ID NOs: 63-74, which has one or more nucleotide additions, deletions and / or substitutions.

[0142] In certain embodiments, the anti-Ang2 aptamer comprises a first consensus sequence and a second consensus sequence, and the first consensus sequence is located 5' to the second consensus sequence.

[0143] In certain embodiments, the anti-Ang2 aptamer comprises a first consensus sequence and a second consensus sequence, and the second consensus sequence is located 5' to the first consensus sequence.

[0144] In certain embodiments, the anti-VEGF aptamer is conjugated to a polyethylene glycol (PEG) moiety. In certain embodiments, the PEG moiety is conjugated to the 5' end of the anti-VEGF aptamer. In certain embodiments, the PEG moiety is conjugated to the 3' end of the anti-VEGF aptamer. In certain embodiments, the anti-Ang2 aptamer is conjugated to a polyethylene glycol (PEG) moiety. In certain embodiments, the PEG moiety is conjugated to the 5' end of the anti-Ang2 aptamer. In certain embodiments, the PEG moiety is conjugated to the 3' end of the anti-Ang2 aptamer.

[0145] In certain embodiments, the bispecific aptamer has the formula A1-(L)n-A2, wherein A1 is an anti-VEGF aptamer and A2 is an anti-Ang2 aptamer, or A1 is an anti-Ang2 aptamer and A2 is an anti-VEGF aptamer; L is a linker; n is a number that is at least 0. In certain embodiments, n is 0 to 20. In certain embodiments, n is 0 to 10.

[0146] In certain embodiments, the bispecific aptamer is capable of specifically binding to both VEGF and Ang2.

[0147] In certain embodiments, the bispecific aptamer has a K of about 500 pM or less. D values ​​bind to VEGF-121 with a K of about 500 pM or less D Value for binding to Ang2.

[0148] In certain embodiments, the bispecific aptamer has a K of about 200 pM or less. D values ​​bind to VEGF-121 with a K of approximately 200 pM or less D Value for binding to Ang2.

[0149] In certain embodiments, the bispecific aptamer has a K of about 100 pM or less. D values ​​bind to VEGF-121 with a K of approximately 100 pM or less D Value for binding to Ang2.

[0150] In certain embodiments of the bispecific aptamer, L is selected from a naturally occurring nucleotide linker, a modified nucleotide linker, a hydrocarbon linker, a polyethylene glycol linker, and a combination thereof. In certain embodiments, at least one L is a polyethylene glycol linker. In certain embodiments, at least one L is a hexaethylene glycol (H or PEG6) linker. In certain embodiments, L is a hexaethylene glycol linker and n is 0 to 10.

[0151] In certain embodiments of the bispecific aptamer, A1 is an anti-VEGF aptamer comprising the nucleotide sequence shown in any one of SEQ ID NOs: 1-62, or a variant or truncated form thereof; A2 is an anti-Ang2 aptamer comprising the nucleotide sequence shown in any one of SEQ ID NOs: 63-74, or a variant or truncated form thereof.

[0152] In certain embodiments of the bispecific aptamer, A1 is an anti-Ang2 aptamer comprising the nucleotide sequence shown in any one of SEQ ID NOs: 63-74, or a variant or truncated form thereof; A2 is an anti-VEGF aptamer comprising the nucleotide sequence shown in any one of SEQ ID NOs: 1-62, or a variant or truncated form thereof.

[0153] In certain embodiments of the bispecific aptamer, A1 is an anti-VEGF aptamer comprising the nucleotide sequence shown in SEQ ID NO:45 or a truncated form thereof, A2 is an anti-Ang2 aptamer comprising the nucleotide sequence shown in SEQ ID NO:68 or a truncated form thereof, L is a hexaethylene glycol linker, and n is 0 to 10.

[0154] In certain embodiments of the bispecific aptamer, A1 is an anti-VEGF aptamer comprising the nucleotide sequence shown in SEQ ID NO:55 or a truncated form thereof, A2 is an anti-Ang2 aptamer comprising the nucleotide sequence shown in SEQ ID NO:68 or a truncated form thereof, L is a hexaethylene glycol linker, and n is 0 to 10.

[0155] In certain embodiments of the bispecific aptamer, A1 is an anti-VEGF aptamer comprising the nucleotide sequence shown in SEQ ID NO:48 or a truncated form thereof, A2 is an anti-Ang2 aptamer comprising the nucleotide sequence shown in SEQ ID NO:68 or a truncated form thereof, L is a hexaethylene glycol linker, and n is 0 to 10.

[0156] In certain embodiments of the bispecific aptamer, A1 is an anti-Ang2 aptamer comprising the nucleotide sequence shown in SEQ ID NO:68 or a truncated form thereof, A2 is an anti-VEGF aptamer comprising the nucleotide sequence shown in SEQ ID NO:45 or a truncated form thereof, L is a hexaethylene glycol linker, and n is 0 to 10.

[0157] In certain embodiments of the bispecific aptamer, A1 is an anti-Ang2 aptamer comprising the nucleotide sequence shown in SEQ ID NO:68 or a truncated form thereof, A2 is an anti-VEGF aptamer comprising the nucleotide sequence shown in SEQ ID NO:55 or a truncated form thereof, L is a hexaethylene glycol linker, and n is 0 to 10.

[0158] In certain embodiments of the bispecific aptamer, A1 is an anti-Ang2 aptamer comprising the nucleotide sequence shown in SEQ ID NO:68 or a truncated form thereof, A2 is an anti-VEGF aptamer comprising the nucleotide sequence shown in SEQ ID NO:48 or a truncated form thereof, L is a hexaethylene glycol linker, and n is 0 to 10.

[0159] In certain embodiments, the bispecific aptamer is selected from r-AMSB101, r-AMSB102, r-AMSB103, r-AMSB104, r-AMSB105, r-AMSB106, r-AMSB103.1, r-AMSB103.2, r-AMSB103.3, r-AMSB103.4, r-AMSB103.5, r-AMSB103.6, AMSB101, AMSB102, AMSB103, AMSB104, AMSB105, AMSB106, AMSB103.1, AMSB103.2, AMSB103.3, AMSB103.4, AMSB103.5 and AMSB103.6.

[0160] In certain embodiments, the bispecific aptamer comprises the nucleotide sequence set forth in any one of SEQ ID NOs: 75-78 and 138-157.

[0161] Composition

[0162] In one aspect, the present application provides a composition comprising the anti-Ang2 aptamer described herein, the anti-VEGF aptamer described herein and / or the bispecific aptamer described herein.

[0163] In certain embodiments, the composition is a pharmaceutical composition.

[0164] In certain embodiments, the composition comprises a pharmaceutically acceptable excipient or carrier.

[0165] In certain embodiments, the composition is used to prevent, treat and / or ameliorate a neovascular disease, disorder or condition. The neovascular disease, disorder or condition may be an ocular neovascular disease, disorder or condition. In certain embodiments, the neovascular disease, disorder or condition is selected from age-related macular degeneration, choroidal neovascularization, diabetic macular edema, retinal vein occlusion and diabetic retinopathy. In certain embodiments, the neovascular disease, disorder or condition is selected from wet age-related macular degeneration, myopic choroidal neovascularization and proliferative diabetic retinopathy.

[0166] Medical uses and methods

[0167] On the other hand, the present application provides a method for preventing, treating and / or improving neovascular diseases, disorders or conditions, comprising administering to a subject in need thereof an effective amount of the anti-Ang2 aptamer described herein, an effective amount of the anti-VEGF aptamer described herein, an effective amount of the bispecific aptamer described herein and / or an effective amount of the composition described herein.

[0168] In certain embodiments, the neovascular disease, disorder or condition is an ocular neovascular disease, disorder or condition. In certain embodiments, the neovascular disease, disorder or condition is selected from age-related macular degeneration, choroidal neovascularization, diabetic macular edema, retinal vein occlusion, and diabetic retinopathy. In certain embodiments, the neovascular disease, disorder or condition is selected from wet age-related macular degeneration, myopic choroidal neovascularization, and proliferative diabetic retinopathy.

[0169] On the other hand, the present application provides the use of the anti-Ang2 aptamer described in the present application, the anti-VEGF aptamer described in the present application, the bispecific aptamer described in the present application and / or the composition described in the present application in the preparation of a medicament for preventing, treating and / or improving neovascular diseases, disorders or conditions.

[0170] In certain embodiments, the neovascular disease, disorder or condition is an ocular neovascular disease, disorder or condition. In certain embodiments, the neovascular disease, disorder or condition is selected from age-related macular degeneration, choroidal neovascularization, diabetic macular edema, retinal vein occlusion, and diabetic retinopathy. In certain embodiments, the neovascular disease, disorder or condition is selected from wet age-related macular degeneration, myopic choroidal neovascularization, and proliferative diabetic retinopathy.

[0171] Other aspects and advantages described in the present application will become apparent to those skilled in the art from the following detailed description (in which only illustrative embodiments described in the present application are shown). As will be appreciated, the present application is capable of other and different embodiments, and its several details are capable of modification in various obvious aspects, all without departing from the present application. Therefore, the drawings and description are to be regarded as illustrative in nature, and not restrictive.

[0172] Incorporated by Reference

[0173] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. BRIEF DESCRIPTION OF THE DRAWINGS

[0174] The novel features of the present invention are particularly set forth in the appended claims. The features and advantages of the present invention will be better understood by reference to the following detailed description and accompanying drawings (also referred to herein as "figures" and "FIG.") which set forth illustrative embodiments in which the principles of the present invention are employed, wherein:

[0175] Figure 1A-Figure 1C The binding affinity of the anti-VEGF aptamers described in this application is shown.

[0176] Figure 2A-2D An in vitro VEGF receptor competition assay of the anti-VEGF aptamers described in this application is shown.

[0177] Figure 3A-3B The secondary structure of the anti-VEGF aptamer described in this application is shown.

[0178] Figure 4A The binding affinity of the anti-Ang2 aptamer described in this application is shown; Figure 4B The secondary structure of the anti-Ang2 aptamer described in the present application is shown; Figure 4C The anti-Ang2 aptamers described in the present application were shown to inhibit the binding of human Ang2 to Tie2.

[0179] Figure 5 The secondary structure of the bispecific aptamers described in this application is shown.

[0180] Figure 6A-6B In vitro VEGF and Ang2 receptor competition analysis of the bispecific aptamers described in this application is shown.

[0181] Figure 7A-7C The affinity of the bispecific aptamers described in this application to VEGF and Ang2 is shown.

[0182] Figure 8A-8C Shown are the results of in vivo efficacy testing of the anti-VEGF aptamers described herein in a rat laser-induced choroidal neovascularization (CNV) model.

[0183] Figure 9A-9C Shown are the results of in vivo efficacy testing of the bispecific aptamers described herein in a rat laser-induced choroidal neovascularization (CNV) model.

[0184] Figure 10A-10C Shown are the results of in vivo efficacy testing of the bispecific aptamers described herein in a monkey laser-induced choroidal neovascularization (CNV) model.

[0185] Figure 11A-11C The effects of the anti-Ang2 aptamers described in the present application on angiogenesis and vascular permeability are shown. DETAILED DESCRIPTION

[0186] Although various embodiments of the present invention have been shown and described herein, it will be apparent to those skilled in the art that such embodiments are provided as examples only. Those skilled in the art may make many changes, modifications and substitutions without departing from the present invention. It should be understood that various alternatives to the embodiments of the present invention described herein may be employed.

[0187] Definition of terms

[0188] As used herein, the term "aptamer" generally refers to a non-naturally occurring nucleic acid that has a desired effect on a target molecule. The desired effect may include, but is not limited to, binding to a target, catalytically changing a target, reacting with a target in a manner that modifies or changes a target or a functional activity of a target, covalently attaching to a target (such as in a suicide inhibitor), and promoting a reaction between a target and another molecule. In certain embodiments, the effect may be a specific binding affinity to a target molecule that is a three-dimensional chemical structure rather than a polynucleotide that binds to a nucleic acid ligand by a mechanism independent of Watson / Crick base pairing or triple helix formation, wherein an aptamer is not a nucleic acid with a known physiological function that is bound by a target molecule. Aptamers for a given target include nucleic acids that can be identified from a candidate nucleic acid mixture by a method comprising the following steps, wherein the aptamer can be a ligand for the target: (a) contacting the candidate mixture with the target, wherein nucleic acids with increased affinity for the target relative to other nucleic acids in the candidate mixture can be separated from the rest of the candidate mixture; (b) isolating the nucleic acids with enhanced affinity from the rest of the candidate mixture; and (c) amplifying the nucleic acids with enhanced affinity to produce a ligand-enriched nucleic acid mixture, thereby identifying aptamers for the target molecule. It is recognized that affinity interactions are a matter of degree; however, in this specification, the "specific binding affinity" of an aptamer to its target means that the aptamer can generally bind to its target with a much higher affinity than other non-target components in its binding mixture or sample. "Aptamers" or "nucleic acid ligands" are a set of copies of a type or species of nucleic acid molecules having a specific nucleotide sequence. An aptamer can include any suitable number of nucleotides. An aptamer can be DNA and / or RNA (or a combination of DNA and RNA), and can be single-stranded, double-stranded, or contain double-stranded or triple-stranded regions. In some cases, the aptamer may also include one or more (e.g., 1-20, 1-19, 1-18, 1-17, 1-16, 1-15, 1-14, 1-13, 1-12, 1-11, 1-10, 1-9, 1-8, 1-7, 1-6, 1-5, 1-4, 1-3 or 1-2) non-nucleotide substitutions. For example, one or more nucleotides of the aptamer may be substituted with a polyethylene glycol moiety or a linker, the linker comprising multiple (e.g., 1-10, 1-9, 1-8, 1-7, 1-6, 1-5, 1-4, 1-3 or 1-2) polyethylene glycol moieties. In some cases, the linker may be a hexaethylene glycol (H or PEG6) linker. Such substitutions may occur on any nucleotide of the aptamer, as long as it does not substantially affect the activity (e.g., binding activity or inhibitory activity) and / or function of the aptamer. In some cases, the substitution does not substantially affect the secondary structure of the aptamer, for example, the substitution may occur on nucleotides contained in the bulge or loop regions of the aptamer secondary structure. In some cases, the substitution does not occur on any nucleotides contained in the stem region of the aptamer secondary structure.

[0189] As used herein, the term "anti-VEGF aptamer" generally refers to a nucleic acid molecule having a specific binding affinity for VEGF. In some cases, the anti-VEGF aptamer can comprise one or more (e.g., 1-20, 1-19, 1-18, 1-17, 1-16, 1-15, 1-14, 1-13, 1-12, 1-11, 1-10, 1-9, 1-8, 1-7, 1-6, 1-5, 1-4, 1-3 or 1-2) non-nucleotide substitutions, as defined herein. For example, one or more nucleotides of the anti-VEGF aptamer can be substituted with a polyethylene glycol moiety or a linker comprising multiple (e.g., 1-10, 1-9, 1-8, 1-7, 1-6, 1-5, 1-4, 1-3 or 1-2) polyethylene glycol moieties. In some cases, the linker can be a hexaethylene glycol (H or PEG6) linker. Such substitutions may occur at any nucleotide of the anti-VEGF aptamer, as long as they do not substantially affect the activity (e.g., binding activity or inhibitory activity) and / or function of the anti-VEGF aptamer. In some cases, the substitution does not substantially affect the secondary structure of the anti-VEGF aptamer, for example, the substitution may occur at a nucleotide contained in a bulge or loop region of the secondary structure of the anti-VEGF aptamer. In some cases, the substitution does not occur at any nucleotide contained in the stem region of the secondary structure of the anti-VEGF aptamer.

[0190] As used herein, the term "VEGF" generally refers to vascular endothelial growth factor A (VEGFA or VEGF-A) and its splice variants and isoforms. VEGF can be found as four different splice variants called VEGF121 (or VEGF-121), VEGF165 (or VEGF-165), VEGF189 (or VEGF-189) and VEGF206 (or VEGF-206; the number refers to the number of amino acids in the polypeptide). All four isoforms exist in the form of disulfide-linked homodimers. Although VEGF-165 is the most common isoform observed, the isoform secretion patterns are different in different cell types. These isoforms bind to two receptors Flt-1 and Flk-1 / KDR with high affinity, but their binding affinities to heparin and the extracellular matrix are different. The number of human VEGF in the NCBI database may be NP_001273973.1, NP_001028928.1, NP_001020540.2, NP_001020539.2, NP_001020538.2, NP_003367.4 or NP_001020537.2.

[0191] As used herein, the term "K DThe term "value" generally refers to the determination of the binding affinity of an aptamer and a target by a technique suitable for the aptamer and target pair, such as by using a ligand binding assay utilizing radioactivity or fluorescence measurements, surface plasmon resonance (SPR), biolayer interferometry (BLI, e.g. System), SRU Biosystems The dissociation constant is measured by isothermal titration calorimetry (ITC) or microthermophoresis (MST). In some embodiments, K is determined using a standard fluorescence-based ligand binding assay and saturation analysis. D Value. In one embodiment, various concentrations of fluorescently labeled target molecules are incubated with the particles described herein at room temperature with gentle rotation for at least 3 hours. Each sample is then washed and the remaining bound target is quantified by measuring the fluorescence of each particle using a flow cytometer. Then, for example, by using an equilibrium binding model (e.g., according to the law of mass action), the background-subtracted fluorescence value is fitted to the saturation binding curve.

[0192] The terms "specific binding" or "specifically binds to" or "specific for" are used interchangeably herein and generally refer to the binding of an agent (e.g., a nucleic acid agent such as an aptamer) to a target molecule (e.g., a protein or portion thereof) that is measurably and / or statistically distinct from nonspecific interactions (e.g., nonspecific interactions can be binding to a reference molecule or a random molecule). Specific binding can be measured, for example, by competition with a control molecule similar to the target (e.g., an excess of unlabeled target), in which case specific binding is indicated if binding of the labeled target to the candidate agent is competitively inhibited by excess unlabeled target. Specific binding can be, for example, by having a K for a target of at least about 1 nM, at least about 900 pM, at least about 800 pM, at least about 700 pM, at least about 600 pM, at least about 500 pM, at least about 400 pM, at least about 300 pM, at least about 200 pM, at least about 100 pM, at least about 90 pM, at least about 80 pM, at least about 70 pM, at least about 60 pM, at least about 50 pM, at least about 40 pM, at least about 30 pM, at least about 20 pM, at least about 10 pM, at least about 5 pM, at least about 1 pM or more. D of molecules manifested.

[0193] As used herein, the term "VEGF receptor binding domain" generally refers to a domain of VEGF that binds to or is recognized by a corresponding VEGF receptor.

[0194] As used herein, the term "VEGF-R" or "VEGF receptor" generally refers to a receptor that binds VEGF or a VEGF family member, including splice variants and isoforms thereof. VEGF receptors can include: (i) Flt-1 (fin tyrosine kinase), also known as VEGF-R1 (Shibuya et al., Oncogene (1990), 5:519-524; De Vries et al., Science (1992), 255:989-991); (ii) Flk-1 (fetal liver kinase), a mouse RTK (Quinn et al., Proc Natl Acad Sci USA (1993), 90:7533-7537; Millauer et al., Cell (1993), 72:835-846) and its human homolog KDR (kinase insert domain-containing receptor, also known as VEGF-R2; Terman et al., Biochem Biophys Res Comm (1992), 187:1579-1586); and (iii) Flt-4, which is expressed on lymphatic endothelium but not on vascular endothelium (Pajusola et al., Cancer Res (1992), 52:5738-43).

[0195] As used herein, the term "RNA aptamer" generally refers to an aptamer comprising ribonucleotide units."RNA aptamer" is also meant to include RNA analogs as defined herein.

[0196] As used herein, the term "DNA aptamer" generally refers to an aptamer comprising deoxyribonucleotide units."DNA aptamer" is also meant to include DNA analogs as defined herein.

[0197] As used herein, the term "highly soluble" generally refers to the characteristic of an agent that is soluble in a solvent (e.g., water or an appropriate buffer) to a relatively high degree (e.g., 80% or more by total weight, 85% or more by total weight, 90% or more by total weight, 95% or more by total weight, 99% or more by total weight).

[0198] As used herein, the term "nuclease-resistant" generally refers to the characteristic of an agent that is resistant to nuclease cleavage. In some cases, nucleic acid molecules can be destroyed by exonucleases acting on the 5' or 3' ends of the nucleic acid. In addition, endonucleases can cut DNA or RNA at internal phosphodiester bonds between individual nucleotides. However, when a molecule (e.g., DNA or RNA) is nuclease-resistant (e.g., after certain modifications), it may no longer be destroyed or digested by exonucleases or endonucleases.

[0199] As used herein, the term "modified nucleotide" generally refers to a nucleotide that is not naturally present, but is an analog or ester of a naturally occurring nucleotide. When used in the context of an oligonucleotide or nucleic acid molecule (such as an aptamer), it generally means that at least one of the four constituent nucleotides of the oligonucleotide (i.e., A, G, T / U and C) is an analog or ester of a naturally occurring nucleotide. In certain embodiments, modified nucleotides can confer nuclease resistance to the oligonucleotide. In certain embodiments, modified nucleotides can result in a predominantly hydrophobic interaction between the aptamer and its protein target, resulting in a high binding efficiency and a stable eutectic complex. A substituted pyrimidine at the C-5 position is an example of a modified nucleotide. Modifications can include backbone modifications, methylation, rare base pairing combinations, such as isobases isocytidine and isoguanidine, etc. Modifications can also include 3' and 5' modifications, such as end-capping. Other modifications may include substitution of one or more natural nucleotides with an analog, internucleotide modifications such as those with uncharged linkages (e.g., methylphosphonates, phosphotriesters, phosphoamidates, carbamates, etc.) and those with charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.), those with intercalators (e.g., acridine, psoralen, etc.), those containing chelators (e.g., metals, radioactive metals, boron, oxidized metals, etc.), those containing alkylating agents, and those with modified linkages (e.g., alpha anomeric nucleic acids, etc.). In addition, any hydroxyl group normally present on the sugar of a nucleotide may be substituted with a phosphonate or phosphate group; protected with standard protecting groups; or activated to prepare additional linkages with additional nucleotides or solid supports. The 5' and 3' terminal OH groups can be phosphorylated or substituted with amines, organic capping moieties of about 1 to about 20 carbon atoms, polyethylene glycol (PEG) polymers ranging from about 10 to about 80 kDa in certain embodiments, PEG polymers ranging from about 20 kDa to about 60 kDa in certain embodiments, or other hydrophilic or hydrophobic biopolymers or synthetic polymers. In certain embodiments, the modification can be at the C-5 position of the pyrimidine. These modifications can be produced by amide linkages directly at the C-5 position or by other types of linkages.

[0200] As used herein, the term "2'-modified nucleotide" generally refers to a modified nucleotide having a 2' carbon atom. For example, cytidine, uridine, adenosine, guanosine can have a modification of the 2' carbon atom.

[0201] As used herein, the term "2'-fluoro modified nucleotide" generally refers to a nucleotide having a 2'-fluoro substituent. 2'-deoxy-2'-fluoro modified oligonucleotides can be prepared by the method described in U.S. Pat. No. 6,531,584.

[0202] As used herein, the term "cytidine" generally refers to a nucleoside molecule formed when cytosine is attached to a ribose ring (also known as furanose) via a β-N1-glycosidic bond. Cytidine may have the following structure:

[0203]

[0204] As used herein, the term "2'-modified cytidine" generally refers to a cytidine having a modification at the 2' carbon atom.

[0205] As used herein, the term "2'-deoxy-2'-fluorocytidine" generally refers to a chemical substance having the following structure:

[0206] As used herein, the term "2'-modified uridine" generally refers to a modified uridine having a 2' carbon atom. Uridine is a glycosylated pyrimidine analog comprising uracil attached to a ribose ring (or more specifically, ribofuranose) via a β-N1-glycosidic bond. Uridine can have the following structure:

[0207] As used herein, the term "2'-deoxy-2'-fluorouridine" generally refers to a chemical substance having the following structure:

[0208] As used herein, the term "2'-modified adenosine" generally refers to a modified adenosine having a 2' carbon atom. Adenosine is a purine nucleoside composed of an adenine molecule attached to a ribose sugar molecule (ribofuranose) moiety via a β-N9-glycosidic bond. Adenosine may have the following structure:

[0209] As used herein, the term "2'-deoxy-2'-fluoroadenosine" generally refers to a chemical substance having the following structure:

[0210] As used herein, the term "2'-modified guanosine" generally refers to a modified guanosine having a 2' carbon atom. Guanosine is a purine nucleoside comprising guanine attached to a ribose (ribofuranose) ring via a β-N9-glycosidic bond. Guanosine may have the following structure:

[0211] As used herein, the term "2'-deoxy-2'-fluoroguanosine" generally refers to a chemical substance having the following structure:

[0212] As used herein, the term "nucleotide" generally refers to an organic molecule used as a monomer unit to form nucleic acid polymers deoxyribonucleic acid (DNA) or ribonucleic acid (RNA). Nucleotides are composed of three subunit molecules: a nitrogenous base, a five-carbon sugar (ribose or deoxyribose) and at least one phosphate group. Nucleosides are composed of a nitrogenous base and a 5-carbon sugar. Therefore, nucleosides with a phosphate group produce nucleotides.

[0213] As used herein, the term "natural nucleotides" generally refers to nucleotides found in nature. For example, natural nucleotides may include cytidine, adenosine, guanosine, uridine. In certain embodiments, "natural nucleic acids" also include synthetic or modified nucleotides that do not interfere with amplification and / or sequencing.

[0214] As used herein, the term "reference aptamer" generally refers to an aptamer that competes for binding with a target, such as the aptamers described herein. In certain embodiments, the reference aptamer can bind to the same target as the aptamers described herein.

[0215] As used herein, the term "competition" generally refers to the action of one chemical substance inhibiting another substance by competing with it for binding or bonding. For example, a reference aptamer can compete with an aptamer described herein for binding to a target. In another embodiment, an aptamer described herein can compete with a receptor or ligand of the target for binding to the target.

[0216] As used herein, the term "secondary structure" generally refers to the higher order structure of an amino acid molecule. The secondary structure can be formed by base pairing interactions inside a single nucleic acid polymer or between two polymers. It can be expressed as a list of paired bases in a nucleic acid molecule. The secondary structure can be generally divided into a spiral (continuous base pairs) and various types of loops (unpaired nucleotides surrounded by a spiral). Generally, these elements or their combinations can be further classified into other categories, including stems, protrusions, loops and spirals. In the present application, the secondary structure can be determined by using the NUPACK software suite.

[0217] As used herein, the term "5'-3'" generally refers to the sequence from the 5'-end to the 3'-end of a DNA or RNA chain. The 5'-end may refer to the end of a DNA chain or RNA chain at which the fifth carbon in the sugar ring of deoxyribose or ribose is at its end. The phosphate group attached to the 5' end allows two nucleotides to be connected, i.e., the 5' phosphate is covalently bound to the 3' hydroxyl of another nucleotide to form a phosphodiester bond. The 3'-end may refer to termination at the hydroxyl of the third carbon in the sugar ring, also referred to as the tail end. The synthesis of new nucleic acid molecules generally requires the 3'-hydroxyl because it is connected (coupled) to the 5'-phosphate of a separate nucleotide, allowing the formation of a chain of connected nucleotides.

[0218] As used herein, the term "stem" generally refers to a region of nucleic acid secondary structure, the stem comprising a base-paired helix.

[0219] As used herein, the term "bulge" generally refers to a region of nucleic acid secondary structure where one strand of the helix has one or more bases that do not have a complementary counterpart in the opposing strand in the secondary structure of the nucleic acid molecule.

[0220] As used herein, the term "loop" generally refers to a series of short consecutive unpaired bases within a longer paired helix in a nucleic acid secondary structure.

[0221] As used herein, the term "consensus sequence" generally refers to a specific position (not necessarily continuous) of a designated oligonucleotide. "Designated" means that the composition of the position may not be completely random. Not all oligonucleotides in a mixture have the same nucleotide at that position; for example, a consensus sequence may contain a known ratio of specific nucleotides.

[0222] As used herein, the term "truncated" generally refers to an aptamer that has been truncated by nucleotide deletion but still has the desired or even improved binding properties. The length of the truncated form can vary depending on the length of the starting aptamer, as defined herein for the term "aptamer". The truncation in truncation can occur in the fixed or variable region of the starting aptamer, or can occur in both the fixed and variable regions.

[0223] As used herein, the term "modulate biological activity" generally refers to modulating (e.g., enhancing or attenuating) the biological activity of a target molecule (e.g., a protein such as a receptor or ligand). For example, the anti-VEGF aptamers described herein can modulate the biological activity of VEGF and / or VEGF receptors.

[0224] As used herein, the term "neovascular disease or disorder" generally refers to a disease or disorder associated with neovascularization. Neovascular diseases or disorders may include ocular neovascular diseases (e.g., retinal and choroidal neovascular diseases), erythroderma glaucoma, pterygium, solid tumor cancer, osteoarthritis, rheumatoid arthritis, vascular abnormalities and malformations (e.g., hemangiomas, lymphangiomas, etc.) and psoriasis.

[0225] As used herein, the term "ocular neovascular disease" generally refers to a disease characterized by ocular neovascularization, ie, the development of abnormal blood vessels in the eye of a subject.

[0226] As used herein, the term "VEGF-related disease, disorder or condition" generally refers to a disease, disorder or condition associated with abnormal activity or loss of activity of VEGF. For example, a VEGF-related disease, disorder or condition may include abnormal angiogenesis. For example, a VEGF-related disease, disorder or condition may include cancer, rheumatoid arthritis, bullous diseases (including bullous pemphigoid, dermatitis herpetiformis and erythema multiforme) and psoriasis.

[0227] As used herein, the term "age-related macular degeneration" or "AMD" generally refers to macular degeneration associated with aging. Macular degeneration can affect the central area of ​​the retina (called the macula) and can cause gradual or rapid loss of vision to levels of 20 / 200 or lower. And AMD may affect central vision, such as for reading and watching television, resulting in decreased vision, while peripheral vision remains relatively intact.

[0228] As used herein, the term "diabetic retinopathy" or "DR" generally refers to late microvascular complications of diabetes, such as type 2 diabetes. Diabetic retinopathy is a retinal microvascular disease that can present in a series of stages with increasing severity and worsening visual outcomes. DR can be roughly divided into two main clinical stages: non-proliferative diabetic retinopathy (NPDR) and proliferative diabetic retinopathy (PDR), where the term "proliferative" refers to the presence of retinal neovascularization.

[0229] As used herein, the term "diabetic macular edema" generally refers to the symptoms that accompany any stage of diabetic retinopathy resulting in a significant decrease in central vision.

[0230] As used herein, the term "retinal vein occlusion" generally refers to a complete or partial blockage of a retinal blood vessel that restricts blood flow through the retinal tissue. The site of blockage usually occurs on the venous side and can occur in a branch vessel (branch retinal vein occlusion-BRVO) or in the central retinal vein (central retinal vein occlusion-CRVO).

[0231] As used herein, the term "myopic choroidal neovascularization" generally refers to a disease causing visual impairment in patients with pathological myopia. When new blood vessels are generated in the macular area, pigmented fibrous scars are usually formed, resulting in a dark spot in the center of vision. Myopic choroidal neovascularization belongs to choroidal neovascularization.

[0232] As used herein, the term "anti-VEGF agent" generally refers to a compound that inhibits the activity or production of vascular endothelial growth factor ("VEGF").

[0233] As used herein, the term "composition" generally refers to the distribution of individual substances that make up a mixture. The individual substances can be named components.

[0234] As used herein, the term "pharmaceutical composition" generally refers to a formulation prepared in a form suitable for pharmaceutical administration. A pharmaceutical composition can generally be formulated to be compatible with its intended route of administration. Examples of routes of administration may include, but are not limited to, oral and parenteral administration, such as intravenous, intradermal, subcutaneous, inhalation, topical, transdermal, transmucosal and rectal administration.

[0235] As used herein, the term "pharmaceutically acceptable excipient or carrier" generally refers to any excipient or carrier approved by a regulatory agency of the Federal or state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, more specifically, in humans. The term "carrier" may refer to a diluent, adjuvant, excipient or vehicle with which the therapeutic agent is administered, including but not limited to sterile liquids such as water and oils.

[0236] As used herein, the term "effective amount" generally refers to the amount required to improve at least one symptom of the condition or disorder to be prevented, alleviated or treated as described herein. The phrase "therapeutically effective amount", when it relates to an anti-VEGF aptamer, an anti-Ang2 aptamer or a bispecific aptamer, a composition or an agent described herein, means the amount of the aptamer that will provide the desired specific pharmacological response after administration in a large number of individuals in need of such treatment. It should be emphasized that a therapeutically effective amount of an aptamer administered to a specific individual under a specific situation is not always effective in treating the disorder / disease described herein, even if such a dose is considered to be a therapeutically effective amount by a person skilled in the art.

[0237] As used herein, the term "Ang2" generally refers to angiopoietin-2, an angiogenic factor belonging to the E2F family. Ang2 is considered to be a naturally occurring antagonist of Tie2. Unless otherwise expressly stated, not only human Ang2, but also Ang2 of various species should be considered to be covered by the term. The term "Ang2" also covers functional fragments and components of full-length Ang2. Human Ang2 is also known as Ensembl: ENSG00000091879 or MIM: 601922.

[0238] As used herein, the term "interaction between the Ang2 and the Tie2" generally refers to the activity of Ang2 binding to Tie2. Tie2 is an endothelial receptor tyrosine kinase (RTK) that is involved in embryonic vascular development and pathological angiogenesis.

[0239] As used herein, the term "substantially non-binding" generally refers to little or almost no binding to a particular substance. For example, very little or almost no (e.g., less than 10%, less than 9%, less than 8%, less than 7%, less than 6%, less than 5%, less than 4%, less than 3%, less than 2%, less than 1%, less than 0.5%, less than 0.1% or less than 0.01%) aptamers described herein can bind to their targets.

[0240] As used herein, the term "anti-Ang2 aptamer" generally refers to a nucleic acid molecule having a specific binding affinity for Ang2. In some cases, the anti-Ang2 aptamer may comprise one or more (e.g., 1-20, 1-19, 1-18, 1-17, 1-16, 1-15, 1-14, 1-13, 1-12, 1-11, 1-10, 1-9, 1-8, 1-7, 1-6, 1-5, 1-4, 1-3 or 1-2) non-nucleotide substitutions, as defined herein. For example, one or more nucleotides of the anti-Ang2 aptamer may be substituted with a polyethylene glycol moiety or a linker comprising multiple (e.g., 1-10, 1-9, 1-8, 1-7, 1-6, 1-5, 1-4, 1-3 or 1-2) polyethylene glycol moieties. In some cases, the linker may be a hexaethylene glycol (H or PEG6) linker. Such substitutions may occur at any nucleotide of the anti-VEGF aptamer, as long as they do not substantially affect the activity (e.g., binding activity or inhibitory activity) and / or function of the anti-VEGF aptamer. In some cases, the substitutions do not substantially affect the secondary structure of the anti-Ang2 aptamer, for example, the substitutions may occur at nucleotides contained in the bulge or loop regions of the secondary structure of the anti-Ang2 aptamer. In some cases, the substitutions do not occur at any nucleotides contained in the stem region of the secondary structure of the anti-Ang2 aptamer.

[0241] As used herein, the term "anti-Ang2 agent" generally refers to an agent that inhibits the activity or production of Ang2.

[0242] As used herein, the term "aflibercept" generally refers to a recombinant fusion protein consisting of the vascular endothelial growth factor (VEGF) binding portion from the extracellular domains of human VEGF receptors 1 and 2, fused to the Fc portion of human IgG1 immunoglobulin.

[0243] As used herein, the term "linker" generally refers to an agent designed to facilitate the functional connection of two moieties into one connected moiety. For example, a linker can be used to make a single strand to obtain a desired biological activity. For example, a linker can be used to make a single strand to impart a desired degree of stability to the resulting connected nucleotides.

[0244] As used herein, the term "nucleotide linker" generally refers to a linker made of nucleotides. The length of the nucleotide linker connecting adjacent nucleotides can vary.

[0245] As used herein, the term "modified nucleotide linker" generally refers to a nucleotide linker having one or more modifications.

[0246] As used herein, the term "hydrocarbon linker" generally refers to a linker made of hydrocarbons. Hydrocarbons are organic compounds composed entirely of hydrogen and carbon. Examples of hydrocarbons include, but are not limited to, methane, ethane, propane, butane, pentane, hexane, heptane, octane, nonane, decane, undecane, and dodecane.

[0247] As used herein, the term "polyethylene glycol linker" generally refers to a linker made of one or more polyethylene glycol (PEG) subunits.

[0248] As used herein, the term "fragment thereof" generally refers to a partial region that can be obtained from a complete parent molecule (e.g., an aptamer described herein). The fragment may still retain the properties of the parent molecule from which it is derived. In some cases, the fragment may provide many advantages over the complete parent molecule for manufacturing and / or medical use.

[0249] As used herein, the term "variant" generally refers to an aptamer molecule that differs from a parent molecule (e.g., an aptamer) in at least one nucleotide. A variant can refer to the molecule itself, a composition comprising the molecule. When such a molecule is DNA or RNA, it can also refer to the nucleotide sequence of the molecule. In some cases, a variant differs from its parent molecule (e.g., an aptamer) in one or more nucleotide acids, such as 1-50, 1-40, 1-30, 1-20, 1-15, 1-14, 1-13, 1-12, 1-11, 1-10, 1-9, 1-8, 1-7, 1-6, 1-5, 1-4, 1-3 or 1-2 nucleotide additions, deletions or substitutions. In some cases, a variant may have at least about 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more) sequence homology / identity with the nucleotide sequence of its parent molecule.

[0250] As used herein, the term "reducing neovascularization" generally refers to a decrease in the degree of neovascularization. Neovascularization is the natural formation of new blood vessels, usually in the form of a functional microvascular network that can be perfused with red blood cells, which forms a collateral circulation in response to local poor perfusion or ischemia. In this application, it can be used interchangeably with "angiogenesis".

[0251] As used herein, the term "reducing vascular permeability" generally refers to reducing the degree of vascular permeability in a tissue. Changes in vascular permeability are believed to play a role in both normal and pathological physiological processes (Cullinan-Bove et al., 1993, Endocrinology 133:829-837; Senger et al., 1993, Cancer and Metastasis Reviews, 12:303-324). Disease states associated with increased angiogenesis and / or vascular permeability can be cancer, diabetes, psoriasis, rheumatoid arthritis, Kaposi's sarcoma, hemangioma, acute and chronic kidney disease, atherosclerosis, arterial restenosis, autoimmune diseases, acute inflammation, excessive scarring and adhesions, endometriosis, dysfunctional uterine bleeding and eye diseases with retinal vascular proliferation.

[0252] As used herein, the term "mouse oxygen-induced ischemic retinopathy (OIR) model" generally refers to an animal model of oxygen-induced retinopathy in mice, which has reproducible and quantifiable proliferative retinal neovascularization. The model can be used to examine the pathogenesis and therapeutic intervention of retinal neovascularization in retinopathy of prematurity (ROP) and other vascular diseases. The preparation method of the model is described in, for example, Smith LE et al. Oxygen-induced retinopathy in the mouse. Invest. Opthalmol. Vis. Sci. 1994; 35: 101-111.

[0253] As used herein, the term "Ang2-related disease, disorder or condition" generally refers to a disease, disorder or condition associated with abnormal activity or loss of activity of Ang2. For example, an Ang2-related disease, disorder or condition may have an effect on angiogenesis. Examples of such diseases, disorders or conditions may be cancer or cancerous diseases, eye diseases such as age-related macular degeneration and diabetic retinopathy, and / or chronic kidney disease such as diabetic nephropathy, post-renal failure, pre-renal azotemia and intrinsic renal failure.

[0254] As used herein, the singular forms "a", "and", and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a particle" includes a plurality of such particles and reference to "the sequence" includes reference to one or more of the sequences and equivalents thereof known to those skilled in the art, and so forth.

[0255] As used herein, the term "about" generally refers to an approximate value based on a given value reasonably inferred by one of ordinary skill in the art, including equivalent values ​​and approximate values ​​resulting from the experimental and / or measurement conditions used for such a given value. For example, it can refer to a value that is no more than 10% higher or lower than the value modified by the term.

[0256] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention belongs. Although any methods and materials similar or equivalent to the methods and materials described herein can also be used in the practice or testing of the present invention, preferred methods and materials are now described. All publications mentioned herein are incorporated herein by reference to claim and describe the methods and / or materials associated with the citation of these publications.

[0257] It will be apparent to those skilled in the art after reading this application that each individual embodiment described and illustrated herein has discrete components and features that can be easily separated or combined with features of any of the other several embodiments without departing from the scope or spirit of the invention. The method of any example can be performed in the order of the events listed or in any other order that is logically possible. This is intended to provide support for all such combinations. DETAILED DESCRIPTION OF THE INVENTION

[0259] Anti-VEGF Aptamer

[0260] In one aspect, the present application provides an anti-VEGF aptamer that has a K of about 20 nanomolar (nM) or less. D The values ​​bind to VEGF-121 with a K of approximately 20 nanomolar (nM) or less. D Values ​​for binding to VEGF-165.

[0261] For example, the anti-VEGF aptamer can bind to VEGF-121, and its K DValues ​​of about 20 nanomolar (nM) or less, 18 nanomolar (nM) or less, 16 nanomolar (nM) or less, 14 nanomolar (nM) or less, 12 nanomolar (nM) or less, 10 nanomolar (nM) or less, 8 nanomolar (nM) or less, 6 nanomolar (nM) or less, 4 nanomolar (nM) or less, 2 nanomolar (nM) or less, 1 nanomolar (nM) or less, 0.5 nanomolar (nM) or less, 0.4 nanomolar (nM) or less, 0.2 nanomolar (nM) or less, 0.1 nanomolar (nM) or less, 0.09 nanomolar (nM) or less, 0.08 nanomolar (nM) or less, 0.07 nanomolar (nM) or less, 0.06 nanomolar (nM) or less, 0.05 nanomolar (nM) or less, 0.04 nanomolar (nM) or less or 0.03 nanomolar (nM) or less.

[0262] For example, the anti-VEGF aptamer can bind to VEGF-165, and its K D The value is about 20 nanomolar (nM) or less, 18 nanomolar (nM) or less, 16 nanomolar (nM) or less, 14 nanomolar (nM) or less, 12 nanomolar (nM) or less, 10 nanomolar (nM) or less, 8 nanomolar (nM) or less, 6 nanomolar (nM) or less, 4 nanomolar (nM) or less, 2 nanomolar (nM) or less, 1 nanomolar (nM) or less, 0.5 nanomolar (nM) or less, 0.4 nanomolar (nM) or less, 0.2 nanomolar (nM) or less. 0.06 nanomolar (nM) or less, 0.05 nanomolar (nM) or less, 0.04 nanomolar (nM) or less or 0.03 nanomolar (nM) or less.

[0263] VEGF-121 may be human VEGF-121, mouse VEGF-120, monkey VEGF-121, rabbit VEGF-121 and / or rat VEGF- 120. VEGF-165 may be human VEGF-165, mouse VEGF-164, monkey VEGF-165, rabbit VEGF-165 and / or rat VEGF-164.

[0264] Human VEGF-121 (NCBI No. P15692-9) may comprise the amino acid sequence set forth in SEQ ID NO: 117. Mouse VEGF-120 (NCBI No. Q00731-3) may comprise the amino acid sequence set forth in SEQ ID NO: 132. Rat VEGF-120 (NCBI No. P16612-4) may comprise the amino acid sequence set forth in SEQ ID NO:130.

[0265] Human VEGF-165 (NCBI No. P15692-4) may comprise the amino acid sequence set forth in SEQ ID NO: 123. Mouse VEGF-164 (NCBI No. Q00731-2) may comprise the amino acid sequence set forth in SEQ ID NO: 131. Monkey VEGF-165 (NCBI No. H9EQI6) may comprise the amino acid sequence set forth in SEQ ID NO: 123. Rat VEGF-164 (NCBI No. P16612-2) may comprise the amino acid sequence set forth in SEQ ID NO: 127.

[0266] Rabbit VEGF-189 (NCBI No. G1T1L9) may comprise the amino acid sequence shown in SEQ ID NO:124.

[0267] The anti-VEGF aptamer antibody can specifically bind to 1) the VEGF receptor binding domain of VEGF-121 or a fragment thereof and 2) the VEGF receptor binding domain of VEGF-165 or a fragment thereof.

[0268] The VEGF receptor binding domain of VEGF-121 may comprise the amino acid sequence shown in any one of SEQ ID NOs: 118-122, 128, 129 and 133. The VEGF receptor binding domain of VEGF-165 may comprise the amino acid sequence shown in any one of SEQ ID NOs: 118-122, 128 and 129.

[0269] The receptor binding domain 1 of human VEGF-121 may comprise the amino acid sequence shown in SEQ ID NO: 118. The receptor binding domain 2 of human VEGF-121 may comprise the amino acid sequence shown in SEQ ID NO: 119. The receptor binding domain 3 of human VEGF-121 may comprise the amino acid sequence shown in SEQ ID NO: 120. The receptor binding domain 4 of human VEGF-121 may comprise the amino acid sequence shown in SEQ ID NO: 121. The receptor binding domain 5 of human VEGF-121 may comprise the amino acid sequence shown in SEQ ID NO: 122.

[0270] The receptor binding domain 1 of human VEGF-165 may comprise the amino acid sequence shown in SEQ ID NO: 118. The receptor binding domain 2 of human VEGF-165 may comprise the amino acid sequence shown in SEQ ID NO: 119. The receptor binding domain 3 of human VEGF-165 may comprise the amino acid sequence shown in SEQ ID NO: 120. The receptor binding domain 4 of human VEGF-165 may comprise the amino acid sequence shown in SEQ ID NO: 121. The receptor binding domain 5 of human VEGF-165 may comprise the amino acid sequence shown in SEQ ID NO: 122.

[0271] The receptor binding domain 1 of monkey VEGF-165 may comprise the amino acid sequence shown in SEQ ID NO: 118. The receptor binding domain 2 of monkey VEGF-165 may comprise the amino acid sequence shown in SEQ ID NO: 119. The receptor binding domain 3 of monkey VEGF-165 may comprise the amino acid sequence shown in SEQ ID NO: 120. The receptor binding domain 4 of monkey VEGF-165 may comprise the amino acid sequence shown in SEQ ID NO: 121. The receptor binding domain 5 of monkey VEGF-165 may comprise the amino acid sequence shown in SEQ ID NO: 122.

[0272] The receptor binding domain 1 of rabbit VEGF-189 may comprise the amino acid sequence shown in SEQ ID NO: 125. The receptor binding domain 2 of rabbit VEGF-189 may comprise the amino acid sequence shown in SEQ ID NO: 119. The receptor binding domain 3 of rabbit VEGF-189 may comprise the amino acid sequence shown in SEQ ID NO: 126. The receptor binding domain 4 of rabbit VEGF-189 may comprise the amino acid sequence shown in SEQ ID NO: 121. The receptor binding domain 5 of rabbit VEGF-189 may comprise the amino acid sequence shown in SEQ ID NO: 122.

[0273] The receptor binding domain 1 of rat VEGF-164 may comprise the amino acid sequence shown in SEQ ID NO: 118. The receptor binding domain 2 of rat VEGF-164 may comprise the amino acid sequence shown in SEQ ID NO: 119. The receptor binding domain 3 of rat VEGF-164 may comprise the amino acid sequence shown in SEQ ID NO: 128. The receptor binding domain 4 of rat VEGF-164 may comprise the amino acid sequence shown in SEQ ID NO: 121. The receptor binding domain 5 of rat VEGF-164 may comprise the amino acid sequence shown in SEQ ID NO: 129.

[0274] The receptor binding domain 1 of rat VEGF-120 may comprise the amino acid sequence shown in SEQ ID NO: 118. The receptor binding domain 2 of rat VEGF-120 may comprise the amino acid sequence shown in SEQ ID NO: 119. The receptor binding domain 3 of rat VEGF-120 may comprise the amino acid sequence shown in SEQ ID NO: 128. The receptor binding domain 4 of rat VEGF-120 may comprise the amino acid sequence shown in SEQ ID NO: 121. The receptor binding domain 5 of rat VEGF-120 may comprise the amino acid sequence shown in SEQ ID NO: 129.

[0275] The receptor binding domain 1 of mouse VEGF-164 may comprise the amino acid sequence shown in SEQ ID NO: 118. The receptor binding domain 2 of mouse VEGF-164 may comprise the amino acid sequence shown in SEQ ID NO: 119. The receptor binding domain 3 of mouse VEGF-164 may comprise the amino acid sequence shown in SEQ ID NO: 128. The receptor binding domain 4 of mouse VEGF-164 may comprise the amino acid sequence shown in SEQ ID NO: 121. The receptor binding domain 5 of mouse VEGF-164 may comprise the amino acid sequence shown in SEQ ID NO: 129.

[0276] The receptor binding domain 1 of mouse VEGF-120 may comprise the amino acid sequence shown in SEQ ID NO: 118. The receptor binding domain 2 of mouse VEGF-120 may comprise the amino acid sequence shown in SEQ ID NO: 119. The receptor binding domain 3 of mouse VEGF-120 may comprise the amino acid sequence shown in SEQ ID NO: 128. The receptor binding domain 4 of mouse VEGF-120 may comprise the amino acid sequence shown in SEQ ID NO: 133. The receptor binding domain 5 of mouse VEGF-120 may comprise the amino acid sequence shown in SEQ ID NO: 129.

[0277] Anti-VEGF aptamers can inhibit the interaction between VEGF-121 and VEGF-R1. Anti-VEGF aptamers inhibit the interaction between VEGF-121 and VEGF-R2. Anti-VEGF aptamers can inhibit the interaction between VEGF-165 and VEGF-R1. Anti-VEGF aptamers can also inhibit or additionally inhibit the interaction between VEGF-165 and VEGF-R2.

[0278] The anti-VEGF aptamers described in the present application can reduce and / or improve neovascularization and / or leakage in animal models (such as ocular animal models).

[0279] The animal model can be a vertebrate model, and in some cases, the animal model can be a mammalian model. The animal can be a rat, mouse, rabbit, goat, sheep, non-human primate or any other suitable animal.

[0280] In certain embodiments, the anti-VEGF aptamers described herein are capable of reducing and / or ameliorating lesions and / or leakage in a laser-induced choroidal neovascularization (CNV) model, such as a rat model or a non-human primate (NHP) model.

[0281] The anti-VEGF aptamers described herein can be highly soluble. For example, the anti-VEGF aptamer can be soluble in a solvent to a relatively high degree (e.g., 80% or more of the total weight, 85% or more of the total weight, 90% or more of the total weight, 95% or more of the total weight, 99% or more of the total weight). For example, the anti-VEGF aptamer can be formulated to a concentration of 100 mg / ml or more, or 150 mg / ml or more, such as 200 mg / ml or more.

[0282] The anti-VEGF aptamer can be an RNA aptamer, a DNA aptamer, or a combination thereof. For example, the anti-VEGF aptamer can mainly contain RNA, it can mainly contain DNA, or it can contain both RNA and DNA.

[0283] The anti-VEGF aptamer can comprise one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more) modified nucleotides. In some cases, all nucleotides of the anti-VEGF aptamer can be modified nucleotides. For example, the anti-VEGF aptamer can have 20 nucleotides, and all of the 20 nucleotides can be modified nucleotides.

[0284] In certain cases, the anti-VEGF aptamers described herein may be nuclease-resistant.

[0285] The modified nucleotides may comprise chemical substitutions or modifications at one or more positions independently selected from the ribose position, the deoxyribose position, the phosphate position and the base position. The modified nucleotides include one or more modifications independently selected from the following modifications: 2'-position sugar modification, 2'-amino (2'-NH2) modification, 2'-fluoro (2'-F) modification, 2'-O-methyl (2'-OMe) modification, 2'-O-(2-methoxyethyl) (2'-O-MOE) modification, 5-position modified pyrimidine, modification at the cytosine exocyclic amine, substitution with 5'-bromouracil, substitution with 5'-bromodeoxyuridine, substitution with 5'-bromodeoxycytidine, backbone modification, locked nucleic acid (LNA), methylation, 3' cap and 5' cap. The 5-position modified pyrimidine is selected from 5-carboxy-2'-deoxyuridine, 5-aminoallyl-2'-deoxyuridine, 5-[(3-indolyl)propionamide-N-allyl]-2'-deoxyuridine, 5-carboxy-2'-deoxycytidine, 5-aminoallyl-2'-deoxycytidine, biotin-16-aminoallyl-2'-deoxycytidine, 5-(N-benzylcarboxamide)-2'-deoxyuridine, 5-(N-isobutylcarboxamide)-2'-deoxyuridine, 5-(N-naphthylmethylcarboxamide)-2'-deoxyuridine and 5-(N-tryptophanaminocarboxamide)-2'-deoxyuridine.

[0286] The anti-VEGF aptamer may comprise at least one (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more) 2'-modified nucleotide. In certain embodiments, all nucleotides may be 2'-modified nucleotides. The 2'-modified nucleotides may be selected from 2'-amino modified nucleotides, 2'-fluoro modified nucleotides, 2'-O-methyl modified nucleotides and 2'-O-(2-methoxyethyl) modified nucleotides.

[0287] In some cases, all cytidines may be 2'-modified cytidines. In some cases, all cytidines may be 2'-fluoro modified cytidines and / or 2'-O-methyl modified cytidines. In some cases, all cytidines may be 2'-deoxy-2'-fluoro cytidines. In some cases, all uridines may be 2'-modified uridines. In some cases, all uridines may be 2'-fluoro modified uridines and / or 2'-O-methyl modified uridines. In some cases, all uridines may be 2'-deoxy-2'-fluoro uridines. In some cases, all adenosines may be 2'-modified adenosines. In some cases, all adenosines may be 2'-fluoro modified adenosines and / or 2'-O-methyl modified adenosines. In some cases, all adenosines may be 2'-deoxy-2'-fluoro adenosines. In some cases, all guanosines may be 2'-modified guanosines. In some cases, all guanosines may be 2'-fluoro modified guanosines and / or 2'-O-methyl modified guanosines. In some cases, all guanosines may be 2'-deoxy-2'-fluoro guanosines.

[0288] For example, the anti-VEGF aptamer comprises at least one 2'-modified nucleotide. In certain embodiments, all nucleotides of the anti-VEGF aptamer may be 2'-modified nucleotides. In certain embodiments, all nucleotides of the anti-VEGF aptamer may be 2'-fluoro modified nucleotides and / or 2'-O-methyl modified nucleotides. For example, the 2'-fluoro modified nucleotides may be 2'-fluoro (2'-F) modified nucleotides or 2'-fluoro-2'-deoxy modified nucleotides. For example, the 2'-fluoro modified nucleotides may comprise the following structures:

[0289] In some cases, the anti-VEGF aptamer does not contain any natural nucleotides (eg, unmodified A, C, T, U, or G).

[0290] The anti-VEGF aptamer may comprise about 10 to about 150 nucleotides. For example, the VEGF aptamer may comprise about 10 to about 150 nucleotides, about 10 to about 140 nucleotides, about 10 to about 130 nucleotides, about 10 to about 120 nucleotides, about 10 to about 110 nucleotides, about 10 to about 100 nucleotides, about 10 to about 90 nucleotides, about 10 to about 80 nucleotides, about 10 to about 70 nucleotides, about 10 to about 60 nucleotides, about 10 to about 50 nucleotides, about 10 to about 40 nucleotides, about 10 to about 30 nucleotides, about 10 to about 20 nucleotides.

[0291] The anti-VEGF antibody can compete with the anti-VEGF reference aptamer for binding to VEGF-165 and / or VEGF-121.

[0292] The anti-VEGF reference aptamers or anti-VEGF aptamers described herein may comprise a nucleotide sequence with or without modification. For example, an aptamer may comprise natural and / or modified nucleotides. When an aptamer is defined as comprising or consisting of a nucleotide sequence shown in a specific SEQ ID NO, the nucleotides in the sequence may be further modified.

[0293] According to the present application, the anti-VEGF aptamer r-AMS0401 has natural nucleotides, and its nucleotide sequence is as shown in SEQ ID NO: 1; the anti-VEGF aptamer AMS0401 has corresponding 2'-fluoro modified nucleotides, and its nucleotide sequence is as shown in SEQ ID NO: 31. Therefore, the aptamer comprising the nucleotide sequence shown in SEQ ID NO: 1 may include both r-AMS0401 and AMS0401, but the aptamer comprising the nucleotide sequence shown in SEQ ID NO: 31 may not include r-AMS0401.

[0294] Similarly, the anti-VEGF aptamer r-AMS0402 has natural nucleotides, the nucleotide sequence of which is as shown in SEQ ID NO: 2; and the anti-VEGF aptamer AMS0402 has corresponding 2'-fluoro modified nucleotides, the nucleotide sequence of which is as shown in SEQ ID NO: 32. The anti-VEGF aptamer r-AMS0403 has natural nucleotides, the nucleotide sequence of which is as shown in SEQ ID NO: 3; and the anti-VEGF aptamer AMS0403 has corresponding 2'-fluoro modified nucleotides, the nucleotide sequence of which is as shown in SEQ ID NO: 33. The anti-VEGF aptamer r-AMS0404 has natural nucleotides, the nucleotide sequence of which is as shown in SEQ ID NO: 4; and the anti-VEGF aptamer AMS0404 has corresponding 2'-fluoro modified nucleotides, the nucleotide sequence of which is as shown in SEQ ID NO: 34. The anti-VEGF aptamer r-AMS0405 has natural nucleotides, the nucleotide sequence of which is as shown in SEQ ID NO: 5; and the anti-VEGF aptamer AMS0405 has corresponding 2'-fluoro modified nucleotides, the nucleotide sequence of which is as shown in SEQ ID NO: 35. The anti-VEGF aptamer r-AMS0406 has natural nucleotides, the nucleotide sequence of which is as shown in SEQ ID NO: 6; and the anti-VEGF aptamer AMS0406 has corresponding 2'-fluoro modified nucleotides, the nucleotide sequence of which is as shown in SEQ ID NO: 36. The anti-VEGF aptamer r-AMS0407 has natural nucleotides, the nucleotide sequence of which is as shown in SEQ ID NO: 7; and the anti-VEGF aptamer AMS0407 has corresponding 2'-fluoro modified nucleotides, the nucleotide sequence of which is as shown in SEQ ID NO: 37. The anti-VEGF aptamer r-AMS0408 has natural nucleotides, and its nucleotide sequence is as shown in SEQ ID NO: 8; and the anti-VEGF aptamer AMS0408 has corresponding 2'-fluoro modified nucleotides, and its nucleotide sequence is as shown in SEQ ID NO: 38. The anti-VEGF aptamer r-AMS0409 has natural nucleotides, and its nucleotide sequence is as shown in SEQ ID NO: 9; and the anti-VEGF aptamer AMS0409 has corresponding 2'-fluoro modified nucleotides, and its nucleotide sequence is as shown in SEQ ID NO: 39. The VEGF aptamer r-AMS0410 has natural nucleotides, and its nucleotide sequence is as described in SEQ ID NO: 10; and the anti-VEGF aptamer AMS0410 has corresponding 2'-fluoro modified nucleotides, and its nucleotide sequence is as shown in SEQ ID NO: 40.VEGF aptamer r-AMS0411 has natural nucleotides, the nucleotide sequence of which is shown in SEQ ID NO: 11; and anti-VEGF aptamer AMS0411 has corresponding 2'-fluoro modified nucleotides, the nucleotide sequence of which is shown in SEQ ID NO: 41. VEGF aptamer r-AMS0416 has natural nucleotides, the nucleotide sequence of which is shown in SEQ ID NO: 12; and anti-VEGF aptamer AMS0416 has corresponding 2'-fluoro modified nucleotides, the nucleotide sequence of which is shown in SEQ ID NO: 42. Anti-VEGF aptamer r-AMS0419 has natural nucleotides, the nucleotide sequence of which is shown in SEQ ID NO: 13; and anti-VEGF aptamer AMS0419 has corresponding 2'-fluoro modified nucleotides, the nucleotide sequence of which is shown in SEQ ID NO: 43. The anti-VEGF aptamer r-AMS0420 has natural nucleotides, the nucleotide sequence of which is as shown in SEQ ID NO: 14; and the anti-VEGF aptamer AMS0420 has corresponding 2'-fluoro modified nucleotides, the nucleotide sequence of which is as shown in SEQ ID NO: 44. The anti-VEGF aptamer r-AMS0421 has natural nucleotides, the nucleotide sequence of which is as shown in SEQ ID NO: 15; and the anti-VEGF aptamer AMS0421 has corresponding 2'-fluoro modified nucleotides, the nucleotide sequence of which is as shown in SEQ ID NO: 45. The anti-VEGF aptamer r-AMS0425 has natural nucleotides, the nucleotide sequence of which is as shown in SEQ ID NO: 16; and the anti-VEGF aptamer AMS0425 has corresponding 2'-fluoro modified nucleotides, the nucleotide sequence of which is as shown in SEQ ID NO: 46. The anti-VEGF aptamer r-AMS0421.1 has natural nucleotides, and its nucleotide sequence is as shown in SEQ ID NO: 17; and the anti-VEGF aptamer AMS0421.1 has corresponding 2'-fluoro modified nucleotides, and its nucleotide sequence is as shown in SEQ ID NO: 47. The anti-VEGF aptamer r-AMS0427 has natural nucleotides, and its nucleotide sequence is as shown in SEQ ID NO: 18; and the anti-VEGF aptamer AMS0427 has corresponding 2'-fluoro modified nucleotides, and its nucleotide sequence is as shown in SEQ ID NO: 48. In addition, the anti-VEGF aptamer r-AMS0427 has natural nucleotides, and its nucleotide sequence is as shown in SEQ ID NO: 18; and the anti-VEGF aptamers AMS0427.1 and AMS0427.2 have corresponding nucleotides with various modifications, and their nucleotide sequences are as shown in SEQ ID NO: 49 and SEQ ID NO: 50, respectively.The anti-VEGF aptamer r-AMS0421.3 has natural nucleotides, and its nucleotide sequence is as shown in SEQ ID NO: 19; the anti-VEGF aptamer AMS0421.3 has corresponding 2'-fluoro modified nucleotides, and its nucleotide sequence is as shown in SEQ ID NO: 51. The anti-VEGF aptamer r-AMS0421.4 has natural nucleotides, and its nucleotide sequence is as shown in SEQ ID NO: 20; and the anti-VEGF aptamer AMS0421.4 has corresponding 2'-fluoro modified nucleotides, and its nucleotide sequence is as shown in SEQ ID NO: 52. The anti-VEGF aptamer r-AMS0421.5 has natural nucleotides, and its nucleotide sequence is as shown in SEQ ID NO: 21; and the anti-VEGF aptamer AMS0421.5 has corresponding 2'-fluoro modified nucleotides, and its nucleotide sequence is as shown in SEQ ID NO: 53. The anti-VEGF aptamer r-AMS0425.1 has natural nucleotides, the nucleotide sequence of which is as shown in SEQ ID NO: 22; and the anti-VEGF aptamer AMS0425.1 has corresponding 2'-fluoro modified nucleotides, the nucleotide sequence of which is as shown in SEQ ID NO: 54. The anti-VEGF aptamer r-AMS0426 has natural nucleotides, the nucleotide sequence of which is as shown in SEQ ID NO: 23; and the anti-VEGF aptamer AMS0426 has corresponding 2'-fluoro modified nucleotides, the nucleotide sequence of which is as shown in SEQ ID NO: 55. The anti-VEGF aptamer r-AMS0425.3 has natural nucleotides, the nucleotide sequence of which is as shown in SEQ ID NO: 24; and the anti-VEGF aptamer AMS0425.3 has corresponding 2'-fluoro modified nucleotides, the nucleotide sequence of which is as shown in SEQ ID NO: 56. The anti-VEGF aptamer r-AMS0425.8 has natural nucleotides, the nucleotide sequence of which is as shown in SEQ ID NO: 25; and the anti-VEGF aptamer AMS0425.8 has corresponding 2'-fluoro modified nucleotides, the nucleotide sequence of which is as shown in SEQ ID NO: 57. The anti-VEGF aptamer r-AMS0425.10 has natural nucleotides, the nucleotide sequence of which is as shown in SEQ ID NO: 26; and the anti-VEGF aptamer AMS0425.10 has corresponding 2'-fluoro modified nucleotides, the nucleotide sequence of which is as shown in SEQ ID NO: 58. The anti-VEGF aptamer r-AMS0425.11 has natural nucleotides, the nucleotide sequence of which is as shown in SEQ ID NO: 27; and the anti-VEGF aptamer AMS0425.11 has corresponding 2'-fluoro modified nucleotides, the nucleotide sequence of which is as shown in SEQ ID NO: 59.The anti-VEGF aptamer r-AMS0425.12 has natural nucleotides, the nucleotide sequence of which is as shown in SEQ ID NO: 28; and the anti-VEGF aptamer AMS0425.12 has corresponding 2'-fluoro modified nucleotides, the nucleotide sequence of which is as shown in SEQ ID NO: 60. The anti-VEGF aptamer r-AMS0425.16 has natural nucleotides, the nucleotide sequence of which is as shown in SEQ ID NO: 29; and the anti-VEGF aptamer AMS0425.16 has corresponding 2'-fluoro modified nucleotides, the nucleotide sequence of which is as shown in SEQ ID NO: 62. The anti-VEGF aptamer r-AMS0430 has natural nucleotides, the nucleotide sequence of which is as shown in SEQ ID NO: 30; and the anti-VEGF aptamer AMS0430 has corresponding 2'-fluoro modified nucleotides, the nucleotide sequence of which is as shown in SEQ ID NO: 61.

[0295] The anti-VEGF reference aptamer or anti-VEGF aptamer described in the present application may comprise a secondary structure, and the secondary structure comprises, from 5' to 3' direction, a first stem, a first protrusion, a second stem, a second protrusion, a third stem, a third protrusion, a fourth stem and a first loop. The anti-VEGF aptamer may comprise a secondary structure, and the secondary structure consists of, from 5' to 3' direction, a first stem, a first protrusion, a second stem, a second protrusion, a third stem, a third protrusion, a fourth stem and a first loop.

[0296] The anti-VEGF reference aptamer or anti-VEGF aptamer described in the present application may comprise a first consensus sequence, wherein the first consensus sequence comprises the nucleotide sequence shown in any one of SEQ ID NOs: 79-90.

[0297] Alternatively, or additionally, the anti-VEGF reference aptamer or anti-VEGF aptamer described herein may comprise a second consensus sequence, wherein the second consensus sequence comprises the nucleotide sequence shown in any one of SEQ ID NOs: 91-100.

[0298] For example, the anti-VEGF reference aptamer or anti-VEGF aptamer described in the present application may include a first consensus sequence containing the nucleotide sequence shown in SEQ ID NO: 79, and a second consensus sequence containing the nucleotide sequence shown in SEQ ID NO: 91; the anti-VEGF reference aptamer or anti-VEGF aptamer described in the present application may include a first consensus sequence containing the nucleotide sequence shown in SEQ ID NO: 80, and a second consensus sequence containing the nucleotide sequence shown in SEQ ID NO: 92; the anti-VEGF reference aptamer or anti-VEGF aptamer described in the present application may include a first consensus sequence containing the nucleotide sequence shown in SEQ ID NO: 81, and a second consensus sequence containing the nucleotide sequence shown in SEQ ID NO: 93; the anti-VEGF reference aptamer or anti-VEGF aptamer described in the present application may include a first consensus sequence containing the nucleotide sequence shown in SEQ ID NO: 82, and a second consensus sequence containing the nucleotide sequence shown in SEQ ID NO: 93; the anti-VEGF reference aptamer or anti-VEGF aptamer described in the present application may include a first consensus sequence containing the nucleotide sequence shown in SEQ ID NO: 83, and a second consensus sequence containing the nucleotide sequence shown in SEQ ID NO: NO:94; the anti-VEGF reference aptamer or anti-VEGF aptamer described in the present application may include a first consensus sequence containing the nucleotide sequence shown in SEQ ID NO:84, and a second consensus sequence containing the nucleotide sequence shown in SEQ ID NO:95; the anti-VEGF reference aptamer or anti-VEGF aptamer described in the present application may include a first consensus sequence containing the nucleotide sequence shown in SEQ ID NO:86, and a second consensus sequence containing the nucleotide sequence shown in SEQ ID NO:97; the anti-VEGF reference aptamer or anti-VEGF aptamer described in the present application may include a first consensus sequence containing the nucleotide sequence shown in SEQ ID NO:87, and a second consensus sequence containing the nucleotide sequence shown in SEQ ID NO:98; the anti-VEGF reference aptamer or anti-VEGF aptamer described in the present application may include a first consensus sequence containing the nucleotide sequence shown in SEQ ID NO:88, and a second consensus sequence containing the nucleotide sequence shown in SEQ ID NO:98; the anti-VEGF reference aptamer or anti-VEGF aptamer described in the present application may include a first consensus sequence containing the nucleotide sequence shown in SEQ ID NO:89, and a second consensus sequence containing the nucleotide sequence shown in SEQ ID NO: NO:99; the anti-VEGF reference aptamer or anti-VEGF aptamer described in the present application may include a first consensus sequence containing the nucleotide sequence shown in SEQ ID NO:90, and a second consensus sequence containing the nucleotide sequence shown in SEQ ID NO:100.

[0299] The first consensus sequence may be included in the nucleotide sequence that forms the first stem, first protrusion, second stem, second protrusion, third stem, third protrusion and / or fourth stem of an anti-VEGF reference aptamer or an anti-VEGF aptamer described herein. In some cases, the first consensus sequence may not be included in the nucleotide sequence that forms the first loop of an anti-VEGF reference aptamer or an anti-VEGF aptamer described herein. For example, the first consensus sequence may be present anywhere in the aptamer except in the region that forms the first loop.

[0300] For example, in some cases, the first consensus sequence may be contained in the second stem, the second bulge, and the third stem. In some cases, the first consensus sequence may be contained in the second stem, the second bulge, the third stem, and the third bulge. In some cases, the first consensus sequence may be contained in the second stem, the second bulge, the third stem, the third bulge, and the fourth stem.

[0301] The second consensus sequence may be included in the nucleotide sequence that forms the first stem, first protrusion, second stem, second protrusion, third stem, third protrusion and / or fourth stem of an anti-VEGF reference aptamer or an anti-VEGF aptamer described herein. In some cases, the second consensus sequence may not be included in the nucleotide sequence that forms the first loop of an anti-VEGF reference aptamer or an anti-VEGF aptamer described herein. For example, the second consensus sequence may be present anywhere in the aptamer except in the region that forms the first loop.

[0302] In some cases, the second consensus sequence may comprise the fourth stem, the third protuberance, the third stem, the second protuberance and the second stem. In some cases, the second consensus sequence may be contained in the third protuberance, the third stem, the second protuberance and the second stem. In some cases, the second consensus sequence may be contained in the third stem, the second protuberance and the second stem.

[0303] The first consensus sequence and the second consensus sequence can be paired to ensure that the secondary structure of the aptamer is correctly formed. For example, when selecting the first consensus sequence, those skilled in the art may be able to adjust the nucleotide sequence of the second consensus sequence as long as the secondary structure of the aptamer can be properly formed.

[0304] The anti-VEGF reference aptamer or anti-VEGF aptamer described in the present application may comprise a first consensus sequence and a second consensus sequence, wherein the first consensus sequence may be located at the 5′ end of the second consensus sequence.

[0305] In some cases, the anti-VEGF reference aptamer or anti-VEGF aptamer described herein may comprise a first consensus sequence and a second consensus sequence, wherein the second consensus sequence may be located at the 5′ end of the first consensus sequence.

[0306] The first loop of an anti-VEGF reference aptamer or an anti-VEGF aptamer described herein can comprise 2-30 nucleotides (e.g., at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29 or at least 30 nucleotides).

[0307] The anti-VEGF reference aptamer or anti-VEGF aptamer described herein may comprise a nucleotide sequence as shown in any one of SEQ ID NOs: 1-62, or a variant or truncated form thereof. A variant may comprise a nucleotide sequence having at least 50% identity to a nucleotide sequence as shown in any one of SEQ ID NOs: 1-62. A variant may comprise a nucleotide sequence as shown in any one of SEQ ID NOs: 1-62, which has one or more (e.g., 1-2, 1-3, 1-4, 1-5, 1-6, 1-7, 1-8, 1-9, 1-10, 1-11, 1-12, 1-13, 1-14, 1-15, 1-16, 1-17, 1-18, 1-19, 1-20 or more) nucleotide additions, deletions and / or substitutions.

[0308] The anti-VEGF reference aptamer may comprise about 10 to about 150 nucleotides. For example, the anti-VEGF interference aptamer may comprise about 10 to about 150 nucleotides, about 10 to about 140 nucleotides, about 10 to about 130 nucleotides, about 10 to about 120 nucleotides, about 10 to about 110 nucleotides, about 10 to about 100 nucleotides, about 10 to about 90 nucleotides, about 10 to about 80 nucleotides, about 10 to about 70 nucleotides, about 10 to about 60 nucleotides, about 10 to about 50 nucleotides, about 10 to about 40 nucleotides or about 10 to about 30 nucleotides, about 10 to about 20 nucleotides.

[0309] Anti-VEGF aptamer antibodies can be used to modulate the biological activity of VEGF or VEGF receptors.

[0310] Anti-VEGF aptamers can be used to prevent, treat and / or ameliorate VEGF-related diseases, disorders or conditions. For example, a VEGF-related disease, disorder or condition can be a neovascular disease, disorder or condition. For example, a VEGF-related disease, disorder or condition can be an ocular neovascular disease, disorder or condition. For example, a VEGF-related disease, disorder or condition can be selected from age-related macular degeneration, choroidal neovascularization, diabetic macular edema, retinal vein occlusion and diabetic retinopathy. For example, a VEGF-related disease, disorder or condition can be selected from wet age-related macular degeneration, myopic choroidal neovascularization and proliferative diabetic retinopathy.

[0311] In one aspect, the present application provides an anti-VEGF agent, which includes the aptamer described in the present application. The anti-VEGF agent may also include a polyethylene glycol (PEG) moiety. For example, the PEG moiety may be conjugated to the 5' end and / or the 3' end of the anti-VEGF aptamer.

[0312] In another aspect, the present application provides a composition comprising the anti-VEGF aptamer and / or anti-VEGF agent described herein.

[0313] In some cases, the composition can be a pharmaceutical composition. For example, the composition can include a pharmaceutically acceptable excipient or carrier.

[0314] In some cases, the composition may be present in discrete dosage forms, each containing a predetermined amount of active ingredient in the form of a powder or granules, a solution or a suspension in an aqueous or non-aqueous liquid. Such dosage forms may be prepared by any method known to those skilled in the art, for example, it may include a step of associating the active ingredient with a carrier, which constitutes one or more other ingredients. Typically, the composition is prepared by uniformly and intimately mixing the active ingredient with a liquid carrier or a finely divided solid carrier or both, and then, if necessary, shaping the product into the desired appearance.

[0315] The composition may include a therapeutically effective amount of an active composition (e.g., an anti-VEGF aptamer or anti-VEGF agent as described herein). A therapeutically effective amount may be an amount of the subject composition that is capable of preventing and / or treating (at least in part) a neovascular disease or condition and / or any complications thereof in a subject suffering from the disease or condition or at risk of developing the disease or condition. The specific amount / concentration of the active agent included may vary depending on the method of administration and the needs of the patient, and may be determined based on, for example, volume, viscosity, and / or the patient's weight. For example, a suitable dose may be from about 0.1 mg or 1 mg / kg / day to about 50 mg / kg / day; sometimes, the dose may be even higher. It should be understood that a person skilled in the art (e.g., a physician or pharmacist) may conveniently adjust these specific doses based on the conditions of the particular patient, formulation, and / or disease.

[0316] The composition may also include an effective amount of additional therapeutically active components, such as additional therapeutically active components for preventing, treating and / or ameliorating neovascular diseases or conditions. Each active component may be present in the pharmaceutical composition in a pharmaceutically effective amount. The anti-VEGF aptamers described herein may or may not be combined with additional active components.

[0317] Non-limiting exemplary compositions and methods for preparing such compositions are described below. For example, the composition may be in a form suitable for oral administration (such as tablets, capsules, pills, powders, sustained release formulations, solutions, suspensions), parenteral injection (such as sterile solutions, suspensions or emulsions), topical administration (such as ointments or creams) or rectal administration (such as suppositories). The composition may be a unit dosage form suitable for single administration of a precise dose. In certain embodiments, the composition may be a liquid pharmaceutical composition.

[0318] In the composition, the anti-VEGF aptamer can be combined with a pharmaceutical carrier by intimately mixing according to conventional pharmaceutical formulation techniques. The carrier can take a variety of forms depending on the form of preparation desired for administration.

[0319] The composition may further comprise one or more pharmaceutically acceptable additives and excipients. Such additives and excipients include, but are not limited to, anti-adherents, anti-foaming compositions, buffer compositions, polymers, antioxidants, preservatives, chelating compositions, viscosity modifiers, tension modifiers, flavoring agents, colorants, odorants, opacifiers, suspending compositions, adhesives, fillers, plasticizers, lubricants and / or mixtures thereof.

[0320] In another aspect, the present application provides a method for regulating the biological activity of VEGF or a VEGF receptor, comprising administering an effective amount of the anti-VEGF aptamer or anti-VEGF agent described herein to a subject in need thereof.

[0321] On the other hand, the present application provides a method for preventing, treating and / or improving VEGF-related diseases, disorders or conditions, comprising administering an effective amount of the anti-VEGF aptamer or anti-VEGF agent described herein to a subject in need thereof.

[0322] For example, a VEGF-related disease, disorder or condition can be a neovascular disease, disorder or condition. For example, a VEGF-related disease, disorder or condition can be an ocular neovascular disease, disorder or condition. For example, a VEGF-related disease, disorder or condition can be selected from age-related macular degeneration, choroidal neovascularization, diabetic macular edema, retinal vein occlusion, and diabetic retinopathy. For example, a VEGF-related disease, disorder or condition can be selected from wet age-related macular degeneration, myopic choroidal neovascularization, and proliferative diabetic retinopathy.

[0323] In one aspect, the present application provides a use of the anti-VEGF aptamer or anti-VEGF agent described in the present application in the preparation of an agent for regulating the biological activity of VEGF or VEGF receptor.

[0324] In one aspect, the present application provides a use of the aptamer described in the present application or the anti-VEGF agent described in the present application in the preparation of a medicament for preventing, treating and / or ameliorating VEGF-related diseases, disorders or conditions.

[0325] VEGF-related diseases, disorders or conditions can be neovascular diseases, disorders or conditions. For example, VEGF-related diseases, disorders or conditions can be ocular neovascular diseases, disorders or conditions. For example, VEGF-related diseases, disorders or conditions can be selected from age-related macular degeneration, choroidal neovascularization, diabetic macular edema, retinal vein occlusion and diabetic retinopathy. For example, VEGF-related diseases, disorders or conditions can be selected from wet age-related macular degeneration, myopic choroidal neovascularization and proliferative diabetic retinopathy.

[0326] Anti-Ang2 Aptamer

[0327] In one aspect, the present application provides an aptamer having a K of about 500 picomolar (pM) or less. D For example, the anti-Ang2 aptamer can specifically bind to Ang2 with a K of about 500 picomolar (pM) or less, about 400 picomolar (pM) or less, about 300 picomolar (pM) or less, about 200 picomolar (pM) or less, about 100 picomolar (pM) or less, about 90 picomolar (pM) or less, about 80 picomolar (pM) or less, about 70 picomolar (pM) or less, about 60 picomolar (pM) or less, about 50 picomolar (pM) or less, about 40 picomolar (pM) or less, about 30 picomolar (pM) or less, or about 20 picomolar (pM) or less. D Value for binding to Ang2.

[0328] Ang2 can be human Ang2, mouse Ang2, monkey Ang2, rabbit Ang2 and / or rat Ang2.

[0329] The anti-Ang2 aptamer may not substantially bind to human Ang1. For example, the anti-Ang2 aptamer may bind to Ang1 with an affinity that is significantly lower (e.g., at least 1-fold lower, at least 2-fold lower, up to 3-fold lower, at least 4-fold lower, or more) than its affinity for Ang2. In some cases, the anti-Ang2 aptamer may bind to Ang1, wherein K D Values ​​cannot be measured using ligand binding assays combined with radioactivity or fluorescence measurements, surface plasmon resonance (SPR), biolayer interferometry (BLI, e.g. System), SRU Biosystems The results are measured by isothermal titration calorimetry (ITC) or microthermophoresis (MST).

[0330] Anti-Ang2 aptamers can inhibit the interaction between Ang2 and Tie2.

[0331] The anti-Ang2 aptamers described herein may be able to reduce and / or improve angiogenesis and / or vascular permeability in an animal model, such as an ocular animal model. For example, the ocular animal model may be an oxygen-induced ischemic retinopathy (OIR) model. The animal model may be a vertebrate model, and in some cases, the animal model may be a mammalian model. The animal may be a rat, a mouse, a rabbit, a goat, a sheep, a non-human primate, or any other suitable animal.

[0332] The anti-Ang2 aptamers described herein may be capable of reducing neovascularization and / or reducing vascular permeability in a mouse oxygen-induced ischemic retinopathy (OIR) model.

[0333] The anti-Ang2 aptamers described herein may be highly soluble. For example, the anti-Ang2 aptamers may be soluble in a solvent to a relatively high degree (e.g., 80% or more of the total weight, 85% or more of the total weight, 90% or more of the total weight, 95% or more of the total weight, 99% or more of the total weight). For example, the anti-Ang2 aptamers may be formulated to a concentration of 100 mg / ml or more, 150 mg / ml or more, such as at least 200 mg / ml.

[0334] The anti-Ang2 aptamer may be an RNA aptamer, a DNA aptamer, or a combination thereof. For example, the anti-VEGF aptamer may comprise primarily RNA, it may comprise primarily DNA, or it may comprise both RNA and DNA.

[0335] The anti-Ang2 aptamer may comprise one or more modified nucleotides. In some cases, all nucleotides of the anti-Ang2 aptamer may be modified nucleotides.

[0336] For example, the modified nucleotide may comprise a chemical substitution or modification at one or more positions independently selected from the ribose position, the deoxyribose position, the phosphate position and the base position. The modified nucleotide may include one or more modifications independently selected from the following modifications: 2'-position sugar modification, 2'-amino (2'-NH2) modification, 2'-fluoro (2'-F) modification, 2'-O-methyl (2'-OMe) modification, 2'-O-(2-methoxyethyl) (2'-O-MOE) modification, 5-position modified pyrimidine, modification at the cytosine exocyclic amine, substitution with 5'-bromouracil, substitution with 5'-bromodeoxyuridine, substitution with 5'-bromodeoxycytidine, backbone modification, locked nucleic acid (LNA), methylation, 3' cap and 5' cap. The 5-position modified pyrimidine is selected from 5-carboxy-2'-deoxyuridine, 5-aminoallyl-2'-deoxyuridine, 5-[(3-indolyl)propionamide-N-allyl]-2'-deoxyuridine, 5-carboxy-2'-deoxycytidine, 5-aminoallyl-2'-deoxycytidine, biotin-16-aminoallyl-2'-deoxycytidine, 5-(N-benzylcarboxamide)-2'-deoxyuridine, 5-(N-isobutylcarboxamide)-2'-deoxyuridine, 5-(N-naphthylmethylcarboxamide)-2'-deoxyuridine and 5-(N-tryptophanaminocarboxamide)-2'-deoxyuridine.

[0337] The anti-Ang2 aptamer may comprise at least one (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more) 2'-modified nucleotide. In some cases, all nucleotides of the anti-Ang2 aptamer may be 2'-modified nucleotides. The 2'-modified nucleotides may be selected from 2'-amino modified nucleotides, 2'-fluoro modified nucleotides, 2'-O-methyl modified nucleotides and 2'-O-(2-methoxyethyl) modified nucleotides. For example, the 2'-fluoro modified nucleotides may be 2'-fluoro (2'-fluoro) modified nucleotides or 2'-fluoro-2'-deoxy modified nucleotides. For example, the 2'-fluoro modified nucleotides may comprise the following structures:

[0338] The anti-Ang2 aptamer may comprise at least one 2'-fluoro modified nucleotide, at least one 2'-O-methyl modified nucleotide and / or at least one LNA.

[0339] In some cases, all cytidines of the anti-Ang2 aptamer may be 2'-modified cytidines. In some cases, all cytidines may be 2'-fluoro-modified cytidines and / or 2'-O-methyl-modified cytidines. In some cases, all cytidines may be 2'-deoxy-2'-fluoro cytidines. In some cases, all uridines may be 2'-modified uridines. In some cases, all uridines may be 2'-fluoro-modified uridines and / or 2'-O-methyl-modified uridines. In some cases, all uridines may be 2'-deoxy-2'-fluoro uridines. In some cases, all adenosines may be 2'-modified adenosines. In some cases, all adenosines may be 2'-fluoro-modified adenosines and / or 2'-O-methyl-modified adenosines. In some cases, all adenosines may be 2'-deoxy-2'-fluoro adenosines. In some cases, all guanosines may be 2'-modified guanosines. In some cases, all guanosines may be 2'-fluoro modified guanosines and / or 2'-O-methyl modified guanosines. In some cases, all guanosines may be 2'-deoxy-2'-fluoro guanosines. In some cases, all nucleotides may be 2'-fluoro modified nucleotides and / or 2'-O-methyl modified nucleotides. In some cases, all nucleotides may be 2'-fluoro modified nucleotides.

[0340] In some cases, the anti-Ang2 aptamer does not contain any natural nucleotides (eg, unmodified A, C, T, U, or G).

[0341] The anti-Ang2 peptide may comprise about 10 to about 150 nucleotides. For example, the anti-Ang2 aptamer may comprise about 10 to about 150 nucleotides, about 10 to about 140 nucleotides, about 10 to about 130 nucleotides, about 10 to about 120 nucleotides, about 10 to about 110 nucleotides, about 10 to about 100 nucleotides, about 10 to about 90 nucleotides, about 10 to about 80 nucleotides, about 10 to about 70 nucleotides, about 10 to about 60 nucleotides, about 10 to about 50 nucleotides, about 10 to about 40 nucleotides, about 10 to about 30 nucleotides, or about 10 to about 20 nucleotides.

[0342] The anti-Ang2 aptamer can compete with the anti-Ang2 reference aptamer for binding to Ang2.

[0343] The anti-Ang2 reference aptamer or anti-Ang2 aptamer described herein may comprise a nucleotide sequence with or without modification. For example, the aptamer may comprise natural and / or modified nucleotides. When an aptamer is defined as comprising or consisting of a nucleotide sequence shown in a specific SEQ ID NO, the nucleotides in the sequence may be further modified.

[0344] According to the present application, the anti-Ang2 aptamer r-AMS0526 has natural nucleotides, and the nucleotide sequence is as shown in SEQ ID NO: 64; the anti-Ang2 aptamer AMS0526 has corresponding 2'-fluoro modified nucleotides, and the nucleotide sequence is as shown in SEQ ID NO: 68. Therefore, the aptamer comprising the nucleotide sequence shown in SEQ ID NO: 64 may cover both r-AMS0526 and AMS0526, but the aptamer comprising the nucleotide sequence shown in SEQ ID NO: 68 may not cover r-AMS0526.

[0345] Similarly, the anti-Ang2 aptamer r-AMS0525 has natural nucleotides, the nucleotide sequence is as shown in SEQ ID NO: 63; and the anti-Ang2 aptamer AMS0525 has corresponding 2'-fluoro modified nucleotides, the nucleotide sequence is as shown in SEQ ID NO: 67. The anti-Ang2 aptamer r-AMS0525.3 has natural nucleotides, the nucleotide sequence is as shown in SEQ ID NO: 65; and the anti-Ang2 aptamer AMS0525.3 has corresponding 2'-fluoro modified nucleotides, the nucleotide sequence is as shown in SEQ ID NO: 69. The anti-Ang2 aptamer r-AMS0525.4 has natural nucleotides, the nucleotide sequence is as shown in SEQ ID NO: 66; and the anti-Ang2 aptamer AMS0525.4 has corresponding 2'-fluoro modified nucleotides, the nucleotide sequence is as shown in SEQ ID NO: 70. The anti-Ang2 aptamer r-AMS0525 has natural nucleotides, and its nucleotide sequence is as shown in SEQ ID NO:63; and the anti-Ang2 aptamer AMS0525.5, AMS0525.6, AMS0525.7 or AMS0525.8 has the corresponding nucleotides with various modifications, and its nucleotide sequence is as shown in SEQ ID NO:71-74.

[0346] The anti-Ang2 reference aptamer or anti-Ang2 aptamer described in the present application may comprise a secondary structure, and the secondary structure comprises a first stem, a first protrusion, a second stem, a second protrusion, a third stem, a third protrusion, a fourth stem and a first loop from 5' to 3' direction. The anti-Ang2 aptamer may comprise a secondary structure, and the secondary structure consists of a first stem, a first protrusion, a second stem, a second protrusion, a third stem, a third protrusion, a fourth stem and a first loop from 5' to 3' direction.

[0347] The anti-Ang2 reference aptamer or anti-Ang2 aptamer described in the present application may comprise a first consensus sequence, wherein the first consensus sequence comprises the nucleotide sequence shown in any one of SEQ ID NOs: 101-108.

[0348] Alternatively, or additionally, the anti-Ang2 reference aptamer or anti-Ang2 aptamer described herein may comprise a second consensus sequence, wherein the second consensus sequence comprises the nucleotide sequence shown in any one of SEQ ID NOs: 109-116.

[0349] For example, the anti-Ang2 reference aptamer or anti-Ang2 aptamer described in the present application may include a first consensus sequence containing the nucleotide sequence shown in SEQ ID NO: 101, and a second consensus sequence containing the nucleotide sequence shown in SEQ ID NO: 109; the anti-Ang2 reference aptamer or anti-Ang2 aptamer described in the present application may include a first consensus sequence containing the nucleotide sequence shown in SEQ ID NO: 102, and a second consensus sequence containing the nucleotide sequence shown in SEQ ID NO: 110; the anti-Ang2 reference aptamer or anti-Ang2 aptamer described in the present application may include a first consensus sequence containing the nucleotide sequence shown in SEQ ID NO: 103, and a second consensus sequence containing the nucleotide sequence shown in SEQ ID NO: 111; the anti-Ang2 reference aptamer or anti-Ang2 aptamer described in the present application may include a first consensus sequence containing the nucleotide sequence shown in SEQ ID NO: 104, and a second consensus sequence containing the nucleotide sequence shown in SEQ ID NO: 112; the anti-Ang2 reference aptamer or anti-Ang2 aptamer described in the present application may include a first consensus sequence containing the nucleotide sequence shown in SEQ ID NO: 105, and a second consensus sequence containing the nucleotide sequence shown in SEQ ID NO: NO:113; the anti-Ang2 reference aptamer or anti-Ang2 aptamer described in the present application may include a first consensus sequence containing the nucleotide sequence shown in SEQ ID NO:106, and a second consensus sequence containing the nucleotide sequence shown in SEQ ID NO:114; the anti-Ang2 reference aptamer or anti-Ang2 aptamer described in the present application may include a first consensus sequence containing the nucleotide sequence shown in SEQ ID NO:107, and a second consensus sequence containing the nucleotide sequence shown in SEQ ID NO:115; the anti-Ang2 reference aptamer or anti-Ang2 aptamer described in the present application may include a first consensus sequence containing the nucleotide sequence shown in SEQ ID NO:108, and a second consensus sequence containing the nucleotide sequence shown in SEQ ID NO:116.

[0350] The first consensus sequence may be included in the nucleotide sequence of the first stem, the first protrusion, the second stem, the second protrusion, the third stem, the third protrusion and / or the fourth stem of the anti-Ang2 reference aptamer of the anti-Ang2 aptamer described in the present application. In some cases, the first consensus sequence may not be included in the nucleotide sequence forming the first loop of the anti-Ang2 reference aptamer or the anti-Ang2 aptamer described in the present application. For example, the first consensus sequence may be present anywhere in the aptamer except in the region forming the first loop.

[0351] In some cases, the first consensus sequence may be included in the first stem, the first bulge, the second stem and the second stem. In some cases, the first consensus sequence may be included in the first stem, the first bulge, the second stem, the second bulge and the third stem. In some cases, the first consensus sequence may be included in the first stem, the first bulge, the second stem, the second bulge, the third stem and the third bulge. In some cases, the first consensus sequence may be included in the first stem, the first bulge, the second stem, the second bulge, the third stem and the third bulge. In some cases, the first consensus sequence may be included in the first stem, the first bulge, the second stem, the second bulge, the third stem, the third bulge and the fourth stem. In some cases, the first consensus sequence may be included in the second stem, the second bulge and the third stem. In some cases, the first consensus sequence may be included in the second stem, the second bulge, the third stem and the third bulge. In some cases, the first consensus sequence may be included in the second stem, the second bulge, the third stem, the third bulge and the fourth stem. In some cases, the first consensus sequence may be included in the third stem, the third bulge and the fourth stem.

[0352] The second consensus sequence may be included in the nucleotide sequence forming the first stem, first protrusion, second stem, second protrusion, third stem, third protrusion and / or fourth stem of the anti-Ang2 reference aptamer or anti-Ang2 aptamer described herein. In some cases, the second consensus sequence may not be included in the nucleotide sequence forming the first loop of the anti-Ang2 reference aptamer or anti-Ang2 aptamer described herein. For example, the second consensus sequence may be present anywhere in the aptamer except in the region forming the first loop.

[0353] In some cases, the second consensus sequence may be included in the first stem, the first bulge, the second stem and the second stem. In some cases, the second consensus sequence may be included in the first stem, the first bulge, the second stem, the second bulge and the third stem. In some cases, the second consensus sequence may be included in the first stem, the first bulge, the second stem, the second bulge, the third stem and the third bulge. In some cases, the second consensus sequence may be included in the first stem, the first bulge, the second stem, the second bulge, the third stem and the third bulge. In some cases, the second consensus sequence may be included in the first stem, the first bulge, the second stem, the second bulge, the third stem, the third bulge and the fourth stem. In some cases, the second consensus sequence may be included in the second stem, the second bulge and the third stem. In some cases, the second consensus sequence may be included in the second stem, the second bulge, the third stem and the third bulge. In some cases, the second consensus sequence may be included in the second stem, the second bulge, the third stem, the third bulge and the fourth stem. In some cases, the second consensus sequence may be included in the third stem, the third bulge and the fourth stem.

[0354] The first consensus sequence and the second consensus sequence can be paired to ensure that the secondary structure of the aptamer is correctly formed. For example, when selecting the first consensus sequence, those skilled in the art may be able to adjust the nucleotide sequence of the second consensus sequence as long as the secondary structure of the aptamer can be correctly formed.

[0355] The anti-Ang2 reference aptamer or anti-Ang2 aptamer described in the present application may comprise a first consensus sequence and a second consensus sequence, wherein the first consensus sequence may be located at the 5′ end of the second consensus sequence.

[0356] In some cases, the anti-Ang2 reference aptamer or anti-Ang2 aptamer described herein may comprise a first consensus sequence and a second consensus sequence, wherein the second consensus sequence may be located at the 5′ end of the first consensus sequence.

[0357] For example, 1) the first consensus sequence may be contained in the second stem, the second bulge, the third stem, the third bulge and the fourth stem; while the second consensus sequence may be contained in the fourth stem, the third bulge, the third stem, the second bulge and the second stem; 2) the first consensus sequence may be contained in the first bulge, the second stem, the second bulge, the third stem, the third bulge and the fourth stem; while the second consensus sequence may be contained in the fourth stem, the third bulge, the third stem, the second bulge, the second stem and the first bulge; or, 3) the first consensus sequence may be contained in the nucleotide sequence forming the first stem, the second stem, the second bulge, the third stem, the third bulge and the fourth stem; while the second consensus sequence may be contained in the fourth stem, the third bulge, the third stem, the second bulge and the second stem, the first bulge and the first stem.

[0358] For example, 1) the second consensus sequence may be contained in the second stem, the second bulge, the third stem, the third bulge and the fourth stem; while the first consensus sequence may be contained in the fourth stem, the third bulge, the third stem, the second bulge and the second stem; 2) the second consensus sequence may be contained in the first bulge, the second stem, the second bulge, the third stem, the third bulge and the fourth stem; while the first consensus sequence may be contained in the fourth stem, the third bulge, the third stem, the second bulge, the second stem and the first bulge; or, 3) the second consensus sequence may be contained in the nucleotide sequence forming the first stem, the second stem, the second bulge, the third stem, the third bulge and the fourth stem; while the first consensus sequence may be contained in the fourth stem, the third bulge, the third stem, the second bulge and the second stem, the first bulge and the first stem.

[0359] The first loop of the anti-Ang2 reference aptamer or the anti-Ang2 aptamer described herein may comprise 2-30 nucleotides (e.g., at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 20, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29 or at least 30 nucleotides).

[0360] The anti-Ang2 reference aptamer or anti-Ang2 aptamer described herein may comprise a nucleotide sequence as shown in any one of SEQ ID NOs: 63-74, or a variant or truncated form thereof. The variant may comprise a nucleotide sequence having at least 50% identity with the nucleotide sequence as shown in any one of SEQ ID NOs: 63-74. The variant may comprise a nucleotide sequence as shown in any one of SEQ ID NOs: 63-74, which has one or more (e.g., 1-2, 1-3, 1-4, 1-5, 1-6, 1-7, 1-8, 1-9, 1-10, 1-11, 1-12, 1-13, 1-14, 1-15, 1-16, 1-17, 1-18, 1-19, 1-20 or more) nucleotide additions, deletions and / or substitutions.

[0361] The anti-Ang2 reference aptamer may comprise about 10 to about 150 nucleotides. For example, the anti-Ang2 reference aptamer may comprise about 10 to about 150 nucleotides, about 10 to about 140 nucleotides, about 10 to about 130 nucleotides, about 10 to about 120 nucleotides, about 10 to about 110 nucleotides, about 10 to about 100 nucleotides, about 10 to about 90 nucleotides, about 10 to about 80 nucleotides, about 10 to about 70 nucleotides, about 10 to about 60 nucleotides, about 10 to about 50 nucleotides, about 10 to about 40 nucleotides, about 10 to about 30 nucleotides, or about 10 to about 20 nucleotides.

[0362] Anti-Ang2 aptamers can be used to modulate the biological activity of Ang2 or Tie2.

[0363] Anti-Ang2 aptamers can be used to prevent, treat and / or ameliorate Ang2-related diseases, disorders or conditions. For example, Ang2-related diseases, disorders or conditions can be neovascular diseases, disorders or conditions. For example, Ang2-related diseases, disorders or conditions can be ocular neovascular diseases, disorders or conditions. For example, Ang2-related diseases, disorders or conditions can be selected from age-related macular degeneration, choroidal neovascularization, diabetic macular edema, retinal vein occlusion and diabetic retinopathy. For example, Ang2-related diseases, disorders or conditions can be selected from wet age-related macular degeneration, myopic choroidal neovascularization and proliferative diabetic retinopathy.

[0364] In one aspect, the present application provides an anti-Ang2 agent, which includes the aptamer described in the present application. The anti-Ang2 agent may also include a polyethylene glycol (PEG) moiety. For example, the polyethylene glycol moiety may be conjugated to the 5' end and / or 3' end of the anti-Ang2 aptamer.

[0365] In another aspect, the present application provides a composition comprising the anti-Ang2 aptamer and / or anti-Ang2 agent described herein.

[0366] In some cases, the composition can be a pharmaceutical composition. For example, the composition can include a pharmaceutically acceptable excipient or carrier.

[0367] In some cases, the composition may be present in discrete dosage forms, each containing a predetermined amount of active ingredient in the form of a powder or granules, a solution or a suspension in an aqueous or non-aqueous liquid. Such dosage forms may be prepared by any method known to those skilled in the art, for example, it may include a step of associating the active ingredient with a carrier, which constitutes one or more other ingredients. Typically, the composition is prepared by uniformly and intimately mixing the active ingredient with a liquid carrier or a finely divided solid carrier or both, and then, if necessary, shaping the product into the desired appearance.

[0368] The composition may include a therapeutically effective amount of an active composition (e.g., an anti-Ang2 aptamer or anti-Ang2 agent as described herein). A therapeutically effective amount may be an amount of the subject composition that is capable of preventing and / or treating (at least in part) a neovascular disease or disorder and / or any complications thereof in a subject suffering from the disease or disorder or at risk of developing the disease or disorder. The specific amount / concentration of the active agent included may vary depending on the method of administration and the needs of the patient, and may be determined based on, for example, volume, viscosity, and / or the patient's weight. For example, a suitable dose may be from about 0.1 mg or 1 mg / kg / day to about 50 mg / kg / day; sometimes, the dose may be even higher. It should be understood that a person skilled in the art (e.g., a physician or pharmacist) may conveniently adjust these specific doses based on the conditions of the particular patient, formulation, and / or disease.

[0369] The composition may also include an effective amount of additional therapeutically active components, such as additional therapeutically active components for preventing, treating and / or ameliorating neovascular diseases or conditions. Each active component may be present in the pharmaceutical composition in a pharmaceutically effective amount. The anti-Ang2 aptamers described herein may or may not be combined with additional active components.

[0370] In some cases, the additional therapeutically active component may be an anti-VEGF agent. The anti-VEGF agent may include aflibercept. The anti-VEGF agent may also include an anti-VEGF aptamer described herein.

[0371] Non-limiting exemplary compositions and methods for preparing such compositions are described below. For example, the composition can be in a form suitable for oral administration, such as tablets, capsules, pills, powders, sustained release formulations, solutions, suspensions, parenteral injections, such as sterile solutions, suspensions or emulsions, topical administration such as ointments or creams, or rectal administration such as suppositories. The composition can be a unit dosage form suitable for single administration of a precise dose. In certain embodiments, the composition can be a liquid pharmaceutical composition.

[0372] In the composition, the anti-Ang2 aptamer can be intimately mixed with a pharmaceutical carrier according to conventional pharmaceutical formulation techniques. The carrier can take a variety of forms depending on the form of preparation desired for administration.

[0373] The composition may further comprise one or more pharmaceutically acceptable additives and excipients. Such additives and excipients include, but are not limited to, anti-adherents, anti-foaming compositions, buffer compositions, polymers, antioxidants, preservatives, chelating compositions, viscosity modifiers, tension modifiers, flavoring agents, colorants, odorants, opacifiers, suspending compositions, adhesives, fillers, plasticizers, lubricants and / or mixtures thereof.

[0374] In one aspect, the present application provides a method for modulating the biological activity of Ang2 or Tie2, comprising administering an effective amount of the anti-Ang2 aptamer or anti-Ang2 agent described herein to a subject in need thereof.

[0375] In one aspect, the present application provides a method for preventing, treating and / or ameliorating Ang2-related diseases, disorders or conditions, comprising administering an effective amount of the anti-Ang2 aptamer or anti-Ang2 agent described herein to a subject in need thereof.

[0376] For example, the Ang2-related disease, disorder or condition may be a neovascular disease, disorder or condition, and may be a neovascular disease, disorder or condition. The Ang2-related disease, disorder or condition may be an ocular neovascular disease, disorder or condition. The Ang2-related disease, disorder or condition may be selected from age-related macular degeneration, choroidal neovascularization, diabetic macular edema, retinal vein occlusion and diabetic retinopathy. The Ang2-related disease, disorder or condition may be selected from wet age-related macular degeneration, myopic choroidal neovascularization and proliferative diabetic retinopathy.

[0377] The method may further comprise administering an anti-VEGF agent to the subject. The anti-VEGF agent may comprise aflibercept and / or an anti-VEGF aptamer described herein.

[0378] In another aspect, the present application provides a use of the anti-Ang2 aptamer or anti-Ang2 agent described in the present application in the preparation of an agent for regulating the biological activity of Ang2 or Tie2.

[0379] In one aspect, the present application provides a use of the aptamer described herein or the anti-Ang2 agent described herein in the preparation of a medicament for preventing, treating and / or ameliorating Ang2-related diseases, disorders or conditions.

[0380] For example, the Ang2-related disease, disorder or condition may be a neovascular disease, disorder or condition, and may be a neovascular disease, disorder or condition. The Ang2-related disease, disorder or condition may be an ocular neovascular disease, disorder or condition. The Ang2-related disease, disorder or condition may be selected from age-related macular degeneration, choroidal neovascularization, diabetic macular edema, retinal vein occlusion and diabetic retinopathy. The Ang2-related disease, disorder or condition may be selected from wet age-related macular degeneration, myopic choroidal neovascularization and proliferative diabetic retinopathy.

[0381] On the one hand, the present application provides the use of 1) a combination of an anti-Ang2 aptamer or an anti-Ang2 agent described herein and 2) an anti-VEGF agent (e.g., aflibercept and / or the anti-VEGF aptamer described herein) in the preparation of a medicament for preventing, treating and / or ameliorating neovascular diseases, disorders or conditions.

[0382] The anti-Ang2 aptamer or anti-Ang2 agent described herein can be administered simultaneously or sequentially with the anti-VEGF agent.

[0383] The neovascular disease, disorder or condition may be an ocular neovascular disease, disorder or condition. The neovascular disease, disorder or condition may be selected from age-related macular degeneration, choroidal neovascularization, diabetic macular edema, retinal vein occlusion and diabetic retinopathy. The neovascular disease, disorder or condition may be selected from wet age-related macular degeneration, myopic choroidal neovascularization and proliferative diabetic retinopathy.

[0384] Bispecific Aptamers

[0385] In one aspect, the present invention provides a bispecific aptamer, which comprises the anti-Ang2 aptamer described herein and the anti-VEGF aptamer described herein. The bispecific aptamer may be included in the composition described herein.

[0386] The bispecific aptamer can have the formula A1-(L)n-A2, wherein: A1 is an anti-VEGF aptamer described herein, and A2 is an anti-Ang2 aptamer described herein; or A1 is an anti-Ang2 aptamer described herein, and A2 is an anti-VEGF aptamer described herein; L is a linker; n is a number of at least 0. For example, n can be 0 to 20, such as 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20.

[0387] A bispecific aptamer may be able to specifically bind to both VEGF and Ang2.

[0388] For example, a bispecific aptamer can be expressed with a K of about 500 pMa or less. D The bispecific aptamer may bind to VEGF-121 with a K of about 500 picomolar (pM) or less, about 400 picomolar (pM) or less, about 300 picomolar (pM) or less, about 200 picomolar (pM) or less, about 100 picomolar (pM) or less, about 90 picomolar (pM) or less, about 80 picomolar (pM) or less, about 70 picomolar (pM) or less, about 60 picomolar (pM) or less, about 50 picomolar (pM) or less, about 40 picomolar (pM) or less, about 30 picomolar (pM) or less, about 20 picomolar (pM) or less.D values ​​for binding to VEGF-121), and bispecific aptamers can bind to VEGF-121 with a K of about 500 picomolar (pM) or less. D The bispecific aptamer may bind to Ang2 with a K of about 500 picomolar (pM) or less, about 400 picomolar (pM) or less, about 300 picomolar (pM) or less, about 200 picomolar (pM) or less, about 100 picomolar (pM) or less, about 90 picomolar (pM) or less, about 80 picomolar (pM) or less, about 70 picomolar (pM) or less, about 60 picomolar (pM) or less, about 50 picomolar (pM) or less, about 40 picomolar (pM) or less, about 30 picomolar (pM) or less, about 20 picomolar (pM) or less. D value for binding to Ang2).

[0389] L may be selected from the group consisting of a naturally occurring nucleotide linker, a modified nucleotide linker, a hydrocarbon linker, a polyethylene glycol linker, and combinations thereof.

[0390] In some cases, at least one L can be a polyethylene glycol linker. In some cases, at least one L can be a hexaethylene glycol (also known as H or PEG6) linker. For example, L can be a hexaethylene glycol linker, and n can be 0 to 10 (e.g., n is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10).

[0391] For example, A1 can be a VEGF aptamer comprising the nucleotide sequence shown in any one of SEQ ID NOs: 1-62, or a variant or truncated form thereof; and A2 can be an anti-Ang2 aptamer comprising the nucleotide sequence shown in any one of SEQ ID NOs: 63-74, or a variant or truncated form thereof.

[0392] As another example, A1 can be an anti-Ang2 aptamer comprising the nucleotide sequence shown in any one of SEQ ID NOs: 63-74, or a variant or truncated form thereof; and A2 can be an anti-VEGF aptamer comprising the nucleotide sequence shown in any one of SEQ ID NOs: 1-62, or a variant or truncated form thereof.

[0393] In certain cases of the bispecific aptamer, A1 is an anti-VEGF aptamer comprising the nucleotide sequence shown in SEQ ID NO:15 or a truncated form thereof, A2 is an anti-Ang2 aptamer comprising the nucleotide sequence shown in SEQ ID NO:64 or a truncated form thereof, L is a hexaethylene glycol linker, and n is 0 to 10.

[0394] In certain cases of the bispecific aptamer, A1 is an anti-VEGF aptamer comprising the nucleotide sequence shown in SEQ ID NO:18 or a truncated form thereof, A2 is an anti-Ang2 aptamer comprising the nucleotide sequence shown in SEQ ID NO:64 or a truncated form thereof, L is a hexaethylene glycol linker, and n is 0 to 10.

[0395] In certain cases of the bispecific aptamer, A1 is an anti-VEGF aptamer comprising the nucleotide sequence shown in SEQ ID NO:23 or a truncated form thereof, A2 is an anti-Ang2 aptamer comprising the nucleotide sequence shown in SEQ ID NO:64 or a truncated form thereof, L is a hexaethylene glycol linker, and n is 0 to 10.

[0396] In certain cases of the bispecific aptamer, A1 is an anti-Ang2 aptamer comprising the nucleotide sequence shown in SEQ ID NO:64 or a truncated form thereof, A2 is an anti-VEGF aptamer comprising the nucleotide sequence shown in SEQ ID NO:15 or a truncated form thereof, L is a hexaethylene glycol linker, and n is 0 to 10.

[0397] In certain cases of the bispecific aptamer, A1 is an anti-Ang2 aptamer comprising the nucleotide sequence shown in SEQ ID NO:64 or a truncated form thereof, A2 is an anti-VEGF aptamer comprising the nucleotide sequence shown in SEQ ID NO:18 or a truncated form thereof, L is a hexaethylene glycol linker, and n is 0 to 10.

[0398] In certain cases of the bispecific aptamer, A1 is an anti-Ang2 aptamer comprising the nucleotide sequence shown in SEQ ID NO:64 or a truncated form thereof, A2 is an anti-VEGF aptamer comprising the nucleotide sequence shown in SEQ ID NO:23 or a truncated form thereof, L is a hexaethylene glycol linker, and n is 0 to 10.

[0399] In certain cases of the bispecific aptamer, A1 is an anti-VEGF aptamer comprising the nucleotide sequence shown in SEQ ID NO:45 or a truncated form thereof, A2 is an anti-VEGF aptamer comprising the nucleotide sequence shown in SEQ ID NO:68 or a truncated form thereof, L is a hexaethylene glycol linker, and n is 0 to 10.

[0400] In certain cases of the bispecific aptamer, A1 is an anti-VEGF aptamer comprising the nucleotide sequence shown in SEQ ID NO:48 or a truncated form thereof, A2 is an anti-Ang2 aptamer comprising the nucleotide sequence shown in SEQ ID NO:68 or a truncated form thereof, L is a hexaethylene glycol linker, and n is 0 to 10.

[0401] In certain cases of the bispecific aptamer, A1 is an anti-VEGF aptamer comprising the nucleotide sequence shown in SEQ ID NO:55 or a truncated form thereof, A2 is an anti-Ang2 aptamer comprising the nucleotide sequence shown in SEQ ID NO:68 or a truncated form thereof, L is a hexaethylene glycol linker, and n is 0 to 10.

[0402] In certain cases of the bispecific aptamer, A1 is an anti-Ang2 aptamer comprising the nucleotide sequence shown in SEQ ID NO:68 or a truncated form thereof, A2 is an anti-VEGF aptamer comprising the nucleotide sequence shown in SEQ ID NO:45 or a truncated form thereof, L is a hexaethylene glycol linker, and n is 0 to 10.

[0403] In certain cases of the bispecific aptamer, A1 is an anti-Ang2 aptamer comprising the nucleotide sequence shown in SEQ ID NO:68 or a truncated form thereof, A2 is an anti-VEGF aptamer comprising the nucleotide sequence shown in SEQ ID NO:48 or a truncated form thereof, L is a hexaethylene glycol linker, and n is 0 to 10.

[0404] In certain cases of the bispecific aptamer, A1 is an anti-Ang2 aptamer comprising the nucleotide sequence shown in SEQ ID NO:68 or a truncated form thereof, A2 is an anti-VEGF aptamer comprising the nucleotide sequence shown in SEQ ID NO:55 or a truncated form thereof, L is a hexaethylene glycol linker, and n is 0 to 10.

[0405] In some cases, the bispecific aptamer may comprise the nucleotide sequence set forth in any one of SEQ ID NOs: 75-78 and 138-157.

[0406] The bispecific aptamer can be selected from r-AMSB101, r-AMSB102, r-AMSB103, r-AMSB104, r-AMSB105, r-AMSB106, r-AMSB103.1, r-AMSB103.2, r-AMSB103.3, r-AMSB103.4, r-AMSB103.5, r-AMSB103.6, AMSB101, AMSB102, AMSB103, AMSB104, AMSB105, AMSB106, AMSB103.1, AMSB103.2, AMSB103.3, AMSB103.4, AMSB103.5 and AMSB103.6.

[0407] In r-AMSB101, A1 is an anti-VEGF aptamer comprising the nucleotide sequence shown in SEQ ID NO: 15, A2 is an anti-Ang2 aptamer comprising the nucleotide sequence shown in SEQ ID NO: 64, L is a hexaethylene glycol linker, and n is 0.

[0408] In r-AMSB102, A1 is an anti-VEGF aptamer comprising the nucleotide sequence shown in SEQ ID NO:23, A2 is an anti-Ang2 aptamer comprising the nucleotide sequence shown in SEQ ID NO:64, L is a hexaethylene glycol linker, and n is 0.

[0409] In r-AMSB103, A1 is an anti-VEGF aptamer comprising the nucleotide sequence shown in SEQ ID NO: 18, A2 is an anti-Ang2 aptamer comprising the nucleotide sequence shown in SEQ ID NO: 64, L is a hexaethylene glycol linker, and n is 0.

[0410] In r-AMSB104, A1 is an anti-VEGF aptamer comprising the nucleotide sequence shown in SEQ ID NO:64, A2 is an anti-Ang2 aptamer comprising the nucleotide sequence shown in SEQ ID NO:15, L is a hexaethylene glycol linker, and n is 0.

[0411] In r-AMSB105, A1 is an anti-VEGF aptamer comprising the nucleotide sequence shown in SEQ ID NO:64, A2 is an anti-Ang2 aptamer comprising the nucleotide sequence shown in SEQ ID NO:23, L is a hexaethylene glycol linker, and n is 0.

[0412] In r-AMSB106, A1 is an anti-VEGF aptamer comprising the nucleotide sequence shown in SEQ ID NO:64, A2 is an anti-Ang2 aptamer comprising the nucleotide sequence shown in SEQ ID NO:18, L is a hexaethylene glycol linker, and n is 0.

[0413] In r-AMSB103.1, A1 is an anti-VEGF aptamer comprising the nucleotide sequence shown in SEQ ID NO:18, A2 is an anti-Ang2 aptamer comprising the nucleotide sequence shown in SEQ ID NO:64, L is a hexaethylene glycol linker, and n is 1.

[0414] In r-AMSB103.2, A1 is an anti-VEGF aptamer comprising the nucleotide sequence shown in SEQ ID NO:18, A2 is an anti-Ang2 aptamer comprising the nucleotide sequence shown in SEQ ID NO:64, L is a hexaethylene glycol linker, and n is 2.

[0415] In r-AMSB103.3, A1 is an anti-VEGF aptamer comprising the nucleotide sequence shown in SEQ ID NO:18, A2 is an anti-Ang2 aptamer comprising the nucleotide sequence shown in SEQ ID NO:64, L is a hexaethylene glycol linker, and n is 3.

[0416] In r-AMSB103.4, A1 is an anti-VEGF aptamer comprising the nucleotide sequence shown in SEQ ID NO:18, A2 is an anti-Ang2 aptamer comprising the nucleotide sequence shown in SEQ ID NO:64, L is a hexaethylene glycol linker, and n is 4.

[0417] In r-AMSB103.5, A1 is an anti-VEGF aptamer comprising the nucleotide sequence shown in SEQ ID NO:18, A2 is a nucleotide sequence shown in SEQ ID NO:64, L is a hexaethylene glycol linker, and n is 5.

[0418] In r-AMSB103.6, A1 is an anti-VEGF aptamer comprising the nucleotide sequence shown in SEQ ID NO:18, A2 is an anti-Ang2 aptamer comprising the nucleotide sequence shown in SEQ ID NO:64, L is a hexaethylene glycol linker, and n is 6.

[0419] In AMSB101, A1 is an anti-VEGF aptamer comprising the nucleotide sequence shown in SEQ ID NO:45, A2 is an anti-Ang2 aptamer comprising the nucleotide sequence shown in SEQ ID NO:68, L is a hexaethylene glycol linker, and n is 0.

[0420] In AMSB102, A1 is an anti-VEGF aptamer comprising the nucleotide sequence shown in SEQ ID NO:55, A2 is an anti-Ang2 aptamer comprising the nucleotide sequence shown in SEQ ID NO:68, L is a hexaethylene glycol linker, and n is 0.

[0421] In AMSB103, A1 is an anti-VEGF aptamer comprising the nucleotide sequence shown in SEQ ID NO:48, A2 is an anti-Ang2 aptamer comprising the nucleotide sequence shown in SEQ ID NO:68, L is a hexaethylene glycol linker, and n is 0.

[0422] In AMSB104, A1 is an anti-VEGF aptamer comprising the nucleotide sequence shown in SEQ ID NO:68, A2 is an anti-Ang2 aptamer comprising the nucleotide sequence shown in SEQ ID NO:45, L is a hexaethylene glycol linker, and n is 0.

[0423] In AMSB105, A1 is an anti-VEGF aptamer comprising the nucleotide sequence shown in SEQ ID NO:68, A2 is an anti-Ang2 aptamer comprising the nucleotide sequence shown in SEQ ID NO:55, L is a hexaethylene glycol linker, and n is 0.

[0424] In AMSB106, A1 is an anti-VEGF aptamer comprising the nucleotide sequence shown in SEQ ID NO:68, A2 is an anti-Ang2 aptamer comprising the nucleotide sequence shown in SEQ ID NO:48, L is a hexaethylene glycol linker, and n is 0.

[0425] In AMSB103.1, A1 is an anti-VEGF aptamer comprising the nucleotide sequence shown in SEQ ID NO:48, A2 is an anti-Ang2 aptamer comprising the nucleotide sequence shown in SEQ ID NO:68, L is a hexaethylene glycol linker, and n is 1.

[0426] In AMSB103.2, A1 is an anti-VEGF aptamer comprising the nucleotide sequence shown in SEQ ID NO:48, A2 is an anti-Ang2 aptamer comprising the nucleotide sequence shown in SEQ ID NO:68, L is a hexaethylene glycol linker, and n is 2.

[0427] In AMSB103.3, A1 is an anti-VEGF aptamer comprising the nucleotide sequence shown in SEQ ID NO:48, A2 is an anti-Ang2 aptamer comprising the nucleotide sequence shown in SEQ ID NO:68, L is a hexaethylene glycol linker, and n is 3.

[0428] In AMSB103.4, A1 is an anti-VEGF aptamer comprising the nucleotide sequence shown in SEQ ID NO:48, A2 is an anti-Ang2 aptamer comprising the nucleotide sequence shown in SEQ ID NO:68, L is a hexaethylene glycol linker, and n is 4.

[0429] In AMSB103.5, A1 is an anti-VEGF aptamer comprising the nucleotide sequence shown in SEQ ID NO:48, A2 is an anti-Ang2 aptamer comprising the nucleotide sequence shown in SEQ ID NO:68, L is a hexaethylene glycol linker, and n is 5.

[0430] In AMSB103.6, A1 is an anti-VEGF aptamer comprising the nucleotide sequence shown in SEQ ID NO:48, A2 is an anti-Ang2 aptamer comprising the nucleotide sequence shown in SEQ ID NO:68, L is a hexaethylene glycol linker, and n is 6.

[0431] Composition

[0432] In one aspect, the present application provides a composition comprising the anti-Ang2 aptamer described herein, the anti-VEGF aptamer described herein and / or the bispecific aptamer described herein. In some cases, the composition comprises an effective amount of the anti-Ang2 aptamer described herein and an effective amount of the anti-VEGF aptamer described herein. In some cases, the composition comprises an effective amount of the bispecific aptamer described herein.

[0433] The composition may be a pharmaceutical composition. The composition may comprise a pharmaceutically acceptable excipient or carrier.

[0434] The composition can be used to prevent, treat and / or improve a neovascular disease, disorder or condition. The neovascular disease, disorder or condition can be an ocular neovascular disease, disorder or condition. In certain embodiments, the neovascular disease, disorder or condition is selected from age-related macular degeneration, choroidal neovascularization, diabetic macular edema, retinal vein occlusion and diabetic retinopathy. In certain embodiments, the neovascular disease, disorder or condition is selected from wet age-related macular degeneration, myopic choroidal neovascularization and proliferative diabetic retinopathy.

[0435] For example, the composition can be in a form suitable for oral administration, such as tablets, capsules, pills, powders, sustained release formulations, solutions, suspensions, parenteral injections, such as sterile solutions, suspensions or emulsions, topical administration, such as ointments or creams, or rectal administration, such as suppositories. The composition can be in a unit dosage form suitable for single administration of a precise dose. In some cases, the composition can be a liquid pharmaceutical composition.

[0436] Pharmaceutically acceptable excipients or carriers may include, but are not limited to, anti-adherents, anti-foaming agents, buffers, polymers, antioxidants, preservatives, chelating agents, viscosity regulators, tonicity regulators, flavoring agents, colorants, odorants, opacifiers, suspending agents, binders, fillers, plasticizers, lubricants and / or mixtures thereof.

[0437] In some cases, the composition may be present in discrete dosage forms, each containing a predetermined amount of active ingredient in the form of a powder or granules, a solution or a suspension in an aqueous or non-aqueous liquid. Such dosage forms may be prepared by any method known to those skilled in the art, for example, it may include a step of associating the active ingredient with a carrier, which constitutes one or more other ingredients. Typically, the composition is prepared by uniformly and intimately mixing the active ingredient with a liquid carrier or a finely divided solid carrier or both, and then, if necessary, shaping the product into the desired appearance.

[0438] The composition may include a therapeutically effective amount of an activating agent (e.g., an agent described herein). A therapeutically effective amount may be the amount of the test composition of a subject that can prevent and / or treat (at least in part) a neovascular disease or a disorder and / or any complication thereof of a subject who suffers from the disease or condition or has a risk of developing the disease or condition. The specific amount / concentration of the activating agent included may vary according to the needs of the administration method and the patient, and may be determined based on, for example, volume, viscosity, and / or the patient's body weight. For example, a suitable dosage may be about 0.1 mg or 1 mg / kg / day to about 50 mg / kg / day; sometimes, the dosage may even be higher. It should be understood that those skilled in the art (e.g., a doctor or pharmacist) may conveniently adjust these specific doses based on the conditions of a particular patient, preparation, and / or disease.

[0439] Medical uses and methods

[0440] On the other hand, the present application provides a method for preventing, treating and / or improving neovascular diseases, disorders or conditions, comprising administering to a subject in need thereof an effective amount of the anti-Ang2 aptamer described herein, an effective amount of the anti-VEGF aptamer described herein, an effective amount of the bispecific aptamer described herein and / or an effective amount of the composition described herein.

[0441] On the other hand, the present application provides the use of the anti-Ang2 aptamer described in the present application, the anti-VEGF aptamer described in the present application, the bispecific aptamer described in the present application and / or the composition described in the present application in the preparation of a medicament for preventing, treating and / or improving neovascular diseases, disorders or conditions.

[0442] The neovascular disease, disorder or condition can be an ocular neovascular disease, disorder or condition. In certain embodiments, the neovascular disease, disorder or condition is selected from age-related macular degeneration, choroidal neovascularization, diabetic macular edema, retinal vein occlusion and diabetic retinopathy. In certain embodiments, the neovascular disease, disorder or condition is selected from wet age-related macular degeneration, myopic choroidal neovascularization and proliferative diabetic retinopathy.

[0443] Other Implementations

[0444] The present application also provides the following implementation modes:

[0445] 1. An anti-Ang2 aptamer having a K of about 500 picomolar (pM) or less D The value specifically binds to Ang2.

[0446] 2. The anti-Ang2 aptamer of embodiment 1, which has a K of about 100 picomolar (pM) or less D The value specifically binds to Ang2.

[0447] 3. The anti-Ang2 aptamer of any one of embodiments 1-2, wherein the Ang2 is human Ang2, mouse Ang2, monkey Ang2, rabbit Ang2 and / or rat Ang2.

[0448] 4. The anti-Ang2 aptamer according to any one of embodiments 1 to 3, which does not substantially bind to human Ang1.

[0449] 5. The anti-Ang2 aptamer according to any one of embodiments 1 to 4, which inhibits the interaction between the Ang2 and the Tie2.

[0450] 6. The anti-Ang2 aptamer according to any one of embodiments 1 to 5, which is capable of reducing neovascularization and / or reducing vascular permeability in a mouse oxygen-induced ischemic retinopathy (OIR) model.

[0451] 7. The anti-Ang2 aptamer of any one of embodiments 1-6, which is highly soluble.

[0452] 8. The anti-Ang2 aptamer according to any one of embodiments 1-7, which is an RNA aptamer, a DNA aptamer or a combination thereof.

[0453] 9. The anti-Ang2 aptamer of any one of embodiments 1-8, comprising one or more modified nucleotides, and / or one or more substitutions (e.g., substitutions with one or more PEGs). For example, one or more (e.g., 1-20, 1-19, 1-18, 1-17, 1-16, 1-15, 1-14, 1-13, 1-12, 1-11, 1-10, 1-9, 1-8, 1-7, 1-6, 1-5, 1-4, 1-3, or 1-2) nucleotides of the anti-Ang2 aptamer may be substituted with a polyethylene glycol moiety or a linker comprising a plurality (e.g., 1-10, 1-9, 1-8, 1-7, 1-6, 1-5, 1-4, 1-3, or 1-2) of polyethylene glycol moieties. In some cases, the linker may be a hexaethylene glycol (H or PEG6) linker. Such substitutions may occur on any nucleotide of the anti-Ang2 aptamer, as long as they do not substantially affect the activity (e.g., binding activity or inhibitory activity) and / or function of the anti-Ang2 aptamer. In some cases, the substitution does not substantially affect the secondary structure of the anti-Ang2 aptamer, for example, the substitution may occur on a nucleotide contained in a bulge or loop region of the secondary structure of the anti-Ang2 aptamer. In some cases, the substitution does not occur on any nucleotide contained in the stem region of the secondary structure of the anti-Ang2 aptamer.

[0454] 10. The anti-Ang2 aptamer according to any one of embodiments 1 to 9, which is nuclease-resistant.

[0455] 11. The anti-Ang2 aptamer of any one of embodiments 1-10, wherein all nucleotides of the anti-Ang2 aptamer are modified nucleotides.

[0456] 12. The anti-Ang2 aptamer of any one of embodiments 9-11, wherein the modified nucleotide comprises a chemical substitution or modification at one or more positions independently selected from a ribose position, a deoxyribose position, a phosphate position and a base position.

[0457] 13. An anti-Ang2 aptamer according to any one of embodiments 9 to 12, wherein the modified nucleotides include one or more independently selected from 2'-position sugar modification, 2'-amino (2'-NH2) modification, 2'-fluoro (2'-F) modification, 2'-O-methyl (2'-OMe) modification, 2'-O-(2-methoxyethyl) (2'-O-MOE) modification, 5-position modified pyrimidine, modification at the exocyclic amine of cytosine, substitution with 5'-bromouracil, substitution with 5'-bromodeoxyuridine, substitution with 5'-bromodeoxycytidine, backbone modification, locked nucleic acid (LNA), methylation, 3' cap and 5' cap.

[0458] 14. The anti-Ang2 aptamer of embodiment 13, wherein the 5-position modified pyrimidine is selected from 5-carboxy-2'-deoxyuridine, 5-aminoallyl-2'-deoxyuridine, 5-[(3-indolyl)propionamide-N-allyl]-2'-deoxyuridine, 5-carboxy-2'-deoxycytidine, 5-aminoallyl-2'-deoxycytidine, biotin-16-aminoallyl-2'-deoxycytidine, 5-(N-benzylcarboxamide)-2'-deoxyuridine, 5-(N-isobutylcarboxamide)-2'-deoxyuridine, 5-(N-naphthylmethylcarboxamide)-2'-deoxyuridine and 5-(N-tryptophanaminocarboxamide)-2'-deoxyuridine.

[0459] 15. The anti-Ang2 aptamer of any one of embodiments 1-14, comprising one or more 2'-modified nucleotides.

[0460] 16. The anti-Ang2 aptamer of any one of embodiments 1-15, wherein all nucleotides of the anti-Ang2 aptamer are 2'-modified nucleotides.

[0461] 17. The anti-Ang2 aptamer of any one of embodiments 15-16, wherein the 2'-modified nucleotides are selected from 2'-amino modified nucleotides, 2'-fluoro modified nucleotides, 2'-O-methyl modified nucleotides and 2'-O-(2-methoxyethyl) modified nucleotides.

[0462] 18. The anti-Ang2 aptamer of any one of embodiments 1-17, comprising at least one 2'-fluoro modified nucleotide, at least one 2'-O-methyl modified nucleotide and / or at least one LNA.

[0463] 19. The anti-Ang2 aptamer of any one of embodiments 1-18, wherein all cytidines of the anti-Ang2 aptamer are 2'-modified cytidines.

[0464] 20. The anti-Ang2 aptamer of any one of embodiments 1-19, wherein all cytidines of the anti-Ang2 aptamer are 2'-fluoro-modified cytidine and / or 2'-O-methyl-modified cytidine.

[0465] 21. The anti-Ang2 aptamer of any one of embodiments 1-20, wherein all cytidines of the anti-Ang2 aptamer are 2'-deoxy-2'-fluorocytidine.

[0466] 22. The anti-Ang2 aptamer of any one of embodiments 1-21, wherein all uridines of the anti-Ang2 aptamer are 2'-modified uridines.

[0467] 23. The anti-Ang2 aptamer of any one of embodiments 1 to 22, wherein all uridines of the anti-Ang2 aptamer are 2'-fluoro-modified uridines and / or 2'-O-methyl-modified uridines.

[0468] 24. The anti-Ang2 aptamer of any one of embodiments 1-23, wherein all uridines of the anti-Ang2 aptamer are 2'-deoxy-2'-fluorouridine.

[0469] 25. The anti-Ang2 aptamer of any one of embodiments 1-24, wherein all adenosines of the anti-Ang2 aptamer are 2'-modified adenosines.

[0470] 26. The anti-Ang2 aptamer of any one of embodiments 1-25, wherein all adenosines of the anti-Ang2 aptamer are 2'-fluoro-modified adenosine and / or 2'-O-methyl-modified adenosine.

[0471] 27. The anti-Ang2 aptamer of any one of embodiments 1-26, wherein all adenosines of the anti-Ang2 aptamer are 2'-deoxy-2'-fluoroadenosine.

[0472] 28. The anti-Ang2 aptamer of any one of embodiments 1-27, wherein all guanosines of the anti-Ang2 aptamer are 2'-modified guanosines.

[0473] 29. The anti-Ang2 aptamer of any one of embodiments 1-28, wherein all guanosines of the anti-Ang2 aptamer are 2'-fluoro-modified guanosine and / or 2'-O-methyl-modified guanosine.

[0474] 30. The anti-Ang2 aptamer of any one of embodiments 1-29, wherein all guanosines of the anti-Ang2 aptamer are 2'-deoxy-2'-fluoroguanosine.

[0475] 31. The anti-Ang2 aptamer of any one of embodiments 1-30, wherein all nucleotides of the anti-Ang2 aptamer are 2'-modified nucleotides.

[0476] 32. The anti-Ang2 aptamer of any one of embodiments 1-31, wherein all nucleotides of the anti-Ang2 aptamer are 2'-fluoro-modified nucleotides and / or 2'-O-methyl-modified nucleotides.

[0477] 33. The anti-Ang2 aptamer of any one of embodiments 1-32, wherein all nucleotides of the anti-Ang2 aptamer are 2'-fluoro-modified nucleotides.

[0478] 34. The anti-Ang2 aptamer of any one of embodiments 1-33, which does not comprise any natural nucleotides.

[0479] 35. The anti-Ang2 aptamer of any one of embodiments 1-34, comprising about 10 to about 150 nucleotides.

[0480] 36. The anti-Ang2 aptamer of any one of embodiments 1-35, which competes with an anti-Ang2 reference aptamer for binding to said Ang2, wherein the anti-Ang2 reference aptamer comprises a secondary structure, which comprises, from 5' to 3' direction, a first stem, a first protrusion, a second stem, a second protrusion, a third stem, a third protrusion, a fourth stem and a first loop.

[0481] 37. The anti-Ang2 aptamer of embodiment 36, wherein the anti-Ang2 reference aptamer comprises a secondary structure consisting of a first stem, a first protrusion, a second stem, a second protrusion, a third stem, a third protrusion, a fourth stem and a first loop from 5' to 3' direction.

[0482] 38. The anti-Ang2 aptamer of any one of embodiments 36-37, wherein the anti-Ang2 reference aptamer comprises a first consensus sequence, wherein the first consensus sequence comprises the nucleotide sequence shown in any one of SEQ ID NOs: 101-108.

[0483] 39. The anti-Ang2 aptamer of any one of embodiments 36-38, wherein the anti-Ang2 reference aptamer comprises a second consensus sequence, and the second consensus sequence comprises the nucleotide sequence shown in any one of SEQ ID NOs: 109-116.

[0484] 40. The anti-Ang2 aptamer of any one of embodiments 38-39, wherein the first consensus sequence is contained in the nucleotide sequences forming the first protrusion, the second stem, the second protrusion, the third stem, the third protrusion and / or the fourth stem of the anti-Ang2 reference aptamer.

[0485] 41. The anti-Ang2 aptamer of any one of embodiments 38-40, wherein the first consensus sequence is not comprised in the nucleotide sequence forming the first loop of the anti-Ang2 reference aptamer.

[0486] 42. The anti-Ang2 aptamer of any one of embodiments 39-41, wherein the second consensus sequence is contained in the nucleotide sequence forming the first protrusion, the second stem, the second protrusion, the third stem, the third protrusion and / or the fourth stem of the anti-Ang2 reference aptamer.

[0487] 43. The anti-Ang2 aptamer of any one of embodiments 39-42, wherein the second consensus sequence is not comprised in the nucleotide sequence forming the first loop of the anti-Ang2 reference aptamer.

[0488] 44. The anti-Ang2 aptamer of any one of embodiments 36-43, wherein the first loop of the anti-Ang2 reference aptamer comprises 2-30 nucleotides.

[0489] 45. The anti-Ang2 aptamer of any one of embodiments 36-44, wherein the first loop of the anti-Ang2 reference aptamer comprises 3-10 nucleotides.

[0490] 46. ​​The anti-Ang2 aptamer of any one of embodiments 36-45, wherein the anti-Ang2 reference aptamer comprises the nucleotide sequence shown in any one of SEQ ID NOs: 63-74, or a variant or truncated form thereof.

[0491] 47. The anti-Ang2 aptamer of embodiment 46, wherein the variant comprises a nucleotide sequence that is at least 50% identical to the nucleotide sequence shown in any one of SEQ ID NOs: 63-74.

[0492] 48. The anti-Ang2 aptamer of any one of embodiments 46-47, wherein the variant comprises the nucleotide sequence shown in any one of SEQ ID NOs: 63-74, which has one or more nucleotide additions, deletions and / or substitutions.

[0493] 49. The anti-Ang2 aptamer of any one of embodiments 36-48, wherein the anti-Ang2 reference aptamer comprises about 10 to about 150 nucleotides.

[0494] 50. The anti-Ang2 aptamer of any one of embodiments 38-49, wherein the anti-Ang2 reference aptamer comprises the first consensus sequence and the second consensus sequence, and wherein the first consensus sequence is located at the 5′ end of the second consensus sequence.

[0495] 51. The anti-Ang2 aptamer of any one of embodiments 38-49, wherein the anti-Ang2 reference aptamer comprises the first consensus sequence and the second consensus sequence, and wherein the second consensus sequence is located at the 5′ end of the first consensus sequence.

[0496] 52. The anti-Ang2 aptamer of any one of embodiments 1-51, wherein the anti-Ang2 aptamer comprises a secondary structure comprising, from 5' to 3' direction, a first stem, a first protrusion, a second stem, a second protrusion, a third stem, a third protrusion, a fourth stem and a first loop.

[0497] 53. The anti-Ang2 aptamer of any one of embodiments 1-52, wherein the anti-Ang2 aptamer comprises a secondary structure consisting of a first stem, a first protrusion, a second stem, a second protrusion, a third stem, a third protrusion, a fourth stem and a first loop from 5' to 3' direction.

[0498] 54. The anti-Ang2 aptamer of any one of embodiments 1-53, wherein the anti-Ang2 aptamer comprises a first consensus sequence, wherein the first consensus sequence comprises the nucleotide sequence shown in any one of SEQ ID NOs: 101-108.

[0499] 55. The anti-Ang2 aptamer of any one of embodiments 1-54, wherein the anti-Ang2 aptamer comprises a second consensus sequence, and the second consensus sequence comprises the nucleotide sequence shown in any one of SEQ ID NOs: 109-116.

[0500] 56. The anti-Ang2 aptamer of any one of embodiments 54-55, wherein the first consensus sequence is contained in the nucleotide sequence forming the first protrusion, the second stem, the second protrusion, the third stem, the third protrusion and / or the fourth stem of the anti-Ang2 aptamer.

[0501] 57. The anti-Ang2 aptamer of any one of embodiments 54-56, wherein the first consensus sequence is not comprised in the nucleotide sequence forming the first loop of the anti-Ang2 aptamer.

[0502] 58. The anti-Ang2 aptamer of any one of embodiments 55-57, wherein the second consensus sequence is contained in the nucleotide sequence forming the first protrusion, the second stem, the second protrusion, the third stem, the third protrusion and / or the fourth stem of the anti-Ang2 aptamer.

[0503] 59. The anti-Ang2 aptamer of any one of embodiments 55-58, wherein the second consensus sequence is not comprised in the nucleotide sequence forming the first loop of the anti-Ang2 aptamer.

[0504] 60. The anti-Ang2 aptamer of any one of embodiments 52-59, wherein the first loop of the anti-Ang2 aptamer comprises 2-30 nucleotides.

[0505] 61. The anti-Ang2 aptamer of any one of embodiments 52-60, wherein the first loop of the anti-Ang2 aptamer comprises 3-10 nucleotides.

[0506] 62. The anti-Ang2 aptamer of any one of embodiments 1-61, wherein the anti-Ang2 aptamer comprises the nucleotide sequence shown in any one of SEQ ID NOs: 63-74, or a variant or truncated form thereof.

[0507] 63. The anti-Ang2 aptamer of embodiment 62, wherein the variant comprises a nucleotide sequence that is at least 50% identical to the nucleotide sequence shown in any one of SEQ ID NOs: 63-74.

[0508] 64. The anti-Ang2 aptamer of any one of embodiments 62-63, wherein the variant comprises the nucleotide sequence shown in any one of SEQ ID NOs: 63-74, which has one or more nucleotide additions, deletions and / or substitutions.

[0509] 65. The anti-Ang2 aptamer of any one of embodiments 54-64, wherein the anti-Ang2 aptamer comprises the first consensus sequence and the second consensus sequence, and wherein the first consensus sequence is located at the 5′ end of the second consensus sequence.

[0510] 66. The anti-Ang2 aptamer of any one of embodiments 54-64, wherein the anti-Ang2 aptamer comprises the first consensus sequence and the second consensus sequence, wherein the second consensus sequence is located at the 5′ end of the first consensus sequence.

[0511] 67. The anti-Ang2 aptamer of any one of embodiments 1-66, wherein the anti-Ang2 aptamer is conjugated to a polyethylene glycol moiety (PEG).

[0512] 68. The anti-Ang2 aptamer of embodiment 67, wherein at least one PEG moiety is conjugated to the 5′ end of the anti-Ang2 aptamer.

[0513] 69. The anti-Ang2 aptamer of any one of embodiments 67-68, wherein at least one PEG moiety is conjugated to the 3′ end of the anti-Ang2 aptamer.

[0514] 70. An anti-VEGF aptamer having a K of about 20 nanomolar (nM) or less D The values ​​bind to VEGF-121 with a K of approximately 20 nanomolar (nM) or less. D Values ​​for binding to VEGF-165.

[0515] 71. The anti-VEGF aptamer of embodiment 70, which has a K of about 2 nanomolar (nM) or less. D Values ​​for binding to VEGF-121.

[0516] 72. The anti-VEGF aptamer of any one of embodiments 70-71, which has a K of about 2 nanomolar (nM) or less. D Values ​​for binding to VEGF-165.

[0517] 73. The anti-VEGF aptamer of any one of embodiments 70-72, wherein the VEGF-121 is human VEGF-121, mouse VEGF-120, monkey VEGF-121, rabbit VEGF-121 and / or rat VEGF-120.

[0518] 74. The anti-VEGF aptamer of any one of embodiments 70-73, wherein the VEGF-165 is human VEGF-165, mouse VEGF-164, monkey VEGF-165, rabbit VEGF-165 and / or rat VEGF-164.

[0519] 75. The anti-VEGF aptamer of any one of embodiments 70-74, which specifically binds to both the VEGF receptor binding domain of VEGF-121 and the VEGF receptor binding domain of VEGF-165.

[0520] 76. The anti-VEGF aptamer of embodiment 75, wherein the VEGF receptor binding domain of VEGF-121 comprises the amino acid sequence shown in any one of SEQ ID NOs: 118-122, 128, 129 and 133.

[0521] 77. The anti-VEGF aptamer of any one of embodiments 75-76, wherein the VEGF receptor binding domain of VEGF-165 comprises the amino acid sequence shown in any one of SEQ ID NOs: 118-122, 128 and 129.

[0522] 78. The anti-VEGF aptamer of any one of embodiments 70-77, which inhibits the interaction between said VEGF-121 and said VEGF-R1.

[0523] 79. The anti-VEGF aptamer of any one of embodiments 70-78, which inhibits the interaction between said VEGF-121 and said VEGF-R2.

[0524] 80. The anti-VEGF aptamer of any one of embodiments 70-79, which inhibits the interaction between said VEGF-165 and said VEGF-R1.

[0525] 81. The anti-VEGF aptamer of any one of embodiments 70-80, which inhibits the interaction between said VEGF-165 and said VEGF-R2.

[0526] 82. The anti-VEGF aptamer of any one of embodiments 70-81, which is capable of reducing and / or ameliorating lesions and / or leakage in a laser-induced choroidal neovascularization (CNV) rat model.

[0527] 83. The anti-VEGF aptamer of any one of embodiments 70-82, which is highly soluble.

[0528] 84. The anti-VEGF aptamer of any one of embodiments 70-83, which is an RNA aptamer, a DNA aptamer or a combination thereof.

[0529] 85. The anti-VEGF aptamer of any one of embodiments 70-84, which is nuclease-resistant.

[0530] 86. The anti-VEGF aptamer of any one of embodiments 70-85, comprising one or more modified nucleotides, and / or one or more substitutions (such as substitutions with one or more PEGs). For example, one or more (e.g., 1-20, 1-19, 1-18, 1-17, 1-16, 1-15, 1-14, 1-13, 1-12, 1-11, 1-10, 1-9, 1-8, 1-7, 1-6, 1-5, 1-4, 1-3, or 1-2) nucleotides of the anti-VEGF aptamer can be substituted with a polyethylene glycol moiety or a linker comprising a plurality (e.g., 1-10, 1-9, 1-8, 1-7, 1-6, 1-5, 1-4, 1-3, or 1-2) of polyethylene glycol moieties. In some cases, the linker can be a hexaethylene glycol (H or PEG6) linker. Such substitutions may occur at any nucleotide of the anti-VEGF aptamer, as long as they do not substantially affect the activity (e.g., binding activity or inhibitory activity) and / or function of the anti-VEGF aptamer. In some cases, the substitution does not substantially affect the secondary structure of the anti-VEGF aptamer, for example, the substitution may occur at a nucleotide contained in a bulge or loop region of the secondary structure of the anti-VEGF aptamer. In some cases, the substitution does not occur at any nucleotide contained in the stem region of the secondary structure of the anti-VEGF aptamer.

[0531] 87. The anti-VEGF aptamer of embodiment 86, wherein all nucleotides of the anti-VEGF aptamer are modified nucleotides.

[0532] 88. The anti-VEGF aptamer of any one of embodiments 86-87, wherein the modified nucleotide comprises a chemical substitution or modification at one or more positions independently selected from a ribose position, a deoxyribose position, a phosphate position, and a base position.

[0533] 89. An anti-VEGF aptamer of any one of embodiments 86-88, wherein the modified nucleotides include one or more modifications independently selected from the following modifications: 2'-position sugar modification, 2'-amino (2'-NH2) modification, 2'-fluoro (2'-F) modification, 2'-O-methyl (2'-OMe) modification, 2'-O-(2-methoxyethyl) (2'-O-MOE) modification, 5-position modified pyrimidine, modification at the exocyclic amine of cytosine, substitution with 5'-bromouracil, substitution with 5'-bromodeoxyuridine, substitution with 5'-bromodeoxycytidine, backbone modification, locked nucleic acid (LNA), methylation, 3' cap and 5' cap.

[0534] 90. The anti-VEGF aptamer of embodiment 89, wherein the 5-position modified pyrimidine is selected from 5-carboxy-2'-deoxyuridine, 5-aminoallyl-2'-deoxyuridine, 5-[(3-indolyl)propionamide-N-allyl]-2'-deoxyuridine, 5-carboxy-2'-deoxycytidine, 5-aminoallyl-2'-deoxycytidine, biotin-16-aminoallyl-2'-deoxycytidine, 5-(N-benzylcarboxamide)-2'-deoxyuridine, 5-(N-isobutylcarboxamide)-2'-deoxyuridine, 5-(N-naphthylmethylcarboxamide)-2'-deoxyuridine and 5-(N-tryptophanaminocarboxamide)-2'-deoxyuridine.

[0535] 91. The anti-VEGF aptamer of any one of embodiments 70-90, comprising at least one 2'-modified nucleotide.

[0536] 92. The anti-VEGF aptamer of embodiment 91, wherein all nucleotides of the anti-VEGF aptamer are 2'-modified nucleotides.

[0537] 93. The anti-VEGF aptamer of any one of embodiments 91-92, wherein the 2'-modified nucleotides are selected from 2'-amino modified nucleotides, 2'-fluoro modified nucleotides, 2'-O-methyl modified nucleotides and 2'-O-(2-methoxyethyl) modified nucleotides.

[0538] 94. The anti-VEGF aptamer of any one of embodiments 70-93, comprising at least one 2'-fluoro modified nucleotide, at least one 2'-O-methyl modified nucleotide and / or at least one LNA.

[0539] 95. The anti-VEGF aptamer of any one of embodiments 70-94, wherein all cytidines of the anti-VEGF aptamer are 2'-modified cytidines.

[0540] 96. The anti-VEGF aptamer of any one of embodiments 70-95, wherein all cytidines of the anti-VEGF aptamer are 2'-fluoro-modified cytidines and / or 2'-O-methyl-modified cytidines.

[0541] 97. The anti-VEGF aptamer of any one of embodiments 70-96, wherein all cytidines of the anti-VEGF aptamer are 2'-deoxy-2'-fluorocytidine.

[0542] 98. The anti-VEGF aptamer of any one of embodiments 70-97, wherein all uridines of the anti-VEGF aptamer are 2'-modified uridines.

[0543] 99. The anti-VEGF aptamer of any one of embodiments 70-98, wherein all uridines of the anti-VEGF aptamer are 2'-fluoro-modified uridines and / or 2'-O-methyl-modified uridines.

[0544] 100. The anti-VEGF aptamer of any one of embodiments 70-99, wherein all uridines of the anti-VEGF aptamer are 2'-deoxy-2'-fluorouridine.

[0545] 101. The anti-VEGF aptamer of any one of embodiments 70-100, wherein all adenosines of the anti-VEGF aptamer are 2'-modified adenosines.

[0546] 102. The anti-VEGF aptamer of any one of embodiments 70-101, wherein all adenosines of the anti-VEGF aptamer are 2'-fluoro-modified adenosine and / or 2'-O-methyl-modified adenosine.

[0547] 103. The anti-VEGF aptamer of any one of embodiments 70-102, wherein all adenosines of the anti-VEGF aptamer are 2'-deoxy-2'-fluoroadenosine.

[0548] 104. The anti-VEGF aptamer of any one of embodiments 70-103, wherein all guanosines of the anti-VEGF aptamer are 2'-modified guanosines.

[0549] 105. The anti-VEGF aptamer of any one of embodiments 70-104, wherein all guanosines of the anti-VEGF aptamer are 2'-fluoro-modified guanosines and / or 2'-O-methyl-modified guanosines.

[0550] 106. The anti-VEGF aptamer of any one of embodiments 70-105, wherein all guanosines of the anti-VEGF aptamer are 2'-deoxy-2'-fluoroguanosine.

[0551] 107. The anti-VEGF aptamer of any one of embodiments 70-106, wherein all nucleotides of the anti-VEGF aptamer are 2'-modified nucleotides.

[0552] 108. The anti-VEGF aptamer of any one of embodiments 70-107, wherein all nucleotides of the anti-VEGF aptamer are 2'-fluoro modified nucleotides and / or 2'-O-methyl modified nucleotides.

[0553] 109. The anti-VEGF aptamer of any one of embodiments 70-108, wherein all nucleotides of the anti-VEGF aptamer are 2'-fluoro modified nucleotides.

[0554] 110. The anti-VEGF aptamer of any one of embodiments 70-109, wherein the anti-VEGF aptamer does not comprise any natural nucleotides.

[0555] 111. The anti-VEGF aptamer of any one of embodiments 70-110, comprising about 10 to about 150 nucleotides.

[0556] 112. The anti-VEGF aptamer of any one of embodiments 70-111, wherein the anti-VEGF aptamer competes with an anti-VEGF reference aptamer for binding to the VEGF-165 and the VEGF-121, wherein the anti-VEGF reference aptamer comprises a secondary structure, wherein the secondary structure comprises, from 5' to 3' direction, a first stem, a first protrusion, a second stem, a second protrusion, a third stem, a third protrusion, a fourth stem and a first loop.

[0557] 113. The anti-VEGF aptamer of embodiment 112, wherein the anti-VEGF reference aptamer comprises a secondary structure consisting of a first stem, a first protrusion, a second stem, a second protrusion, a third stem, a third protrusion, a fourth stem and a first loop from 5' to 3' direction.

[0558] 114. The anti-VEGF aptamer of any one of embodiments 112-113, wherein the anti-VEGF reference aptamer comprises a first consensus sequence, and the first consensus sequence comprises the nucleotide sequence shown in any one of SEQ ID NOs: 79-90.

[0559] 115. The anti-VEGF aptamer of any one of embodiments 112-114, wherein the anti-VEGF reference aptamer comprises a second consensus sequence, and the second consensus sequence comprises the nucleotide sequence shown in any one of SEQ ID NOs: 91-100.

[0560] 116. The anti-VEGF aptamer of any one of embodiments 114-115, wherein the first consensus sequence is contained in the nucleotide sequence forming the first stem, first protrusion, second stem, second protrusion, third stem, third protrusion and / or fourth stem of the anti-VEGF reference aptamer.

[0561] 117. The anti-VEGF aptamer of any one of embodiments 114-116, wherein the first consensus sequence is not contained in the nucleotide sequence forming the first loop of the anti-VEGF reference aptamer.

[0562] 118. The anti-VEGF aptamer of any one of embodiments 115-117, wherein the second consensus sequence is contained in the nucleotide sequence forming the first stem, the first protrusion, the second stem, the second protrusion, the third stem, the third protrusion and / or the fourth stem of the anti-VEGF reference aptamer.

[0563] 119. The anti-VEGF aptamer of any one of embodiments 115-118, wherein the second consensus sequence is not contained in the nucleotide sequence forming the first loop of the anti-VEGF reference aptamer.

[0564] 120. The anti-VEGF aptamer of any one of embodiments 112-119, wherein the first loop of the anti-VEGF reference aptamer comprises 2-30 nucleotides.

[0565] 121. The anti-VEGF aptamer of any one of embodiments 112-120, wherein the first loop of the anti-VEGF reference aptamer comprises 3-10 nucleotides.

[0566] 122. The anti-VEGF aptamer of any one of embodiments 112-121, wherein the anti-VEGF reference aptamer comprises the nucleotide sequence shown in any one of SEQ ID NOs: 1-62, or a variant or truncated form thereof.

[0567] 123. The anti-VEGF aptamer of embodiment 122, wherein the variant comprises a nucleotide sequence that is at least 50% identical to the nucleotide sequence shown in any one of SEQ ID NOs: 1-62.

[0568] 124. The anti-VEGF aptamer of any one of embodiments 122-123, wherein the variant comprises the nucleotide sequence shown in any one of SEQ ID NOs: 1-62, which has one or more nucleotide additions, deletions and / or substitutions.

[0569] 125. The anti-VEGF aptamer of any one of embodiments 112-124, wherein the anti-VEGF reference aptamer comprises about 10 to about 150 nucleotides.

[0570] 126. The anti-VEGF aptamer of any one of embodiments 114-125, wherein the anti-VEGF reference aptamer comprises the first consensus sequence and the second consensus sequence, and wherein the first consensus sequence is located 5' to the second consensus sequence.

[0571] 127. The anti-VEGF aptamer of any one of embodiments 114-125, wherein the anti-VEGF reference aptamer comprises the first consensus sequence and the second consensus sequence, and wherein the second consensus sequence is located 5' to the first consensus sequence.

[0572] 128. The anti-VEGF aptamer of any one of embodiments 70-127, wherein the anti-VEGF aptamer comprises a secondary structure comprising, from 5' to 3' direction, a first stem, a first protrusion, a second stem, a second protrusion, a third stem, a third protrusion, a fourth stem and a first loop.

[0573] 129. The anti-VEGF aptamer of any one of embodiments 70-128, wherein the anti-VEGF aptamer comprises a secondary structure consisting of a first stem, a first protrusion, a second stem, a second protrusion, a third stem, a third protrusion, a fourth stem and a first loop from 5' to 3' direction.

[0574] 130. The anti-VEGF aptamer of any one of embodiments 70-129, wherein the anti-VEGF aptamer comprises a first consensus sequence, wherein the first consensus sequence comprises the nucleotide sequence shown in any one of SEQ ID NOs: 79-90.

[0575] 131. The anti-VEGF aptamer of any one of embodiments 70-130, wherein the anti-VEGF aptamer comprises a second consensus sequence, and the second consensus sequence comprises the nucleotide sequence shown in any one of SEQ ID NOs: 91-100.

[0576] 132. The anti-VEGF aptamer of any one of embodiments 130-131, wherein the first consensus sequence is contained in the nucleotide sequence that forms the first stem, the first protrusion, the second stem, the second protrusion, the third stem, the third protrusion and / or the fourth stem of the anti-VEGF aptamer.

[0577] 133. The anti-VEGF aptamer of any one of embodiments 130-132, wherein the first consensus sequence is not contained in the nucleotide sequence forming the first loop of the anti-VEGF aptamer.

[0578] 134. The anti-VEGF aptamer of any one of embodiments 131-133, wherein the second consensus sequence is contained in the nucleotide sequence forming the first stem, the first protrusion, the second stem, the second protrusion, the third stem, the third protrusion and / or the fourth stem of the anti-VEGF aptamer.

[0579] 135. The anti-VEGF aptamer of any one of embodiments 131-134, wherein the second consensus sequence is not contained in the nucleotide sequence forming the first loop of the anti-VEGF aptamer.

[0580] 136. The anti-VEGF aptamer of any one of embodiments 128-135, wherein the first loop of the anti-VEGF aptamer comprises 2-30 nucleotides.

[0581] 137. The anti-VEGF aptamer of any one of embodiments 128-136, wherein the first loop of the anti-VEGF aptamer comprises 3-10 nucleotides.

[0582] 138. The anti-VEGF aptamer of any one of embodiments 70-137, wherein the anti-VEGF aptamer comprises the nucleotide sequence shown in any one of SEQ ID NOs: 1-62, or a variant or truncated form thereof.

[0583] 139. The anti-VEGF aptamer of embodiment 138, wherein the variant comprises a nucleotide sequence that is at least 50% identical to the nucleotide sequence shown in any one of SEQ ID NOs: 1-62.

[0584] 140. The anti-VEGF aptamer of any one of embodiments 138-139, wherein the variant comprises the nucleotide sequence shown in any one of SEQ ID NOs: 1-62, which has one or more nucleotide additions, deletions and / or substitutions.

[0585] 141. The anti-VEGF aptamer of any one of embodiments 130-140, wherein the anti-VEGF aptamer comprises the first consensus sequence and the second consensus sequence, and wherein the first consensus sequence is located 5' to the second consensus sequence.

[0586] 142. The anti-VEGF aptamer of any one of embodiments 130-140, wherein the anti-VEGF aptamer comprises the first consensus sequence and the second consensus sequence, wherein the second consensus sequence is located 5' to the first consensus sequence.

[0587] 143. The anti-VEGF aptamer of any one of embodiments 70-142, wherein the anti-VEGF aptamer is conjugated to a polyethylene glycol (PEG) moiety.

[0588] 144. The anti-VEGF aptamer of embodiment 143, wherein at least one PEG moiety is conjugated to the 5' end of the anti-VEGF aptamer.

[0589] 145. The anti-VEGF aptamer of any one of embodiments 143-144, wherein at least one PEG moiety is conjugated to the 3' end of the anti-VEGF aptamer.

[0590] 146. A bispecific aptamer comprising the anti-Ang2 aptamer of any one of embodiments 1-69 and the anti-VEGF aptamer of any one of embodiments 70-145.

[0591] 147. The bispecific aptamer of embodiment 146, having the formula A1-(L)n-A2, wherein:

[0592] A1 is the anti-VEGF aptamer, and A2 is the anti-Ang2 aptamer, or A1 is the anti-Ang2 aptamer, and A2 is the anti-VEGF aptamer;

[0593] L is a connector; and

[0594] n is a number that is at least 0.

[0595] 148. The bispecific aptamer of any one of embodiments 146-147, which is capable of specifically binding to VEGF and Ang2.

[0596] 149. The bispecific aptamer of any one of embodiments 146-148, which has a K of about 500 pM or less. D values ​​bind to VEGF-121 with a K of about 500 pM or less D Value for binding to Ang2.

[0597] 150. The bispecific aptamer of any one of embodiments 146-149, which has a K of about 200 pM or less. D values ​​bind to VEGF-121 with a K of approximately 200 pM or less D Value for binding to Ang2.

[0598] 151. The bispecific aptamer of any one of embodiments 146-150, which has a K of about 100 pM or less. D values ​​bind to VEGF-121 with a K of approximately 100 pM or less D Value for binding to Ang2.

[0599] 152. The bispecific aptamer of any one of embodiments 147-151, wherein n is 0 to 20.

[0600] 153. The bispecific aptamer of any one of embodiments 147-152, wherein n is 0 to 10.

[0601] 154. The bispecific aptamer of any one of embodiments 147-153, wherein L is selected from a naturally occurring nucleotide linker, a modified nucleotide linker, a hydrocarbon linker, a polyethylene glycol linker, and combinations thereof.

[0602] 155. The bispecific aptamer of any one of embodiments 147-154, wherein at least one L is a polyethylene glycol linker.

[0603] 156. The bispecific aptamer of any one of embodiments 147-155, wherein at least one L is a hexaethylene glycol linker.

[0604] 157. The bispecific aptamer of any one of embodiments 147-156, wherein L is a hexaethylene glycol linker and n is 0 to 10.

[0605] 158. The bispecific aptamer of any one of embodiments 147-157, wherein A1 is an anti-VEGF aptamer comprising a nucleotide sequence shown in any one of SEQ ID NOs 1-62, or a variant or truncated form thereof; and A2 is an anti-Ang2 aptamer comprising a nucleotide sequence shown in any one of SEQ ID NOs: 63-74, or a variant or truncated form thereof.

[0606] 159. The bispecific aptamer of any one of embodiments 147-158, wherein A1 is an anti-Ang2 aptamer comprising the nucleotide sequence shown in any one of SEQ ID NOs: 63-74, or a variant or truncated form thereof; and A2 is an anti-VEGF aptamer comprising the nucleotide sequence shown in any one of SEQ ID NOs: 1-62, or a variant or truncated form thereof.

[0607] 160. The bispecific aptamer of any one of embodiments 147-159, wherein:

[0608] 1) A1 is an anti-VEGF aptamer comprising the nucleotide sequence shown in SEQ ID NO:45 or a truncated form thereof, A2 is an anti-Ang2 aptamer comprising the nucleotide sequence shown in SEQ ID NO:68 or a truncated form thereof, L is a hexaethylene glycol linker, and n is 0-10;

[0609] 2) A1 is an anti-VEGF aptamer comprising the nucleotide sequence shown in SEQ ID NO:55 or a truncated form thereof, A2 is an anti-Ang2 aptamer comprising the nucleotide sequence shown in SEQ ID NO:68 or a truncated form thereof, L is a hexaethylene glycol linker, and n is 0-10;

[0610] 3) A1 is an anti-VEGF aptamer comprising the nucleotide sequence shown in SEQ ID NO: 68 or a truncated form thereof, A2 is an anti-Ang2 aptamer comprising the nucleotide sequence shown in SEQ ID NO: 68 or a truncated form thereof, L is a hexaethylene glycol linker, and n is 0-10;

[0611] 4) A1 is an anti-Ang2 aptamer comprising the nucleotide sequence shown in SEQ ID NO: 68 or a truncated form thereof, A2 is an anti-VEGF aptamer comprising the nucleotide sequence shown in SEQ ID NO: 45 or a truncated form thereof, L is a hexaethylene glycol linker, and n is 0-10;

[0612] 5) A1 is an anti-Ang2 aptamer comprising the nucleotide sequence shown in SEQ ID NO:68 or a truncated form thereof, A2 is an anti-VEGF aptamer comprising the nucleotide sequence shown in SEQ ID NO:55 or a truncated form thereof, L is a hexaethylene glycol linker, and n is 0-10; or

[0613] 6) A1 is an anti-Ang2 aptamer comprising the nucleotide sequence shown in SEQ ID NO:68 or a truncated form thereof, A2 is an anti-VEGF aptamer comprising the nucleotide sequence shown in SEQ ID NO:48 or a truncated form thereof, L is a hexaethylene glycol linker, and n is 0 to 10.

[0614] 161. The bispecific aptamer of any one of embodiments 146-160, which is selected from r-AMSB101, r-AMSB102, r-AMSB103, r-AMSB104, r-AMSB105, r-AMSB106, r-AMSB103.1, r-AMSB103.2, r-AMSB103.3, r-AMSB103.4, r-AMSB103.5, r-AMSB103.6, AMSB101, AMSB102, AMSB103, AMSB104, AMSB105, AMSB106, AMSB103.1, AMSB103.2, AMSB103.3, AMSB103.4, AMSB103.5 and AMSB103.6.

[0615] 162. The bispecific aptamer of any one of embodiments 146-161, comprising the nucleotide sequence shown in any one of SEQ ID NOs: 75-78 and 138-157.

[0616] 163. A composition comprising the anti-Ang2 aptamer of any one of embodiments 1-69, the anti-VEGF aptamer of any one of embodiments 70-145 and / or the bispecific aptamer of any one of embodiments 146-162.

[0617] 164. The composition of embodiment 163, which is a pharmaceutical composition.

[0618] 165. The composition of any one of embodiments 163-164, comprising a pharmaceutically acceptable excipient or carrier.

[0619] 166. The composition of any one of embodiments 163-165, for use in preventing, treating and / or ameliorating a neovascular disease, disorder or condition.

[0620] 167. The composition of embodiment 166, wherein the neovascular disease, disorder or condition is an ocular neovascular disease, disorder or condition.

[0621] 168. The composition of any one of embodiments 166-167, wherein the neovascular disease, disorder or condition is selected from age-related macular degeneration, choroidal neovascularization, diabetic macular edema, retinal vein occlusion and diabetic retinopathy.

[0622] 169. The composition of any one of embodiments 166-168, wherein the neovascular disease, disorder or condition is selected from wet age-related macular degeneration, myopic choroidal neovascularization and proliferative diabetic retinopathy.

[0623] 170. A method for preventing, treating and / or ameliorating a neovascular disease, disorder or condition, comprising administering to a subject in need thereof an effective amount of an anti-Ang2 aptamer of any one of embodiments 1-69, an effective amount of a VEGF aptamer of any one of embodiments 70-145, an effective amount of a bispecific aptamer of any one of embodiments 146-162 and / or an effective amount of a composition of any one of embodiments 163-169.

[0624] 171. The method of embodiment 170, wherein the neovascular disease, disorder or condition is an ocular neovascular disease, disorder or condition.

[0625] 172. The method of any one of embodiments 170-171, wherein the neovascular disease, disorder or condition is selected from age-related macular degeneration, choroidal neovascularization, diabetic macular edema, retinal vein occlusion and diabetic retinopathy.

[0626] 173. The method of any one of embodiments 170-172, wherein the neovascular disease, disorder or condition is selected from wet age-related macular degeneration, myopic choroidal neovascularization and proliferative diabetic retinopathy.

[0627] 174. Use of the anti-Ang2 aptamer of any one of embodiments 1-69, the anti-VEGF aptamer of any one of embodiments 70-145, the bispecific aptamer of any one of embodiments 146-162 and / or the combination of any one of embodiments 163-169 in the preparation of a medicament for preventing, treating and / or ameliorating neovascular diseases, disorders or conditions.

[0628] 175. The use of embodiment 174, wherein the neovascular disease, disorder or condition is an ocular neovascular disease, disorder or condition.

[0629] 176. The use of any one of embodiments 174-175, wherein the neovascular disease, disorder or condition is selected from age-related macular degeneration, choroidal neovascularization, diabetic macular edema, retinal vein occlusion and diabetic retinopathy.

[0630] 177. The use of any one of embodiments 174-176, wherein the neovascular disease, disorder or condition is selected from wet age-related macular degeneration, myopic choroidal neovascularization and proliferative diabetic retinopathy.

[0631] This application also relates to the following sequence:

[0632]

[0633]

[0634]

[0635]

[0636]

[0637]

[0638]

[0639]

[0640]

[0641]

[0642]

[0643]

[0644]

[0645] Example

[0646] The following examples are set forth in order to provide one of ordinary skill in the art with a complete summary and description of how to make and use the invention, and are not intended to limit the scope of what the inventors regard as their invention, nor are they intended to represent that the experiments that follow are all or the only experiments that were performed. Efforts have been made to ensure the accuracy of the numbers used (e.g., amounts, temperatures, etc.), but some experimental errors and deviations should be taken into account. Unless otherwise indicated, parts are parts by weight, molecular weight is weight average molecular weight, temperature is in degrees Celsius, and pressure is at or near atmospheric pressure. Standard abbreviations may be used, such as bp, base pairs; kb, kilobase; pl, picoliter; s or sec, seconds; min, minutes; h or hr hours; aa, amino acids; nt, nucleotides; im, intramuscular (IM); ip, intraperitoneal (IP); sc, subcutaneous (IP); and the like.

[0647] Example 1 Selection of anti-VEGF aptamers

[0648] Using chemically enhanced particle display (CAPD), a platform as described (the platform as described above, please refer to Wang et al. WO2018064086A1; Wang et al. WO2018102115A1; Wang et al. PCT / US2013 / 071318) identified the anti-VEGF aptamer described in the present application. Detailed methods and steps are described in, for example, WO 2018064086A1 (which is incorporated herein by reference in its entirety).

[0649] Briefly, recombinant human VEGF-121 and VEGF-165 proteins from different suppliers (listed in Table 1) were used as target proteins for aptamer discovery. Typical initial selection libraries contain random regions of 40-50 nucleotides, all of which contain 2'-fluorine (2'-F) modifications. For example, for selection against human VEGF-121 (R&D systems, 4644-vs-CF), the forward primer used was 5'-CGCCCTCGTCCCATCTC-3' (SEQ ID NO: 134), and the reverse primer used was 5'-CGTTCTCGGTTGGTGTTC-3' (SEQ ID NO: 135).

[0650] Table 1 Recombinant VEGFA protein used for aptamer selection

[0651] protein Provider Catalog Number Human VEGF-121 R&D systems 4644-vs-CF Human VEGF-121 (C-6His) New Protein C699 Human VEGF-121(N-6His) ACROBiosystems VE1-H5246 <![CDATA[Biotinylated human VEGF-121 (Avitag TM )]]> ACROBiosystems VE1-H82E7 Human VEGF-121 ProSpec CYT-200 Human VEGF-121 Shenandoah Biotechnology 100-116 Human VEGF-165 R&D systems 293-VE-500 Human VEGF-165(N-6His) ACROBiosystems VE5-H5248 <![CDATA[Biotinylated human VEGF-165 (Avitag TM )]]> ACROBiosystems VE5-H82Q0 Human VEGF-165 Shenandoah Biotechnology 100-44 Mouse VEGF-120 Shenandoah Biotechnology 200-52 Rat VEGF-164 R&D systems 564-RV / CF Mouse VEGF-164 Shenandoah Biotechnology 200-34

[0652] Selection begins with the synthesis of a library of monoclonal modified aptamer particles (MAPs), each of which displays multiple copies of a fully 2'-fluoro-modified aptamer candidate sequence on its surface. The emulsion is then disrupted and the reverse strand is dehybridized, leaving a single strand of 2'-fluoro-modified aptamer (~90%) and the native DNA template sequence (~10%) on the particle, completing the formation of MAPs, which are now ready for screening. Like the template particles, MAPs are monoclonal, with each particle displaying approximately 10 5 copies of a single modified aptamer sequence and about 10 4 copies of a naturally occurring amplifiable DNA sequence.

[0653] The MAPs are then incubated with one or more selected VEGF targets from Table 1 at 37°C. The MAPs are subsequently labeled with fluorescently labeled (Alexa Fluor 488 or 647) anti-VEGF antibodies (for unlabeled VEGF), anti-His antibodies (for His-tagged VEGF), or streptavidin proteins (for biotinylated VEGF). The fluorescence intensity of each MAP reflects the relative affinity of the 2'-fluoro-modified aptamer for the VEGF target, which allows for quantitative separation of aptamers with high affinity for the target by fluorescence activated cell sorter (FACS). In order to perform iterative rounds of CAPD to focus the pool on the best binders, the native DNA coding strands on the enriched MAPs are amplified using PCR by a high-fidelity polymerase and subsequent rounds of screening or sequencing are performed. Anti-VEGF aptamers with higher affinity can be preferentially selected by shortening the incubation time, reducing the VEGF concentration, and extending the washing time in consecutive rounds. To avoid the generation of anti-VEGF aptamers that bind to VEGF primarily through less specific polar interactions, increasing concentrations of polyanionic competitors such as salmon sperm DNA (Thermo Fisher Scientific, 15632011), herring sperm DNA (Sigma-Aldrich, D3159) and dextran sulfate (Sigma-Aldrich, 31404) were introduced in successive rounds.

[0654] To ensure binding specificity to the selected target, VEGF, increasing concentrations of non-target proteins such as bovine serum albumin (BSA) or casein, or non-target protein mixtures such as diluted human serum (0%, 0.1%, 1%, and 10%) can be introduced into the selection to ensure that the resulting anti-VEGF aptamer is specific even in excess (up to 10% concentration compared to VEGF). 9 It can also specifically recognize VEGF with high affinity in the presence of interfering proteins.

[0655] In some options, a method for enriching anti-VEGF aptamers with slow dissociation rates was also introduced. To this end, the enriched high-affinity MAPs were incubated with saturating concentrations of biotinylated VEGF (ACROBiosystems, VE1-H82E7 or VE5-H82Q0) targets, followed by washing with excess unlabeled VEGF (ACROBiosystems, VE1-H5246 or VE5-H5248) in consecutive rounds for extended durations (from 1 minute to 24 hours). Unlabeled VEGF can replace biotinylated VEGF dissociated from MAPs and will not show any fluorescent signal after labeling MAPs with fluorescent streptavidin. MAPs showing anti-VEGF aptamers with slower dissociation rates can retain more biotinylated VEGF targets after the washing procedure and show higher fluorescence intensity, which allows quantitative separation of anti-VEGF aptamers against VEGF with slower dissociation rates by fluorescence activated cell sorter (FACS).

[0656] For some selections against VEGF-165, excess heparin (Sigma-Aldrich H3393) was introduced as a competitor in the selection to ensure that anti-VEGF aptamers with higher affinity for the receptor binding domain of VEGF-165 were preferentially selected and to avoid the generation of anti-VEGF aptamers targeting the heparin binding domain of VEGF-165. In this way, the resulting anti-VEGF aptamers are likely to recognize both VEGF-165 and VEGF-121.

[0657] To generate anti-VEGF aptamers that can recognize VEGF-121 and VEGF-165 with similar high affinity, some selections were performed by switching the protein target between human VEGF-121 and human VEGF-165 during alternating rounds of selection. The "switching" selection process generated a family of anti-VEGF aptamers, all of which bind VEGF-121 and VEGF-165 with high affinity. Species cross-reactivity facilitates preclinical evaluation of potential therapeutic anti-VEGF aptamers in animal models. To generate aptamers that bind both human VEGF and rat / mouse VEGF, some selections were also performed by switching the protein target between human VEGF-121 and mouse VEGF-120 (Shenandoah Biotechnology, 200-52) or rat VEGF164 (R&D Systems, 564-RV / CF) during alternating rounds of selection.

[0658] Example 2 Identification and truncation of anti-VEGF aptamers

[0659] Truncated and modified variants of the anti-VEGF aptamers described in this application were prepared by LGC Biosearch Technologies (Novato, CA) and examined for their binding affinities to the corresponding targets. Briefly, the equilibrium binding constants of the enriched libraries were measured using a magnetic bead partitioning method. Biotinylated anti-VEGF aptamers were conjugated to 1 μm streptavidin-coated MyOne Streptavidin C1 magnetic beads (Thermo Fisher Scientific, 65002). The anti-VEGF aptamer was incubated at 37°C with a fixed concentration of 0.01 nM and a concentration range of 10 -12 Up to 10 -8 Binding assays were performed by incubating the target protein in PBSMCT buffer (DPBS containing 2.5 mM MgCl2, 1 mM CaCl2 and 0.01% TWEEN-20, pH 7.2) for 90 minutes. The bound target protein was isolated by magnetic separation and subsequently labeled by fluorescent anti-VEGF or anti-His-tagged antibodies. The proportion of bound anti-VEGF aptamers was quantified by flow cytometry (BD Accuri C6 Plus). The raw binding data were corrected for nonspecific background binding of target protein to empty magnetic beads. The binding fraction of the anti-VEGF aptamer was plotted as a function of protein concentration, and the equilibrium binding constant (K) was extracted from the data using a nonlinear curve fitting algorithm (Langmuir single-site binding model). D value) (Figure 1).

[0660] Representative truncated variants of anti-aptamer sequences selected from recombinant human VEGF-165 are shown in Table 2, where their K values ​​for VEGF-121 and VEGF-165 are indicated. D Most of the anti-VEGF aptamers shown in Table 2 showed high affinity for VEGF-165, however, they could not recognize VEGF-121 with suitable affinity. These results suggest that the use of VEGF-165 as a target (similar to ) The resulting anti-aptamer generated most likely binds to the heparin-binding domain of VEGF-165 and therefore fails to recognize VEGF-121, which lacks the heparin-binding domain.

[0661] Table 2 Selection of truncated aptamers for human VEGF-165

[0662]

[0663]

[0664] Representative truncated variants of anti-VEGF aptamer sequences from the selection for recombinant human VEGF-121 are shown in Tables 3 and 4, along with their K values ​​for VEGF-121 and VEGF-165. D The aptamers shown in Table 3 showed high affinity for VEGF-121; however, they showed lower affinity for VEGF-165 (K D >10 nM). These results indicate that the anti-VEGF aptamers in Table 3 do not bind to the VEGF receptor binding domain on VEGF-121 because VEGF-121 and VEGF-165 share the same VEGF receptor binding domain. The truncated aptamer sequences listed in Table 4 were generated using advanced selection methods as described above, such as including polyanions and / or protein competitors, increasing the dissociation rate, switching between VEGF-121 and VEGF-165, and the resulting anti-VEGF aptamers can recognize VEGF-121 and VEGF-165 with high affinity.

[0665] Table 3 Aptamers of human VEGF-121

[0666]

[0667] Table 4 Aptamers of both human VEGF-121 and human VEGF-165

[0668]

[0669]

[0670] Various mutations and truncated variants of two high-affinity anti-VEGF aptamers (AMS0421 and AMS0425) and their K for VEGF-121 and VEGF-165 D The values ​​are shown in Tables 5 and 6, respectively. In a series of mutation and deletion experiments, AMS0421 was truncated to a 38-mer (AMS0427) (Table 5), and in a series of mutation and deletion experiments, AMS0425 was truncated to a 36-mer (AMS0426) (Table 6).

[0671] Table 5 Variants of anti-VEGF aptamer AMS0421

[0672] Aptamer ID <![CDATA[K of VEGF-121 D (nM)]]> <![CDATA[K of VEGF-165 D (nM)]]> AMS0421 0.045 0.096 AMS0421.1 0.049 0.101 AMS0427 0.045 0.091 AMS0421.3 0.051 0.098 AMS0421.4 0.471 1.92 AMS0421.5 0.511 0.879 AMS0427.1 0.047 0.092 AMS0427.2 0.043 0.087

[0673] Table 6 Variants of anti-VEGF aptamer AMS0425

[0674]

[0675]

[0676] Figure 1A Two representative fully modified anti-VEGF aptamers described in this application are and K of human VEGF-121 D Determination of value; Figure 1B Two representative fully modified anti-VEGF aptamers described in this application are and K of human VEGF-165 D Determination of value. Figure 1C is the K of AMS0427 (38 nucleotides of fully 2'-fluorine-modified anti-VEGF aptamer) described in this application for various VEGFA isoforms D Determination of value.

[0677] As can be seen from Figure 1, the only FDA-approved aptamer-based anti-VEGF nucleic acid therapeutic that binds only to VEGF-165 In comparison, AMS0426 and AMS0427 were both less than 150 pM ( Figure 1A and Figure 1B ) binds to human VEGF-121 and human VEGF-165 with comparable or superior affinity to FDA-approved protein-based anti-VEGF therapeutics that bind to VEGF-121 and VEGF-165 with similar affinity The binding affinities of AMS0426 and AMS0427 were both improved by more than 10-fold. The truncated variant (38-mer AMS0427) encompassing the shortest sequence with the highest affinity binding bound to human VEGF-121 (from five different suppliers), human VEGF-165 (from three different suppliers), mouse VEGF 120, and rat VEGF-164 with comparable affinities ranging from 0.01 to 0.15 nM. Figure 1C ).

[0678] Example 3 Anti-VEGF Aptamer In Vitro VEGF-Receptor Competition Assay

[0679] To demonstrate that the anti-VEGF aptamers described in the present application are potent inhibitors of vascular endothelial growth factor-A (VEGF) signaling, in vitro competition assays were performed to verify that the selected anti-VEGF aptamers can block the interaction between VEGFA and VEGF-Rs (such as VEGF-R1 and VEGF-R2). Three different recombinant VEGF receptors (two VEGF-R1 and one VEGF-R2) (R&D Systems, 3516-FL, 321-FL and 357-KD) were tested. In order to determine the receptor competition IC 500.1 nM His-tagged VEGF-121 or VEGF-165 was conjugated to Dynabeads His-tag separation and pull-down beads (ThermoFisher Scientific, 10104D) and then incubated with 1 nM VEGF receptor and a concentration range of 10 -12 Up to 10 -8 The aptamers were incubated with 1 nM of 1% VEGF in PBS MCT buffer (DPBS containing 2.5 mM MgCl2, 1 mM CaCl2 and 0.01% TWEEN-20, pH 7.2) for 90 minutes. VEGF-bound receptors and anti-VEGF aptamers were separated by magnetic separation, and the VEGF-bound receptors were subsequently labeled by fluorescent anti-human antibodies. The content of VEGF-bound receptors was quantified by flow cytometry (BD Accuri C6 Plus). The raw binding data were corrected for nonspecific background binding and normalized to the fluorescence intensity from samples with 1 nM VEGF receptor but no competition from the anti-VEGF aptamer. The content of bound receptors was plotted as a function of the anti-VEGF aptamer concentration, and the IC was extracted from the data using a nonlinear curve fitting algorithm (dose-response inhibition). 50 value (Figure 2).

[0680] Figure 2A Two representative fully modified anti-VEGF aptamers AMS0427 and AMS0426, and the non-binding fully modified anti-VEGF aptamers AMS0421.12 and IC for human VEGF-121 and human VEGF receptor 1 50 Determination of value; Figure 2B Two representative fully modified anti-VEGF aptamers AMS0427 and AMS0426, and the non-binding fully modified anti-VEGF aptamers AMS0421.12 and Determination of IC50 values ​​for human VEGF-165 and human VEGF receptor 1; Figure 2C Two representative fully modified anti-VEGF aptamers AMS0427 and AMS0426, and the non-binding fully modified anti-VEGF aptamers AMS0421.12 and IC for human VEGF-121 and human VEGF receptor 2 50 Determination of value; Figure 2D Two representative fully modified anti-VEGF aptamers AMS0427 and AMS0426, and the non-binding fully modified anti-VEGF aptamers AMS0421.12 and IC for human VEGF-165 and human VEGF receptor 2 50 Determination of value.

[0681] It can be seen that AMS0427 and AMS0426 potently inhibited the interactions between VEGF-121 and VEGF-R1, VEGF-165 and VEGF-R1, VEGF-121 and VEGF-R2, and VEGF-165 and VEGF-R2 (IC 50 value is about 100 pM), indicating that the anti-VEGF aptamers of the present invention bind to and block the receptor binding domains on both VEGF isoforms.

[0682] Example 4 Secondary structure of anti-VEGF aptamer

[0683] The two-dimensional structure analysis of the selected anti-VEGF aptamer was performed using the NUPACK software suite. The results are shown in FIG3 . Figure 3A The secondary structure predictions of AMS0421 and AMS0427 are demonstrated. The dotted boxes highlight the conserved nucleotide sequences; Figure 3B Demonstrated are the secondary structure predictions for AMS0426, AMS0427, and AMS0430. The dotted boxes highlight the conserved nucleotide sequences.

[0684] According to various mutations and truncated variants of AMS0421 and their K for VEGF-121 and VEGF-165 D The values ​​(as shown in Table 5) demonstrate that the sequences highlighted in the dashed box containing the three bulge regions (i.e., the first bulge, the second bulge, and the third bulge) are highly conserved ( Figure 3A ).

[0685] The nucleotide composition of the top loop region (i.e., the first loop) is not essential and can tolerate modification or substitution with a hexaethylene glycol (Heg) linker. Similar analyses were performed on various mutations and truncated variants of AMS0426. Although sequences AMS0426 and AMS0427 appear very different, their predicted structures are very similar. The sequence shown in the dashed box is highly conserved in both AMS0426 and AMS0427, and AMS0426 contains the same bulge regions (first bulge and second bulge) as those in AMS0427 ( Figure 3B ), but for AMS0426 and AMS0427, the positions of the non-essential top loop and bottom stem regions are reversed. To verify this finding, AMS0426 was mutated into AMS0430 by switching their top loop (i.e., first loop) and bottom stem (i.e., first stem) regions to make them more similar to AMS0427, and confirmed that the performance of AMS0426 and AMS0430 was not altered ( Figure 3B). It was demonstrated that the conserved nucleotide sequences in the selected anti-VEGF aptamers (ie, consensus sequence 1 and consensus sequence 2) are the sequences shown in the dashed boxes in FIG3 , and these conserved nucleotide sequences are underlined in Table 7.

[0686] Table 7 Conserved sequences of anti-VEGF aptamers

[0687]

[0688] Example 5 In vivo efficacy testing of anti-VEGF aptamers in the rat laser-induced choroidal neovascularization (CNV) model

[0689] This study was conducted largely following previously established procedures. The study was conducted using 6-8 week old male BN (Brown Norway) rats. The rats were anesthetized with sodium pentobarbital (30 mg / kg, injected via tail vein), the pupils were dilated, and CNV was induced in the rats by laser rupture of Bruch's membrane (6 burns / eye. Laser settings: 150 mW, diameter 100 μm, duration 100 ms). Only laser points that formed bubbles but did not bleed were considered valid CNV lesions and were included in the study. The following agents were then administered by intravitreal injection on the same day (D1): Group 1: 5 μl of drug vehicle as a negative control; Group 2: 5 μl of 40 mg / ml of aflibercept; Group 3: 5 μl of 40 mg / ml of AMS0427. Fluorescein angiography (FA) was performed to visualize CNV lesions: 10% sodium fluorescein was injected at 0.5 ml / kg of body weight; after injection, a series of rapid red-free images were taken within the first minute (early images) and 5 minutes later (late images). The severity of leakage of each lesion was scored based on the late images according to a grading scale of 0-3 (grade 3 being the most severe, representing clinically significant CNV). The percentage of lesions with grade 3 leakage and the mean leakage score were then calculated for each group.

[0690] Previous examples have demonstrated the high in vitro potency of anti-VEGF aptamers against both VEGF-165 and VEGF-121 and suggest that they may serve as potent therapeutic agents for retinal diseases such as wet AMD, DME, and DR. In this example, the anti-VEGF aptamers described in this application have been tested in the laser-induced CNV model, which is a commonly used animal model for wet AMD. It is also worth noting that the anti-VEGF aptamers have been previously tested in this model. (Please refer to Mark H et al., Comparing Pegaptanib and Triamcinolone Efficacy in the Rat Choroidal Neovascularization Model, (REPRINTED) ARCH OPHTHALMOL / Vol. 126 (No. 7), July 2008), and reported negligible benefits compared to the drug vehicle control (PBS solution).

[0691] The results are shown in Figure 8. These results show that the anti-VEGF aptamer of the present invention significantly reduced the number of grade 3 lesions and the average leakage score compared to the negative control, reaching a level comparable to that of aflibercept. This demonstrates the in vivo efficacy of the anti-VEGF aptamer.

[0692] Example 6 Selection of anti-Ang2 aptamers

[0693] The selection method is similar to that of Example 1.

[0694] Briefly, recombinant human angiopoietin-2 protein (R&D Systems, 623-AN) was used as a target protein for anti-Ang2 aptamer discovery. A typical initial selection library contained a random region of 40 nucleotides, all of which contained 2'-fluorine (2'-F) modifications. The forward primer was 5'-ATCCAGAGTGACG-CTCTTCAGCA-3' (SEQ ID NO: 136) and the reverse primer was 5'-TGAAGAGCGTCACTCTGGAT-3' (SEQ ID NO: 137). The following examples describe the selection and generation of aptamers that specifically bind to recombinant human Ang2.

[0695] Each selection begins with the synthesis of a library of monoclonal modified aptamer particles (MAPs), each of which displays multiple copies of fully 2'-fluorinated modified aptamer candidate sequences on its surface. The MAPs are then incubated with the Ang2 target at 37°C. The MAPs are subsequently labeled using fluorescently labeled (Alexa Fluor 488 or 647) anti-Ang2 antibodies or anti-His antibodies (for His-tagged Ang2) or streptavidin protein (for biotinylated Agn2). The fluorescence intensity of each MAP reflects the relative affinity of the 2'-fluorinated modified aptamer for the Ang2 target, which allows the quantitative separation of aptamers with high affinity for the target by fluorescence activated cell sorter (FACS). In order to perform iterative rounds of CAPD to focus the pool on the best binders, the native DNA coding strands on the enriched MAPs are amplified using PCR by high-fidelity polymerases and subsequent rounds of screening or sequencing are performed. Anti-Ang2 aptamers with higher affinity can be preferentially selected by shortening the incubation time, reducing the Ang2 concentration and extending the washing time in consecutive rounds. To avoid the generation of anti-Ang2 aptamers that bind to Ang2 primarily through less specific polar interactions, increasing concentrations of polyanionic competitors such as salmon sperm DNA (ThermoFisher Scientific, 15632011), herring sperm DNA (Sigma-Aldrich, D3159) and dextran sulfate (Sigma-Aldrich, 31404) were introduced in successive rounds.

[0696] In some selection processes, advanced techniques were used to ensure the fine binding specificity requirements of anti-Ang2 aptamers—ideally, anti-Ang2 aptamers should not bind to their homologue Ang1, which has the opposite effect to Ang2. For example, increasing concentrations of non-target proteins such as bovine serum albumin (BSA) or casein or Ang1 (R&D Systems, 923-AN) or non-target protein mixtures (such as diluted human serum 0%, 0.1%, 1% and 10%) can be introduced into the selection to ensure that the aptamer binds even in excess (up to 10% concentration compared to Ang2). 9 When the interfering protein is present at a concentration of 100 times (times), the anti-Ang2 aptamer obtained can also specifically recognize Ang2 with high affinity.

[0697] In some options, a method for enriching anti-Ang2 aptamers with slow dissociation rates was also introduced. To this end, the enriched high-affinity MAPs were incubated with a saturating concentration of biotinylated Ang2 target and subsequently washed with excess unlabeled Ang2 for increasing durations (from 1 minute to 24 hours). Unlabeled Ang2 can replace biotinylated Ang2 dissociated from MAPs and does not show any fluorescent signal after labeling MAPs with fluorescent streptavidin. MAPs showing aptamers with slower dissociation rates can retain more biotinylated Ang2 targets after the washing procedure and show higher fluorescence intensity, which allows us to quantitatively separate anti-VEGF aptamers against Ang2 with slower dissociation rates by fluorescence activated cell sorter (FACS).

[0698] Species cross-reactivity facilitates preclinical evaluation of potential therapeutic anti-Ang2 aptamers in animal models. To generate anti-Ang2 aptamers that bind both human Ang2 and mouse Ang2, some selections were also performed by switching the protein target between human Ang2 and mouse Ang2 (R&D Systems, 7186-AN) during alternating rounds of selection. The switch selection process generated a family of anti-Ang2 aptamers, all of which bind to both human and mouse Ang2 with high affinity.

[0699] Example 7 Identification and truncation of anti-Ang2 aptamers and binding affinity determination

[0700] Various mutations and truncated variants of a representative anti-Ang2 aptamer (AMS0525) were obtained, and their binding affinity to Ang2 was measured using a magnetic bead partitioning method. The biotinylated anti-Ang aptamer was conjugated to 1 μm streptavidin-coated MyOne streptavidin C1 magnetic beads (Thermo Fisher Scientific, 65002). The aptamer was incubated at 37°C with a fixed concentration of 0.01 nM and a concentration range of 10 -12 Up to 10 -8 The binding assay was performed by incubating the Ang2 protein in PBSMCT buffer (DPBS containing 2.5 mM MgCl2, 1 mM CaCl2 and 0.01% TWEEN-20, pH 7.2) for 90 minutes. The bound target protein was separated by magnetic separation and then labeled with a fluorescent anti-His tag antibody. The content of bound anti-Ang2 aptamer was quantified by flow cytometry (BD Accuri C6 Plus). The raw binding data were corrected for nonspecific background binding of target protein to empty magnetic beads. The content of bound anti-Ang2 aptamer was plotted as a function of protein concentration, and the equilibrium binding constant (K) was extracted from the data using a nonlinear curve fitting algorithm (Langmuir single site binding model).D value)( Figure 4A ).

[0701] The K of Ang2 obtained D The values ​​are shown in Table 8. In a series of mutation and deletion experiments, AMS0525 was truncated to a 48-mer (AMS0526). D Compared with the partially modified anti-Ang2 aptamers that bind to human, AMS0526 is a fully modified aptamer that binds to Ang2 with superior affinity (K D <100 pM) binds to both human and mouse Ang2 and does not recognize human Ang1 ( Figure 4A ).

[0702] Table 8 Variants of anti-Ang2 aptamer AMS0525

[0703] Aptamer ID <![CDATA[K of Ang2 D (nM)]]> AMS0525 0.404 AMS0526 0.032 AMS0525.3 0.033 AMS0525.4 >1 AMS0525.5 0.043 AMS0525.6 0.029 AMS0525.7 0.093 AMS0525.8 0.085

[0704] Interestingly, it was noted that replacing the 2'F modified nucleotides with the corresponding nucleotides modified with 2'OMe or LNA did not significantly affect the binding of the resulting anti-Ang2 aptamers to target Ang2 (as evidenced by the K D value).

[0705] In addition, the two-dimensional structure analysis of the anti-Ang2 aptamer AMS0526 was performed using the NUPACK software suite, and the predicted structure is shown in Figure 4B shown.

[0706] Example 8 Anti-Ang2 Aptamer In Vitro Tie2 Receptor Competition Assay

[0707] In order to demonstrate that the anti-Ang2 aptamers of the present invention are potent inhibitors of Ang2 signaling, an in vitro competition assay was performed to verify that the selected anti-Ang2 aptamers can block the interaction between Ang2 and Tie-2. 50 0.01 nM His-tagged Ang2 was conjugated to Dynabeads His-tag separation and pull-down beads (ThermoFisher Scientific, 10104D) and then incubated with 1 nM Tie2 (R&D Systems, 313-TI) and a concentration range of 10 -12 Up to 10 -8Tie2 and anti-Ang2 aptamer were incubated together with 1 nM of Tie2 in PBS MCT buffer (DPBS containing 2.5 mM MgCl2, 1 mM CaCl2 and 0.01% TWEEN-20, pH 7.2) for 90 min. Ang2-bound Tie2 and anti-Ang2 aptamer were separated by magnetic separation, and Ang2-bound Tie2 was subsequently labeled with fluorescent anti-human antibodies. The content of Ang2-bound receptor was quantified by flow cytometry (BD Accuri C6Plus). The raw binding data were corrected for nonspecific background binding and normalized to the fluorescence intensity from samples containing 1 nM Tie2 but without anti-Ang2 aptamer competition. The content of bound receptor was plotted as a function of anti-Ang2 aptamer concentration, and IC was extracted from the data using a nonlinear curve fitting algorithm (dose-response inhibition). 50 value( Figure 4C ). It can be seen that AMS0526 can be used with an IC of 83.9 pM 50 Potently inhibited the interaction between Ang2 and Tie2, which is 30 times better than the previously reported anti-Ang2 aptamer ( Figure 4C ).

[0708] Example 9 In vivo efficacy testing of anti-Ang2 aptamers in oxygen-induced retinopathy (OIR) model

[0709] This study was conducted largely following previously established procedures to test effects on angiogenesis and vascular permeability. OIR was induced by placing littermates of C57BL / 6 mice in 75% O2 at postnatal day 7 (P7). At P12, mice were returned to room air. To test effects on angiogenesis, mice received intravitreal injections of the following agents on the same day: Group 1 (G1): PBS (negative control); G2: 20 μg aflibercept; G3: 20 μg AMS0525G4; G4: 20 μg aflibercept + 20 μg AMS0525; At P17, mice were sacrificed, fixed in 10% phosphate-buffered formalin for 4 h at 22°C, and eyes were dissected and retinal flat mounts were prepared. Retinas were then stained with FITC-labeled Griffonia simplicifolia (GSA) lectin (Vector Laboratories) for 45 min to visualize NV. Digital photographs were acquired at 5X magnification using a Zeiss fluorescence microscope, and images were merged into one image to show the entire retina using the photo merge option of Photoshop CS5.4. The area of ​​retinal NV was measured by Image-Pro Plus (MediaCybernetics) by an independent researcher who was unaware of the identity of the samples. To test the effect on vascular permeability, OIR was induced by the same procedure as above, but mice received injections at P16, when neovascularization (NV) had already formed. In this way, only the effect of the drug on vascular permeability was tested, and NV growth was not tested. At P17, vitreous samples of the mice were obtained and the amount of albumin leaking from the vessels was measured by ELISA.

[0710] The results are shown in Figure 11. While inhibition of Ang2 alone had a very mild effect (consistent with previous studies), combining the anti-Ang2 aptamer of the present invention with aflibercept almost completely eliminated NV, resulting in significantly better efficacy than aflibercept alone ( Fig. 11B ).like Fig. 11C As shown, although NV had been established, the combination of the anti-Ang2 aptamer of the present invention and aflibercept reduced leakage better than aflibercept alone.

[0711] Example 10 Obtaining a bispecific aptamer

[0712] In order to develop bispecific aptamer constructs specific for VEGF and Ang2, a variety of aptamer constructs containing anti-VEGF aptamers and anti-Ang2 aptamers were designed and tested. Bispecific aptamer constructs were tested by combining one of the three anti-VEGF aptamers (AMS0421, AMS0426 or AMS0427) and the anti-Ang2 aptamer AMS0526. The bispecific aptamer constructs were synthesized from head to tail, and the aptamer constructs (with anti-VEGF aptamer at the 5' end or anti-Ang2 aptamer at the 5' end) were directly connected in both directions without any linker. The results are shown in Table 9.

[0713] Table 9 VEGF / Ang2 bispecific aptamers

[0714]

[0715] Based on the binding affinity to VEGF-121 and Ang2, the bispecific aptamers AMSB103 and AMSB106 appear to give the best results in this experiment. Both bispecific aptamers (AMSB103 and AMSB106) are synthesized by combining the anti-VEGF aptamer AMS0427 and the anti-Ang2 aptamer AMS0526. Both AMSB103 and AMSB106 show binding affinity to VEGF-121 and Ang2, which is equal to or better than the binding affinity of its precursor aptamer (Table 9). The non-essential bottom stem region (CGC for both aptamers) of the anti-VEGF aptamer AMS0427 and the anti-Ang2 aptamer AMS0526 is carefully selected to minimize the chance of misfolding and interference between the two single aptamers. As shown in the predicted secondary structures of AMSB103 and AMSB106 ( Figure 5 ), the structures of both the anti-VEGF aptamer AMS0427 and the anti-Ang2 receptor AMS0526 were well preserved in both bispecific constructs.

[0716] Another set of bispecific aptamers containing the aptamer anti-VEGF aptamer AMS0427 and the anti-Ang2 aptamer AMS0526 (where the anti-VEGF aptamer is located at the 5' end) was tested to determine the effect of the total length of the linker. The aptamer constructs were synthesized from head to tail and connected to six hexaethylene glycol (Heg) linkers (AMSB103.1-AMSB103.6) through zero (AMSB103). The results are shown in Table 10. All bispecific aptamer constructs performed well, demonstrating that the Heg linker length has little effect on the binding affinity of AMSB103 to both VEGF and Ang2. AMSB103 without the Heg linker was used for future experiments.

[0717] Table 10 VEGF / Ang2 bispecific aptamer AMSB103 with different linkers

[0718]

[0719]

[0720] "H" represents a hexaethylene glycol (Heg) linker.

[0721] The bispecific aptamer AMSB103 was also tested in a VEGF and Ang2 functional receptor competition assay. Based on the functional competition assay data, AMSB103 showed an IC of <100 pM. 50 The value inhibits VEGF / VEGFR2 interaction and Ang2 / Tie2 interaction ( Fig. 6A and Figure 6B ).

[0722] Example 11 Simultaneous Binding of Bispecific Aptamers to VEGF and Ang2

[0723] To demonstrate the ability of the bispecific aptamers described in this application to simultaneously bind VEGF and Ang2, a binding affinity assay based on modified magnetic beads was developed. Briefly, the 5'-biotinylated bispecific aptamer AMSB103 was synthesized by LGC Biosearch Technologies (Novato, CA) and conjugated to 2.8 μm streptavidin-coated M-270 streptavidin magnetic beads (Thermo Fisher Scientific, 65305). The binding affinity of AMSB103 to VEGF-121 and VEGF-165 was first saturated with a fixed concentration of aptamer (0.01 nM) with an excess of Ang2 (1 μM) in PBSMCT buffer (DPBS containing 2.5 mM MgCl2, 1 mM CaCl2 and 0.01% TWEEN-20, pH 7.2) at 37°C for 30 minutes. Then, a concentration range of 10 -12 Up to 10 -8M of VEGF in PBSMCT buffer was added to the mixture of bispecific aptamer and Ang2 and incubated at 37°C for 90 minutes. The bound VEGF and Ang2 proteins were distributed by magnetic separation and subsequently labeled by fluorescent anti-VEGF antibodies and anti-Ang2 antibodies (each antibody had a different fluorescent label). Ang2 and VEGF bound by the bispecific aptamer were quantified by flow cytometry (BD Accuri C6 Plus). The raw binding data were corrected for nonspecific background binding of the target protein to empty magnetic beads. The content of VEGF-bound bispecific aptamer was plotted as a function of VEGF concentration, and the equilibrium binding constant (K) of AMSB103 for VEGF protein was extracted from the data using a nonlinear curve fitting algorithm (Langmuir single-site binding model). D value)( Fig. 7A and Figure 7B ).

[0724] Interestingly, the presence of high concentrations of Ang2 did not affect the binding of AMSB103 to VEGF-165.

[0725] The binding affinity of AMSB103 to Ang2 was measured using a similar assay by first saturating a fixed concentration of bispecific aptamer (0.01 nM)-coated M-270 streptavidin beads with an excess of VEGF-165 (1 μM) in PBS MCT buffer for 30 min at 37°C. -12 Up to 10 -8 M of Ang2 in PBSMCT buffer was added to the bispecific aptamer-VEGF mixture and incubated at 37°C for 90 minutes. The bound VEGF and Ang2 proteins were separated by magnetic separation and subsequently labeled with fluorescent anti-VEGF antibodies and anti-Ang2 antibodies (each antibody had a different fluorescent label). The aptamer-bound VEGF and Ang2 were quantified by flow cytometry (BD Accuri C6 Plus). The raw binding data were corrected for nonspecific background binding of the target protein to empty magnetic beads. The content of the specific aptamer bound to Ang2 was plotted as a function of Ang2 concentration, and the equilibrium binding constant (K) of AMSB103 for Ang2 was extracted from the data using a nonlinear curve fitting algorithm (Langmuir single-site binding model). D value)( Figure 7C ).

[0726] The presence of high concentration of VEGF-121 did not affect the binding of AMSB103 to Ang2.

[0727] The affinity of AMSB103 for VEGF-121, VEGF-165 and Ang2 is <100 pM (Figure 7). Because the VEGF-121 or VEGF-165 binding affinity test was performed in the presence of a saturating concentration of Ang2 (1 μM), and because the Ang2 binding test was performed in the presence of a saturating concentration of VEGF-121 (1 μM), it can be concluded that AMSB103 binds to both VEGF and Ang2.

[0728] Example 12 In vivo efficacy testing of bispecific aptamers in a rat laser-induced CNV model

[0729] This study was conducted largely following previously established procedures. The study was conducted using 6- to 8-week-old male Brown Norway (BN) rats. The rats were anesthetized with sodium pentobarbital (30 mg / kg, injected via the tail vein), the pupils were dilated, and CNV was induced in the rats by laser rupture of Bruch's membrane (6 burns / eye. Laser settings: 150 mW, diameter 100 μm, duration 100 ms). Only laser points that formed bubbles but did not bleed were considered valid CNV lesions and were included in the study. The following agents were then administered by intravitreal injection on the same day (D1): Group 1: 5 μl of drug vehicle as a negative control; Group 2: 5 μl of 40 mg / ml of aflibercept; Group 3: 5 μl of 40 mg / ml of AMSB103. Fluorescein angiography (FA) was performed to visualize CNV lesions: 10% sodium fluorescein was injected at 0.5 ml / kg of body weight; after injection, a series of rapid red-free images were taken within the first minute (early images), and additional images were taken 5 minutes later (late images). The severity of leakage for each lesion was scored based on the late images according to a grading scale of 0-3 (grade 3 being the most severe, representing clinically significant CNV). The percentage of lesions with grade 3 leakage and the mean leakage score were then calculated for each group.

[0730] The results are shown in Figure 9. As can be seen from the results, compared with the negative control, AMSB103 significantly reduced the number of grade 3 lesions and the average leakage score. Compared with aflibercept, AMSB103 also showed a trend of better reduction of grade 3 lesions and better reduction of the average leakage score. This demonstrates the in vivo efficacy of the bispecific aptamer of the present invention.

[0731] Therefore, the bispecific aptamers described in the present application (e.g., AMSB103) can serve as potent therapeutic agents for various diseases, such as wet age-related macular degeneration (AMD), diabetic macular edema (DME), and diabetic retinopathy (DR), because the laser-induced CNV model is a commonly used animal model for wet AMD.

[0732] Example 13 In vivo efficacy testing of bispecific aptamers in the non-human primate (NHP) laser-induced CNV model

[0733] This study was conducted largely following previously established procedures. Adult cynomolgus monkeys (2–4 kg) were used for the study. Monkeys were anesthetized with ketamine hydrochloride (10 mg / kg, IM) and sodium pentobarbital (12 mg / kg, IV), pupils were dilated, and CNV was induced in monkeys by laser destruction of Bruch's membrane around the macula (6–8 burns per eye. Laser settings: wavelength 532 nm, 400–500 mW, diameter 50 μm, duration 100 ms). Only laser spots that formed blebs but did not bleed were considered valid CNV lesions and were included in the study. Two weeks after laser treatment (D15), fluorescein angiography (FA) was performed to visualize CNV lesions: 100 mg / ml sodium fluorescein was injected at 100 mg / ml body weight; after injection, a series of rapid images were taken within the first minute (early images) and 5 minutes later (late images). The leakage of each lesion was visualized by comparing the late images with the early images, and the severity of leakage was scored according to a scale from Grade I to Grade IV: Grade I - no hyperfluorescence; Grade II - hyperfluorescence without leakage; Grade III - hyperfluorescence and late leakage in early or mid-term images; Grade IV - bright hyperfluorescence during transit, and late leakage outside the treatment area. Grade IV lesions were considered clinically significant. Then, the monkeys were assigned to different experimental groups so that each group had a considerable proportion of lesions with Grade IV leakage. Optical coherence tomography (OCT) was also performed to measure the height of subretinal high reflective material (SHRM) at the laser burn, which resembled human pathological CNV. The following agents were then administered by intravitreal injection on the same day (D15): Group 1: 50 μl PBS as a negative control; Group 2: 50 μl 2 mg / ml AMSB103. Following the above procedure, at D29, CNV lesions were measured again by FA imaging, and the effect of each agent was measured by comparing the leakage area of ​​Grade IV lesions before and after injection. In addition, OCT was performed, and the height of SHRM before and after injection was compared.

[0734] The results are shown in Figure 10. As can be seen from the results, the injection of PBS (Group 1) resulted in almost no reduction in SHRM thickness and no reduction in leakage area. In contrast, the injection of AMSB103 resulted in a significant reduction in SHRM thickness and leakage area, confirming its potent efficacy in inhibiting CNV in NHPs.

[0735] Interestingly, It was also tested in this model but was reported to be ineffective in inhibiting CNV, which may be attributed to the fact that it does not inhibit some VEGF isoforms such as VEGF-121 (see RTTzekov et al., Evaluation of intravitreal application of Pegaptanib Sodium on Laser-induced CNV in Cynomolgus Monkeys, ARVO Annual Meeting Abstract, May 2006). However, the bispecific aptamers described in this application showed potent efficacy in this model.

[0736] Although preferred embodiments of the present invention have been shown and described herein, it is obvious to those skilled in the art that such embodiments are provided only as examples. The present invention is not intended to be limited by the specific examples provided in the specification. Although the present invention has been described with reference to the foregoing description, the description and illustration of the embodiments herein are not meant to be interpreted in a limiting sense. Without departing from the present invention, many variations, changes and substitutions will now occur to those skilled in the art. In addition, it should be understood that all aspects of the present invention are not limited to the specific description, configuration or relative proportions set forth herein according to various conditions and variables. It should be understood that various alternatives to the embodiments of the present invention described herein may be adopted when practicing the present invention. It is contemplated that the present invention will also cover any such substitutions, modifications, variations or equivalents. The following claims are intended to define the scope of the present invention, and methods and structures within the scope of these claims and their equivalents are thereby covered. Sequence Listing <110> Aipujide Biotechnology Co., Ltd. <120> Aptamers and their uses <130> 0014-PA-010CN <160> 157 <170> PatentIn version 3.5 <210> 1 <211> 39 <212> RNA <213> Artificial Sequence <220> <223> Natural anti-VEGF aptamers <400> 1 gcucuucagc cccgcgccgg gucccacucu gcgccgcuc 39 <210> 2 <211> 30 <212> RNA <213> Artificial Sequence <220> <223> Natural anti-VEGF aptamers <400> 2 gugcuucua uccguccccc ccuugcugcg 30 <210> 3 <211> 44 <212> RNA <213> Artificial Sequence <220> <223> Natural anti-VEGF aptamers <400> 3 auucugucuu uuuaaauaau guccccuugu ugcacauuac agaa 44 <210> 4 <211> 40 <212> RNA <213> Artificial Sequence <220> <223> Natural anti-VEGF aptamers <400> 4 uucugucuuu uuagauaaug uccccuuguu gcacauuaca 40 <210> 5 <211> 48 <212> RNA <213> Artificial Sequence <220> <223> Natural anti-VEGF aptamers <400> 5 gcucuucaau guuaacuacc aaucguugau cguuuugcag aaaauucc 48 <210> 6 <211> 48 <212> RNA <213> Artificial Sequence <220> <223> Natural anti-VEGF aptamers <400> 6 gcucuucggu guuaacuacc aaucguugau cguuuugcaa aaaauucc 48 <210> 7 <211> 30 <212> RNA <213> Artificial Sequence <220> <223> Natural anti-VEGF aptamers <400> 7 uccgcuugcg gagcagcuucuguauucugc 30 <210> 8 <211> 30 <212> RNA <213> Artificial Sequence <220> <223> Natural anti-VEGF aptamers <400> 8 uccgcuugcg gagcaucuucuguauucugc 30 <210> 9 <211> 30 <212> RNA <213> Artificial Sequence <220> <223> Natural anti-VEGF aptamers <400> 9 uccgcuugcg gagcaccuucuguauucugc 30 <210> 10 <211> 30 <212> RNA <213> Artificial Sequence <220> <223> Natural anti-VEGF aptamers <400> 10 ggaaaacagu auaaugucuu guuucuucuc 30 <210> 11 <211> 40 <212> RNA <213> Artificial Sequence <220> <223> Natural anti-VEGF aptamers <400> 11 gguuuaucuu aacuuucugc uacgauacag uuuuuguuga 40 <210> 12 <211> 40 <212> RNA <213> Artificial Sequence <220> <223> Natural anti-VEGF aptamers <400> 12 ccaaccgugu aucugucuug cuugcggcgg uuuuguugug 40 <210> 13 <211> 40 <212> RNA <213> Artificial Sequence <220> <223> Natural anti-VEGF aptamers <400> 13 aguuauuugg uggagaggau ccauuuagcu uauacaauuc 40 <210> 14 <211> 40 <212> RNA <213> Artificial Sequence <220> <223> Natural anti-VEGF aptamers <400> 14 ccggccauug guggagauua uccuuugagu acgguuauuc 40 <210> 15 <211> 45 <212> RNA <213> Artificial Sequence <220> <223> Natural anti-VEGF aptamers <400> 15 uuucgcuaga uggcuaacac guauauuugu ggagaugcac uagcg 45 <210> 16 <211> 40 <212> RNA <213> Artificial Sequence <220> <223> Natural anti-VEGF aptamers <400> 16 cguggagaug cauucugucg aggauuggcu aacacgcgaa 40 <210> 17 <211> 40 <212> RNA <213> Artificial Sequence <220> <223> Natural anti-VEGF aptamers <400> 17 uccuuagaug gcuaacacgu auauuugugg agaugcacua 40 <210> 18 <211> 38 <212> RNA <213> Artificial Sequence <220> <223> Natural anti-VEGF aptamers <400> 18 cgcuagaugg cuaacacuau uguggagaug cacuagcg 38 <210> 19 <211> 38 <212> RNA <213> Artificial Sequence <220> <223> Natural anti-VEGF aptamers <400> 19 gcguagaugg cuaacacuau uguggagaug cacuacgc 38 <210> 20 <211> 41 <212> RNA <213> Artificial Sequence <220> <223> Natural anti-VEGF aptamers <400> 20 cgcuaguggc gaacacguau auuuguggcg augcacuagc g 41 <210> twenty one <211> 44 <212> RNA <213> Artificial Sequence <220> <223> Natural anti-VEGF aptamers <400> twenty one cgcuagaugg ccuaacacgu auauuugugg agauggcacu agcg 44 <210> twenty two <211> 36 <212> RNA <213> Artificial Sequence <220> <223> Natural anti-VEGF aptamers <400> twenty two cguggagaug cauucugucg aggauuggcu aacacg 36 <210> twenty three <211> 36 <212> RNA <213> Artificial Sequence <220> <223> Natural anti-VEGF aptamers <400> twenty three cguggagaug cauucugucg aagauuggcu aacacg 36 <210> twenty four <211> 34 <212> RNA <213> Artificial Sequence <220> <223> Natural anti-VEGF aptamers <400> twenty four cguggagaug cauucuucga gauuggcuaa cacg 34 <210> 25 <211> 36 <212> RNA <213> Artificial Sequence <220> <223> Natural anti-VEGF aptamers <400> 25 cguggagaug cguuccgucg aggaucggcu aacacg 36 <210> 26 <211> 40 <212> RNA <213> Artificial Sequence <220> <223> Natural anti-VEGF aptamers <400> 26 cagguggaga ugcauucugu cgaagauugg cuaacaccug 40 <210> 27 <211> 39 <212> RNA <213> Artificial Sequence <220> <223> Natural anti-VEGF aptamers <400> 27 gccguggaga ugcguuccgu cgggaucggc uaacacggc 39 <210> 28 <211> 40 <212> RNA <213> Artificial Sequence <220> <223> Natural anti-VEGF aptamers <400> 28 gccguggaga ugcguuccgu cgaggaucgg cuaacacggc 40 <210> 29 <211> 36 <212> RNA <213> Artificial Sequence <220> <223> Natural anti-VEGF aptamers <400> 29 cguggcgaug cguuccgucg aggaucggcg aacacg 36 <210> 30 <211> 40 <212> RNA <213> Artificial Sequence <220> <223> Natural anti-VEGF aptamers <400> 30 gcggauuggc uaacacgguc gacguggaga ugcauuccgc 40 <210> 31 <211> 39 <212> RNA <213> Artificial Sequence <220> <223> Modified anti-VEGF aptamers <220> <221> misc_feature <222> (1)..(39) <223> a represents 2'-fluoroadenylic acid, u represents 2'-fluorouridine acid, c represents 2'-fluorocytidine acid, g represents 2'-Fluoroguanylate <400> 31 gcucuucagc cccgcgccgg gucccacucu gcgccgcuc 39 <210> 32 <211> 30 <212> RNA <213> Artificial Sequence <220> <223> Modified anti-VEGF aptamers <220> <221> misc_feature <222> (1)..(30) <223> a represents 2'-fluoroadenylic acid, u represents 2'-fluorouridine acid, c represents 2'-fluorocytidine acid, g represents 2'-Fluoroguanylate <400> 32 gugcuucua uccguccccc ccuugcugcg 30 <210> 33 <211> 44 <212> RNA <213> Artificial Sequence <220> <223> Modified anti-VEGF aptamers <220> <221> misc_feature <222> (1)..(44) <223> a represents 2'-fluoroadenylic acid, u represents 2'-fluorouridine acid, c represents 2'-fluorocytidine acid, g represents 2'-Fluoroguanylate <400> 33 auucugucuu uuuaaauaau guccccuugu ugcacauuac agaa 44 <210> 34 <211> 40 <212> RNA <213> Artificial Sequence <220> <223> Modified anti-VEGF aptamers <220> <221> misc_feature <222> (1)..(40) <223> a represents 2'-fluoroadenylic acid, u represents 2'-fluorouridine acid, c represents 2'-fluorocytidine acid, g represents 2'-Fluoroguanylate <400> 34 uucugucuuu uuagauaaug uccccuuguu gcacauuaca 40 <210> 35 <211> 48 <212> RNA <213> Artificial Sequence <220> <223> Modified anti-VEGF aptamers <220> <221> misc_feature <222> (1)..(48) <223> a represents 2'-fluoroadenylic acid, u represents 2'-fluorouridine acid, c represents 2'-fluorocytidine acid, g represents 2'-Fluoroguanylate <400> 35 gcucuucaau guuaacuacc aaucguugau cguuuugcag aaaauucc 48 <210> 36 <211> 48 <212> RNA <213> Artificial Sequence <220> <223> Modified anti-VEGF aptamers <220> <221> misc_feature <222> (1)..(48) <223> a represents 2'-fluoroadenylic acid, u represents 2'-fluorouridine acid, c represents 2'-fluorocytidine acid, g represents 2'-Fluoroguanylate <400> 36 gcucuucggu guuaacuacc aaucguugau cguuuugcaa aaaauucc 48 <210> 37 <211> 30 <212> RNA <213> Artificial Sequence <220> <223> Modified anti-VEGF aptamers <220> <221> misc_feature <222> (1)..(30) <223> a represents 2'-fluoroadenylic acid, u represents 2'-fluorouridine acid, c represents 2'-fluorocytidine acid, g represents 2'-Fluoroguanylate <400> 37 uccgcuugcg gagcagcuucuguauucugc 30 <210> 38 <211> 30 <212> RNA <213> Artificial Sequence <220> <223> Modified anti-VEGF aptamers <220> <221> misc_feature <222> (1)..(30) <223> a represents 2'-fluoroadenylic acid, u represents 2'-fluorouridine acid, c represents 2'-fluorocytidine acid, g represents 2'-Fluoroguanylate <400> 38 uccgcuugcg gagcaucuucuguauucugc 30 <210> 39 <211> 30 <212> RNA <213> Artificial Sequence <220> <223> Modified anti-VEGF aptamers <220> <221> misc_feature <222> (1)..(30) <223> a represents 2'-fluoroadenylic acid, u represents 2'-fluorouridine acid, c represents 2'-fluorocytidine acid, g represents 2'-Fluoroguanylate <400> 39 uccgcuugcg gagcaccuucuguauucugc 30 <210> 40 <211> 30 <212> RNA <213> Artificial Sequence <220> <223> Modified anti-VEGF aptamers <220> <221> misc_feature <222> (1)..(30) <223> a represents 2'-fluoroadenylic acid, u represents 2'-fluorouridine acid, c represents 2'-fluorocytidine acid, g represents 2'-Fluoroguanylate <400> 40 ggaaaacagu auaaugucuu guuucuucuc 30 <210> 41 <211> 40 <212> RNA <213> Artificial Sequence <220> <223> Modified anti-VEGF aptamers <220> <221> misc_feature <222> (1)..(40) <223> a represents 2'-fluoroadenylic acid, u represents 2'-fluorouridine acid, c represents 2'-fluorocytidine acid, g represents 2'-Fluoroguanylate <400> 41 gguuuaucuu aacuuucugc uacgauacag uuuuuguuga 40 <210> 42 <211> 40 <212> RNA <213> Artificial Sequence <220> <223> Modified anti-VEGF aptamers <220> <221> misc_feature <222> (1)..(40) <223> a represents 2'-fluoroadenylic acid, u represents 2'-fluorouridine acid, c represents 2'-fluorocytidine acid, g represents 2'-Fluoroguanylate <400> 42 ccaaccgugu aucugucuug cuugcggcgg uuuuguugug 40 <210> 43 <211> 40 <212> RNA <213> Artificial Sequence <220> <223> Modified anti-VEGF aptamers <220> <221> misc_feature <222> (1)..(40) <223> a represents 2'-fluoroadenylic acid, u represents 2'-fluorouridine acid, c represents 2'-fluorocytidine acid, g represents 2'-Fluoroguanylate <400> 43 aguuauuugg uggagaggau ccauuuagcu uauacaauuc 40 <210> 44 <211> 40 <212> RNA <213> Artificial Sequence <220> <223> Modified anti-VEGF aptamers <220> <221> misc_feature <222> (1)..(40) <223> a represents 2'-fluoroadenylic acid, u represents 2'-fluorouridine acid, c represents 2'-fluorocytidine acid, g represents 2'-Fluoroguanylate <400> 44 ccggccauug guggagauua uccuuugagu acgguuauuc 40 <210> 45 <211> 45 <212> RNA <213> Artificial Sequence <220> <223> Modified anti-VEGF aptamers <220> <221> misc_feature <222> (1)..(45) <223> a represents 2'-fluoroadenylic acid, u represents 2'-fluorouridine acid, c represents 2'-fluorocytidine acid, g represents 2'-Fluoroguanylate <400> 45 uuucgcuaga uggcuaacac guauauuugu ggagaugcac uagcg 45 <210> 46 <211> 40 <212> RNA <213> Artificial Sequence <220> <223> Modified anti-VEGF aptamers <220> <221> misc_feature <222> (1)..(40) <223> a represents 2'-fluoroadenylic acid, u represents 2'-fluorouridine acid, c represents 2'-fluorocytidine acid, g represents 2'-Fluoroguanylate <400> 46 cguggagaug cauucugucg aggauuggcu aacacgcgaa 40 <210> 47 <211> 40 <212> RNA <213> Artificial Sequence <220> <223> Modified anti-VEGF aptamers <220> <221> misc_feature <222> (1)..(40) <223> a represents 2'-fluoroadenylic acid, u represents 2'-fluorouridine acid, c represents 2'-fluorocytidine acid, g represents 2'-Fluoroguanylate <400> 47 uccuuagaug gcuaacacgu auauuugugg agaugcacua 40 <210> 48 <211> 38 <212> RNA <213> Artificial Sequence <220> <223> Modified anti-VEGF aptamers <220> <221> misc_feature <222> (1)..(38) <223> a represents 2'-fluoroadenylic acid, u represents 2'-fluorouridine acid, c represents 2'-fluorocytidine acid, g represents 2'-Fluoroguanylate <400> 48 cgcuagaugg cuaacacuau uguggagaug cacuagcg 38 <210> 49 <211> 38 <212> RNA <213> Artificial Sequence <220> <223> Modified anti-VEGF aptamers <220> <221> misc_feature <222> (1)..(3) <223> a represents 2'-O-methyl A, u represents 2'-O-methyl U, c represents 2'-O-methyl C, g represents 2'-O-methyl G <220> <221> misc_feature <222> (4)..(35) <223> a represents 2'-fluoroadenylic acid, u represents 2'-fluorouridine acid, c represents 2'-fluorocytidine acid, g represents 2'-Fluoroguanylate <220> <221> misc_feature <222> (36)..(38) <223> a represents 2'-O-methyl A, u represents 2'-O-methyl U, c represents 2'-O-methyl C, g represents 2'-O-methyl G <400> 49 cgcuagaugg cuaacacuau uguggagaug cacuagcg 38 <210> 50 <211> 38 <212> RNA <213> Artificial Sequence <220> <223> Modified anti-VEGF aptamers <220> <221> misc_feature <222> (1)..(3) <223> a represents locked nucleic acid (LNA) A, c represents locked Nucleic acid (LNA) C, g stands for locked nucleic acid (LNA) G, u stands for Locked Nucleic Acid (LNA) U <220> <221> misc_feature <222> (4)..(35) <223> a represents 2'-fluoroadenylic acid, u represents 2'-fluorouridine acid, c represents 2'-fluorocytidine acid, g represents 2'-Fluoroguanylate <220> <221> misc_feature <222> (36)..(38) <223> a represents locked nucleic acid (LNA) A, c represents locked Nucleic acid (LNA) C, g stands for locked nucleic acid (LNA) G, u stands for Locked Nucleic Acid (LNA) U <400> 50 cgcuagaugg cuaacacuau uguggagaug cacuagcg 38 <210> 51 <211> 38 <212> RNA <213> Artificial Sequence <220> <223> Modified anti-VEGF aptamers <220> <221> misc_feature <222> (1)..(38) <223> a represents 2'-fluoroadenylic acid, u represents 2'-fluorouridine acid, c represents 2'-fluorocytidine acid, g represents 2'-Fluoroguanylate <400> 51 gcguagaugg cuaacacuau uguggagaug cacuacgc 38 <210> 52 <211> 41 <212> RNA <213> Artificial Sequence <220> <223> Modified anti-VEGF aptamers <220> <221> misc_feature <222> (1)..(41) <223> a represents 2'-fluoroadenylic acid, u represents 2'-fluorouridine acid, c represents 2'-fluorocytidine acid, g represents 2'-Fluoroguanylate <400> 52 cgcuaguggc gaacacguau auuuguggcg augcacuagc g 41 <210> 53 <211> 44 <212> RNA <213> Artificial Sequence <220> <223> Modified anti-VEGF aptamers <220> <221> misc_feature <222> (1)..(44) <223> a represents 2'-fluoroadenylic acid, u represents 2'-fluorouridine acid, c represents 2'-fluorocytidine acid, g represents 2'-Fluoroguanylate <400> 53 cgcuagaugg ccuaacacgu auauuugugg agauggcacu agcg 44 <210> 54 <211> 36 <212> RNA <213> Artificial Sequence <220> <223> Modified anti-VEGF aptamers <220> <221> misc_feature <222> (1)..(36) <223> a represents 2'-fluoroadenylic acid, u represents 2'-fluorouridine acid, c represents 2'-fluorocytidine acid, g represents 2'-Fluoroguanylate <400> 54 cguggagaug cauucugucg aggauuggcu aacacg 36 <210> 55 <211> 36 <212> RNA <213> Artificial Sequence <220> <223> Modified anti-VEGF aptamers <220> <221> misc_feature <222> (1)..(36) <223> a represents 2'-fluoroadenylic acid, u represents 2'-fluorouridine acid, c represents 2'-fluorocytidine acid, g represents 2'-Fluoroguanylate <400> 55 cguggagaug cauucugucg aagauuggcu aacacg 36 <210> 56 <211> 34 <212> RNA <213> Artificial Sequence <220> <223> Modified anti-VEGF aptamers <220> <221> misc_feature <222> (1)..(34) <223> a represents 2'-fluoroadenylic acid, u represents 2'-fluorouridine acid, c represents 2'-fluorocytidine acid, g represents 2'-Fluoroguanylate <400> 56 cguggagaug cauucuucga gauuggcuaa cacg 34 <210> 57 <211> 36 <212> RNA <213> Artificial Sequence <220> <223> Modified anti-VEGF aptamers <220> <221> misc_feature <222> (1)..(36) <223> a represents 2'-fluoroadenylic acid, u represents 2'-fluorouridine acid, c represents 2'-fluorocytidine acid, g represents 2'-Fluoroguanylate <400> 57 cguggagaug cguuccgucg aggaucggcu aacacg 36 <210> 58 <211> 40 <212> RNA <213> Artificial Sequence <220> <223> Modified anti-VEGF aptamers <220> <221> misc_feature <222> (1)..(40) <223> a represents 2'-fluoroadenylic acid, u represents 2'-fluorouridine acid, c represents 2'-fluorocytidine acid, g represents 2'-Fluoroguanylate <400> 58 cagguggaga ugcauucugu cgaagauugg cuaacaccug 40 <210> 59 <211> 39 <212> RNA <213> Artificial Sequence <220> <223> Modified anti-VEGF aptamers <220> <221> misc_feature <222> (1)..(39) <223> a represents 2'-fluoroadenylic acid, u represents 2'-fluorouridine acid, c represents 2'-fluorocytidine acid, g represents 2'-Fluoroguanylate <400> 59 gccguggaga ugcguuccgu cgggaucggc uaacacggc 39 <210> 60 <211> 40 <212> RNA <213> Artificial Sequence <220> <223> Modified anti-VEGF aptamers <220> <221> misc_feature <222> (1)..(40) <223> a represents 2'-fluoroadenylic acid, u represents 2'-fluorouridine acid, c represents 2'-fluorocytidine acid, g represents 2'-Fluoroguanylate <400> 60 gccguggaga ugcguuccgu cgaggaucgg cuaacacggc 40 <210> 61 <211> 40 <212> RNA <213> Artificial Sequence <220> <223> Modified anti-VEGF aptamers <220> <221> misc_feature <222> (1)..(40) <223> a represents 2'-fluoroadenylic acid, u represents 2'-fluorouridine acid, c represents 2'-fluorocytidine acid, g represents 2'-Fluoroguanylate <400> 61 gcggauuggc uaacacgguc gacguggaga ugcauuccgc 40 <210> 62 <211> 36 <212> RNA <213> Artificial Sequence <220> <223> Modified anti-VEGF aptamers <220> <221> misc_feature <222> (1)..(36) <223> a represents 2'-fluoroadenylic acid, u represents 2'-fluorouridine acid, c represents 2'-fluorocytidine acid, g represents 2'-Fluoroguanylate <400> 62 cg...

Claims

1. An anti-Ang2 aptamer that specifically binds to Ang2 with a KD value of 100 pM or less and does not bind to human Ang1, wherein the nucleotide sequence of the anti-Ang2 aptamer is shown in SEQ ID NO:

68.

2. The anti-Ang2 aptamer of claim 1, wherein the anti-Ang2 aptamer comprises a secondary structure comprising, from 5' to 3' direction, a first stem, a first protrusion, a second stem, a second protrusion, a third stem, a third protrusion, a fourth stem and a first loop.

3. A bispecific aptamer comprising the anti-Ang2 aptamer of claim 1 and an anti-VEGF aptamer, having the formula A1-(L)n-A2, wherein: 1) A1 is an anti-VEGF aptamer having a nucleotide sequence as shown in SEQ ID NO: 45, A2 is an anti-Ang2 aptamer having a nucleotide sequence as shown in SEQ ID NO: 68, L is a hexaethylene glycol linker, and n is 0 to 10; 2) A1 is an anti-VEGF aptamer having a nucleotide sequence as shown in SEQ ID NO: 55, and A2 is an anti-Ang2 aptamer having a nucleotide sequence as shown in SEQ ID NO: 68, L is a hexaethylene glycol linker, and n is 0 to 10; 3) A1 is an anti-VEGF aptamer having a nucleotide sequence as shown in SEQ ID NO: 48, and A2 is an anti-Ang2 aptamer having a nucleotide sequence as shown in SEQ ID NO: 68, L is a hexaethylene glycol linker, and n is 0 to 10; 4) A1 is an anti-Ang2 aptamer having a nucleotide sequence as shown in SEQ ID NO: 68, A2 is an anti-VEGF aptamer having a nucleotide sequence as shown in SEQ ID NO: 45, L is a hexaethylene glycol linker, and n is 0 to 10; 5) A1 is an anti-Ang2 aptamer having a nucleotide sequence as shown in SEQ ID NO: 68, A2 is an anti-VEGF aptamer having a nucleotide sequence as shown in SEQ ID NO: 55, L is a hexaethylene glycol linker, and n is 0 to 10; or 6) A1 is an anti-Ang2 aptamer whose nucleotide sequence is shown in SEQ ID NO: 68, A2 is an anti-VEGF aptamer whose nucleotide sequence is shown in SEQ ID NO: 48, L is a hexaethylene glycol linker, and n is 0 to 10.

4. The bispecific aptamer of claim 3, wherein the anti-VEGF aptamer comprises a secondary structure comprising, from 5' to 3' direction, a first stem, a first protrusion, a second stem, a second protrusion, a third stem, a third protrusion, a fourth stem and a first loop.

5. The bispecific aptamer according to claim 3, wherein the nucleotide sequence thereof is the nucleotide sequence shown in any one of SEQ ID NOs: 77-78 and 148-157.

6. Use of the anti-Ang2 aptamer of claim 1 or the bispecific aptamer of claim 5 in the preparation of a medicament for treating and / or ameliorating a neovascular disease, disorder or condition, wherein the neovascular disease, disorder or condition is selected from age-related macular degeneration, choroidal neovascularization, diabetic macular edema, retinal vein occlusion and diabetic retinopathy.

Images