Induction of osteogenesis by delivery of BMP-encoding RNA

Abstract

The present invention is entitled "Inducing osteogenesis by delivering BMP encoding RNA". The present invention relates to a pharmaceutical composition comprising a polyribonucleotide (RNA) having a sequence encoding bone morphogenetic protein (BMP), the purpose of which is to (i) treat or prevent bone disease, bone disorder or bone injury in a patient; and / or (ii) induce or enhance osteogenic differentiation, osteogenesis, ossification, bone regeneration and / or bone morphogenesis. The present invention also relates to respective BMP encoding RNA (BMP RNA), in particular chemically modified forms thereof. The present invention also relates to complexes comprising BMP RNA or complexed with BMP RNA, in particular respective transfection complexes, such as lipofection, magnetofection and magnetic lipofection complexes. The present invention further relates to carriers and carrier bodies that have been loaded with RNA or complexes, and to pharmaceutical compositions comprising the carriers or carrier bodies. The present invention further relates to a matrix or scaffold for sustained mRNA delivery, and its use in in vivo, ex vivo and in vitro bone regeneration.

Description

[0001] This application is a divisional application. The application date of the original application is November 10, 2015, the application number is 201580072722.0 (PCT / EP2015 / 076238), and the name of the invention is “Inducing osteogenesis by delivering BMP encoding RNA”.

[0002] The present invention relates to a pharmaceutical composition comprising a polyribonucleotide (RNA) having a sequence encoding a bone morphogenetic protein (BMP) for use in (i) treating or preventing bone disease, bone disorder or bone injury in a patient; and / or (ii) inducing or enhancing osteogenic differentiation, osteogenesis, ossification, bone regeneration and / or bone morphogenesis. The present invention also relates to respective BMP encoding RNA (BMP RNA), in particular chemically modified forms thereof. The present invention also relates to complexes comprising BMP RNA or complexed with BMP RNA, in particular respective transfection complexes, such as lipofection, magnetofection and magnetic lipofection complexes. The present invention further relates to carriers and carrier bodies to which RNA or complexes have been loaded, and to pharmaceutical compositions comprising said carriers or carrier bodies. The present invention further relates to a matrix or scaffold for sustained mRNA delivery, and its use in in vivo, ex vivo and in vitro bone regeneration.

[0003] Bone tissue is a dense connective tissue mainly composed of collagen and hydroxyapatite. The bone tissue composed of three main cell types - osteoblasts, osteoclasts and osteocytes - provides protection for other organs, supports the body, and enables it to move (Balmayor, Stem Cell Therapy for Bone Disorders.In:Chase & Vemuri (eds.) Mesenchymal Stem Cell Therapy.Humana Press, New York 2012, 101-116). Skeleton also produces red blood cells and white blood cells in the bone marrow and stores all minerals necessary for life (Carmona, Bone Health and Osteoporosis:A Report of the Surgeon General 2004, US Department of Health and Human Services, Office of the Surgeon General., Rockville, MD). When bone tissue is damaged, ossification occurs, which attempts to restore the normal function of the tissue. The healing process typically involves a coordinated response of the bone marrow, cortical bone, periosteum, and surrounding soft tissue, including the regulation of cell proliferation, migration, and differentiation (Dimitriou, Injury 36(12), 2005, 1392-1404; Einhorn, Clin Orthop Relat Res 355, 1998, 7-21). Many signaling molecules, such as fibroblast growth factor (FGF), bone morphogenetic protein (BMP), platelet-derived growth factor, and vascular endothelial growth factor (VEGF), are involved in the regulation of new bone formation. Cells are recruited to the fracture site through the release of cytokines, hypoxia, and vascular rupture.

[0004] Fracture healing is a complex physiological process. For various reasons, this process may fail and, for example, result in delayed union or non-union fractures. Treatment options are primarily designed to enhance the cellular processes that lead to fracture repair. Simultaneously, biomaterials are often used to provide mechanical support to the fracture site (Tanner, JR Soc Interface 5, 2010, 541-557; Tanner, Proc Inst Mech Eng H 224(12), 2010, 1359-1372) and to provide delivery platforms for the required growth factors (Mourino, Expert Opin Drug Deliv 10(10), 2013, 1353-1365; Romagnoli, Clin Cases Miner Bone Metab 10(3), 2013, 155-161).

[0005] BMPs are perhaps the most important growth factors involved in bone regeneration (Bessa, J Tissue Eng Regen Med 2(2-3), 2008, 81-96; Bessa, J Tissue Eng Regen Med 2(1), 2008, 1-13; Urist, Clin Orthop Relat Res 53, 1967, 243-283). They regulate osteogenesis at two different levels: (1) the commitment of skeletal progenitor cells and (2) the maturation of osteoblasts during postnatal development (Yamaguchi, Endocr Rev 21(4), 2000, 393-411). Specifically, BMP-2 has been shown to be effective in inducing osteogenesis both in vitro and in vivo (Keibl, Injury 42(8), 2011, 814-820; Katagiri, J Cell Biol 127(6 Pt 1), 1994, 1755-1766; Shekaran, Bone regeneration using an alpha 2 beta 1 integrin-specific hydrogel as a BMP-2 delivery vehicle. Biomaterials, 2014). However, the use of BMP proteins (particularly recombinant BMP-2) to treat bone defects is expensive and requires supraphysiological concentrations, which has the risk of causing serious side effects such as inflammation and structural abnormalities in bone formation (Zara, Tissue Engineering: Part A 17(9&10), 2011, 1389-1399).

[0006] Currently, several scientists have explored the possibility of gene transfer to bone tissue for therapeutic purposes. Some advantages of gene delivery over protein delivery have been demonstrated. They include the flexibility of expressing proteins locally and focally as needed, or expressing proteins in a diffuse manner. In addition, proteins are produced intracellularly. Therefore, this helps therapeutic approaches occur. Unlike their recombinant equivalents, proteins delivered via gene transfer will be nascent and uncontaminated by varying percentages of incorrectly folded and potentially antigenic molecules (Evans, Adv Drug Deliv Rev 64(12), 2012, 1331-1340). In addition, proteins can be expressed for a long time, and the level of transgenic expression can be regulated. Therefore, the dose of therapeutic protein used during treatment is reduced (Evans, 2012, supra). In particular, gene transfer using plasmid DNA encoding BMP-2 has been shown to have some potential for bone healing and regeneration (Lu, J Biomater Sci Polym Ed 23(1-4), 2012, 509-526; Chang, Neurosurgery 65, 2009, 75-81; Park, Gene Ther 10(13), 2003, 1089-1098).

[0007] However, despite some advantages, viral vectors currently used for gene delivery are associated with safety concerns, including strong immunogenicity and insertional mutagenesis. Non-viral vectors are limited by low gene transfer efficiency (Evans, 2012, supra). The latter is mainly attributed to insufficient transport of plasmid DNA into the cell nucleus.

[0008] An alternative to DNA-based gene therapy is messenger RNA (mRNA) delivery. Recently, transcript therapy using mRNA has gained great interest as a safer alternative to gene and recombinant protein therapy. mRNA has neither the risk of immunogenicity nor potential mutagenicity—it accompanies recombinant protein and gene therapy respectively. A further technical advantage is that mRNA only needs to reach the cytoplasm to become active, while DNA needs to reach the nucleus (Yamamoto, European Journal of Pharmaceutics and Biopharmaceutics 71, 2009, 484-489; Tavernier, Journal of Controlled Release 150, 2011, 238-247). Accordingly, mRNA has emerged as a pioneering therapeutic approach in a wide variety of medical indications (Yamamoto, European Journal of Pharmaceutics and Biopharmaceutics 71, 2009, 484-4891; Tavernier, Journal of Controlled Release 150, 2011, 238-247; Kormann, Nature Biotechnology 29, 2011, 154-157; Esteller, Nature Review Genetics 12, 2011, 861-874). Specifically, mRNA has recently emerged as an alternative to non-viral gene therapy. Since mRNA functions in the cytoplasm, it overcomes the limitations associated with transport across the nuclear membrane, so it is not related to mRNA-based transcript therapies.

[0009] Although mRNA clearly represents a potential tool for many therapeutics, clinical applications have so far been limited (eg cancer vaccination) due to the strong immunogenicity and limited stability of conventional mRNA (Van Tendeloo, Curr Opin Mol Ther 9(5), 2007, 423-431).

[0010] Holtkamp demonstrated that mRNA stability was increased by adding a polyadenylic acid tail of 120 nucleotides in length (Blood 108 (13), 2006, 4009-4017). Further, Holtkamp has also reported on studies on optimizing UTR to achieve stability and translation efficiency (Holtkamp supra). In addition, chemical modification of mRNA has been reported, which has led to increased stability and reduced activation of the innate immune system. Specifically, the generation and therapeutic potential of chemically modified mRNA (cmRNA) encoding therapeutic mouse erythropoietin (EPO) and surfactant protein B (SP-B) have been reported, inducing hematopoiesis and having the potential to treat lethal congenital lung disease, respectively (Kormann, Nat Biotechnol 29 (2), 2011, 154-157). In addition, collagen sponges have been used as 3D matrices for loading DNA or cmRNA, and cells have also been seeded thereon (Chevallay, Medical and Biological Engineering and Computing 38, 2000, 211-218; Reckhenrich, Biomaterials 32, 2011, 1996-2003; Scherer, The Journal of Gene Medicine 4, 2002, 634-643; Elangovan, Journal of Controlled Release 218, 2015, 22-28; WO 01 / 00708). Recent studies have shown that compared with 2D cell cultures based on 'culture dishes', culturing cells in 3D scaffolds is closer to the in vivo situation with respect to cell shape, cell signaling, and cell properties, which can affect gene expression in cells (Mueller-Klieser, American Journal of Pysiology-Cell Physiology, 273, 1997, C1109-C1123). Collagen sponge is one of the 3D matrices that can change cell migration, attachment, adhesion and, in some cases, differentiation (Chevallay, Medical and Biological Engineering and Computing 38, 2000, 211-218). In addition, Mays has proposed treating allergic asthma by cmRNA encoding the T full transcription factor FOXP3 (J Clin Invest 123 (3), 2013, 1216-1228). CmRNA as an improved therapeutic tool for diseases associated with defective or defective genes or proteins is also disclosed in WO 2011 / 012316.In general, transcript therapies using cmRNA are emerging as safer and more promising alternatives to gene and recombinant protein therapies. However, due to the transient translation and relatively low stability of cmRNA compared to DNA, their application is limited. In addition, for example, in the case of EPO cmRNA, repeated application / administration is required for successful treatment (constant adaptation to hematocrit is required).

[0011] A more advanced approach in gene therapy is to use genetically modified autologous tissue grafts to repair defective tissue. This treatment strategy seeks to stimulate the healing process by delivering genes through minimally manipulated autologous tissue containing progenitor cells and having the properties of space filling, induction or conduction scaffolds (Evans, Eur Cell Mater 18, 2009, 96-111; Evans, Tissue Eng 13 (8), 2007, 1987-1993). For example, adipose tissue is known to have osteoprogenitor cells; it has the ability to serve as a natural scaffold material and can be easily harvested (Evans, 2009, supra; Dragoo, Plast Reconstr Surg 115 (6), 2005, 1665-1673). Evans (2009, supra) uses adipose and muscle tissue grafts transduced with adenovirus carrying human BMP-2 cDNA to repair bone and cartilage defects. However, this method also suffers from the above-mentioned defects.

[0012] Over the years, continuous gene or drug delivery systems have been increasingly popular because they do not require repeated doses. Therefore, patients can use their drugs more easily, and this can lead to better acceptance of treatment methods (Bartus, Science 281, 1998, 1161). In the case of RNA therapy, when long-term protein expression is intended for, for example, bone disease, such a delayed delivery system would be particularly suitable. However, up to now, there is a lack of effective methods for continuous delivery of RNA.

[0013] Therefore, the technical problem underlying the present invention is to provide improved means and methods for bone-related medical interventions.

[0014] This technical problem is solved by providing the embodiments characterized in the claims.

[0015] Accordingly, the present invention relates to a pharmaceutical composition comprising a polyribonucleotide (RNA) having a sequence encoding a bone morphogenetic protein (BMP) for use in a patient.

[0016] (i) treating or preventing bone disease, bone disorder or bone injury; and / or

[0017] (ii) inducing or enhancing osteogenic differentiation, osteogenesis, ossification, bone regeneration and / or bone morphogenesis.

[0018] The present invention also relates to a method of (in a patient in need thereof)

[0019] (i) treating or preventing bone disease, bone disorder or bone injury; and / or

[0020] (ii) inducing or enhancing osteogenic differentiation, osteogenesis, ossification, bone regeneration and / or bone morphogenesis,

[0021] The method includes the step of administering a pharmaceutically effective amount of RNA having a sequence encoding bone BMP (a pharmaceutical composition containing the same) to a patient in need thereof.

[0022] The present invention solves the technical problem identified above, since, as documented below and in the accompanying examples, it was surprisingly found that RNA encoding BMP(s), in particular cmRNA encoding human BMP-2 (SEQ ID NO: 3, encoded by SEQ ID NO: 1; hBMP-2 cmRNA) or human BMP-7 (SEQ ID NO: 4, encoded by SEQ ID NO: 2; hBMP-7 cmRNA) induces / enhances osteogenesis. Thus, in the context of the present invention, theoretical evidence was obtained that RNA encoding BMP(s) can be successfully used in transcript therapy for bone regeneration and for the treatment or prevention of bone-related diseases, disorders or injuries, respectively.

[0023] Furthermore, in the context of the present invention, evidence is provided that a single treatment with a BMP-encoding RNA (BMP RNA) is sufficient for a complete / total treatment (or prevention) of a bone-related disease, disorder or injury. Thus, an advantage of the means and methods of the present invention is that only one administration of the BMP RNA is required.

[0024] Another advantage of the means and methods of the present invention is that alternatives to DNA-based gene therapy and conventional transcript therapy can be applied without being subject to respective limitations, such as limitations of viral and non-viral vectors, and without the disadvantages of safety issues and / or limited stability / expressibility.

[0025] Another advantage of using the RNA according to the present invention is that (for example, in contrast to using DNA vectors), the duration of treatment is adjustable. For example, in the case of induced stem cells, the desired rule is that the transcription factor is only transiently active in order to reprogram somatic cells into stem cells. By dosing (dosed administration) the RNA encoding the relevant BMP (one or more), the activity can be controlled over time. In contrast, previously known methods have the risk of integrating the administered gene, which may lead to complications such as tumorigenesis and, in addition, may make it impossible to control the duration.

[0026] The present invention is based, inter alia, on the experiments described in the accompanying examples.

[0027] These embodiments particularly show that cells (such as MSC, such as BMSC and AMSC) transfected with BMP RNA (such as hBMP-2 or -7 cmRNA) secrete elevated levels of bioactive BMP (such as BMP-2 or BMP-7), particularly under long-term basis (such as continuing for more than 7 days). The secretory proteins of these levels effectively induce osteogenic differentiation (in vitro experiments). This is indicated by the expression of osteogenic markers, particularly by the alkaline phosphatase (ALP) level of the elevation disclosed in transfected cells, and by the enhanced expression (detected by quantitative RT-PCR) of RunX2, ALP, Osterix, osteocalcin, osteopontin and type I collagen. In addition, this is indicated by (in vitro) mineralization (deposited mineralized matrix). Mineralization is shown by positive alizarin red staining, which is achieved 2 weeks after transfection (MSC with respective cmRNA). The osteogenic potential of BMP RNA (such as hBMP-2 and -7 cmRNA) has also been demonstrated in human adipose tissue transfected with respective BMP RNA (ex vivo). Human adipose tissue also produces an osteogenic response (in vitro), as indicated by the expression of hBMP-2, RunX2, ALP, and type I collagen.

[0028] In the context of the present invention, it is also demonstrated that transfection conditions can be optimized to obtain higher transfection efficiency, even with minimal cytotoxicity. In this case, cmRNA transfection MSC is first studied by using several transfection reagents and different reporter cmRNA (fluorescent proteins). High transfection efficiency is achieved, which results in sustained protein expression (up to 5 days). Expression peaks are typically observed between 24 and 48 hours after transfection.

[0029] In addition, carried out cytotoxicity screening to test the biocompatibility of the complex for transfection MSC.From the result of expression and cell survival, select the best transfection scheme to further utilize BMP RNA (such as hBMP-2 or -7 cmRNA) transfection cell (MSC). Specifically, by using Metridia (Metridia) luciferase as reporter system, show DreamFectGold (DF-Gold) is a kind of non-viral lipid reinforcing agent that is very suitable for (cm) RNA delivery into cell.DF-Gold / (cm) RNA complex is efficient in (cm) RNA transfection, but very gentle to cell.

[0030] For transfection purposes, lipofection and magnetofection procedures were employed in the context of the present invention and the accompanying examples. Thus, robust enhancement of transfection efficiency was achieved using various (cm)RNAs, particularly in two different primary cell types, AMSC and BMSC. In particular, transfer of BMP RNA (e.g., hBMP-2 or -7 cmRNA) into cells (e.g., MSCs, such as BMSCs and AMSCs) by both lipofection and magnetofection was shown to support in vitro osteogenesis.

[0031] The highest transfection efficiencies are achieved using magnetofection, particularly when magnetofection is applied to MSCs (eg, BMSCs or AMSCs).

[0032] BMSCs are particularly considered difficult to transfect (Lakshmipathy, Stem cells 22 (4), 2004, 531-543). However, in the context of the present invention, it is shown that, even with BMSCs, efficient transfection can be achieved using eGFP cmRNA magnetic positive liposomes (lipoplex), producing 80% positive cells after 24 hours. Similarly, when hBMP-2 cmRNA was used, a 6-fold increase in the magnetic transfection advantage index (MAI) was measured in AMSCs. In particular, hBMP-2 transfected AMSCs were able to secrete significantly higher amounts of hBMP-2 over a period of more than 7 days compared to untransfected cells. In this case, a plateau in protein expression was observed between 24 and 72 hours. This effect is also beneficial for the therapeutic effects of hBMP-2 cmRNA (or another BMP RNA) according to the present invention. In fact, due to the constant production of hBMP-2 (or another BMP) by transfected cells, osteogenic gene expression and mineralization are also enhanced.

[0033] In addition, AMSCs transfected via magnetofection exhibited higher expression of the transcription factor RunX2, osteopontin, and alkaline phosphatase, as well as higher mineral deposition. Without being bound by theory, the expression of RunX2 reflects the role of the transcription factor RunX2 in controlling the osteogenic differentiation process. AMSCs transfected with hBMP-2 cmRNA via magnetofection showed the highest and most sustained expression of RunX2, which in turn correlated well with the more pronounced osteogenesis observed in those samples in vitro.

[0034] In principle, the above description about BMP-2 in the context of the present invention also shows about BMP-7. Especially, compared with untransfected cells, over a period of more than 3 days, the AMSCs of hBMP-7 transfection can secrete quite a higher amount of hBMP-7. In this case, maximum protein expression was observed 24 hours after transfection. Two different hBMP-7 cmRNA dosages were tested, i.e. 20 and 32pg / cell. When compared with the 32pg / cell dosage, the cells transfected with 20pg / cells resulted in significantly higher hBMP-7 secretion. The AMSCs of transfection can deposit a mineralized matrix, which shows that the bone formation enhanced in vitro in those samples.

[0035] As described above, it was further demonstrated in the context of the present invention that adipose tissue biopsies transfected with hBMP-2 cmRNA (or another BMP RNA) expressed enhanced hBMP-2 levels (or levels of another BMP), which in turn upregulated the expression of several osteogenic markers when cultured in vitro for up to 7 days. Based on these results, it can be concluded that fat implants transfected with hBMP-2 (or fat implants transfected with other BMPs) can be used as an effective source of hBMP-2 (or another BMP) and respective progenitor cells for autologous tissue repair. Therefore, the in vitro results achieved in the context of the present invention show that BMP RNA, particularly hBMP-2 and -7 cmRNA, represents an advancement in the application of autologous tissue transplantation technology in bone regeneration. It avoids the use of viral vectors and their associated drawbacks (safety concerns, etc., see above).

[0036] The accompanying examples and disclosures provided herein further provide a solid foundation for addressing studies of bone formation in clinically relevant animal models. Thus, those skilled in the art can readily perform these studies.

[0037] As respective non-limiting examples, hBMP-2 cmRNA is transplanted onto bone implant material and is administered to the bone defect of non-critical size in rat femur in vivo. The micro-computed tomography (μCT) results obtained support the therapeutic effect of hBMP-2 cmRNA in bone healing. In those animals processed with hBMP-2 cmRNA, stimulation of osteogenesis in vivo has been observed. By contrast, in animals processed with non-specific cmRNA (for example, cmRNA encoding firefly luciferase (FFL)), osteogenesis is not observed. This proves that hBMP-2 cmRNA mediates the therapeutic expression of hBMP-2 in bone defect site in vivo, causing osteogenesis to occur.

[0038] Further prove in the context of the present invention, when loading RNA, particularly BMP-encoding RNA, and when cells to be transfected have been seeded thereon, carrier / carrier body (such as collagen sponge or fibrin clot) can be a part for efficient transfection system.Therefore, carrier / carrier body can work as 3D matrix in bone regeneration.In addition, evidence is provided in the context of the present invention: carrier / carrier body (such as collagen sponge or fibrin clot) can not only be used as the 3D scaffold for inoculating cells, but also can be used as the depot (depot) for continuously delivering RNA (particularly BMP-encoding RNA, such as cmRNA or even non-chemically modified BMP-encoding RNA).

[0039] In particular, and as shown in the accompanying examples, first the collagen sponge is preloaded with positive liposomes containing (m) RNA and vacuum dried. The loaded sponge of the drying is then used as the 3D matrix for cell inoculation. Therefore, the present invention further relates to a delivery system that combines cell inoculation and (m) RNA transfection steps and is simplified to a single step. Additionally, the collagen sponge loaded with (m) RNA shows delayed delivery properties. Therefore, they can overcome the rapid and transient production of protein after classical 2D mRNA transfection. As an example of clinical application, using the collagen sponge loaded with hBMP2 (m) RNA, bone regeneration is studied in vitro and in vivo. In addition, in order to study the potential of the collagen sponge loaded with vacuum dried (m) RNA as a ready-to-use bioproduct, its shelf life is estimated in a successful long-term stability test. Therefore, the present invention further provides a continuous (m) RNA delivery depot. This opens a new path for the convenient and safe alternative to gene therapy in clinical methods.

[0040] Surprisingly, in the context of the present invention it could even turn out that unmodified (m)RNA can also be successfully used for gene therapy purposes, in particular when part of and when administered via the sustained delivery system / depot disclosed herein.

[0041] Another advantage of the present invention is high cell transfection efficiency (near 100%) and low cytotoxicity. As mentioned above, considering the stability problem, vacuum-dried RNA - especially when loaded on collagen sponge - is long-term stable (e.g., at room temperature for at least 6 months). Further, in the context of the present invention, in vitro bone regeneration (using MC3T3-E1 cells and MSCs) and in vivo bone regeneration (in rat femoral defects) using hBMP2 RNA confirmed the ability of this system in preclinical applications.

[0042] In summary, the present invention provides, among other things, RNA-loaded (vacuum-dried) carriers (collagen sponges) as stable and efficient RNA delivery systems for prolonged protein expression, thereby bringing transcript therapy one step closer to clinical approaches. In particular, the present invention discloses the safety, efficacy and stability of RNA-loaded vacuum-dried collagen sponges as ready-to-use biological products. Respective virus-free and gene-free technologies provide RNA sustained delivery systems that are independent of RNA modification, cell type and cell density. When prolonged protein delivery meets therapeutic goals, studies of bone differentiation in vitro and in vivo using this technology confirm the ability of RNA-loaded vacuum-dried collagen sponges to be used in clinical applications. This research opens new avenues for simpler and more promising applications of messenger RNA, which surpass DNA-based gene therapy in terms of safety.

[0043] The present invention also relates to the following items:

[0044] 1. A pharmaceutical composition comprising a polyribonucleotide (RNA) having a sequence encoding a bone morphogenetic protein (BMP), for use in a patient:

[0045] (i) treating or preventing bone disease, bone disorder or bone injury; and / or

[0046] (ii) inducing or enhancing osteogenic differentiation, osteogenesis, ossification, bone regeneration and / or bone morphogenesis.

[0047] 2. The pharmaceutical composition of item 1, wherein the BMP is BMP-2 or BMP-7.

[0048] 3. The pharmaceutical composition of item 1 or 2, wherein the RNA is encapsulated.

[0049] 4. The pharmaceutical composition according to any one of items 1 to 3, wherein the RNA is transfected by lipofection.

[0050] 5. The pharmaceutical composition according to any one of items 1 to 4, wherein the RNA is transfected by magnetofection.

[0051] 6. The pharmaceutical composition of item 5, further comprising magnetic nanoparticles (MNPs).

[0052] 7. The pharmaceutical composition according to any one of items 4 to 6, further comprising a liposome transfection reagent (LTR).

[0053] 8. The pharmaceutical composition according to item 7, wherein the w / w ratio of said LTR to said RNA is 2 to 20 μg of said LTR per microgram of said RNA.

[0054] 9. The pharmaceutical composition of item 7 or 8, wherein the ratio of said MNP to said LTR to said RNA is about 0.5 (iron weight): about 2 to 5 or 4 to 7 (weight): about 1 (weight), respectively.

[0055] 10. The pharmaceutical composition according to any one of items 1 to 9, wherein the RNA is to be delivered in vivo.

[0056] 11. The pharmaceutical composition of item 10, wherein said RNA is to be administered directly to the bone or bone tissue of said patient.

[0057] 12. The pharmaceutical composition according to any one of items 1 to 9, wherein the RNA is delivered ex vivo to cells to be introduced into the patient.

[0058] 13. The pharmaceutical composition of item 12, wherein the RNA is delivered to cells of the patient ex vivo, and wherein the cells to which the RNA has been delivered are to be reintroduced into the patient.

[0059] 14. The pharmaceutical composition according to item 12 or 13, wherein the cells are osteoprogenitor cells.

[0060] 15. The pharmaceutical composition according to any one of items 12 to 14, wherein the cells are mesenchymal stem cells (MSCs).

[0061] 16. The pharmaceutical composition according to item 15, wherein the MSC is adipose-derived mesenchymal stem cell (AMSC) or bone marrow-derived MSC (BMSC).

[0062] 17. An RNA having a sequence encoding BMP-2 or BMP-7, wherein 25% of the cytidines in the RNA are 5-methylcytidine (m5C) and 25% of the uridines in the RNA are 2-thiouridine (s2U).

[0063] 18. The pharmaceutical composition according to any one of items 1 to 16, wherein the RNA is the RNA according to item 17.

[0064] In principle, the pharmaceutical compositions of the present invention are used to treat or prevent any disease, disorder, defect or injury that is associated with, associated with, physiologically associated with or affects bone (also referred to herein as bone disease). In this article, the RNA according to the present invention can be used to treat or prevent such that BMP(s) that are not naturally expressed to the desired extent or not naturally expressed at all can be formed in the cells or tissues to be introduced into the RNA. The RNA can be used in two situations: (i) when BMP cannot be formed due to a genetic defect but also due to a disease, or (ii) when the introduction of a BMP is beneficial to the body. The RNA can also be used to supplement a BMP that is not expressed to a sufficient extent.

[0065] In particular, the bone diseases treated or prevented according to the present invention are associated with, linked to, or physiologically related to (the function of) one or more BMPs, such as BMP-1, BMP-2, BMP-3, BMP-4, BMP-5, BMP-6, BMP-7, BMP-8a, BMP-8b, BMP-10, and / or BMP-15, preferably BMP-7, and more preferably BMP-2. More specifically, the bone diseases treated according to the present invention are bone diseases that can be treated, prevented, or ameliorated (the symptoms thereof) by delivering, inducing, and / or increasing (the function of) one or more BMPs.

[0066] The pharmaceutical compositions of the present invention may also be used to induce or enhance osteogenic differentiation (e.g., differentiating MSCs into osteoblasts), osteogenesis, ossification, bone regeneration, bone morphogenesis, bone formation, bone growth, mineralization and / or calcification, particularly in a patient; more particularly in the context of treating or preventing bone diseases in the context of the present invention.

[0067] Many types of bone diseases are known in the art and are described, for example, in Evans (2012, supra), in particular in Table 1 thereof. Examples of bone diseases to be treated or prevented in the context of the present invention are osteogenesis imperfecta (a monogenic dominant-negative genetic disease), (degenerative) osteoporosis, (osteoporotic) fractures, nonunions, bone defects, partial defects, bone cysts, spinal fusions, avascular necrosis, bone tumors (e.g., osteosarcoma, Ewing's sarcoma), osteolysis (e.g., cancer-induced osteolysis, aseptic loosening).

[0068] A specific area in which BMP RNA can be used according to the present invention is the field of regenerative medicine associated with bone. In the context of disease processes or aging, degenerative bone diseases that can be treated, alleviated, prevented, or even cured by introducing BMP (one or more) have occurred, particularly if the BMP (one or more) produced due to the disease or aging process is too little or does not produce BMP at all. By introducing the relevant BMP RNA encoding BMP (one or more), the degenerative process can be stopped, or regeneration can even be started. Therefore, on the one hand, the bone disease treated or prevented according to the present invention is a degenerative bone disease. Examples of degenerative bone diseases are degenerative osteoporosis, Paget's disease, spondylosis (also referred to as progressive degenerative arthritis), osteomalacia, and rickets, etc.

[0069] In one aspect, the pharmaceutical composition of the invention is used for bone healing. For example, in this context, (osteoporotic) fractures, nonunions, partial defects, bone cysts, spinal fusions, avascular necrosis are to be cured.

[0070] In particular, according to the present invention, it is envisaged to treat, prevent and / or cure non-unions, partial defects and bone fractures, more particularly osteoporotic fractures.

[0071] The RNA used according to the invention can also influence the course of bone diseases. Examples are bone diseases that are not directly attributable to a genetic defect, but in which the disease course can be positively influenced by BMP RNA expression. An example is BMPs for bone healing as factors in "tissue engineering."

[0072] The BMP encoded by the RNA according to the present invention may be BMP-1, BMP-2, BMP-3, BMP-4, BMP-5, BMP-6, BMP-7, BMP-8a, BMP-8b, BMP-10 and / or BMP-15, preferably BMP-7, more preferably BMP-2. The preferred BMP used according to the present invention is human BMP (hBMP). BMPs are well known in the art and are described, for example, in (Bessa, J Tissue Eng Regen Med 2 (2-3), supra; Bessa, J Tissue Eng Regen Med 2 (1), supra; Urist, supra). The nucleotide and amino acid sequences of (h) BMPs can be obtained via databases known in the art (e.g., NCBI under http: / / www.ncbi.nlm.nih.gov / ). Table 5 below lists examples of respective database entries.

[0073] The specific nucleotide sequence of hBMP-2 is depicted in SEQ ID NO: 1. The specific nucleotide sequence of hBMP-7 is depicted in SEQ ID NO: 2. The specific amino acid sequence of hBMP-2 is depicted in SEQ ID NO: 3. The specific amino acid sequence of hBMP-7 is depicted in SEQ ID NO: 4.

[0074] It is envisaged in the context of the present invention that the term "BMP" (or "BMP RNA") also comprises functional fragments and variants of the respective BMP (or the respective BMP RNA).

[0075] In addition to BMP RNA itself, variants of BMP RNA may also be employed according to the present invention. Variants of BMP RNA may differ structurally from the BMP RNA itself, yet still be functionally active in the same manner as the BMP RNA itself. In particular, variants of BMP RNA are intended to encode proteins that can function as the respective BMP itself, i.e., can exhibit bone morphogenic activity. More specifically, variants of BMP RNA are intended to encode proteins that can regulate bone formation. In this context, bone formation can be regulated at two different levels: (i) the commitment of skeletal progenitor cells; and / or (ii) the maturation of osteoblasts during postnatal development. Thus, variants of BMP RNA are intended to encode proteins that can induce or enhance osteogenic differentiation, osteogenesis, ossification, bone regeneration, and / or bone morphogenesis. A person skilled in the art can readily determine, based on their position, whether a given variant of BMP RNA functions as the respective BMP RNA itself, e.g., encodes a protein that can exhibit bone morphogenic activity. For this purpose, a person skilled in the art can rely on the prior art (e.g., as disclosed in Yamaguchi supra) and the respective means and methods provided in the accompanying examples. For example, a skilled artisan can determine whether a given variant of a BMP RNA induces osteogenesis in vitro, ex vivo, and / or in vivo (eg, as determined in appended Examples 5 or 7, respectively).

[0076] In principle, the more similar a BMP RNA variant is to the respective BMP RNA itself, the more preferred it is.

[0077] A specific BMP RNA or variant of a BMP RNA according to the present invention may be an RNA selected from the group consisting of:

[0078] (a) RNA encoding an amino acid sequence of BMP-1, BMP-2 (particularly preferred), BMP-3, BMP-4, BMP-5, BMP-6, BMP-7 (preferred), BMP-8a, BMP-8b, BMP-10 or BMP-15, for example encoding the amino acid sequence depicted in SEQ ID NO: 3 or SEQ ID NO: 4;

[0079] (b) RNA encoding an amino acid sequence of BMP-1, BMP-2 (particularly preferred), BMP-3, BMP-4, BMP-5, BMP-6, BMP-7 (preferred), BMP-8a, BMP-8b, BMP-10 or BMP-15 having one or more substituted, inserted and / or deleted amino acid residues, for example, an amino acid sequence depicted by SEQ ID NO: 3 or SEQ ID NO: 4 having one or more substituted, inserted and / or deleted amino acid residues (wherein the RNA encodes a protein capable of exhibiting bone morphogenic activity);

[0080] (c) RNA (encoded by a nucleotide sequence) that hybridizes with the complementary strand of a nucleotide sequence encoding an amino acid sequence of BMP-1, BMP-2 (particularly preferred), BMP-3, BMP-4, BMP-5, BMP-6, BMP-7 (preferred), BMP-8a, BMP-8b, BMP-10 or BMP-15, for example, a nucleotide sequence encoding the amino acid sequence depicted in SEQ ID NO: 3 or SEQ ID NO: 4 (wherein the RNA encodes a protein capable of exhibiting bone morphogenic activity); and

[0081] (d) RNA encoding an amino acid sequence that is at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the (full-length) amino acid sequence of BMP-1, BMP-2 (particularly preferred), BMP-3, BMP-4, BMP-5, BMP-6, BMP-7 (preferred), BMP-8a, BMP-8b, BMP-10 or BMP-15, for example to the (full-length) amino acid sequence depicted in SEQ ID NO: 3 or SEQ ID NO: 4 (wherein the RNA encodes a protein capable of exhibiting bone morphogenic activity).

[0082] In the context of the present invention, "having one or more substituted, inserted and / or deleted amino acid residues" specifically refers to having at most 500, at most 400, at most 300, at most 200, at most 100, at most 50, at most 30, at most 20, at most 10, at most 9, at most 8, at most 7, at most 6, at most 5, at most 4, at most 3, at most 2 or 1 substituted, inserted and / or deleted amino acid residues. In a specific aspect, the term refers to one or more amino acid exchanges, preferably conservative amino acid exchanges, for example at most 500, at most 400, at most 300, at most 200, at most 100, at most 50, at most 30, at most 20, at most 10, at most 9, at most 8, at most 7, at most 6, at most 5, at most 4, at most 3, at most 2 or 1 (conservative) amino acid exchange.

[0083] In the context of the present invention, "hybridization" refers to hybridization that can occur between one nucleic acid molecule and another (complementary) nucleic acid molecule. The hybridization of two nucleic acid molecules typically occurs under conventional hybridization conditions. In the context of the present invention, stringent hybridization conditions are preferred. Hybridization conditions are described, for example, in Sambrook and Russell (2001), Molecular Cloning: A Laboratory Manual, CSH Press, Cold Spring Harbor, NY, USA. In a specific embodiment, "hybridization" refers to hybridization occurring under the following (stringent) hybridization conditions:

[0084] Hybridization buffer: 2×SSC, preferably 1×SSC; 10×Denhardt solution (Fikoll 400+PEG+

[0085] BSA; ratio 1:1:1); 0.1% SDS; 5 mM EDTA; 50 mM Na2HPO4;

[0086] 250 μg / ml herring sperm DNA; 50 μg / ml tRNA; or

[0087] 0.25 M sodium phosphate buffer, pH 7.2;

[0088] 1mM EDTA

[0089] 7% SDS

[0090] Hybridization temperature T 60°C, preferably 65°C

[0091] Wash buffer: 2×SSC, preferably 1×SSC, more preferably 0.1×SSC; 0.1% SDS

[0092] Washing temperature T 60°C, preferably 65°C.

[0093] As described above, RNA encoding functional fragments of BMPs may also be employed according to the present invention. In this context, "functional" means that the fragment is functionally active in the same manner as the respective full-length BMP RNA. In particular, functionally active fragments of BMPs are fragments of BMPs that still exhibit bone morphogenic activity. Mutual modifications are made herein above with respect to the functional activity of BMP RNA variants, which also apply to functional fragments of BMPs.

[0094] Particular (functional) fragments of a BMP may be amino acid fragments of at least 50, at least 100, at least 150, at least 200, at least 300, at least 500 or at least 700 (contiguous) amino acid residues of the respective BMP.

[0095] BMP RNAs encoding functional fragments of proteins encoded by variants of any of the BMP RNAs described herein may also be employed in the context of the present invention. Similarly, such BMP RNAs are particularly intended to encode proteins that can function as the respective BMPs, i.e., can exhibit bone morphogenetic activity. Mutatively, what is described herein above with respect to the functional activities of variants of BMP RNAs and BMP fragments also applies to such BMP RNAs.

[0096] In principle, the term "BMP RNA" as used herein is meant to include all of the following: (i) RNA encoding BMP itself and full-length BMP as described herein, respectively, (ii) variant RNA encoding BMP variants as described herein, and (iii) RNA encoding functional fragments (variants) of BMP as described herein.

[0097] Exemplary nucleotide sequences of BMP RNA / BMP RNA constructs employed in accordance with the present invention are depicted in SEQ ID NO: 29 or 30 (two hBMP-2 (cm) RNAs) and SEQ ID NO: 29 (hBMP-7 (cm) RNA).

[0098] In the context of the present invention, RNA is understood to mean any polyribonucleotide molecule that is suitable for expressing a protein or a functional fragment thereof, or that can be translated into a protein or a functional fragment thereof, if it enters a cell. The term "protein" as used herein includes any type of amino acid sequence, i.e., a chain of two or more amino acid residues, each of which is linked via a peptide bond; and also includes peptides and fusion proteins.

[0099] In a particularly preferred aspect, the RNA employed according to the present invention, for example the RNA contained in the pharmaceutical composition of the present invention, is a messenger RNA (mRNA). This means that according to this aspect, any RNA defined herein may be in the form of an mRNA.

[0100] The RNA employed may be double-stranded RNA (eg due to intermolecular or intramolecular hybridization), or preferably single-stranded RNA (which may, however, contain at least one double-stranded portion due to intramolecular hybridization; eg hairpin structure(s)).

[0101] In one aspect, the RNA employed according to the invention is a non-naturally occurring RNA, in particular a non-naturally occurring mRNA.

[0102] The RNA used according to the present invention can be chemically modified RNA (cmRNA). In principle, this is preferred. CmRNA is known in the art and is described, for example, in Kormann (supra), Mays (supra) and WO 2011 / 012316. Specifically, the cmRNA used can be the cmRNA described in WO 2011 / 012316.

[0103] Preferably, RNA, in particular cmRNA, is employed according to the present invention with increased stability and / or reduced immunogenicity. Specifically, it is envisioned that RNA, and in particular cmRNA, eliminates RNA interactions with Toll-like receptors and / or with retinoid-inducible gene 1 (RIG-I). In principle, this applies to any (cm)RNA as defined herein.

[0104] Immunogenicity and stability can be determined in a manner known per se.

[0105] In order to measure the immunogenicity of RNA, various methods well known to those skilled in the art can be used. A very suitable method is to measure the inflammatory markers in the cells as a reaction to the administration of RNA. Normally, cytokines associated with inflammation are measured, such as TNF-α, IFN-α, IFN-β, IL-8, IL-6, IL-12 or other cytokines known to those skilled in the art. The expression of DC activation markers can also be used to estimate immunogenicity. A further indication of the immune response is to detect the combination with Toll-like receptors TLR-3, TLR-7 and TLR-8 and the combination with the helicase RIG-1.

[0106] Immunogenicity is usually determined by comparison with a control. In conventional methods, RNA employed according to the invention is administered to cells, and the secretion of inflammatory markers is measured over defined time intervals as a response to the administration of the RNA. As a standard for comparison, an RNA known to elicit little or no immune response can be used, in which case the immune response to the RNA employed according to the invention should be within the same range, rather than elevated. Using the RNA employed according to the invention, it is expected, for example, that the immune response will be reduced by at least 30%, typically by at least 50% or even 75%, or even completely prevented.

[0107] Immunogenicity can be determined by measuring the aforementioned factors, particularly by measuring TNF-α and IL-8 levels and the binding capacity to TLR-3, TLR-7, TLR-8 and helicase RIG-1. Thus, in order to determine whether (m) RNA has the desired low immunogenicity, the amount of one or more of the aforementioned factors after administering the relevant polyribonucleotides can be measured. Therefore, for example, a certain amount of (m) RNA to be detected can be administered to mice via tail vein or ip, and then one or more of the aforementioned factors in the blood can be measured after a predetermined period of time, for example, after 7 or 14 days. The amount of the factor is then associated with the amount of the factor present in the blood of untreated animals. In order to determine immunogenicity, it has been found that determining the binding capacity to TLR-3, TLR-7, TLR-8 and / or helicase RIG-1 is very valuable. TNF-α levels and IL-8 levels also provide very good indications. Utilize (m) RNA adopted according to the present invention, compared with unmodified RNA, for example, its binding capacity with TLR-3, TLR-7, TLR-8 and RIG-1 may be reduced by at least 50%. Generally, it is possible that the binding of the factor is reduced by at least 75% or even 80%. In a preferred embodiment, for (m) RNA adopted according to the present invention and animals not administered with mRNA, the binding capacity with TLR-3, TLR-7, TLR-8 and RIG-1 falls in the same range. In other words, in a specific aspect, it is envisioned that (m) RNA adopted according to the present invention does not actually cause inflammatory or immune responses.

[0108] In particular, it is envisaged that the RNA employed according to the invention has such low immunogenicity that the patient's overall condition is not affected. A slight increase in the aforementioned factors may be tolerated as long as the overall condition is not thereby aggravated.

[0109] Further properties of the (m)RNA employed according to the invention are its efficiency and stability. For this purpose, the transcription efficiency, transfection efficiency, translation efficiency and the duration of protein expression are important and can be determined by methods known per se.

[0110] Transcription efficiency indicates how effectively RNA can be produced from DNA. Here, problems may arise from the use of high levels of modified nucleotides. RNA modified according to the present invention can be produced with high transcription efficiency.

[0111] Specific RNAs employed according to the present invention are RNAs with (chemically) modified cytidine nucleotides and / or (chemically) modified uridine nucleotides. Such RNAs are described, for example, in WO 2011 / 012316.

[0112] Examples of suitable (chemical) modifications are listed in Table 4. A preferred modified cytidine is 5-methylcytidine (m5C). A preferred modified uridine is 2-thiouridine (s2U).

[0113] Specifically, the cmRNA used according to the present invention can be an RNA having 5 to 50% modified cytidine nucleotides and / or 5 to 50% modified uridine nucleotides, and 50 to 95% unmodified cytidine nucleotides and / or 50 to 95% unmodified uridine nucleotides. Adenosine and guanosine nucleotides can be unmodified or partially modified, but they are preferably present in an unmodified form. Preferably, 7.5 to 35% of the cytidine and / or uridine nucleotides are modified, and more preferably, the content of modified cytidine nucleotides is in the range of 15% to 25% and / or the content of modified uridine nucleotides is in the range of 15% to 25%.

[0114] A non-limiting example of a cmRNA employed in accordance with the present invention is an RNA wherein about 25% of the cytidines of the RNA are modified cytidines such as 5-methylcytidine (m5C) and / or about 25% of the uridines of the RNA are modified uridines such as 2-thiouridine (s2U) (m5C (0.25) S2U (0.25) RNA). The respective adenosine and guanosine nucleotides are preferably present in unmodified form.

[0115] However, on the other hand, the RNA used according to the present invention may not be cmRNA, that is, RNA may be non-chemically modified RNA. In this regard, non-chemically modified RNA may be non-naturally occurring or preferably naturally occurring RNA. It is specifically envisioned that the non-chemically modified RNA used in the context of the present invention only comprises non-modified, i.e. naturally occurring nucleoside residues, i.e. naturally occurring adenosine, guanosine, cytidine and uridine. In principle, other naturally occurring nucleosides (e.g., inosine, thymidine, etc.) may also be included. Specifically, RNA may not be cmRNA as described above, for example, it may not be cmRNA as described in WO2011 / 012316. However, even the non-chemically modified RNA used according to the present invention can have reduced immunogenicity, and for example, can eliminate (m) RNA and Toll-like receptors and the interaction with retinoid-inducible gene 1 (RIG-I). In particular, when loaded onto a matrix or support, i.e., a carrier, according to the present invention and as described elsewhere herein, non-chemically modified RNA can be advantageously used. Therefore, similarly, non-chemically modified RNA also shows, for example, an extended lifespan. This makes the respective non-chemically modified RNA-loaded vectors desirable depots for sustained / delayed RNA delivery.Another advantage of non-chemically modified RNA is that no step of chemically modifying the RNA to be used is required.

[0116] Thus, it is also contemplated in the context of the present invention that the use of the pharmaceutical compositions disclosed herein, the matrix or scaffold, i.e., the carrier, and the pharmaceutical composition be formulated for sustained and / or delayed delivery of RNA, particularly non-chemically modified RNA employed in accordance with the present invention. More specifically, the pharmaceutical composition or matrix / scaffold can be formulated into a system, such as a reservoir, for sustained and / or delayed delivery of RNA. As described in more detail below, in this regard, it is also preferred that the RNA is in the form of a complex according to the present invention and that the matrix / scaffold is a collagen sponge that can be vacuum and / or freeze-dried and loaded with RNA.

[0117] In principle, the (m)RNA employed according to the invention can therefore be used directly. However, there is also the possibility of (further) modifying the mRNA, for example in order to introduce (further) beneficial properties. Firstly, the mRNA can be modified by attaching other coding or non-coding sequences to the coding strand. Secondly, the modification can also be carried out by binding further molecules to the functional groups provided in the modified nucleotides.

[0118] In this case, the RNA used according to the present invention may have further functional regions and / or 3' or 5' non-coding regions. The 3' and / or 5' non-coding regions may be naturally flanking regions of the coded protein (BMP), or artificial sequences that contribute to RNA stabilization. A person skilled in the art can find sequences that are suitable for this in each case by routine experimentation.

[0119] In a preferred embodiment, the RNA contains an m7GpppG cap, an internal ribosome entry site (IRES) and / or a poly(A) tail at the 3' end, in particular to improve translation. The RNA may have further regions that promote translation.

[0120] All that is necessary is that the function of the BMP or a functional fragment thereof can be provided which will use the (m)RNA to treat, alleviate or prevent the bone disease.

[0121] In one embodiment, (m) RNA to be adopted can be combined with a targeting ligand that is bound to a surface receptor specific for the target cell, so that receptor-mediated transfection of the target cell becomes possible. For this purpose, first, the medium or (m) RNA itself suitable for introducing (m) RNA into the cell can be modified with a ligand. The example of a suitable medium for introducing (m) RNA into the cell is a cationic reagent. These include cationic lipids, cationic polymers or also include nanoparticles, nanocapsules, magnetic nanoparticles and nanoemulsions. Suitable medium is known to those skilled in the art and is described in the professional literature. Suitable ligands are also well known to those skilled in the art and are described in the literature and are available. For example, transferrin, lactoferrin, clenbuterol (clenbuterol), sugar, uronic acid, antibodies, aptamers, etc. can be used as ligands. The example of this type of medium and ligand is also described elsewhere in this article.

[0122] As mentioned above, (m) RNA itself can be modified with ligands. For this purpose, preferably (m) RNA has a modified nucleoside with a primary amino group or an azido group at the 2' position of the ribose. Examples can be found in Table 4. Such modifications are particularly preferred because they contribute to biological activity. Via these modifications, ligands can easily be introduced by amide formation or "click" chemistry, for example, by bioconjugation technology.

[0123] In a specific embodiment, an RNA sequence capable of binding to a protein, such as a receptor (aptamer), can be introduced at the 5' end of the (m)RNA. The advantage of this procedure is that the ligand can be introduced directly into the matrix at the DNA level and cloned and introduced into the (m)RNA, for example, by in vitro translation (IVT). Therefore, subsequent modification of the (m)RNA with the ligand is no longer necessary.

[0124] In a further embodiment, (m) RNA is modified by further modification with an inert polymer such as polyethylene glycol (PEG). Methods in this regard are well known to those skilled in the art, and methods such as those known for ligands can be used. Therefore, for example, a binding site for the polyethylene glycol of post-transcriptional binding PEG can be provided in the small portion of the modified nucleotide for (m) RNA. Polyethylene glycol is used for the extracellular stabilization of (m) RNA, i.e., it protects polyribonucleotide molecules until they reach cells. When entering cells, PEG is cut off. Therefore, it is preferred to design the bond between PEG and RNA so as to promote the cutting when entering cells. For this reason, for example, a functional group that can be cut off in pH dependency can be provided. Other molecules of stabilizing RNA can also be provided via the appropriate active site on the modified nucleotide. In this way, (m) RNA can be prevented from enzymatic degradation by spatial stabilization protection, and prevent interaction with biological fluid components. (m) RNA modified in this way can be referred to as "stealth" (m) RNA.

[0125] Preferred methods for protecting and stabilizing RNA are described in EP 1198489, the contents of which are hereby expressly incorporated by reference. The RNA used according to the invention can be protected by the method described in EP 1198489. It has been found that, firstly, RNA can also be advantageously stabilized and protected by this method, and secondly, the activity of the RNA treated in this way is not restricted or is not significantly restricted. Therefore, in a preferred embodiment of the present invention, the RNA is treated according to EP 1198489.

[0126] In one embodiment, the RNA (mRNA, cmRNA, etc.) used according to the present invention can be encapsulated, i.e., contained in a capsule. For example, the capsule can be a nanocapsule. Suitable capsules are known in the art and are also described elsewhere herein.

[0127] In one embodiment, the pharmaceutical composition of the present invention further comprises one or more medicaments or one or more reagents for RNA delivery and / or introduction into target cells or target tissues. Specifically, it is envisioned that this / these medicaments (one or more) or reagents (one or more) support RNA delivery and / or introduction into cells or tissues. This / these medicaments (one or more) or reagents (one or more) can be used together with RNA. The RNA to be delivered / introduced can also be coupled (e.g., covalently bound or compounded) or uncoupled (e.g., only mixed with it) with this / these medicaments (one or more) or reagents (one or more). Separate medicaments or reagents are known in the art (e.g., Tavernier, J Control Release 150 (3) (2011), 238-47), and are, for example, selected from: lipids and liposomes, micelles, polymers and dendrimers, etc. Specific examples of the respective agents or reagents are DOTAP (1,2-dioleyl-3-trimethylammonium propane), DODAP (1,2-dioleyl-3-dimethylammonium propane), DOTMA (1,2-di-O-octadecenyl-3-trimethylammonium propane), XTC (2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane) and MC3 (((6Z,9Z,28Z,31Z)-triacontria-6,9,28,31-tetraene-1 9-amino-4-(dimethylamino)butyrate), ALNY-100 ((3aR,5s,6aS)-N,N-dimethyl-2,2-di((9Z,12Z)-octadec-9,12-diene)tetrahydro-3aH-cyclopenta[d][1,3]dioxol-5-amine)), NC98-5 (4,7,13-tris(3-oxo-3-(undecylamino)propyl)-N1,N16-diundecyl-4,7,10,13-tetraazadecanoyl) Hexadecane-1,16-diamide), C12-200, DLin-KC2-DMA, DODAP, 1,2-distearoyloxy-N,N-dimethyl-3-aminopropane or "DSDMA", 1,2-dioleyloxy-N,N-dimethyl-3-aminopropane or "DODMA", 1,2-dilinoleyloxy-N,N-dimethyl-3-aminopropane or "DLinDMA", 1,2-dilinolenyloxy )-N,N-dimethyl-3-aminopropane or "DLenDMA", N-dioleyl-N,N-dimethylammonium chloride or "DODAC", N,N-distearoyl-N,N-dimethylammonium bromide or "DDAB", N-(1,2-dimyristyloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethylammonium bromide or "DMRIE", 3-dimethylamino-2-(cholest-5-en-3-β-oxybut-4-oxy)-1-(cis, cis-9,1-(cis,cis-9',1-2'-octadecadienyloxy)propane or "CpLinDMA", N,N-dimethyl-3,4-dioleyloxybenzylamine or "DMOBA", 1,2-N,N'-dioleylcarbamoyl-3-dimethylaminopropane or "DOcarbDAP", 2,3-dilinoleoyloxy-N,N-dimethylpropylamine or "D LinDAP", 1,2-N,N'-dilinoleylcarbamoyl-3-dimethylaminopropane or "DLincarbDAP", 1,2-dilinoleylcarbamoyl-3-dimethylaminopropane or "DLinCDAP", 2,2-dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane or "DLin-K-DMA", 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane or "DLin-K-XTC2-DMA", or mixtures thereof (Heyes, J Controlled Release 107 (2005), 276-287; Morrissey, Nat. Biotechnol. 23(8) (2005), 1003-1007; WO2005 / 121348). Further examples are DC-Chol (N,N-dimethyl-N-ethylformamide cholesterol), 1,4-bis(3-N-oleylamino-propyl)piperazine (Gao, Biochem. Biophys. Res. Comm. 179 (1991), 280; Wolf et al. BioTechniques 23 (1997), 139; US Pat. No. 5,744,335). Further examples are LIPOFECTIN (DOTMA:DOPE) (Invitrogen, Carlsbad, Calif.), LIPOFECTAMINE (DOSPA:DOPE) (Invitrogen), LIPOFECTAMINE 2000 (Invitrogen), FUGENE, TRANSFECTAM (DOGS) and EFFECTENE. Further examples are modified and unmodified polyacrylates, polyalkylcyanoacrylates, polylactide, polylactide-polyglycolide copolymers, polycaprolactone, dextran, albumin, gelatin, alginate, collagen, chitosan, cyclodextrin, polylysine, polyarginine, oligo- / polyamines and polyethyleneimine.

[0128] The agents or reagents may be oligomers, polymers or lipidoids. They may contain oligo(alkyleneamine) moieties, such as the characteristic oligo(alkyleneamine) moieties described in PCT / EP2014 / 063756. Specifically, the agents or reagents may be oligomers, polymers or lipidoids as described in PCT / EP2014 / 063756. A key feature of these specific agents or reagents is that they contain the common structural entity of the following formula (I):

[0129]

[0130] Such agents or reagents may be (components comprising) oligo(alkyleneamines) selected from:

[0131] a) oligomers or polymers comprising a plurality of groups of formula (II) as side chains and / or as terminal groups:

[0132]

[0133] wherein in a plurality of such groups, the variables a, b, p, m, n and R of each group of formula (II) are 2 to R 6 are independently defined as follows:

[0134] a is 1 and b is an integer from 2 to 4; or a is an integer from 2 to 4 and b is 1,

[0135] p is 1 or 2,

[0136] m is 1 or 2; n is 0 or 1, and m+n≥2; and

[0137] R 2 to R 5 are independently selected from hydrogen; the group -CH2-CH(OH)-R 7 、-CH(R 7 )-CH2-OH, -CH2-CH2-(C=O)-OR 7 、-CH2-CH2-(C=O)-NH-R 7 or -CH2-R 7 , where R 7 is selected from C3-C18 alkyl or C3-C18 alkenyl having one C-C double bond; an amino protecting group; and a poly(ethylene glycol) chain;

[0138] R 6 Selected from hydrogen; the group -CH2-CH(OH)-R 7 、-CH(R 7 )-CH2-OH, -CH2-CH2-(C=O)-OR 7、-CH2-CH2-(C=O)-NH-R 7 or -CH2-R 7 , where R 7 is selected from a C3-C18 alkyl group or a C3-C18 alkenyl group having one C-C double bond; an amino protecting group; -C(NH)-NH2; a poly(ethylene glycol) chain; and a receptor ligand,

[0139] and wherein one or more of the nitrogen atoms indicated in formula (II) may be protonated to provide a cationic group of formula (II);

[0140] b) oligomers or polymers comprising as repeating units a plurality of groups of formula (III):

[0141]

[0142] wherein in a plurality of such groups, the variables a, b, p, m, n and R of each group of formula (III) are 2 to R 5 are independently defined as follows:

[0143] a is 1 and b is an integer from 2 to 4; or a is an integer from 2 to 4 and b is 1,

[0144] p is 1 or 2,

[0145] m is 1 or 2; n is 0 or 1, and m+n≥2; and

[0146] R 2 to R 5 are independently selected from hydrogen; the group -CH2-CH(OH)-R 7 、-CH(R 7 )-CH2-OH, -CH2-CH2-(C=O)-OR 7 or -CH2-CH2-(C=O)-NH-R 7 or -CH2-R 7 , where R 7 is selected from C3-C18 alkyl or C3-C18 alkenyl having one C-C double bond; an amino protecting group; -C(NH)-NH2; and a poly(ethylene glycol) chain;

[0147] and wherein one or more of the nitrogen atoms indicated in formula (III) may be protonated to provide a cationic group of formula (III); and

[0148] c) a lipid having the structure of formula (IV):

[0149]

[0150] where variables a, b, p, m, n, and R 1 to R 6 The following are defined:

[0151] a is 1 and b is an integer from 2 to 4; or a is an integer from 2 to 4 and b is 1,

[0152] p is 1 or 2,

[0153] m is 1 or 2; n is 0 or 1, and m+n≥2; and

[0154] R 1 to R 6 are independently selected from hydrogen; the group -CH2-CH(OH)-R 7 、-CH(R 7 )-CH2-OH, -CH2-CH2-(C=O)-OR 7 、-CH2-CH2-(C=O)-NH-R 7 or -CH2-R 7 , where R 7 is selected from C3-C18 alkyl or C3-C18 alkenyl having one C-C double bond; an amino protecting group; -C(NH)-NH2; a poly(ethylene glycol) chain; and a receptor ligand; provided that R 1 to R 6 At least two residues are -CH groups 2 -CH(OH)-R 7 、-CH(R 7 )-CH2-OH, -CH2-CH2-(C=O)-OR 7 、-CH2-CH2-(C=O)-NH-R 7 or -CH2-R 7 , where R 7 is selected from C3-C18 alkyl or C3-C18 alkenyl having one C-C double bond;

[0155] and wherein one or more of the nitrogen atoms indicated in formula (IV) may be protonated to provide the cationic lipidoid of formula (IV).

[0156] In more specific aspects, such agents or reagents can be (components comprising) oligo(alkyleneamines) selected from a) and b), wherein:

[0157] a) is an oligomer or polymer comprising a plurality of groups of formula (IIa) as side chains and / or as terminal groups:

[0158] -NR 2 {CH2-(CH2) a -NR 3-CH2-(CH2) b -NR 4} m -[CH2-(CH2) a -NR 5 ] n -R 6 (IIa),

[0159] where a, b, m, n and R 2 to R 6 as defined above, and wherein one or more of the nitrogen atoms indicated in formula (IIa) may be protonated to provide a cationic oligomeric or polymeric structure; and

[0160] b) is an oligomer or polymer comprising a plurality of groups of formula (IIIa) as repeating units:

[0161] -NR 2 {CH2-(CH2) a -NR 3 -CH2-(CH2) b -NR 4} m -[CH2-(CH2) a -NR 5 ] n -(IIIa),

[0162] where a, b, m, n and R 2 to R 5 As defined above, and wherein one or more of the nitrogen atoms indicated in formula (IIIa) may be protonated to provide a cationic oligomeric or polymeric structure.

[0163] In another more specific aspect, such agent or reagent can be (a component comprising) an oligo(alkyleneamine) selected from a lipidoid having the structure of formula (IVa):

[0164] R 1 -NR 2 {CH2-(CH2) a -NR 3 -CH2-(CH2) b -NR 4} m -[CH2-(CH2) a -NR 5 ] n -R 6 (IVa),

[0165] where a, b, m, n and R 1 to R 6As defined above, and wherein one or more of the nitrogen atoms indicated in formula (IVa) may be protonated to provide a cationic lipidoid.

[0166] For such agents or reagents, in Formula (II), (IIa), (III), (IIIa), (IV), or (IVa), n may be 1; or m may be 1 and n may be 1.

[0167] Furthermore, for such agents or reagents, in Formula (II), (IIa), (III), (IIIa), (IV) or (IVa), a may be 1 and b may be 2; or a may be 2 and b may be 1.

[0168] In a particular aspect, the oligomer, polymer or lipidoid can be a cationic (eg, protonated) oligomer, polymer or lipidoid.

[0169] A non-limiting example of such an oligomer, polymer or lipidoid employed in the context of the present invention is a cationic lipid prepared by mixing 100 mg of N,N'-bis(2-aminoethyl)-1,3-propylenediamine (0.623 mmol) with 575.07 mg of 1,2-epoxydodecane (3.12 mmol, (N-1) equivalents, where N is 2x the amount of primary amine plus 1x the amount of secondary amine / oligo(alkyleneamine)) and mixing at 80° C. with constant shaking for 96 hours. Such an oligomer, polymer or lipidoid is also referred to as lipidoid “C12-(2-3-2)”.

[0170] The agents or reagents employed in accordance with the present invention, particularly polymers, may be copolymers, particularly statistical copolymers. Such copolymers may be copolymers containing a statistical / random arrangement of alternating length alkyleneamine repeat units (e.g., in contrast to less preferred polymers containing similarly arranged non-alternating length alkyleneamine repeat units). The copolymers may be cationic (e.g., protonated) copolymers. Copolymers employed in accordance with the present invention are known in the art and are described, for example, in EP 14 19 9439.2, WO 01 / 00708, EP-A1 198489, and CA-A1 2,377,207.

[0171] In particular, the copolymer may be a statistical copolymer comprising a plurality of repeating units (a) independently selected from repeating units of the following formulae (a1) and (a2):

[0172] -CH2-CH2-NH- (a1)

[0173]

[0174] a plurality of repeating units (b), wherein the repeating units (b) are independently selected from the repeating units of the following formulae (b1) to (b4):

[0175] -CH2-CH2-CH2-NH- (b1)

[0176]

[0177] -CH2-CH2-CH2-CH2-NH- (b3)

[0178]

[0179] wherein the molar ratio of the sum of repeating units (a) to the sum of repeating units (b) is in the range of 0.7 / 1.0 to 1.0 / 0.7, and

[0180] One or more of the nitrogen atoms of the repeating units (a) and / or (b) contained in the copolymer may be protonated to provide a cationic copolymer.

[0181] The copolymer may be a statistical copolymer, wherein any repeating unit (a) and any repeating unit (b) are statistically distributed in the copolymer macromolecule. It is generally obtained by copolymerizing a mixture of monomers that produce repeating units (a) during the polymerization reaction and monomers that produce repeating units (b) during the polymerization reaction. Preferably, the copolymer is a random copolymer, wherein any repeating unit (a) and any repeating unit (b) are randomly distributed in the polymer macromolecule.

[0182] The copolymers according to the present invention may be linear, branched or dendritic copolymers. As will be appreciated by the skilled reader, repeating units of formula (a1), (b1) or (b3) having two valences (i.e., open bonds to adjacent units) result in an extension of the copolymer structure in a linear fashion. Thus, the linear copolymers of the present invention comprise repeating units of formula (a1) and one or more types of repeating units of formula (b1) and (b3), but do not include repeating units of formula (a2), (b2) or (b4). As will be further appreciated, the presence of repeating units of formula (a2), (b2) or (b4) having three valences provides branching points in the copolymer structure. Thus, branched copolymers comprise repeating units of one or more types of repeating units of formula (a2), (b2) and (b4), and may further comprise repeating units of one or more types of repeating units of formula (a1), (b1) and (b3).

[0183] The copolymer according to the present invention comprises a plurality of repeating units (a) independently selected from the repeating units of formulae (a1) and (a2) defined above and a plurality of repeating units (b) independently selected from the repeating units of formulae (b1) to (b4) defined above. Preferred are copolymers comprising a plurality of repeating units (a) independently selected from the repeating units of formulae (a1) and (a2) defined above and a plurality of repeating units (b) independently selected from the repeating units of formulae (b1) and (b2) defined above.

[0184] It is also preferred that the copolymer according to the present invention is a branched copolymer comprising one or more types of repeating units selected from the group consisting of repeating units (a2), (b2) and (b4), and which optionally further comprises one or more types of repeating units of formula (a1), (b1) and (b3), and in particular a copolymer comprising repeating units of formula (a2) and one or more types of repeating units of formula (b2) and (b4), and which optionally further comprises one or more types of repeating units of formula (a1), (b1) and (b3). According to the above, a more preferred copolymer is therefore a branched copolymer comprising repeating units of formula (a2) and repeating units of formula (b2), and which optionally further comprises one or more types of repeating units of formula (a1) and (b1).

[0185] In the copolymer according to the present invention, the total number of repeating units (a) and repeating units (b) is usually 20 or more, preferably 50 or more, more preferably 100 or more. Usually, the total number of repeating units (a) and repeating units (b) is 10,000 or less, preferably 5,000 or less, more preferably 1,000 or less.

[0186] Furthermore, for the copolymer according to the present invention, it is preferred that the repeating units (a) and (b) account for 80 mol% or more, more preferably 90 mol% or more, of all the repeating units in the copolymer. Further preferred are copolymers in which the repeating units (a) selected from (a1) and (a2) and the repeating units (b) selected from (b1) and (b2) account for 80 mol% or more, more preferably 90 mol% or more of all the repeating units in the copolymer. Most preferably, all the repeating units in the copolymer are repeating units (a) or (b), specifically all the repeating units in the copolymer are repeating units (a) selected from (a1) and (a2) or repeating units (b) selected from (b1) and (b2).

[0187] The weight average molecular weight of the copolymers according to the invention, as measured, for example, via size exclusion chromatography relative to linear poly(ethylene oxide) standards, typically ranges from 1,000 to 500,000 Da, preferably from 2,500 to 250,000 Da, more preferably from 5,000 to 50,000 or less.

[0188] The terminal groups of the copolymers according to the present invention generally comprise one or more types of groups (c) independently selected from the groups of the following formulae (c1) to (c3), preferably selected from the groups of the following formulae (c1) and (c2):

[0189] -CH2-CH2-NH2 (c1)

[0190] -CH2-CH2-CH2-NH2 (c2)

[0191] -CH2-CH2-CH2-CH2-NH2 (c3).

[0192] Preferably, the end groups in the copolymer are composed of one or more types of groups (c), and the groups (c) are independently selected from the groups of the following formulae (c1) to (c3), preferably selected from the groups of formulae (c1) and (c2). As will be appreciated by those skilled in the art, the number of end groups depends on the structure of the copolymer according to the present invention. Although linear copolymers have only two ends, a greater number of end groups are contained in branched, particularly dendritic copolymers. As will be further appreciated, one or more of the nitrogen atoms of the end groups (c) included in the copolymer can also be protonated to provide a cationic copolymer.

[0193] In the copolymer according to the present invention, the molar ratio of the sum of repeating units (a) to the sum of repeating units (b) is in the range of 0.7 / 1.0 to 1.0 / 0.7, and preferably in the range of 0.8 / 1.0 to 1.0 / 0.8. This molar ratio can be determined, for example, via NMR. Therefore, it will be understood that this ratio is generally determined for a plurality of macromolecules of the copolymer according to the present invention, and that this ratio generally indicates the total ratio of the sum of repeating units (a) to the sum of repeating units (b) in a plurality of macromolecules.

[0194] As mentioned above, one or more of the nitrogen atoms of the copolymers according to the invention may be protonated to produce a cationic form of the copolymer, typically an oligocationic or polycationic form. It will be appreciated that the primary, secondary or tertiary amino groups in the repeating units (a) or (b) or in the terminal group (c) can act as proton acceptors, particularly in water and aqueous solutions, including physiological fluids. Thus, the copolymers of the invention typically have an overall positive charge in aqueous solutions having a pH below 7.5. Aqueous solutions as referred to herein are solutions in which the solvent comprises 50% (vol. / vol.) or more, preferably 80 or 90% or more and most preferably 100% water. Similarly, if the compositions according to the invention are in contact with physiological fluids having a pH below 7.5, including, for example, blood and lung fluid, they typically comprise repeating units (a) and (b) in which the nitrogen atoms are protonated. The pK of the copolymers used in the compositions according to the invention is preferably 0.05 or 0.15. a The value can be automatically obtained by using pK a The net charge at a given pH value can then be calculated, for example, from the Henderson-Hasselbach equation. Any charge may be shared among several basic centers and is not necessarily attributed to a single point. Typically, in solution at physiological pH, the copolymer used in the composition according to the present invention comprises repeating units having amino groups in a protonated state and repeating units having amino groups in a non-protonated state.

[0195] However, as the skilled reader will appreciate, the copolymers according to the invention and the compositions according to the invention may also be provided in the form of dry salts containing the copolymers in cationic form.

[0196] As will be further understood, the counterions (anions) to the positive charges of the protonated amino groups in the compositions according to the invention comprising copolymers and nucleic acids, in particular RNA, preferably single-stranded RNA such as mRNA, are generally provided by anionic moieties contained in the nucleic acids. If the positively charged groups are present in excess compared to the anionic moieties in the nucleic acids, the positive charges can be balanced by other anions, in particular anions commonly encountered in physiological fluids, such as Cl - or HCO3 - .

[0197] In light of the above, preferred copolymers according to the present invention are random copolymers wherein:

[0198] 80 mol% or more of all repeating units, more preferably all repeating units, are formed from:

[0199] a plurality of repeating units (a) independently selected from repeating units of the following formulae (a1) and (a2):

[0200] -CH2-CH2-NH- (a1)

[0201]

[0202] a plurality of repeating units (b) independently selected from repeating units of the following formulae (b1) and (b2):

[0203] -CH2-CH2-CH2-NH- (b1)

[0204]

[0205] wherein the molar ratio of the sum of repeating units (a) to the sum of repeating units (b) is in the range of 0.7 / 1.0 to 1.0 / 0.7, more preferably in the range of 0.8 / 1.0 to 1.0 / 0.8;

[0206] The terminal groups of the copolymer are formed by:

[0207] Group (c) independently selected from groups of formula (c1) and (c2):

[0208] -CH2-CH2-NH2 (c1)

[0209] -CH2-CH2-CH2-NH2 (c2); and

[0210] wherein one or more of the nitrogen atoms of the repeating units (a) and / or (b) and / or the terminal groups (c) contained in the copolymer may be protonated to provide a cationic copolymer. Further preferred is that the copolymer is a branched copolymer comprising units (a2) and (b2), optionally together with units (a1) and / or (b1).

[0211] The copolymer according to the present invention can be conveniently prepared using similar procedures known for preparing polyalkyleneimines such as branched or linear polyethyleneimines (PEI). It should be understood that the monomers used to produce the copolymer must be adjusted accordingly. In the context of the present invention, it has been found that monomers can react conveniently in a quantitative manner so that the ratio of units (a) and (b) in the copolymer can be adjusted by adjusting the monomer ratio in the monomer mixture undergoing polymerization accordingly. Polyethyleneimines can be prepared, for example, via the ring-opening polymerization of aziridine, and the copolymer according to the present invention can be prepared via the ring-opening polymerization of a monomer mixture comprising aziridine, azetidine and, where applicable, pyrrolidine--or in a preferred embodiment, aziridine and azetidine--or consisting thereof. It should be understood that the expression "where applicable" refers to the presence or absence of repeating units (b3) and (b4) or terminal groups (c3) formed by pyrrolidine. The ring-opening polymerization of unsubstituted cyclic amines typically results in branched copolymers. The linear copolymers according to the invention can be prepared, for example, via polymerization of appropriate N-substituted aziridines, N-substituted azetidines and N-substituted pyrrolidines, or N-substituted aziridines and N-substituted azetidines, followed by cleavage of the N-substituent attached to the resulting polyalkyleneimine chain, for example by hydrolysis, for example in analogy to the procedure disclosed in Katrien F. Weyts, Eric J. Goethals, New synthesis of linearpolyethyleneimine, Polymer Bulletin, January 1988, Volume 19, Issue 1, pp 13-19.

[0212] For the preparation of dendrimers (or dendritic copolymers), the synthetic strategies known for the production of polyethyleneimine or polypropyleneamine dendrimers can be applied analogously. Polypropyleneimine dendrimers can be synthesized from acrylonitrile building blocks using repeated sequential Michael additions to primary amines followed by heterogeneous catalytic hydrogenation (Newkome and Shreiner Poly(amidoamine), polypropylenimine, and related dendrimers and dendrons possessing different 1→2 branching motifs: An overview of the divergent procedures. Polymer 49 (2008) 1-173; De Brabander-Van Den Berg et al. Large-scale production of polypropylenimine dendrimers, Macromolecular Symposia (1994) 77 (1) 51–62). Polyethyleneimine dendrimers can be produced using a repeated sequence of Michael additions of vinyl bromide building blocks to primary amines, followed by conversion of the alkyl bromide to the amine using the Gabriel amine synthesis method (Yemul & Imae, Synthesis and characterization of poly(ethyleneimine) dendrimers, Colloid Polym Sci (2008) 286:747–752). Thus, one skilled in the art will be able to produce not only dendrimers having, for example, strictly alternating layers of propyleneimine and ethyleneimine. Similarly, dendrimer generation can be produced having layers comprising or consisting of a random composition of repeating units of formula (a2), (b2), and (b4), preferably repeating units (a2) and (b2).

[0213] The ring-opening polymerization of aziridine and azetidine, or aziridine, azetidine and pyrrolidine can be carried out in solution, for example in water. There is no particular limitation on the total monomer concentration, with typical concentrations ranging from 10% wt / wt to 80% wt / wt, preferably from 30% wt / wt to 60% wt / wt. Typically, polymerization is initiated by protons, making it preferred to add a Bronsted acid, particularly an inorganic acid such as sulfuric acid, to the reaction system. A small amount of acid is generally sufficient, such as 0.001 to 0.01 equivalents, based on the total concentration of monomers. The reaction proceeds at a suitable rate, for example in a temperature range of 50 to 150° C., particularly 90 to 140° C. Within these ranges, higher molecular weight copolymers are generally at higher temperatures, while lower molecular weight copolymers are at lower temperatures.

[0214] In principle, lipids are preferred agents or reagents for use according to the present invention, particularly compared to oligomers, and more particularly polymers.

[0215] Further examples of one or more agents or one or more agents for delivering and / or introducing RNA into target cells or target tissues are lipofectamine transfection reagents (LTR's) and magnetic particles (MPs), as described elsewhere herein.

[0216] A specific mode for delivering and / or introducing RNA into a target cell or target tissue is transfection. Thus, in one aspect, it is envisioned that the RNA to be employed is transfected (into a (target) cell or tissue) to be delivered / administered via transfection, and / or prepared for transfection. Means and methods for transfecting RNA are well known in the art and are described, for example, in Tavernier (ibid.), Yamamoto (Eur J Pharm Biopharm. 71 (3) (2009), 484-9) and Kormann (Nat Biotechnol. 29 (2) (2011), 154-7).

[0217] The specific mode of transfection is lipofection, magnetofection or magnetic lipofection. In the context of the present invention, good results were achieved using these types of transfection. Using magnetofection, the results were particularly good, and using magnetic lipofection, the results were extremely good.

[0218] Thus, in one aspect, the RNA to be employed can be prepared for lipofection, prepared for transfection by lipofection, delivered / introduced via lipofection, and / or administered via lipofection.

[0219] According to this aspect, the pharmaceutical composition of the present invention may (further) comprise at least one lipid or liposome transfection reagent or enhancer (LTR; liposome transfection reagent). The RNA to be employed may be contained in, complexed with, and / or delivered by the LTR. Specifically, the RNA to be employed may be contained in and / or delivered by (each) lipofection complex containing the RNA and the LTR. The pharmaceutical composition of the present invention may (further) comprise a lipofection complex.

[0220] LTRs are known in the art and are marketed, for example, by OzBiosciences, Marseille, France. The LTRs employed in accordance with the present invention may be selected from the above-mentioned agents or reagents for delivering and / or introducing RNA into target cells or target tissues. For example, such LTRs may be lipids or lipidoids, preferably cationic lipids or cationic lipidoids, such as the lipidoids disclosed in PCT / EP2014 / 063756 (e.g., C12-(2-3-2)), lipids disclosed in EP2285772 (e.g., Dogtor), and lipopolyamines disclosed in EP1003711 (e.g., DreamFect). TM and DreamFect Gold TM ). Specific LTRs can be selected from:

[0221] (i) C12-(2-3-2);

[0222] (ii)DreamFect TM , preferably DreamFect Gold TM (DF TM / DF-GOLD TM ;OzBiosciences, Marseille, France);

[0223] (iii) Dogtor (OzBiosciences, Marseille, France); and

[0224] (iv) Lipofectamine, for example, Lipofectamine 2000 (Invitrogene, CA, USA).

[0225] In principle, Dogtor is preferred, DreamFect TM is more preferred and F-Gold TM and C12-(2-3-2) are even more preferred LTR(s).

[0226] LTR, such as Dogtor, is described, for example, in EP 2 285 772. LTR, such as DF TM or DF-Gold TM , for example, as described in EP1003711. In principle, oligomers, polymers or lipidoids as disclosed in PCT / EP2014 / 063756, the specific cationic lipids disclosed in EP2285772 and the specific lipopolyamines disclosed in EP1003711 are preferred LTRs according to the present invention. LTRs such as C12-(2-3-2) and DF-Gold TM , is the most preferred.

[0227] A non-limiting example of a lipofection complex is DF-Gold TM / RNA positive liposomes and C12-(2-3-2) / RNA positive liposomes.

[0228] The agents and reagents described herein for delivering and / or introducing RNA into target cells or target tissues and the LTRs described herein can be combined with one or more (e.g., two, three, or four) further lipids (e.g., cholesterol, DOPE, and / or PEG-lipids (e.g., DMPE-PEG)). These further lipids can support the desired functions of the agent / agent and LTR (supporting and / or increasing the delivery and / or introduction of RNA into cells or tissues and improving the efficiency of transfection, respectively) and act as "helper lipids" for each. Specific examples of such "helper lipids" are cholesterol, DPPC, DOPE, and / or PEG-lipids (e.g., DMPE-PEG, DMG-PEG (e.g., DMG-PEG2k)). Further lipids (e.g., "helper lipids") can also be part of (one or more) of the complexes / particles disclosed herein. A skilled artisan can readily prepare complexes / particles according to the present invention based on their position. Examples of further lipids (e.g., "helper lipids") are also known in the art. A skilled artisan can readily select an appropriate further lipid (e.g., "helper lipid") and the ratio of the agent / agent / LTR to the further lipid (e.g., "helper lipid") based on their position. Such ratios can be molar ratios of agent / agent / LTR: further lipid(s) of 1-4:1-5, 3-4:4-6, about 4:about 5, about 4:about 5.3 (narrower ranges are preferred). For example, an agent / agent / LTR can be combined with three further lipids, such as cholesterol, DOPE, and DMPE-PEG, in molar ratios of 8:5.3:4.4:0.9, more specifically 8:5.29:4.41:0.88, respectively.

[0229] In another aspect, the RNA to be employed can be prepared for magnetofection, prepared for transfection by magnetofection, delivered / introduced via magnetofection, and / or administered via magnetofection.The principles of magnetofection are known in the art and are described, for example, in WO 02 / 00870.

[0230] According to this aspect, the pharmaceutical composition of the present invention may (further) comprise at least one magnetic particle (MP), in particular at least one magnetic nanoparticle (MNP). The RNA to be employed may be contained in, complexed with, and / or delivered by the MP. Specifically, the RNA to be employed may be contained in and / or delivered by (respective) magnetofection complexes containing the RNA and the MP. The pharmaceutical composition of the present invention may (further) comprise a magnetofection complex.

[0231] The MPs (or MNPs) to be used may be core-shell MPs, iron oxide silica MPs and / or (branched) PEI-decorated MPs. Specific MPs (or MNPs) may be MPs (or MNPs) with SiOx / phosphonate-PEI coatings, further referred to as SO-Mag6-115 MPs (or MNPs). MPs (or MNPs) may be produced according to the accompanying examples and, for example, according to Mykhaylyk (Liposomal magnetofection. In: Weissig V (ed.) Liposomes, Methods in Molecular Biology, vol. 605. Humana Press-Springer, New York 2010, 487-525; Pharm Res 29 (5), 2012, 1344-1365).

[0232] A non-limiting example of a magnetofection complex is the SO-Mag6-115 MP (or MNP) / RNA magnetofection complex. Further MPs (or MNPs) and respective magnetofection complexes are described in WO 02 / 00870.

[0233] In a more specific aspect, the magnetofection complex may include a third component and may therefore be in the form of a magnetic triplet. The third component may be an LTR (e.g. as defined above). The magnetic triplet may then be named a magnetic lipofection complex and may be named, for example, as defined below.

[0234] In another more specific aspect, the RNA to be employed can be prepared for magnetic lipofection, prepared for transfection by magnetic lipofection, delivered / introduced via magnetic lipofection, and / or administered via magnetic lipofection.

[0235] In principle, magnetic lipofection combines the advantages of lipofection and magnetofection, and in particular the advantages of both transfection methods. Thus, in principle, what was stated above with respect to lipofection and magnetofection also applies, mutatis mutandis, to magnetic lipofection.

[0236] According to the aspect of magnetic lipofection, the pharmaceutical composition of the present invention may (further) comprise at least one magnetic lipofection complex (also known as magnetic positive liposome). The RNA to be employed may be contained in, complexed with, and / or delivered by such a complex. The magnetic lipofection complex may be a magnetic triplet and may, for example, comprise RNA, at least one MP (as defined above) and at least one LTR (as defined above).

[0237] A non-limiting example of a magnetic lipofection complex is a SO-Mag6-115 MP (or MNP) / DF-Gold / RNA magnetic lipofection complex.

[0238] In principle, the skilled person can easily determine suitable ratios between the components (e.g., RNA, LTR, MP) of the transfection complexes employed according to the invention. Respective guidance is provided, for example, in Kormann (supra), Mays (supra), WO 02 / 00870 and the accompanying examples.

[0239] However, as mentioned above, specific ratios have been found to be very useful in the context of the present invention, eg, resulting in highly effective and / or efficient transfection.

[0240] Such specific ratios are w / w ratios of LTR to RNA in the range of about 1 to 40 μg, 5 to 35 μg, 10 to 30 μg, 15 to 25 μg, 17 to 23 μg, 18 to 22 μg, 19 to 21 μg, 1 to 20 μg, 2 to 20 μg, 3 to 20 μg, 1 to 15 μg, 2 to 15 μg, 3 to 15 μg, 1 to 10 μg, 2 to 10 μg, 3 to 10 μg, 4 to 10 μg, 5 to 10 μg, 4 to 12 μg, 5 to 11 μg, 6 to 10 μg, or 7 to 9 μg of said LTR per μg of said RNA. Likewise, in particular, if the LTR is prepared as an LTR solution (e.g., in the accompanying examples), such ratios are LTR solution to RNA v / w ratios in the range of 0.5 to 15 μl, 0.5 to 10 μl, 0.5 to 8 μl, 1 to 15 μl, 1 to 10 μl, 1 to 8 μl, 1 to 6 μl, 1.5 to 5.5 μl, 2 to 5 μl, 3 to 4 μl, 1 to 3 μl, 4 to 6 μl, 1.5 to 2.5 μl, 4.5 to 5.5 μl, 1.7 to 2.3 μl, or 4.7 to 5.3 μl of said LTR solution per μg of said RNA. In principle, narrower ranges are preferred. In this case, the preferred LTR is DreamFect TM , or more preferably DF-Gold TM Or C12-(2-3-2).Preferred RNA is BMP-7 RNA, more preferably BMP-2 RNA.

[0241] A further specific ratio of LTR to RNA is an N / P ratio of about 4-12, preferably about 6-10, preferably about 9-11, and more preferably about 8, wherein N / P represents the molar ratio of amino groups of the LTR to phosphate groups of the RNA.

[0242] In particular, if cells, such as adipose-derived mesenchymal stem cells (AMSCs), are to be transfected, such specific ratios are LTR to RNA w / w ratios in the range of about 5 to 35 μg, 10 to 30 μg, 15 to 25 μg, 17 to 23 μg, 18 to 22 μg or 19 to 21 μg of said LTR / μg of said RNA. Similarly, in particular, if LTRs are prepared as an LTR solution (e.g., in the accompanying examples), such specific ratios are LTR solution to RNA v / w ratios in the range of 4 to 6 μl, 4.5 to 5.5 μl or 4.7 to 5.3 μl of said LTR solution / μg of said RNA. In principle, narrower ranges are preferred. The most preferred ratio (resulting in highly effective and efficient transfection of AMSCs) is a w / w ratio of LTR to RNA of about 20 μg of LTR per μg of RNA, and / or a v / w ratio of LTR solution to RNA of about 5 μl of LTR solution per μg of RNA. Mutual modifications apply to the above description of preferred LTRs and / or RNA.

[0243] In particular, if cells, such as bone marrow-derived MSCs (BMSCs), are to be transfected, such specific ratios are LTR to RNA w / w ratios in the range of about 4 to 12 μg, 5 to 11 μg, 6 to 10 μg or 7 to 9 μg of said LTR per μg of said RNA. Similarly, in particular, if the LTRs are prepared as an LTR solution (e.g. in the accompanying examples), such specific ratios are LTR solution to RNA v / w ratios in the range of 1 to 3 μl, 1.5 to 2.5 μl or 1.7 to 2.3 μl of said LTR solution per μg of said RNA. In principle, narrower ranges are preferred. The most preferred ratios (resulting in highly effective and efficient transfection of BMSCs) are LTR to RNA w / w ratios of about 8 μg of said LTR per μg of said RNA, and / or LTR solution to RNA v / w ratios of about 2 μl of said LTR solution per μg of said RNA. Mutually, what is stated above regarding preferred LTRs and / or RNA also applies here, mutatis mutandis.

[0244] Further, such specific ratios are MP to RNA iron w / w ratios in the range of 0.05 to 5 μg, 0.05 to 3 μg, 0.05 to 1 μg, 0.07 to 5 μg, 0.1 to 5 μg, 0.1 to 1 μg, 0.2 to 0.8 μg, 0.3 to 0.7 μg, or 0.4 to 0.6 μg (iron weight) of the MP / μg of the RNA. In principle, narrower ranges are preferred. The most preferred ratio is an MP to RNA iron w / w ratio of about 0.5 μg of the MP per μg of the RNA. In this context, a preferred MP is SO-Mag6-115MP (or more preferably MNP). A preferred RNA is BMP-7 or more preferably BMP-2RNA.

[0245] Further specific ratios of this type are MP to LTR iron w / w ratios in the range of about 0.05 to 5 μg, 0.05 to 3 μg, 0.05 to 1 μg, 0.07 to 5 μg, 0.1 to 5 μg, 0.1 to 1 μg, 0.2 to about 0.8 μg, 0.3 to 0.7 μg or 0.4 to 0.6 μg (iron weight) of said MP per about 12 to 20 μg (preferably about 16 μg) of said LTR. Likewise, in particular, if the LTR is prepared as an LTR solution (e.g., in the accompanying examples), the ratios are MP to LTR solution iron w / v ratios in the range of 0.05 to 5 μg, 0.05 to 3 μg, 0.05 to 1 μg, 0.07 to 5 μg, 0.1 to 5 μg, 0.1 to 1 μg, 0.2 to 0.8 μg, 0.3 to 0.7 μg, or 0.4 to 0.6 μg (iron weight) of the MP per 4 μl of the LTR solution. In principle, narrower ranges are preferred. The most preferred ratios are MP to LTR iron w / w ratios of about 0.5 μg of the MP per about 12 to 20 μg (preferably about 16 μg) of the LTR, and / or MP to LTR solution iron w / v ratios of about 0.5 μg of the MP per 4 μl of the LTR solution. In this context, the preferred MP is SO-Mag6-115MP (or more preferably MNP). The preferred LTR is DreamFect TM or more preferably DF-Gold TM C12-(2-3-2).

[0246] Furthermore, such specific ratios are those in which the MP to LTR to RNA iron w / w / w ratio ranges from 0.05 to 5 μg, 0.05 to 3 μg, 0.05 to 1 μg, 0.07 to 5 μg, 0.1 to 5 μg, 0.1 to 1 μg, 0.2 to 0.8 μg, 0.3 to 0.7 μg, or 0.4 to 0.6 μg (weight of iron) of said MP: 1 to 40 μg, 5 to 35 μg, 10 to 30 μg, 15 to 25 μg, 17 to 23 μg, 18 to 22 μg, 19 to 21 μg, 1 to 20 μg, 2 to 20 μg. or 7 to 9 μg of said LTR: 0.1 to 10 μg, 0.1 to 7 μg, 0.1 to 4 μg, 0.4 to 10 μg, 0.7 to 10 μg, 0.7 to 4 μg, 0.8 to 3 μg, 0.9 to 2 μg, 0.5 to 1.5 μg or 0.7 to 1.3 μg of said RNA. Likewise, in particular, if the LTR is prepared as an LTR solution (e.g., in the accompanying Examples), these ratios are MP to LTR solution to RNA with a w / v / w ratio of iron in the range of 0.05 to 5 μg, 0.05 to 3 μg, 0.05 to 1 μg, 0.07 to 5 μg, 0.1 to 5 μg, 0.1 to 1 μg, 0.2 to 0.8 μg, 0.3 to 0.7 μg, or 0.4 to 0.6 μg (weight of iron) of said MP: 0.4 to 40 μg. In some embodiments, the present invention relates to a method for preparing an LTR solution containing 0.1 to 10 μg, 0.1 to 7 μg, 0.1 to 4 μg, 0.4 to 10 μg, 0.7 to 10 μg, 0.7 to 4 μg, 0.8 to 3 μg, 0.9 to 2 μg, 0.5 to 1.5 μg or 0.7 to 1.3 μg of the RNA. In principle, narrower ranges are preferred. The most preferred ratios are an MP to LTR to RNA iron w / w / w ratio of about 0.5 μg of MP: about 12 to 20 μg (preferably about 16 μg) of LTR: about 1 μg of RNA and / or an MP to LTR solution to RNA iron w / v / w ratio of about 0.5 μg of MP: about 4 μl of LTR solution: about 1 μg of RNA. Mutually, what was stated above regarding preferred LTRs, RNAs, and / or MPs also applies here.

[0247] The concentration of the LTR solution employed in accordance with the present invention can range from about 0.1 to 10, 0.5 to 8, 1 to 7, 2 to 6, 3 to 5, or 1 to 2 μg LTR / μl (narrower ranges are preferred). Non-limiting examples of specific concentrations are about 0.5, 1, 1.5, 2, 3, 4, 5, 6, 7, or 8 μg LTR / μl. 2 or 4 μg LTR / μl are preferred.

[0248] The formation of the complex employed in the context of the present invention can be carried out at an RNA concentration of, for example, about 50 μg / ml to about 350 μg / ml, preferably about 100 μg / ml to about 300 μg / ml, more preferably about 150 μg / ml to about 250 μg / ml, and most preferably about 200 μg / ml.

[0249] In order to obtain stable and sufficient expression of proteins encoded by RNA, it is important that enough RNA arrives at the desired cells. This and therefore the transfection efficiency can be measured in the following manner: after administering the labeled RNA, the RNA content arriving at the cells is measured by measuring the label. Flow cytometry can be used to measure the label. When labeling is achieved with a fluorescent molecule, the transfection efficiency can be calculated, for example as the percentage of the cell population, wherein the fluorescence intensity is higher compared to the control cells treated only with PBS. The RNA employed according to the present invention can be effectively produced, and the transfection efficiency is higher.

[0250] Translation efficiency specifies the efficiency with which RNA is translated into protein. The higher the translation efficiency, the lower the dosage of the RNA that must be used for treatment. Translation efficiency can be determined by comparing the translation ratio of the RNA to be adopted with the translation ratio of the control RNA. In principle, the translation efficiency of the RNA to be adopted may be slightly lower. However, this can be overcompensated by the much higher stability that is shown in the duration of protein expression.

[0251] In principle, the administration scheme of the active compound / pharmaceutical composition of the present invention can be determined by the attending physician, for example, based on clinical factors. As known in the medical field, the dosage of any one patient depends on many factors, including the patient's stature, body weight, body surface area, age, the specific compound used, sex, administration time and route, general health status and other drugs that may be used simultaneously. However, technicians / attending physicians are prone to (a) inferring (treatment) effective concentration (one or more) and / or dosage with their position, for example, in vivo or in vitro. Corresponding samples can be obtained from, for example, bone (for example, by suitable probes), and active compound (BMP and / or suitable markers) can be detected, and its corresponding concentration can be measured in the sample, for example, by HPLC.

[0252] The determination of the concentration of the active compound can be obtained in human patients, healthy (human) individuals, and animals such as laboratory animals, non-human transgenic animals (e.g., transgenic mice, rats, pigs, etc.). It is envisioned that the determination of the concentration of the active compound in, for example, the bone can be derived, for example, in (healthy) volunteers, and a corresponding administration regimen for (human) patients can be established. For example, the dose dependency can be determined by standard methods known in the art (e.g., the dose administered versus the concentration / dose detected in various areas of the bone). Further methods include, but are not limited to, the detection of labeled peptides in vivo (e.g., by corresponding labeling techniques, such as radiolabeling, fluorescent labeling, etc.) or physiological / biochemical assays. Therefore, it can be inferred that the dose of the active compound to be administered in order to obtain the desired concentration of the active compound in a certain part of the bone. These and other methods for deriving these concentrations are also known in the art.

[0253] In particular, the skilled person can easily determine the appropriate dosage of RNA for transfection according to the invention (e.g. μg RNA per cell). Guidance is provided, for example, in Kormann (supra), Mays (supra), WO 02 / 00870 and the accompanying examples.

[0254] The dosage used in each case can depend on the function that the BMP RNA must meet. As mentioned above, the duration of action of the RNA can also be deliberately adjusted. The dosage and / or duration of treatment can also depend on the specific indication. For example, if RNA is used for the chronic treatment of bone diseases caused by defective BMP genes, the duration of action will be as long as possible, while for other indications, it can be deliberately adjusted to a suitable time window. Each dosage can be set accordingly.

[0255] However, as stated above, certain dosages have been found to be very useful in the context of the present invention, particularly because they result in highly effective and / or efficient transfection.

[0256] The range of such specific doses of RNA to be transfected is 0.5-100 pg, 0.5-70 pg, 0.5-40 pg, 5-100 pg, 10-100 pg, 1-50 pg, 5-40 pg, 10-30 or 15 to 25 pg RNA per cell (to be transfected). In principle, a narrower range is preferred. The most preferred dose is a dose of about 20 pg RNA per cell (to be transfected). If RNA is to be delivered (to cells or tissues) in vitro or in vitro, the above (range) doses are particularly useful.

[0257] In one aspect, the pharmaceutical compositions of the present invention comprise a matrix or scaffold; which is also referred to elsewhere herein and in the art as a "carrier." It is specifically contemplated that the RNA to be used has been added to the carrier or has been loaded into / onto the carrier according to this aspect. More specifically, it is contemplated that the pharmaceutical compositions of the present invention comprise a combination of a carrier and a complex as described herein, the complex containing the RNA to be used, which likewise can be added to or has been loaded into / onto the carrier. In other words, it is contemplated that the RNA is loaded into / onto the carrier or has been added to the carrier in the form of the complex. Mutual modifications are applicable here to what is described elsewhere herein with respect to the complex and the RNA.

[0258] In the context of the present invention, a vector is an object or substance that can be contacted with cells or tissues to be transformed / transfected in vivo, in vitro or in vitro. It is envisioned that the vector carries the RNA used according to the present invention and is optionally inoculated with cells to be transformed / transfected. It is specifically envisioned that the RNA is therefore contained in a complex as described herein. The vectors used according to the present invention are known in the art and are described, for example, in WO 01 / 00708 and [10-12]. In addition to RNA, compounds such as small molecules and / or cytokines can also be loaded into / onto the vector. For example, this can enhance the migration of cells to be inoculated (entering the vector) and / or improve transfection efficacy.

[0259] The carrier can be a material connected in a coherent manner, i.e. a solid substance, particularly preferably a plastic or a deformable solid substance, such as a gel, sponge, foil, powder, granules or fascia. The carrier can consist of a non-bioabsorbable or preferably bioresorbable material.

[0260] The carrier can also be a carrier produced by cross-linking the (co)polymer according to the present invention, preferably in the presence of RNA. Thus, for example, there is the possibility of introducing unchemically modified or chemically modified known gene carriers (naked) RNA, positive liposomes, complexes (polyplexes), etc. into the cross-linked polymer according to the present invention. For this purpose, by adding a cross-linking-initiating agent to an aqueous solvent or an organic solvent, for example, in situ cross-linking is performed in the presence of gene carriers, oligonucleotides, etc. The nature of the cross-linking agent depends on the structure of the copolymer. Thus, for example, the polymer backbone (e.g., as described in WO01 / 00708) Figure 2(shown in ) can be cross-linked by adding dithiols such as cyteinyl-cysteine ​​or non-amino acid dithiols. Cross-linking of (co)polymers containing carboxylic acids can be carried out by adding any diamine during the activation of the carboxylic acid (e.g., in situ reaction of the carboxylic acid with the activated ester) (Nathan et al., Macromolecules 25 (1992), 4476-4484). Polymer backbones containing primary or secondary amines can be cross-linked, for example, by adding activated dicarboxylic acids. After cross-linking, the product can be dried until a film is formed.

[0261] An example of a non-bioresorbable material is silicon (e.g., for catheters). However, various non-bioresorbable materials can also be used that can be introduced into the body as implants and / or are already used, for example, in plastic surgery. Examples include PTFE (e.g., for vascular replacements), polyurethane (e.g., for catheters), and metallic materials (e.g., pharmaceutical steels and titanium alloys for endoprostheses; metal meshes used as vascular supports (stents).

[0262] Preferably, the carrier is a bioresorbable material. Examples thereof are fibrin glue or fibrin clot (e.g., produced by thrombin or fibrinogen), chitin, oxidized cellulose, gelatin, polyethylene glycol carbonate, aliphatic polyesters, such as polylactic acid, polyglycolic acid, and amino acid compounds derived therefrom, such as polyamides and polyurethanes or polyethers and corresponding mixed polymers. In addition, any other biodegradable polymer can be used as a carrier, particularly the so-called self-curing adhesive based on hydrogels. In particular, any material that can be enzymatically degraded in vivo and / or by a hydrolysis process is suitable as a bioresorbable material. Examples thereof are also bioresorbable chemically defined calcium sulfate, tricalcium phosphate, hydroxyapatite, polyanhydrides, and carriers made from purified proteins or partially purified extracellular matrix. Carrier collagen is particularly preferred, particularly preferably, a collagen matrix produced from cartilage and skin collagen, such as those sold by Sigma or Collagen Corporation. For example, examples of producing collagen matrices are described in U.S. Patents 4,394,370 and 4,975,527. The carrier may be fibrin, in particular a fibrin clot.

[0263] The carrier is very preferably derived from collagen, and particularly preferably a collagen sponge. Collagen sponges are known in the art (e.g. WO 01 / 00708 and Lee, Biomaterials 32, 2011, 744-752; Meinel, Biomaterials 27, 2006, 4993-5002; Kempen, Biomaterials 30, 2009, 2816-2825) and can be used, for example, as "KOLLAGENresorb TM Purchased from Resorba (Nürenburg, Germany).

[0264] Typically, negatively charged polysaccharides such as glycosaminoglycans are bound to collagen via ionic interactions. Binding can occur on the positively charged amino acids (lysine, hydroxylysine and arginine) in the collagen fibrils or even by divalent cations such as calcium-mediated negatively charged amino acids. In addition, the ion binding properties of collagen can be purposefully affected by the pretreatment of acid or alkaline solutions and subsequent freeze drying. By these techniques known in collagen chemistry, it is possible to soak the collagen material using a suspension of RNA according to the present invention (e.g., with complex as described herein) to produce ionic binding between the collagen and RNA and RNA complex as carrier materials employed according to the present invention.

[0265] In collagen, positively charged amino acids are not concentrated in the short cationic part. However, this structural feature of the carrier is useful for the effective combination of RNA. In order to achieve a tighter combination with the carrier material, it is possible to further use cationic substances such as peptides (Plank et al., Human Gene Therapy 10 (1999), 319-333) or polyethyleneimine (PEI) derivatization that bind to RNA. For this purpose, collagen sponges are modified, for example, with difunctional coupling agents succinimidyl-pyridyl-dithiopropionate (SPDP). Polyethyleneimine utilizes iminothiocyclopentane (iminothiolane) derivatization, which results in the introduction of thiol groups. Cationic peptides to be coupled carry cysteine ​​at the C-terminus. The thiol groups react with the collagen sponge derivatized by forming a disulfide bond with SPDP. The sponge derivatives obtained in this way should be tightly bound to RNA, and the release of expected RNA is delayed for a long time to occur.

[0266] To produce a matrix / scaffold, i.e., a carrier, loaded with RNA for use according to the invention, for example, a dry (collagen) material can be incubated with the RNA / (polymer) complex, e.g., in a lyoprotectant solution of about 5%, preferably about 2%, glucose. The loaded carrier, e.g., a sponge, can then be freeze-dried and / or vacuum-dried.

[0267] Typically, the RNA-loaded vector according to the present invention can be produced by contacting the corresponding vector with RNA, in particular contained in the complex described herein, so that the vector absorbs the RNA or the respective complex, or binds to it in such a way that it can be released again, preferably in a delayed manner. Corresponding methods are known to those skilled in the art (Bonadio et al. (1999), Nat. Med. 5(7): 753-759; Shea, LD et al. (1999), Nat. Biotechnol. 17(6): 551-554). For example, the production of a combination of a collagen sponge or fibrin clot and an RNA / LTR complex as a carrier is described herein.

[0268] In principle, the RNA employed according to the present invention may be delivered / administered by any suitable route or means of delivery / administration.

[0269] The RNA used according to the present invention can be administered in a manner known per se to patients who need proteins or protein fragments encoded by the RNA, for example because they suffer from diseases caused by defective genes. For this reason, the RNA can be formulated into pharmaceutical preparations with common pharmaceutically acceptable additives. The form of the preparation depends on the location and nature of administration. Because, in one aspect, the RNA used according to the present invention is characterized by particularly high stability, it can be formulated in many ways, depending on the location and form of its use. For example, the RNA can be freeze-dried, processed in this form, for example crushed or ground and stored, and then reconstituted when needed and retaining its biological activity.

[0270] In one aspect, the pharmaceutical composition of the invention (or the RNA contained therein) will be delivered / administered via gene therapy or be prepared for gene therapy. In particular, gene therapy is envisioned as transcript therapy, more specifically, transcript replacement therapy.

[0271] For example, when RNA is loaded onto a vector (e.g., in the form of a complex), the RNA can be delivered / administered in vivo or ex vivo. Suitable delivery / administration routes or modes are known in the art and are described, for example, in Mitragotri (Nat Rev Drug Discov 13(9)(2014), 55-72), Tavernier G (supra) and Yin (Nat Rev Genet 15(8)(2014), 541-55). For example, RNA, for example, when loaded onto a vector (e.g., in the form of a complex), can be transferred into cells in vitro, in vivo, and ex vivo, preferably into cells of higher eukaryotes, preferably cells of vertebrates, particularly mammals. According to the present invention, it has been demonstrated that the means and methods provided are particularly useful in the context of in vivo and ex vivo delivery / administration methods.

[0272] In one aspect, the RNA can be delivered / administered in vivo. According to this aspect, the RNA (or a pharmaceutical composition comprising it) can be prepared for in vivo delivery / administration and / or the RNA will be delivered / administered in vivo.

[0273] For in vivo applications, for example, the following are possible: for example, when RNA is loaded onto a carrier (e.g., in the form of a complex), the RNA is introduced directly as an implant, such as in the form of a sponge or clot, or as a coating, such as in joint replacements or as an endoprosthesis (e.g., to improve tissue integration). Furthermore, it is possible to process the coating material in powder form, which can be purposefully introduced and fixed in the organism using conventional tissue glue systems (e.g., fibrin glue) and made available in the form of a reservoir (transfection).

[0274] Specifically, it is envisioned that RNA is delivered / administered into the tissue of the patient or in its immediate vicinity, particularly the tissue of expectation induction bone growth, bone regeneration, bone formation, osteogenesis, ossification etc. This type of tissue can, for example, be bone tissue itself. Therefore, RNA can be directly delivered / administered into the patient's bone or bone tissue. For example, RNA can be directly applied into bone defect or in its immediate vicinity of bone defect. The tissue can also be other tissues, such as muscle tissue. In this case, ectopic bone formation can, for example, be induced by RNA. For these purposes, and other purposes of delivery / administration in vivo, the RNA of complex form as described herein can be added or loaded into matrix or support, i.e., carrier as described above (such as collagen / collagen sponge, fibrin / fibrin clot, titanium membrane, heparin-chitosan matrix, hydroxyapatite). Specifically envision, this occurs before implantation. However, RNA can also be delivered / administered without matrix or support. In principle, the (direct) application of RNA to treat (prevent or cure) bone diseases (e.g., bone defects or fractures) can follow the same procedures as those described for the (direct) administration of recombinant proteins such as recombinant hBMP-2 and recombinant hBMP-7 (see, e.g., Katanec, Coll Antropol 38(1)(2014), 325-30; Cicciù, Open Dent J 6(2012), 51-5; Docherty Skogh, Plast Reconstr Surg 123(6)(2009), 192e-3e; Baltzer, Orthop Rev (Pavia) 4(1)(2012), e4; Heliotis M, Int J Oral Maxillofac Surg 35(3)(2006), 265-9; van den Bergh JP, J Clin Periodontol 27(9)(2000), 627-36). RNA can also be added to bone cement or bone filling materials. In this case, a paste-like product can be produced. This can be further applied to bone defects. In principle, RNA can also be injected directly into the bone, for example without a matrix or scaffold. However, direct injection with a matrix or scaffold is also possible in principle.

[0275] On the other hand, RNA can be delivered / administered in vitro. According to this aspect, RNA (or a pharmaceutical composition comprising it) can be prepared for delivery / administration in vitro, and / or will be delivered / administered in vitro. For example, RNA can be delivered / administered in vitro to enter the cell (e.g., osteocyte) to be introduced into the patient, i.e., cell can be introduced into the patient in the form of transfection (gene modification). In a specific embodiment, RNA is delivered / administered in vitro to enter the cell (e.g., osteocyte) of the patient and the cell having delivered / administered the RNA is reintroduced into the patient, i.e., the same patient, i.e., cell can be reintroduced into the patient in the form of transfection (gene modification). Therefore, a preferred embodiment is that cells are just derived from the patient to be treated.

[0276] The cells to be (re)introduced into the patient may be any cells suitable for this purpose. The cells may, for example, be osteoprogenitor cells. They may be mesenchymal stem cells (MSCs), such as muscle-derived mesenchymal stem cells (MMSCs), or preferably adipose-derived mesenchymal stem cells (AMSCs) or bone marrow-derived MSCs (BMSCs).

[0277] In a more specific embodiment of ex vivo delivery / administration, the RNA (or a pharmaceutical composition comprising the same) can be prepared for delivery / administration via an autologous tissue graft, and / or will be delivered / administered via an autologous tissue graft. Specifically, it is envisioned that, according to the means and methods described herein, the autologous tissue graft, particularly the cells contained therein, are transfected and therefore genetically modified, i.e., one or more BMPs described herein are expressed as a result of ex vivo delivery / administration of the RNA according to the present invention (or a pharmaceutical composition comprising the same). More specifically, it is envisioned that the autologous tissue graft, particularly the cells contained therein, are transfected or will be transfected according to the present invention, i.e., by one or more BMP RNAs described herein and respective transfection means and methods. With necessary modifications, what is described herein elsewhere regarding these means and methods also applies here.

[0278] The autologous tissue grafts adopted according to the present invention may comprise progenitor cells. Specifically envisioned to comprise osteoprogenitor cells. The autologous tissue grafts may comprise muscle cells or adipocytes (such as AMSCs). The autologous tissue grafts may comprise skeletal cells, such as osteoblasts, osteoclasts and / or osteocytes. In specific aspects, the autologous tissue graft is bone-tissue pulp or comprises bone-tissue pulp. The bone-tissue pulp may comprise any (bone) cell defined herein, in particular any (bone) cell that will be or has been transfected according to the present invention, i.e., will be or has been genetically modified according to the present invention to express a BMP as defined herein.

[0279] In principle, suitable means and methods for ex vivo delivery / transfection of BMP RNA are known in the art and are also apparent from the accompanying examples. However, in the context of one embodiment of the present invention, it is envisaged that BMP RNA will be delivered in Opti-MEM medium (Gibco TM , Invitrogen, CA, USA). As described above, excellent delivery / transfection efficiency has been achieved using this delivery / transfection medium.

[0280] Also for the purpose of ex vivo delivery / administration, RNA, for example in the form of a complex, can be incorporated into or loaded onto a matrix or scaffold, i.e., a carrier as described above (e.g., collagen / collagen sponge, fibrin / fibrin clot, titanium membrane, heparin-chitosan matrix, hydroxyapatite).

[0281] In this context, it is specifically envisaged that the vector / vector body is preloaded with RNA or preferably RNA complexes in a first step, optionally dried (e.g. vacuum and / or freeze-dried), and as a second step, seeded with cells to be delivered / administered (e.g. transfected) with the RNA.

[0282] For drying purposes, a lyoprotectant (e.g., sucrose) can be added to the RNA / RNA complex at a suitable concentration (e.g., about 1% to about 6%, preferably about 2% to about 5%, or particularly about 5%, about 3%, or most preferably about 2%).

[0283] The RNA-loaded vectors can be monitored for transfection efficiency and / or cell survival (e.g., as described in the accompanying Examples). Vectors that perform poorly in this regard can be sorted out.

[0284] The carrier of RNA-load, particularly if it shows good performance, can be administered to the patient.In principle, the cell of RNA transfection in the context of in vitro purpose disclosed herein can be delivered / administered in the same manner as described above about the purpose in vivo with this paper, preferably with RNA loaded into its interior / on matrix / support and delivered / administered together.For example, it can be administered into the tissue of the patient or very close to the tissue of the patient, particularly expect to induce bone growth, bone regeneration, bone formation, osteogenesis, ossification etc. In addition, this tissue can be bone tissue itself, or it can be other tissues such as muscle tissue. In a specific aspect, it can directly be placed / implanted into the position of bone defect or beside bone defect.

[0285] The above-mentioned RNA-loaded vectors and their means and methods of delivery / administration and production are particularly useful in autologous tissue transplantation, in particular in the autologous tissue transplantation described herein. Mutual modifications, as described elsewhere herein in this regard also apply here. In particular, the vectors can be inoculated with respective progenitor cells such as osteoprogenitor cells, or skeletal cells such as osteoblasts, osteoclasts and / or osteocytes, MSCs such as MMSCs or AMSCs, etc.

[0286] RNA-loaded carriers as described herein are particularly useful for sustained and / or delayed RNA delivery, for example as depots for RNA delivery, particularly sustained and / or delayed RNA delivery, and as (sustained and / or delayed) RNA delivery systems, respectively. In principle, this is applicable to in vivo, in vitro and ex vivo delivery / administration, but in particular, is applicable to in vivo delivery / administration purposes as described herein.

[0287] The meaning of sustained / delayed delivery is known in the art and is used separately in the context of the present invention. For example, sustained / delayed RNA delivery can be RNA delivery, in particular delivery of a pharmaceutically active amount of RNA over a period of at least one day, two days, three days, four days, five days, six days, one week, two weeks, three weeks, one month, two months, three months, four months, five months or six months. In principle, longer periods are preferred.

[0288] Technicians can easily produce the carrier / carrier body of RNA-loaded that is suitable according to the present invention.For this purpose, technicians can rely on respective means and methods known in the art (Chevally, Medical and Biological Engineering and Computing 38,2000,211-218) and the means and methods described in this article and the accompanying examples.For example, those skilled in the art can apply the above-mentioned method steps.For example, when the carrier of RNA-loaded is to be produced for the purpose of in vivo delivery / administration described herein, the cell inoculation step (and the step that may be associated therewith) can be omitted.The present invention further relates to respective means and methods for producing the carrier of RNA-loaded.

[0289] For example, the amount of RNA according to the present invention or the RNA loaded on the carrier / carrier body can be in the range of about 0.1 μg to about 10 μg per carrier / carrier body, preferably about 0.5 μg to about 8 μg, preferably about 1 μg to about 6 μg, preferably about 1.5 μg to about 5 μg, and most preferably about 2 to about 3.5 μg. The amount of cells seeded into / on the carrier / carrier body can be, for example, about 5,000 to about 50,000 per carrier / carrier body, preferably about 7,500 to about 40,000, preferably about 10,000 to about 30,000. Specific examples are about 10,000, about 20,000, and about 30,000 per carrier body.

[0290] As a non-limiting example, the above values ​​are particularly applicable to a carrier body as exemplified in the context of the present invention (i.e. having a diameter of 5 to 7 mm, a thickness of about 1 to 2 mm and a volume of roughly about 50 mm). 3 The carrier body used according to the invention can be, for example, a disk with a diameter of about 1 mm to several centimeters (e.g. about 5 cm diameter) and a thickness of about 2 mm to 2 cm, depending on, for example, the form and diameter of the bone fraction to be cured. This roughly estimates a volume of several mm 3 to cm 3 In principle, the shape of the carrier body (eg a disc) can be adapted, for example, to the shape of the bone fragment, or can be of an otherwise suitable shape. For example, it can be irregular instead of circular.

[0291] Typically, the carrier body (e.g. a (collagen) sponge) can be adapted to its specific use. For example, its shape can be adapted to the bone fragment, bone lesion, bone cavity (e.g. caused by a bone fragment, by a bone injury, by a (dental) cyst, etc.), bone injury, etc. to be treated. In one aspect, it is envisaged that the shape of the carrier body is adapted to the bone fragment / bone cavity. In other words, the carrier body can have the same shape as the bone fragment / bone cavity. In particular, it is envisaged that once the carrier body is implanted in or near the injured part of the bone (e.g. a bone fragment / bone injury), the carrier body together with the rest of the bone resembles the original shape of the bone.

[0292] Typically the carrier body may be compressible (e.g. a (collagen) sponge). Thus, the initial shape of the carrier body may be slightly enlarged compared to the bone fragment, bone cavity etc. to be treated, but may be squeezed into the bone fragment, bone cavity etc. to resemble the original shape of the bone after implantation.

[0293] For these aspects, the carrier body can be, for example, a collagen sponge or a fibrin clot (e.g., as described herein). The skilled person / attending physician can easily vary values ​​such as the amount of RNA and / or cells to be loaded into / onto a certain carrier body.

[0294] In a further embodiment, the RNA is provided in a delayed release polymer, for example as a carrier for an implant coating. For this purpose, the RNA can be used as such or as an RNA protected, for example, with a coating polymer and / or polymer complex.

[0295] In addition, implant is the further selection of using RNA.On the surface of respective implant, there can be the coating of the delayed release polymer comprising the RNA of coding BMP (one or more), for example, as the beneficial factor (one or more) for implant ingrowth.According to the present invention, it is envisioned that the coating comprising (m) RNA of only a kind of factor (BMP) of coding and the coating comprising (m) RNA of several factors (BMP) of coding are provided.Various factors (BMP) can also be provided so that they are released in the form of staggered intervals.

[0296] The expression "RNA encoding one or more factors (BMP)" should be understood to mean both: an RNA sequence encoding more than one protein - in the singular or as a fusion protein - and a mixture of different RNA sequences encoding different (BMP) proteins, wherein each RNA sequence encodes one protein.

[0297] The (m)RNA used according to the present invention can be advantageously used to promote the ingrowth of the implanted prosthesis. If available on the surface of the prosthesis to be inserted, such as a dental implant, a hip prosthesis, a knee prosthesis or a vertebral fusion, the (m)RNA used according to the present invention can release BMP (one or more), which can promote the ingrowth and other functions required for the newly inserted prosthesis. Therefore, for example, under the background of or after the implantation of a prosthesis, bioactive substances such as growth factors such as BMP-2 or BMP-7 can be applied according to the present invention. In this embodiment, the RNA encoding BMP (one or more) used according to the present invention can be applied to the implant in the form of a coating that releases RNA (in a measurable manner), and then gradually released therefrom (in a measurable manner), such as so that the cells near the implant can continuously or intermittently produce and release the desired factor if necessary. Systemic administration of (m)RNA is also possible. There may be such a situation that the (m)RNA translation in cells not affected by the gene defect is undesirable, such as due to the generation of undesirable side effects. In order to selectively translate (m)RNA only in cells that need the encoded protein, for example, in cells with a gene defect, the corresponding vector can be supplemented with sequences that can treat the affected tissue, for example, via a ligand. In a further embodiment, sequences that bind to endogenous microRNAs, which are not expressed in target cells, can be added to the vector containing the (m)RNA, so that the (m)RNA is degraded in all cells containing the relevant endogenous microRNAs, while they remain in the target cells. Thus, side effects can be minimized.

[0298] When RNA is administered systemically, it is generally formulated into an injectable liquid with conventional additives such as agents for adjusting tonicity and stabilizers, preferably as a unit dosage form. As stabilizers, commonly known ones are used, such as lipids, polymers, and nanosystems or liposomes. In a preferred embodiment, a composition suitable for parenteral administration is provided.

[0299] Common carriers are generally biocompatible—i.e., pharmaceutically acceptable—synthetic, natural, or mixed natural-synthetic polymers, whose release characteristics can be specifically tailored and therefore will not be described in detail here. For example, polylactide or polylactide / glycolide polymers are used. In this way, for example, it is possible to selectively release a desired factor, either continuously or intermittently, over a longer or shorter period of time and at a desired location.

[0300] The RNA used according to the present invention can specifically provide high stability, which leads to long-term protein expression. For example, when RNA is intended to be used to treat or prevent bone diseases caused by gene defects, the longer it is retained in the cell, the more valuable it may be. The faster the RNA degrades, the faster the protein expression ends, and in some cases, RNA must be administered more frequently. On the contrary, using RNA that remains stable in cells for a long time can greatly reduce the frequency of administration. It has been found that the RNA (particularly cmRNA) used according to the present invention stably expresses up to 4 weeks. Therefore, very long-acting RNA can be used if necessary. Therefore, RNA expression that can last up to 4 weeks is ideally suitable for treating chronic bone diseases. Respective RNA only needs to be given a few times (for example, every 4 weeks) or even only once.

[0301] In this context, a single treatment with BMP RNA is provided herein that is sufficient to provide a thorough and even complete treatment (or prevention) of a bone-related disease, disorder, or injury. Thus, in a specific embodiment, a pharmaceutical composition of the present invention is prepared for a single administration / treatment and / or will be administered only once / as a single treatment. According to this specific embodiment, a subsequent second administration / treatment (or even further subsequent administration / treatment) is not required.

[0302] For other embodiments, for example when RNA is intended only for transient expression, the duration of protein expression can be regulated by affecting stability. A further valuable property of the RNA to be employed is that the duration of action can be selectively regulated via stability, such that the duration of protein expression can be adjusted so that it occurs in a desired time window (see above).

[0303] The stability of the mRNA used according to the present invention can be measured by methods known per se. Particularly suitable is a method for measuring the survival of cells containing the RNA compared to cells without the RNA. The generation of encoded proteins (BMPs) over time can also be monitored. Here, the stability of RNA is understood to refer to when RNA has been introduced into cells, and the RNA that can express the desired protein or can be translated into the protein or its functional fragment can be expressed over a long period of time, will not immediately degrade and will not be inactivated.

[0304] Therefore, the method for testing the stability and survival time of RNA in cells is to determine how long the protein encoded by RNA can be detected in cells or perform its function. The method for it is described in the embodiments. Therefore, for example, (m) RNA with a sequence encoding a reporter molecule can optionally be introduced into cells together with the RNA encoding the desired protein, and after a predetermined period of time, the reporter molecule and optionally the presence of the encoded protein can then be determined. Suitable reporter molecules are well known in the prior art, and conventional reporter molecules can also be used here. In a preferred embodiment, RFP--red fluorescent protein--is used as a reporter molecule.

[0305] The pharmaceutical compositions of the present invention are administered to a patient, preferably a human patient / human. However, the bone diseases (and related conditions) described herein can also be treated or prevented in non-human animal subjects / patients, such as pets (e.g., dogs, cats, rabbits, rats, and mice), livestock (e.g., cows, pigs, sheep), horses or ponies, or birds (e.g., chickens, turkeys, parrots).

[0306] Any pharmaceutical composition of the present invention can be provided together with instruction manual or single-page instruction manual.Instruction manual / single-page can include how technician / attending physician is according to treatment or prevention disease or disorder (bone disease) of the present invention.Specifically, instruction manual / single-page can include respectively respectively about delivery as herein described / mode of administration and delivery / administration scheme guidance (such as delivery / route of administration, dosage regimen, delivery / administration time, delivery / administration frequency).Specifically, instruction manual / single-page can include preparation pharmaceutical composition for single administration / treatment and / or will only once / as the explanation of single treatment administration.Instruction manual / single-page can further include not needing the explanation of subsequent second administration / treatment (or even further follow-up administration / treatment).In principle, herein other places respectively about delivery / mode of administration and delivery / administration scheme, such as about in vitro or in vivo delivery / administration, the ratio of MP, LTR and / or RNA and dosage described, can be included in instruction manual / single-page as respective explanation.

[0307] The present invention further relates to BMP (cm) RNA as described and defined herein. Mutual modifications, what has been said elsewhere in this document regarding BMP and RNA also applies here.

[0308] A non-limiting but preferred example of a (cm)BMP RNA of the present invention is an RNA having a sequence encoding a BMP (e.g., BMP-2 or BMP-7) or a functional fragment of a BMP, wherein 5 to 50%, 7.5 to 30%, 15 to 25 or preferably about 25% of the cytidines of the RNA are chemically modified cytidines (e.g., 5-methylcytidine; m5C) and / or 5 to 50%, 7.5 to 30%, 15 to 25 or preferably about 25% of the uridines of the RNA are chemically modified uridines (e.g., 2-thiouridine; s2U).

[0309] On the one hand, the present invention relates to a pharmaceutical composition, in particular a pharmaceutical composition as described herein, comprising a BMP-encoding RNA, in particular the above-mentioned BMP-encoding RNA, preferably in the form of a complex as described herein, more preferably, in the form of an RNA-loaded vector as described herein.

[0310] The present invention also relates to complexes as described and defined herein, i.e., complexes comprising (cm)RNA as described herein or complexes thereof. In particular, the present invention relates to transfection complexes as described and defined herein (e.g., lipofection, magnetofection, and magnetic lipofection complexes). In principle, with necessary modifications, what is described elsewhere herein regarding BMPs, RNAs, LTRs, MPs, and other essential components of the complex also applies here.

[0311] A non-limiting but preferred example of a complex of the present invention is an RNA comprising a sequence encoding a BMP (e.g., BMP-2 or BMP-7) or a functional fragment of a BMP or a complex thereof, wherein 5 to 50%, 7.5 to 30%, 15 to 25 or preferably about 25% of the cytidines of the RNA are chemically modified cytidines (e.g., 5-methylcytidine; m5C) and / or 5 to 50%, 7.5 to 30%, 15 to 25 or preferably about 25% of the uridines of the RNA are chemically modified uridines (e.g., 2-thiouridine; s2U). More specifically, such complexes may comprise one or more LTRs as described and defined herein (e.g., Lipofectamine 2000, Dogtor, DreamFect TM or preferably DF-Gold TM or C12-(2-3-2)) and / or MP (e.g. core-shell MP, iron oxide silica MP and / or (branched) PEI decorated MP, such as MP with SiOx / phosphonate-PEI coating (e.g. SO-Mag6-115 MP)). Even more specifically, MP, LTR and / or RNA can be included in this complex (or other complexes of the present invention) in the respective ratios as described above. In particular, these ratios can be:

[0312] The w / w ratio of LTR to RNA is about 8 μg or about 20 μg of said LTR per μg of said RNA,

[0313] The v / w ratio of the LTR solution to the RNA is about 2 μl or about 5 μl of the LTR solution per μg of the RNA,

[0314] The iron w / w ratio of MP to RNA is about 0.5 μg of said MP per μg of said RNA,

[0315] The MP to LTR iron w / w ratio is about 0.5 μg of said MP per about 12 to 20 μg (preferably about 16 μg) of said LTR,

[0316] The MP to LTR solution iron w / v ratio is about 0.5 μg of the MP per 4 μl of the LTR solution,

[0317] an iron w / w / w ratio as described elsewhere herein, for example an iron w / v / w ratio of about 0.5 μg of said MP: about 12 to 20 μg (preferably about 16 μg) of said LTR: about 1 μg of said RNA, and / or

[0318] The iron w / v / w ratio is as described elsewhere herein, for example, the iron w / v / w ratio is about 0.5 μg of the MP: about 4 μl of the LTR solution: about 1 μg of the RNA.

[0319] Such a complex (or other complexes of the invention) may further comprise one or more further lipids (e.g., "helper lipid(s)"). What was said above with respect to the further lipid(s) (e.g., "helper lipid(s)") also applies here, mutatis mutandis.

[0320] Likewise, the above-mentioned RNA or complex is intended to be used according to the means and methods of the present invention. In this case, the RNA or complex is intended to be included in a pharmaceutical composition of the present invention. The present invention also relates to a pharmaceutical composition comprising BMP (cm) RNA or a complex as described and defined herein.

[0321] BMP RNA and respective complexes can be easily prepared according to means and methods known in the art and according to the means and methods described in this article and the accompanying examples. For example, BMP RNA can be prepared by an in vitro transcription system and can therefore be an in vitro transcribed BMP RNA (IVT BMP RNA). In this case, for example, the method of producing the BMP RNA in vitro from a mixture of ATP, CTP, GTP and UTP is suitable. The materials required for performing this in vitro transcription are known to those skilled in the art and are commercially available, particularly buffers, enzymes and nucleotide mixtures. The nature of the DNA used to produce the RNA used according to the present invention is also not critical. Typically, it can be cloned DNA.

[0322] In another aspect, the present invention relates to a matrix or scaffold / carrier / carrier body as described herein, i.e. to a matrix / scaffold / carrier / carrier body loaded with the RNA employed according to the invention, e.g. in the form of a complex as described herein, and optionally further seeded with cells as described herein.

[0323] In another aspect, the present invention also relates to a pharmaceutical composition comprising the RNA-loaded matrix / scaffold / carrier / carrier body as defined herein.

[0324] The present invention also relates to the RNA-loaded vectors described herein as ready-to-use biological products, in particular for use in bone regeneration and / or the bone diseases described herein.

[0325] The present invention further relates to the use of a matrix / scaffold / carrier / carrier body, pharmaceutical composition or biologic formulated for sustained and / or delayed delivery and as a sustained delivery system / depot, respectively.

[0326] The invention is further described by reference to the following non-limiting figures and examples.

[0327] The attached pictures are as follows:

[0328] Figure 1 The integrity and size of the modified mRNA were determined using native agarose gel electrophoresis. cmRNA and high-range RiboRuler RNA alignments (ladder) were mixed with RiboRuler formamide containing a loading dye and incubated at 70°C for 10 minutes. Subsequently, the sample was cooled on ice and applied to an agarose gel. Detection was performed by ethidium bromide staining and visualization on an Intas gel imaging system.

[0329] Figure 2(A) Kinetics of MetLuc cmRNA complexes formed using Lipofectamine 2000 (LF), Dogtor, DF-Gold, or bPEI as enhancers at a cmRNA dose of 20 pg / cell and (B) cell survival 5 and 24 hours after transfection. Significant differences between untransfected controls (100% cell survival) and transfected cells are indicated with (*). (C) Comparison of the time curves of reporter gene expression in AMSCs after transfection with DF-Gold positive liposomes encoding pDNA or cmRNA for MetLuc. Area under the curve for "pDNA" and "cmRNA," AUC pDNA and AUC cmRDNA , calculated by integrating the data between time points 0 and 120 hours. Significant differences between pDNA and cmRNA data are indicated with (*).

[0330] Figure 3 Expression of Tomato, eGFP and MetLuc reporter genes in AMSC and BMSC after transfection with DF-Gold / cmRNA positive liposomes and DF-Gold / SO-Mag6-115 / cmRNA magnetic triplet. The cmRNA dose applied was 20pg / cell. Fluorescence microscope images of cells were taken 24 hours after transfection with the following complexes: (A) tomato N1 cmRNA and (B) eGFP cmRNA. The scale bar represents 250μm. (C) FACS results of the percentage of cells expressing eGFP 24 hours after transfection with eGFP cmRNA complex. Between untransfected and lipofected (*) or magnetically transfected cells (**) and between lipofected and magnetically transfected (D) shows the time course of Daphnia pulex luciferase expression in two cell types transfected with MetLuc cmRNA complexes. The significant differences between magnetofection and lipofection of AMSCs and BMSCs are indicated by (*) and (**), respectively. To calculate MAI, the area under the “magnetofection” curve AUC was calculated for both BMSCs and AMSCs. MF Normalized to the area under the “lipofection” curve AUC LF .

[0331] Figure 4At different time points after DF-Gold / cmRNA positive liposomes and DF-Gold / SO-Mag6-115 / cmRNA magnetic triplet transfection, hBMP-2 is produced in AMSC. The hBMP-2 produced is normalized to the hBMP-2cmRNA dose (20pg / cell) applied. (A) The influence of the culture medium (osteoblastic culture medium vs. Opti-MEM) used during transfection on the content of the secreted hBMP-2 measured in the supernatant; (*) indicates the significant difference between the comparison groups. (B) The content of endogenous hBMP-2 (cmRNA (-)) and hBMP-2 (cmRNA (+)) produced by transfected cells measured in the supernatant (secreted hBMP-2) and in the cell lysate (intracellular hBMP-2) on the 1st, 2nd and 3rd day after transfection. (*) shows the significant difference of the hBMP-2 secreted between untreated cells and transfected cells. (**) indicates a significant difference between hBMP-2 secreted by transfected cells and intracellular hBMP-2 at a given observation time. (#) indicates a significant difference in hBMP-2 secretion between lipofection and magnetofection. (C) Time course of total (secreted + intracellular) hBMP-2 content in transfected cells. To calculate MAI = 6.0, the area under the curve (AUC) was calculated after subtracting the "untreated cells" curve, which shows the level of endogenous hBMP-2. ref Then, the area under the “magnetic transfection” curve AUC MF Normalized to the area under the “lipofection” curve AUC LF .

[0332] Figure 5 Alkaline phosphatase (ALP) activity of cells transfected with DF-Gold / cmRNA positive liposomes. (A) ALP staining 12 days after transfection. (B) ALP activity 3, 7 and 12 days after transfection. (*) indicates significant differences between untransfected and transfected cells and (**) indicates significant differences between 3 and 12 days after transfection. Under the cmRNA dosage of 20pg / cell applied, after lipofection and magnetofection of AMSCs with hBMP-2cmRNA complex, the expression of bone-related genes increases. 3, 7, 14 and 21 days after transfection, the expression of (C) RunX2, (D) Osx, (E) ALP, (F) Coll I, (G) OPN and (H) OCN increases exponentially. The gray bar represents the lipofection of the DF-Gold / cmRNA complex, and the dotted line symbolizes the magnetofection of the SO-Mag6-115 / DF-Gold / cmRNA triplet. (*) indicates significant difference between lipofection and magnetofection groups at the same observation time. (**) indicates significant difference between lipofection and magnetofection groups at different observation times after transfection. significant difference in time.

[0333] Figure 6 Mineralization of AMSCs after lipofection and magnetofection. Alizarin red staining 21 days after transfection: (A) untransfected cells, (B) magnetofected cells, and (C) lipofected cells. (D) Quantification of Alizarin red staining 14 and 21 days after transfection. Significant differences between untransfected and transfected cells are indicated by (*), and Comparisons between differently transfected cells are indicated.

[0334] Figure 7 3mm fat discs were transfected with DF-Gold / cmRNA positive liposomes at a v / w ratio of 4 enhancers to cmRNA and a dose of 5μg hBMP-2- or tomato N1-cmRNA / disc. (A) Fluorescence microscopy images of fat discs were taken 24 hours after transfection with tomato N1 cmRNA complexes. The scale bar represents 500μm. Bone-related gene expression was induced after fat disc transfection with DF-Gold / hBMP-2cmRNA complexes. (B) The expression of hBMP-2, (C) RunX2, (D) ALP, and (E) Coll I increased exponentially. Total RNA was extracted and RT-PCR was performed 3 and 7 days after transfection. Expression is reported as a doubling induction compared to the untransfected control. All values ​​are normalized to β-tubulin. (*) Indicates significant differences between 3 and 7 days after transfection for ALP and ColI expression.

[0335] Figure 8 hBMP-7 production in AMSCs at different time points after transfection with DF-Gold / cmRNA positive liposomes and DF-Gold / SO-Mag6-115 / cmRNA magnetic triplets. The hBMP-7 produced was normalized to the hBMP-7 cmRNA dose applied (20 and 32 pg / cell).

[0336] Figure 9 Mineralization of AMSCs following lipofection with DF-Gold / hBMP-7 cmRNA-positive liposomes and magnetofection with SO-Mag6-115 / DF-Gold / hBMP-7 cmRNA triplet. The cmRNA doses used were 20 and 32 pg / cell. Alizarin red staining 21 days after transfection: (A) untransfected cells, (B-C) lipofected cells, and (C-D) magnetofected cells.

[0337] Figure 10MetLuc expression at different time points after transfection of AMSCs with DF-Gold / MetLuc mRNA positive liposomes. The v / w ratio of DF-Gold to mRNA was tested in the range of 0.5 to 5 μl of DF-Gold to μg mRNA at applied mRNA doses of 2.5, 5, 10, and 20 pg / cell.

[0338] Figure 11 MetLuc expression at different time points after transfection of BMSCs with DF-Gold / MetLuc mRNA positive liposomes. The v / w ratio of DF-Gold to mRNA was tested in the range of 0.5 to 5 μl of DF-Gold to μg mRNA at applied mRNA doses of 2.5, 5, 10, and 20 pg / cell.

[0339] Figure 12 Flow cytometry histograms of (A) AMSCs and (B) BMSCs 24 hours after transfection with DF-Gold / eGFP mRNA positive liposomes at a v / w ratio of DF-Gold to mRNA of 4 (lipofection) and DF-Gold / SO-Mag6-115 / eGFP mRNA magnetic triplets at a w / w ratio of Fe to mRNA of 0.5 (magnetofection).

[0340] Figure 13 BMP-2 RNA grafted onto bone implant material – μ-CT results – whole bone. μ-CT 3D reconstructions and longitudinal sections obtained for all groups after 2 weeks of treatment. (A) Fibrin, (B) C12-(2-3-2) / FFL cmRNA, and (C) C12-(2-3-2) / hBMP-2 cmRNA. Areas of callus formation were highlighted by setting the same threshold (2500-4500) in ImageJ software for all samples. (D) Quantification of callus formation by ImageJ.

[0341] Figure 14 Complex loading and cell seeding on collagen sponge. (A) Scanning electron microscopy of vacuum-dried collagen sponges without and with LucSNIM RNA-positive liposomes (average hydrodynamic diameter of positive liposomes: 65.8 nm). (B) Fluorescence microscopy of NIH3T3 cells 30 hours after seeding on collagen sponges loaded with tdTomato mRNA, 10% of which was FITC-labeled. (C) Hematoxylin staining of NIH3T3 cells 7 days after seeding on collagen sponges. Cell nuclei were stained dark blue with hematoxylin. The scale bar shows 100 μm. The left edge of the above figure represents the surface of the collagen sponge.

[0342] FIG15 Transfection efficacy and cell survival 48 hours after seeding NIH3T3 cells on collagen sponges loaded with eGFP mRNA-complexes. (A) Fluorescence microscopy at 4× magnification (JULY TM (A) Expression of eGFP mRNA in NIH3T3 cells. (B) FACS analysis: A significant shift in mean fluorescence intensity in NIH3T3 cells transfected with 100 pg / cell eGFP mRNA compared to untransfected cells. (C) FACS analysis: Correlation between mRNA dose and transfection efficiency. (D) and (E) FACS analysis of PI staining and WST assay, respectively, demonstrated approximately 60-70% cell viability. All data are presented as the mean ± SD of three replicates.

[0343] Figure 16 Expression kinetics of Daphnia pulex luciferase mRNA in 2D vs. 3D cultures of NIH3T3 cells. Supernatants were collected every 24 hours after transfection and Met-luc expression was measured immediately. All data are presented as mean ± SD of three replicates. The Y axis is a logarithmic scale.

[0344] Figure 17 Kinetics of Daphnia cerevisiae luciferase expression in collagen sponges using MSCs at different cell densities. The amount of mRNA-positive liposomes used in this experiment was 50 pg / cell. Supernatants were collected every 24 hours after transfection and stored at -20°C. After 8 days, Daphnia cerevisiae luciferase expression was measured at all time points. Data are shown as mean ± SD of three replicates. The Y-axis is a logarithmic scale.

[0345] Figure 18 Immunohistochemical analysis of in vivo bone regeneration. (A) Mineralized bone tissue staining. The red rectangle indicates the location of the sponge placed in the femoral defect. The black area indicates highly mineralized tissue. (B) Callus formation in the periosteal region. (C) Proportion of fibrous tissue formation. (D) Proportion of osteoid formation. Values ​​were compared using a T-test (n = 9).

[0346] Figure 19 hBMP2 expression by MSCs seeded on hBMP2 mRNA-loaded collagen sponges. Three different doses were tested. Data are shown as mean ± SD of three replicates.

[0347] Figure 20 In vitro osteodifferentiation. RT-qPCR results: Fold increase in expression of osteoblast markers 7 and 14 days after seeding cells on hBMP2 cmRNA-loaded collagen sponges. Values ​​are mean ± SD of three replicates. (A) MC3T3-E1 cells: Values ​​are normalized to GAPDH expression. In 3D, data are expressed as fold increase relative to untransfected cells. (B) MSCs: Values ​​are normalized to β-tubulin expression. In 2D, data are expressed as fold increase relative to untransfected cells and compared using multiple t-tests.

[0348] FIG21 shows in vivo bone regeneration. (A) μ-CT image of a rat femur 2 weeks after implantation. The red portion represents newly formed bone. (B) μ-CT analysis assessing the area of ​​bone formation 2 weeks after implantation. Values ​​were compared using a t-test (n=9).

[0349] Figure 22 Stability of mRNA-positive liposomes on vacuum-dried collagen sponges. MetLuc mRNA-loaded collagen sponges were vacuum-dried for 2 hours, then vacuum-sealed and maintained at room temperature. At various time points after vacuum drying, the plates were opened and NIH3T3 cells were seeded on the sponges. 24 hours after cell seeding, MetLuc expression was measured. All data are presented as mean ± SD of three replicates. The Y-axis is logarithmic.

[0350] Figure 23 SEM images of collagen sponges before and after vacuum drying. Scale bar indicates 200 μm.

[0351] Figure 24 Kinetics of Metluc expression in NIH3T3 cells grown on collagen sponges after transfection with SNIM Metluc or unmodified Metluc mRNA. Supernatants were collected every 24 hours after transfection and stored at -20°C. After 10 days, luciferase expression in Daphnia pulex was measured at all time points. Data shown are mean ± SD of three replicates. The Y-axis is logarithmic.

[0352] Figure 25 Effect of vacuum drying of the sponge on the expression dynamics of Metluc in NIH3T3 cells grown on collagen sponges. Supernatants were collected every 24 hours after transfection and stored at -20°C. Five days later, luciferase expression in Daphnia pulex was measured at all time points. Data shown are the mean ± SD of three replicates. The Y-axis is logarithmic.

[0353] Figure 26FACS analysis: The positive (CD90 and CD29) and negative (CD45, CD106 and CD31) markers of MSCs after isolation from rat adipose tissue were studied. IgM, K-FITC, IgG1, K-FITC and IgG1, K-PE have been used as controls.

[0354] Figure 27 During differentiation, the macroscopic changes are the morphology of the sponge. Pictures were taken from 96-well plates 7 days after seeding MSCs on the sponge.

[0355] Figure 28 In vivo osteogenesis of collagen sponges loaded with hBMP2 cmRNA-positive liposomes in different parts of the bone. Values ​​were compared using T-test.

[0356] Figure 29 μ-CT: Effects of hBMP2 cmRNA-loaded collagen sponge on bone regeneration in vivo two weeks after surgery. The yellow part represents newly formed bone.

[0357] Figure 30 (A) is loaded with an implant of hBMP-2 encoding cmRNA in rat femoral medulla, and the mineralization of the tissue is significantly increased. (B) As a result of implanting a collagen sponge loaded with hBMP-2 encoding cmRNA, periosteal (periostal) tissue formation is significantly increased. (C) After being treated with a collagen sponge loaded with hBMP-2 cmRNA, fibrous tissue / total volume (Fb.V / TV) is significantly increased. (D) After being treated with a collagen sponge loaded with hBMP-2 cmRNA, osteoid formation / total volume (OV / TV) increases. (E) As a result of implanting a collagen sponge loaded with hBMP-2 cmRNA, less bone resorption is opposed.

[0358] Throughout this specification, numerous documents, including patent applications, are cited. The disclosures of these documents, while not considered relevant to the patentability of the present invention, are nevertheless incorporated herein by reference in their entirety. More specifically, all referenced documents are incorporated by reference to the same extent as if each individual document were specifically and individually indicated to be incorporated by reference.

[0359] The present invention will now be described with reference to the following examples, which are illustrative only and are not to be construed as limiting the scope of the invention.

[0360] Example 1

[0361] Materials and Methods (particularly relevant to Examples 1 to 7).

[0362] Materials. Dulbecco's modified Eagle's medium (DMEM), Dulbecco's phosphate-buffered saline (DPBS) without calcium and magnesium, fetal bovine serum (FBS), penicillin / streptomycin (P / S), and accutase solution were purchased from PAA Laboratories GmbH (Pasching, Austria). Opti-MEM medium and type II collagenase were obtained from Gibco. TM (Invitrogen, CA, USA). Ficoll-Paque TM Purchased from GE Healthcare Ltd. (CT, USA). Tetraethyl orthosilicate (TEOS), 3-(trihydroxysilyl)propylmethylphosphonate (THPMP), and branched polyethyleneimine (bPEI) were obtained from Sigma-Aldrich (MO, USA). All other reagents and materials were obtained from Sigma-Aldrich unless otherwise stated. Magnetoresistive transfection experiments were performed using a 24-well magnetic plate (OzBiosciences, Marseille, France).

[0363] Animals. Female Sprague-Dawley rats (250-300 g) were purchased from Charles River Laboratories (Sulzfeld, Germany) and used for adipose and bone marrow mesenchymal stem cell isolation. Immediately prior to tissue collection, animals were euthanized by carbon dioxide asphyxiation. The procedures used were approved by the local ethics committee and performed in accordance with the German Animal Protection Act.

[0364] Isolation and culture of rat-derived mesenchymal stem cells. Bone marrow mesenchymal stem cells (BMSCs) were isolated using the previously described protocol (Balmayor, Biores Open Access 2(5), 2013, 346-355). Briefly, the femur and tibia were cleared from all surrounding tissues, cut at both epiphyses, and incubated in sterile DMEM containing 2.5 mg / ml type II collagenase at 37°C and 5% CO2 for 2 h. Once the bone marrow was flushed out with complete DMEM (i.e., supplemented with 10% FBS and 1% P / S), the cells were pelleted and resuspended in fresh complete DMEM. Subsequently, Ficoll-Paque TM The mononuclear cell fraction was collected by density gradient centrifugation (500 g, 30 min), washed and resuspended in complete DMEM. Cells were centrifuged at 3000 cells / cm 2 After 24 hours of culture, the medium was changed to remove non-adherent cells.

[0365] In order to separate adipose mesenchymal stem cells (AMSC), the adipose tissue collected from the abdominal area was cut into small millimeter-sized pieces and transferred to a falcon tube containing sterile DPBS. After several washing steps with DPBS, the fat pieces were incubated in 0.5mg / ml type II collagenase solution at 37°C for 30 minutes. Next, complete DMEM culture medium was added to stop the collagenase action, and the mixture was centrifuged at 600g for 10 minutes. The cell pellet obtained was resuspended in complete DMEM culture medium and filtered through a 40μm cell strainer (BD Falcon, NJ, USA) and filtered at 3000 cells / cm 2 Plate inoculation.

[0366] Both BMSCs and AMSCs were expanded and cultured using complete DMEM at 37°C and 5% CO2. For transfection and differentiation experiments, cells up to passage 6 were used. During the culture period, the culture medium was changed every three days, and the cells were maintained at 37°C and 5% CO2. The isolated MSCs were characterized according to the protocol published by Balmayor (2013, supra).

[0367] Ex Vivo Human Adipose Tissue Culture. Fresh human subcutaneous adipose tissue was obtained from healthy patients undergoing reconstructive surgery with written informed consent and approval by the local ethics committee of the University Hospital “Klinikum rechts der Isar” of the Technical University of Munich, Germany.

[0368] Human adipose tissue was dissected out from the skin and blood vessels under sterile conditions. Subsequently, the tissue was carefully cut into slices of about 1 mm thick. Next, according to the protocol described by Evans (2009, supra), a skin biopsy punch (3 mm) was used to punch out uniform 3 mm × 1 mm circular explants. The resulting tissue explants were washed three times with sterile DPBS and placed in a culture dish of 35 mm diameter. Subsequently, they were cultured in complete DMEM at 37 ° C and 5% CO2 for up to 7 days. First, after 2 hours, and then every 24 hours of culture, the culture medium was replaced to ensure sufficient oxygenation conditions (Puri, J Lipid Res 48 (2), 2007, 465-471).

[0369] Synthesis of Iron Oxide Silica Magnetic Nanoparticles. Iron oxide silica core-shell magnetic nanoparticles were synthesized as previously described (Mykhaylyk, Liposomal magnetofection. In: Weissig V (ed.) Liposomes, Methods in Molecular Biology, vol. 605. Humana Press-Springer, New York 2010, 487-525; Mykhaylyk, Pharm Res 29(5), 2012, 1344-1365). First, Fe(II) / Fe(III) hydroxides were precipitated from an aqueous solution of iron salts and converted into magnetite "core" nanoparticles. Subsequently, the surface of the nanoparticles was stabilized by co-condensation of tetraethyl orthosilicate (TEOS) and 3-(trihydroxysilyl)propylmethylphosphonate (THPMP), resulting in a silica coating with surface phosphonic acid groups. Finally, an aqueous solution of 25-kD branched polyethyleneimine at pH 7.0 was applied at a PEI to iron w / w ratio of 11.5% to decorate the particle surface. The resulting magnetic nanoparticles with SiOx / phosphonate-PEI coating will be further referred to as SO-Mag6-115 MNPs or MNPs. The detailed physicochemical properties of these nanoparticles have been reported by Mykhaylyk (supra). Briefly, as measured by dynamic light scattering (DLS) using a Malvern Instruments Zetasizer Nano ZS (Herrenberg, Germany), when suspended in water, the particles had an average hydrated diameter Dh = 97 ± 14 (PDI = 0.32 ± 0.03) and a zeta potential ζ = +34.1 ± 2.7.

[0370] Chemically modified messenger RNA encoding MetLuc, eGFP, tomato, and human BMP-2 was generated. Plasmid vectors containing codon-optimized open reading frames of Daphnia pulex luciferase (Daphnia pulex) and human BMP-2 mRNA were synthesized and cloned into the BamHI-EcoRI sites of pVAXA120 by GeneArt (Life Technologies, CA, USA). NotI-HindIII was used to cut off eGFP from peGFP-N1 (Clontech, CA, USA) and cloned into the EcoRI-HindIII of pVAXA120 via semi-blunt ligation. The coding sequence of Tomato was cut off from ptd Tomato-N1 (Clonetech, CA, USA) with NotI-KpnI and connected into the EcoRI-KpnI sites of pVAXA120 via semi-blunt ligation. The vector pVAXA120 has been described previously (Kormann, Nat Biotechnol 29(2), 2011, 154-157) and was constructed by cloning a segment of 120A between the PstI-NotI sites of pVAX1 (Invitrogen, CA, USA).

[0371] To generate templates for in vitro transcription (IVT), the above plasmid DNA (pDNA) (i.e., pVAXA120-MetLuc, pVAXA120-eGFP, pVAXA120-Tomato, or pVAXA120-hBMP-2) was linearized by restriction enzyme digestion with NotI. The template pDNA was further purified by chloroform-ethanol precipitation. IVT was performed using RiboMAX TM Large-scale RNA production system-T7 (Promega, WI, USA) was used. To synthesize capped mRNA, an anti-reverse cap analog (ARCA, m 7,3’-O GpppG, Jena Biosciences, Jena, Germany) ensures that the cap is incorporated only in the desired orientation. To generate modified mRNA, 25% of cytidine-5'-triphosphate and uridine-5'-triphosphate were replaced with 5-methylcytidine-5'-triphosphate and 2-thiouridine-5'-triphosphate (Jena Biosciences, Jena, Germany). The resulting modified mRNA was purified by ammonium acetate precipitation. The integrity and size of the modified mRNA produced were confirmed by native agarose gel electrophoresis.

[0372] Formation and characterization of transfection complexes. Positive liposomes and complexes are always prepared freshly by mixing the selected lipid transfection reagent, such as Lipofectamine 2000 (Invitrogene, CA, USA), DreamFect Gold (DF-Gold) and Dogtor (OzBiosciences, Marseille, France) or bPEI with their respective cmRNA. The volume-to-weight ratio of the liposome transfection reagent to cmRNA was selected according to the manufacturer's instructions (i.e., 2 μl Lipofectamine 2000 or 4 μl DF-Gold or 4 μl Dogtor per μg mRNA). In the case of bPEI, a 10 mg / ml aqueous solution was prepared and the pH was adjusted to 7.0 before use. The complex was formed by mixing bPEI and cmRNA solution at N / P=8 and then incubating at room temperature for 20 minutes to allow the complex to assemble. To prepare magnetic positive liposomes, an equal volume of SO-Mag6-115 MNP aqueous suspension (0.1 μg Fe / μl) and DF-Gold diluent (80 μl DFGold was diluted with water to 100 μl). Subsequently, an equal volume of cmRNA diluent (0.2 μg / μl water or 150 mM NaCl or unsupplemented Opti-MEM) was added, mixed carefully, and the mixture was kept at room temperature for 20 minutes. The resulting ratio of the components in the SO-Mag6-115 / DF-Gold / cmRNA complex was 0.5: 4: 1 (iron weight / volume / weight). The average hydrodynamic diameter (Dh), polydispersity index (PDI) and zeta potential (ζ) of the complex were characterized using the DLS method (Table 1).

[0373] Transfection protocol in AMSCs and BMSCs. For transfection, AMSCs and BMSCs were plated at 1.25 × 10 4 cells / cm 2Cells were seeded in 24-well plates. After 24 hours of incubation, the cell culture medium was replaced with fresh, unsupplemented Opti-MEM. 100 μl of positive liposomes or bPEI-complexes containing 20 pg / cell cmRNA (i.e., MetLuc, eGFP, or tomato cmRNA) were prepared as described above and added to the cells. 5 hours after transfection, the culture medium was replaced with complete DMEM. The cells were further cultured under standard conditions for up to 10 days until results were evaluated. To further improve transfection efficacy, SO-Mag6-115 MNPs were associated with a lipid transfection reagent and cmRNA to form magnetic SO-Mag6-115 particles / DF-Gold / cmRNA positive liposomes, as described above, with an iron weight / volume / weight ratio of 0.5:4:1. For transfection, 100 μl of magnetic positive liposomes containing 20 pg / cell cmRNA (i.e., MetLuc, eGFP, or tomato cmRNA) were added to the AMSCs or BMSCs in culture, and a magnetic field was applied by placing the cell culture plate on a 24-well magnetic plate for 30 minutes. Next, the magnetic plate was removed and the transfection was allowed to continue. All transfections throughout the study were performed in triplicate. In order to quantitatively characterize the effect of magnetofection on transfection efficacy, the MAI was calculated as follows:

[0374]

[0375] AUC represents the area under the kinetic curve of target protein (MetLuc and hBMP-2) expression after magnetofection (MF) and lipofection (LF), respectively.

[0376] One of the aims of the study was to compare AMSCs and BMSCs in terms of transfection efficiency. Therefore, the volume-to-weight ratio of liposomal transfection reagent to mRNA used was chosen according to the manufacturer's instructions to be equal for both cell types. However, for both cell types, further optimization of the transfection protocol was performed using DF-Gold to cmRNA ratios of 0.5-5 μl transfection reagent / μg nucleic acid at doses of 2.5, 5, 10, and 20 pg / cell. Figures 10 to 12 and details in their respective instance sections.

[0377] Evaluation of luciferase activity in transfected cells. Luciferase catalyzes the oxidation of coelenterazine to produce coelenteramide, CO2, and light (λ max480 nm). Based on this reaction, coelenterazine can be used as a substrate for the detection of many secreted luciferases (Inouye, Protein Expr Purif 88 (1), 2013, 150-156). In this study, native coelenterazine (Synchem OHG, Felsberg, Germany) was used to determine MetLuc activity. Briefly, equal volumes of 50 μl of supernatant (collected from transfected cells at 5 hours, 1, 2, 3, 5, and 7 days after transfection) and coelenterazine solution (pH 7.0, 50 μM in degassed sodium phosphate buffer) were mixed in a white opaque 96-well plate. Luminescence intensity was measured in light units / unit time or relative light units (RLU) at room temperature using a PerkinElmer Wallac Victor 1420 multilabel counter (MA, USA). All samples were measured in triplicate. MetLuc activity was expressed in normalized relative light units calculated using the following equation:

[0378]

[0379] where RLU is the value obtained from the device, V1 corresponds to the volume of supernatant collected for measurement and V2 is the total supernatant volume in ml.

[0380] Enhanced green fluorescent protein (eGFP) positive cells. In order to evaluate the transfection efficiency with the percentage of eGFP positive cells, transfected cells with eGFP cmRNA were analyzed by flow cytometry. For this reason, 24 hours after transfection, the cells were washed twice with DPBS and separated by using 100 μl cell digestion solution / each well of a 24-well plate. Subsequently, the cell culture plate was centrifuged at 500 g for 10 minutes, and the cells were resuspended in DPBS (2% FBS). Flow cytometry analysis was performed on a MACSQuant analyzer (Miltenyi Biotech, Bergisch Gladbach, Germany), and at least 5,000 events were collected for each sample.

[0381] Enhanced green fluorescent protein (eGFP) and tomato expressing cells AMSCs and BMSCs transfected with eGFP and tomato cmRNA were imaged under a fluorescence microscope (Biorevo BZ9000, Keyence, Osaka, Japan) 24 hours after transfection.

[0382] Cytotoxicity screening of chemically modified mRNA complexes. Cytotoxicity screening was performed by transfecting AMSCs with different MetLuc cmRNA complexes and then analyzing cell respiration activity (survival) at 5 and 24 hours after transfection using a standard MTS assay performed in triplicate according to the manufacturer's instructions (CellTiter 96, Promega, WI, USA). For experimental details, see elsewhere herein.

[0383] BMP-2 by transfected cells produces. The above-mentioned lipofection and magnetofection scheme are used to deliver hBMP-2 cmRNA into AMSC. 20 or 32pg hBMP-2 cmRNA / cell is used for transfection. At the time point of definition, according to the manufacturer's instructions, by enzyme-linked immunosorbent assay (ELISA, Quantikine, R&D Systems, MN, USA), the level of secreted and cell-related human BMP-2 is measured in supernatant and cell lysate respectively. The absorbance at 450nm is measured in PerkinElmer Wallac Victor1420 multi-label counter (MA, USA). Wavelength correction is set at 570nm. The experiment is carried out in triplicate, and protein content is measured using a standard curve (scope: 0-4000pg / ml hBMP-2).

[0384] In addition, cells were transfected in the presence of osteogenic medium (i.e., 2% FBS, 10 mM β-glycerophosphate, 200 μM ascorbic acid). Osteogenic medium was prepared without dexamethasone. Therefore, in further experiments, relevant information related to the osteogenic capacity of cell-released hBMP-2 could be obtained.

[0385] hBMP-2 cmRNA is transfected into primary human tissue. Explant transfection was carried out according to the protocol previously described by Evans (2009, supra), with slight modifications. In brief, the washed human adipose tissue dish was placed in a 48-well plate and transfected with 5 μg hBMP-2 cmRNA or tomato cmRNA using DF-Gold positive liposomes (4 μl DF-Gold / 1 μg cmRNA). 80 μl suspension containing the complex was directly injected into the tissue dish. The plate was returned to the incubator for 1 hour. Then, 500 μl of fresh, unsupplemented Opti-MEM was added to each well of the explant containing the transfection, and the cells were incubated for another 5 hours. The culture medium was then changed to osteogenic culture medium, and the explants were further cultured for 3 days and 7 days as described above. All transfections of tissue explants were carried out on freshly collected tissue and under sterile conditions.

[0386] Adipose tissue discs transfected with tomato cmRNA were imaged under a fluorescence microscope (Biorevo BZ9000, Keyence, Osaka, Japan) 24 hours after transfection.

[0387] In vitro osteogenesis. Under osteogenic stimulation, hBMP-2 cmRNA transfected AMSCs were cultured to evaluate the ability of hBMP-2 cmRNA to induce in vitro osteogenesis. hBMP-2 cmRNA was transferred into cells using lipofection and magnetofection methods, as previously described. 5 hours after transfection, the culture medium was exchanged with an osteogenic culture medium that did not contain dexamethasone. The transfected cells were kept in osteogenic culture medium for up to 21 days, and the culture medium was partially replaced (i.e., half the volume was replaced with fresh osteogenic culture medium) every 3 days. Untransfected cells cultured under the same conditions were used as a control. After in vitro osteogenesis, the expression of bone-related genes and the occurrence of mineralization were evaluated.

[0388] Alkaline phosphatase (ALP) activity. Alkaline phosphatase activity was assessed on days 3, 7, and 12 after transfection. For this purpose, an alkaline phosphatase colorimetric assay (Abcam, Cambridge, UK) was used according to the manufacturer's instructions.

[0389] This assay is based on the use of p-nitrophenyl phosphate (pNPP) as a phosphatase substrate. pNPP is dephosphorylated in the presence of ALP. As a result, a yellow p-nitrophenol (pNP) compound is formed, which is characterized by a maximum absorbance at 405 nm. The ALP assay was performed based on the manufacturer's protocol. Briefly, transfected cells were washed twice with DPBS and then incubated with assay buffer at room temperature for 20 minutes. After good homogenization of the cell monolayer, the samples were centrifuged to remove insoluble matter. The pNPP solution was added to the sample and control sample and incubated at room temperature for 60 minutes and protected from light. As described above, pNP production was determined by measuring the absorbance at 405 nm using a multi-label counter. The pNP content value was calculated based on the standard curve. In all cases, evaluation was performed in triplicate.

[0390] In addition, ALP was stained in fixed cells by incubating with a staining mixture of Fast Blue B salt and naphthol AS-MX phosphate (Cox, J Histochem Cytochem 47(11), 1999, 1443-1456) at 37°C for 30 minutes. The staining solution was washed off with DPBS, and the cells were analyzed under a microscope. Areas stained purple were considered positive.

[0391] Quantitative real-time PCR. 3, 7, 14 and 21 days after hBMP-2 cmRNA transfection, cells were washed twice with DPBS and subsequently lysed with TRIzol (Life technology, CA, USA). Total RNA was isolated based on the phenol / chloroform method. RNA concentration and purity were determined spectrophotometrically using a photometric adaptor and a UV spectrophotometer (Eppendorf AG, Hamburg, Germany). According to the manufacturer's instructions, first-strand cDNA was reverse transcribed from total RNA using the First Strand cDNA Synthesis Kit (first-strand cDNA synthesis kit) (Thermo Scientific, MA, USA). The expression of bone-related genes was determined by real-time quantitative reverse transcription polymerase chain reaction (RT-PCR). Amplification primers are listed in Table 2. Using SsoFast Eva Green Supermix (Bio-Rad Laboratories Inc., CA, USA), and real-time PCR was performed on a Bio-Rad CFX96 thermal cycler (Bio-Rad Laboratories Inc., CA, USA).

[0392] In the case of transfected adipose tissue, total RNA was extracted 3 and 7 days after transfection. According to the manufacturer's protocol, the washed tissue was collected in RNAlater reagent (Qiagen GmbH, Hilden, Germany). Before RNA extraction, the tissue was homogenized in TRIzol using a handheld homogenizer (PT1200E Polytron, Kinematica GmbH, Eschbach, Germany). RNA extraction, cDNA synthesis and RT-PCR were performed using the same protocol as above-mentioned cells. The expression levels of hBMP-2, RunX2, ALP and Coll I were analyzed. Amplification primers are listed in Table 3.

[0393] In general, β-tubulin was chosen as a reference gene. Data are expressed as fold induction relative to controls, ie, untransfected cells and tissues, respectively.

[0394] Alizarin red staining and quantification. 14 days and 21 days after transfection, alizarin red staining was performed to evaluate the calcium deposits in cells transfected with hBMP2 cmRNA complex. These calcium deposits will be indicators of AMSC osteogenic differentiation. In brief, ethanol-fixed cells were incubated at room temperature for 15 minutes with alizarin red solution (5 mg / mL in DPBS). The stained cells were thoroughly washed to remove non-specific staining and / or possible precipitates. Mineralized nodules and calcium deposits were stained as red spots, indicating osteogenesis. Subsequently, 100 mM hexadecylpyridinium chloride was used. The Alizarin Red dye was extracted at room temperature for 3 hours. The absorbance was then measured at 570 nm. The experiment was performed in triplicate and the results were reported compared to untransfected control cells.

[0395] Statistical Analysis. All values ​​obtained are reported as mean ± standard deviation. Statistical analysis was performed using GraphPad Prism version 6.00 (GraphPad Software, CA, USA). The data were analyzed for normal distribution by applying the Shapiro-Wilk test. One-way ANOVA followed by Tukey's multiple comparison test was performed to analyze the expression of MetLuc in cells transfected with different transfection reagents ( Figure 2 A) and flow cytometry results ( Figure 3 C). In addition, when two independent samples were analyzed, a Student's t-test was used. All statistical analyses were performed according to the recommendations of the software used. A probability of P < 0.05 was considered significant. The area under the curve (AUC) value was calculated using Origin Pro 9G software (Microcal software; OriginLab Corp, MA, USA).

[0396] Production of chemically modified mRNA. cmRNA encoding eGFP, Tomato, MetLuc, and human BMP-2 was generated using a published protocol (Kormann, supra). The molecular size and mass of the generated cmRNA were analyzed by agarose gel electrophoresis ( Figure 1 All cmRNAs were of the expected size, and no degradation (no smearing) or extra byproducts (extra bands of unexpected sizes) were detected.

[0397] MTS assay. Cell monolayers were treated with 200 μl / well of MTS reagent solution (5:1 ratio in serum-free MEM without phenol red) and incubated for 3 hours under standard culture conditions with light protection. 100 μl of culture medium from each well was transferred into a 96-well plate, and the absorbance at 490 nm was measured in a PerkinElmer Wallac Victor 1420 multilabel counter (MA, USA). Latex rubber was used to induce cell death (positive control) (Balmayor, 2013, supra). Untreated cells were used as negative controls (i.e., 100% cell survival).

[0398] CmRNA formulations for in vivo testing.

[0399] C12-(2-3-2) / cmRNA lipid formulation. Cationic lipids (also referred to as "C12-(2-3-2)") were prepared by mixing 100 mg of N,N'-bis(2-aminoethyl)-1,3-propylenediamine (0.623 mmol) with 575.07 mg of 1,2-epoxydodecane (3.12 mmol, (N-1) equivalents, where N is 2× the amount of primary amine plus 1× the amount of secondary amine / oligo(alkyleneamine)) and mixing at 80°C with constant shaking for 96 hours. Lipid particles were formulated using the cationic lipid C12-(2-3-2), the helper lipids DOPE and cholesterol, and the PEG-lipid DMPE-PEG 2k at a molar ratio of 8:5.29:4.41:0.88. Briefly, appropriate volumes of each lipid stock solution were combined in absolute ethanol to achieve concentrations of 50, 20, 20, and 20 mg / ml, respectively. The final volume was adjusted to 200 μl. Liposome formation was achieved by rapid solvent exchange. Subsequently, 200 μl of the liposome mixture was mixed with 800 μl of cmRNA (i.e., hBMP-2 cmRNA or FFL cmRNA) in citrate buffer. The final cmRNA concentration was fixed at 200 μg / ml with an N / P ratio of 17. After incubation at room temperature for 30 minutes, the positive liposomes were dialyzed against water overnight.

[0400] In vivo testing of fibrin clots containing C12-(2-3-2) / cmRNA lipids. Fibrin clots containing C12-(2-3-2) / cmRNA complexes were prepared just before implantation. Therefore, C12-(2-3-2) / hBMP-2 cmRNA and C12-(2-3-2) / FFL cmRNA complexes, both containing 2.5 μg cmRNA, were independently mixed with 50 μl of fibrinogen (3000 KIU / mL, Tissucol, Baxter, Unterschleiβheim, Germany) and lyophilized. 30 minutes before the start of surgery, the fibrinogen-cmRNA powder was rehydrated with sterile water. After complete homogenization, fibrinogen-C12-(2-3-2) / cmRNA was mixed with 50 μl of thrombin (4 U / mL, Tissucol, Baxter, Unterschleiβheim, Germany) and allowed to clot for 2 minutes. As a control, fibrin clots were obtained following the same procedure as above in the complete absence of cmRNA.

[0401] Noncritical Size Defects: hBMP-2 cmRNA Application—For In Vivo Testing. Transcortical 3 mm noncritical size bone defects were generated under sterile conditions. Bone defects were created bilaterally in the mid-femoral diaphysis of 18 male Sprague-Dawley rats (Charles River Laboratories, Sulzfeld, Germany). Rats weighing between 650 and 750 g were randomly divided into three groups (n = 6 per group): fibrin (control group); fibrin + 2.5 μg FFL cmRNA; and fibrin + 2.5 μg hBMP-2 cmRNA.

[0402] Anesthesia was induced by intramuscular injection of a mixture of 110 mg / kg ketamine (Ketanest S, 25 mg / ml, Pfizer, Karlsruhe, Germany) and 12 mg / kg xylazine (Rompun, 20 mg / ml, Bayer, Leverkusen, Germany). A 3 mm drill hole was created in the middle of the femoral shaft and flushed with 0.9% sodium chloride solution (B-Braun, Melsungen, Germany). Depending on the group, the defect was filled with 100 μl of fibrin clot created just before implantation. Therefore, the clot was transferred from the eppendorf tube using forceps and placed in the bone defect to ensure complete closure.

[0403] Rats received carprofen (rimadyl, Pfizer, Karlsruhe, Germany) (4 mg / kg) once daily for four days as analgesic treatment.

[0404] Two weeks after the operation, rats were killed under general anesthesia by intracardial injection of an overdose of pentobarbital (120 mg / kg, Eutha77, EssexPharma, Hamburg, Germany). Femurs were harvested and stored in formalin solution (neutral buffer, 10%, Sigma-Aldrich, MO, USA) for 24 hours. Subsequently, samples were transferred to 80% ethanol until further processing.

[0405] Microcomputed tomography (μCT) analysis—for in vivo testing. All explanted femora were subjected to microcomputed tomography analysis (μCT) (μCT 40; Scanco Medical AG, Bassersdorf, Switzerland). The settings used for the measurements are described below. The increment was set to 157 μm and the angle was 0°. The voxel size of the images was set to 8000 μm and the total number of slices was 665. Therefore, each sample was studied at a total interval of 5.32 mm in the longitudinal direction. The integration time of the beam was set to a maximum of 300 ms, and three data sets were detected for each measuring point (the average of which was used for subsequent calculations). The μCT device was calibrated once a week using a hydroxyapatite phantom.

[0406] The mineralized bone and trabecular callus structures were analyzed using the software ImageJ (National Institutes of Health, MD, USA) by means of a 3D segmentation algorithm. The μCT dataset was transferred to a 3D layer defined by a plug-in called KHK_microCT, provided by Professor Karl Heinz Kunzelmann (Department of Operative / Restorative Dentistry, Ludwig-Maximilians-University of Munich, Germany). In order to separate the density levels of mineralized bone and callus, a grayscale threshold was introduced and set between values ​​of 2500-4500 for the two density intervals studied. Another threshold called The plugin was then used for 3D imaging and quantification of callus structure. The only numerical value considered was the bone volume (BV), which was used to compare the amount of newly formed callus for each sample. This amount was automatically converted to metric values ​​by the KHK_microCT plugin mentioned above. Detailed 3D images of the callus structure were obtained using a built-in plugin called "3D Viewer."

[0407] Example 2. Optimization of the ratio of DF-Gold to mRNA transfected in AMSCs and BMSCs.

[0408] To further optimize the transfection protocol for AMSCs and BMSCs using mRNA-positive liposomes containing DF-Gold, different parameters were considered. The v / w ratio of DF-Gold to mRNA was studied from 0.5 to 5 μl enhancer / μg nucleic acid at doses of 2.5, 5, 10, and 20 pg / cell. The results are shown in Figure 10 and 11For both cell types, a dose of 20 pg mRNA / cell was found to be optimal. Additionally, 5 μl DF-Gold / μg mRNA in AMSCs and 2 μl DF-Gold / μg mRNA in BMSCs were found to be the optimal amount of enhancer used.

[0409] Example 3. Efficient delivery of cmRNA to stem cells by lipofection and magnetofection.

[0410] First, the efficiency of different reagents for transfecting adipose-derived stem cells (AMSCs) with cmRNA was investigated. Figure 2 A shows the expression kinetics of Daphnia pulex luciferase up to 120 hours after transfection. For all tested reagents, maximum expression was achieved 24 hours after transfection. bPEI was the least efficient of all reagents, and no significant expression was observed with bPEI for any measured time point (p>0.05). The different lipid-based reagents differed in the resulting MetLuc expression kinetics. Although the highest expression was observed after 24 hours with Lipofectamine 2000 (p<0.0001), its lifespan was the shortest at 48 hours or later, with low MetLuc activity. On the other hand, DreamFect Gold (DF-Gold) and Dogtor, although less efficient than Lipofectamine 2000 at the 24-hour time point, maintained MetLuc expression for up to 120 hours. In addition to transfection efficiency, the cytotoxicity of different transfection reagents in AMSCs was also tested. In the case of Lipofectamine 2000, MetLuc cmRNA complexes were the most toxic, with cell survival falling to less than 75% within 5 hours ( Figure 2 B). DF-Gold and bPEI complexes produced mild cytotoxicity at both measured time points, with over 80% cell survival. At 24 hours post-transfection, there was no statistically significant difference in cell survival between DF-Gold transfected cells and untransfected controls (p=0.06).

[0411] Based on the desired characteristics of longer transgene expression (up to 120 hours after transfection) and low cytotoxicity, DF-Gold was selected to transfect mesenchymal stem cells (AMSC and BMSC) with cmRNA. The dose of cmRNA per cell was optimized for both cell types. The results showed that 20pg / cell was the optimal dose for transfection. Data are available at Figure 10 and 11The v / w ratio of DF-Gold to cmRNA was fixed at 4 (manufacturer's instructions) to allow for a more accurate comparison between AMSCs and BMSCs. However, this ratio was also improved for both cell types. The results showed that the v / w ratio of AMSCs was 5 and the v / w ratio of BMSCs was 2 ( Figure 10 and Figure 11 ).

[0412] Since plasmid DNA (pDNA) is a commonly used non-viral vector for gene transfer, MetLuc expression was compared after transfection with MetLuc cmRNA or its plasmid counterpart (pVAXA120-MetLuc). Although the target protein appeared to be expressed at a higher level 24 hours after pDNA lipofection of the cells, cmRNA expression in this case remained at a higher level starting from 48 hours until the end of the observation period of 120 hours, compared to the sharply decreased pDNA. Without being bound by theory, the sustained expression may be evidence of better mRNA protection from degradation and an indication of cmRNA stabilization, for example due to the respective positive liposomes used according to the invention (e.g. DF-Gold). TM / cmRNA).

[0413] The efficacy of target protein expression after lipofection of pDNA and cmRNA encoding MetLuc was compared ( Figure 2 C). 24 hours after transfection, the transfection efficiency of pDNA-transfected AMSCs was almost twice as high (p = 0.005). However, between 48 hours and 120 hours after transfection, MetLuc expression levels were significantly higher for cells transfected with cmRNA (p = 0.0002) and remained significantly higher up to 120 hours after transfection (p = 0.007). The area under the curve for "pDNA" and "cmRNA", AUC pDNA =1.71·10 8 (normalized RLU·h) and AUC cmRDNA =1.68·10 8 (normalized RLU·h), calculated by integrating the data between the 0 and 120 h time points, showed that cmRNA delivery can result in a “bioavailability” of the target protein similar to that achieved following pDNA delivery.

[0414] In order to further increase the efficiency of cmRNA transfection, magnetic transfection was used. For this purpose, PEI-decorated iron oxide core-silica shell magnetic nanoparticles (i.e., SO-Mag6-115) were used. The SO-Mag6-115 nanoparticles are characterized by a hydrodynamic diameter of approximately 96 ± 14 nm and a high positive zeta potential of 34 ± 3 mV. The magnetic nanoparticles appear visually stable in aqueous suspension. No precipitation was observed in water, 150 mM NaCl, or cell culture medium. In addition, the nanoparticles have a clear response to an externally applied magnetic field.

[0415] In magnetofection experiments, BMSCs were transfected and compared side-by-side with AMSCs. Compared to lipofection, magnetofection resulted in a significant increase in transfection efficiency for both cell types ( Figure 3 ). 24 hours after transfection, flow cytometric analysis of eGFP-transfected cells revealed 59.7% (AMSC) and 73.2% (BMSC) positive cells ( Figure 3 C). In contrast, only 37.5% (AMSC) and 38.9% (BMSC) of cells were positive for eGFP when lipofected (i.e., DF-Gold was used as the transfection reagent). Representative histograms are shown. Figure 12 This flow cytometry data is consistent with the data from fluorescence microscopy and MetLuc assay ( Figure 3 A, B and D). Figure 3 A clearly shows that a higher percentage of transfected BMSCs expressed tomato protein when tomato cmRNA was transferred into the cells using magnetofection. A similar pattern was observed after delivery of cmRNA encoding eGFP. Figure 3 Fluorescence micrographs of AMSCs and BMSCs expressing eGFP are shown in B. Similarly, AMSCs and BMSCs transfected by magnetofection with MetLuc cmRNA were Figure 3 D shows significantly increased expression of MetLuc for both 24 hours after transfection (p<0.0001).

[0416] A significantly more pronounced effect of magnetofection on BMSCs was obtained. Figure 3 Shown in D. A 4.4-fold and 2.4-fold increase in MetLuc activity (MAI) was determined for BMSC and AMSC, respectively. These data provide evidence that protein expression is significantly enhanced in both MSC types when magnetofection is used.

[0417] Example 4. Enhanced secretion of hBMP-2 by transfected stem cells.

[0418] Due to the importance of osteogenic conditions in the upcoming experiments, transfection of hBMP-2 cmRNA was performed in Opti-MEM medium as well as in the presence of osteogenic medium. Interestingly, performing transfection in Opti-MEM and further changing to osteogenic medium after 5 h did not seem to impair transfection efficiency ( Figure 4 A) Significantly lower hBMP-2 expression was observed when transfection was performed in the presence of osteogenic medium (p<0.05). Figure 4 B shows the quantitative secreted and cell-associated hBMP-2 content in cell lysates and supernatants of transfected cells at different time points after transfection. Significantly higher hBMP-2 levels were detected in samples from transfected cells compared to untransfected controls (p<0.001). Maximum hBMP-2 expression was observed 48 hours after transfection. After 48 hours, the intracellular levels of hBMP2 were significantly reduced (p=0.007). Despite the higher intracellular levels of hBMP-2, transfected AMSCs secreted significantly higher levels of hBMP-2 up to 7 days after transfection ( Figure 4 B and C) (p = 0.0008). Figure 4 B and C show the levels of hBMP-2 in samples from magnetofected cells. Total cell production of hBMP-2 was approximately 700 pg / μg cmRNA ( Figure 4 C). This represents a 6-fold increase (MAI) compared to the hBMP-2 levels obtained after lipofection ( Figure 4 C). The higher levels of hBMP-2 observed using magnetofection were associated with the expression of the eGFP reporter gene ( Figure 3 B. Figure 12 )、MetLuc( Figure 3 D) and Tomato( Figure 3 The higher transfection efficiency and expression observed in cmRNA of A) are consistent. It is worth mentioning that the intracellular level of hBMP-2 in transfected cells was also significantly increased by magnetofection (p<0.0003). Figure 4 In B, it can be seen that 24 hours after transfection, the intracellular amount of hBMP-2 is almost identical to the secreted hBMP-2 (p = 0.8). After this time point, the transfected cells were able to secrete significantly higher amounts of hBMP-2 compared to the levels quantified in cell lysates (p < 0.001).

[0419] Example 5. hBMP-2 cmRNA delivery induces osteogenesis in vitro in AMSCs.

[0420] As a first indication of in vitro osteogenesis, alkaline phosphatase (ALP) activity was measured in hBMP-2 transfected AMSCs. 12 days after hBMP-2 cmRNA transfer, increased ALP expression in transfected cells could be determined ( Figure 5 A and B). Quantification of ALP activity showed that a significant increase was observed as early as 7 days for transfected cells compared to the control group, and this increase persisted until day 12 ( Figure 5 B, p<0.01).

[0421] Subsequently, the expression of osteogenesis-related genes was quantified by real-time PCR at different time points ( Figure 5 (C) For both the lipofection and magnetofection groups, the expression of RunX2, Osterix, ALP, Coll I, osteopontin, and osteocalcin increased over time compared to the untransfected group. Interestingly, 14 days after transfection, RunX2, ALP, and OPN showed significantly higher expression in the magnetofection group when compared to the lipofection group. In particular, in the case of OPN, magnetofection resulted in continued high expression after 14 days. On the other hand, for the magnetofection group, a decrease in RunX2 expression was only observed after 14 days.

[0422] Alizarin red staining ( Figure 6 B and C) showed that the number of calcified nodules in the transfected group was significantly higher than that in the untransfected cells ( Figure 6 A). In addition, after lipofection, at a lower hBMP-2 cmRNA dose (i.e., 20 pg / cell, Figure 6 C), the staining is significantly more intense. This corresponds to the optimized dose obtained by titration experiments with MetLuc cmRNA ( Figure 10 At a higher dose of 32 pg / cell, mineralization was significantly poorer (Figure C, right). However, it became stronger when magnetofection was used for cmRNA transfer ( Figure 6 B) Quantitative analysis of Alizarin Red staining confirmed those results. Figure 6 D shows that when positive liposomes were used, the lower dose group (20 pg / cell) had significantly higher mineralization (p < 0.0001) compared to the higher dose (32 pg / cell). For cells transfected with 20 pg hBMP-2 cmRNA, mineralization increased with culture time. By using magnetofection, significantly higher mineralization was detected for the higher dose group (p = 0.04, 14 days; p = 0.007, 21 days, Figure 6 D) Furthermore, this was clearly noted as early as 14 days after transfection.

[0423] Example 6. Transfection of human adipose tissue induces gene expression in vitro.

[0424] Human adipose tissue was transfected with DF-Gold / Tomato N1 cmRNA or DF-Gold / hBMP-2 cmRNA complexes. Figure 7 As shown in A, a large number of cells in the fat discs became Tomato N1 positive after transfection. For hBMP-2 transfected discs, RT-PCR revealed that hBMP-2 expression increased more than 4-fold compared to untreated explants ( Figure 7 B) In addition, increased expression of bone-related genes such as RunX2, Osterix, and Coll I was clearly observed in transfected tissues cultured under osteogenic conditions compared to the control group. In the case of ALP and Coll I, their expression increased significantly from 3 to 7 days after transfection (p < 0.001).

[0425] Example 7. BMP-2 cmRNA approximately doubles bone formation in vivo within two weeks.

[0426] Figure 13 Figures AC show μCT 3D reconstructions and longitudinal cross-sections of all study groups after 2 weeks of treatment. Signs of new bone formation can be observed in the μCT cross-sections of the C12-(2-3-2) / hBMP-2 cmRNA group. In contrast, no signs of new bone formation were observed in the fibrin or C12-(2-3-2) / FFL cmRNA groups. This model was used to determine the role of hBMP-2 cmRNA in spontaneous bone healing. Figure 13 D shows a quantitative analysis of the amount of callus formation for all groups. This μCT data shows that compared to the control group, callus formation was significantly increased after 2 weeks in animals treated with fibrin containing C12-(2-3-2) / hBMP-2 cmRNA (p < 0.05). No significant differences were found between the fibrin and fibrin containing C12-(2-3-2) / FFL cmRNA groups. No significant callus formation was observed in these groups.

[0427] The μCT results obtained demonstrated the therapeutic effect of hBMP-2 cmRNA on bone healing. In animals treated with hBMP-2 cmRNA, stimulation of bone formation in vivo was clearly observed. In contrast, no bone formation was observed in animals treated with nonspecific cmRNA (i.e., FFL cmRNA). This suggests that hBMP-2 cmRNA mediates the therapeutic expression of hBMP-2 at the site of the bone defect, causing bone formation to occur.

[0428] Further Materials and Methods (especially relevant to Examples 8 to 14).

[0429] Materials. Dulbecco's modified Eagle's medium (DMEM), α-minimum essential medium (α-MEM), calcium- and magnesium-free Dulbecco's phosphate-buffered saline (DPBS), fetal bovine serum (FBS), penicillin / streptomycin (P / S), 0.05% trypsin-EDTA, and collagenase types I and II were purchased from Gibco, Life Technologies GmbH (Darmstadt, Germany).

[0430] The auxiliary lipids including 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC) and cholesterol were supplied by AvantiPolar Lipids INC, (AL, USA). Other materials required for complex preparation, such as ethanol and 1,2-dimyristoyl-sn-glycerol, methoxypolyethylene glycol (DMG-PEG) 2kD, were purchased from Carl Roth (Karlsruhe, Germany) and Nof America Corporation (NY, USA), respectively. The trade name is "KOLLAGEN resorb TM The collagen sponge was provided by Resorba (Nürenburg, Germany). All other reagents and materials were obtained from Sigma-Aldrich unless otherwise stated.

[0431] Complex preparation. The cationic lipid C12-(2-3-2) (supplied by ethris GmbH and also referred to as "C12EPE") has been used as a non-viral transfection reagent, along with DPPC and cholesterol as helper lipids and DMG-PEG2k as the PEGylated lipid.

[0432] RNA complexes were formed at an RNA concentration of 200 μg / ml and an N / P ratio of 8 (which represents the molar ratio of lipid amino groups to RNA phosphate groups). Using an insulin syringe, the self-assembly of the complex was induced by rapidly injecting an acetic acid solution of the lipid phase into the aqueous phase containing cmRNA, followed by vortexing at high speed for 15 seconds and incubating at room temperature for 30 minutes. The synthesized positive liposomes were dialyzed against double distilled water using a dialysis cassette with a molecular weight cutoff of 7 kDa (Pierce, USA), with a single water exchange after 30 minutes, and then dialyzed overnight.

[0433] Particle size and zeta potential measurements. The particle size of positive liposomes was measured by laser light scattering using a Zetasizer (Malvern Instruments, Worcester, UK). 750 μl of the complex was filled into a clean disposable cuvette and a total of 30 and 300 runs were performed, respectively, for particle fractionation and surface charge assessment.

[0434] Luciferase assay for Daphnia pulex. The expression kinetics of the reporter mRNA Daphnia pulex luciferin were used to test the quality of the continuous mRNA delivery of the collagen sponge. To this end, cell culture supernatants were collected every 24 h after transfection and replaced with new culture medium. The collected culture medium was measured immediately or frozen at -20 ° C until the last day of the experiment when samples were measured together. To quantify Met luc expression, 80 μl of supernatant was gently mixed with 30 μl of 0.05 mM coelenterazine (Synchem, Felsberg, Germany) in a black 96-well plate (Costar, NY, USA) and measured using a luminescence reader (Wallac Victor, Perkin-Elmer Life Sciences) in triplicate.

[0435] Isolation and expansion of rat mesenchymal stem cells (MSC). Rat bone marrow mesenchymal stem cells (BMSC) are provided by ethris GmbH. Adipose mesenchymal stem cells (AMSC) are isolated from the adipose tissue of male rats. In the process, the adipose tissue is cut into millimeter-sized pieces and transferred to a falcon tube (Corning Inc., NY, USA) containing sterile DPBS and washed several times with DPBS. Next, the fat pieces are incubated in type II collagenase solution (0.4 mg / ml) for 30 minutes at 37°C in a humidified environment. Then, collagenase activity is terminated by adding complete DMEM culture medium (DMEM containing 10% v / v FBS and 1% v / v penicillin / streptomycin), and the mixture is centrifuged at 600g for 10 minutes. The upper fat layer is collected and resuspended in complete DMEM culture medium. In the next step, the cell suspension was filtered through a 40 μm cell strainer (Corning Inc., NY, USA), plated in a T75 cm flask (Corning Inc., NY, USA), and placed in complete DMEM at 37°C and 5% CO2 in a humidified atmosphere

[20] . To remove non-adherent cells, the medium was changed the next day. The cells were expanded to a cell density of 1500-3000 cells / cm 2 , and the culture medium was changed every three days. In this study, MSCs were used until passage 6.

[0436] Experimental setup. The collagen sponge was cut into small pieces (6 mm in diameter) using a punch (VBS Lochzange, Nr.19970181). The pieces were placed in the wells of a sterile, flat-bottomed, polypropylene-uncoated 96-well plate (Eppendorf, Humburg, Germany). 50 μl of positive liposomes (2%) in sucrose as a freeze-dried protective agent were added dropwise to each piece and incubated at room temperature for 90 minutes to allow them to be completely absorbed by the sponge. The loaded sponge was then moved to a high vacuum (Martin Christ Gefriertrocknungsanlagen GmbH, Osterode am Harz, Germany) and dried there at 0.05 mbar for at least 2 hours. Afterwards, the sponge was used to seed cells or vacuum-sealed and kept at room temperature until use. In the case of cell seeding, the desired cell density in 50 μl complete culture medium (complete DMEM for NIH3T3 and MSC cells) was added to each sponge, and then incubated at 37°C and 5% CO2 in a humidified atmosphere for 30 minutes. During the incubation period, cells must be seeded on the collagen sponge as they will not attach and grow on polypropylene uncoated plates. Then, 200 μl of complete culture medium is added to the wells and the plate is incubated in a cell culture incubator.

[0437] The entire procedure was performed under sterile conditions using a laminar flow hood (BDK Luft und reinraumtechnik GmbH, Sonnenbühl-Genkingen, Germany). In addition, plastic materials were avoided due to the high electrostatic charge of the collagen sponge.

[0438] Effectiveness of cmRNA transfer. FACS analysis was performed to characterize the effectiveness of cmRNA transfection in the 3D system. To this end, each sponge was incubated with 300U / ml type I collagenase in Hanks balanced salt solution (HBSS) with calcium and magnesium for 4 to 7 hours. During the incubation period, the sponge was visually inspected several times to ensure that the collagen was completely digested. The cells were centrifuged at 500g for 5 minutes and then washed with DPBS. In the next step, the cells were incubated at 37°C with 10μl of 0.05% trypsin-EDTA for 5 minutes to accelerate the separation of the cells. The separation was stopped by adding 90μl of DPBS containing 2% FBS to each well.

[0439] FACS analysis was performed using an Attune NxT flow cytometer (Life technologies, NY, USA). Before each experiment, calibration beads (Molecular probes, Life technologies, NY, USA) were used to calibrate the machine. Cell debris was excluded from the analysis by using forward and side scatter gating. Untransfected cells cultured under 2D and 3D conditions were used as negative controls to adjust the fluorescence channel to detect eGFP fluorescence. The data obtained three times were analyzed using FlowJo_V10 software.

[0440] Cell death / survival assays. Cell survival was assessed using propidium iodide staining and the WST assay. For both assays, vacuum-dried collagen sponges loaded with different doses of eGFP-cmRNA complexes were used. 10,000 NIH3T3 cells per sponge were seeded in complete DMEM medium and incubated for 48 hours at 37°C in a humidified atmosphere with 5% CO2.

[0441] For live-dead staining, cells were prepared for FACS analysis as described above. Then, just before measurement, a 1:1000 dilution of a 1 mg / ml propidium iodide stock solution was added to each well.

[0442] Cell survival was assessed by WST reaction assay according to the manufacturer's instructions (Colorimetric Cell Survival Kit II (WST-1), Promokine, Heidelberg, Germany). Before adding the WST reagent, the supernatant was pipetted up and down three times to obtain a homogenized solution from the sponge in each well. 100 μl of the supernatant was then transferred to a new cell culture 96-well plate (Corning Inc., NY, USA) for measurement. The supernatant from the untransfected well was used as a blank control. The absorbance was measured at 450 nm using a multi-spectrophotometer reader (Wallac Victor, Perkin-Elmer Life Sciences, MA, USA) in triplicate.

[0443] hBMP-2 secretion by MSC cultured on a collagen matrix loaded with hBMP2-cmRNA. Culture medium samples of MSC transfected with different doses of hBMP2 cmRNA positive liposomes were collected 24 hours after transfection, and the concentration of hBMP-2 was measured with a human BMP-2 ELISA kit according to the manufacturer's instructions (R&D Systems, Minneapolis, MN). The experiment was performed in triplicate and a standard curve (r 2 =0.99) to determine the protein content.

[0444] Scanning electron microscopy. Scanning electron microscopy (SEM) was used to characterize the morphology of the collagen sponges and to evaluate the loading of mRNA complexes thereon. All samples were coated with gold and palladium in a ratio of 60 / 40 using a sputter coater (Edwards sputter coater S150B, HHV Ltd, West Sussex, UK). SEM was then performed using a Zeiss-Leo DSM982 Gemini (FELMI-ZFE, Graz, Austria) at 1.2 kV.

[0445] Hematoxylin staining of cells seeded on collagen sponges. 24 hours after seeding NIH3T3 cells on collagen sponges, the cells were fixed with 4% formaldehyde in phosphate-buffered saline (PBS) at pH 7.4 overnight at room temperature. The collagen sponges were then dehydrated and embedded in paraffin. Collagen sections (7 μmm) were dewaxed and stained with hematoxylin according to standard protocols.

[0446] RNA isolation and reverse transcriptase real-time polymerase chain reaction (RT-PCR). 7 days and 14 days after seeding cells on hBMP-2-loaded collagen sponges, an appropriate volume of type I collagenase in Hanks balanced salt solution (HBSS) was added to each well to reach a final concentration of 300U / ml of type I collagenase. The plate was then incubated at 37°C and 5% CO2 in a humidified atmosphere for 4 to 7 hours. According to the manufacturer's instructions, when the collagen sponge was completely dissolved, the cells were centrifuged at 500g for 5 minutes, the supernatant was removed, and the cells were subsequently lysed by TRIzol reagent (Ambion by life technologies, Darmstadt, Germany) for total RNA isolation.

[0447] RNA concentration and purity were determined using a NanoDrop 2000C spectrophotometer (Thermo Scientific, DE, USA). First strand cDNA was reverse transcribed from 450 ng of total RNA using a First Strand cDNA Synthesis Kit (Thermo Scientific, Darmstadt, Germany) according to the manufacturer's instructions. For each of the hBMP2 transfected and untransfected groups, 15 sponges were used and the lysed cells were combined for RNA isolation.

[0448] In order to evaluate the expression of bone-related genes, quantitative real-time PCR (n=3) was performed using Advanced Universal SYBR Green Supermix (Bio-Rad, Munich, Germany). PCR was performed on a Light Cycler 96 thermal cycler (Roche, Mannheim, Germany). The expression levels of the target genes were normalized to the expression levels of GAPDH (in the case of MC3T3-E1 cells) and β-tubulin (for MSCs). The data are expressed as doubling induction relative to the control, i.e., untransfected MC3T3-E1 cells in 3D and untransfected MSCs in 2D culture. The primer sequences from the 5' end to the 3' end are listed as follows:

[0449] Mouse primers used for MC3T3-E1 cell bone regeneration experiments:

[0450] Gene Forward primer (SEQ ID No.) Reverse primer (SEQ ID No.) ALP gtgccctgactgaggctgtc(32) ggatcatcgtgtcctgctcac(33) OCN ccgggagcagtgtgagctta(34) tagatgcgtttgtaggcggtc(35) GAPDH gcacagtcaaggccgagaat(36) gccttctccatggtggtgaa(37)

[0451] Rat Primers for MSC Bone Regeneration Experiment:

[0452] Gene Forward primer (SEQ ID No.) Reverse primer (SEQ ID No.) RUNX2 ccgtgtcagcaaaacttcttt(38) gctcacgtcgctcatcttg(39) OSX cccaactgtcaggagctagag(40) gatgtggcggctgtgaat(41) OCN acggcagcttcagctttg(42) gaggcagagagagggaacag(43) ALP tggaacactgggtcccata(44) gacctggtcttccctccaa(45) β-tubulin ctgatgagcagggcgagt(46) tccgagaagttcttaagcctca(47)

[0453] In vitro bone differentiation. As previously mentioned, the collagen sponge is loaded with 3 μg hBMP2 mRNA positive liposomes in 2% sucrose and vacuum dried. In the next step, 30,000 freshly isolated rat AMSCs in 50 μl DMEM are seeded on each collagen sponge and incubated for 30 minutes in a humidified atmosphere of 5% CO2 at 37°C to ensure that the cells adhere to the collagen sponge. Then, 250 μl osteogenic culture medium (DMEM+2% FBS+10mMβ-glycerophosphate+200 μM L-ascorbic acid+1% penicillin-streptomycin) is added to each well. Half of the culture medium is replaced every two to three days. The negative control containing untransfected cells in 3D (seeded on collagen sponge) and 2D (seeded on normal cell culture flask) was treated exactly the same as the transfected cells in 3D. 7 days and 14 days after inoculation, the expression of osteogenic markers of the cells was studied by RT-PCR.

[0454] In vivo bone differentiation. The in vivo implantation experiment was designed according to the Guidelines for the Care and Use of Laboratory Animals (National Research Council (US) Committee, National Academies Press (US), 2011). A total of 9 SD rats (6-month-old males, average weight 600-700 g; Janvier, Le Genest-St-Isles, France) were used. In each rat, an empty collagen sponge (as a negative control) was used to treat the femoral defect in the left leg, and the right femoral defect was healed with a 2.5 μg hBMP2 cmRNA-loaded sponge. In order to avoid infection and relieve pain during and after surgery, conventional antibiotics and analgesics were taken, and Medetomidin ( Orion pharma, Espoo, Finland; 135 μg / kg), midazolam ( Unterhaching, Germany; 2.5 mg / kg) and fentanyl ( The animals were anesthetized with a combination of 5 μg / kg (Beerse, Belgium).

[0455] After shaving and disinfection, a small skin incision was made in the lateral region and a full-thickness bone defect was created in the central part of the femur using a 2 mm outer diameter bone drill.

[0456] After the scaffold was applied to the defect, a polyethylene membrane was used to cover the implant area to minimize any effect on the self-renewal capacity of the pericranium. Finally, 4-0 poly(lactide-co-glycolide) (vicryl) sutures were used to close the pericranium and overlying skin. At two weeks, sodium pentobarbital ( Rats were sacrificed with 400 mg / kg of phenobarbital (Merial GmbH, Hallbergmoos, Germany), and samples were collected for μCT and histological analysis.

[0457] μ-Computed Tomography (μ-CT) Analysis. Three-dimensional X-ray microcomputed tomography (μ-CT) imaging was performed using a μCT40 (Scanco Medical, Bassersdorf, Switzerland) to quantify bone formation. Bone volume was measured to compare the amount of newly formed callus tissue for each sample (defects treated with empty collagen sponge and defects treated with hBMP2 cmRNA-loaded collagen sponge).

[0458] Histological Observation of Rat Femoral Defects. Qualitative and morphological features of bone regeneration were analyzed using histological preparations. Femora were dehydrated with a graded series of ethanol from 40% to 100%, sectioned, and embedded in methacrylate resin (Technovit 7200, Heraeus Kulzer GmbH, Wehrheim, Germany). Thin sections (approximately 30 μm) were prepared and stained with Levai-Laczko stain and evaluated under a light microscope (Donath K. and Breuner G., J. Oral Pathology (11), 1982, 318-326; Laczko J. and Levai G. (31), Mikroskopie, 1975, 1-4).

[0459] Statistical Analysis. All statistical analyses were performed using GraphPad Prism version 6.05 for Windows (GraphPad Software Inc., San Diego, CA). Statistical significance was determined using t-test and multiple t-test. P < 0.05 was considered significant.

[0460] Example 8. Further alternative cmRNA complex formation with C12-(2-3-2).

[0461] The cationic lipid provided by Ethris GmbH has been used as non-viral vector, based on the electrostatic interaction between the positive amino group of lipid and the negative phosphate group of cmRNA, manufactures the stable positive liposome (Anderson, Human Gene Therapy 14,2003,191-202) with cmRNA. In order to stabilize the positive liposome structure and reduce leakage, two kinds of auxiliary lipids (Anderson, Drug Delivery 11,2004,33-39) called 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC) and cholesterol are supplied to Ethris lipids; Liang, Journal of Colliod and Interface Science 278,2004,53-62). Finally, 1,2-dimyristoyl-sn-glycerol, methoxypolyethylene glycol (DMG-PEG) 2kD are added in lipid mixture to provide the liposome of PEGization. As is well known, PEGylation improves the physicochemical properties of liposome formulations by increasing water solubility, protecting from enzymatic degradation and limiting immunogenicity and antigenic response (Milla, Current Drug Metabolism 13, 2012, 105-119). The final N / P ratio of the entire acetic acid lipid mixture is 8 / 5.29 / 4.41 / 0.88, which represents the molar ratio of the amino group of C12-(2-3-2) / DPPC / cholesterol / DMG-PEG to a phosphate group of the cmRNA molecule. The biophysical properties of cmRNA positive liposomes are tabulated in Table 6. The hydrodynamic diameter of all products is approximately 50nm, and the polydispersity index is close to 0.1, which indicates a homogeneous product. In addition, the total surface charge of all complexes is slightly positive, close to neutral.

[0462] Example 9. cmRNA complex loading and cell seeding on collagen sponge.

[0463] Before loading on the collagen sponge, 2% sucrose was added to the cmRNA positive liposome solution as a freeze-drying protectant. Freeze-drying protectants maintain the integrity of the biological system during dehydration during vacuum drying (Kannan, Journal of Liposome Research, 2014, 1-9). Visualization of the sponge by scanning electron microscopy (SEM) showed that the vacuum-dried collagen sponge containing 2% sucrose was similar to a closed cage with smaller pores ( Figure 23 ).

[0464] To ensure the possibility of loading cmRNA-positive liposomes on the sponge, the cmRNA-loaded sponge was investigated by SEM, and cmRNA-containing positive liposomes were detected on the collagen sponge ( Figure 14A ).

[0465] To study cmRNA loading and cell transfection on collagen sponges, the sponges were loaded with 2 μg tdTomato cmRNA-positive liposomes, of which 10% of tdTomato cmRNA was covalently FITC-conjugated. Using a Leica DMi8 fluorescence microscope (Leica microsystems, Heerbrugg, Switzerland), 30 hours after inoculation of NIH3T3 cells, the dispersion of cells and cmRNA-positive liposomes on the sponges and the transfection efficacy were visualized. Figure 14B As shown, cells were transfected and expressed tdTomato protein (red spots), primarily in locations with high cmRNA accumulation (green dots).

[0466] To investigate the cell behavior on the 3D matrix, 7 days after seeding NIH3T3 cells, hematoxylin staining of vertical sections of the sponge confirmed that NIH3T3 cells had migrated into the collagen sponge. Figure 14C , it is clear that cells are able to migrate into the sponge and use the entire matrix for growth and signaling, which is more likely to resemble the situation in vivo.

[0467] First, it is shown that cells can grow in collagen sponge 3D matrix.Other studies have also demonstrated that collagen sponge is used as the suitable 3D scaffold for cell culture, which can improve cell signaling and cell properties, and affect gene expression (Chevallay, Medical and Biological Engineering and Computing 38,2000,211-218) in cells.Then, using SEM and fluorescence microscopy with fluorescently labeled cmRNA, visible uniformly distributed cmRNA positive liposomes and cells (Figure 14).

[0468] Example 10. Transfection efficacy and cell survival on collagen sponges.

[0469] To verify the efficacy and safety of cell transfection on collagen sponges, the expression of eGFP cmRNA in NIH3T3 cell line was evaluated 48 h after transfection. TM Fluorescence microscopy (Baker and Baker Ruskinn, USA) was used to visualize positive eGFP-expressing cells ( Figure 15A To quantify these results, FACS analysis was performed and a significant increase in mean fluorescence intensity was observed in the transfected cells. Figure 15B In dose-response experiments, transfection efficiencies as high as 100% were observed using higher amounts of cmRNA per cell ( Figure 15C ).

[0470] In the clinical setting, not only transfection efficiency but also cytotoxicity becomes a determining factor. Therefore, in addition to GFP expression, cell survival was quantified 48 hours after transfection in two independent experiments using two different methods: PI staining followed by FACS analysis and WST assay. Similar results with cell survival in the range of 60-70% were obtained using both methods ( Figure 15D and E). Unlike transfection efficiency, cell survival appeared to be dose-independent, while a dose-dependent increase in efficacy was observed.

[0471] Quantification of eGFP cmRNA transfection efficacy on collagen sponges by FACS analysis demonstrated the remarkable high efficacy of the present technology, which achieved 100% transfected cells ( Figure 15B To validate the technology of the present application for clinical use, cell survival was also assessed, and a dose-independent cell survival of approximately 60-70% was observed, which is acceptable for both the in vitro and in vivo methods of the present application. Figure 15D And E). Dose independence in cell survival assays can be the result of uniform cell distribution within the 3D matrix, which may be very similar to the in vivo situation and improve cell signaling and proliferation (Mueller-Klieser, American Journal of Physiology-CellPhysiology 273, 1997, C1109-C1123), in such a way that cells can tolerate even high doses of cmRNA complexes. When overall efficacy is low and higher doses of cmRNA are required, this dose independence trend of cell survival will be particularly beneficial.

[0472] Example 11. Collagen sponge acts as a reservoir for sustained cmRNA delivery

[0473] To investigate whether collagen sponges could provide a sustained cmRNA delivery system, the expression kinetics of Met luciferin cmRNA (Met luc) in MIH3T3 cells were measured every 24 h and compared in 2D and 3D cultures ( Figure 16 ).

[0474] Based on these results, the collagen sponge demonstrated the properties of a sustained cmRNA delivery system, with a protein expression plateau for the next 6 days. Furthermore, compared to 2D cell culture, which showed almost no expression after 8 days, the cmRNA-loaded collagen sponge showed relatively high protein expression even after 11 days using a higher cmRNA dose.

[0475] Similar results have been obtained by loading positive liposomes containing unmodified mRNA onto collagen sponges ( Figure 24 However, when non-vacuum dried collagen sponges were used, the system lost its delayed delivery efficiency ( Figure 25 ). This provides evidence that vacuum drying is a necessary and critical step in providing a sustained cmRNA delivery system in the present setting.

[0476] In the next step, the system was tested on primary cells using rat mesenchymal stem cells (MSCs) isolated from bone marrow (BMSCs) and adipose tissue (AMSCs). Using these two cell types, the kinetics of Met luc expression was determined by seeding increasing numbers of cells on positive liposome-loaded collagen sponges. Figure 17 As shown, MSCs seeded on composite-loaded collagen sponges revealed prolonged protein expression for at least the next four days, regardless of cell density. No significant increase in Met luc expression was observed for higher cell densities (>10,000 cells / sponge), and further experiments were performed using 10-20,000 cells / sponge.

[0477] Use cell lines ( Figure 16 ) and primary cells with various cell densities ( Figure 17 ) and modified and unmodified mRNA ( Figure 24 ) The expression kinetics of Daphnia pulex luciferase cmRNA were measured to evaluate the ability of collagen sponges to deliver sustained cmRNA. Based on the kinetic results, vacuum-dried cmRNA-loaded collagen sponges provide a robust sustained delivery system for cmRNA that is independent of RNA modification, cell type, and cell density; it even provides a robust sustained delivery system for primary cells that are more sensitive to contact inhibition and cell density

[21] . When switching to low cell density is also feasible, this system will be very advantageous in the absence of cell sources and patient samples. In order to have such a delayed delivery system, vacuum drying seems to play a key role, while the expression of cmRNA in non-dried sponges decreases more rapidly ( Figure 25 The extended cmRNA delivery after vacuum drying—not limited by therapy—may be due to the closed cage structure of the vacuum-dried collagen sponge ( Figure 23 ), where the trapped positive liposomes need time to contact with cells or be released from the matrix

[10] . Uniform distribution of vacuum-dried cmRNA positive liposomes on collagen sponge ( Figure 14A ) may be another reason for the steady-state expression that lasts for several days without a peak of transfection efficacy or burst release (Lee, Biomaterials 32, 2011, 744-752).

[0478] Vacuum drying also had another substantial effect, where cmRNA complexes on vacuum-dried collagen sponges were stable at room temperature for at least 6 months ( Figure 22 ; See also Example 14). For very sensitive mRNA molecules, this study has achieved this considerable shelf life for the first time. This can increase the availability and ease of use of potential cmRNA therapeutics and bring cmRNA closer to clinical application.

[0479] While the technology was well optimized for delivering reporter cmRNA to cell lines and primary cells, the system was tested to study the physiological effect of using hBMP2 cmRNA, namely bone formation.

[0480] Example 12. In vitro cell differentiation

[0481] To verify the physiological effects of the sustained cmRNA delivery system, two in vitro bone differentiation experiments were designed using two different cells, MC3T3-E1 and MSC, using hBMP2 cmRNA-positive liposomes (Lee, Biomaterials 32, 2011, 744-752; Meine, Biomaterials 27, 2006, 4993-5002; Kim, Biomaterials 28, 2007, 1830-1837).

[0482] To confirm the osteogenic differentiation of osteoblast-like cells (MC3T3-E1) 7 and 14 days after seeding the cells on hBMP2 cmRNA-loaded collagen sponges, reverse transcription polymerase chain reaction (RT-qPCR) was performed to quantify the expression of osteogenic markers (OCN and ALP). Untransfected cells seeded on unloaded collagen sponges were used as negative controls. Figure 20A As shown, both markers were strongly expressed at both time points and expression increased by day 14.

[0483] In the next step, in vitro osteodifferentiation using MSCs was performed using the same setup. First, freshly isolated MSCs were evaluated for positive and negative markers ( Figure 26 MSCs were then seeded on collagen sponges loaded with hBMP2 cmRNA positive liposomes. 24 h after transfection, the expression of hBMP2 in the supernatant was quantified using ELISA ( Figure 19). After 7 and 14 days, the expression of osteogenic markers (RUNX2, OSX, OCN and ALP) was detected using RT-qPCR. Unexpectedly, all markers were highly expressed not only in transfected MSCs seeded on 3D collagen scaffolds but also in non-transfected MSCs. Therefore, non-transfected MSC cultures in conventional 2D conditions (standard cell culture in culture dishes) that were treated exactly the same as the cells in 3D (for culture medium and washing) were selected as negative controls to normalize the expression of differentiation markers observed in cells in 3D. Figure 20B As shown, culture in 3D collagen matrix alone significantly upregulated the expression of osteogenic markers in MSCs.

[0484] In vitro bone differentiation was performed using an osteoblast-like cell line (MC3T3-E1) and MSCs seeded on hBMP2 cmRNA-loaded collagen sponges [10, 19] (Figure 20). In the case of MC3T3-E1 cells, hBMP2 mRNA had a significant effect in triggering bone formation, as the expression of osteogenic markers was several-fold higher in the transfected cells compared to the untransfected cells seeded on the 3D collagen scaffolds ( Figure 20A ).

[0485] In contrast, there was little significant difference in the expression of osteogenic markers between hBMP2-transfected and non-transfected MSCs on collagen sponges ( Figure 20B However, hBMP2 expression was previously detected using ELISA in MSCs seeded on hBMP2 cmRNA-loaded collagen sponges ( Figure 19 ). According to this data, collagen sponge itself can trigger MSC bone regeneration in vitro. Previously, it has also been shown that collagen sponge can trigger cartilage formation (Bosnakovski, Biotechnology and Bioengineering 93, 2006, 1152-1163). Another explanation for this phenomenon goes through the dramatic macroscopic changes in transfected and untransfected collagen sponges containing MSCs ( Figure 27 By day 7, the sponges loaded with hBMP2 appeared fluffier and expanded in size, while the unloaded sponges compressed and shrunk over time. Because MSCs are too confluent in the unloaded, contracted sponges, they lose their multipotency and begin to reprogram into terminally differentiated cells (Sekiya, Stem Cells 20, 2002, 530-541; Coulter, PNAS 97, 2000, 3213-3218), and when they are grown in osteogenic medium, osteogenic differentiation is most likely.

[0486] Example 13. In vivo cell differentiation

[0487] The in vivo bone regeneration activity was evaluated by a rat femoral defect model. As the experimental and control groups, hBMP2cmRNA-loaded and unloaded vacuum-dried collagen sponges were applied to the femoral defects of the two groups of animals, respectively. In detail, the prepared sponge was implanted into a 2mm diameter bone defect established in the central part of the rat femur. In order to visualize and quantify bone healing, micro-computed tomography (μ-CT) scans were performed two weeks after surgery. Figure 21A As shown, more newly formed bone was found in the hBMP2cmRNA treated group. Quantification of the results also demonstrated that hBMP2cmRNA-loaded collagen sponge could significantly increase bone regeneration compared to blank collagen ( Figure 21B In the μ-CT 3D scanning model, the effect of hBMP2 on callus formation was also obvious ( Figure 29 Exploring further details, further analysis using μ-CT in different parts of the bone (periosteum, cortex and medulla) revealed the highest bone regeneration in the medullary region ( Figure 27 ), where many bone marrow stem cells reside.

[0488] To verify the newly formed bone, immunohistochemistry was also performed at week 2, and higher mineralized bone tissue was found in the hBMP2 cmRNA-treated group. Similar to the μ-CT results, highly mineralized areas (dark black in the immunohistochemistry images) were observed mostly in the medullary fraction ( Figure 18A Furthermore, histological analysis in the periosteum region showed a significant increase in callus formation in the hBMP2 cmRNA-treated group compared to the control ( Figure 18B Further analysis demonstrated that significantly more fibrous tissue was produced in the group treated with hBMP2 cmRNA-loaded sponges compared to the group treated with empty sponges ( Figure 18C During bone healing, fibrous tissue can trigger a trend towards osteoid formation and bone regeneration (Luellmann-Rauch, De Boeck Supèrrieur, 2008). Figure 18D It showed that more osteoid was formed in the hBMP2 cmRNA-treated group.

[0489] To test the present cmRNA delivery system at the preclinical level, cmRNA-loaded collagen sponges have been applied to in vivo bone formation using hBMP2 cmRNA. The in vivo bone formation effect of chemically modified BMP2 cmRNA complexes with PEI has recently been published (Elangovan, supra).

[0490] However, in this study, hBMP2 cmRNA positive liposomes (table 6) with half the size of PEI complex were used, which can improve in vitro cell uptake and pharmacokinetics and biodistribution in vivo (Lee, Biomaterials 32, 2011, 744-752; Albanese, Annual Review of Biomedical Engineering 14, 2012, 1-16). The hBMP2 cmRNA positive liposomes were then stabilized on collagen sponges by vacuum drying, and a ready-to-use bioproduct was formed. Finally, the effect of this bioproduct was evaluated in an animal model, demonstrating that this technology is delivered in hBMP2 cmRNA for the function of bone regeneration in vivo.

[0491] Various studies have demonstrated the role of BMP2 protein in bone tissue engineering using various carriers (Meinel, Biomaterials 27, 2006, 4993-5002; Kempen, Biomaterials 30, 2009, 2816-2825). However, collagen is currently the only FDA-approved carrier for recombinant hBMP2. Therefore, in this study, we investigated the effectiveness of collagen as a carrier for stable hBMP2 cmRNA.

[0492] For carrying out in vivo experiment, loaded and unloaded collagen sponge are all implanted into rat femoral defect.After two weeks, rats were put to death, and bone formation was evaluated using μ-CT and immunohistochemistry. The result obtained is similar to the result of MC3T3-E1 cell bone regeneration in vitro. μ-CT result and immunohistochemistry all show that compared with blank collagen, bone formation is significantly higher in the defect processed with the collagen loaded by hBMP2cmRNA (Figures 21, 18A and B and Figure 29 Further analysis in different parts of the bone (periosteum, cortex and medulla) demonstrated that the greatest bone formation occurred in the medullary region ( Figure 28 、 Figure 21A and Figure 18A). Although for ideal tissue engineering, new bone should be mainly produced in the cortical region, but here this medullary bone formation is due to collagen sponge being placed in bone defect.In this study, loaded and unloaded collagen sponge are all placed in whole bone defect (rather than just in cortical part).Because medullary region contains much more BMSC compared with other parts of bone, maximum bone formation occurs there.In other words, in order to see cortical bone formation, the collagen sponge loaded by hBMP2cmRNA- should only be placed in the cortical region, but due to the smaller size of the bone of rat, this is not feasible in rat model.Other publications of the same animal model of recombinant BMP2 protein treatment also demonstrate that when 2 weeks, compared with cortex, more bone formation in medulla is formed.However, in 4 weeks, observed more cortical bone formation (Keibl, Injury 42,2011,814-820).Therefore, the additional experiment at the time point later can be useful for studying bone regeneration in the cortical region.

[0493] Further histological analysis demonstrated that significantly more fibrous tissue was generated in the hBMP2-treated group ( Figure 18C This can also be considered a sign of bone formation, because during bone healing, fibrous tissue can follow the trend of functional fibrous tissue and then toward osteoid formation (Luellmann-Rauch, De Boeck Supèrrieur, 2008). Similarly, more osteoid formation was detected in the hBMP2 cmRNA treatment group ( Figure 18D ).

[0494] These results differ from those seen in in vitro bone regeneration using MSCs, where hBMP2 cmRNA-loaded and unloaded collagen sponges had almost identical effects on bone formation ( Figure 20B). This difference may be due to the difference between in vitro and in vivo conditions, because a large number of factors may affect the effect of BMP and collagen sponge on bone regeneration in vivo, such as the presence of small molecules, growth factors and cytokines (Lynch, Journal of Periodontology 62, 1991, 710-716; Wan, PNASA 105, 2008, 868-691; Mountziaris, Tissue Engineering Part B: Reviews 14, 2008, 179-186). These factors do not exist in an in vitro environment, so the in vivo results may not fully follow the in vitro results. Therefore, collagen sponges and other carriers as described herein can not only be preloaded with desired cmRNA-positive liposomes, but also can be preloaded with small molecules and cytokines, which can enhance the migration of MSCs in sponges (Xu, Oncology Reports 23, 2010, 1561-1567; Wu, Stem Cell Reviews and Reports 8, 2012, 243-250), and thereby improve transfection efficacy.

[0495] Further results of bone histomorphometry:

[0496] After autopsy, the femur was harvested, freed from the surrounding soft tissue, and subsequently fixed in 4% paraformaldehyde (PFA) for 24 hours. Next, the sample was dehydrated by immersion in graded alcohol and xylene, and finally embedded in methyl methacrylate (MMA). Micro-crushed sections were then prepared and stained according to the protocol of Von Kossa, preparing toluidine blue and tartrate-resistant acid phosphatase (TRAcP).

[0497] The drilled area was theoretically divided into four areas for histomorphometry.

[0498] The periosteal area surrounding the drill hole (M1),

[0499] The visible drilled area within the dense layer where the implant is placed (M2),

[0500] the intramedullary drilled area (M3) where part of the implant is also placed,

[0501] • and a defined area (M4) around the drilled area within the bone marrow where the implant is placed.

[0502] Von Kossa staining sections were examined to show mineralized tissue, indicating new bone formation. Using this method, in the region M4 of the drill holes of the collagen sponge loaded with the cmRNA encoding hBMP-2, it was found that per tissue volume was significantly (using Mann-Whitney U test, p=0.01) higher amounts of mineralized tissue (BV / TV), which showed that the bone formation enhanced at the outer surface of the intramedullary implant was expected to form bone at this local area, although hematopoietic stem cells are most likely to have the most intensive contact with the implant at the peripheral surface ( Figure 30A ).

[0503] The periosteal region surrounding the drill hole (M1) exhibited a higher overall tissue mass in the bone implanted with hBMP-2 encoding cmRNA-loaded sponges than in the bone implanted with only empty sponges, suggesting increased osteogenic activity due to overexpression of functional hBMP-2 ( Figure 30B ).

[0504] Examination of toluene blue-stained sections revealed significantly higher fibrous tissue ( Figure 30C In addition, not only was there an increase in fibrous tissue, but also an increase in the formation of fibrous tissue into osteoid ( Figure 30D ), which suggests a higher formation of extracellular matrix meant to serve as a precursor in the development of new bone tissue.

[0505] TRAcP staining revealed significantly fewer osteoclasts per millimeter of bone circumference (N.Oc / B.Pm) in the dense layer region (M2) after treatment with collagen sponge loaded with cmRNA encoding hBMP-2, suggesting less bone resorption due to the inflammatory process in the drilled bone surface ( Figure 30E ).

[0506] Example 14. Stability determination of cmRNA-positive liposomes vacuum-dried on collagen sponge.

[0507] A long-term stability assessment was performed to estimate the shelf life of cmRNA positive liposomes vacuum-dried on collagen sponges as biological products. For this purpose, 96-well plates containing Met luc cmRNA positive liposomes on vacuum-dried collagen sponges were vacuum-sealed and stored at room temperature. At certain time points, one of the plates was used to inoculate NIH3T3 cells on the sponge. 24 hours after cell inoculation, the expression of Daphnia pulex luciferase was measured. The expression of the plates stored at different time points was then compared with the expression of the plates used directly after vacuum drying (time point = 0). Figure 9 As shown, cmRNA complexes on vacuum-dried collagen sponges were stable at room temperature for at least 6 months, regardless of the cmRNA dose used.

[0508] The present invention relates to the following table:

[0509] Table 1. Characteristics of DF-Gold / hBMP-2 cmRNA positive liposomes and SO-Mag6-115 / DF-Gold / hBMP-2 cmRNA magnetic positive liposomes formulated at an iron / cmRNA ratio of 0.5:1 (w / w). Each value represents the mean ± SD (n = 30).

[0510]

[0511] Table 2. Description of designed rat primers used in qRT-PCR assays.

[0512]

[0513] Table 3. Description of designed human primers used in qRT-PCR assays.

[0514]

[0515] Table 4. Examples of suitable modifications in cmRNA to be employed.

[0516]

[0517] Table 5. Database entries for nucleotide and amino acid sequences of BMPs.

[0518]

[0519] Table 6. Characteristics of mRNA complexes

[0520]

[0521] The present invention cites the following (additional) references:

[0522] 1.Balmayor, Stem Cell Therapy for Bone Disorders. In: Chase LG, Vemuri MC (eds.) Mesenchymal Stem Cell Therapy. Humana Press, New York 2012, 101-116

[0523] 2.Carmona,Bone Health and Osteoporosis:A Report of the SurgeonGeneral 2004,U.S.Department of Health and Human Services,Office of theSurgeon General.,Rockville,MD

[0524] 3.Dimitriou,Injury 36(12),2005,1392-1404

[0525] 4.Einhorn,Clin Orthop Relat Res 355,1998,7-21

[0526] 5.Tanner,J R Soc Interface 5,2010,541-557

[0527] 6.Tanner,Proc Inst Mech Eng H 224(12),2010,1359-1372

[0528] 7.Mourino,Expert Opin Drug Deliv 10(10),2013,1353-1365

[0529] 8.Romagnoli,Clin Cases Miner Bone Metab 10(3),2013,155-161

[0530] 9.Bessa,J Tissue Eng Regen Med 2(2-3),2008,81-96

[0531] 10.Bessa,J Tissue Eng Regen Med 2(1),2008,1-13

[0532] 11.Urist,Clin Orthop Relat Res 53,1967,243-283

[0533] 12.Yamaguchi,Endocr Rev 21(4),2000,393-411

[0534] 13.Keibl,Injury 42(8),2011,814-820

[0535] 14.Katagiri,J Cell Biol 127(6Pt 1),1994,1755-1766

[0536] 15.Shekaran,Bone regeneration using an alpha 2beta 1integrin-specifichydrogel as aBMP-2delivery vehicle.Biomaterials,2014

[0537] 16.Evans,Adv Drug Deliv Rev 64(12),2012,1331-1340

[0538] 17.Lu,J Biomater Sci Polym Ed 23(1-4),2012,509-526

[0539] 18.Chang,Neurosurgery 65,2009,75-81

[0540] 19.Park,Gene Ther 10(13),2003,1089–1098

[0541] 20.Van Tendeloo,Curr Opin Mol Ther 9(5),2007,423-431

[0542] 21.Holtkamp,Blood 108(13),2006,4009-4017

[0543] 22.Kormann,Nat Biotechnol 29(2),2011,154-157

[0544] 23.Mays,J Clin Invest 123(3),2013,1216-1228

[0545] 24.Balmayor,Biores Open Access 2(5),2013,346-355

[0546] 25.Evans,Eur Cell Mater 18,2009,96-111

[0547] 26.Puri,J Lipid Res 48(2),2007,465-471

[0548] 27. Mykhaylyk, Liposomal magnetofection. In: Weissig V (ed.) Liposomes, Methods in Molecular Biology, vol. 605. Humana Press-Springer, New York 2010, 487-525

[0549] 28.Mykhaylyk,Pharm Res 29(5),2012,1344-1365

[0550] 29.Inouye,Protein Expr Purif 88(1),2013,150-156

[0551] 30.Cox,J Histochem Cytochem 47(11),1999,1443-1456

[0552] 31.Lakshmipathy,Stem cells 22(4),2004,531-543

[0553] 32.Evans,Tissue Eng 13(8),2007,1987-1993

[0554] 33.Dragoo,Plast Reconstr Surg 115(6),2005,1665-1673 Sequence Listing <110> Azeris Corporation <120> Induction of osteogenesis by delivery of BMP-encoding RNA <130> X2050 PCT S3 <150> EP 14 19 2539.6 <151> 2014-11-10 <160> 47 <170> BiSSAP 1.3 <210> 1 <211> 1191 <212> DNA <213> Homo sapiens <220> <221> CDS <222> 1..1191 <223> / translation table=1 <400> 1 atg gtg gcc ggg acc cgc tgt ctt cta gcg ttg ctg ctt ccc cag gtc 48 Met Val Ala Gly Thr Arg Cys Leu Leu Ala Leu Leu Leu Pro Gln Val 1 5 10 15 ctc ctg ggc ggc gcg gct ggc ctc gtt ccg gag ctg ggc cgc agg aag 96 Leu Leu Gly Gly Ala Ala Gly Leu Val Pro Glu Leu Gly Arg Arg Lys 20 25 30 ttc gcg gcg gcg tcg tcg ggc cgc ccc tca tcc cag ccc tct gac gag 144 Phe Ala Ala Ala Ser Ser Gly Arg Pro Ser Ser Gln Pro Ser Asp Glu 35 40 45 gtc ctg agc gag ttc gag ttg cgg ctg ctc agc atg ttc ggc ctg aaa 192 Val Leu Ser Glu Phe Glu Leu Arg Leu Leu Ser Met Phe Gly Leu Lys 50 55 60 cag aga ccc acc ccc agc agg gac gcc gtg gtg ccc ccc tac atg cta 240 Gln Arg Pro Thr Pro Ser Arg Asp Ala Val Val Pro Pro Tyr Met Leu 65 70 75 80 gac ctg tat cgc agg cac tca ggt cag ccg ggc tca ccc gcc cca gac 288 Asp Leu Tyr Arg Arg His Ser Gly Gln Pro Gly Ser Pro Ala Pro Asp 85 90 95 cac cgg ttg gag agg gca gcc agc cga gcc aac act gtg cgc agc ttc 336 His Arg Leu Glu Arg Ala Ala Ser Arg Ala Asn Thr Val Arg Ser Phe 100 105 110 cac cat gaa gaa tct ttg gaa gaa cta cca gaa acg agt ggg aaa aca 384 His His Glu Glu Ser Leu Glu Glu Leu Pro Glu Thr Ser Gly Lys Thr 115 120 125 acc cgg aga ttc ttc ttt aat tta agt tct atc ccc acg gag gag ttt 432 Thr Arg Arg Phe Phe Phe Asn Leu Ser Ser Ile Pro Thr Glu Glu Phe 130 135 140 atc acc tca gca gag ctt cag gtt ttc cga gaa cag atg caa gat gct 480 Ile Thr Ser Ala Glu Leu Gln Val Phe Arg Glu Gln Met Gln Asp Ala 145 150 155 160 tta gga aac aat agc agt ttc cat cac cga att aat att tat gaa atc 528 Leu Gly Asn Asn Ser Ser Phe His His Arg Ile Asn Ile Tyr Glu Ile 165 170 175 ata aaa cct gca aca gcc aac tcg aaa ttc ccc gtg acc aga ctt ttg 576 Ile Lys Pro Ala Thr Ala Asn Ser Lys Phe Pro Val Thr Arg Leu Leu 180 185 190 gac acc agg ttg gtg aat cag aat gca agc agg tgg gaa agt ttt gat 624 Asp Thr Arg Leu Val Asn Gln Asn Ala Ser Arg Trp Glu Ser Phe Asp 195 200 205 gtc acc ccc gct gtg atg cgg tgg act gca cag gga cac gcc aac cat 672 Val Thr Pro Ala Val Met Arg Trp Thr Ala Gln Gly His Ala Asn His 210 215 220 gga ttc gtg gtg gaa gtg gcc cac ttg gag gag aaa caa ggt gtc tcc 720 Gly Phe Val Val Glu Val Ala His Leu Glu Glu Lys Gln Gly Val Ser 225 230 235 240 aag aga cat gtt agg ata agc agg tct ttg cac caa gat gaa cac agc 768 Lys Arg His Val Arg Ile Ser Arg Ser Leu His Gln Asp Glu His Ser 245 250 255 tgg tca cag ata agg cca ttg cta gta act ttt ggc cat gat gga aaa 816 Trp Ser Gln Ile Arg Pro Leu Leu Val Thr Phe Gly His Asp Gly Lys 260 265 270 ggg cat cct cct cac aaa aga gaaaa cgt CA gcc aaa cac aaa cag 864 Gly His Pro Leu His Lys Arg Glu Lys Arg Gln Ala Lys His Lys Gln 275 280 285 cgg aaa cgc ctt aag tcc agc tgt aag aga cac cct ttg tac gtg gac 912 Arg Lys Arg Lys Ser Ser Cys Lys Arg His Pro Leu Tyr Val Asp 290,295,300 ttc agt gac gtg ggg tgg aat gac tgg att gtg gct ccc ccg ggg tat 960 Phe Ser Asp Val Gly Trp Asn Asp Trp Ile Val Ala Pro Pro Gly Tyr 305 310 315 320 cac gcc ttt tac tgc cac gga gaa tgc cct tt cct ctg gct gat cat 1008 His Ala Phe Tyr Cys His Gly Glu Cys Pro Phe Pro Leu Ala Asp His 325 330 335 ctg aac tcc act aat cat gcc att gtt cag acg gtc aac tct gtt 1056 Leu Asn Ser Thr Asn His Ala Ile Val Gln Thr Leu Val Asn Ser Val 340 345 350 aac tct aag att cct aag gca tgc tgt gtc ccg aca gaa ctc agt gct 1104 Asn Ser Lys Ile Pro Lys Ala Cys Cys Val Pro Thr Glu Leu Ser Ala 355 360 365 atc tcg atg ctg tac ctt gac gag aat gaa aag gtt gta tta aag aac 1152 Ile Ser Met Leu Tyr Leu Asp Glu Asn Glu Lys Val Val Leu Lys Asn 370 375 380 tat cag gac atg gtt gtg gag ggt tgt ggg tgt cgc tag 1191 Tyr Gln Asp Met Val Val Glu Gly Cys Gly Cys Arg 385 390 395 <210> 2 <(211)> 1296 <(212)> DNA <(213)> Homo sapiens <220> <(221)> CDS <(222)> 1..1296 <(223)> / translation_table=1 <400> 2 atg cac gtg cgc tca ctg cga gct gcg gcg ccg cac agc ttc gtg gcg 48 Met His Val Arg Ser Leu Arg Ala Ala Ala Pro His Ser Phe Val Ala 1 5 10 15 ctc tgg gca ccc ctg ttc ctg ctg cgc tcc gcc ctg gcc gac ttc agc 96 Leu Trp Ala Pro Leu Phe Leu Leu Arg Ser Ala Leu Ala Asp Phe Ser 20 25 30 ctg gac aac gag gtg cac tcg agc ttc atc cac cgg cgc ctc cgc agc 144 Leu Asp Asn Glu Val His Ser Ser Phe Ile His Arg Arg Leu Arg Ser 35 40 45 cag gag cgg cgg gag atg cag cgc gag atc ctc tcc att ttg ggc ttg 192 Gln Glu Arg Arg Glu Met Gln Arg Glu Ile Leu Ser Ile Leu Gly Leu 50 55 60 ccc cac cgc ccg cgc ccg cac ctc cag ggc aag cac aac tcg gca ccc 240 Pro His Arg Pro Arg Pro His Leu Gln Gly Lys His Asn Ser Ala Pro 65 70 75 80 atg ttc atg ctg gac ctg tac aac gcc atg gcg gtg gag gag ggc ggc 288 Met Phe Met Leu Asp Leu Tyr Asn Ala Met Ala Val Glu Glu Gly Gly 85 90 95 ggg ccc ggc ggc cag ggc ttc tcc tac ccc tac aag gcc gtc ttc agt 336 Gly Pro Gly Gly Gln Gly Phe Ser Tyr Pro Tyr Lys Ala Val Phe Ser 100 105 110 acc cag ggc ccc cct ctg gcc agc ctg caa gat agc cat ttc ctc acc 384 Thr Gln Gly Pro Pro Leu Ala Ser Leu Gln Asp Ser His Phe Leu Thr 115 120 125 gac gcc gac atg gtc atg agc ttc gtc aac ctc gtg gaa cat gac aag 432 Asp Ala Asp Met Val Met Ser Phe Val Asn Leu Val Glu His Asp Lys 130 135 140 gaa ttc ttc cac cca cgc tac cac cat cga gag ttc cgg ttt gat ctt 480 Glu Phe Phe His Pro Arg Tyr His His Arg Glu Phe Arg Phe Asp Leu 145 150 155 160 tcc aag atc cca gaa ggg gaa gct gtc acg gca gcc gaa ttc cgg atc 528 Ser Lys Ile Pro Glu Gly Glu Ala Val Thr Ala Ala Glu Phe Arg Ile 165 170 175 tac aag gac tac atc cgg gaa cgc ttc gac aat gag acg ttc cgg atc 576 Tyr Lys Asp Tyr Ile Arg Glu Arg Phe Asp Asn Glu Thr Phe Arg Ile 180 185 190 agc gtt tat cag gtg ctc cag gag cac ttg ggc agg gaa tcg gat ctc 624 Ser Val Tyr Gln Val Leu Gln Glu His Leu Gly Arg Glu Ser Asp Leu 195 200 205 ttc ctg ctc gac agc cgt acc ctc tgg gcc tcg gag gag ggc tgg ctg 672 Phe Leu Leu Asp Ser Arg Thr Leu Trp Ala Ser Glu Glu Gly Trp Leu 210 215 220 gtg ttt gac atc aca gcc acc agc aac cac tgg gtg gtc aat ccg cgg 720 Val Phe Asp Ile Thr Ala Thr Ser Asn His Trp Val Val Asn Pro Arg 225 230 235 240 cac aac ctg ggc ctg cag ctc tcg gtg gag acg ctg gat ggg cag agc 768 His Asn Leu Gly Leu Gln Leu Ser Val Glu Thr Leu Asp Gly Gln Ser 245 250 255 atc aac ccc aag ttg gcg ggc ctg att ggg cgg cac ggg ccc cag aac 816 Ile Asn Pro Lys Leu Ala Gly Leu Ile Gly Arg His Gly Pro Gln Asn 260 265 270 aag cag ccc ttc atg gtg gct ttc ttc aag gcc acg gag gtc cac ttc 864 Lys Gln Pro Phe Met Val Ala Phe Phe Lys Ala Thr Glu Val His Phe 275 280 285 cgc agc atc cgg tcc acg ggg agc aaa cag cgc agc cag aac cgc tcc 912 Arg Ser Ile Arg Ser Thr Gly Ser Lys Gln Arg Ser Gln Asn Arg Ser 290 295 300 aag acg ccc aag aac cag gaa gcc ctg cgg atg gcc aac gtg gca gag 960 Lys Thr Pro Lys Asn Gln Glu Ala Leu Arg Met Ala Asn Val Ala Glu 305 310 315 320 aac agc agc agc gac cag agg cag gcc tgt aag aag cac gag ctg tat 1008 Asn Ser Ser Ser Asp Gln Arg Gln Ala Cys Lys Lys His Glu Leu Tyr 325 330 335 gtc agc ttc cga gac ctg ggc tgg cag gac tgg atc atc gcg cct gaa 1056 Val Ser Phe Arg Asp Leu Gly Trp Gln Asp Trp Ile Ile Ala Pro Glu 340 345 350 ggc tac gcc gcc tac tac tgt gag ggg gag tgt gcc ttc cct ctg aac 1104 Gly Tyr Ala Ala Tyr Tyr Cys Glu Gly Glu Cys Ala Phe Pro Leu Asn 355 360 365 tcc tac atg aac gcc acc aac cac gcc atc gtg cag acg ctg gtc cac 1152 Ser Tyr Met Asn Ala Thr Asn His Ala Ile Val Gln Thr Leu Val His 370 375 380 ttc atc aac ccg gaa acg gtg ccc aag ccc tgc tgt gcg ccc acg cag 1200 Phe Ile Asn Pro Glu Thr Val Pro Lys Pro Cys Cys Ala Pro Thr Gln 385 390 395 400 ctc aat gcc atc tcc gtc ctc tac ttc gat gac agc tcc aac gtc atc 1248 Leu Asn Ala Ile Ser Val Leu Tyr Phe Asp Asp Ser Ser Asn Val Ile 405 410 415 ctg aag aaa tac aga aac atg gtg gtc cgg gcc tgt ggc tgc cac tag 1296 Leu Lys Lys Tyr Arg Asn Met Val Val Arg Ala Cys Gly Cys His 420 425 430 <210> 3 <211> 396 <212> PRT <213> Homo sapiens <220> <223> [CDS]: 1..1191 of SEQ ID NO 1 <400> 3 Met Val Ala Gly Thr Arg Cys Leu Leu Ala Leu Leu Leu Pro Gln Val 1 5 10 15 Leu Leu Gly Gly Ala Ala Gly Leu Val Pro Glu Leu Gly Arg Arg Lys 20 25 30 Phe Ala Ala Ala Ser Ser Gly Arg Pro Ser Ser Gln Pro Ser Asp Glu 35 40 45 Val Leu Ser Glu Phe Glu Leu Arg Leu Leu Ser Met Phe Gly Leu Lys 50 55 60 Gln Arg Pro Thr Pro Ser Arg Asp Ala Val Val Pro Pro Tyr Met Leu 65 70 75 80 Asp Leu Tyr Arg Arg His Ser Gly Gln Pro Gly Ser Pro Ala Pro Asp 85 90 95 His Arg Leu Glu Arg Ala Ala Ser Arg Ala Asn Thr Val Arg Ser Phe 100 105 110 His His Glu Glu Ser Leu Glu Glu Leu Pro Glu Thr Ser Gly Lys Thr 115 120 125 Thr Arg Arg Phe Phe Phe Asn Leu Ser Ser Ile Pro Thr Glu Glu Phe 130 135 140 Ile Thr Ser Ala Glu Leu Gln Val Phe Arg Glu Gln Met Gln Asp Ala 145 150 155 160 Leu Gly Asn Asn Ser Ser Phe His His Arg Ile Asn Ile Tyr Glu Ile 165 170 175 Ile Lys Pro Ala Thr Ala Asn Ser Lys Phe Pro Val Thr Arg Leu Leu 180 185 190 Asp Thr Arg Leu Val Asn Gln Asn Ala Ser Arg Trp Glu Ser Phe Asp 195 200 205 Val Thr Pro Ala Val Met Arg Trp Thr Ala Gln Gly His Ala Asn His 210 215 220 Gly Phe Val Val Glu Val Ala His Leu Glu Glu Lys Gln Gly Val Ser 225 230 235 240 Lys Arg His Val Arg Ile Ser Arg Ser Leu His Gln Asp Glu His Ser 245 250 255 Trp Ser Gln Ile Arg Pro Leu Leu Val Thr Phe Gly His Asp Gly Lys 260 265 270 Gly His Pro Leu His Lys Arg Glu Lys Arg Gln Ala Lys His Lys Gln 275 280 285 Arg Lys Arg Leu Lys Ser Ser Cys Lys Arg His Pro Leu Tyr Val Asp 290 295 300 Phe Ser Asp Val Gly Trp Asn Asp Trp Ile Val Ala Pro Pro Gly Tyr 305 310 315 320 His Ala Phe Tyr Cys His Gly Glu Cys Pro Phe Pro Leu Ala Asp His 325 330 335 Leu Asn Ser Thr Asn His Ala Ile Val Gln Thr Leu Val Asn Ser Val 340 345 350 Asn Ser Lys Ile Pro Lys Ala Cys Cys Val Pro Thr Glu Leu Ser Ala 355 360 365 Ile Ser Met Leu Tyr Leu Asp Glu Asn Glu Lys Val Val Leu Lys Asn 370 375 380 Tyr Gln Asp Met Val Val Glu Gly Cys Gly Cys Arg 385 390 395 <210> 4 <211> 431 <212> PRT <213> Homo sapiens <220> <223> [CDS]: 1..1296 of SEQ ID NO 2 <400> 4 Met His Val Arg Ser Leu Arg Ala Ala Ala Pro His Ser Phe Val Ala 1 5 10 15 Leu Trp Ala Pro Leu Phe Leu Leu Arg Ser Ala Leu Ala Asp Phe Ser 20 25 30 Leu Asp Asn Glu Val His Ser Ser Phe Ile His Arg Arg Leu Arg Ser 35 40 45 Gln Glu Arg Arg Glu Met Gln Arg Glu Ile Leu Ser Ile Leu Gly Leu 50 55 60 Pro His Arg Pro Arg Pro His Leu Gln Gly Lys His Asn Ser Ala Pro 65 70 75 80 Met Phe Met Leu Asp Leu Tyr Asn Ala Met Ala Val Glu Glu Gly Gly 85 90 95 Gly Pro Gly Gly Gln Gly Phe Ser Tyr Pro Tyr Lys Ala Val Phe Ser 100 105 110 Thr Gln Gly Pro Pro Leu Ala Ser Leu Gln Asp Ser His Phe Leu Thr 115 120 125 Asp Ala Asp Met Val Met Ser Phe Val Asn Leu Val Glu His Asp Lys 130 135 140 Glu Phe Phe His Pro Arg Tyr His His Arg Glu Phe Arg Phe Asp Leu 145 150 155 160 Ser Lys Ile Pro Glu Gly Glu Ala Val Thr Ala Ala Glu Phe Arg Ile 165 170 175 Tyr Lys Asp Tyr Ile Arg Glu Arg Phe Asp Asn Glu Thr Phe Arg Ile 180 185 190 Ser Val Tyr Gln Val Leu Gln Glu His Leu Gly Arg Glu Ser Asp Leu 195 200 205 Phe Leu Leu Asp Ser Arg Thr Leu Trp Ala Ser Glu Glu Gly Trp Leu 210 215 220 Val Phe Asp Ile Thr Ala Thr Ser Asn His Trp Val Val Asn Pro Arg 225 230 235 240 His Asn Leu Gly Leu Gln Leu Ser Val Glu Thr Leu Asp Gly Gln Ser 245 250 255 Ile Asn Pro Lys Leu Ala Gly Leu Ile Gly Arg His Gly Pro Gln Asn 260 265 270 Lys Gln Pro Phe Met Val Ala Phe Phe Lys Ala Thr Glu Val His Phe 275 280 285 Arg Ser Ile Arg Ser Thr Gly Ser Lys Gln Arg Ser Gln Asn Arg Ser 290 295 300 Lys Thr Pro Lys Asn Gln Glu Ala Leu Arg Met Ala Asn Val Ala Glu 305 310 315 320 Asn Ser Ser Ser Asp Gln Arg Gln Ala Cys Lys Lys His Glu Leu Tyr 325 330 335 Val Ser Phe Arg Asp Leu Gly Trp Gln Asp Trp Ile Ile Ala Pro Glu 340 345 350 Gly Tyr Ala Ala Tyr Tyr Cys Glu Gly Glu Cys Ala Phe Pro Leu Asn 355 360 365 Ser Tyr Met Asn Ala Thr Asn His Ala Ile Val Gln Thr Leu Val His 370 375 380 Phe Ile Asn Pro Glu Thr Val Pro Lys Pro Cys Cys Ala Pro Thr Gln 385 390 395 400 Leu Asn Ala Ile Ser Val Leu Tyr Phe Asp Asp Ser Ser Asn Val Ile 405 410 415 Leu Lys Lys Tyr Arg Asn Met Val Val Arg Ala Cys Gly Cys His 420 425 430 <210> 5 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Forward primer <400> 5 ccgtgtcagc aaaacttctt t 21 <210> 6 <211> 19 <212> DNA <213> Artificial sequence <220> <223> Reverse primer <400> 6 gctcacgtcg ctcatcttg 19 <210> 7 <211> 19 <212> DNA <213> Artificial sequence <220> <223> Forward primer <400> 7 tggaacactg ggtcccata 19 <210> 8 <211> 19 <212> DNA <213> Artificial sequence <220> <223> Reverse primer <400> 8 gacctggtct tccctccaa 19 <210> 9 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Forward primer <400> 9 cccaactgtc aggagctaga g 21 <210> 10 <211> 18 <212> DNA <213> Artificial sequence <220> <223> Reverse primer <400> 10 gatgtggcgg ctgtgaat 18 <210> 11 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> Forward primer <400> 11 tgcttgaaga cctatgtggg ta 22 <210> 12 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Reverse primer <400> 12 aaaggcagca tttggggtat 20 <210> 13 <211> 18 <212> DNA <213> Artificial sequence <220> <223> Forward primer <400> 13 acggcagctt cagctttg 18 <210> 14 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Reverse primer <400> 14 gaggcagaga gagggaacag 20 <210> 15 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Forward primer <400> 15 atcgacagtc aggcgagttc 20 <210> 16 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Reverse primer <400> 16 gctgtgaaac tcgtggctct 20 <210> 17 <211> 18 <212> DNA <213> Artificial sequence <220> <223> Forward primer <400> 17 ctgatgagca gggcgagt 18 <210> 18 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> Reverse primer <400> 18 tccgagaagt tcttaagcct ca 22 <210> 19 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Forward primer <400> 19 ccccctacat gctagacctg t 21 <210> 20 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> Reverse primer <400> 20 cactcgtttc tggtagttct tcc 23 <210> twenty one <211> twenty two <212> DNA <213> Artificial sequence <220> <223> Forward primer <400> twenty one tgcctaggcg catttcaggt gc 22 <210> twenty two <211> 20 <212> DNA <213> Artificial sequence <220> <223> Reverse primer <400> twenty two tgaggtgact ggcggggtgt 20 <210> twenty three <211> 20 <212> DNA <213> Artificial sequence <220> <223> Forward primer <400> twenty three acgtggctaa gaatgtcatc 20 <210> twenty four <211> 19 <212> DNA <213> Artificial sequence <220> <223> Reverse primer <400> twenty four ctggtaggcg atgtcctta 19 <210> 25 <211> 19 <212> DNA <213> Artificial sequence <220> <223> Forward primer <400> 25 cagccgcttc acctacagc 19 <210> 26 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Reverse primer <400> 26 ttttgtattc aatcactgtc ttgcc 25 <210> 27 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Forward primer <400> 27 gagggcgagg acgaggctta 20 <210> 28 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Reverse primer <400> 28 tctaacagag gcaaaactga gcacc 25 <210> 29 <211> 1674 <212> DNA <213> Artificial sequence <220> <223> When the vector was linearized with XbaI, the sequence of the uncapped hBmp2 mRNA <400> 29 gagaataact tgcgcacccc actttgcgcc ggtgcctttg ccccagcgga gcctgcttcg 60 ccatctccga gccccaccgc ccctccactc ctcggccttg cccgacactg agacgctgtt 120 cccagcgtga aaagagagac tgcgcggccg gcacccggga gaaggaggag gcaaagaaaa 180 ggaacggaca ttcggtcctt gcgccaggtc ctttgaccag agtttttcca tgtggacgct 240 ctttcaatgg acgtgtcccc gcgtgcttct tagacggact gcggtctcct aaaggtcggc 300 caccatggtc gccggcacca gatgtctgct ggctctgctg ctgcctcagg tgctgctggg 360 cggagctgcc ggactggtgc ctgagctggg cagaagaaag ttcgccgctg ccagctctgg 420 cagacccagc agccagcctt ccgacgaggt gctgagcgag ttcgagctgc ggctgctgag 480 catgttcggc ctgaagcaga ggcccacccc cagcagagat gccgtggtgc ccccctacat 540 gctggacctg tacagacggc acagcggaca gcctggaagc cctgcccctg accacagact 600 ggaaagagcc gccagccggg ccaacaccgt gcggagcttt caccacgagg aaagcctgga 660 agaactgccc gagacaagcg gcaagaccac ccggcggttc tttttcaacc tgtcctccat 720 ccccaccgaa gagttcatca ccagcgccga actccaggtg ttccgcgagc agatgcagga 780 cgccctgggc aacaacagct catttcacca ccggatcaac atctacgaga tcatcaagcc cgccaccgcc aacagcaagt tccccgtgac ccggctgctg gacacccggc tggtcaacca gaacgccagc agatgggaga gcttcgacgt gacccctgcc gtgatgagat ggaccgccca 960 gggccacgcc aaccacggct ttgtggtgga agtggcccac ctggaagaga agcagggcgt 1020 gtccaagcgg cacgtgcgga tcagcagaag cctgcaccag gacgagcaca gctggtccca gatccggccc ctgctggtca ccttcggcca cgatggcaag ggccaccccc tgcacaagag 1140 agagaagcgg caggccaagc acaagcagcg gaagcggctg aagtccagct gcaagcggca ccccctgtac gtggacttca gcgacgtggg ctggacgac tggatcgtgg cccctcccgg 1260 ctaccacgcc ttctactgcc acggcgagtg ccccttcccc ctggccgacc acctgaacag 1380. gccatcgtgc agaccctggt caacagcgtg aactccaaga tccccaaggc ctgctgcgtg cccaccgagc tgagcgccat cagcatgctg tacctggacg agaacgagaa ggtggtgctg aagaactacc aggacatggt ggtggaaggc tgtggctgta gatgatacag caaaattaaa tacataaata tatatataga attctgcaga aaaaaaaaaa aaaaaaaaaa 1560 aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 1620 aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaag cggccgctcg agtc 1674 <210> 30 <211> 1661 <212> DNA <213> Artificial Sequence <220> <223> Sequence of uncapped hBmp2 mRNA when the vector is linearized with NotI <400> 30 gagaataact tgcgcacccc actttgcgcc ggtgcctttg ccccagcgga gcctgcttcg 60 ccatctccga gccccaccgc ccctccactc ctcggccttg cccgacactg agacgctgtt 120 cccagcgtga aaagagagac tgcgcggccg gcacccggga gaaggaggag gcaaagaaaa 180 ggaacggaca ttcggtcctt gcgccaggtc ctttgaccag agtttttcca tgtggacgct 240 ctttcaatgg acgtgtcccc gcgtgcttct tagacggact gcggtctcct aaaggtcggc 300 caccatggtc gccggcacca gatgtctgct ggctctgctg ctgcctcagg tgctgctggg 360 cggagctgcc ggactggtgc ctgagctggg cagaagaaag ttcgccgctg ccagctctgg 420 cagacccagc agccagcctt ccgacgaggt gctgagcgag ttcgagctgc ggctgctgag 480 catgttcggc ctgaagcaga ggcccacccc cagcagagat gccgtggtgc ccccctacat 540 gctggacctg tacagacggc acagcggaca gcctggaagc cctgcccctg accacagact 600 ggaaagagcc gccagccggg ccaacaccgt gcggagcttt caccacgagg aaagcctgga 660 agaactgccc gagacaagcg gcaagaccac ccggcggttc tttttcaacc tgtcctccat 720 ccccaccgaa gagttcatca ccagcgccga actccaggtg ttccgcgagc agatgcagga 780 cgccctgggc aacaacagct catttcacca ccggatcaac atctacgaga tcatcaagcc 840 cgccaccgcc aacagcaagt tccccgtgac ccggctgctg gacacccggc tggtcaacca 900 gaacgccagc agatgggaga gcttcgacgt gacccctgcc gtgatgagat ggaccgccca 960 gggccacgcc aaccacggct ttgtggtgga agtggcccac ctggaagaga agcagggcgt 1020 gtccaagcgg cacgtgcgga tcagcagaag cctgcaccag gacgagcaca gctggtccca 1080 gatccggccc ctgctggtca ccttcggcca cgatggcaag ggccaccccc tgcacaagag 1140 agagaagcgg caggccaagc acaagcagcg gaagcggctg aagtccagct gcaagcggca 1200 ccccctgtac gtggacttca gcgacgtggg ctggaacgac tggatcgtgg cccctcccgg 1260 ctaccacgcc ttctactgcc acggcgagtg ccccttcccc ctggccgacc acctgaacag 1320 caccaaccac gccatcgtgc agaccctggt caacagcgtg aactccaaga tccccaaggc 1380 ctgctgcgtg cccaccgagc tgagcgccat cagcatgctg tacctggacg agaacgagaa 1440 ggtggtgctg aagaactacc aggacatggt ggtggaaggc tgtggctgta gatgatacag 1500 caaaattaaa tacataaata tatatataga attctgcaga aaaaaaaaaa aaaaaaaaaa 1560 aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 1620 aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaag c 1661 <210> 31 <211> 1489 <212> DNA <213> Artificial sequence <220> <223> Sequence of uncapped hBmp7 mRNA when the vector is linearized with NotI <400> 31 gagacccaag ctggctagcg tttaaactta agcttggtac cgagctcgga tccgccacca 60 tgcacgtacg cagtcttagg gctgctgccc cacacagctt tgtggccctg tgggcacccc 120 tctttctgct taggtctgct cttgccgact tttcactgga caacgaggtc cattcctcat 180 ttatccaccg tcgactgaga agccaagaga ggcgggaaat gcagcgcgag attttgtcta 240 tcctgggatt gccccataga cctcgtcccc atctccaagg gaaacacaac tctgctccca 300 tgttcatgct ggatctgtac aatgccatgg cagtggagga aggtggtggc ccaggaggac 360 agggcttctc ctatccgtac aaggccgtct tttccaccca aggtccaccg ttggcgagtc 420 tccaggattc ccatttcctg accgatgcgg acatggtgat gtcattcgtg aacctggtgg 480 aacacgacaa agagttcttt caccccaggt atcaccacag agagttccgc ttcgacttga 540 gtaaaatccc tgagggagaa gccgttactg ccgccgagtt tcgcatttac aaggactaca 600 ttcgggagag gttcgataac gaaaccttcc ggatatccgt gtatcaggtg ctgcaagagc 660 atctggggag agagtccgat ctcttcctcc tggacagtag gacactgtgg gcgtctgagg 720 aaggctggct tgtgttcgac ataactgcca cgagcaatca ctgggttgta aacccaaggc 780 ataacctggg gcttcagctg tctgtcgaga cactggatgg gcagagcatc aatcccaaac 840 tggctgggtt gatcggacgc catggtccac agaacaaaca gcctttcatg gtagctttct 900 ttaaggccac agaagtgcac tttcggagta ttcggagcac tggcagcaaa cagagaagcc 960 agaatagatc caagacccct aagaatcagg aagccctgcg gatggcaaat gtggcggaga 1020 atagcagctc agatcagaga caggcttgca agaagcatga actgtatgtg tcttttcgag 1080 atctcggatg gcaggactgg attatcgcac cagagggcta tgctgcctac tattgcgaag 1140 gcgagtgcgc atttcctctg aacagctaca tgaacgcaac caatcatgcc attgtccaaa 1200 cactcgttca cttcatcaat ccggaaactg tgcctaaacc ctgttgtgca cctacgcagc 1260 tgaacgctat atctgttctg tactttgacg attcatccaa cgtcatcctc aagaagtacc 1320 gcaatatggt tgtccgagca tgcggctgtc actgagaatt cctgcagaaa aaaaaaaaaa 1380 aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 1440 aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaagc 1489 <210> 32 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Forward mouse primer <400> 32 gtgccctgac tgaggctgtc 20 <210> 33 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Reverse mouse primer <400> 33 ggatcatcgt gtcctgctca c 21 <210> 34 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Forward mouse primer <400> 34 ccgggagcag tgtgagctta 20 <210> 35 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Reverse mouse primer <400> 35 tagatgcgtt tgtaggcggt c 21 <210> 36 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Forward mouse primer <400> 36 gcacagtcaa ggccgagaat 20 <210> 37 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Reverse mouse primer <400> 37 gccttctcca tggtggtgaa 20 <210> 38 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Forward rat primer <400> 38 ccgtgtcagc aaaacttctt t 21 <210> 39 <211> 19 <212> DNA <213> Artificial sequence <220> <223> Reverse rat primer <400> 39 gctcacgtcg ctcatcttg 19 <210> 40 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Forward rat primer <400> 40 cccaactgtc aggagctaga g 21 <210> 41 <211> 18 <212> DNA <213> Artificial sequence <220> <223> Reverse rat primer <400> 41 gatgtggcgg ctgtgaat 18 <210> 42 <211> 18 <212> DNA <213> Artificial sequence <220> <223> Forward rat primer <400> 42 acggcagctt cagctttg 18 <210> 43 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Reverse rat primer <400> 43 gaggcagaga gagggaacag 20 <210> 44 <211> 19 <212> DNA <213> Artificial sequence <220> <223> Forward rat primer <400> 44 tggaacactg ggtcccata 19 <210> 45 <211> 19 <212> DNA <213> Artificial sequence <220> <223> Reverse rat primer <400> 45 gacctggtct tccctccaa 19 <210> 46 <211> 18 <212> DNA <213> Artificial sequence <220> <223> Forward rat primer <400> 46 ctgatgagca gggcgagt 18 <210> 47 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> Reverse rat primer <400> 47 tccgagaagt tcttaagcct ca 22

Claims

1. A pharmaceutical composition comprising (i) an RNA having a sequence encoding a bone morphogenetic protein (BMP), and (ii) an oligo(alkyleneamine) component which is a lipidoid having a structure of formula (IV): where variables a, b, p, m, n, and R 1 to R 6 The following are defined: a is 1 and b is 2, p is 1, m is 1; n is 1; and R 1 to R 6 are independently selected from hydrogen; the group -CH2-CH(OH)-R 7 、Group -CH(R 7 )-CH2-OH, where R 7 is a C10 alkyl group; provided that R 1 to R 6 At least two residues are selected from the group -CH2-CH(OH)-R 7 、Group -CH(R 7 )-CH2-OH, where R 7 is a C10 alkyl group; and wherein one or more of the nitrogen atoms indicated in formula (IV) are protonated to provide a cationic lipidoid of formula (IV), Its use is to treat or prevent bone damage in a patient.

2. The pharmaceutical composition of claim 1, wherein the BMP is BMP-2 or BMP-7.

3. The pharmaceutical composition of claim 1, wherein the RNA is non-chemically modified or chemically modified RNA.

4. The pharmaceutical composition of claim 1, wherein the RNA is single-stranded RNA.

5. The pharmaceutical composition of any one of claims 1 to 4, wherein the lipidoid is a cationic lipid prepared by mixing 100 mg of N,N'-bis(2-aminoethyl)-1,3-propylenediamine with 575.07 mg of 1,2-epoxydodecane at 80°C with constant shaking for 96 hours.

6. The pharmaceutical composition of any one of claims 1 to 4, further comprising one or more of cholesterol, DPPC, DOPE, and PEG-lipid.

7. The pharmaceutical composition according to any one of claims 1 to 4, further comprising (i) DOPE, cholesterol, and DMPE-PEG; or (ii) DPPC, cholesterol and DMG-PEG 2k.

8. The pharmaceutical composition of claim 7, wherein the molar ratio of the lipidoid and (i) or (ii) is 8:5.3:4.4:0.9 or 8:5.29:4.41:0.88, and wherein the molar ratio of the amino groups of the lipidoid to the phosphate groups of the RNA is 8.

9. The pharmaceutical composition of claim 1, wherein the RNA forms a complex with the lipidoid.

10. The pharmaceutical composition of claim 1, further comprising a cell into which the RNA is to be delivered ex vivo.

11. The pharmaceutical composition of claim 10, wherein the cells are cells of the patient.

12. The pharmaceutical composition of claim 10 or 11, wherein the cells are osteoprogenitor cells.

13. The pharmaceutical composition of claim 10 or 11, wherein the cells are mesenchymal stem cells (MSCs). The pharmaceutical composition of claim 13 , wherein the MSC is adipose-derived mesenchymal stem cell (AMSC) or bone marrow-derived MSC (BMSC).

15. The pharmaceutical composition of any one of claims 1 to 4 and 9, further comprising a matrix or scaffold to which the RNA has been added or to which the RNA has been loaded.

16. The pharmaceutical composition of claim 15, wherein the matrix or scaffold comprises collagen and / or fibrin.

17. The pharmaceutical composition of claim 16, wherein the matrix or scaffold is a collagen sponge and / or a fibrin clot or fibrin glue.

18. The pharmaceutical composition of claim 15, wherein the matrix or scaffold is vacuum dried.

19. The pharmaceutical composition of claim 11, wherein the cells have been seeded on a matrix or scaffold as defined in any one of claims 15 to 18.

20. The pharmaceutical composition of claim 3, wherein 25% of the cytidines in the chemically modified RNA are 5-methylcytidine, and 25% of the uridines in the chemically modified RNA are 2-thiouridine.

21. Use of a pharmaceutical composition as defined in any one of claims 1 to 20 for the preparation of a medicament for treating or preventing bone damage in a patient.

22. The use according to claim 21, wherein the BMP is BMP-2 or BMP-7.

23. The use of claim 21, wherein the RNA is non-chemically modified or chemically modified RNA.

24. The use of claim 21, wherein the RNA is single-stranded RNA.

25. The use of claim 21, wherein the pharmaceutical composition further comprises one or more of cholesterol, DPPC, DOPE and PEG-lipid.

26. The use of claim 21, wherein the pharmaceutical composition further comprises (i) DOPE, cholesterol, and DMPE-PEG; or (ii) DPPC, cholesterol and DMG-PEG 2k.

27. The use of claim 26, wherein the molar ratio of the lipidoid and (i) or (ii) is 8:5.3:4.4:0.9 or 8:5.29:4.41:0.88, and wherein the molar ratio of amino groups of the lipidoid to phosphate groups of the RNA is 8.

28. The use of claim 21, wherein the RNA forms a complex with the lipidoid.

29. The use of claim 21, wherein the pharmaceutical composition further comprises a matrix or scaffold to which the RNA has been added or loaded.

30. The use of claim 29, wherein the matrix or scaffold comprises collagen and / or fibrin.

31. The use according to claim 30, wherein the matrix or scaffold is a collagen sponge and / or a fibrin clot or fibrin glue.

32. The use of claim 29, wherein the matrix or scaffold is vacuum dried.

33. The use of claim 23, wherein 25% of the cytidines in the chemically modified RNA are 5-methylcytidine, and 25% of the uridines in the chemically modified RNA are 2-thiouridine.

Images